Santa Rasa
ASSOCIATION OF PERSISTENT VIRAL INFECTIONS WITH MYALGIC ENCEPHALOMYELITIS/ CHRONIC FATIGUE SYNDROME
Doctoral Thesis for obtaining the degree of a Doctor of Medicine
Speciality – Microbiology and Virology
Scientific supervisor: Dr. med., Assoc. Prof. Modra Murovska
The Doctoral Thesis are developed with the support of the ESF project “Support to implementation of doctoral study programmes and obtaining the scientific degree in RSU” Agreement No. 2009/0147/1DP/1.1.2.1.2/09/IPIA/VIAA/009
Riga, 2017 ANNOTATION
Myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS) is a multifactorial disease with unexplained aetiology. Human herpesvirus (HHV)-6, HHV-7, human parvovirus B19 (B19V) and xenotropic murine leukemia virus-related virus (XMRV) are thought to be possible trigger factors in ME/CFS development. The aim of this study was to determine the involvement of HHV-6, HHV-7, B19V and XMRV in etiopathogenesis of ME/CFS. Various polymerase chain reaction (PCR) methods to detect presence of viral genomic sequences were used, viral load and expression of virus-specific genes. Presence of HHV-6A and HHV-6B by PCR and restriction analysis was distinguished with following visualization of amplification products electrophoretically. Immunoenzymatic methods were used to estimate presence of virus-specific antibodies, reaction patterns of these antibodies, as well as the level of cytokines in blood plasma, while the HHV-6 antigen expression was detected by indirect immunofluorescence. The analysis of patients with ME/CFS and apparently healthy individuals revealed absence of XMRV proviral gag and env gene sequences in DNA from patients and apparently healthy individuals. These data are in concordance with the results obtained in many laboratories worldwide. HHV-6 specific antibodies in 92.1% of ME/CFS patients’ and 76.7% of apparently healthy individuals’ plasma samples were found. Markers of persistent HHV-6 infection in a latent phase had 42% of patients and 28.7% of healthy individuals, though in an active phase – 11% of ME/CFS cases and none of healthy individuals. HHV-6B is prevalent in Latvian ME/CFS patients. HHV-7 specific antibodies had 84.6% of patients and 93.8% of analysed controls. Markers of persistent HHV-7 infection in latent and active phase had 58% vs 34% of ME/CFS patients and 67.3% vs 8% of apparently healthy individuals. B19V specific antibodies in 78% of patients with ME/CFS and 67.4% of healthy individuals were detected. Presence of latent/persistent B19V infection markers had 12% of patients and 1.9% of controls but 17% of patients and 1.9% of healthy individuals had an active infection. According to the antibody pattern, 36% of ME/CFS patients had recent B19V infection and 43% – sustained infection. In patients with a persistent viral infection in an active phase median HHV-6 load (1927 vs 279 copies/106 cells), median HHV-7 load (238.6 vs 196.7 copies/106 cells) and median B19V load (251.8 vs 37.2 copies/106 cells) was higher than in patients with a persistent viral infection in a latent phase.
2 Analysing HHV-6, HHV-7 and B19V co-infection, latent infection/co-infection was observed to 51.5% of patients and 76.7% of apparently healthy individuals, whereas active – 45% of ME/CFS patients and 8.7% of healthy individuals. HHV-6 load in patients with persistent infection/co-infection in a latent and active phase was 262 and 653.2 copies/106 cells, respectively, whereas HHV-7 load was 166.5 and 248.5 copies/106 cells, respectively. In case of latent/persistent B19V co-infection, the viral load was 96.8, in case of active co-infection – 250.8 copies/106 cells. ME/CFS patients with a persistent infection in an active phase had higher level of pro-inflammatory (IL-6, TNF-α and IL-12) and anti-inflammatory (IL-10) cytokines than with a persistent infection in a latent phase, however without any statistical difference in part of cases. No difference was found in the level of IL-6 among patient groups without infection, with latent infection/co-infection, active single, double and triple co-infection, in turn a significant difference was revealed in the levels of TNF-α, IL-12 and IL-10 among these five groups. Furthermore, the level of TNF-α, IL-12 and IL-10 is significantly higher in patients with severe compared with moderate course of ME/CFS. All patients had unexplained chronic fatigue lasting for more than 6 months. Impaired memory, decreased concentration and sleep disturbances were most frequently observed symptoms in patients with ME/CFS. Patients with B19V genomic sequence and NS1 specific antibodies significantly often had lymphadenopathy and multi-joint pain. Moreover, onset of symptoms corresponded to B19V infection appearance time. The obtained data allow to conclude that XMRV infection is not associated with ME/CFS. Significantly more frequent findings of persistent HHV-6, HHV-7 and B19V infection/co-infection in an active phase with a higher viral load and elevated levels of pro- and anti-inflammatory cytokines among patients with ME/CFS than apparently healthy individuals indicate the importance of these infections/co-infections in ME/CFS development. Moreover, they are accompanied by a more severe ME/CFS clinical course.
3 ANOTĀCIJA
Mialģiskais encefalomielīts/hroniskā noguruma sindroms (ME/CFS) ir neskaidras izcelsmes multifaktoriāla slimība. Cilvēka herpesvīruss (HHV)-6, HHV-7, cilvēka parvovīruss B19 (B19V) un ksenotropajam peļu leikozes vīrusam radniecīgais vīruss (XMRV) tiek uzskatīti par iespējamajiem ME/CFS palajdējfaktoriem. Pētījuma “Persistentu vīrusu infekciju saistība ar mialģisko encefalomielītu/hroniskā noguruma sindromu” mērķis bija noteikt HHV-6, HHV-7, B19V un XMRV iesaisti ME/CFS etiopatoģenēzē. Dažādas polimerāzes ķēdes reakcijas (PCR) tika izmantotas vīrusu genoma secību klātbūtnes, vīrusu slodzes un gēnu ekspresijas noteikšanai. PCR un restrikcijas analīzi lietoja HHV-6A un HHV6-B izšķiršanai ar sekojošu fragmentu garuma elektroforētisku noteikšanu. Vīrusspecifisko antivielu klātbūtni un antivielu spektru, kā arī citokīnu līmeni asins plazmā noteica ar imūnfermentatīvajām metodēm, bet HHV-6 antigēnu ekspresiju – ar netiešās imūnfluorescences metodi. Analizējot pacientus ar ME/CFS un praktiski veselus indivīdus, XMRV provīrusa gag un env gēnu secības netika atrastas ne pacientu, ne arī praktiski veselu indivīdu DNS paraugos. Šie dati atbilst daudziem pasaulē veikto pētījumu rezultātiem. HHV-6 specifiskās antivielas atrada 92,1% ME/CFS pacientu un 76,7% praktiski veselu indivīdu plazmā. Marķierus persistentai HHV-6 infekcijai latentā fāzē konstatēja 42% pacientu un 28,7% veselu indivīdu, bet aktīvā fāzē – 11% ME/CFS pacientu, bet nevienam no veselajiem indivīdiem. Latvijā pacientiem ar ME/CFS prevalēja HHV-6B. HHV-7 specifiskās antivielas noteiktas 84,6% ME/CFS pacientu un 93,8% analizēto kontroles grupas indivīdu. Marķierus persistentai HHV-7 infekcijai latentā un aktīvā fāzē atrada 58% vs 34% ME/CFS pacientu un 67,3% vs 8% praktiski veselu indivīdu. B19V specifiskās antivielas detektētas 78% pacientu ar ME/CFS un 67,4% veselo indivīdu. Latentas/persistentas B19V infekcijas marķierus konstatēja 12% pacientu un 1,9% kontroles indivīdu, bet aktīvas infekcijas marķierus – 17% pacientu un 1,9% veselo indivīdu. Saskaņā ar noteikto antivielu spektru, nesen pārciesta B19V infekcija atrasta 36% pacientu un sen pārciesta (ilgstoša) – 43% pacientu. Pacientiem ar persistentu infekciju aktīvā fāzē mediānas HHV-6 slodze (1927 vs 279 kopijas/106 šūnu), mediānas HHV-7 slodze (238,6 vs 196,7 kopijas/106 šūnu) un mediānas B19V slodze (251,8 vs 37,2 kopijas/106 šūnās) bija augstāka nekā latentā fāzē. Analizējot HHV-6, HHV-7 un B19V koinfekciju, latenta infekcija/koinfekcija bija noteikta 51,5% pacientu un 76,7% praktiski veselo indivīdu, bet aktīva – 45% ME/CFS
4 pacientu un 8,7% veselo indivīdu. Pacientiem ar persistentu infekciju/koinfekciju latentā un aktīvā fāzē HHV-6 slodze bija 262 un 653,2 kopijas/106 šūnu, attiecīgi, bet HHV-7 slodze – 166,5 un 248,5 kopijas/106 šūnu, attiecīgi. Latentas/persistentas B19V koinfekcijas gadījumā B19V slodze bija 96,8, bet aktīvas – 250,8 kopijas/106 šūnu. Iekaisuma (IL-6, TNF-α un IL-12) un pretiekaisuma (IL-10) citokīnu līmenis augstāks bija pacientiem ar persistentu infekciju aktīvā fāzē, nekā latentā fāzē, taču ne visos gadījumos rezultāts bija statistiski būtisks. Lai gan starp pacientu grupām bez infekcijas, ar latentu infekciju/koinfekciju, aktīvu atsevišķu, dubultu un trīskāršu koinfekciju netika konstatētas būtiskas IL-6 līmeņa atšķirības, starp šīm piecām grupām atrastas būtiskas TNF-α, IL-12 un IL-10 atšķirības, turklāt, TNF-α, IL-12 un IL-10 līmenis bija būtiski augstāks pacientiem ar smagu nekā vidēji smagu slimības gaitu. Vairāk kā sešus mēnešus ilgs hronisks nogurums izpaudās visiem ME/CFS pacientiem. Visbiežāk pacientiem konstatēja atmiņas traucējumus, koncentrēšanās grūtības un miega traucējumus. Pacientiem ar detektētu B19V genoma secību un NS1 antivielām biežāk novēroja limfadenopātiju un locītavu sāpes, turklāt, simptomu parādīšanās atbilda inficēšanās ar B19V laikam. Šī pētījuma rezultāti ļauj secināt, ka XMRV infekcija nav saistīta ar ME/CFS. Būtiski biežāka persistentas HHV-6, HHV-7 un B19V infekcijas/koinfekcijas atrade aktīvā fāzē ar augstāku vīrusa slodzi un paaugstinātu iekaisuma un pretiekaisuma citokīnu līmeni pacientiem ar ME/CFS salīdzinot ar praktiski veseliem indivīdiem, kas saistīti ar smagāku ME/CFS klīnisko gaitu, liecina par šo vīrusu infekcijas/koinfekcijas nozīmīgo lomu ME/CFS attīstībā un klīniskajā norisē.
5
TABLE OF CONTENTS
Abreviations ...... 9 Introduction ...... 11 Scientific novelty of the study ...... 12 Aim of the study ...... 12 Objectives of the study ...... 13 Hypothesis of the study ...... 13 1. Literature ...... 14 1.1. Myalgic encephalomyelitis/chronic fatigue syndrome and clinical signs ...... 14 1.2. ME/CFS diagnostics ...... 16 1.3. Possible causes of ME/CFS ...... 17 1.4. ME/CFS associated infectious agents...... 20 1.5. Role of xenotropic murine leukemia related virus in ME/CFS ...... 22 1.6. Involvement of human herpesvirus-6 and 7 in ME/CFS ...... 24 1.7. Involvement of human parvovirus B19V in ME/CFS ...... 28 1.8. Potential development mechanisms of ME/CFS ...... 30 1.9. ME/CFS treatment strategies ...... 34 2. Material and Methods ...... 38 2.1. Patients and biological material ...... 38 2.2. Molecular methods ...... 39 2.2.1. DNA isolation ...... 40 2.2.2. RNA isolation ...... 40 2.2.3. Nucleic acid quantity analysis ...... 41 2.2.4. Complementary DNA synthesis ...... 41 2.2.5. DNA and cDNA quality analysis ...... 41 2.2.6. Virus genomic sequence detection by nested PCR ...... 42 2.2.7. HHV-6A and HHV-6B detection by nPCR and HindIII restriction ...... 45 2.2.8. Detection of virus gene expression using PCR ...... 46 2.2.9. Electrophoretic analysis ...... 46 2.2.10. Viral load determination with real-time PCR ...... 47 2.3. Immunological methods ...... 48 2.3.1. Detection of HHV-6, HHV-7 and B19V specific antibodies ...... 48 2.3.2. Evaluation of B19V antibody reaction patterns ...... 48
6 2.3.3. Determination of cytokine level ...... 49 2.3.4. Indirect immunofluorescence ...... 50 2.4. Phylogenetic analysis ...... 50 2.5. Statistical analysis...... 50 3. Results ...... 52 3.1. Patients with ME/CFS ...... 52 3.2. Analysis of XMRV genomic sequences in patients with ME/CFS ...... 53 3.3. Involvement of human herpesvirus-6 in development of ME/CFS ...... 54 3.3.1. Presence of HHV-6 specific antibodies ...... 54 3.3.2. Frequency of HHV-6 genomic sequences ...... 54 3.3.3. HHV-6 load ...... 55 3.3.4. Presence HHV-6 antigens ...... 55 3.3.5. Association of HHV-6 infection with ME/CFS clinical symptoms ...... 57 3.3.6. Level of cytokines in case of HHV-6 infection ...... 57 3.4. Involvement of human herpesvirus-7 in development of ME/CFS ...... 58 3.4.1. Presence of HHV-7 specific antibodies ...... 58 3.4.2. Frequency of HHV-7 genomic sequences ...... 58 3.4.3. HHV-7 load ...... 59 3.4.4. Association of HHV-7 with ME/CFS clinical symptoms ...... 60 3.4.5. Level of cytokines in case of HHV-7 infection ...... 60 3.5. Involvement of parvovirus B19V in development ME/CFS ...... 61 3.5.1. Presence of B19V specific antibodies ...... 61 3.5.2. Frequency of B19V genomic sequences ...... 62 3.5.3. B19V load ...... 62 3.5.4. B19V antibody reaction patterns ...... 63 3.5.5. Association of B19V with ME/CFS clinical symptoms ...... 64 3.5.6. Level of cytokines in case of B19V infection ...... 65 3.5.7. B19V phylogenetic analysis ...... 66 3.6. Involvement of HHV-6, HHV-7 and B19V infection/co-infection in development of ME/CFS ...... 67 3.6.1. Frequency of virus infection/co-infection ...... 67 3.6.2. Viral load in patients with co-infection ...... 69 3.6.3. Cytokine level in ME/CFS patients with viral infection/co-infection ...... 70 3.6.4. ME/CFS typical symptoms in patients with infection/co-infection ...... 72 3.6.5. Severity of ME/CFS in patients with infection/co-infection ...... 74 4. Discussion ...... 77 5. Conclusions ...... 93
7 6. Recommendations ...... 94 7. List of publications ...... 95 7.1. Papers in journals included in the international databases ...... 95 7.2. Papers in other journals and collections of articles ...... 95 7.3. Presentations at international conferences/congresses ...... 96 7.4. Presentations at local conferences/congresses ...... 97 8. References...... 98 Acknowledgements ...... 111
8 ABREVIATIONS
AIDS acquired immunodeficiency syndrome B19V human parvovirus B19 bp base pairs CBT cognitive behavioural therapy CD cluster of differentiation CDC Centers for Disease Control and Prevention cDNA complementary deoxyribonucleic acid ciHHV-6 chromosomally integrated HHV-6 CMV cytomegalovirus (HHV-5) CNS central nervous system DNA deoxyribonucleic acid dNTP deoxynucleotide triphosphate EBV Epstein-Barr virus ELISA Enzyme-Linked Immunosorbent Assay HHV Human Herpesvirus HRP horseradish peroxidase HSV herpes simplex virus ICD-10 International statistical classification of diseases and related health problems ICP International Consensus Panel IFN interferon IgG immunoglobulin G IgM immunoglobulin M IL interleukin IQR interquartile range LT lymphotoxin ME/CFS Myalgic Encephalomyelitis/Chronic Fatigue Syndrome
MgCl2 magnesium chloride MHC major histocompatibility complex ml millilitre μl microliter nm nanometre ng nanogram pg picogram
9 MLV murine leukemia virus mRNA messenger ribonucleic acid NIOF Neuro-Inflammatory and Oxidative Fatigue NK natural killer nPCR nested polymerase chain reaction OAS oligoadenylate synthetase PBMC peripheral blood mononuclear cells PBS phosphate buffer saline PCR polymerase chain reaction PMNL polymorphonuclear leukocytes PMV polytropic mouse endogenous viruses RNA ribonucleic acid RT reverse transcription SD standard deviation SDS sodium dodecyl sulphate SEID systemic exertion intolerance disease Th T-helper TNF-α tumor necrosis factor alpha VZV varicella zoster virus (HHV-3) XMRV xenotropic murine leukemia virus-related virus XPR1 xenotropic and polytropic retrovirus receptor 1
10 INTRODUCTION
Myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS) is a chronic, complex disease involving central nervous system and immune system disorders, cell energy metabolism and ion transport dysfunction, as well as cardiovascular abnormalities (Carruthers et al., 2011). This illness mainly is characterized by severe chronic fatigue, including such clinical symptoms as tender cervical or axillary lymph nodes, muscle pain, joint pain without swelling or redness, post-exertional malaise for more than 24 hours, impaired memory/concentration, headaches, sore throat and un-refreshing sleep (Fukuda et al., 1994; Carruthers et al., 2011). Prevalence of ME/CFS is reported depending on the applied criteria for diagnostics and it is determined from 0.76% of clinically diagnosed up to 3.48% of self-reported population (Johnston et al., 2013). Still there is no consensus on a single case definition for this disease. Diagnosis is based on differential diagnostics and clinical symptoms, therefore it is necessary to identify specific biomarkers for ME/CFS. However, currently there is no effective and standardized diagnostic tests, prophylactic and treatment strategies for this disease (Albright et al., 2011; Bansal et al., 2012). Viral infections have been considered as one of potential etiological factors for ME/CFS, which accompanied by immune disturbances can facilitate maintenance of disease symptoms (Bansal et al., 2012; Fischer et al., 2014). Many patients confirm an onset of ME/CFS with flu-like symptoms. Moreover, the observed immune abnormalities could be caused by a viral infection or a viral infection follows immune disturbances. Still, the role of viral infections in ME/CFS remains obscure (Morinet and Corruble, 2012; Underhill, 2015). Infectious agents that have been studied in association with ME/CFS are hepatitis C virus, human immunodeficiency virus, coxsackie B, Epstein-Barr virus (EBV), human herpesvirus (HHV)-6, human parvovirus B19 (B19V) and such bacteria as borrelia, chlamydia and mycoplasma. However, an association of a single specific infectious agent and ME/CFS has not been established (Nicolson et al., 2003; Bansal et al., 2012; Chapenko et al., 2012; Halpin et al., 2017; Loebel et al., 2017). Studies on the association of xenotropic murine leukemia virus-related virus (XMRV) with ME/CFS started after a published report on frequently detectable XMRV in patients with ME/CFS (Lombardi et al., 2009). Furthermore, ME/CFS could result from reactivation of persistent herpesvirus infection, which is found more frequently in patients with ME/CFS compared to donors (Chapenko et al., 2006; Krueger and Ablashi, 2006). Similarly, B19V infection is present at onset of ME/CFS, therefore it could be one of causal factors of this
11 disease (Fremont et al., 2009). Some researchers report that the reactivation of these viruses could serve as an objective biomarker (Ablashi et al., 2000; Chapenko et al., 2006; Kerr et al., 2010; Aoki et al., 2016). On the contrary, others find no association of HHV-6, HHV-7 and B19V infection with ME/CFS etiopathogenesis (Koelle et al., 2002; Cameron et al., 2010). Also immune system disorders are determined in various studies by the analysis of changes in several cytokine production in patients with ME/CFS (Russell et al., 2016; Mensah et al., 2017). Therefore, it is important to conduct studies in order to clarify the role of these viruses in ME/CFS, as well as to determine etiological, progression, maintenance mechanisms and biomarkers for this disease. This study was conducted in Rīga Stradiņš University, A.Kirchenstein Institute of Microbiology and Virology, where the first studies on ME/CFS were started in Latvia. To clarify the role of HHV-6, HHV-7, B19V and XMRV in ME/CFS, deoxyribonucleic acid (DNA) extraction using phenol-chloroform method, ribonucleic acid (RNA) extraction using TriReagent, DNA and RNA concentration measurement and complementary DNA (cDNA) synthesis were performed in this study. The quality of DNA and cDNA were assessed detecting β-globin sequence by polymerase chain reaction (PCR), whereas virus genomic sequences and transcripts were determined by PCR and nested PCR (nPCR). HHV-6A and B were distinguished using nPCR and restriction analysis. The obtained PCR products were analysed in agarose gel electrophoresis and the viral load was detected by real-time PCR. HHV-6 proteins were detected by indirect immunofluorescence, whereas HHV-6, HHV-7 and B19V antibodies and the level of cytokines - assessed by serological methods.
Scientific novelty of the study
In this study frequency and activity of persistent viral infection and co-infection, viral load, time from infection onset, level of cytokines and association with clinical symptoms in patients with ME/CFS were estimated to clarify the involvement of HHV-6, HHV-7, B19V and XMRV infections in the development of ME/CFS.
Aim of the study
To determine the involvement of human herpesvirus-6, human herpesvirus-7, parvovirus B19 and xenotropic murine leukemia virus related virus in etiopathogenesis of myalgic encephalomyelitis/chronic fatigue syndrome.
12 Objectives of the study
1. To detect the presence of XMRV provirus genomic sequences in DNA extracted from peripheral blood of ME/CFS patients. 2. To estimate the frequency of HHV-6 and HHV-7 specific antibodies and genomic sequences, infection activity phase, viral load, as well as HHV-6 type and antigen expression in patients with ME/CFS. 3. To detect the frequency of B19V specific antibodies and genomic sequences, infection activity phase, viral load, genotype and period of time from B19V infection appearance in ME/CFS patients. 4. To determine the expression level of cytokines (IL-6, TNF-α, IL-12, IL-4 and IL-10) in patients with persistent infection/co-infection in latent and active phase. 5. To analyse the association of HHV-6, HHV-7 and B19V infection/co-infection with ME/CFS clinical symptoms. 6. To estimate the influence of infection activity on severity of ME/CFS clinical course.
