DOCSLIB.ORG

Drymophila and Hypocnemis)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Drymophila and Hypocnemis) The Auk 116(4):1093-1106, 1999 HIGH LEVELS OF MITOCHONDRIAL DNA DIFFERENTIATION IN TWO LINEAGES OF ANTBIRDS (DRYMOPHILA AND HYPOCNEMIS) JOHN M. BATES?3 SHANNONJ. HACKETT,• AND JAQUELINEM. GOERCK2 •Departmentof Zoology,Field Museum of NaturalHistory, Roosevelt Road at LakeShore Drive, Chicago,Illinois 60605, USA; and 2Departmentof Biology,University of Missouri-St.Louis, 8001 NaturalBridge Road, St. Louis, Missouri 63121, USA ABSTRACT.--Weassessed levels of geneticdifferentiation based on mitochondrialDNA se- quences(portions of the cytochrome-band ND2 genes)at severaltaxonomic levels in tham- nophilidantbirds. Our focuswas to investigategenetic differentiation among populations of two speciesin the genusDrymophila and to identify the sistergenus to Drymophila.In addition,we presentevidence of highlevels of populationsubdivision in Hypocnemiscantator (WarblingAntbird). This widespread Amazonian taxon co-occurs, on a localscale, with D. devillei(Striated Antbird). Sequencedivergences among populations of D. devilleiand D. cau- data(Long-tailed Antbird), two bamboo-specialists,often exceeded 2% between populations. Divergenceswithin H. cantator,a specieswith moregeneralized habitat requirements and a more"continuous" distribution, were even higher, including 5.7% divergence between sam- plesseparated by 350 km of apparentlycontinuous Amazonian forest. At highertaxonomic levels,genetic distances suggest that antbirdgenera and biological species are old. Genetic divergencebetween the two speciesthat comprise the genusHypocnemis was 9.3%, and di- vergencebetween D. devilleiand D. caudataaveraged 7.2%. Weighted parsimony and maxi- mum-likelihoodanalyses supported Hypocnemis asthe sister taxon to Drymophila;the genus Myrmotherulawas not monophyletic,supporting previous allozyme analyses. In additionto the protein-codingsequences, we foundthat spacerregions between genes also provided phylogeneticallyinformative characters from the levelof suboscinefamilies to within the biologicalspecies that we studied.Received 31 March1998, accepted 7 April 1999. WITH SOME266 currentlyrecognized biolog- this study and are thoughtto be restricted ical species(Parker et al. 1996), the antbirds largelyto areasof bambooin the upper-tropi- (formerlyFormicariidae) recently have been di- cal zone of the Andes (D. caudata)and in the videdinto theFormicariidae (ground antbirds, westernand southernparts of the Amazonba- 70 species)and Thamnophilidae(typical ant- sin (D. devillei;Fig. 1). The entiregenus is cur- birds,196 species) based on DNA-DNA hybrid- rently under study by one of us (JMG) to un- izationdata (Sibleyand Ahlquist1990). Mem- derstandits evolutionaryhistory and how this bersof thesespecies-rich families are distrib- history relatesto current ecologyand distri- uted throughoutthe Neotropics.Antbirds in- bution. habit all levels of tropical forest and many Specializationon bambooexhibited by D. de- different insectivorous niches such that as villei and D. caudatais known for a small guild many as 40 speciescan occurat a singlesite. In of Neotropicalbirds (Parker 1982, Kratter 1997, thispaper, we presentdata on geneticstructure Parker et al. 1997). Bamboo-specialistbirds, within and among three biologicalspecies like theirpreferred habitat, tend to havepatchy (sensuMayr 1963) of thamnophilidantbirds: distributions. In the Andean foothills, D. cau- Drymophiladevillei (Striated Antbird), D. caudata data occurs between 1,200 and 2,500 m from (Long-tailedAntbird), and Hypocnemiscantator Venezuelato Bolivia.Three subspecies,with (WarblingAntbird). presumablydisjunct distributions, have been Thegenus Drymophila has been considered to described(Peters 1951), but eventhese subspe- have eight species(Peters 1951), six of which are restricted to the Atlantic forests of eastern ciesprobably are composedof disjunctpopu- South America. The other two are the focus of lations subdividedby deep river valleys and high mountainridges. Based on limited speci- men data, D. devilleishows a similarlypatchy E-mail:[email protected] distribution in the lowlands (Stotz 1990, Rid- 1093 1094 BATES,HACKETT, AND GOERCK [Auk, Vol. 116 10•N oo Attc•zt•,c Ocec• P•c•.f•.c Ocec•'•. 