sign in sign up
<<
Home , Ribonuclease P

MOLECULAR AND CELLULAR BIOLOGY, Mar. 1991, p. 1662-1667 Vol. 11, No. 3 0270-7306/91/031662-06$02.00/0 Copyright © 1991, American Society for Microbiology A Required for RNase P Activity in Candida (Torulopsis) glabrata Mitochondria Codes for a 227-Nucleotide RNA with Homology to Bacterial RNase P RNA HSIAO-HSUEH SHU,1 CAROL A. WISE,1 G. DESMOND CLARK-WALKER,2 AND NANCY C. MARTIN'* Department ofBiochemistry, School of Medicine, University ofLouisville, Louisville, Kentucky 40292,1 and Department of Molecular and Population Genetics, The Australian National University, Canberra ACT 2601, Australia2 Received 15 October 1990/Accepted 21 December 1990

We have mapped a gene in the mitochondrial DNA of Candida (Torulopsis) glabrata and shown that it is required for 5' end maturation of mitochondrial tRNAs. It is located between the tRNA'¶et and tRNAPIo , the same tRNA genes that flank the mitochondrial RNase P RNA gene in the Saccharomyces cerevisiae. The gene is extremely AT rich and codes for AU-rich that display some sequence homology with the mitochondrial RNase P RNA from S. cerevisiae, including two regions of striking sequence homology between the mitochondrial RNAs and the bacterial RNase P RNAs. RNase P activity that is sensitive to micrococcal has been detected in mitochondrial extracts of C. glabrata. An RNA of 227 nucleotides that is one of the RNAs encoded by the gene that we mapped cofractionated with this mitochondrial RNase P activity on glycerol gradients. The nuclease sensitivity of the activity, the cofractionation of the RNA with activity, and the homology of the RNA with known RNase P RNAs lead us to propose that the 227-nucleotide RNA is the RNA subunit of the C. glabrata mitochondrial RNase P .

RNase P is a tRNA biosynthetic enzyme that is responsi- that the region between these two tRNA genes is transcribed ble for removing 5' leaders from tRNA precursors. It is an and that a 227-nucleotide RNA product of the gene cofrac- unusual enzyme in that it consists of both RNA and tionated with a nuclease-sensitive RNase P activity on subunits in (2, 10, 22), (11, 13, 16), and glycerol gradients. The RNA shares sequence homology mammals (1, 3). It has been demonstrated that the RNA with the S. cerevisiae mitochondrial RNase P RNA and the subunit in bacteria is the catalytic component. A secondary bacterial RNase P RNAs. These data lead us to propose that structural model of the bacterial RNase P RNAs has been this RNA is the RNA subunit of C. glabrata mitochondrial proposed, and limited sequence blocks of primary homology RNase P. have been identified (12). Some of these primary and sec- ondary structural features appear to be shared with other eukaryotic RNase P RNAs (3, 13), including the RNase P RNA encoded by the mitochondrial DNA of Saccharomyces MATERIALS AND METHODS cerevisiae (17). The RNA subunit of the mitochondrial enzyme from S. Strains and culture conditions. The wild-type C. glabrata cerevisiae is encoded by a gene called the tRNA synthesis strain CBS 138 was used in previous studies (6, 7). Petite let mutants were induced by exposure to ethidium bromide (1.0 locus (17) which is located between the tRNA and tR- ,ug/ml) for 4 h and then plated on glucose medium. Petite NAIr° genes on the mitochondrial DNA (24). The RNA mutants (20) were identified by colony size and inability to subunit of the S. cerevisiae enzyme is about 490 nucleotides grow on glycerol media. DNA retained in these mutants was long and is extremely AU rich (18). In extensive sequence characterized by digestion (Fig. 1). Cells analysis of the mitochondrial DNA of the yeast Candida were grown in 2% galactose-0.2% glucose-1% Bacto-Pep- glabrata, Clark-Walker et al. (6) noted that the region of the tone (Difco)-1% yeast extract. DNA between the tRNA"et and tRNAPFO genes in the Isolation and characterization of RNA. Total cellular small mitochondrial DNA of that yeast could encode an RNA of RNAs were isolated as described previously (19). Mitochon- 258 nucleotides and noted short regions of sequence homol- dria were isolated and lysed as described by Miller and ogy to the S. cerevisiae tRNA synthesis locus. This obser- Martin (17). DNase I from Cooper Biochemicals was used vation led to the suggestion that the region could be analo- according to the manufacturer's directions for removal of gous to the S. cerevisiae tRNA synthesis locus. We DNA from samples prior to Northern (RNA) analysis and undertook an analysis of this region of the C. glabrata primer extension experiments. RNA for sequencing experi- genome to determine whether it did indeed encode the RNA ments shown in Fig. 6A and B was obtained by hybrid subunit of the mitochondrial RNase P in this strain. been We used deletion mapping to define a region of C. glabrata selection (18) of wild-type mitochondrial RNA that had mitochondrial DNA required for the maturation of 5' ends of size fractionated on Sephacryl S-300 (Pharmacia). Labeling, mitochondrial tRNAs and found that it is located near the digestion, and gel procedures were as described by Morales et et al. (18). The RNA for enzymatic RNA sequencing in Fig. tRNA and tRNAPrO genes. We show by physical mapping 6C was obtained by separating mitochondrial nucleic acid on a 5% acrylamide-6 M urea gel, identifying the 227-base RNA after ethidium bromide staining, and eluting the RNA from * Corresponding author. the gel by a modification of the procedure described by 1662 VOL. 11, 1991 C. GLABRATA GENE REQUIRED FOR RNase P ACTIVITY 1663