Hypothesis of the study
1. Persistent viral infections, like beta-herpesviruses HHV-6 and HHV-7, and parvovirus B19V infections, are ME/CFS trigger factors and are associated with the development of ME/CFS. 2. The activity phase of virus infection is of the greatest importance because – an active infection causes much deeper immunological disturbances and is associated with a more severe ME/CFS clinical course. 3. XMRV could be associated with ME/CFS development (confirm or deny this hypothesis).
Structure of the study
Doctoral thesis is written in English. It contains following parts: introduction, scientific novelty, aim, objectives and hypothesis of the study, as well as literature review, materials and methods, results, discussion, conclusions, recommendations, list of publications, references’ section and acknowledgements. Thesis is written on 111 pages with seven tables and 19 figures, and contains 229 references to literature sources. Results of this study are published in 10 papers and reported in 20 local and international conferences/congresses as oral or poster presentation.
13 1. LITERATURE
1.1. Myalgic encephalomyelitis/chronic fatigue syndrome and clinical signs
Myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS) is a complex disease that causes central nervous system and immune system disturbances, cell energy metabolisms and ion transport dysfunction, as well as cardiovascular problems, gastrointestinal dysfunction, cognitive impairment, myalgia, arthralgia, orthostatic intolerance, inflammation and innate immunity disturbances. The main clinical sign is persisting chronic fatigue, which is not relieved by rest and lasts for more than six months (Carruthers et al., 2011; Mensah et al., 2017). A part of patients is wheelchair dependent and many are housebound or even bedbound (Underhill, 2015). ME/CFS is sporadic with occasional outbreaks (Carruthers et al., 2003). Currently around 80% of ME/CFS cases are undiagnosed (Bested and Marshall, 2015). According to the literature data, already back in 2009 around 17 million people were diagnosed with this disease including 800,000 patients in the United States of America and 240,000 in the United Kingdom (Lorusso et al., 2009). Risk factors for ME/CFS are age 30 to 39 years, female gender, genetic predisposition, contact with other patients, stress, trauma, exposure to toxins, physical activity and rest ratio, as well as a recent history of infectious disease (Underhill, 2015). Nevertheless, ME/CFS can affect individuals from all races, genders, age groups and social statuses. Population studies show that prevalence of ME/CFS worldwide is from 0.76% of clinically diagnosed up to 3.48% of self-reported population depending on the applied diagnostic criteria. Most of the patients with ME/CFS suffer from long lasting symptoms, besides 6% of recovered patients after a longer period of time experience relapse of the disease (Bansal et al., 2012; Johnston et al., 2013). Symptoms of this disease are various, such as long lasting fatigue, memory loss, difficulty concentrating, sore throat, lymphadenopathy, muscle pain, headaches, un-refreshing sleep and extreme fatigue after exertion. The cause of ME/CFS is unknown and there are no standardized biological markers or tests for diagnostics, therefore existence of this medical diagnosis has been questioned for long time (Silverman et al., 2010). Currently ME/CFS diagnosis is based on clinical symptoms and differential diagnosis in order to exclude other objective medical or psychiatric causes of fatigue. In 1988 Holmes with his colleagues of the Centers for Disease Control and Prevention (CDC) developed ME/CFS definition to standardize patient population for research purposes. Fukuda et al. revised Holmes et al. 1988 definition in 1994 and it became the most widely used ME/CFS
14 diagnostic criteria. According to these criteria, ME/CFS is defined as a sudden clinically defined permanent or recurrent fatigue without previous manifestation, which is not consequence of ongoing exertion and is not relieved with resting. ME/CFS diagnosis is set up in case when a patient suffers from fatigue for at least six months and has persistent or relapsing four out of eight following symptoms: 1. Short-term memory impairment or major difficulty concentrating which results in significant reduction of professional, educational, social and individual activities. 2. Sore throat. 3. Sensitive neck or axillary lymph nodes. 4. Muscle pain. 5. Multiple joint pain without joint swelling or redness. 6. Standard or severe headache of a new type. 7. Un-refreshing sleep. 8. Post-exertion malaise lasting for more than 24 hours (Fukuda et al., 1994). During the following years, many new or revised definitions have been published. Post-exertion malaise as an important symptom is emphasized in 2003 developed Canadian criteria. These criteria include less cases with psychiatric symptomatic, though more with deterioration of physical function, severe fatigue and malaise, as well as neurological symptoms (Carruthers et al., 2003). International Consensus Panel (ICP) in 2011 developed International Consensus Criteria suggesting that this disease is to be defined as myalgic encephalomyelitis due to widespread inflammation and multi-systemic neuropathology (Carruthers et al., 2011). There is a number of ME/CFS diagnostic criteria since the first one was defined in 1988: 1. 1988 CDC definition. 2. 1990 Australian definition – modified 1988 definition that includes neuropsychiatric symptoms. 3. 1991 Oxford definition – includes fatigue and presence of infectious agent. 4. 1994 CDC definition – replaces the definition developed in 1988 and is used the most widespread. 5. 2003 Canadian Consensus Criteria – post-exertion malaise is considered as the most important symptom. 6. 2005 CDC empirical definition (Christley et al., 2010). 7. 2011 International Consensus Criteria created by ICP (Carruthers et al., 2011).
15 8. In 2015 the Institute of Medicine committee recommends using criteria for systemic exertion intolerance disease (SEID) (Committee on the Diagnostic Criteria for Myalgic Encephalomyelitis/Chronic Fatigue Syndrome et al., 2015). 9. In 2015 Maes publishes validation of Neuro-Inflammatory and Oxidative Fatigue (NIOF) case definition to replace the previously used ME/CFS (Maes, 2015). Inconsistence in the results of various studies is often consequences of a lack of single united ME/CFS diagnostic criteria usage. Differences in disease course, treatment efficiency and immune system indication levels are observed in patients with acute and graduate onset of the disease (Masuda et al., 2002). It is possible that by the time ME/CFS is diagnosed, it is too late to detect presence of a such potential trigger factor as virus, because it could have caused the disease and subsequently be eliminated. This is called “hit and run” mechanism, where the virus is detectable only during the onset phase of a disease, therefore it is important to diagnose ME/CFS as soon as possible (Morinet and Corruble, 2012). It is discussed that ME/CFS could be divided into subgroups. Defining subsets of ME/CFS with certain pathophysiological processes will allow developing an advanced case definition (Fischer et al., 2014). Observing natural killer (NK) cell function shows that patients form subgroups according to response to interferon (IFN)-α therapy (See and Tilles, 1996). Researcher Bansal from East London University suggests dividing ME/CFS patients into subgroups based on acute and graduate onset of symptoms, as well as with and without immune system disturbances, instead of grouping according to symptoms (Bansal et al., 2012). Identification of ME/CFS biomarkers will enable selection of effective therapy. Further improvement after treatment will serve as a proof of this biomarker causal or promoter role in the illness (Fischer et al., 2014).
1.2. ME/CFS diagnostics
ME/CFS diagnosis is based on clinical symptoms and differential diagnosis excluding other possible chronic fatigue causing diseases. There are no specific physiologic signs or diagnostic tests for ME/CFS diagnosis yet, therefore diagnosis is manly based on clinical symptoms (Fukuda et al., 1994). It has lately been reported that ME/CFS can be preliminary diagnosed already three months after the illness onset instead of six months (Bested and Marshall, 2015). Currently the best diagnostics option is to assess a patient according to ME/CFS diagnostic criteria, exclude other diseases that could cause symptoms and analyse presence of possible symptom causing agents. Standard tests are used to ascertain that chronic fatigue is not caused by any other factor. Differential diagnostics is used to exclude history of
16 Lyme disease, such autoimmune diseases as systemic lupus erythematosus, multiple sclerosis and rheumatoid arthritis, as well as depression, mental diseases, sleep disturbances, obesity, joint and muscle pain causes. Also hepatitis, anaemia, tumour, haemochromatosis, neuromuscular diseases, hypothyroidism, diabetes, anxiety, obstructive sleep apnoea and/or hypopnoea syndrome, alcohol and drugs that could be the cause of ME/CFS symptoms are ruled out (Avellaneda Fernandez et al., 2009; Morch et al., 2013). However, when diagnosing ME/CFS it should be taken into account that ME/CFS is reported to be accompanied by several co-morbidities, like fibromyalgia, orthostatic intolerance, migraine headache, allergies, multiple chemical sensitivity, intestinal cystitis, irritable bowel or bladder syndromes, Sjogren syndrome, thyroiditis, temporomandibular joint syndrome, prolapsed mitral valve and Raynaud’s phenomenon (Bested and Marshall, 2015). Nowadays many researchers are making efforts to find an objective biomarker for ME/CFS diagnostics. Gene expression analysis is used to study pathogenesis of this disease. It is demonstrated that gene expression level could be used for ME/CFS differential diagnostics because of altered expression of 88 genes. Expression of 85 genes is elevated while three genes expression level in patients with ME/CFS is reduced (Kerr et al., 2008). Lately an elevated level of transforming growth factor beta family protein activin B accompanied by normal levels of activin A and its binding protein - follistatin in serum allows to distinguish patients with ME/CFS from apparently healthy individuals (Lidbury et al., 2017).
1.3. Possible causes of ME/CFS
ME/CFS as other chronic diseases has been studied for many decades, though it still is an unclear and controversial syndrome (Jason et al., 2000). Heightened sensitivity to pain – hyperalgesia is observed in patients with ME/CFS. Pain threshold is three times lower in patients compared to control group individuals. Hyperalgesia indicates the involvement of central nervous system (CNS) in development of ME/CFS (Meeus et al., 2010). Whereas, debilitation by ME/CFS in 12 to 18 year-old adolescents is linked to fatigue, cognitive disturbances and hypersensitivity that is associated with changed autonomous cardiovascular control (Wyller and Helland, 2013). Autoantibodies are detected in patients with ME/CFS prompting to hypothesize autoimmunity as a possible reason for ME/CFS (Maes et al., 2012 b). Nevertheless, Glassford proposes neuroinflammatory etiopathology for ME/CFS with changes in nociceptive and neuroimmune activity that leads to increased nervous sensitivity and ME/CFS clinical
17 symptoms (Glassford, 2017). Also data are published on hereditary ME/CFS with higher risk to inherit this disease from the first, second and third degree relatives. Predisposition can be genetically inherited, though the involvement of viral infections, environmental factors, stress and traumas cannot be excluded as a potential cause of ME/CFS (Albright et al., 2011). Patients with ME/CFS also present oxidative stress associated lipid profile with higher level of triglycerides, malondialdehyde and protein carbonyl, and lower level of high-density lipoprotein cholesterol (Tomic et al., 2012). ME/CFS patient’s post-exertion characterizes severe oxidative stress, reduced NK cell and macrophage function, diminished lymphocyte mitogen response, immunoglobulin G (IgG) subclass – IgG1 and IgG3 deficiency, as well as reduced complement activity (Bassi et al., 2008). Current research shows evidence characteristic to post-infectious immune disturbances (Mensah et al., 2017). Literature data regarding commonly found viruses seropositivity in ME/CFS patients are varied. Inconsistency could be due to various virus antigens and diagnostics criteria used in serological studies (Bansal et al., 2012). Opportunistic infections with low virulence viruses or parasitic enterobacteria caused by changes in gut temperature lead to mitochondrial deterioration in brain neurons (Nishihara, 2012). Measurement of adenosine triphosphate in neutrophils and mitochondria indicates that there is a mitochondrial dysfunction, which correlates with severity of ME/CFS. Decreased mitochondrial function, high level of cell free DNA and low level of antioxidants is characteristic to patients with ME/CFS. Moreover, low mitochondrial function leads to the production of inflammatory mediators (Myhill et al., 2013). Studies show that immune disturbances have an important role in ME/CFS (Patarca-Montero, 2001; Stewart et al., 2003; Brenu et al., 2011). There are several reports on changes in the levels of cytokines and the results often are contradictory, what could be a consequence of methodological diversities, used diagnostic criteria, relapse or remission of the disease on time of observation, determination of stress level, physical activity, sleep disturbances and blood sample collection time of the day. Unfortunately, it is difficult to compare results obtained by different methods. It is assumed that immunomodulating therapy could improve clinical manifestations of ME/CFS (Bansal et al., 2012). The contact with other ME/CFS patients among patients affected by ME/CFS in sporadic cases is not registered. However, individuals affected during outbreaks are registered to be in close contact indicating on transmissible pathogen in ME/CFS that could be asymptomatic in some carriers (Underhill, 2015). ME/CFS is hypothesized to be a result of viral or bacterial infection. Investigation on association of this disease with such infectious agents as herpes simplex viruses (HSV) 1 and
18 2, varicella zoster virus (VZV), EBV, cytomegalovirus (CMV), HHV-6, HHV-7, HHV-8 and B19V has been ongoing for many years. Also polyomaviruses JC and BK, adenovirus, rubella virus, hepatitis C virus, XMRV, enteroviruses as coxsackie B virus, such bacteria as coxiella burnetii, borrelia, chlamydophila pneumonia and mycoplasma are studied (Nicolson et al., 2003; Appel et al., 2007; Lombardi et al., 2009; Zhang et al., 2010; Bansal et al., 2012). Innate immune systems subset is cytotoxic lymphocytes – NK cells, which receptors recognize virus infected and transformed cell ligands in early stages and can secrete cytokines that may interact with adaptive immune system cells (Odom et al., 2012; Mensah et al., 2017). Reduced NK cell cytotoxic activity in ME/CFS patients is widely detected in many studies. Decreased cytotoxic activity of NK cells could be linked to decreased expression of NK cell activating receptor NKG2D revealed by Hardcastle and co-workers (Hardcastle et al., 2015). Odom et al., describe interaction mechanisms of HHV with NK cell receptors and ligands for virus evasion in NK cells that could contribute to pathogenic mechanism of HHV-6 and HHV-7 in ME/CFS (Odom et al., 2012). NK cells also secrete cytokines, which activate other NK cells and cellular immune system. The cluster of differentiation (CD) 69 is one of the specific markers for early NK cell activation. Elevated NK and CD69 expression is associated with elevated cytotoxicity and cell lysis. NK cells have important role in the elimination of infected and transformed host cells, thereby reduced NK function can lead to chronic virus infection (Brenu et al., 2010). The analysis of T, B and NK cell phenotypes and function also shows skew in NK cell and poor T cell function, whereas compartments of B cells are similar between patients and donors. These researchers assume that these findings could be linked to a virus infection (Curriu et al., 2013). However, analysing immune cells of patients with moderate and severe ME/CFS with follow-up after six months, changes between groups are observed only after six months. Alterations are found in NK cell receptors, invariant natural killer T cell phenotype, γδ T cells and CD8+ T cell markers (Hardcastle et al., 2015). Immunological disturbances are considered as a component in ME/CFS because of the type of symptoms and changes in immune system, though it is still unclear, if these defects are a cause or consequence of ME/CFS. Stress, mood changes and sleep disturbances affect immune system and can induce immune system changes contributing to the development of severe or prolonged viral infection (Bansal et al., 2012). Symptoms and course of ME/CFS in outbreak and sporadic cases may develop into a chronic disease and suggests the involvement of persistent pathogen in ME/CFS (Underhill, 2015). However, there currently is no conclusive proof of the involvement of an infection in all patients with ME/CFS (Mensah et al., 2017).
19 1.4. ME/CFS associated infectious agents
ME/CFS starts suddenly with infectious-like symptoms and immune disturbances show characteristic response to pathogen with a failure to eliminate it (Underhill, 2015). Various microbial and viral infections are considered to be possible trigger factors of ME/CFS, including EBV, CMV, HHV-6, B19V, enteroviruses and such bacteria as Lyme disease causing borrelia and Q fever causing coxiella burnetii (Komaroff, 2006). Stress can reactivate viruses, like EBV, and various viral infections can cause fatigue (Glaser et al., 2005). Increment of stress can also induce relapse of the disease. Enteroviruses genomic sequences in stomach biopsy samples from patients with ME/CFS are detected (Chia et al., 2010). Mycoplasma infection is more frequent among patients with ME/CFS compared to healthy donors (Appel et al., 2007). Decrease in chronic fatigue is observed in patients with ME/CFS three to five years after an infection with giardia lamblia (Morch et al., 2013). Another study finds immunoglobulin M (IgM) and IgG class antibodies against B19V, EBV, enteroviruses and coxiella burnetii in patients with ME/CFS (Zhang et al., 2010). Serological findings of higher frequency of EBV and coxsackie B presence in patients than controls show immune disturbances that can lead to a viral reactivation (Mainan, 1994; Lerner et al., 2004). CMV specific IgM class antibodies against non-structural proteins are found in 16 out of 34 ME/CFS patients with CMV specific IgG class antibodies to envelope glycoproteins. None of 59 control group individuals has IgM class antibodies, but 44 have IgG class antibodies (Lerner et al., 2002). Researchers report on an elevated activity of antiviral enzyme 2'-5'-oligoadenylate synthetase (OAS) in mononuclear cells from patients with ME/CFS. This protein is induced by IFN-α and IFN-β, it degrades viral RNA and inhibits virus replication, therefore it is important in response against viral infections. The level of OAS correlates with severity of ME/CFS suggesting that a chronic virus infection could be the cause of ME/CFS (Nijs and Fremont, 2008). Meanwhile reports on herpesvirus and enterovirus serological and PCR detection are controversial, where only a part of studies shows an association with ME/CFS (Mainan, 1994). The detection of anti-HHV-6 IgM class antibodies and HHV-6 antigen in peripheral blood mononuclear cells (PBMC) culture represents HHV-6 reactivation and is frequently found in patients with ME/CFS. HHV-6 and HHV-7 reactivation is revealed in patients with ME/CFS, therefore ME/CFS could result from a latent herpesvirus reactivation (Chapenko et al., 2006; Krueger and Ablashi, 2006). In addition, active HHV-6, HHV-7 or B19V infection or co-infection could be a trigger factor for ME/CFS development (Chapenko et al., 2012). Other studies show that a virus reactivation could serve as an objective
20 biomarker for ME/CFS (Ablashi et al., 2000; Underhill, 2015). Meanwhile some researchers do not support a hypothesis of involvement of virus reactivation in pathogenesis of ME/CFS. Using enzyme-linked immunosorbent assay (ELISA) and PCRs they do not find statistically more anti-HHV-6, EBV and CMV antibodies as well as virus genomic sequences in patients compared to the donors. Cameron and colleagues have analysed 20 patients with ME/CFS and all are HHV-6 seropositive. Titers of IgG class antibodies are higher in case of primary infection, but do not differ between patients with ME/CFS and controls, though study cohort is rather small to draw general and statistically significant conclusions (Cameron et al., 2010). Others show no difference between severity of symptoms and viral load of HHV-6 and HHV-7 in DNA from saliva and PBMCs among patients and controls (Oakes et al., 2013). Serological data disclaim history of HSV-1 and 2, CMV, HHV-6 or human hepatitis C virus infection in 22 monozygotic twins in case of ME/CFS diagnosed in one of twins. Frequency of HSV, VZV, EBV, CMV, HHV-6, HHV-7, HHV-8, B19V, polyomaviruses JC and BK genomic sequences detected by PCR is not different in twins with ME/CFS and healthy twins (Koelle et al., 2002). Frequency of EBV in this study is lower than in general population (20% vs 80–90%, respectively) therefore results and methodology are rather uncertain (Bansal et al., 2012). A similar report was published before on 548 analysed patients with chronic fatigue (Buchwald et al., 1996). Burbelo with colleagues published findings of frequently detectable immunoreactivity with HHV-6B, but rarely with HHV-6A in patients with ME/CFS and healthy donors, though presence and level of virus-specific antibodies are similar between the groups (Burbelo et al., 2012) Many researchers are focused on possible association of ME/CFS with XMRV after Lombardi with colleagues in 2009 reported on detection of XMRV in 67% of patients with ME/CFS and 3.7% of control group individuals (Lombardi et al., 2009). One year later another research was published on detection of murine leukemia virus (MLV) related virus in patients with ME/CFS (Lo et al., 2010), while other researchers are unable to detect XMRV (Knox et al., 2011). Current research results tend to support the involvement of herpesviruses and enteroviruses in ME/CFS (Bansal et al., 2012). Although in some studies the association of ME/CFS with virus infection is not found, ME/CFS can be triggered by various factors and virus or other infections could form a subgroup of ME/CFS (Wallace et al., 1999; Cameron et al., 2010). Moreover, autoimmune, immune, metabolic and psychologic disturbances could emerge due to infectious disease (Underhill, 2015).