80"W 75 55 F•G.1. Distribution of Drymophilacaudata (circles) and D. devillei(triangles). In severalplaces both spe- ciesare known from the samesector (closed circles). Sites for samplesof Hypocnemiscantator used in this study are also indicated(open squares);in severalinstances these sites correspond with localitieswhere D. devilleioccurs (dark triangles).Numbers depict localitiesin Appendix. The easternmostopen triangle is where the type of D. devilleisubochracea was collected.Locational data compiledand map preparedby M. and P. Isler. gely and Tudor 1994, Stotz et al. 1997). Two villei and two populationsof D. caudatafrom subspecieshave been described, both of which southernPeru. To establish the outgroup for the were consideredto be probablebiological spe- genus,we also obtainedsequences from indi- ciesby Parkeret al. (1996).The nominateform, vidualsrepresenting a numberof other small D. d. devillei, is known from areas of bamboo in thamnophilids.To provideadditional compar- southeastern Peru and northern Bolivia, but ative data on geneticstructure within biologi- severalspecimen records also exist from as far cal species,we alsoincluded multiple samples north as easternColombia (Stotz 1990).Dry- of both biologicalspecies of Hypocnemis.Al- mophilad. subochraceais known from only a few thoughthese samples cover only a smallpor- localities that lie south of the Amazon, from the tion of the geographicdistribution of thesetwo east bank of the Rio Madeira to a western trib- taxa(particularly for H. cantator),they provide utary of the Rio Xingu in Brazil. more divergencedata from anotherlineage We presentsequences from parts of the mi- from this part of Amazonia.Our resultspro- tochondrialcytochrome-b (cyt b) and NADH vide a clearpicture of thehigh levelsof genetic dehydrogenasesubunit 2 (ND2) genesfor mul- structurewe believeare typical of many forest- tiple populationsof both subspeciesof D. de- dwelling Neotropicalspecies. October1999] GeneticDifferentiation in Antbirds 1095 METHODS Biosystems,Inc. [ABI]). Cycle-sequencingreactions were Nh4OAcprecipitated, rinsed in ethanol, dried, DNA sequencing.--Samplesof the 34 individuals resuspendedin a formamide-EDTA solution, and used in this study were obtainedfrom tissuecollec- run on an ABI 377 Automated DNA Sequencer.Se- tions of the LouisianaState UniversityMuseum of quenceswere obtained from both strandsof DNA, NaturalScience (LSUMNS), the Academyof Natural checkedusing the programSequencher 3.0 (Gene Sciencesin Philadelphia(ANSP), and the Bird Di- CodesCorp.), aligned to the chicken(Gallus gallus) vision of the Field Museum of Natural History sequence(Desjardins and Morais 1990) to ensure (FMNH; Appendix).Voucher specimens are housed there were no insertions or deletions of bases in the at these institutions, the Museu Paraense Emilio antbird sequences,and submitted to GenBank Goeldi, Be16m,Brazil (MPEG), and Museu de Zoo- (AFl18154 to AFl18221; Appendix). logia da Universidadede S•o Paulo,Brazil (MZUSP). The followingprotocol was undertakento ensure All DNA work was carried out in the Field Museum's that the smallfragments of DNA weremitochondrial PritzkerLaboratory for the Studyof MolecularSys- in origin (not nuclear copies).