00 E

' cON E CL'' U JiIE ATPase sub. A l4 l5 16 Cyt.b Cyt.ox.sub. 8 6 9 2 *3 ~ SrRNA Var.I LrRNA 2 3 4 5 6 7 8 9 *y.O.sb12 13 14 15' 16 17 18 1

*..,. 1~~*yt.ox.sub \ I I1 EI 0. \ ml\ r- 0 =0-- ccO a ,~ a > atCL _7C > _ > ON. n< un cm Imc I < m x m mII-x L () (L m 0 I

0 cl aL c c > 3 e)n (U) m m0 x m L___ __ 8 103 18 34 FIG. 1. Mitochondrial genome map of wild-type and deletion mutant strains of C. glabrata. The 19-kb circular genome is depicted as a linear molecule. The genes described previously (7) are designated by thick black lines, and the tRNA genes are designated by their three-letter amino acid codes. Restriction enzyme sites are indicated below the linear map. The lower lines labeled 8, 18, 34, and 103 represent regions retained in the petite mutant genomes used in this study. The dashes indicate the degree of uncertainty as to where the ends of the deletions actually fall.

Kuchino and Nichimura (14). The labeled RNA (5) was then of (Sigma) and calcium. EGTA was annealed to a 24-base oligonucleotide complementary to added to the sample that had been incubated in its absence, nucleotides 325 to 349 in region 11 (6) and digested with and all samples were assayed for RNase P activity. RNase H (Boehringer Mannheim Biochemicals), and the Nucleotide sequence accession number. The sequence re- digestion mix was separated on a 20% acrylamide-8.3 M ported here is found in a previously reported sequence with urea sequencing gel. Two digestion products resulted, and EMBL accession number X02168. the smaller and more abundant one was eluted from the gel and sequenced (8). RESULTS Northern analysis of RNAs. Whole-cell RNAs were sepa- rated on a 10% acrylamide-4 M urea gel (19), and mitochon- Figure 1 shows a diagram of the wild-type C. glabrata drial RNAs were separated on 5% acrylamide-6 M urea gels. mitochondrial genome and the DNA remaining in four The separated RNAs were transferred to a Zeta-probe deletion mutants isolated from this strain. The number of membrane as instructed by the manufacturer (Bio-Rad), deletion mutants was limited, but we selected four from fixed by baking at 80°C, and exposed for 10 min to 301-nm different regions of the genome to determine whether, as in UV light to cross-link the RNA to the filter. DNA containing S. cerevisiae, some deletion mutants retained the ability to region II nucleotides from 175 to 359 (6) was derived by a make mature mitochondrial tRNAs while others lost it. combination of subcloning and BAL 31 digestion and tran- Northern analysis was used to assess the ability of various scribed with T7 polymerase (Promega) in the presence of strains to make mature tRNAs. tRNA gene products were radiolabeled nucleotides to prepare a probe specific to the detected only