21 1.5. Role of xenotropic murine leukemia related virus in ME/CFS
XMRV is gammaretrovirus that belongs to Retroviridae family, Orthoretrovirinae subfamily and Gammaretrovirus genus. First, it was identified in 2006 while studying the lack of ribonuclease L coding antiviral gene RNASEL function in patients with prostate cancer (Urisman et al., 2006). XMRV contains a single stranded RNA genome that replicates with host cell DNA intermediate. The genome has 95% homology with several endogenous murine retroviruses and 94% – with exogenous murine retroviruses (Silverman et al., 2010). Polytropic mouse endogenous viruses (PMV) and modified-PMV share 95% sequence homology, whereas xenotropic and PMV – 90% homology (Singh, 2010). XMRV structure is characterized by C type gammaretrovirus morphology with polygonal core and around 100 nm diameter. Virus genome consists of 8185 nucleotides and virus particles are bounded by lipid bilayer. Virus has core proteins coded by gag gene, envelope proteins coded by env gene, three pol gene coded proteins (PRO ‒ protease, RT ‒ reverse transcriptase and IN ‒ integrase) and two RNA genomes (Urisman et al., 2006). XMRV have the same replication cycle as other orthoretroviruses, where an infection starts with a mature virus binding to the host cell receptor and env protein induced membrane fusion. After virus entry into cytoplasm, RNA to double stranded DNA molecule is copied using enzyme – reverse transcriptase. Likely, during mitosis DNA is transferred to nucleus, where incorporation into chromosomal DNA is catalysed by enzyme – integrase. After viral DNA is integrated into host DNA, it is called provirus. Then DNA is transcribed and RNA product is exported from the nucleus. In cytoplasm, a part of the molecules is translated to virus proteins and a part is encapsidated to form progeny virus particles. Budding virions are assembled in immature particles and subsequently protease cleaves virus polyproteins and a virus is mature and infectious (Rein, 2011). XPR1 is xenotropic and polytropic retrovirus receptor 1, multi-transmembrane-spanning protein, which is a cell surface receptor that defines infectivity of XMRV (Battini et al., 1999; Dong et al., 2007). The transmission route of XMRV is unclear, though other retroviruses use various body fluids (Groom and Bishop, 2012). XMRV is discovered in patients with prostate cancer and publications report potential association with other diseases. The observations of RNase L proteolysis in PBMCs from patients with ME/CFS and infectious-like chronic immune system activation led to examination of XMRV in these patients (Demettre et al., 2002; Lombardi et al., 2009). XMRV gag gene sequence is detected by nPCR in 67% out of 100 patients and 3.7% out of 218 healthy donors’ DNA from PBMC. Further analysing obtained results in Cleveland
22 Clinics, 99% sequence identity with XMRV is found by sequencing virus genomes from three patients. The presence of XMRV in this study cohort is confirmed by several methods. Presence of XMRV protein is detected by immunoblots in activated T and B cells isolated from PBMCs. In co-culture assays activated PBMCs and blood plasma from patients with ME/CFS is able to transfer XMRV to LNCaP cells, but this is not observed in donors’ samples. Besides, circulating antibodies against XMRV proteins are detected only in patients with ME/CFS and in none of control group individuals (Lombardi et al., 2009). In 2010, MLV-related virus gag gene sequence is amplified in 86.5% out of 37 patients and 6.8% out of 44 control group individuals, whereas env gene sequence – in one patient and one donor. Genetically distinct MLV-related virus group is defined by sequencing. Detected gag and env gene sequences in this study are more related to polytropic and modified polytropic MLV viruses (Lo et al., 2010). Later many researchers publish their efforts to detect XMRV in patients with ME/CFS and donors using serological and molecular biology methods. Tough no evidence is found in Germany, China, Sweden, the United Kingdom, Japan, the United States of America, Canada and the Netherlands (Hohn et al., 2010; Hong et al., 2010; Elfaitouri et al., 2011; Groom et al., 2010; Furuta et al., 2011; Satterfield et al., 2011; Steffen et al., 2011; van Kuppeveld et al., 2010). XMRV or MLV-related sequences, antibodies or infectious virus are not confirmed in large ME/CFS patient groups, including in the part of the patients from the first study by Lombardi and colleagues (Knox et al., 2011). Obscurity in detection of XMRV has some explanations. Commercial reagents and clinical samples could be contaminated with MLV-related virus genomic sequences containing murine DNA. Cloned or amplified XMRV DNA might be the source of contamination. It could also originate from frequently used XMRV-infected prostate cancer cell line 22Rv1 (Kearney et al., 2012). Various geographic localizations may explain differences in some results, but not in the same country. Another reason for problems with XMRV detection could be XMRV sequence variation or XMRV-like viruses. XMRV strain identity is 99%, therefore the existence of distinct or related viruses is possible and detection of them with PCR or some other methods can be difficult (Silverman et al., 2010). Considering that ME/CFS diagnostics is based on clinical symptoms and differential diagnostics, the diversity of results can be generated because of diagnostic criteria used in a particular study. Besides, limitations of standardized and very sensitive methods and broad availability of human positive controls for XMRV detection contribute to differences in study results. PCR method is very sensitive in terms of contamination, therefore it could fail to detect variations of XMRV (Silverman et al., 2010). On the contrary, false positive result can
23 be a consequence of technical divergence likewise in cross-reactive antibody tests (Groom et al., 2010). After several years of studies, large effort and expenses from clinicians, scientists and patients, it is concluded that there is no association between XMRV and human diseases, and positive results are consequences of contamination (Groom and Bishop, 2012). Publications of the findings of XMRV in patients with ME/CFS have been retracted in December 2011 and in 2012 (Alberts, 2011; Lo et al., 2012).
1.6. Involvement of human herpesvirus-6 and 7 in ME/CFS
HHV-6 and HHV-7 belong to Herpesviridae family, Beta-herpesvirinae subfamily, Roseolovirus genus (Roizman et al., 1981). HHV-6 was first isolated in 1986 from PBMCs of patients with acquired immunedeficiency syndrome (AIDS) and lympholeukosis (Salahuddin et al., 1986). HHV-7 was first isolated in 1990 from CD4+ lymphocytes of healthy adult (Frenkel et al., 1990). Primary infection with these viruses usually is observed in early childhood – from age of six months to three years. They can cause Roseola infantum or Exanthema subitum with fever, rashes and elevated body temperature lasting for three to five days. In addition, it can affect several organ systems, including CNS (Yamanishi et al., 1988). Likewise, infection course can be asymptomatic (Kondo et al., 1990). HHV-7 can also cause Exanthema subitum, though not always association of clinical signs with virus DNA detection is found (Magalhaes et al., 2011). HHV-6 A and B types are distinguished. From them the type A is more neurotropic and often isolated from patients with immunosuppression, but B is isolated from children with Exanthema subitum. Both virus types share 90% homology (Zuckerman et al., 1995). Since 2014, HHV-6A and HHV-6B have been defined as distinct viruses (Ablashi et al., 2014). These viruses consist of icosahedral capsid with 162 capsomeres and nucleus with 90–110 nm low-density core. 160–200 nm large virus particles are located in cytoplasmic vacuoles and extracellularly. They consist of 6.5% of double-stranded DNA, 70% of proteins, 20% of phospholipids and 1.6% of carbohydrates. Glycoproteins change antigenic cell surface of an infected cell providing binding of the virus to a cell. They have a major role in immune response and pathogenesis of infection (Campadelli-Fiume et al., 1999; De Bolle et al., 2005). HHV-6A genome is 159 kilobase pair (kbp), HHV-6B – 165 kbp and HHV-7 – 145 kbp long (Gompels et al., 1995; Megaw et al., 1998). During lytic replication, these viruses penetrate into the host cell, genomic DNA migrates to the nucleus, where during replication these viruses rely on host cell DNA
24 replication and transcription using RNA with following synthesis of gene products (Chisholm and Lopez, 2011). Herpesvirus gene transcription is defined in the infectious cycle. Alpha-genes are encoding immediate early proteins that activate beta-genes, which subsequently induce synthesis of gamma proteins encoded by gamma-genes (Mirandola et al., 1998). When nucleocapsid is formed, it binds to the tegument proteins and in cytoplasmic vacuoles gains envelope. During exocytosis, virions are released into extracellular space by vacuoles (De Bolle et al., 2005). Cell functions also can be modified expressing only a part of virus genes without the complete replication cycle (Agut et al., 2017). The main target cells for HHV-6 and HHV-7 are CD4+ T cells, though they can infect not only T lymphocytes, but also monocytes, macrophages, CD34+ bone marrow precursors cells, NK cells, dendritic and CNS oligodendrocyte cells (Krueger et al., 2003; Otani and Okuno, 2007). HHV-6 receptor CD46 is very common, therefore this virus has broad cell tropism and it can also infect astrocytes and epithelial cells (De Bolle et al., 2005; Komaroff, 2006). After infecting the cell, HHV-6 reduces the expression of infected and non-infected cell surface receptor CD46 (Santoro et al., 1999; Tang et al., 2013). Likewise, a significant reduction of HHV-7 receptor CD4 expression is observed six to nine days after HHV-7 infection. When infecting CD4+ T cells, the virus causes a decrease of CD4 antigen on cell surface (Furukawa et al., 1994). HHV-6 and HHV-7 are very widespread and prevalence is more than 90% of general population. Genetically these viruses share 20% up to 75% nucleotide sequence identity and virions have some common antigen epitopes (Ward, 2005; Caselli and Di Luca, 2007; Agut et al., 2017). The main infectious rout with these viruses is horizontal – via body fluids, e.g. blood and saliva. Primary infection with HHV-6B occurs when a child is six months to three years old, therefore most of the children have HHV-6B specific antibodies in the first year of their lives (Yanagi et al., 1990; Agut et al., 2017). Primary infection with HHV-6A and HHV-7 is observed later and HHV-7 specific antibodies are not detected in children before age of two (Wyatt et al., 1991; Agut et al., 2017). In 141 Brazilian children by age of four with rash disease Exanthema subitum, HHV-7 is detected by PCR only in 6.4% of children. Recent primary HHV-6 infection is observed in 41% of children, 48% have past HHV-6 infection and 11% of children have undetermined HHV-6 infection analysed by indirect immunofluorescence (Magalhaes et al., 2011). HHV-6 and HHV-7 are lymphotropic and immunomodulating viruses. Moreover, HHV-6 has also neurotropic properties. Following the primary infection, they can remain persistent in T lymphocytes, monocytes, bone marrow precursor cells, respiratory tract secretions and salivary glands. After reactivation, they can cause changes in immune system,
25 nervous system and other systems in organism (Campadelli-Fiume et al., 1999; Clark, 2000). These viruses can reactivate in case of immunosuppression and can be serious pathogens in immunocompromised individuals (Richman et al., 2002). Virus reactivation is possible in cases of immune disturbances, long-term stress, immunosuppressive therapy, prolonged anaesthesia, transplantation, AIDS and others (Yalcin et al., 1994). Virus can reactivate in the presence of malignant and non-malignant diseases, e.g. ME/CFS (Ablashi et al., 1991). HHV-6 can integrate into the host genome, therefore an infection can be transmitted not only in a horizontal, but also in a vertical route (Richman et al., 2002). Chromosomally integrated HHV-6 (ciHHV-6) is also capable of reactivation in host cells or these cells can be infected by exogenous HHV-6 strain. The production of late viral protein in both cases is associated with replication. During reactivation, the cells die through lytic virus replication or they are recognized by immune response resulting in chronic inflammation that causes symptoms (Montoya et al., 2012). In case of reactivated ciHHV-6 in mother, virus is transmitted transplacental to the descendant (Gravel et al., 2013). In case of ciHHV-6A, super-infection with HHV-6A or HHV-6B can result in reactivation of integrated virus (Tweedy et al., 2015). Prevalence of ciHHV-6 is 0.5% up to 1% of population (Geraudie et al., 2012; Gravel et al., 2015). Recently chromosomal integration of HHV-7 into the host genome was discovered, though no data on the prevalence is available yet (Prusty et al., 2017). Moreover, it is unclear whether viral integration into host chromosome telomeres can lead to disease clinical signs (Clark, 2016). However, presence of inherited ciHHV-6 as a risk factor to develop angina pectoris is reported (Gravel et al., 2015). Most of the herpesviruses use mechanisms that disturb first class major histocompatibility complex (MHC) molecules presenting virus antigen. Virus antigen presentation to cytotoxic T cells is interrupted by HHV-7 U21 gene product that leads first class MHC molecules to degradation in lysosomes. Besides host cytotoxic T cell response, virus infection induces ligand expression for NK cell activation by changing cytotoxic NK cells to identify and kill virus-infected cells (Schneider and Hudson, 2011). Herpesvirus infection was revealed in patients with ME/CFS already in 1988 (Komaroff, 1988). ME/CFS onset after the virus infection is confirmed by 50% of patients (Krueger and Ablashi, 2006). In 1994 Ablashi reports that ME/CFS could be a result of immunological disturbances after herpesvirus reactivation (Ablashi et al., 1994). Later the determination of HHV-6 and HHV-7 reactivation in patients with ME/CFS was confirmed (Sairenji et al., 1995). Virus reactivation can contribute to disease development and altered immune response. HHV-6 immunosuppressive effect on CD4+ lymphocytes involves the
26 suppression of IL-12 expression in dendritic cells. The infectious organism can promote abnormal immune response, though after its elimination immune system changes maintain and cause symptoms of ME/CFS (Krueger and Ablashi, 2006). The study shows detection of antibodies against HHV-6 early protein (p41/38) in 54% of patients with ME/CFS and 8% of control group individuals (Ablashi et al., 2000). Determining active HHV-6 replication by the detection of elevated level of IgM class antibodies against HHV-6 specific early antigen, other researchers mention etiological association of ME/CFS and HHV-6 infection. High level of HHV-6 specific IgM class antibodies is found in 57.1% of patients with ME/CFS and 16% of donors (Richman et al., 2002). Another group also shows higher HHV-6 specific IgM and IgG class antibody titers in ME/CFS patients’ blood serum compared to healthy persons (Krueger and Ablashi, 2006). However, the analysis of donor group from Argentina with nPCR revealed HHV-7 in 90% of DNA from blood plasma and in 100% of DNA from saliva. At the same study, HHV-6 genomic sequence is present in 6 out of 40 salivary DNA samples and in none of DNA from blood plasma (Biganzoli et al., 2010). In previous studies, HHV-7 reactivation was detected more often than HHV-6 reactivation in patients with ME/CFS. Such changes of immunological parameters as a decreased count of CD3+ and CD4+ T cells, an increase of CD95+ and a decrease of CD4+/CD8+ ratio are observed in patients with a concurrent active HHV-6 and HHV-7 infection (Chapenko et al., 2006). Other studies also show CD4+ T cell response to HHV-6. MHC tetramers with CD4+ epitopes can detect HHV-6 specific T cell populations. Furthermore, IFN-γ and IL-10 are declared to be sufficient markers for HHV-6 induced cell response (Nastke et al., 2012). The report has also been published on the association of HHV-6 and HHV-7 reactivation with levels of IL-12 and TNF-α, which are higher in the presence of active HHV-6 and HHV-7 infection compared to latent infection (Nora-Krukle et al., 2011). HHV-6A is linked more with aetiology and pathogenesis of ME/CFS and other CNS diseases, because it is determined in 70% of these cases, whereas HHV-6B more often is found in healthy donors. Active HHV-6 replication, which most probably is reactivation from a latent phase, is detected in 70% of patients with ME/CFS and 20% of controls using HHV-6 specific mononuclear antibodies and PCR (Krueger and Ablashi, 2006). HHV-6A is not detected in any of 200 donors, but HHV-6B is detected in 8% of DNA from whole blood, 16.5% of PBMC and 10.5% of polymorphonuclear leukocyte (PMNL) DNA. Average HHV-6B load in whole blood, PBMC and PMNL is low: 81, 62 and 34.5 copies per million cells, respectively. In one of the 200 donors HHV-6 load is 2 to 3 copies per one cell
27 indicating ciHHV-6. Though, HHV-7 is more prevalent among donors (51.5% in whole blood, 62% in PBMC and 51.5% in PMNL). Average HHV-7 load in whole blood is 129, in PBMC – 225 copies and in PMNL – 62 copies per million cells. This study concludes that the viral load in whole blood is sensitive and an adequate marker (Geraudie et al., 2012). Published studies report on increased HHV-6 and HHV-7 frequency and reactivation in ME/CFS patients, therefore a reactivation of these viruses could be used as an objective biomarker in ME/CFS diagnostics (Ablashi et al., 2000; Di Luca et al., 1995; Komaroff, 2006). Nevertheless, correlation between clinical, histological and laboratory findings must be found to fully understand processes of this disease (Chisholm and Lopez, 2011).
1.7. Involvement of human parvovirus B19V in ME/CFS
B19V is immunomodulating single stranded DNA virus belonging to Parvoviridae family, Parvovirinae subfamily, Erythrovirus genus. It was first discovered in 1975 in blood serum from an apparently healthy donor (Cossart et al., 1975). B19V genome contains linear single stranded 5596 nucleotides long molecule. The right side of the genome encodes structural proteins VP1 and VP2 that compose 95% of B19V virion and are targets for produced virus neutralizing antibodies (Ozawa et al., 1987; Deiss et al., 1990). The left side of the genome encodes non-structural proteins – NS that participate in the production of an infectious virus by participating in transcription regulation, replication and formation of virion capsid (Momoeda et al., 1994). After entry into the cell, B19V migrates to nucleus, where messenger RNA (mRNA) transcription and DNA replication is processed (Richman et al., 2002). Positive and negative DNA strands are encapsidated and assembled virions via cell lysis are released (Green et al., 2000). B19V mainly replicates in primary target cells – erythroblasts, which are erythrocyte progenitor cells in bone marrow (Morey et al., 1993). B19V receptor – globoside is blood group P antigen, which is expressed not only on erythroblasts, but also on megakaryocytes, heart, liver, lung, kidney tissue cells, endothelial, gastro-intestinal smooth muscle and synovial cells (Brown et al., 1993; Soderlund-Venermo et al., 2002). α5β and Ku80 are reported as B19V co-receptors (Luo and Qui, 2015). First B19V was associated with a human disease in 1981 (Pattison et al., 1981). It was the only parvovirus associated with human diseases until 2005, when a new parvovirus – human bocavirus was discovered in Sweden (Allander et al., 2005). B19V frequently is detected in children, therefore 60–80% of adults have antibodies against this virus (Brown et al., 1993; Cooling et al., 1995). B19V can cause rash, erythema infectiosum
28 or the fifth disease, arthralgia, various skin lesions, neutropenia, liver and lung disorders, papular-purpuric gloves and socks syndrome, hepato-biliary diseases, cardiac syndromes, autoimmune and neurological diseases, transient aplastic crisis with a short life-span and aplasia of red blood cell that is observed in immunocompromised patients (Kerr, 2000; Kerr, 2016). Interestingly that B19V genomic sequence was not detected in none of 141 children by age of four with Exanthema rash disease (Magalhaes et al., 2011). Most of B19V infections worldwide are caused by B19V genotype 1. Genotypes 2 and 3 have > 10% nucleotide divergence from genotype 1. A higher frequency of genotype 2 has been observed among European individuals born before 1970s. However, genotype 3 circulates in French, Brazilian and Ghana individuals (Corcoran et al., 2010). The production of virus-specific antibodies represents protection against B19V. Treatment of B19V infection consists of intravenous human normal immunoglobulin that can eliminate a virus from peripheral blood, thereby improving clinical signs in an immunosuppressed individual. However, in some cases this treatment is not effective (Kurtzman et al., 1989; Schwarz et al., 1990; Attard et al., 2015). Viral DNA is eliminated from blood serum within four to five months and a level of antibodies is rapidly decreased. Many years after the primary infection and acute phase B19V can remain persistent in organism and its association with different clinical manifestations has been studied, including encephalitis, encephalopathy, arthritis, autoimmune processes, fatigue and myalgic encephalomyelitis (Kerr and Tyrrell, 2003; Barah et al., 2014). Viruses are considered as possible triggers of ME/CFS (Appel et al., 2007). Analysing the presence of B19V markers in 200 ME/CFS patients diagnosed according to Fukuda 1994 criteria and 200 healthy blood donors using real-time PCR B19V DNA is detected in 11 patients with ME/CFS and none of donors. A significant difference is not revealed in B19V seroprevalence (a proportion of individuals with presence of IgG class antibodies) between patients with ME/CFS and donors. Anti-B19V VP2 IgG class antibodies have 75% of patients and 78% of controls. Anti-B19V VP2 IgM class antibodies are observed in four patients. In addition, 41.5% of patients and only 7% of donors have IgG class antibodies against NS1 protein that is associated with high expression of NHLH1 and GABPA genes, which are linked with ME/CFS. B19V specific NS1 IgM class antibodies are found in three patients and one donor. The presence of B19V specific NS1 antibodies indicate a severe and persistent or chronic B19V infection, thereby immune system of a part of the patients cannot sufficiently control the virus (Kerr et al., 2010). Other report shows findings of IgG class antibodies in 74% and IgM – in one of the analysed patients with ME/CFS.
29 B19V seroprevalence among ME/CFS patients is similar to the percentage in general population (Zhang et al., 2010). Studies suggest that B19V could be one of the trigger factors in at least part of the patients with ME/CFS (Fremont et al., 2009).
1.8. Potential development mechanisms of ME/CFS
HHV-6A, HHV-6B, HHV-7 and B19V are hypothetical candidates involved in ME/CFS pathogenesis (Morinet and Corruble, 2012). After primary infection, some viruses are not eliminated from organism but remain in specific organism cells in persistent form and replicate in low level without damaging the host cell. Persistent infection includes latent and productive infection phases. Viral replication is completely stopped in case of latent infection phase, though virus genome remains in the cells and various factors can contribute to virus reactivation (Traylen et al., 2011). Stress and cell-mediated immunity disturbances can lead to more severe ME/CFS symptoms and virus reactivation from a latent phase (Glaser and Kiecolt-Glaser, 1998). Changes in ME/CFS patients’ cytokine profile support reports on a viral infection and reactivation. Immunological effect of persistent herpesvirus infection does not require DNA synthesis, therefore, it can be important in case of ME/CFS (Fletcher et al., 2009). Persistent virus infection as a potential cause of ME/CFS is supported by data showing the effect of a chronic virus infection (Broderick et al., 2010). Viruses can affect organism directly and indirectly. HHV-6 and HHV-7 infect cells, which are involved in mediation of cell and humoral immune response. By indirect interaction these viruses change cell surface receptor expression, pro-inflammatory and anti-inflammatory cytokine and chemokine expression level, leading to local inflammation. Molecular mimicry is one of the indirect interaction basic mechanisms. Autoimmune response is caused by mimicking cell proteins. One of HHV-6 cell membrane protein has 10 amino acid sequence homology with myelin base protein, therefore autoimmune process is based on low level HHV-6 protein expression on cell surface leading to degeneration of myelin sheath (Tejada-Simon et al., 2003). In vitro studies show that one of possible B19V action mechanisms is direct virus interaction with cells leading to a more aggressive fibroblast function and degradation of cartilage matrix. The activity of capsid protein VP1 affects arachidonic acid metabolism promoting inflammatory reactions. Moreover, B19V non-structural NS1 protein also
30 stimulates such pro-inflammatory cytokines as IL-6 and TNF-α production causing local inflammation (Kerr et al., 2001). Stimulated lymphoid cells express or induce expression of heterogeneous group of soluble mediators in other cells. These are cytokines, hormones and neurotransmitters with effector or regulatory function that can be basis for pathological manifestations (Patarca et al., 1995). T-helper (Th)1, Th2, Th17 and regulatory T cells are adaptive immune systems CD4+ T cell subpopulations that regulate cytokine secretion and inflammatory immune response. Th1 and Th17 immune response is associated with the development of autoimmune diseases, but an increase of Th2 cytokine level shows the presence of other systemic disorder (Drulovic et al., 2009; Nevala et al., 2009). Stimulated T cells are divided into Th1 and Th2 – based on the produced cytokine ability to help macrophage and NK cell or B cell function, respectively (Patarca, 2001). IL-2, IL-12, IL-15, IL-23, interferon (IFN)-γ and TNF-α belong to Th1 type cytokines, whereas Th2 cytokines are IL-4, IL-5, IL-6 and IL-10 (Fletcher et al., 2009; Zhu and Paul, 2008). Soluble proteins have inflammatory or anti-inflammatory function (Brenu et al., 2011). Inflammatory or pro-inflammatory cytokines are IL-1α, IL-1β, IL-6, TNF-α, LT(lymphotoxin)-α whereas IL-10 and IL-13 belong to anti-inflammatory cytokines (Fletcher et al., 2009). Monocytes, fibroblasts and endothelial cells can produce IL-6 induced by other cytokines, viral infection or lipopolysaccharides, whereas normal cells do not produce IL-6. T cells and macrophages produce IL-6 to stimulate immune response upon infection and trauma. Pleotropic IL-6 regulates immune and acute phase response, as well as haematopoiesis and host defence mechanisms. IL-6 has various functions and depending on a target cell type, it can contribute to growth induction or inhibition and differentiation (Patarca-Montero et al., 2001; Pier et al., 2004). Macrophages, activated T, NK and mast cells can produce TNF-α, which modulates immune response after stimulus from an infectious agent or trauma. It can activate neutrophils, polyclonal B cells and destroy tumour cells. TNF-α is secreted by activated lymphoid cells and is involved in systemic inflammation (Patarca, 2001; Pier et al., 2004). Phagocytes, B cells and other antigen-presenting cells produce IL-12 early after an infection as an inflammatory response mechanism against infections. It mediates a cell-mediated immune function and induces other cytokine production, like IFN-γ by T cells and NK cells, is a growth factor, and a cytotoxic activity enhancer. IL-12 also links to innate and adaptive immune responses and participates in the generation of Th1 cells (Trinchieri, 1995).