(1) Sequencesof se- tematicsand Evolution.Samples were from the two lectedindividuals were verified by amplifying(with speciesof Drymophilaand eight other speciesof L14990 and H16065 for cyt b and L5215 and H6313 thamnophilids(Terenura humeralis [Chestnut-shoul- for ND2; sequencesin Hackett [1996], except for dered Antwren]; Myrmotherulalongipennis [Long- H6313 [CCTTTATTTAAGGCTTTGAAGGC]) and se- winged Antwren]; M. leucophthalma[White-eyed quencinga larger pieceof mtDNA using the primers Antwren]; M. hauxwelli [Plain-throated Antwren]; above.(2) Both DNA strandswere sequencedto en- Formicivorarufa [Rusty-backedAntwren]; E grisea sure accurate sequences.(3) Sequenceswere used [White-fringed Antwren]; Hypocnemishypoxantha only if they gave clean sequence(i.e. little back- [Yellow-browed Antbird]; and H. cantator).We in- ground and no double peaks), and sequenceswere cludedmultiple individuals of speciesin Hypocnemis inspectedfor insertions,deletions, or stop codohs becausethe genushas been hypothesizedto be the that would indicatethat the sequenceswould result closestrelative of Drymophila(Ridgely and Tudor in a nonfunctionalprotein. (4) Partition-homogene- 1994:293).At the genericlevel, the goal of this sam- ity testswere performed to assessif thephylogenetic pling schemewas to confirma suitableoutgroup for contentof thesetwo partial genesequences was sim- geneticand ecologicalresearch on Drymophila,and ilar; nuclearcopies would not necessarilybe expect- not to reconstructa phylogenyof thamnophilidgen- ed to havesimilar phylogenetic content to mitochon- era. As a result, higher-levelrelationships among drial genes.(5) Genetic-distancematrices were gen- thamnophilidsshould be viewed as tentative.We eratedseparately for the two genefragments and in- also included a ground antbird (Formicariuscolma spectedfor differences.(6) Sequencesof individuals [Rufous-capped Antthrush], Formicariidae), a from the samecollecting locality, population, or geo- woodcreeper(Lepidocolaptes angustirostris [Narrow- graphicregion were expected to be geneticallymore billed Woodcreeper],Dendrocolaptidae), an ovenbird similarthan thoseof otherpopulations
Load more

Recommended publications
  • The Birds of Reserva Ecológica Guapiaçu (REGUA)
    Cotinga 33 The birds of Reserva Ecológica Guapiaçu (REGUA), Rio de Janeiro, Brazil Leonardo Pimentel and Fábio Olmos Received 30 September 2009; final revision accepted 15 December 2010 Cotinga 33 (2011): OL 8–24 published online 16 March 2011 É apresentada uma lista da avifauna da Reserva Ecológica de Guapiaçu (REGUA), uma reserva privada de 6.500 ha localizada no município de Cachoeiras de Macacu, vizinha ao Parque Estadual dos Três Picos, Estação Ecológica do Paraíso e Parque Nacional da Serra dos Órgãos, parte de um dos maiores conjuntos protegidos do Estado do Rio de Janeiro. Foram registradas um total de 450 espécies de aves, das quais 63 consideradas de interesse para conservação, como Leucopternis lacernulatus, Harpyhaliaetus coronatus, Triclaria malachitacea, Myrmotherula minor, Dacnis nigripes, Sporophila frontalis e S. falcirostris. A reserva também está desenvolvendo um projeto de reintrodução dos localmente extintos Crax blumembachii e Aburria jacutinga, e de reforço das populações locais de Tinamus solitarius. The Atlantic Forest of eastern Brazil and Some information has been published on neighbouring Argentina and Paraguay is among the birds of lower (90–500 m) elevations in the the most imperilled biomes in the world. At region10,13, but few areas have been subject to least 188 bird species are endemic to it, and 70 long-term surveys. Here we present the cumulative globally threatened birds occur there, most of them list of a privately protected area, Reserva Ecológica endemics4,8. The Atlantic Forest is not homogeneous Guapiaçu (REGUA), which includes both low-lying and both latitudinal and longitudinal gradients parts of the Serra dos Órgãos massif and nearby account for diverse associations of discrete habitats higher ground, now mostly incorporated within and associated bird communities.