in mutants 8 and 103. A comparison of the region between the two tRNA genes. Oligonucleotides com- tRNA gene products detected in the wild type and mutant 8 plementary to tRNAs were labeled at the 5' end with showed no difference, leading to the conclusion that mature [y-32PIATP (NEN) and T4 polynucleotide kinase (New En- tRNA"fet (Fig. 2B) and tRNAPrO (data not shown) were gland BioLabs) as suggested by the manufacturer and hy- made. Mutant 103 made tRNAPhe gene products, but the bridized at a Td of 10°C calculated as described by Suggs et majority were larger than the mature tRNAPhe found in al. (23). Hybridizations were done as described by Najarian wild-type cells (Fig. 2C). To determine whether these RNAs et al. (19). Primer extensions were done as described by in mutant 103 were longer at the 5' end, a primer extension Miller and Martin (17). experiment was performed. An oligonucleotide complemen- Preparation of mitochondrial extracts and RNase P assays. tary to the tRNAPh, was hybridized and extended, and the Mitochondria for enzyme assays were further purified by a extension products were compared with those obtained from sucrose flotation technique described by Lambowitz (15). wild-type RNA (Fig. 2D). Mutant 103 accumulated 5' ex- The mitochondria were recovered and lysed as described tended tRNA (Fig. 2D; compare lanes 1 and 2). Clearly, previously (18) except that the lysis buffer contained 10 mM mutant 8 contains a gene necessary for 5' tRNA processing vanadyl ribonucleoside complex (Bethesda Research Labo- and mutant 103 does not. The only obvious region in mutant ratories). An S30 fraction (300 to 400 ,u1) was layered on a 8 without a defined function is between the tRNA"et and 4-ml 10 to 30% glycerol gradient containing 50 mM NH4Cl, tRNApr' genes (Fig. 1). 10 mM MgCl2, 50 mM Tris-HCl (pH 8), 0.2 mM dithiothre- To determine whether RNA was made from this region, itol, and 0.1% Triton X-100 (Boehringer Mannheim). Follow- we subcloned a fragment of C. glabrata mitochondrial DNA ing centrifugation at 60,000 rpm for 4.5 h in an SW60 rotor at derived entirely from the region between the tRNAMet and 4°C, the gradients were fractionated, and each fraction was tRNANO genes to use as a probe (see Materials and Meth- assayed for RNase P activity (18) and for RNA as described ods). Three RNAs were detected with this probe in wild-type above. Samples from the peak fraction of activity were cells (Fig. 3). The same three RNAs were present in mutant incubated with or without ethylene glycol-bis(,-aminoethyl 8. In addition, larger, lower-abundance RNAs were ob- ether)-N,N,N',N'-tetraacetic acid (EGTA) in the presence served. These RNAs contain flanking tRNA sequences (data 1664 SHU ET AL. MOL. CELL. BIOL.