31 Activated T cells and mast cells synthesize IL-4. It is a growth factor of lymphoid cells (B cells, T cells and cytotoxic T cells) and is involved in B cell differentiation and production of antibodies to control immune response against antigen. Allergic and autoimmune diseases are linked with IL-4 expression (Patarca, 2001; Pier et al., 2004). IL-10 is expressed by Th2 lymphocytes, inhibits Th1 synthesised cytokines and regulates the function of lymphoid and myeloid cells. It can suppress macrophage, T and NK cell functions by deactivating synthesis of monocyte/macrophage inflammatory cytokines. IL-10 also can regulate proliferation and differentiation of B cells, thymocytes and mast cells (Brandtzaeg et al., 1996). In patients with ME/CFS immune system dysfunction is identified. Their immunity is broadly studied, though reports on lymphocyte count and cytokine expression in various studies are discrepant (Brenu et al., 2011). No difference has been observed in mitogen induced cytokine production, T cell proliferation in vitro or leukocyte subpopulation counts comparing immunological changes between severe fatigued patients and non-fatigued individuals. However, seasonal changes influence cytokine production and cell count. ME/CFS patients’ immunological profile differs from severe fatigued and non-fatigued individuals. ME/CFS patients have an elevated anti-inflammatory cytokine (IL-10, decreased IFN-γ/IL-10 ratio) level and a reduced inflammatory cytokine (IL-6, TNF-α) level all year long. Although symptoms between the groups are similar, ME/CFS patients experience changes in cytokine expression with tendency to elevated levels of anti-inflammatory cytokines (Ter Wolbeek et al., 2007). Other study publishes findings of significantly higher level of IL-1, TNF-α, neopterin and lysozyme in serum as well as plasma polymorphonuclear neutrophil elastase in patients with ME/CFS compared to the donors. Elevated levels of IL-1 and TNF-α correlate with fatigue, sadness, autonomic symptoms and malaise, whereas a high level of polymorphonuclear neutrophil elastase correlates with concentration and memory problems, as well as past infection. ME/CFS is accompanied by low-level inflammation and activation of cell-mediated immunity (Maes et al., 2012). The published analysis of cytokine panel in this complex disease shows the dominance of Th2 anti-inflammatory cytokines and a decrease in Th1 cytokine levels (Broderick et al., 2010). Further, lipopolysaccharide induced cytokine production in whole blood culture shows a significant increase in level of IL-10 and a decrease in level of IL-12. IL-10 and IL-12 levels inversely correlate with a serum cortisol level in the group of apparently healthy individuals but patients with ME/CFS have no such IL-10 correlation presenting disturbances in glucocorticoid regulation of IL-10 (Visser et al., 2001).
32 It is observed that ME/CFS patients with better stress management ability have a lower grade of fatigue, emotional suffer, a higher decrease of daily cortisol level and a lower level of IL-2. The impact of stress management to suffering and fatigue is higher in patients with an elevated level of IL-6 (Lattie et al., 2012). Cytokine level fluctuations are observed during the day. Analysing changes of cytokine level during the night, it is shown that ME/CFS patients without fibromyalgia had a significantly higher level of IL-10 than patients with fibromyalgia or healthy donors. Levels of IL-4 and TNF-α are similar between patients and donors, though a number of analysed individuals in this study is small (Nakamura et al., 2010). Patients with ME/CFS often experience symptom flare after exertion. Patients and control group individuals have a similar level of cytokine before exertion. Level of IL-1β, IL-6, IL-8, IL-10, IL-12 and IL-13 increases eight hours after exertion in patients with severe symptom flare, but patients with low-grade symptom flare level of IL-10, IL-13 and CD40L decreases. Level of IL-10, TNF-α and CD40L decreases in control group. The controversial study results could be originated from the differences in level of cytokines depending on symptom flare (White et al., 2010). Hornig with co-workers finds differences in immune profiles regarding the duration of ME/CFS. Patients suffering from ME/CFS for less than three years have a lower level of CD40L and elevated IFN-γ comparing to ME/CFS patients suffering for more than three years and controls (Hornig et al., 2015). In patients with ME/CFS immunological disturbances and damaged immune homeostasis is reported. The published study suggests using IL-10, TNF-α, IFN-γ, NK cell activity and phenotype as well as CD8+ T cell activity as biomarkers for ME/CFS. They show differences in CD4+ T cell Th1 and Th2 cytokine levels between patients and donors. Patients with ME/CFS have significantly higher levels of anti-inflammatory IL-10 and inflammatory IFN-γ and TNF-α expression comparing to control group individuals. IL-2 and IL-6 level is also higher in patients with ME/CFS, though a difference is not statistically proved. An increase in IL-10 level indicates a persistent chronic infection (Brenu et al., 2011). Likewise, not only an elevated level of IL-10, but also IFN-γ and TNF-α indicates on a viral, bacterial or fungal infection (Couper et al., 2008). The increased level of these cytokines can correlate with a higher viral load and presence of flu-like symptoms (Brenu et al., 2011). A large study analysed 16 different cytokines in blood plasma to evaluate them as potential ME/CFS biomarkers. Comparing to control group individuals, patients with ME/CFS have elevated levels of LT-α, IL-1-α, IL-1-β, IL-4, IL-5, IL-6, IL-12 and decreased levels of IL-8, IL-13, IL-15. No difference is revealed in levels of TNF-α, IFN-γ, IL-2, IL-10, IL-17 and IL-23 between ME/CFS patients and a control group. This study concludes that
33 IL-5, IL-4 and IL-12 have a high biomarker potential. Also IL-6, IL-15, IL-8, IL-13, IL-1-α and IL-1-β have a good biomarker potential (Fletcher et al., 2009). A certain pattern leads to sequential cytokine expression instead of independent expression, therefore Broderick with his group examining expression of 16 various cytokines in patients with post-mononucleosis chronic fatigue declare that at least five different cytokines must be measured to distinguish ME/CFS cases from controls. Only levels of IL-8 and IL-23 have been significantly different between patients and controls in this study (Broderick et al., 2012). Another study of 16 different cytokines (15 cytokines the same as in Broderick et al., 2012) reveals an increased level of IL-1α and IL-8 with a decreased level of IL-6 in patients with early course of ME/CFS compared to the donors. Whereas, an opposite tendency in patients with long illness duration depicting ME/CFS progression has been observed (Russell et al., 2016). Similar levels of IL-10 are found in 15 patients with ME/CFS and 14 donors – 64 and 44 pg/ml, respectively. Level of TNF-α is 474 and 799 pg/ml in patients and donors, respectively. These researchers conclude that neuroendocrine immune communication disturbances develop from psychological emotional experience and an accelerating factor, such as virus infection (Kavelaars et al., 2000). Mensah et al., suggests slight elevation of pro-inflammatory cytokine level with impaired cellular immunity, particularly NK cell (Mensah et al., 2017). Immune dysfunction can cause ME/CFS symptoms and some of patients have immune response defects (Bansal et al., 2012).
1.9. ME/CFS treatment strategies
Currently there is no unique treatment for ME/CFS, though early action and appropriate treatment strategy can reduce severity of symptoms. Cognitive behavioural therapy (CBT) is often used, although it has been ineffective for many patients because of undefined and scattered subgroups of the disease. Identification of ME/CFS subgroups would promote the development of more effective treatment approaches (Sanders and Korf, 2008). It is important that using CBT for mental health is possible to relieve symptoms in patients who cannot be treated with other medical therapies (Friedberg, 2010). CBT is a powerful tool for depression and anxiety management that was developed as a therapeutic intervention in mental diseases. This intervention is based on changing the way of thinking and behaving in order to improve physical and mental health. Immunodeficiency, sleep disturbances, neuroendocrine disorders and other symptoms are necessary to treat in patients with ME/CFS
34 (Williams, 2003). Analysing psychological, diet and combined approach for ME/CFS management, an effect on symptom severity, fatigue and behavioural control is revealed. Improvement of psychic and social functions after three months of treatment is reported (Arroll and Howard, 2012). Most treatment methods are based on optimal diet, sufficient and qualitative sleep, food supplement uptake and balanced ratio between work and rest (Myhill et al., 2013). Several drugs are not effective for long time therefore non-pharmacological therapy for ME/CFS treatment is developed. It includes a combination of previously mentioned CBT with complex of exercise, optimal diet, sleep hygiene, small dose of tricyclic antidepressants and/or selective serotonin reuptake inhibitors with synergic effect. Patients’ quality of life can be improved as well as intensity and frequency of disease exacerbation decreased by solving or decreasing symptoms of allergy and stress. The therapy consisting of medical, psychiatric and CBT shows effectiveness, moreover physical improvement is observed in patients to whom CBT is applied (Craig and Kakumaku, 2002; Clauw, 2003). Such primary care treatment as pragmatic rehabilitation with personalized activity program, improved sleep hygiene and private consultations was compared with regular treatment by a general practitioner. They concluded that lower costs and successful improvement of patients’ health are obtained using regular therapy for ME/CFS treatment (Richardson et al., 2013). Also graded exercise therapy, pragmatic rehabilitation, adaptive pacing and combination of several therapies are reviewed to assess improvement of patients’ activity and behaviour (Castro-Marrero et al., 2017). Virus infection is a possible trigger for ME/CFS, therefore infectious disease specialists at Stanford University used antiviral therapy and observed significant health improvement in 75% of patients from whom many have had ME/CFS for more than 10 years. In the study, levels of HHV-6 and EBV antibodies have decreased in 75% of patients with ME/CFS after treatment with antivirals. However, many physicians avoid using strong antiviral therapy without confirmed presence of an active infection phase. Antibody titer can remain elevated for long time after primary infection, which can be mistaken as a marker for an active infection. Considering that up to 97% of population have a primary HHV-6 infection by age of two, adults can have an elevated level of antibodies in case of an active infection (Kogelnik et al., 2006). In another study, amelioration of fatigue and mood is observed after treatment with anti-TNF-α drugs (Choy and Panayi, 2001). Furthermore, 29% of patients with ME/CFS and 13% of control group individuals receiving placebo treatment experience 50% relief of pain using medication pregabalin. Patients treated with dexamfetamine are experiencing lower
35 levels of fatigue. Using monoamine oxidase inhibitor – moclobemide increment of energy and vitality has 51% of patients and 33% of placebo receivers, although mood improvement and pain relief is not detected. These studies show that treatment with drugs is ineffective in many patients, whereas some show improvements receiving placebo (Clauw, 2003). Physical and cognitive functions are increased by 19% and 23% after treating HHV-6/EBV seropositive ME/CFS patients with valganciclovir. Although antibody titers did not change significantly, improvement was observed after extended time of treatment (Watt et al., 2012). Another report is published about siblings with ciHHV-6 and debilitating CNS dysfunction. During the symptom flare viral load in whole blood DNA is higher than 5.5 log10 copies/ml and in cerebrospinal fluid DNA – 100 to 600 copies/ml. Detection of 1000 copies/ml of late mRNA in blood serum indicate on virus replication. The viral load was diminished to less than 0.5 log10 copies/ml using antiviral therapy. Clinical and virology analysis correlate with valganciclovir and foscarnet treatment, which are DNA polymerase inhibitors against HHV-6 replication in vitro and in vivo. Suppression of virus lytic activity can interrupt clinical symptoms, though currently there is no identified specific cell type, which is involved in lytic activation. Parent from whom ciHHV-6 was inherited is 64 years old, apparently healthy, and patient’s brother is apparently healthy too. Silencing of affected gene alleles potentially could protect apparently healthy individuals with ciHHV-6 from the expression of the disease (Montoya et al., 2012). Adolescents have better prognosis for recovery and most of the patients can expect improvement after long period of treatment, though full recovery is very rare (Wyller, 2007). The recovery is reported among ME/CFS patients and a greater opportunity is expected using combination of CBT with graded exercise therapy (White et al., 2013). Recent review on the treatment and management of ME/CFS describes several currently used treatment strategies. Pharmacological therapy includes pain relievers, nonsteroidal anti-inflammatory drugs, inflammation-promoting enzyme (COX-2) inhibitors and various antidepressants. Therapy is available of such antivirals and immunomodulators as interferon inducing rintatolimod, nucleotide analogue inhibitors – acyclovir, gancyclovir and valgancyclovir that inhibits virus replication, interferon-α and immunoglobulin levels (Castro-Marrero et al., 2017). Antiviral treatment in patients with severe clinical symptoms is used. Aciclovir and valaciclovir are not effective at low concentrations, whereas ganciclovir and cidofovir pass phosphorylation steps, but foscarnet directly inhibits replication (Agut et al., 2017). Randomised controlled trials on corticosteroids and hormones are also reported and staphylococcal toxoid vaccine for management of ME/CFS symptoms. Lately faecal
36 microbiota transplantation has shown promising results with significant improvement in treated patients. Various vitamins, food supplements, antioxidants, reduced nicotinamide adenine dinucleotide NADH and coenzyme Q10 in ME/CFS are used (Castro-Marrero et al., 2017). The latest therapy includes B cell depleting rituximab – chimeric monoclonal antibody against B cell expressed marker CD20, which is not found on plasma cells. Rituximab can reduce autoantibodies and virus infected B cells. Improvement in 64% of ME/CFS patients after a long-term treatment (mean 105 weeks) is reported and some respond only after seven months (Fluge et al., 2015). Still there is no single effective treatment for this disease (Castro-Marrero et al., 2017).
37 2. MATERIAL AND METHODS
2.1. Patients and biological material
The study was done in accordance with safety and ethical standards, as well as laws and requirements of the Republic of Latvia and the European Union. The cohort was established with the approval of the Ethics Committee of Rīga Stradiņš University issued on September 27, 2012. All enrolled patients gave their informed consent prior to the study. Two hundred patients [130 (65%) female and 70 (35%) male, mean age 38 ± 12] with clinically diagnosed ME/CFS corresponding to 1994 Fukuda Centers for Disease Control and Prevention criteria were included in this cross-sectional study. For clinical ME/CFS diagnosis in Latvia according to International Statistical Classification of Diseases and Related Health Problems (ICD-10), G93.3 – postviral fatigue syndrome (benign myalgic encephalomyelitis), R53 – fatigue and weakness and B94.8 – consequences of other defined infectious and parasitic diseases were used. Criteria for ME/CFS patients to be included in the study were the following: 1. Fatigue lasting at least for six months. 2. At least four out of eight following criteria: post-exertional malaise-marked, rapid physical and/or cognitive fatigability in response to physical exertion with prolonged recovery period taking 24 hours or longer; impaired memory and concentration; un-refreshing sleep; muscle pain; multi-joint pain; tender lymph nodes; sore throat; headache. 3. Each patient’s consent to be enrolled in the study. Exclusion criteria: 1. Anaemia (Fe, B12 deficiency). 2. Cancer in the past, radiation therapy, chemotherapy. 3. Radiation exposure. 4. Pregnancy and postpartum period within 1st year.
38 5. Endocrine disorders, including, diabetes mellitus, thyroid and adrenal diseases. 6. Orthostatic hypotension. 7. Cardiac disorders (congestive heart failure, endocarditis, arrhythmias). 8. Renal disorders (uraemia, electrolyte disturbance). 9. Hepatic disorders (hepatitis, cirrhosis). 10. Connective tissue diseases. 11. Myopathy, myositis, peripheral neuropathies. 12. CNS diseases with motor, sensory, cognitive and mental impairment (stroke, multiple sclerosis, traumatic brain injury, moto-neuron diseases, etc.). 13. Infectious diseases (Lyme disease, EBV, CMV, HIV). 14. Trauma. 15. Toxic substance influence (including alcohol, drugs). 16. Psycho-organic diseases (depression, affective and neurotic conditions). As a control group 150 age and gender matched apparently healthy individuals (blood donors) were enrolled in this study. Samples were collected from the Riga East University Hospital Latvian Centre of Infectious Diseases, RSU Health Centre “Ambulance”, Pauls Stradiņš Clinical University Hospital Neurology clinic and Latvia State Blood Donor centre. Blood samples were collected in vacutainers with ethylenediaminetetraacetic acid – EDTA, transported to A.Kirchenstein Institute of Microbiology and virology laboratory, where aliquots of whole blood samples for DNA extraction were prepared and stored in −70°C. Blood plasma for DNA extraction and immunological analysis was separated with centrifugation, aliquoted and stored in −70°C. PBMCs were separated with Ficoll by density gradient centrifugation and aliquoted. PBMCs for RNA extraction were stored in Tri Reagent at −70°C temperature, whereas PBMCs for indirect immunofluorescence – in growth medium in liquid nitrogen.
2.2. Molecular methods
Potential extraction and PCR cross-contamination were prevented, processing samples in separate rooms for DNA and RNA extraction, PCR setup and electrophoresis. Pipette tips with filters were used for aerosol spread protection. Multiple negative controls (DNA without target genomic sequence in each PCR and water control after every third sample) were included in each assay.
39 2.2.1. DNA isolation
To extract DNA from 0.5 ml of peripheral blood, 1 ml of lysis buffer [1M Tris HCl
(pH 7.6), 2M MgCl2, 4M NaCl] was added, samples mixed and centrifuged at 10000 rpm for 3 min to precipitate the cells. Supernatant was removed, 1 ml of 3X distilled water was added and centrifuged as before. Then supernatant was repeatedly removed and for cell lysis 80 μl proteinase K buffer [NaCl – 5.85 g, 0.5M EDTA], 20 μl 20% sodium dodecyl sulphate (SDS) for leukocyte membrane disruption, as well as 15 μl proteinase K and 3X distilled water up to 0.5 ml was added. The sample was mixed and ~ 4 hours in 55°C temperature incubated. DNA was extracted from peripheral blood by phenol-chloroform extraction method. To previously prepared sample, 0.5 ml phenol was added, for 6 min mixed and centrifuged at 10000 rpm for 10 min. Then 250 μl of phenol and 250 μl of chloroform were added to supernatant, mixed and centrifuged as previously. 0.5 ml of chloroform was added to supernatant, mixed and centrifuged again. To precipitate DNA 1 ml 96% ice-cold ethanol was added to the sample, centrifuged at 14000 rpm for 15 min in +4°C temperature and the supernatant removed. Then DNA was washed with 1 ml 70% ice-cold ethanol, centrifuged as before and the supernatant removed. DNA pellet was air-dried, dissolved in 3X distilled water and stored overnight at +4°C, and for a longer period at −80°C temperature. Blood plasma samples were treated with Deoxyribonuclease I (DNase I), RNase-free reagent to remove possible impurities of cell DNA. DNA from 200 μl cell-free blood plasma was extracted using QIAamp DNA Blood Kit, (Qiagen GmbH, Germany) according to manufacturer’s instruction and stored overnight at +4ºC, and for a longer period at −80°C temperature.
2.2.2. RNA isolation
RNA from frozen PBMCs was extracted with 500 µl Tri Reagent (Applied Biosystems, USA) for cell lysis. 200 µl of chloroform was added, mixed for 15 s, incubated for 15 min at room temperature and centrifuged at 12000 g for 15 min at +4°C temperature. The supernatant was transferred to a new tube, 250 µl isopropanol added, mixed, incubated for 10 min at room temperature and centrifuged at 12000 g for 8 min at +4°C temperature. RNA pellet was washed with 1 ml 75% ethanol, centrifuged at 7500 g for 5 min at +4°C temperature. Ethanol was removed and RNA air-dried for 3 – 5 min, dissolved in DEPC-treated water and stored at −80°C temperature.
40 The presence of RNA was analysed electrophoretically in 1% agarose gel with 10x NorthernMax-Gly Gel Prep/Running Buffer and visualized using UVP BioSpectrum MultiSpectral Imaging System (United Kingdom).
2.2.3. Nucleic acid quantity analysis
Concentration of extracted DNA and RNA was measured spectrophotometrically with “NanoDrop” spectrophotometer. According to manufacturer’s instruction nucleic acid concentration was determined at 260 nm wavelength with program ND1000. The obtained concentration units were ng/μl – nanograms per microliter. Nucleic acid purity was assessed by ratio 260/280 that is around 1.8 for pure DNA and ~ 2 for pure RNA.
2.2.4. Complementary DNA synthesis
Complementary DNA (cDNA) was synthesized with reverse transcription (RT) using commercially available RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific,
USA). In a sterile tube 0.1 ng – 5 µg of total RNA, 1 µl oligo (dT)18 primer and nuclease free water up to 12 µl was mixed, centrifuged, incubated at 65°C temperature for 5 min and chilled on ice. Following reagents were added to the sample: 4 µl 5× Reaction Buffer; 1 µl RiboLock RNase Inhibitor (20 u/µl); 2 µl 10 mM dNTP Mix; 1 µl RevertAid M-MuLV Reverse Transcriptase (200 u/µl). The sample was mixed, centrifuged and incubated at 42°C for 60 min. Synthesis reaction was terminated at 70°C for 5 min. Aliquots were stored at −70°C temperature.