    [Show full text]
  • Territory Size and Stability in a Sedentary Neotropical Passerine: Is Resource Partitioning a Necessary Condition?
    J. Field Ornithol. 76(4):395±401, 2005 Territory size and stability in a sedentary neotropical passerine: is resource partitioning a necessary condition? Janet V. Gorrell,1 Gary Ritchison,1,3 and Eugene S. Morton2 1 Department of Biological Sciences, Eastern Kentucky University, Richmond, Kentucky 40475 USA 2 Hemlock Hill Field Station, 22318 Teepleville Flats Road, Cambridge Springs, Pennsylvania 16403 USA Received 9 April 2004; accepted 11 April 2005 ABSTRACT. Long-term pair bonds and defense of territories year-round are common among tropical passer- ines. The boundaries of these territories tend to be stable, perhaps re¯ecting the need to defend an area that, regardless of conditions, provides suf®cient food resources. If, however, these stable territories are not, even tem- porarily, suf®ciently large, then intra-pair competition for available food may result, particularly in species with no sexual size dimorphism. With such competition, sex-speci®c differences in foraging behavior may result. Male and female Dusky Antbirds (Cercomacra tyrannina) are not size dimorphic, and pairs jointly defend territories throughout the year. Our objective was to determine if paired Dusky Antbirds exhibited sex-speci®c differences in foraging behavior. Foraging antbirds were observed in central Panama from February±July 2002 to determine if pairs par- titioned food resources. Males and females exhibited no differences in foraging behavior, with individuals of both sexes foraging at similar heights and using the same foraging maneuvers (glean, probe, and sally) and substrates (leaves, rolled leaves, and woody surfaces). These results suggest that Dusky Antbirds do not partition resources and that territory switching, rather than resource partitioning, may be the means by which they gain access to additional food resources.
    [Show full text]
  • Serra Dos Tucanos, Brazil 2017 BIRDS
    Field Guides Tour Report Serra dos Tucanos, Brazil 2017 Oct 23, 2017 to Nov 2, 2017 Marcelo Padua For our tour description, itinerary, past triplists, dates, fees, and more, please VISIT OUR TOUR PAGE. We made quite a journey to find this bird! The Three-toed Jacamar is an Atlantic Forest endemic, and we were able to get some super looks at it. Photo by participant Ben Oko. As a tour leader, one of the most common questions I get from participants is, which "tour is my favorite?". Although this is a question with no answer as each tour is different, and I love all the tours I lead, there are certain aspects of a tour that I enjoy more than others, and this tour checks the box for most of them. It starts with the facts that the climate is mild and we usually do not face extreme temperatures, but it also has to do with the abundance of species of birds, many of which are endemic, the comfort of the lodge that offers great food and lovely rooms surrounded by great habitat, the diversity of habitats, and the fact that you get to settle in to a room for long enough to actually enjoy it and unpack your suitcase. This year's tour was a great success. We found most of the targets we set out to find, we enjoyed a good mix of people with great camaraderie, and the weather was kind to us for the most part. So even though I can't choose a favorite tour, I can say with certainty that if I ever had to choose, this would certainly be one of the top contenders.