A1 2 3 B 1 2 3 C 1 2 3 D 1 2 A 1 2 W- 1 770 780 530 400 280 '.6

160

FIG. 2. Analysis of tRNAs in wild-type and mutant strains. Whole-cell tRNAs were isolated, separated by electrophoresis, transferred to a Zeta-probe membrane, and hybridized to radioac- tive oligonucleotides complementary to tRNAs. (A) Ethidium bro- mide-stained gel; (B) tRNA'et probe; (C) tRNAPhe probe. Lanes: 1, wild-type RNA; 2, mutant 8 RNA; 3, mutant 103 RNA. (D) Primer FIG. 3. Encoding of stable RNAs by the region between the extension analysis of tRNAPhe gene products from the wild type tRNAMet and tRNApro genes. Mitochondrial RNA was isolated, (lane 1) and mutant 103 (lane 2). Arrow indicates the cDNA resulting separated by electrophoresis, and transferred to a Zeta-probe mem- from the 5' end of the mature tRNAPhe. brane, and the membrane was probed with sequences homologous to the DNA sequence between the tRNAMet and tRNA'r° genes. Numbers at the left mark the positions of migration of RNA size standards and are given in nucleotides. Lanes: 1, wild-type RNA; 2, not shown) since transcription of this region of the DNA mutant 8 RNA. (A) Five-hour exposure; (B) overnight exposure. initiates upstream of the tRNAfmet gene (21) and continues through the tRNAPrO gene. The relative abundance of the three RNAs between 200 and 260 nucleotides differed in the wild-type and the mutant cells, with the smallest RNA being To determine the actual length of the RNase P RNA, we more abundant in wild-type cells and the largest RNA being determined the ends of the RNA that cofractionated with more abundant in the mutant. Similar accumulation of proc- RNase P activity. End-labeled RNA isolated by hybrid essing intermediates has been observed in S. cerevisiae selection was treated with base-specific , but het- petite mutants (27), but the reason for such accumulation is erogeneity of the ends prevented us from obtaining clear not known. Nevertheless, both strains produce the 227- sequence. We then reasoned that the scarcity of G's in the nucleotide RNA that is associated with RNase P activity (see RNA would lead to a distinctive pattern after partial diges- below). The appearance of the very small RNA (around 180 tion with Ti and would give sufficient information to fix the nucleotides in Fig. 3B, lane 2) was variable; therefore, we ends of the RNA. The results of such an analysis with presumed that it was a degradation product. 5'-end-labeled RNA are shown in Fig. 6A. Counting up from To determine whether any or all of these RNAs were the bottom of the gel and comparing the base hydrolysis associated with RNase P activity, we fractionated a mito- ladder (lane 9) with the sample most heavily digested with Ti chondrial extract on a 10 to 30% glycerol gradient. The (lane 10) led us to conclude that there were 19 nucleotides RNase P activity cofractionated with the smallest RNA from from the most abundant 5' end to the first G. The appearance the region between the two tRNA genes (Fig. 4A, lanes 7 to of oligonucleotides 18, 19, and 21 bases long (number 1) 10). Smaller RNAs in the active fractions must be cleavage indicated that the RNA had limited heterogeneity at the 5' products of larger RNAs produced during our manipula- end. Partial Ti digests (lanes 7 and 8) gave a series of tions, since they were not detected in the material loaded on oligonucleotides with the next-largest one separated from the gradient. Some of the middle RNA triplet also was found the first by 5 nucleotides (number 2). Although these partic- in fractions with RNase P activity, while the rest was located ular experiments did not allow us to count the exact number in larger material toward the bottom of the gradient. In the of nucleotides between the widely spaced G's in the RNA, experiment shown here, the largest RNA was not evident in the pattern of partial digestion products was consistent with any glycerol gradient fraction even though it was in the the DNA sequence (6). The results obtained with RNA sample loaded on the gradient. labeled from the 3' end were not as straightforward to If the RNase P activity in C. glabrata mitochondria interpret (Fig. 6B). First, there was a 30-nucleotide RNA depends on an RNA component, the activity should be (arrow) which varied in amount in three different experi- sensitive to micrococcal nuclease. Active fractions from the ments. We therefore believe that this RNA is a contaminant. glycerol gradient were treated with micrococcal nuclease, The most abundant products in the total digest migrated with and their RNase P activities were compared with those of base hydrolysis ladder products that appear to be 2 (number sham-treated controls. The activity was sensitive to treat- 1) and 9 (number 2) bases long (since we labeled with pCp, ment with micrococcal nuclease (Fig. 5). dimers rather than monomers account for the fastest-migrat- VOL. 11, 1991 C. GLABRATA GENE REQUIRED FOR RNase P ACTIVITY 1665