2.2.5. DNA and cDNA quality analysis
To assure the quality of cDNA and DNA from peripheral blood and exclude possible contamination of plasma DNA by cellular DNA, PCR was carried out to detect β-globin gene sequence according to Vandamme et al., 1995 with following primers: GS268 5’- ACACAACTGTGTTCACTAGC-3’ and GS269 5’-TGGTCTCCTTAAACCTGTCTTG-3’. Peripheral blood DNA and cDNA were considered as qualitative if 200 bp products were acquired by PCR. Negative β-globin PCR result in plasma DNA samples indicated on pure DNA (without cell DNA contamination), though obtaining 200 bp product from plasma
41 DNA was considered invalid for virus-specific genome sequence analysis and repeated DNA extraction was carried out. Components for 25 µl PCR amplification mix for one sample: 2.5 µl 10× Taq PCR buffer +KCl-MgCl2; 2 µl 25 mM MgCl2; 0.5 µl 10 mM dNTP; 0.1 µl 100 µM GS268 primer; 0.1 µl 100 µM GS269 primer; 0.1 µl 5U/µl Taq polymerase; 17.7 µl molecular biology grade water; 2 µl DNA sample (300 ng/reaction). Amplification conditions: Initial denaturation – 3 min, 95°C; Amplification (40 cycles: DNA denaturation – 30 s, 95°C; Primer hybridisation – 30 s, 55°C; DNA synthesis – 45 s), 72°C; Final synthesis – 7 min, 72°C.
2.2.6. Virus genomic sequence detection by nested PCR
nPCR was used to detect virus or provirus genomic sequences in patients and apparently healthy individuals’ DNA. Cycle 1 components for 50 µl PCR amplification mix for one sample with corresponding primers to detect virus or provirus gene sequences were:
5 μl 10× Taq PCR buffer +KCl-MgCl2;
3 μl 25 mM MgCl2; 1 μl 10 mM dNTP; 0.2 μl 100 µM corresponding forward primer; 0.2 μl 100 µM corresponding reverse primer; 0.2 μl 5U/μl Taq polymerase; DNA sample (To detect XMRV: 100 – 250 ng; HHV-6: 1 μg; HHV-7: 1 μg; B19: 1 μg per reaction); Molecular biology grade water up to 50 µl.
Cycle 2 components for 25 µl PCR amplification mix for one sample:
2.5 μl 10× Taq PCR buffer +KCl-MgCl2;
1.5 μl 25 mM MgCl2; 0.5 μl 10 mM dNTP; 0.1 μl 100 µM corresponding forward primer; 0.1 μl 100 µM corresponding reverse primer; 0.1 μl 5U/μl Taq polymerase; 15.2 μl molecular biology grade water; 5 μl of cycle 1 amplification product.
42 XMRV provirus env and gag sequence analysis by nPCR
Presence of XMRV provirus env and gag sequences was detected in DNA extracted from peripheral blood, according to Lombardi et al., 2009 and Lo et al., 2010. Primers complementary to env gene encoded envelope proteins, whereas primers amplifying gag gene encoded viral core proteins. XMRV VP62 plasmid (obtained through the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH: XMRV VP62 cDNA from Drs. Robert H. Silverman and Beihua Dong) was used as a positive control (Urisman et al., 2006; Dong et al., 2007). Sensitivity of the nPCR was five copies per reaction (Lombardi et al., 2009; Lo et al., 2010). Presence of XMRV env gene sequence was detected with following primers: Cycle 1: 5922F – 5’-GCTAATGCTACCTCCCTCCTGG-3’ 6273R – 5’-GGAGCCCACTGAGGAATCAAAACAGG-3’ Cycle 2: 5942F – 5’-GGGGACGATGACAGACACTTTCC-3’ 6159R – 5’-CACATCCCCATTTGCCACAGTAG-3’ Presence of XMRV gag gene sequence was detected with following primers: Cycle 1: 419F – 5’-ATCAGTTAACCTACCCGAGTCGGAC-3’ 1154R – 5’-GCCGCCTCTTCTTCATTGTTCTC-3’ Cycle 2: GAG-I-F – 5’-TCTCGAGATCATGGGACAGA-3’ GAG-I-R – 5’-AGAGGGTAAGGGCAGGGTAA-3’ Amplification conditions for both cycles: Initial denaturation – 4 min, 94°C; Amplification (45 cycles: Denaturation – 45 s, 94°C; Primer hybridisation – 45 s, 66.6°C; Synthesis – 45 s, 72°C); Final synthesis – 7 min, 72°C.
HHV-6 genome sequence detection using nPCR
nPCR was used to amplify specific virus DNA sequence in DNA isolated from peripheral blood (a marker of persistent infection) and cell-free blood plasma (a marker of an active infection). The detection of HHV-6 genomic sequence was performed in accordance with Secchiero et al., 1995. Used primers were complementary to the gene that encodes main capsid proteins for both HHV-6A and HHV-6B. HHV-6 genomic DNA (Advanced Biotechnologies Inc, Columbia, MD, USA) was used as a positive control. Sensitivity of
43 HHV-6-specific primers was three copies per reaction (Tomsone et al., 2001; Kozireva et al., 2008). Presence of HHV-6 U3 gene sequence was detected with following primers: Cycle 1: HV1 forward – 5’-GCGTTTTCAGTGTGTAGTTCGGCAG-3’ HV2 reverse – 5’-TGGCCGCATTCGTACAGATACGGAGG-3’ Cycle 2: HV3 forward – 5’-GCTAGAACGTATTTGCTGCAGAACG-3’ HV4 reverse – 5’-ATCCGAAACAACTGTCTGACTGGCA-3’ Amplification conditions for both cycles: Initial denaturation – 3 min, 95°C; Amplification (30 cycles: Denaturation – 1 min, 94°C; Primer hybridisation – 1 min, 57°C; Synthesis – 1 min, 72°C); Final synthesis – 7 min, 72°C.
HHV-7 genome sequence detection using nPCR
Detection of HHV-7 specific genomic sequence in DNA isolated from peripheral blood is a marker of a persistent infection, whereas in cell-free blood plasma – a marker of an active infection. HHV-7 genome sequence detection was done using primers according to Berneman et al., 1992. Primers were complementary to U10 gene (Pfeiffer et al., 1995). HHV-7 genomic DNA (Advanced Biotechnologies Inc., Columbia, MD, USA) was used as a positive control. Sensitivity of HHV-7-specific primers was one copy per reaction (Tomsone et al., 2001; Kozireva et al., 2008). Presence of HHV-7 U10 gene sequence was detected with following primers: Cycle 1: HV7 forward – 5’-TATCCCAGCTGTTTTCATATAGTAAC-3’ HV8 reverse – 5’-GCCTTGCGGTAGCACTAGATTTTTTG-3’ Cycle 2: HV10 forward – 5’-CAGAAATGATAGACAGATGTTGG-3’ HV11 reverse – 5’-TAGATTTTTTGAAAAAGATTTAATAAC-3’ Amplification conditions for the first and second cycles were: Initial denaturation – 4 min, 94°C; Amplification (30 cycles: Denaturation – 1 min, 94°C; Primer hybridisation – 2 min, 60°C for cycle 1 and 2 min, 55°C for cycle 2; Synthesis – 2 min, 72°C); Final synthesis – 7 min, 72°C.
B19V genome sequence detection using nested PCR
Considering virus genomic sequence detection in DNA isolated from whole peripheral blood but not in DNA from cell free blood plasma, the virus genomic sequence is located in
44 peripheral blood cells. The presence of B19V genomic sequence only in DNA from peripheral blood cells indicated a persistent infection, whereas B19V genomic sequence detected also in DNA from cell free blood plasma is a marker for an active infection. Presence of human parvovirus B19V genomic sequence was determined according to Barah et al., 2001, using primers complementary to NS1 gene. Viremic serum DNA (kindly provided by Prof. K. Hedman, Department of Virology, Heartman Institute, University of Helsinki) was used as a positive control. Sensitivity of B19-specific primers was 1 – 10 copies per reaction (Barah et al., 2001). Presence of B19V NS1 gene sequence was detected with following primers: Cycle 1: NS1 F-out – 5’-AATACACTGTGGTTTTATGGGCCG-3’ NS1 R-out – 5’-CCATTGCTGGTTATAACCACAGGT-3’ Cycle 2: NS1 F-in – 5’-GAAAACTTTCCATTTAATGATGTAG-3’ NS1 R-in – 5’-CTAAAATGGCTTTTGCAGCTTCTAC-3’ Amplification conditions for both cycles were: Initial denaturation – 6 min, 95°C; Amplification (40 cycles: Denaturation – 30 s, 95°C; Primer hybridisation – 30 s, 55°C; Synthesis – 30 s, 72°C); Final synthesis – 7 min, 72°C.
2.2.7. HHV-6A and HHV-6B detection by nPCR and HindIII restriction
HHV-6A and HHV-6B according to Lyall and Cubie, 1995 were differentiated. Amplification components for both cycles were prepared as previously described for nPCR. Presence of HHV-6 large tegument protein gene sequence was detected with following primers: Cycle 1: O1 – 5'-AGTCATCACGATCGGCGTGCTATC-3' O2 – 5'-TATCTAGCGCAATCGCTATGTCG-3' Cycle 2: I3 – 5'-TCGACTCTCACCCTACTGAACGAG-3' I4 – 5'-TGACTAGAGAGCGACAAATTGGAG-3' Amplification conditions for both cycles were: Initial denaturation – 5 min, 95°C; Amplification (30 cycles: Denaturation – 1 min, 94°C; Primer hybridisation – 1 min, 60°C; Synthesis – 1 min, 72°C); Final synthesis – 10 min, 72°C. Amplification products were analysed electrophoretically in 1.7% agarose gel as described in the section below “Electrophoretic analysis” to determine 163 bp amplification product. Obtained nPCR amplification products were digested with HindIII restriction endonuclease (Thermo Scientific, USA) which cleaves HHV-6B 163 bp amplification product into 66 bp and 97 bp fragments, whereas does not cleave HHV-6A.
45
2.2.8. Detection of virus gene expression using PCR
PCR was used to amplify virus specific DNA sequences in cDNA samples, which were obtained from RNA that was extracted from PBMCs. Each reaction mix contained corresponding primers to detect HHV-6 U89/90, HHV-7 U57 or B19V NS1 gene sequences. Amplification components were prepared as previously described for nPCR second cycle 25 µl adding 2 μl of cDNA sample. HHV-6 U89/90 immediate-early gene expression was detected according to Van den Bosch et al., 2001 using primers complementary to both HHV-6A and HHV-6B: C1bis – 5'-GTTCCTGTTTCATGGCA-3' C2bis – 5’-TCCAGTAATGTGGAAGAAGG-3' HHV-6 U89/90 amplification conditions: Initial denaturation – 10 min, 95°C; Amplification (40 cycles: Denaturation – 20 s, 95°C; Primer hybridisation – 45 s, 50°C; Synthesis – 30 s, 72°C); Final synthesis – 5 min, 72°C. HHV-7 U57 gene expression was detected according to Ito et al., 2013 using following primers: U57F – 5'-CGGAAGTCACTGGAGTAATGACAA-3' U57R – 5'-CCAATCCTTCCGAAACCGAT-3' HHV-7 U57 amplification conditions: Initial denaturation – 5 min, 95°C; Amplification (40 cycles: Denaturation – 30 s, 95°C; Primer hybridisation – 1 min, 60°C; Synthesis – 1 min, 72ºC); Final synthesis – 5 min, 72°C. B19V NS1 gene expression was detected in accordance with Ito et al., 2013 with following primers: B19RT_F – 5'-GGGTTTCAAGCACAAGYAGTAAAAGA-3' B19RT_R – 5'-CGGYAAACTTCCTTGAAAATG-3' B19V NS1 amplification conditions: Initial denaturation – 5 min, 95°C; Amplification (40 cycles: Denaturation – 30 s, 95°C; Primer hybridisation – 1 min, 51.7°C; Synthesis – 1 min, 72°C); Final synthesis – 1 min, 72°C.
2.2.9. Electrophoretic analysis
Electrophoretic analysis was done to separate and identify by PCR amplified DNA fragments. Agarose gel contained 1.7, 2 or 2.5 grams of agarose powder and 100 ml of 1× TAE buffer. 6× Loading buffer with GelRed (fluorescent nucleic acid dye) was mixed with DNA at a volume ratio of 1:5 and transferred to gel. Marker pUC19 DNA/MspI (HpaII)
46 23 and GeneRuler 1 kb DNA Ladder was used to estimate amplification product size. Results were visualised using UVP BioSpectrum MultiSpectral Imaging System (United Kingdom). β-globin PCR amplification products were analysed in 1.7% agarose gel determining expected amplification product size – 200 bp. 2% agarose gel was used for XMRV PCR amplification products determination with an expected size after the first cycle: env – 350 bp, gag – 735 bp and after the second cycle: env – 218 bp, gag – 413 bp. HHV-6, HHV-7 and B19V nPCR amplification products were analysed in 1.7% agarose gel for detection of following size amplification products: HHV-6 – 258 bp; HHV-7 – 124 bp and B19V – 103 bp. In addition, HHV-6 U89/90, HHV-7 U57 and B19V NS1 amplification products were analysed in 2.5% agarose gel to detect amplification products with size: U89/90 – 115 bp; U57 – 147 bp; B19V – 190 bp.
2.2.10. Viral load determination with real-time PCR
HHV-6, HHV-7 and B19V load was estimated using DNA extracted from peripheral blood by real-time PCR according to manufacturer’s instructions. HHV-6 load was determined with HHV-6 Real-TM Quant (Sacace Biotechnologies, Italy) and B19V – with Parvovirus B19 Real-TM Quant kit (Sacace Biotechnologies, Italy). HHV-7 load was detected using Human Herpes Virus 7 genomes genesig kit (Primerdesign, United Kingdom) and in-house real-time PCR amplifying HHV-7 U90 and PI15 (a gene that exists as two copies per human cell) gene sequences based on previous report by Prusty et al., 2013. HHV-7 U90 and PI15 gene sequences were amplified with following primers: U90 H7 For – CCTGCTGCCAGTTTAATATCCG U90 H7 Rev – TACCACCGTGGAAGAGACCA PI15 For – GGCGGAAGCGCTACATTTCGCA PI15 Rev – TATTCCATATTTGCTGCCGGTGGGA Components for 20 µl HHV-7 U90 PCR amplification mix for one sample were: 4 μl 5× HOT FIREPol EvaGreen qPCR Supermix (Solis BioDyne, Estonia); 5 μl 2 µM U90 H7 For + U90 H7 Rev primer mix; 6 μl molecular biology grade water; 5 μl DNA sample (200–250 ng/reaction). Components for 20 µl PI15 PCR amplification mix for one sample: 4 μl 5× HOT FIREPol EvaGreen qPCR Supermix (Solis BioDyne, Estonia);
47 5 μl 2 µM PI15 For + PI15 Rev primer mix; 6 μl molecular biology grade water; 5 μl DNA sample (200–250 ng/reaction). Amplification conditions were: Initial denaturation – 15 min, 95°C; Amplification (40 cycles: Denaturation – 15 s, 95°C; Primer hybridisation – 30 s, 60°C; Synthesis – 30 s, 72°C); Final synthesis – 2 min, 72°C. The amplified data were analysed using BioRad CFX Manager Software Version 3.1.1517.0823. Number of HHV-7 copies per cell is calculated dividing the number of U90 with PI15 copies.
2.3. Immunological methods
Immunological laboratory methods were used to analyse the presence of virus-specific antibodies and the level of cytokines, as well as virus-specific protein expression.
2.3.1. Detection of HHV-6, HHV-7 and B19V specific antibodies
The presence of virus-specific IgM and IgG class antibodies in blood plasma was detected using commercially available kits according to manufacturer’s protocol. IgM and IgG class antibodies against HHV-6 detected with HHV-6 IgM and HHV-6 IgG ELISA kits (Panbio, Australia) and HHV-6 IgG Antibody ELISA kit (Advanced Biotechnologies, Columbia MD, USA). B19V specific IgM and IgG class antibodies estimated with Biotrin Parvovirus B19 Enzyme Immunoassay (Biotrin Ltd, Ireland) and recomWell Parvovirus B19 Enzyme Immunoassay (Mikrogen Diagnostik, Germany). HHV-7 specific IgG class antibodies analysed with immunofluorescence method using HHV-7 IgG IFA Kit (Advanced Biotechnologies, Columbia MD, USA).
2.3.2. Evaluation of B19V antibody reaction patterns
The presence of B19V specific IgM and IgG class antibodies in blood plasma was detected using commercially available recomLine Parvovirus B19 IgM and IgG kits (Mikrogen Diagnostik, Germany). Specific antibodies against six antigens of B19V [Vp-2p – main capsid antigen (conformation epitope); VP-N – N-terminal half of the structure proteins VP-1 and VP-2; VP-1S – specific segment (differentiation to VP-2); VP-2r – main capsid antigen (linear epitope); VP-C – C-terminal half of the structure proteins VP-1 and
48 VP-2; NS-1 – non-structure protein] were identified, thereby various reaction patterns allowed to determine time period after B19V infection onset according to manufacturer’s protocol based on Pfrepper et al., 2005. For example, a sustained infection that occurred long time ago (months to years after infection onset) often shows IgG reactivity against VP-2p and/or VP-N (usually with VP-1S). A recent infection (weeks to months after infection onset) shows strong IgG reactivity against VP-C and presence of VP-2r can be accompanied by VP-2p, VP-N and VP-1S (Pfrepper et al., 2005).
2.3.3. Determination of cytokine level
Respective cytokine present in sample or standard binded to antibodies, which were absorbed on microwell plate. Biotin-conjugated anti-human cytokine antibody was added and binded to human cytokine. After incubation, washing is performed to remove unbound biotin-conjugated antibody. Then streptavidin- horseradish peroxidase (HRP) was added and binded to biotin-conjugated antibody. After this incubation washing was performed to remove unbound streptavidin-HRP, substrate solution was added to react with HRP and develop colour corresponding to the cytokine amount. Then acid was added to stop the reaction, absorbance was measured at 450 nm and concentration calculated. The level of all analysed cytokines in blood plasma was detected according to the manufacturer’s protocol. IL-4 level was detected using Endogen Human ELISA kit (Pierce Biotechnology, Rockford, IL, USA). Sensitivity of the assay was < 2 pg/ml. IL-6 level was detected with eBioscience Human IL-6 Platinium ELISA (eBioscience Europe/International, Austria). Limit of detection was 0.92 pg/ml. IL-10 level was assessed using BIOSOURCE IL-10 EASIA (Enzyme Amplified Sensitivity Immunoassay) from BioSource Europe S.A., Belgium and eBioscience Human IL-10 Platinium ELISA (eBioscience Europe/International, Austria). Detection limit was 1 pg/ml. IL-12 (p70) level was detected with eBioscience Human IL-12p70 Platinium ELISA (eBioscience Europe/International, Austria) with detection limit – 2.1 pg/ml. TNF-alpha level determined using Biorbyt Human TNFα ELISA kit (Biorbyt, United Kingdom) with detection limit of < 1 pg/ml.
49 2.3.4. Indirect immunofluorescence
One ml of PBMCs was transferred to microscope slides with reaction wells, air-dried, fixed with ice-cold methanol and acetone mix (1:1 at -20°C) for 20 min, washed with distilled water and air-dried again. Before the staining, cells were rehydrated in PBS (phosphate buffer saline) for 40 – 60 min and dried. Following primary mouse antibodies were diluted 1:50 in blocking buffer (100 ml buffer: 2g BSA, 0.2g Tween, 10g glycerin, 0.05g sodium azide): anti-p41 (clone 6A5D12), HHV-6B specific anti-gH (gp100) (clone OHV-3) and HHV-6A and HHV-6B specific anti-gB (gp116) (clone OHV-1). 30 µl of antibody dilution was added to PBMCs on slides, incubated in humidity tray for 1 hour and washed 3 times for 3 min with PBS. To stain DNA, Hoechst 33258 (Sigma-Aldrich, St. Louis, MO, USA) was added at a concentration of 0.4 µg/ml to secondary antibodies [rabbit anti-mouse FITC-conjugated (Dako) sera]. Then 30 µl of secondary antibodies were added to slides, incubated for 30 min in humidity tray and washed 3 times for 3 min with PBS and mounted with 40 µl of mounting media (80% glycerine in PBS, 2.5% 1,4-diazabicyclooctane). The samples were analysed microscopically and images captured using Eclipse 80i microscope with a cooled charge-coupled device (CCD) camera (Nikon, Japan).
2.4. Phylogenetic analysis
To perform phylogenetic analysis part of human parvovirus B19V NS genes (396 bp) were aligned by Multiple Sequence Comparison by Log-Expectation – MUSCLE implemented in the MEGA 6 software (Tamura et al., 2013). To ensure the consistency of tree topologies, phylogenetic trees were reconstructed with the neighbour-joining and maximum likelihood methods using the MEGA 6 and PhyML 3.0 (Guindon et al., 2010; Tamura et al., 2013). The robustness of the phylogenetic trees was statistically evaluated by bootstrap analysis with 1000 replicates. The bootstrap value > 75% was considered to a monophyletic group.
2.5. Statistical analysis
Statistical analysis was done by GraphPad Prism 7.0 program. Discrete variables were described as numbers and percentage, and difference in frequency of gender, virus-specific antibodies, antigens, virus presence markers between groups was estimated using such statistical analysis methods as Chi-square and Fisher´s exact tests as appropriate. Continuous
50 variables were expressed as average (± standard deviation – SD) or median (interquartile range – IQR). Considering data distribution, viral loads and cytokine levels were analysed with Analysis of variance – ANOVA and Mann-Whitney nonparametric tests, and displayed in logarithmic scale. A value of p 0.05 was considered to be statistically significant.
51 3. RESULTS
3.1. Patients with ME/CFS
200 patients with ME/CFS were enrolled in this study. From them 65% (130/200) were female and 35% (70/200) were male (p < 0.0001). Mean (± SD) age for all patients was 38 ± 12 years. Age distribution is shown as a frequency of patients divided in 12 groups 20–75 years (with 5-year difference) (Figure 3.1). 79% of patients were between age of 25–50 years.
Figure 3.1 Age distribution among patients with myalgic encephalomyelitis/chronic fatigue syndrome
Frequency of ME/CFS typical symptoms in 200 patients is depicted in Figure 3.2. All patients had more than 6 months lasting unexplained chronic fatigue (p < 0.0001). Impaired memory, decreased concentration and sleep disturbances were most frequently observed symptoms in patients with ME/CFS. Impaired memory was present significantly more than muscle pain (p = 0.0435), lymphadenopathy (p = 0.0113), multi-joint pain (p = 0.0001) and headache of new type (p<0.0001). Decreased concentration had more patients than subfebrility (p = 0.0315), lymphadenopathy (p = 0.0005), muscle pain (p = 0.0025), multi-joint pain (p < 0.0001) and headache of new type (p < 0.0001). Sleep disturbances were observed more frequent than post-exertional malaise (p = 0.0226), subfebrility (p = 0.0113), lymphadenopathy (p = 0.0001), muscle pain (p = 0.0007), multi-joint pain (p < 0.0001) and headache of new type (p < 0.0001).