    [Show full text]
  • An Integrative Approach to Species-Level Systematics Reveals the Depth of Diversification in an Andean Thamnophilid, the Long-Tailed Antbird
    The Condor 114(3):571–583 The Cooper Ornithological Society 2012 AN INTEGRATIVE APPROACH TO SPECIES-LEVEL SYSTEMATICS REVEALS THE DEPTH OF DIVERSIFICATION IN AN ANDEAN THAMNOPHILID, THE LONG-TAILED ANTBIRD MORTON L. ISLER1,3, ANDRÉS M. CUERVO2, GUSTAVO A, BRAVO2, AND RObb T. BRUMFIELD2 1Department of Vertebrate Zoology, MRC-116, National Museum of Natural History, Smithsonian Institution, P. O. Box 37012, Washington, DC 20013 2 Department of Biological Sciences and Museum of Natural Science, Louisiana State University, Baton Rouge, LA 70803 Abstract. The geographic range of the Long-tailed Antbird (Drymophila caudata) extends from the Paria Mountains of Venezuela south through the Andes to northern Bolivia, a geographic and elevational distribution unique in the antbirds (Thamnophilidae). Plumage variation among most populations is not obvious, and although eight subspecies have been described, half have been synonymized. We took a multidimensional approach to reexamining the taxonomy of the complex. We identified lineages by evaluating divergence in mtDNA, and defined study groups within them to take into account previously described plumage differences. We then assessed the taxonomic status of principal lineages and study groups by comparing vocal differences among them to established taxonomic “yardsticks” for thamnophilid antbirds. Finally, we related taxa to the ecology of the regions in which they occur. The outcomes revealed substantial diversification, sufficient for recognition of four species, three restricted to the north and one widespread along the main body of the Andes extending from northwestern Colombia south to Bolivia. Speciation in Andean Drymophila antbirds is partially associated with elevational and environmental divergence. The results provide valuable inputs to mapping and understanding avian evolution in the Andes and demonstrate the value of a multifaceted approach in solving taxonomic problems.
    [Show full text]
  • Birding the Atlantic Rainforest, South-East Brazil Itororo Lodge and Regua 11Th – 20Th March 2018
    BIRDING THE ATLANTIC RAINFOREST, SOUTH-EAST BRAZIL ITORORO LODGE AND REGUA 11TH – 20TH MARCH 2018 White-barred Piculet (©Andy Foster) Guided and report compiled by Andy Foster www.serradostucanos.com.br Sunday 11th March The following 10 day tour was a private trip for a group of 4 friends. We all flew in from the UK on a BA flight landing the night of the 10th and stayed in the Linx Hotel located close to the International airport in Rio de Janeiro. We met up for breakfast at 07.00 and by 08.00 our driver had arrived to take us for the 2.5 hour drive to Itororo Lodge where we were to spend our first 6 nights birding the higher elevations of the Serra do Mar Mountains. On the journey up we saw Magnificent Frigatebird, Cocoi Heron, Great White Egret, Black-crowned Night Heron, Neotropic Cormorant and Roadside Hawk. By 10.30 we had arrived at the lodge and were greeted by Bettina and Rainer who would be our hosts for the next week. The feeders were busy at the lodge and we were soon picking up new species including Azure-shouldered Tanager, Brassy-breasted Tanager, Black-goggled Tanager, Sayaca Tanager, Ruby- crowned Tanager, Golden-chevroned Tanager, Magpie Tanager, Burnished-buff Tanager, Plain Parakeet, Maroon-bellied Parakeet, Rufous-bellied Thrush, Green-winged Saltator, Pale-breasted Thrush, Violet- capped Woodnymph, Black Jacobin, Scale-throated Hermit, Sombre Hummingbird, Brazilian Ruby and White-throated Hummingbird…. not bad for the first 30 minutes! We spent the last hour or so before lunch getting to grips with the feeder birds, we also picked up brief but good views of a Black-Hawk Eagle as it flew through the lodge gardens.