A. RNase P activity assay

A - + 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 pre tRN -P..it* NO *. smv

V 5 leade *

I.A1....I B 12 13 14 15 16 17 18 19 20 .. .:

FIG. 4. Cofractionation of one of the three RNAs encoded by the C. glabrata tRNA synthesis locus with mitochondrial RNase P activity. A mitochondrial extract was fractionated on a 10 to 30% glycerol gradient. Fractions were collected and assayed for RNase P activity (A) as described in Materials and Methods, and RNAs isolated from each fraction (B) were separated by electrophoresis and detected as described for Fig. 3. The positions of migration of the precursor tRNA (pre-tRNA), mature tRNA (tRNA), and 5' leader are indicated in panel A. Lanes: -, no enzyme; +, products of a reaction with S. cerevisiae RNase P (18); 1 to 20, fractions 1 to 20 from the glycerol gradient. Fraction 1 was from the bottom of the gradient. Lane T in panel B is a sample of RNA extracted from the starting material that was loaded on the gradient. Lanes 1 to 20 in panel B correspond to the same fractions used in panel A.

ing labeled signal). In the partial digests, the 9-base fragment that deserve further mention here. One is toward the 5' end (number 2) was part of a 9-, 10-, and 11-base triplet which of both molecules and extends for 15 nucleotides. These collapsed to a 9-base product in the total digest. The next nucleotides correspond to those labeled 20 to 34 in the C. partial digest product up (number 3) from the 9-, 10-, and glabrata RNA shown in Fig. 7. Nucleotides 99 to 112 in S. 11-base triplet was separated by 11 bases from the 9-base cerevisiae (18) are shown in the same figure for comparison. oligoribonucleotide and 11 bases from the 11-base oligoribo- The other region is toward the 3' end of the molecules and is nucleotide. Exclusion of the 30-base-long RNA of unknown substantially longer. Nucleotides 183 to 212 in the C. gla- origin places the next partial digestion product another 22 brata RNA (Fig. 7) are homologous to nucleotides 441 to 471 nucleotides away (number 4). An examination of the DNA in S. cerevisiae (18). Sequences within these two regions sequence does show three G's that have spacing consistent also show sequence similarity to two conserved regions of with this spacing in the RNA, but assignment of the smaller bacterial RNase P RNAs (Fig. 7). fragments was uncertain. This uncertainty could result from anomalous migration in the gel or from heterogeneity of the ends. Because long RNAs differing by one, two, or three DISCUSSION nucleotides proved difficult to purify to homogeneity on a sequencing gel, a smaller RNA, obtained by oligonucleotide- Like mitochondrial DNA deletion mutants of S. cerevi- directed RNase H digestion, was isolated and sequenced siae, deletion mutants of C. glabrata can differ in the ability (Fig. 6). The sequence read up from the bottom of the gel to produce mature tRNA. In both yeast strains, the genetic was 3'-GAUAUAUGAUAUAUAUU and was identical to locus required for RNase P activity maps between the nucleotides 358 to 374 in the sequence published by Clark- tRNAMet and tRNAPro genes. The region between the two Walker et al. (6). Based on these combined results, the most tRNA genes in C. glabrata is much smaller than that abundant 3' end coupled with the most abundant 5' end gave between the two genes in S. cerevisiae, but the gene order is an RNA of 227 nucleotides. maintained. Such conservation of gene order is not observed We have compared the 227-nucleotide RNA from C. for many other genes between the two strains. glabrata with the 490-nucleotide RNA from S. cerevisiae The region between the two tRNAs is only 258 nucleotides (Fig. 7). The AU-rich nature of the RNAs made it easy to in C. glabrata, making it an interesting candidate for a gene find regions of sequence similarity but also raised questions encoding a smaller RNA than the RNA found in S. cerevi- as to their significance. Nonetheless, there were two regions siae, and indeed the RNAs that we find are in the 200- 1666 SHU ET AL. MOL. CELL. BIOL.