52
Figure 3.2 Frequency of typical symptoms of myalgic encephalomyelitis/chronic fatigue syndrome
All included patients reported that onset of ME/CFS symptoms occurred 6–36 months before inclusion in this study, mean (± SD) 10.2 ± 4.2 months. In 85% of patients onset of ME/CFS symptoms had started 8–12 months before inclusion in the study (Figure 3.3).
Figure 3.3 Onset time (in months before inclusion in the study) of myalgic encephalomyelitis/chronic fatigue syndrome typical symptoms
3.2. Analysis of XMRV genomic sequences in patients with ME/CFS
XMRV proviral gag gene sequence was not detected neither in DNA isolated from 150 patients with ME/CFS peripheral blood nor in DNA extracted from peripheral blood of 30 apparently healthy individuals. Only positive control gave amplimers of 735 bp after the
53 first round and 410 bp after the second round that corresponds to the expected XMRV gag gene fragment. Moreover, patients with ME/CFS and apparently healthy individuals’ DNAs were found to be negative in nPCR assay, targeting the XMRV provirus specific env gene sequence. Also only positive control gave amplimer of 351 bp after the first round and 218 bp after the second round corresponding to the expected XMRV env gene fragment.
3.3. Involvement of human herpesvirus-6 in development of ME/CFS
3.3.1. Presence of HHV-6 specific antibodies
HHV-6 specific antibodies were detected in 92.1% (151/164) of analysed ME/CFS patients’ and 76.7% (69/90) apparently healthy individuals’ blood plasma samples (p = 0.0009). Anti-HHV-6 IgG class antibodies had 90.9% (149/164) patients and 76.7% (69/90) apparently healthy individuals (p = 0.0026), though IgM class antibodies had 6.1% (10/164) patients and 2.2% (2/90) apparently healthy individuals (p = 0.2227). From them 4.9% (8/164) of patients and 2.2% (2/90) of apparently healthy individuals (p = 0.5017) had IgG + IgM class antibodies, whereas 1.2% (2/164) of patients with ME/CFS and none of apparently healthy individuals (p = 0.5406) had only IgM class antibodies.
3.3.2. Frequency of HHV-6 genomic sequences
Using nPCR presence of HHV-6 genomic sequences in 53% (106/200) of patients with ME/CFS and in 28.7% (43/150) of apparently healthy individuals was detected (p < 0.0001). From them presence of HHV-6 genomic sequence in DNA isolated from peripheral blood leukocytes (marker of a persistent infection in latent phase) had 42% (84/200) of patients and 28.7% (43/150) of apparently healthy individuals (p = 0.0133), though presence of genomic sequence in cell free blood plasma (marker of a persistent infection in active phase) – 11% (22/200) of ME/CFS patients and none of apparently healthy individuals (p < 0.0001) (Figure 3.4). HHV-6A was detected in one and HHV-6B in the rest of the analysed patients with ME/CFS (p < 0.0001). Using RT-PCR HHV-6 U89/90 gene expression was revealed in 78% (57/73) of the analysed ME/CFS patients PBMCs with previously detected HHV-6 genomic sequence in peripheral blood DNA by nPCR.
54
Figure 3.4 Presence of HHV-6 genomic sequence in DNA isolated from peripheral blood cells and both - peripheral blood and cell free blood plasma of patients with ME/CFS and apparently healthy individuals [WB – whole blood DNA; PBL – peripheral blood leukocytes’ DNA; PL – cell free plasma DNA; ME/CFS – myalgic encephalomyelitis/chronic fatigue syndrome; AHI – apparently healthy individuals]
3.3.3. HHV-6 load
HHV-6 load was elevated (> 10 copies/106 cells) in 66% (66/100) of the analysed patients with ME/CFS and in 2/10 apparently healthy individuals with previously by nPCR detected presence of HHV-6 genomic sequence (p = 0.0064). Elevated HHV-6 load was detected in 56.4% (44/78) of the analysed patients with persistent HHV-6 infection in a latent phase and in 100% (22/22) of patients with persistent HHV-6 infection in an active phase (p < 0.0001). In patients with a persistent HHV-6 infection in a latent phase median (IQR) HHV-6 load was 279 (1022–54.5) copies/106 cells, whereas in patients with a persistent HHV-6 infection in an active phase – 1927 (6732–348.5) copies/106 cells (p = 0.0019). In 43.6% (34/78) of patients with a persistent HHV-6 infection in a latent phase the viral load was < 10 copies/106 cells. Six patients’ median (IQR) viral load was 1209033 (1464421–808183) copies/106 cells.
3.3.4. Presence HHV-6 antigens
Analysing 36 patients PBMCs by indirect immunofluorescence, in six patients with ME/CFS expression of HHV-6 p41 was shown [using HHV-6 specific anti-p41 (clone 6A5D12) antibody]. In 15 patients the presence of HHV-6B was identified [using HHV-6B specific anti-gH (gp100) (clone OHV-3) antibody], and in seven patients with ME/CFS the 55 expression of HHV-6 gp116 was detected [using HHV6A and HHV6B specific anti-gB (gp116) (clone OHV-1) antibody] (Figure 3.5).
Figure 3.5 Indirect immunofluorescence of HHV6-encoded protein expression pattern in PBMCs. DNA is shown in blue. The strong gB (gp116) and gH (gp100) signals (green) were detected in patient samples and at the synapse, when cells were fused (middle panel). The strong nuclear p41 signal (green) was detected in patient samples in a proportion of the cells, but not in all cells N, NN – patients with ME/CFS 56
3.3.5. Association of HHV-6 infection with ME/CFS clinical symptoms
Occurrence of typical ME/CFS clinical symptoms and presence of markers of a persistent HHV-6 infection in latent and active phase in patients with ME/CFS are summarized in Table 3.1.
Table 3.1 Occurrence of typical ME/CFS clinical symptoms in ME/CFS patients with persistent HHV-6 infection in latent and active phase Symptoms Persistent Persistent P value HHV-6 infection in HHV-6 infection in latent phase, n (%) active phase, n (%) Chronic fatigue (>6 months) 84 (100%) 22 (100%) > 0.9999
Post-exertional malaise 53 (63.1%) 14 (63.6%) > 0.9999
Impaired memory 55 (65.5%) 17 (77.3%) 0.4418
Decreased concentration 62 (73.8%) 14 (63.6%) 0.4261
Sleep disturbances 64 (76.2%) 18 (81.8%) 0.7762
Subfebrility 49 (58.3%) 13 (59.1%) > 0.9999
Lymphadenopathy 48 (57.1%) 10 (45.5%) 0.3469
Muscle pain 46 (54.8%) 12 (54.5%) > 0.9999
Multi-joint pain 36 (42.9%) 10 (45.5%) > 0.9999
Headache of new type 37 (44%) 9 (40.9%) 0.8146
3.3.6. Level of cytokines in case of HHV-6 infection
Table 3.2 shows median (IQR) concentration level (pg/ml) and percentage of patients with and without an elevated level of pro-inflammatory (IL-6, TNF-α, and IL-12) and anti-inflammatory cytokines (IL-4 and IL-10) in ME/CFS patients with a persistent HHV-6 infection in latent and active phase.
57 Table 3.2 Level of cytokines in patients with ME/CFS with persistent HHV-6 infection in latent and active phase
Cytokine IL-12 (sensitivity) IL-6 TNF-α IL-4 IL-10 (p70) Assessed (0.92 (< 1 (< 2 (< 1 pg/ml) (2.1 parameters pg/ml) pg/ml) pg/ml) pg/ml)
Persistent HHV-6 infection in latent phase
Median 3.8 68.0 < 2 15.5 12.0 IQR 5.2–2.0 126.4–39 - 36.4–8 16.8–4.6 Patients with elevated level (%) 28.8 80.0 0.0 78.5 96.6 Patients with level under 71.3 20.0 100.0 21.5 3.4 detection limit (%) Persistent HHV-6 infection in active phase Median 4.4 67.0 < 2 20.0 15.1 IQR 26.9–1.3 113.6-55 - 52.4–11.9 18.6–14 Patients with elevated level (%) 55.0 81.0 0.0 88.9 100.0 Patients with level under 45.0 19.0 100.0 11.1 0 detection limit (%) Mann-Whitney test [latent vs 0.9493 0.919 - active infection (pg/ml)] 0.4789 *0.0386 Fishers' exact test [elevated cytokine level latent vs active *0.0356 > 0.9999 > 0.9999 0.6759 > 0.9999 infection (number of patients)] * statistically significant (p < 0.05) - undetectable
3.4. Involvement of human herpesvirus-7 in development of ME/CFS
3.4.1. Presence of HHV-7 specific antibodies
HHV-7 specific IgG class antibodies was detected in 84.6% (11/13) of patients with ME/CFS and 93.8% (30/32) of the analysed apparently healthy individuals (p = 0.5672).
3.4.2. Frequency of HHV-7 genomic sequences
Marker of persistent HHV-7 infection was detected by nPCR in 92% (184/200) of patients with ME/CFS and 75.3% (113/150) of apparently healthy individuals (p < 0.0001). From them presence of HHV-7 genomic sequence in DNA extracted from peripheral blood leukocytes was revealed in 58% (116/200) of ME/CFS patients and 67.3% (101/150) of apparently healthy individuals (p = 0.0766), whereas presence of genomic sequence in DNA
58 from blood plasma – 34% (68/200) of patients and 8% (12/150) of apparently healthy individuals (p < 0.0001) (Figure 3.6). Using RT-PCR HHV-7 U57 gene expression was detected in 45.7% (58/127) of analysed ME/CFS patients PBMCs with previously detected HHV-7 in peripheral blood DNA by nPCR.
Figure 3.6 Presence of HHV-7 genomic sequence in DNA isolated from peripheral blood cells and both peripheral blood and cell free blood plasma of patients with ME/CFS and apparently healthy individuals [WB – whole blood DNA; PBL – peripheral blood leukocytes’ DNA; PL – cell free plasma DNA; ME/CFS – myalgic encephalomyelitis/chronic fatigue syndrome; AHI – apparently healthy individuals]
3.4.3. HHV-7 load
HHV-7 load was elevated (> 10 copies/106 cells) in 67.3% (113/168) of the analysed patients with ME/CFS and in 31.4% (16/51) of the analysed apparently healthy individuals with previously detected HHV-7 genomic sequence by nPCR (p < 0.0001). Elevated HHV-7 load was detected in 62.9% (66/105) of the analysed patients with a persistent HHV-7 infection in a latent phase and in 74.6% (47/63) of patients with an active HHV-7 infection (p = 0.1292). In ME/CFS patients with persistent HHV-7 infection in a latent phase median (IQR) viral load was 196.7 (533–132) copies/106 cells and in patients with a persistent HHV-7 infection in an active phase – 238.6 (410.6–80.2) copies/106 cells (p = 0.3502). HHV-7 load < 10 copies/106 cells was detected in 37.1% (39/105) of the patients with a persistent HHV-7 infection in a latent phase and 25.4% (16/63) of the patients
59 with a persistent HHV-7 infection in an active phase, as well as 68.6% (35/51) of apparently healthy individuals. In one patient with ME/CFS HHV-7 load in whole blood was 1140127.6 copies/106 cells and in hair follicle DNA – 1188811.8 copies/106 cells. In addition, in the same patient’s mother’s hair follicle the HHV-7 load was 2591031.6 copies/106 cells.
3.4.4. Association of HHV-7 with ME/CFS clinical symptoms
Occurrence of typical ME/CFS clinical symptoms and presence of markers of a persistent HHV-7 infection in latent and active phase in patients are shown in Table 3.3.
Table 3.3 Occurrence of typical ME/CFS clinical symptoms in ME/CFS patients with persistent HHV-7 infection in latent and active phase Symptoms Persistent HHV-7 Persistent HHV-7 P value infection in latent phase, infection in active phase, n (%) n (%) Chronic fatigue (>6 months) 116 (100%) 68 (100%) > 0.9999
Post-exertional malaise 68 (58.6%) 40 (58.8%) > 0.9999
Impaired memory 79 (68.1%) 44 (64.7%) 0.7458
Decreased concentration 79 (68.1%) 50 (73.5%) 0.5059
Sleep disturbances 78 (67.2%) 53 (77.9%) 0.1325
Subfebrility 64 (55.2%) 42 (61.8%) 0.4406
Lymphadenopathy 63 (54.3%) 31 (45.6%) 0.2864
Muscle pain 67 (57.8%) 32 (47.1%) 0.1711
Multi-joint pain 55 (47.4%) 30 (44.1%) 0.7596
Headache of new type 51 (44%) 27 (39.7%) 0.6437
3.4.5. Level of cytokines in case of HHV-7 infection
Median (IQR) concentration (pg/ml) and percentage of patients with and without elevated levels of pro-inflammatory and anti-inflammatory (IL-6, TNF-α, IL-12 and IL-4, IL-10) cytokines levels among ME/CFS patients with persistent HHV-7 infection in latent and in active phase is shown in Table 3.4.
60 Table 3.4 Level of cytokines in ME/CFS patients with persistent HHV-7 infection in latent and active phase
Cytokine IL-12 IL-6 IL-4 IL-10 (sensitivity) TNF-α (p70) (0.92 (< 2 (< 1 Assessed (< 1 pg/ml) (2.1 pg/ml) pg/ml) pg/ml) parameters pg/ml)
Persistent HHV-7 infection in latent phase Median 2.9 55.7 < 2 12.5 14.2 IQR 5.2–1.5 125.6–32.8 - 30–6.3 16.4–8.2 Patients with elevated level (%) 30.7 65.2 0.0 83.5 100.0 Patients with level under detection 69.3 34.8 100.0 16.5 0 limit (%) Persistent HHV-7 infection in active phase Median 4.6 57.5 < 2 20.0 15.3 IQR 6.5–2 120.8–36.5 - 50–10.4 17.7–12.7 Patients with elevated level (%) 37.3 83.6 0.0 73.9 95.3 Patients with level under detection 62.7 16.4 100.0 26.1 4.7 limit (%) Mann-Whitney test [latent vs active - infection (pg/ml)] 0.131 0.4814 *0.0421 0.1071 Fishers' exact test [elevated cytokine level latent vs active infection (number 0.4145 *0.0096 >0.9999 0.1841 0.1044 of patients)] * statistically significant (p < 0.05) - undetectable
3.5. Involvement of parvovirus B19V in development ME/CFS
3.5.1. Presence of B19V specific antibodies
B19V specific IgG class antibodies were found in 70% (140/200) of patients with ME/CFS and 67.4% (60/89) of the analysed apparently healthy individuals (p = 0.6803) blood plasma samples. None of apparently healthy individuals had B19V specific IgM class antibodies, though 8% (16/200) of ME/CFS patients had IgM class antibodies (p = 0.0038). From them 2.5% (5/200) had only IgM class antibodies and 5.5% (11/200) had both – IgG and IgM class antibodies (p = 0.3282 and p = 0.0204, respectively).
61 3.5.2. Frequency of B19V genomic sequences
Using nPCR B19V genomic sequence in DNA isolated from peripheral blood and/or blood plasma was detected in 29% (58/200) of ME/CFS patients and in 3.8% (4/104) of apparently healthy individuals (p < 0.0001). Presence of B19V genomic sequences in DNA from peripheral blood leukocytes was detected in 12% (24/200) of patients with ME/CFS and in 1.9% (2/104) of apparently healthy individuals (p = 0.002). However, presence of B19V genomic sequences in DNA from blood plasma was found in 17% (34/200) of patients with ME/CFS and 1.9% (2/104) of apparently healthy individuals (p < 0.0001) (Figure 3.7). B19V NS1 gene expression in PBMCs was detected by RT-PCR and 25 out of 58 (nPCR positive) analysed ME/CFS patients were positive.
Figure 3.7 Presence of B19V NS1 genomic sequence in DNA from peripheral blood cells and both peripheral blood and cell free blood plasma from patients with ME/CFS and apparently healthy individuals [WB – whole blood DNA; PBL – peripheral blood leukocytes’ DNA; PL – cell free plasma DNA; ME/CFS – myalgic encephalomyelitis/chronic fatigue syndrome; AHI – apparently healthy individuals]
3.5.3. B19V load
Elevated viral load was detected in 20 of ME/CFS patients (9 with latent/persistent and 11 with an active B19V infection) and in none of apparently healthy individuals (p = 0.0003). In nine of 24 patients with a latent/persistent B19V infection the viral load was [median (IQR)] 5.6 (27.4–0.8) copies/µg DNA (37.2 copies/106 cells) and in 15 patients < 0.2 copies/µg DNA. In addition, in 11 out of 34 patients with an active B19V infection
62 the viral load was 38.2 (217.5–17.7) copies/µg DNA (251.8 copies/106 cells) and in 23 patients < 0.2 copies/µg DNA (p = 0.0289). All apparently healthy individuals with B19V infection had a viral load < 0.2 copies/µg DNA.
3.5.4. B19V antibody reaction patterns
By analysing B19V specific antibody reaction patterns of 75 patients with ME/CFS (39 with and 36 without the presence of B19V genomic sequence in DNA from peripheral blood and/or blood plasma) with recomLine kit, an acute B19V infection was revealed in one patient, a recent infection (weeks to months after infection onset) in 41% (16/39) of the patients with B19V genomic sequence and in 30.6% (11/36) without it (p = 0.4706). A sustained infection (months to years after infection onset) was observed in 56.4% (22/39) of patients with and 27.8% (10/36) - without B19V genomic sequence in peripheral blood and/or plasma DNA (p = 0.0191) (Figure 3.8). 41.7% (15/36) of patients without B19V genomic sequence were without B19V specific antibodies. In summary, out of 75 analysed patients, 36% (27/75) had a recent B19V infection and 43% (32/75) – a sustained infection. 51.3% (20/39) of the analysed patients with the presence of B19V genomic sequence in DNA isolated from peripheral blood and/or plasma had developed B19V specific NS1 antibodies.
Figure 3.8 Time period after B19V infection onset in ME/CFS patients with and without presence of B19V genomic sequence in DNA from peripheral blood and/or blood plasma * statistically significant (p < 0.05)
63
3.5.5. Association of B19V with ME/CFS clinical symptoms
The occurrence of typical ME/CFS clinical symptoms and the presence of B19V infection markers in patients with ME/CFS are summarized in Table 3.5. The onset of ME/CFS symptoms was determined six months up to three years before inclusion in the study. In 93.3% (70/75) of patients with B19V infection onset of symptoms had occurred 8.3 ± 1.7 months before inclusion in this study and in 6.7% (5/75) of the patients symptoms had started 2.4 ± 0.5 years before. In patients with a recent B19V infection symptoms had started 8.3 ± 1.6 months ago and in patients with a sustained infection – 12.1 ± 7.8 months ago (from them 25% – more than 12 months ago).
Table 3.5 Occurrence of typical ME/CFS clinical symptoms in ME/CFS patients with latent/persistent and active B19V infection Symptoms Latent/persistent B19V Active B19V P value infection, n (%) infection, n (%) Chronic fatigue (>6 months) 24 (100%) 34 (100%) 1.0000
Post-exertional malaise 15 (62.5%) 18 (52.9%) 0.5923
Impaired memory 12 (50%) 24 (70.6%) 0.1694
Decreased concentration 13 (54.2%) 18 (52.9%) 1.0000
Sleep disturbances 15 (62.5%) 22 (64.7%) 1.0000
Subfebrility 9 (37.5%) 20 (58.8%) 0.1820
Lymphadenopathy 10 (41.7%) 17 (50%) 0.5992
Muscle pain 14 (58.3%) 16 (47.1%) 0.4351
Multi-joint pain 9 (37.5%) 15 (44.1%) 0.7872
Headache of new type 14 (58.3%) 13 (38.2%) 0.1828
Figure 3.9 shows the percentage of ME/CFS typical clinical symptoms in the analysed patients with and without detectable NS1 antibodies in the presence of B19V genomic sequence in whole blood DNA. From them 55% of patients with and 21.1% without NS1 antibodies had multi-joint pain (p = 0.0294). Muscle pain was observed in 65% and 42.1%, while lymphadenopathy – 65% of patients with and 31.6% without NS1 antibodies, respectively (p = 0.1517 and p = 0.0369).
64
Figure 3.9 Number of ME/CFS typical symptoms in patients with presence of B19V genomic sequence with and without B19V specific NS1 antibodies * statistically significant (p < 0.05)
3.5.6. Level of cytokines in case of B19V infection
Pro-inflammatory (IL-6, TNF-α and IL-12) and anti-inflammatory (IL-4 and IL-10) cytokines median (IQR) concentration (pg/ml) and percentage of patients with and without an elevated cytokine level in ME/CFS patients with a latent/persistent and active B19V infection is depicted in Table 3.6.
65 Table 3.6 Level of cytokines in patients with ME/CFS with latent/persistent and active B19V infection
Cytokine (sensitivity) IL- 6 IL- 4 TNF- α IL-10 IL-12 (p70) (0.92 (< 2 (< 1 pg/ml) (< 1 pg/ml) (2.1 pg/ml) Assessed pg/ml) pg/ml) parameters
Latent/persistent B19V infection Median 3.0 69.9 < 2 11.6 13.8 IQR 3–2.1 133–29 - 29.6–5.9 15.1–8.1 Patients with elevated level (%) 8.3 76.2 0.0 75.0 100.0 Patients with level under 91.7 23.8 100.0 25.0 0 detection limit (%) Active B19V infection Median 4.5 106.4 < 2 15.8 14.9 IQR 6–1.5 153–42.9 - 82.5–10 18.6–12.7 Patients with elevated level (%) 45.5 72.7 0.0 92.9 92.9 Patients with level under 54.5 27.3 100.0 7.1 7.1 detection limit (%) Mann-Whitney test [latent vs 0.625 0.3581 - 0.0612 active infection (pg/ml)] 0.096 Fishers' exact test [elevated cytokine level persistent vs active *0.0031 > 0.9999 > 0.9999 0.1234 0.4949 infection (number of patients)] * statistically significant (p < 0.05) - undetectable
3.5.7. B19V phylogenetic analysis
Although two B19V genotypes (genotype 1 and 2) were revealed in Latvia, the results of phylogenetic analysis of the B19V NS1 gene (CAGGTTATGTGTATTAAAGACAATAA AATTGTTAAATTGTTACTTTGTCAAAACTATGACCCCCTATTGGTGGGGCAGCATG TGTTAAAGTGGATTGATAAAAAATGTGGCAAGAAAAATACACTGTGGTTTTATGG GCCGCCAAGTACAGGAAAAACAAACTTGGCAATGGCCATTGCTAAAAGTGTTCC AGTATATGGCATGGTTAACTGGAATAATGAAAACTTTCCATTTAATGATGTGGCA GGGAAAAGCTTGGTGGTCTGGGATGAAGGTATTATTAAGTCCACAATTGTAGAAG CTGCAAAAGCCATTTTAGGCGGGCAACCTACCAGGGTAGATCAAAAAATGCGTG GAAGTGTAGCTGTGCCTGGAGTACCTGTGGTTATAACCAGC) showed genotype 1 circulation in patients with ME/CFS (Figure 3.10). The majority of Latvian isolates (also from patients with diagnoses other than ME/CFS) was clustered with genotype 1. Consistent tree topologies were observed with both of neighbour-joining and maximum likelihood methods. The gene diversity for genotype 1 was low – 0.3 ~ 1.1%.