    [Show full text]
  • Breeding Biology of Yellow-Browed Antbird Hypocnemis Hypoxantha
    Daniel M. Brooks et al. 156 Bull. B.O.C. 2016 136(3) Breeding biology of Yellow-browed Antbird Hypocnemis hypoxantha by Daniel M. Brooks, Pablo Aibar, Pam Bucur, Ron Rossi & Harold F. Greeney Received 17 February 2016 Summary.—We provide novel data concerning the nests, eggs and parental care of Yellow-browed Antbird Hypocnemis hypoxantha based on two nests in eastern Ecuador and Peruvian Amazonia, one of which was video-taped. Both adults participated in incubation, with earliest and latest feeding events at 06.11 h and 17.22 h, respectively. Feeding behaviour is described, with intervals of 1–114 minutes (mean = 38.3 minutes) and tettigoniid cicadas the primary prey. Nestlings frequently produced faecal sacs (interval range = 4–132 minutes, mean = 37.8 minutes) immediately following food delivery, and the sac was always carried from the nest by an adult. Two events involving a parent bird being chased from the nest are described, the first involving a male Fulvous Antshrike Frederickena fulva. Systematics are discussed in light of nest morphology and architecture. Yellow-browed Antbird Hypocnemis hypoxantha is a distinctive Amazonian thamnophilid that comprises two currently recognised subspecies: nominate hypoxantha in western Amazonian lowland and foothill forests from southern Colombia south to central Peru, and H. h. ochraceiventris in south-east Amazonian Brazil (Zimmer & Isler 2003). Generally found below 400 m, the nominate subspecies occasionally ranges as high as 900 m (Zimmer & Isler 2003, Ridgely & Tudor 2009). The species’ reproductive biology is almost completely unknown (Zimmer & Isler 2003). Willis (1988) provided a cursory description of a nest with nestlings from Colombia, but included few details of the nest and no description of the eggs or behaviour.
    [Show full text]
  • Brazil's Eastern Amazonia
    The loud and impressive White Bellbird, one of the many highlights on the Brazil’s Eastern Amazonia 2017 tour (Eduardo Patrial) BRAZIL’S EASTERN AMAZONIA 8/16 – 26 AUGUST 2017 LEADER: EDUARDO PATRIAL This second edition of Brazil’s Eastern Amazonia was absolutely a phenomenal trip with over five hundred species recorded (514). Some adjustments happily facilitated the logistics (internal flights) a bit and we also could explore some areas around Belem this time, providing some extra good birds to our list. Our time at Amazonia National Park was good and we managed to get most of the important targets, despite the quite low bird activity noticed along the trails when we were there. Carajas National Forest on the other hand was very busy and produced an overwhelming cast of fine birds (and a Giant Armadillo!). Caxias in the end came again as good as it gets, and this time with the novelty of visiting a new site, Campo Maior, a place that reminds the lowlands from Pantanal. On this amazing tour we had the chance to enjoy the special avifauna from two important interfluvium in the Brazilian Amazon, the Madeira – Tapajos and Xingu – Tocantins; and also the specialties from a poorly covered corner in the Northeast region at Maranhão and Piauí states. Check out below the highlights from this successful adventure: Horned Screamer, Masked Duck, Chestnut- headed and Buff-browed Chachalacas, White-crested Guan, Bare-faced Curassow, King Vulture, Black-and- white and Ornate Hawk-Eagles, White and White-browed Hawks, Rufous-sided and Russet-crowned Crakes, Dark-winged Trumpeter (ssp.
    [Show full text]
  • Reproductive Biology and Nest-Site Selection of the Mato Grosso Antbird Cercomacra Melanaria in the Brazilian Pantanal
    Revista Brasileira de Ornitologia, 22(3), 270-277 ARTICLE September 2014 Reproductive biology and nest-site selection of the Mato Grosso Antbird Cercomacra melanaria in the Brazilian Pantanal Bianca Bernardon1, 2, 3, Paula Fernanda Albonette de Nóbrega1 and João Batista de Pinho1 1 Laboratório de Ornitologia, Núcleo de Estudos Ecológicos do Pantanal, Instituto de Biociências, Universidade Federal de Mato Grosso – UFMT, Avenida Fernando Corrêa, s/nº, Coxipó, CEP 78060-900, Cuiabá, MT, Brazil 2 Current Address: Grupo de Pesquisa em Ecologia de Vertebrados Terrestres, Instituto de Desenvolvimento Sustentável Mamirauá – IDSM, Estrada do Bexiga, 2584, CEP 69553-225, Tefé, AM, Brazil 3 Corresponding author: [email protected] Received on 27 December 2013. Accepted on 26 June 2014. ABSTRACT: Economic activities, such as extensive cattle ranching, may seriously threaten the types of forest most important to the Mato Grosso Antbird Cercomacra melanaria, and information on reproductive biology is essential for defining sound conservation and management strategies for the species. Here, we report on the reproductive biology of this species in the Brazilian Pantanal, focusing on attributes such as incubation and nestling periods, as well as characteristics of parental care. The hypothesis that nest occurrence is associated with canopy opening was also tested. Average nest height was 0.98 m; mean nest construction and egg incubation periods were 12.2 and 14 days, respectively; average nestling period was 9.4 days. Both males and females participated in nest construction, egg incubation, and feeding of nestlings. The canopy was consistently more open away from the nests (18.74%) than at nest sites (10.10%; P < 0.0001), indicating that C.