B X 2345& pre tRNA __e 3 U LI ..iiii.^4iC... 3s Li Au-. U t RNA t... 14 A 4 W :Z t->4 A Ui l5eader * * : . *S,, ,if.. Ir". .3 "aft..:.1 . * C. .:.

} FW So : ':.:.t. .m.r *

.l._. _ 1

1 2 3 4 5 6

FIG. 5. Sensitivity of mitochondrial RNase P activity to micro- coccal nuclease. RNase P activity recovered from the glycerol FIG. 6. Evidence that the RNA that cofractionates with RNase P gradient was assayed before and after treatment with micrococcal activity is 227 nucleotides long. The RNA that cofractionated with nuclease as described in Materials and Methods. Lanes: 1, no RNase P activity was purified and subjected to partial and total Ti mitochondrial extract; 2, mitochondrial extract without prior treat- digestion (A and B) and enzymatic sequencing (C). (A) 5'-end- ment; 3, mitochondrial extract incubated with micrococcal nuclease labeled RNA digested with Ti nuclease. Lanes: 1 and 6, no enzyme in the presence of EGTA prior to assay; 4, mitochondrial extract control; 2 and 7, 0.0004 U of T1; 3 and 8, 0.0008 U of T1; 4 and 9, treated with micrococcal nuclease in the absence of EGTA; 5, as in base hydrolysis ladder; 5 and 10, total digestion with Ti. Numbers lane 4 but no mitochondrial extract; 6, as in lane 5 but micrococcal indicate G residues, with 1 being the 5'-most G in the RNA. (B) nuclease was not inactivated prior to assay. 3-end-labeled RNA digested with Ti nuclease. Lanes: 1, undigested RNA; 2, total digestion with T1; 3, 0.0008 U of TI; 4, 0.0004 U of T1; lane 5, 0.0002 U of TI; 6, base hydrolysis ladder. Numbers indicate G residues, with 1 being the 3'-most residue. Arrow marks nucleotide range. Two regions of sequence homology be- an RNA of unknown origin (see text). (C) 3'-end-labeled RNA tween the two mitochondrial RNAs are clear and very enzymatic sequencing. Lanes: 1, alkaline hydrolysis ladder; 2, A similar to the conserved sequences found in bacterial RNase plus U by digestion with Phy M; 3, A by digestion with U2; 4, G by P RNAs. It is interesting that although three RNAs are digestion by Ti. The unlabeled signal in lane 4 does not have a synthesized from this DNA, all containing these conserved corresponding signal in the ladder of lane 1 and was ignored. sequences, only one of the RNAs, the smallest, shows clear cofractionation with RNase P activity present in mitochon- drial extracts. This cofractionation provides additional evi- region may be too short to be an RNase P RNA. This region dence that at least the 227-base RNA is an RNA component in K. lactis does produce an RNA of about 190 nucleotides of the mitochondrial RNase P. (26) and thus could be another short mitochondrial RNase P Mitochondrial RNase P RNAs are unique in having such RNA. AU-rich sequences. Of the seven G's in the C. glabrata All of the mitochondrial RNase P RNAs share two regions sequence, four are confined to the regions of homology with of sequence homology with the bacterial RNase P RNAs, the bacterial RNAs. All three C's are found in these same emphasizing the importance of these two regions in some regions. Since the mitochondrial RNase P sequences are essential function either in biosynthesis or in binding and based on the DNA sequences that encode them, there cleavage of precursor tRNAs. These two regions are those remains the formal possibility that RNA editing (reviewed in proposed to form a structure in the model of the reference 4) contributes to the final sequence. Although we bacterial RNAs proposed by James et al. (12). We do not have not sequenced the RNA in its entirety, none of our have sufficient phylogenetic comparisons of mitochondrial analyses of these RNAs suggest that editing has occurred. RNase P RNAs nor physical evidence to support or refute The C. glabrata RNase P RNA is the smallest naturally the importance of this interaction but note that the C. occurring RNase P RNA identified to date. Wilson et al. (25) glabrata RNA can only form three, not four, Watson-Crick have sequenced the region of mitochondrial DNA that codes base pairs in such a pseudoknot. Forster and Altman (9) for a majority of the tRNAs in the yeast Kluyveromyces have recently modeled several RNase P RNAs, including lactis. They noted the same sequence similarities in a region that from the mitochondria of S. cerevisiae, into a "cage between the tRNAmet and tRNAPrO genes that we have shaped" structure of five helices. Helix V is optional in their pointed out between the S. cerevisiae and C. glabrata RNAs model, but all of the other RNAs could accommodate helices as well as to the bacterial RNase P RNAs. Since the region I to III, with IV being the pseudoknot mentioned above. The between these two tRNAs in K. lactis is only 191 nucleo- short distance from the 5' end of the C. glabrata RNA to the tides, Wilson et al. suggested that an RNA derived from the predicted to be in helix IV seemingly VOL . 1l, 1991 C. GLABRATA GENE REQUIRED FOR RNase P ACTIVITY 1667