66
Figure 3.10 Phylogenetic tree of human parvoviruses B19V based on NS1 gene (396 bp). Phylogenetic tree was constructed using the maximum likelihood method. Only posterior probabilities values above 90 % are shown. CFS209-Latvia-09 represents the isolate from Latvian ME/CFS patient
3.6. Involvement of HHV-6, HHV-7 and B19V infection/co-infection in development of ME/CFS
3.6.1. Frequency of virus infection/co-infection
Using nPCR markers of persistent viral infection/co-infection was revealed in 96.5% (193/200) of patients with ME/CFS and in 85.3% (128/150) of apparently healthy individuals (p = 0.0003). From them a latent infection/co-infection markers (virus genomic sequences in DNA from peripheral blood leukocytes) were observed in 51.5% (103/200) of patients and 76.7% (115/150) of apparently healthy individuals (p < 0.0001). Whereas an active infection/co-infection markers (virus genomic sequences in DNA from blood plasma) were detected in 45% (90/200) of patients with ME/CFS and 8.7% (13/150) of apparently healthy individuals (p < 0.0001). HHV-6, HHV-7 and B19V genomic sequences were not detected in 3.5% (7/200) of patients and 14.7% (22/150) of apparently healthy individuals (p = 0.0003) (Figure 3.11).
67
Figure 3.11 Frequency of persistent HHV-6, HHV-7 and B19V infection in patients with ME/CFS and apparently healthy individuals AHI – apparently healthy individuals
Figure 3.12 shows the frequency of markers for HHV-6, HHV-7 and B19V infection/co-infection in latent or active phase in groups of patients with ME/CFS compared with apparently healthy individuals.
Figure 3.12 Frequency of persistent HHV-6, HHV-7 and B19V infection/co-infection (%) in latent or active phase HHV-human herpesvirus, B19V – human parvovirus B19, AHI – apparently healthy individuals
68
3.6.2. Viral load in patients with co-infection
Elevated HHV-6 load (> 10 copies/106 cells) was detected in 50% of ME/CFS patients with a persistent infection/co-infection in latent and in 79.6% of patients in an active phase (p = 0.0028). The median HHV-6 load in patients with a persistent infection/co-infection in a latent phase was (IQR) 262 (474–29.7) copies/106 cells, whereas in an active phase – 653.2 (4136–190.5) copies/106 cells (p = 0.0251) (Figure 3.13.a). Similarly, 58.3% of patients with a persistent infection/co-infection in a latent phase and 76.2% in an active phase had elevated HHV-7 load (> 10 copies/106 cells) (p = 0.0209). HHV-7 load was 166.5 (398.6–123.8) copies/106 cells in patients with a persistent infection/co-infection in a latent phase and 248.5 (422–105.6) copies/106 cells in ME/CFS patients with an active infection (p = 0.55) (Figure 3.13.b). Elevated B19V load was detected in 21.9% of patients with a persistent infection/co-infection in latent and 32.5% of patients in an active phase (p = 0.4286). In patients with a persistent infection/co-infection in a latent phase B19V load was 14.7 (27.4–0.7) copies/µg DNA (96.8 copies/106 cells) and in patients with an infection in an active phase – 38 (217.8–18) copies/µg DNA (250.8 copies/106 cells) (p = 0.0444) (Figure 3.13.c).
69
Figure 3.13 HHV-6 (a), HHV-7 (b) and B19V (c) viral load in ME/CFS patients with persistent infection/co-infection in latent and active phase * statistically significant (p < 0.05)
3.6.3. Cytokine level in ME/CFS patients with viral infection/co-infection
According to the used cytokine detection protocols, the mean (range) of IL-6 level in apparently healthy individuals was 6.4 (< 0.92–13) pg/ml. Median (IQR) level of IL-6 in ME/CFS patients with a persistent HHV-6/HHV-7/B19V infection and/or co-infection in a latent phase was 2.5 (5.1–1.9) pg/ml and in patients with a persistent single HHV-6 or HHV-7 infection in an active phase – 4.2 (5.3–1.3) pg/ml. IL-6 level in case of a persistent double (HHV-6+HHV-7 and HHV-7+B19V) infection in an active phase was 4.7 (10.2–2)
70 pg/ml and in case of a persistent triple (HHV-6+HHV-7+B19V) infection in an active phase – 3.3 (6–1.8) pg/ml. In all ME/CFS patients without infection IL-6 level was < 0.92 pg/ml (p = 0.1289) (Figure 3.14.a). TNF-α level in apparently healthy individuals was under the detection level (< 2.3 pg/ml). In ME/CFS patients with a persistent HHV-6/HHV-7/B19V infection and/or a co-infection in a latent phase median (IQR) TNF-α level was 59 (133–29) pg/ml and with a single HHV-6 or HHV-7 infection in an active phase – 44 (68–26.5) pg/ml. In patients with a persistent double (HHV-6+HHV-7 and HHV-7+B19V) infection in an active phase TNF-α level was 62.5 (117.2–43) pg/ml, though with a persistent triple (HHV-6+HHV-7+B19V) infection in an active phase – 123 (178–74.7) pg/ml. In ME/CFS patients without infection the TNF-α level was 59 (77.5–12) pg/ml (p = 0.0492) (Figure 3.14.b). IL-12 level in apparently healthy individuals was under the detection level (< 2.1 pg/ml). In ME/CFS patients with a persistent HHV-6/HHV-7/B19V infection and/or co-infection in a latent phase IL-12 median level was 13.4 (15.6–5.6) pg/ml. In patients with a persistent single (HHV-6 or HHV-7) infection in an active phase and with a double (HHV-6+HHV-7 and HHV-7+B19V) infection in an active phase IL-12 level was 15.5 (16.8–13.3) pg/ml and 15.5 (18.4–13.3) pg/ml, respectively. In case of a persistent triple (HHV-6+HHV-7+B19V) infection in an active phase IL-12 level was 16 (31.3–13.9) pg/ml and patients without infection – 14.6 (15.1–3.1) pg/ml (p = 0.0063) (Figure 3.14.c). In apparently healthy individuals the mean IL-10 level was 10.3 (8.1–12.5) pg/ml. The median (IQR) IL-10 level in ME/CFS patients with a persistent HHV-6/HHV-7/B19V infection and/or co-infection in a latent phase was 12.4 (30–7) pg/ml, whereas in patients with a persistent single (HHV-6 or HHV-7) infection in an active phase – 20 (25–18.3) pg/ml. In addition, in ME/CFS patients with a persistent double (HHV-6+HHV-7 and HHV-7+B19V) and a triple (HHV-6+HHV-7+B19V) infection in an active phase IL-10 level was 21 (98.8–10.3) and 22 (130–12.2) pg/ml, respectively. Median IL-10 level was 5 (11.6–3.1) pg/ml for patients without infection (p = 0.0023) (Figure 3.14.d).
71
Figure 3.14 Median (IQR) IL-6 (a), TNF-α (b), IL-12 (c) and IL-10 (d) levels in ME/CFS patients with and without persistent infection/co-infection WI-without infection, LIC – latent infection/co-infection, ASI – active single infection, ADI –active double infection, ATI – active triple infection
3.6.4. ME/CFS typical symptoms in patients with infection/co-infection
ME/CFS clinical symptoms in case of a persistent single HHV-6, HHV-7 and B19V infection and co-infection (double HHV6+HHV-7, HHV-7+B19V and triple HHV-6+HHV-7+B19V) in latent and active phase with p value (Fisher's exact test) are shown in Table 3.7, Figure 3.15, Figure 3.16, and Figure 3.17.
72
Table 3.7 Occurrence of typical ME/CFS clinical symptoms in ME/CFS patients with persistent HHV-6, HHV-7 and B19V infection/co-infection in latent and active phase
Symptoms
joint pain joint
-
subfebrility
muscle pain muscle
exertional malaise exertional
-
multi
impaired memory memory impaired
lymphadenopathy
sleep disturbances sleep
headache of new type new of headache
post
decreased concentration decreased
Infection Infection phase
chronic fatigue (>6 months) (>6 fatigue chronic Latent 100 52.2 76.1 80.4 76.1 47.8 56.5 52.2 60.9 45.7 single Active 100 52.9 58.8 82.4 76.5 70.6 41.2 52.9 29.4 35.3 single p >0.999 >0.999 0.2158 >0.999 >0.999 0.155 0.395 >0.999 *0.045 0.5708 value 9 9 9 9 7 9 2 Latent 100 62.7 66.7 66.7 64.7 58.8 58.8 58.8 39.2 37.3 double Active 100 50.0 70.4 72.2 70.4 64.8 46.3 48.1 48.1 46.3 double p > 0.2385 0.8337 0.6718 0.6768 0.552 0.242 0.3294 0.4323 0.4295 value 0.9999 5 4 Latent 100 66.7 50 66.7 83.3 33.3 33.3 66.7 16.7 100 triple Active 100 78.9 57.9 47.4 78.9 47.4 52.6 52.6 47.4 31.6 triple p >0.999 0.6061 >0.999 0.6447 >0.999 0.660 0.644 0.6609 0.3449 *0.005 value 9 9 9 9 7 2 * statistically significant (p < 0.05)
Figure 3.15 ME/CFS typical symptoms in patients with persistent single infection in latent and active phase
73
Figure 3.16 ME/CFS typical symptoms in patients with persistent double (HHV-6+HHV-7 and HHV-7+B19V) infection in latent and active phase
Figure 3.17 ME/CFS typical symptoms in patients with persistent triple (HHV-6+HHV-7+B19V) infection in latent and active phase
3.6.5. Severity of ME/CFS in patients with infection/co-infection
Severe course of disease was experienced by 18.7% and moderate – by 81.3% of patients with ME/CFS (p < 0.0001). In patients with severe and moderate ME/CFS median (IQR) IL-6 level was 1.5 (5.2–1.1) pg/ml and 4.5 (5.7–2) pg/ml, respectively (p = 0.0506). TNF-α level was 103 (150.7–44.7) pg/ml in patients with severe and 58 (123–32) pg/ml with moderate ME/CFS (p = 0.0434). In patients with ME/CFS and a severe course of the disease IL-12 level was 19.9
74 (37.3–15.5) pg/ml and with a moderate course – 13.8 (16.4 –7.4) pg/ml (p = 0.0494). Moreover, IL-10 level was 35 (90–8.8) pg/ml in patients with severe and 12.4 (25–6.7) pg/ml with moderate severity of ME/CFS (p = 0.025) (Figure 3.18).
Figure 3.18 Median (IQR) IL-6, TNF-α, IL-10 and IL-12 level in ME/CFS patients with severe and moderate course of the disease * statistically significant, CC – clinical course
HHV-6 load in ME/CFS patients with a severe course of the disease was median (IQR) 1134 (2962–34.5) copies/106 cells and with a moderate course – 391.8 (3190–162.8) copies/106 (p = 0.7656). Though HHV-7 load in patients with severe ME/CFS was 303.6 (514.8–174) copies/106 cells and with a moderate disease course – 175.7 (402.7–90) copies/106 cells (p = 0.0254), but B19V load in cases of severe and moderate ME/CFS was 8 (13.5–2.5) copies/µg DNA (53 copies/106 cells) and 30 (79.1–5.6) copies/µg DNA (197.8 copies/106 cells), respectively (p = 0.2353) (Figure 3.19).
75
Figure 3.19 Median (IQR) HHV-6, HHV-7 (copies/106 cells) and B19V (copies/µg DNA) load in ME/CFS patients with severe and moderate course of the disease * statistically significant, CC – clinical course
76 4. DISCUSSION
ME/CFS is a multifactorial disorder characterized by several symptoms, which frequently follow after a virus infection or prolonged stress. It involves severe fatigue with unexplained pathophysiology leading to the inability to work. After decades of great effort in research, there is still no accordance regarding frequency and severity of immune disturbances in this condition (Bansal et al., 2012; Committee on the Diagnostic Criteria for Myalgic Encephalomyelitis/Chronic Fatigue Syndrome et al., 2015). Contradictions exist on ME/CFS as an organic or psychological disease and some even doubted existence of this disease (Underhill, 2015). Various available ME/CFS diagnostic criteria are used in separate studies, creating diversity in disease prevalence and heterogeneity among researches, therefore single common diagnostic criteria should be introduced in use (Johnston et al., 2013). ME/CFS is recognized as a heterogeneous disease with a lack of homeostasis in multiple organ systems accompanied by psychosocial problems that reduce the quality of life (Winger et al., 2015; Glassford, 2017). Virus infections are believed to be one of ME/CFS potential triggers, because infectious-like symptoms are present in many ME/CFS patients during sudden onset of the disease. Fatigue can be the consequence of a post-viral infection and immunological dysfunctions may be caused or facilitated by a virus infection in patients with ME/CFS. However, there is no consensus on implication of a virus infection in ME/CFS (Morinet and Corruble, 2012). It is not clear, whether an active HHV-6A, HHV-6B, HHV-7 and B19V infection causes ME/CFS or follows the disease. In this study the biological material of 200 patients with clinically diagnosed ME/CFS and 150 apparently healthy individuals’ is analysed with molecular and serological laboratory methods to determine presence, load and activity phase of HHV-6A, HHV-6B, HHV-7, B19V and XMRV, as well as the level of cytokines in association with clinical symptoms. ME/CFS is more prevalent in females compared to males. It is reported that 65 to 80% of adult females have ME/CFS (Underhill, 2015). Likewise, in this study 65% of patients with ME/CFS are females, albeit the prevalence of ME/CFS could be higher than currently assessed. A part of patient responds to treatment and ME/CFS diagnosis is not maintained, though they are not full-recovered, can experience repeated remission and relapse (Underhill, 2015). Onset of ME/CFS can happen at any age, though patients are characterized by a peak at the age of 10 to 19 years and 30 to 39 years (Bakken et al., 2014). This corresponds to average age of adult patients in our study (38 ± 12 years).
77 Support for hypothesis of ME/CFS as an infectious disease for at least a subgroup of patients is published (Underhill, 2015). XMRV as potential causative factor of ME/CFS was considered since 2009, when 67% of patients and 3.7% of healthy donors are reported to be XMRV positive (Lombardi et al., 2009). Next year the publication revealed MLV-related virus gag gene sequence in 86.5% of ME/CFS patients and in 6.8% of controls, whereas env gene sequence in one patient and in one control group individual (Lo et al., 2010). However, these reports are in contrary to this study result, where XMRV specific gag and env gene sequences are absent in DNA isolated from peripheral blood of 150 ME/CFS patients and 30 apparently healthy individuals. The obtained results are in line with majority of published researches worldwide, where XMRV is not detected in patients with ME/CFS. Following many studies for a couple of years, XMRV is concluded not to be associated with human diseases and the detection of viral markers could be a result of contamination (Groom and Bishop, 2012). Trigger factor could differ from causal factor of ME/CFS aetiology and Underhill in 2015 discusses that related pathogens instead of different ones causes this disease (Underhill, 2015). The presence of virus-specific IgG class antibodies in blood plasma or serum is observed in patients with history of an infection, whereas virus-specific IgM class antibodies and virus genomic sequence in DNA from cell-free plasma is present during an acute or primary infection and an active viral infection (Liefeldt et al., 2005). Considering that the primary infection with these viruses usually occurs in early childhood, in case of a persistent infection in adults the presence of virus genomic sequence in DNA isolated from cell-free plasma is a marker for virus reactivation. It is accompanied by detectable virus genomic sequence in DNA isolated from whole blood or blood leukocytes indicating a persistent virus infection (Traylen et al., 2011). In this study, the frequency of B19V specific IgG class antibodies is similar in patients with ME/CFS (70%) and apparently healthy individuals (67.4%) (p = 0.6803). Furthermore, none of apparently healthy individuals but 8% of patients with ME/CFS have IgM class antibodies (p = 0.0038). Other B19V seroprevalence studies likewise do not find a significant difference between the presence of B19V specific IgG class antibodies in patients and control group, reporting that B19V seroprevalence in population varies from 60% to 80%, but others show B19V specific IgG class antibodies in 74% and IgM – in one patient with ME/CFS (Cooling et al., 1995; Zhang et al., 2010). Similarly, anti-B19V VP2 IgG class antibodies are revealed in 75% of 200 apparently healthy individuals and in 78% of 200 patients with ME/CFS. Four out of these ME/CFS patients have anti-B19V VP2 IgM class antibodies
78 (Kerr et al., 2010). The percentage of B19V specific antibody prevalence is typical to general population (Zhang et al., 2010). Considering that B19V seroprevalence increases from 2% in children under age of 5 years up to 85% in elderly people (Servant-Delmas et al., 2010) and the mean age of this study cohort is 38 ± 12 years, results on frequency of IgG class antibodies are consistent with worldwide population. In this study the presence of B19V NS1 specific antibodies accompanied by the presence of B19V DNA is found in 20/39 (51.3%) analysed ME/CFS patients, asserting the persistence of B19V infection. These results coincide with Kerr et al., publication, where IgG class antibodies against NS1 protein are detected in more patients (41.5%) than controls (7%) and are associated with a high expression level of CFS-related NHLH1 and GABPA genes. In Kerr publication B19V specific NS1 IgM class antibodies are found in three patients and one donor. Detectable B19V specific NS1 antibodies indicate on a severe and persistent infection, therefore immune system of a part of the patients is not able to control the virus sufficiently (von Poblotzki et al., 1995; Kerr et al., 2010). In this study B19V genomic sequence is more frequently detected in patients with ME/CFS (29%) than apparently healthy individuals (3.8%) (p < 0.0001). A significant difference is revealed between patients (12%) and apparently healthy individuals (1.9%) in case of a latent/persistent B19V infection (virus genomic sequence only in DNA isolated from leukocytes) (p = 0.002). In addition, an active B19V infection (B19V genomic sequence also in cell-free blood plasma DNA) is significantly often detected in patients with ME/CFS (17%) than apparently healthy individuals (1.9%) (p < 0.0001). Furthermore, B19V replication is proven in patients with a persistent B19V infection by the detection of NS1 gene expression in patients PBMCs. Other studies have also reported the detection of B19V DNA, mRNA and protein in macrophages, T and B cells, follicular dendritic cells and in monocytes (Takahashi et al., 1998), whereas B19V infection of monocyte cell line U937 can be abortive due to a lack of viral particle production (Munakata et al., 2006). The results of our study are in accordance with publications by other researchers who conclude that at least in part of patients B19V could be involved in etiopathogenesis of ME/CFS due to the detection of B19V infection markers in 40% of patients and almost 15% of controls (Fremont et al., 2009). In this study the frequency of elevated B19V load is significantly often estimated in ME/CFS patients than in apparently healthy individuals (p = 0.0003). Moreover, in case of an active B19V infection the viral load is higher than in patients with a latent/persistent B19V infection. Reports from other studies show the detection of B19V genomic sequence with real-time PCR only in patients with ME/CFS and not in control group (Kerr et al., 2010). However part of researchers report no association of B19V
79 infection with ME/CFS, because markers of B19V are not detected in all ME/CFS cases (Sanders and Korf, 2008). Conversely, B19V genomic sequence also is not detected in up to four years old Brazilian children with Exanthema subitum (Magalhaes Ide et al., 2011). Furthermore, reviewing neurological aspects of B19V infection, nine reports have published a correlation of ME/CFS with an acute B19V infection, however two studies deny it (Barah et al., 2014). It is reported that in case of a relative recent or early infection phase IgG reactivity against B19V VP1 linear epitopes, VP2 conformational and linear epitopes is present. Six months after B19V infection IgG response to VP2 linear epitopes decreases, therefore during a sustained infection antibodies against VP1 linear epitopes and VP2 conformational epitopes are detectable (Soderlund et al., 1995; Manaresi et al., 1999; Modrow and Dorsch, 2002; Pfrepper et al., 2005). The analysis of B19V IgG and IgM class antibodies’ patterns discloses an acute infection in only one ME/CFS patient. Recent infection is observed in more patients with the presence of B19V genomic sequence (41%) detected by nPCR than without it (30.6%), though not statistically significant (p = 0.4706). Furthermore, a sustained infection is significantly often found in patients with (56.4%) than without (27.8%) detectable B19V genomic sequence in DNA from whole blood (p = 0.0191). The presence of virus-specific IgG class antibodies in absence of genomic sequence shows a past infection, while the presence of B19V specific antibodies and genomic sequence indicates on a persistent B19V infection (Hemauer et al., 2000). The data of this study show that B19V infection can persist for years. In total a recent B19V infection is revealed in 36% and sustained – in 43% of all the analysed patients that correspond to onset of ME/CFS typical clinical symptoms. In patients with a recent B19V infection, ME/CFS symptoms started 8.3 ± 1.6 months ago and with a sustained infection – 12.1 ± 7.8 months ago, indicating that B19V infection is a potential promoter of this disease. In addition, a severe clinical course of ME/CFS is experienced by more patients with a sustained (28.1%) than with a recent BV19 infection (18.5%), thus pointing to the gradual increase in the symptoms of the disease during an infection. Findings of B19V infection in ME/CFS tends to confirm the hypothesis of B19V as a possible trigger for this disease, however ME/CFS could be caused by various factors and some infectious agents may contribute to forming a subset of this illness (Kerr et al., 2010). However, no specific pathogen is detected yet and rather could be viral than bacterial due to failure of antibiotic treatment. Likewise, ME/CFS could be caused by unidentified novel single or related pathogens (Underhill, 2015). In our study HHV-6 seropositivity is revealed in 92.1% of patients with ME/CFS and 76.7% of analysed apparently healthy individuals showing a difference between these groups.