    [Show full text]
  • Ecuador: HARPY EAGLE & EAST ANDEAN FOOTHILLS EXTENSION
    Tropical Birding Trip Report Ecuador: HARPY EAGLE & East Andean Foothills Extension (Jan-Feb 2021) A Tropical Birding custom extension Ecuador: HARPY EAGLE & EAST ANDEAN FOOTHILLS EXTENSION th nd 27 January - 2 February 2021 The main motivation for this custom extension was this Harpy Eagle. This was one of an unusually accessible nesting pair near the Amazonian town of Limoncocha that provided a worthy add-on to The Andes Introtour in northwest Ecuador that preceded this (Jose Illanes/Tropical Birding Tours). Guided by Jose Illanes Birds in the photos within this report are denoted in RED, all photos were taken by the Tropical Birding guide. 1 www.tropicalbirding.com +1-409-515-9110 [email protected] Tropical Birding Trip Report Ecuador: HARPY EAGLE & East Andean Foothills Extension (Jan-Feb 2021) INTRODUCTION This custom extension trip was set up for one person who simply could not get enough of Ecuador…John had just finished Ecuador: The Andes Introtour, in the northwest of the country, and also joined the High Andes Extension to that tour, which sampled the eastern highlands too. However, he was still missing vast chunks of this small country that is bursting with bird diversity. Most importantly, he was keen to get in on the latest “mega bird” in Ecuador, a very accessible Harpy Eagle nest, near a small Amazonian town, which had been hitting the local headlines and drawing the few birding tourists in the country at this time to come see it. With this in mind, TROPICAL BIRDING has been offering custom add-ons to all of our Ecuador offerings (for 2021 and 2022) to see this Harpy Eagle pair, with only three extra days needed to see it.
    [Show full text]
  • Brazil: Remote Southern Amazonia Campos Amazônicos Np & Acre
    BRAZIL: REMOTE SOUTHERN AMAZONIA CAMPOS AMAZÔNICOS NP & ACRE 7 – 19 July 2015 White-breasted Antbird (Rhegmatorhina hoffmannsi), Tabajara, Rondônia © Bradley Davis trip report by Bradley Davis ([email protected] / www.birdingmatogrosso.com) photographs by Bradley Davis and Bruno Rennó Introduction: This trip had been in the making since the autumn of 2013. Duncan, an avowed antbird fanatic, contacted me after having come to the conclusion that he could no longer ignore the Rio Roosevelt given the recent batch of antbird splits and new taxa coming from the Madeira – Tapajós interfluvium. We had touched on the subject during his previous trips in Brazil, having also toyed with the idea of including an expedition-style extension to search for Brazil's biggest mega when it comes to antbirds – the Rondônia Bushbird. After some back and forth in the first two months of the following year, an e-mail came through from Duncan which ended thusly: “statement of the bleedin’ obvious: I would SERIOUSLY like to see the Bushbird.” At which point the game was on, so to speak. We began to organize an itinerary for the Rio Roosevelt with a dedicated expedition for Rondonia Bushbird. By mid-year things were coming together for a September trip, but in August we were de-railed by a minor health problem and two participants being forced to back out at the last minute. With a bushbird in the balance, we weren't about to call the whole thing off, and thus a new itinerary sans Roosevelt was hatched for 2015, an itinerary which called for about a week in the Tabajara area on the southern border of the Campos Amazônicos National Park, followed by a few days on the west bank of the rio Madeira to go for a couple of Duncan's targets in that area.