T g/abrata: AUAAUAUAUAUUAUAUAAAGAAAAGUCAUAAAUAAUAAUAAUAUA 45 S. cerevisiae. GGAAAGUCAUAAAUA E co/*. GGAAAGUC

UUAUUAUUUAAUUAAAUAAUAAUAAUAUAUUUAAAUAAAUAAUAUAAAUAAUUAAAU 102

UGAAAUAUAUAUUUAUUUUAAUAAAAUAUUAUAUAUUAAUAAUAUUUUAAAUAUAAU 159

AAUAUACAUAAAUAAGCUUAUAU 215 AUAGUUAUAUUAUUAUACAGAAAUAUGCUUA CAGAACCCGGCUUA

AUAGUAUAUAGU 227 FIG. 7. Sequence homology between RNase P RNAs. The 227-nucleotide RNA from C. (T.) glabrata mitochondria has two stretches of sequences homologous to the RNase P RNAs in S. cerevisiae mitochondria and Escherichia coli. precludes the formation of a helix III by this newly reported fission yeast Schizosaccharomyces pombe. EMBO J. 5:1697- mitochondrial RNA. Although additional work will be nec- 1703. essary to finally determine the secondary and tertiary struc- 14. Kuchino, Y., and S. Nichimura. 1989. Enzymatic RNA sequenc- ture P the unusual RNAs ing. Methods Enzymol. 180:155-163. of RNase RNA, mitochondrial 15. Lambowitz, A. M. 1979. Preparation and analysis of mitochon- clearly contribute an additional perspective to the process. drial . Methods Enzymol. 59:421-433. 16. Lee, J.-Y., and D. Engelke. 1989. Partial characterization of an REFERENCES RNA component that copurifies with Saccharomyces cerevisiae 1. Akaboshi, E., C. Guerrier-Takada, and S. Altman. 1980. Veal RNase P. Mol. Cell. Biol. 9:2536-2543. heart P has an essential RNA component. Bio- 17. Miller, D. L., and N. C. Martin. 1983. Characterization of the chem. Biophys. Res. Commun. 96:831-837. yeast mitochondrial locus necessary for tRNA biosynthesis: 2. Baer, M., and S. Altman. 1985. A catalytic RNA and its gene DNA sequence analysis and identification of a new transcript. from Salmonella typhimurium. Science 228:999-1002. Cell 34:911-917. 3. Bartkiewicz, M., H. Gold, and S. Altman. 1989. Identification 18. Morales, M. J., C. A. Wise, M. J. Hollingsworth, and N. C. and characterization of an RNA molecule that copurifies with Martin. 1989. Characterization of yeast mitochondrial RNase P: RNase P activity from HeLa cells. Genes Dev. 3:488-499. an intact RNA subunit is not essential for activity in vitro. 4. Benne, R. 1990. RNA editing in trypanosomes: is there a Nucleic Acids Res. 17:6865-6881. message? Trends Genet. 6:177-181. 19. Najarian, D., H.-H. Shu, and N. C. Martin. 1986. Sequence and 5. Bruce, A. G., and 0. C. Uhlenbeck. 1978. Reactions at the expression of four mutant aspartic acid tRNA genes from the termini of tRNA with T4 RNA . Nucleic Acids Res. mitochondria of Saccharomyces cerevisiae. Nucleic Acids Res. 5:3665-3677. 14:9561-9578. 6. Clark-Walker, G. D., C. R. McArthur, and K. S. Sriprakash. 20. Perlman, P. S. 1975. Cytoplasmic petite mutants in yeast: a 1985. Location of transcriptional control signals and transfer model for the study of reiterated genetic sequences, p. 136-181. RNA sequence in Torulopsis glabrata mitochondrial DNA. In C. W. Birky et al. (ed.), Genetics and biogenesis of mito- EMBO J. 4:465-473. chondria and . Ohio State University Press, Colum- 7. Clark-Walker, G. D., and K. S. Sriprakash. 1983. Map location bus. of transcripts from Torulopsis glabrata mitochondrial DNA. 21. Shu, H. S., and N. C. Martin. Unpublished data. EMBO J. 2:1465-1472. 22. Stark, B. C., R. Kole, E. J. Bowman, and S. Altman. 1978. 8. Donis-Keller, H., A. M. Maxam, and W. Gilbert. 1977. Mapping Ribonuclease P: an enzyme with an essential RNA component. adenines, guanines, and pyrimidines in RNA. Nucleic Acids Proc. Natl. Acad. Sci. USA 75:3717-3721. Res. 4:2527-2538. 23. Suggs, S., T. Hirose, T. Miyake, E. H. Kawashima, M. J. 9. Forster, A. C., and S. Altman. 1990. Similar cage-shaped Johnson, K. Itakura, and R. B. Wallace. 1981. Use of synthetic structures for the RNA components of all ribonuclease P and oligodeoxyribonucleotides for the isolation of specific cloned ribonuclease MRP . Cell 62:407-409. DNA sequences, ICN-UCLA Symp. Dev. Biol. 23:683-693. 10. Gardiner, K., and N. R. Pace. 1980. RNase P ofBacillus subtilis 24. Underbrink-Lyon, K., D. L. Miller, N. A. Ross, H. Fukuhara, has an RNA component. J. Biol. Chem. 255:7507-7509. and N. C. Martin. 1983. Characterization of a yeast mitochon- 11. Hollingsworth, M. J., and N. C. Martin. 1986. RNase P activity drial locus necessary for tRNA biosynthesis. Mol. Gen. Genet. in the mitochondria of Saccharomyces cerevisiae depends on 191:512-518. both mitochondrion- and nucleus-encoded components. Mol. 25. Wilson, C., A. Ragaini, and H. Fukuhara. 1989. Analysis of the Cell. Biol. 6:1058-1064. regions coding for transfer RNAs in Kluyveromyces lactis 12. James, B. D., G. J. Olsen, J. Liu, and N. R. Pace. 1988. The mitochondrial DNA. Nucleic Acids Res. 17:4485-4491. secondary structure of ribonuclease P RNA, the catalytic ele- 26. Wise, C. A. Unpublished data. ment of a ribonucleoprotein enzyme. Cell 52:19-26. 27. Zassenhaus, H. P., N. C. Martin, and R. A. Butow. 1984. Origins 13. Krupp, G., B. Cherayil, D. Frendeway, S. Nishikawa, and D. of transcripts of the yeast mitochondrial varl gene. J. Biol. Soil. 1986. Two RNA species co-purify with RNase P from the Chem. 259:6019-6027.