    [Show full text]
  • Southern Wing-Banded Antbird, Myrmornis Torquata Myrmornithinae
    Thamnophilidae: Antbirds, Species Tree I Northern Wing-banded Antbird, Myrmornis stictoptera ⋆Southern Wing-banded Antbird, Myrmornis torquata ⋆ Myrmornithinae Spot-winged Antshrike, Pygiptila stellaris Russet Antshrike, Thamnistes anabatinus Rufescent Antshrike, Thamnistes rufescens Guianan Rufous-rumped Antwren, Euchrepomis guianensus ⋆Western Rufous-rumped Antwren, Euchrepomis callinota Euchrepomidinae Yellow-rumped Antwren, Euchrepomis sharpei Ash-winged Antwren, Euchrepomis spodioptila Chestnut-shouldered Antwren, Euchrepomis humeralis ⋆Stripe-backed Antbird, Myrmorchilus strigilatus ⋆Dot-winged Antwren, Microrhopias quixensis ⋆Yapacana Antbird, Aprositornis disjuncta ⋆Black-throated Antbird, Myrmophylax atrothorax ⋆Gray-bellied Antbird, Ammonastes pelzelni MICRORHOPIINI ⋆Recurve-billed Bushbird, Neoctantes alixii ⋆Black Bushbird, Neoctantes niger Rondonia Bushbird, Neoctantes atrogularis Checker-throated Stipplethroat, Epinecrophylla fulviventris Western Ornate Stipplethroat, Epinecrophylla ornata Eastern Ornate Stipplethroat, Epinecrophylla hoffmannsi Rufous-tailed Stipplethroat, Epinecrophylla erythrura White-eyed Stipplethroat, Epinecrophylla leucophthalma Brown-bellied Stipplethroat, Epinecrophylla gutturalis Foothill Stipplethroat, Epinecrophylla spodionota Madeira Stipplethroat, Epinecrophylla amazonica Roosevelt Stipplethroat, Epinecrophylla dentei Negro Stipplethroat, Epinecrophylla pyrrhonota Brown-backed Stipplethroat, Epinecrophylla fjeldsaai ⋆Napo Stipplethroat, Epinecrophylla haematonota ⋆Streak-capped Antwren, Terenura
    [Show full text]
  • Southeast Brazil: Atlantic Rainforest and Savanna, Oct-Nov 2016
    Tropical Birding Trip Report Southeast Brazil: Atlantic Rainforest and Savanna, Oct-Nov 2016 SOUTHEAST BRAZIL: Atlantic Rainforest and Savanna October 20th – November 8th, 2016 TOUR LEADER: Nick Athanas Report and photos by Nick Athanas Helmeted Woodpecker - one of our most memorable sightings of the tour It had been a couple of years since I last guided this tour, and I had forgotten how much fun it could be. We covered a lot of ground and visited a great series of parks, lodges, and reserves, racking up a respectable group list of 459 bird species seen as well as some nice mammals. There was a lot of rain in the area, but we had to consider ourselves fortunate that the rainiest days seemed to coincide with our long travel days, so it really didn’t cost us too much in the way of birds. My personal trip favorite sighting was our amazing and prolonged encounter with a rare Helmeted Woodpecker! Others of note included extreme close-ups of Spot-winged Wood-Quail, a surprise Sungrebe, multiple White-necked Hawks, Long-trained Nightjar, 31 species of antbirds, scope views of Variegated Antpitta, a point-blank Spotted Bamboowren, tons of colorful hummers and tanagers, TWO Maned Wolves at the same time, and Giant Anteater. This report is a bit light on text and a bit heavy of photos, mainly due to my insane schedule lately where I have hardly had any time at home, but all photos are from the tour. www.tropicalbirding.com +1-409-515-9110 [email protected] Tropical Birding Trip Report Southeast Brazil: Atlantic Rainforest and Savanna, Oct-Nov 2016 The trip started in the city of Curitiba.
    [Show full text]