80 Whereas IgM class antibodies are found in 6.1% of patients and only 2.2% of controls (p = 0.2227). Published results on the prevalence of HHV-6 antibodies by other researchers are discrepant. Some report on a higher frequency of IgM class antibodies among patients with ME/CFS (50%) compared to donors (28.5%), while some do not find any difference between patients and control groups (Levine et al., 2001; Burbelo et al., 2012). Despite potential differences in geographic distribution, the prevalence of HHV-6 IgG class antibodies in apparently healthy individuals (76.7%) from this study correspond to previously published in Greece (78.8%) that does not differ from the age and gender of adults (Politou et al., 2014). However, Ablashi with colleagues detected IgM class antibodies more frequently in ME/CFS patients (57.1%) and donors (16%) than in our study (6.1% and 2.2%, respectively) (Ablashi et al., 2000). According to PCR results a persistent HHV-6 infection in a latent phase is observed in more patients with ME/CFS than in apparently healthy individuals (42% vs 28.7%, p = 0.0133). Moreover, a persistent HHV-6 infection in an active phase is detected only in patients with ME/CFS (11%) and none of donors (p < 0.0001). Similar to this study results, Di Luca with colleagues found HHV-6 genomic sequences in 44% of patients and 29% of donors (Di Luca et al., 1995). Analysing a larger cohort, HHV-6 is reported to be present in 70% of patients and 20% of controls (Buchwald et al., 1992). Furthermore, 30.5% of patients and 9% of donors have an active HHV-6 infection (Nicolson et al., 2003). Publications show the correlation of an active HHV-6 replication with ME/CFS, which can be emerged from reactivation of a latent virus infection (Ablashi et al., 2000; Buchwald et al., 1992; Sairenji et al., 1995). However, other studies show no difference in the frequency of HHV-6 infection between patient and control groups (Wallace et al., 1999; Reeves et al., 2000; Cameron et al., 2010). Important is a fact that some study cohorts are too small to draw general conclusions about association of a virus infection with ME/CFS. HHV-6A is detected in only one patient with ME/CFS showing that HHV-6B is prevalent among ME/CFS patients in Latvia. Similarly, in another study HHV-6B is more present (75%) than HHV-6A (9.7%) in patients with ME/CFS (Burbelo et al., 2012). Sairenji et al., finds both HHV-6A and HHV-6B antibody titers higher in patients than controls (Sairenji et al., 1995). Controversial, in other studies HHV-6A is more prevalent in patients with ME/CFS but HHV-6B ‒ in controls (Di Luca et al., 1995; Ablashi et al., 2000). These differences can be explained by geographic location, because another study in Latvia also reports on the detection of HHV-6B in Latvian patients with other diseases, like autoimmune thyroiditis (Sultanova et al., 2017).
81 The first gens, which are transcribed after HHV-6 infection are immediate early (IE) genes. IE U89/90 α-gene is expressed in 78% of analysed patients with the presence of HHV-6 showing HHV-6 transcription, as well as optimization of a cell for virus gene expression and replication in these patients with ME/CFS (Mirandola et al., 1998; De Bolle et al., 2005). The detection of specific mRNA is not always a marker for new protein synthesis. Accumulation of transcripts can occur prior to protein synthesis (Mirandola et al., 1998). Moreover, mRNA is not detected in all cases due to potential replication site in lymphoid tissue or other organs, instead of PBMCs (Van den Bosch et al., 2001). HHV-6 reactivation and replication in these ME/CFS patients are proven by the detection of HHV-6 early and late proteins with virus-specific monoclonal antibodies. In our study analysing PBMCs from 36 patients, six patients have early viral protein p41, which is encoded by U27 ORF, appears before viral DNA synthesis and has a DNA polymerase processing function. It is detected with HHV-6 specific antibodies 6A5D12, which react in cell nucleus and are specific to HHV-6A and HHV-6B. Moreover, samples were positive using HHV-6B specific OHV-3 antibodies in 15 patients with ME/CFS, identifying HHV-6B reactivation. These antibodies recognize HHV-6 glycoprotein gH or gp100 which is encoded by U48 ORF and induces cell fusion. Furthermore, seven ME/CFS patient samples were positive using OHV-1 antibodies, which react with HHV-6A and HHV-6B and are associated with virus replication. These monoclonal antibodies recognize glycoprotein gB or gp116 which is encoded by U39 ORF (De Bolle et al., 2005). The analysis of a virus copy number by real-time PCR reveals that HHV-6 load is significantly frequently elevated in ME/CFS patients compared to apparently healthy individuals (p = 0.0064). In patients with a persistent HHV-6 infection in an active phase the viral load is almost seven times higher than in patients with a persistent infection in a latent phase (p = 0.0019). The detection of elevated viral load in all patients with a persistent HHV-6 infection in an active phase as well as a significantly higher viral load in patients with an active infection suggests the usage of an elevated viral load as a marker to distinguish latent from active infection phase. During an active infection, the virus replicates through a rolling circle mechanism and maintains the viral genome as a circular episome. Some patients with HHV-6 related diseases have very high viral loads that can show ciHHV-6 instead of high level of viral replication. Therefore, in patient treatment and association of the virus with this disease it is important to distinguish an active viral infection from integration (Clark, 2016). Telomeric repeats at the end of HHV-6 genome allow integration into host cell telomeres during homologous recombination (Kaufer and Flamand, 2014). Integration in germ line cells can be transmitted
82 to progeny, therefore the virus integrates in a specific chromosome of every nucleated cell (Gravel et al., 2015). It is proved that germ line integrated HHV-6 can be activated to a transmissible infectious form in cell culture (Prusty et al., 2013 b) and can produce infectious virions in patients with immunodeficiency (Endo et al., 2014). Literature data suggest HHV-6 integration in case of detected virus genome copy in every cell of the body (Gravel et al., 2015). In this study possible HHV-6 chromosomal integration is suspected in six ME/CFS patients, due to a high viral load – more than one HHV-6 copy per cell [median (IQR) 1209033 (1464421–808183) copies/106 cells]. Dr. Prusty with colleagues analysed cells from patients with detected HHV-7 sequences in DNA isolated from peripheral blood and demonstrate telomeric integration of HHV-7 into chromosomes (Prusty et al., 2017). HHV-7 chromosomal integration was estimated in one Latvian ME/CFS patient with more than one copy of HHV-7 per cell (1140127.6 copies/106 cells) and confirmed with HHV-7 load detection in DNA from hair follicle (1188811.8 copies/106 cells), as well as with fluorescence in situ hybridisation analysis by Prusty et al., 2017. Germ line integration of HHV-7 was confirmed by the detection of more than two HHV-7 copies per cell (2591031.6 HHV-7 copies/106 cells) in patient’s mother’s hair follicle DNA. In case of a high viral load, it is necessary to distinguish between active viral replication and chromosomal integration to adjust appropriate treatment (Clark, 2016). Moreover, a probability that in some cases an integrated virus is unable to replicate due to such defect, as mutation of genes for lytic replication should be taken into account (Montoya et al., 2012). In our study, HHV-7 specific IgG class antibodies are detected in 84.6% of ME/CFS patients and 93.8% of apparently healthy individuals corresponding to HHV-7 seroprevalence of around 90% among worldwide adult population (Caselli and Di Luca, 2007). The presence of IgM class antibodies is not analysed, as using antibodies it is difficult to distinguish virus reactivation from an acute viral infection without the analysis of antibody spectre (Krueger and Ablashi, 2006). The frequency of a persistent HHV-7 infection in a latent phase is similar between patients with ME/CFS (58%) and apparently healthy individuals (67.3%) (p = 0.0766) while a persistent HHV-7 infection in an active phase is more often found in patients with ME/CFS (34%) than apparently healthy individuals (8%) (p < 0.0001). Moreover, self-assembled HHV-7 U57 gene, which forms an icosahedral capsid, is expressed in 45.7% of analysed patients with HHV-7, indicating on active replication. Worldwide studies on HHV-7 in patients with ME/CFS are very scarce. Some find HHV-7 specific antibodies in 91.4% of
83 patients and 88% of controls, whereas some in all ME/CFS patients and 88% of controls (Sairenji et al., 1995; Ablashi et al., 2000). HHV-7 load in our study is more frequently elevated in patients with ME/CFS than apparently healthy individuals are (p < 0.0001). Patients with a persistent HHV-7 infection in an active phase have a higher viral load than with a latent infection, though without statistical significance (p = 0.3502). The data published by Oakes et al., coincide with our results ‒ they also do not find any statistical difference between HHV-7 copy number in patients and controls DNA isolated from PBMCs and saliva (Oakes et al., 2013). Recently published research data also support the hypothesis on herpesviruses involvement in ME/CFS development due to expression of herpesviruses encoded deoxyuridine triphosphate nucleotidohydrolases – dUTPases that activates humoral immune response (Halpin et al., 2017). Besides, detectable reactivation of HHV-6 and HHV-7 in saliva is considered as a biomarker for physiological fatigue, therefore can be used to distinguish between pathological and physiological fatigue (Aoki et al., 2016). The percentage of HHV-6, HHV-7 and co-infection is estimated to be similar between patients and controls, nevertheless HHV-7 is revealed twice as much as HHV-6 (Wallace et al., 1999). Elsewhere differences in detection of HHV-6, HHV-7 and B19V in twins with and without ME/CFS are not observed (Koelle et al., 2002). Furthermore, Fremont with colleagues estimate similar amount of HHV-6 and HHV-7 positive cases with high loads in gastric and intestinal mucosa tissue from patients and donors. In the same work, B19V is detected significantly more in ME/CFS than in control group (Fremont et al., 2009). Previous studies by colleagues in our laboratory demonstrate the reactivation of HHV-6 and HHV-7 in patients with ME/CFS (Chapenko et al., 2006). The analysis on the presence of herpesviruses genomic sequences in healthy blood donors in Latvia are also conducted (Kozireva et al., 2001). Subsequently, an active HHV-6, HHV-7 and B19V infection and a simultaneous dual or triple infection of these viruses is present in patients with ME/CFS (Chapenko et al., 2012). Analysing co-infections of HHV-6/HHV-7/B19V in this study, a persistent infection/co-infection is more frequently found in patients with ME/CFS (96.5%) than apparently healthy individuals (85.3%) (p = 0.0003). From them a persistent infection/co-infection in a latent phase is revealed in a half of patients with ME/CFS (51.1%) and ¾ of apparently healthy individuals (76.7%) (p < 0.0001). However, a persistent infection/co-infection in an active phase is present significantly more often in patients (45%) than in apparently healthy individuals (8.7%) (p < 0.0001), showing the relevance of an active viral infection in ME/CFS.
84 Persistent single HHV-6 and HHV-7 infection in a latent phase is more often observed in apparently healthy individuals (p = 0.0393 and p < 0.0001, respectively), whereas a frequency of a persistent single B19V infection and a latent double HHV-6+HHV-7 co-infection is similar between patients and controls (p > 0.9999 and p = 0.8916, respectively). In contrary, a persistent double HHV-7+B19V and a triple HHV-6+HHV-7+B19V infection in a latent phase more often is present in patients with ME/CFS than apparently healthy individuals (p = 0.005 and p = 0.0395, respectively). These results demonstrate that the role of a persistent infection in a latent phase cannot be excluded from studies searching for the trigger factors of ME/CFS and factors influencing disease pathogenesis. Notably, single B19V infection is detected in only one patient and two apparently healthy individuals from this cohort. Considering that herpesviruses can be helper viruses for subfamily of parvoviruses – dependoviruses replication, hypothetically they could serve as triggers for B19V infection (Streiter et al., 2011). The data of this study demonstrate no difference in the frequency of a persistent single infection in an active phase among patients with ME/CFS and apparently healthy individuals, whereas a persistent double HHV-7+B19V infection in an active phase is observed in significantly more patients compared to apparently healthy individuals (p = 0.0002). Moreover, an active double HHV-6+HHV-7 and active triple co-infection is found only in patients with ME/CFS (p < 0.0001 and p < 0.0001, respectively), distinctly indicating the involvement of an active co-infection in the development of ME/CFS. Patients with a persistent infection/co-infection in an active phase have a significantly frequently elevated HHV-6 and HHV-7 load compared to a latent phase (p = 0.0028 and p = 0.0209, respectively). HHV-6 and B19V load is significantly higher in patients with an infection/co-infection in an active than in a latent phase (p = 0.0251 and p = 0.0444, respectively). In addition, HHV-7 load is higher in patients with a severe compared to a moderate course of ME/CFS, therefore it could be linked with symptoms severity (p = 0.0254). Other researchers have not analysed viral loads according to co-infections, though they find a similar tendency of higher HHV-7 prevalence and load, as well as a higher B19V frequency in patients with ME/CFS compared to controls suggesting B19V involvement in ME/CFS. Controversial to our research, they do not determine the difference of HHV-6 frequency and load in patients and controls (Fremont et al., 2009). A limited number of studies have analysed the presence of several co-infections in ME/CFS, moreover most of them do not distinguish latent from active infection (Sairenji et al., 1995; Koelle et al., 2002). Many authors have analysed the presence of herpesvirus
85 co-infection and only few of them have included B19V in co-infection analysis (Ablashi et al., 2000; Fremont et al., 2009). HHV-6/EBV/B19V co-infection is reported in around 17% of both patients and controls, whereas HHV-7 is observed in a majority of analysed individuals (Fremont et al., 2009). In this study, we have observed a similar tendency where all co-infections are accompanied by HHV-7, therefore findings of this study support the hypothesis of ME/CFS association with several closely related pathogens (Underhill, 2015). An active virus may be undetectable in many patients’ body fluids because of possible latency in other tissues than peripheral blood (Hüfner et al., 2007). Therefore, although the presence of a virus infection is not detected in all cases of ME/CFS, it could form a subgroup of this disease. Similarly, endocrine, immunological, psychosocial, genetic factors and factors predisposing oxidative stress are considerable in dividing patients into subgroups (Sanders and Korf, 2008). It is hypothesized that ME/CFS could be caused by neurotropic viruses, like HHV-6 and HHV-7, which can infect neurons and immune cells to impair CNS capillaries and micro-arteries, leading to brain damage. This infection initiates immune system disturbances that in its turn can lead to a chronic infection. Immunosuppression and activated immune complexes may cause chronic inflammation, which facilitates the establishing of a persistent infection (Krueger and Ablashi, 2006; Broderick et al., 2010; Glassford, 2017). Furthermore, chronic immune system activation is accompanied by alterations in regulation of cytokine production (Sairenji and Nagata, 2007). Cytokines are small proteins, involved in cell signalling, mostly providing a balance between humoral and cell mediated immune response. Pro-inflammatory cytokines ensure systemic inflammation and anti-inflammatory – inhibition of pro-inflammatory cytokines (Mensah et al., 2017). The analysis of cytokine levels in this study reveals that patients with ME/CFS have elevated levels of pro-inflammatory (IL-6, TNF-α and IL-12) and anti-inflammatory (IL-10) cytokines comparing to apparently healthy individuals. Moreover, ME/CFS patients with a persistent infection in an active phase have higher levels of cytokines than in patients with a persistent infection in a latent phase, however not in all cases statistical difference is confirmed. In contrary, the level of IL-4 is not elevated in patients with ME/CFS, what is supported by other studies where no difference is found in the level of IL-4 between ME/CFS patients and healthy controls (Nakamura et al., 2010; Brenu et al., 2011; Lidbury et al., 2017). Elsewhere IL-4 is found to be higher in women with this disease compared to women in control group (Fletcher et al., 2009). The inconsistency among studies on cytokine levels in patients with ME/CFS are explained by variations in patient and control recruitment in terms of diagnostic criteria,
86 onset, duration and phase of the disease, as well as time of sample collection and used laboratory methods (Mensah et al., 2017). Findings on increased level of several cytokines after exertion are found in patients with severe symptom flare (White et al., 2010). In addition, disease duration for more than three years is reported to impact immune signatures (Hornig et al., 2015). It is shown that HHV-6 can infect monocytes/macrophages and inflammatory cytokines can contribute in the reactivation of this virus from a latent phase (Aoki et al., 2016). In our study IL-6 level is elevated significantly more frequently in patients with a persistent HHV-6 infection in an active phase (55%) than in a latent phase (28.8%) (p = 0.0356). In addition, the level of pro-inflammatory IL-12 is significantly higher in patients with a persistent HHV-6 infection in active than in latent phase (p = 0.0386). TNF-α level is elevated significantly more frequently in patients with a persistent HHV-7 infection in an active phase (83.6%) than in a latent phase (65.2%) (p = 0.0096). Whereas IL-10 level is higher in patients with HHV-7 infection in active compared to latent phase (p = 0.0421). Previous studies show a higher level of IL-12 and TNF-α in the presence of active than latent HHV-6 and HHV-7 infection (Nora-Krukle et al., 2011). ME/CFS patients with active B19V infection concentration of IL-6 is elevated more frequently (45.5%) than in patients with a latent/persistent B19V infection (8.3%) (p = 0.0031). Increased production of TNF-α and IL-6 is also reported in case of B19V infection (Kerr et al., 2001; Kerr and Tyrrell, 2003; Munakata et al., 2006). Viral infection induced prolonged state of immune disbalance accompanied by changes in cytokine level, can lead to the development of ME/CFS clinical symptoms. Findings in this study correspond to Brenu et al., findings of Th1/Th2 cytokine response imbalance that is reflected by increased levels of TNF-α and IL-10, suggesting a persistent chronic infection (Couper et al., 2008; Brenu et al., 2011). Despite frequent findings of elevated IL-6 in patients with active single HHV-6 and B19V infection, analysing the level of cytokines in case of co-infections, no difference is confirmed in the level of IL-6 among patient groups without infection, with a latent infection/co-infection, active single, double and triple co-infection (p = 0.1289). Though a significant difference is revealed in levels of TNF-α, IL-12 and IL-10 among five above mentioned groups (p = 0.0492, p = 0.0063 and p = 0.0023, respectively). Our study results are in accordance with those in the published report on equally raised IL-6 level without any difference between patients’ and donors’ group (Brenu et al., 2011). Other researchers also do not find differences in the level of IL-6 amongst ME/CFS and control cases (Ter Wolbeek
87 et al., 2007; Lidbury et al., 2017). Further analysis discloses a higher level of IL-6 in patients with an active double co-infection than in patients with a latent infection/co-infection and without infection (p = 0.0319 and p = 0.0418, respectively). Despite the fact that a level of IL-6 is elevated only slightly, the results show differences among patients with a persistent co-infection in latent and in active phase, which can be observed only analysing certain ME/CFS patients groups with co-infection. Other studies also report on a raised level of IL-6 in patients with ME/CFS (Fletcher et al., 2009). Taking into account that average onset of ME/CFS among patients included in this study is 10.2 ± 4.2 months, discrepant results can be explained by a difference in the duration of disease. Findings of high IL-6 level concern older patients with the duration of ME/CFS for more than two years but a low level of IL-6 concern younger patients with a resent occurrence of disease (early disease) (Russell et al., 2016). Particularly higher level of TNF-α is found in patients with an active triple co-infection if compared to a latent infection/co-infection and an active double co-infection, presenting a role of an active co-infection with multiple viruses in increase in TNF-α level, which indicates on inflammation that could be caused by a viral infection (p = 0.0045 and p = 0.0158, respectively). A study by Brenu and co-authors shows a higher level of TNF-α in ME/CFS patients, however some authors do not find any difference between patients and controls (Fletcher et al., 2009; Nakamura et al., 2010; Brenu et al., 2011; Lidbury et al., 2017). It is shown that low-level inflammation and activation of cell-mediated immunity is observed in ME/CFS cases and the high level of TNF-α correlates with several clinical symptoms, therefore an increase of inflammatory mediators might explain why these disease symptoms exist (Maes et al., 2012). Similarly, in case of an active triple co-infection the level of IL-12 is more elevated than in a latent infection/co-infection, active single and active double infection cases (p = 0.0003, p = 0.0125, p = 0.0195, respectively). The same tendency in IL-12 level is observed between patients with an active triple co-infection and without infection (p = 0.0636). Elevated level of IL-12 is admitted to have a good biomarker potential in ME/CFS (Fletcher et al., 2009). Russell and co-workers also record increased expression of IL-12 in their study (Russell et al., 2016). In contrary, elsewhere a decreased level of IL-12 is reported (Visser et al., 2001). Significantly higher level of IL-10 is observed in patients with an active double co-infection compared to patients without infection and with a latent infection/co-infection (p = 0.029 and p = 0.0035, respectively). In addition, ME/CFS patients with an active triple co-infection have a higher level of IL-10 in comparison to patients without infection, with a latent infection/co-infection and an active single infection (p = 0.0107, p = 0.0034 and
88 p = 0.0321, respectively). The same tendency of IL-10 level increase in patients with ME/CFS is presented in several studies (Visser et al., 2001; Ter Wolbeek et al., 2007; Nakamura et al., 2010; Brenu et al., 2011). However, some researchers find a similar level of IL-10 in patients and controls, but some find a higher level of IL-10 even in healthy controls (Kavelaars et al., 2000; Patarca, 2001; Fletcher et al., 2009; Lidbury et al., 2017). Cytokines can serve as markers for virus induced changes in cell immunity and an elevated level of certain cytokines can be associated with inflammation caused by a virus infection (Nastke et al., 2012). Broderick et al., demonstrate existing immune disturbances in ME/CFS caused by complex networks of cytokine co-expression (Broderick et al., 2010). The data of this study show that the level of cytokines is changed significantly in case of co-infections. Moreover, patients with an active co-infection demonstrate a higher level of pro-inflammatory and anti-inflammatory cytokines. It is proved, that the level of pro-inflammatory cytokines correlates with the severity of ME/CFS and sleep disturbances (Milrad et al., 2017). Besides, the level of TNF-α in patients with ME/CFS correlates with a degree of fatigue (Bansal et al., 2012). In our study a level of TNF-α, IL-12 and IL-10 is statistically significantly higher in patients with a severe course of ME/CFS compared to those with a moderate course (p = 0.0434, p = 0.0494 and p = 0.025). Inversely, the level of IL-6 tends to be higher in patients with moderate severity of the disease (p = 0.0506). Stress and fatigue are estimated to be greater in patients with an elevated level of IL-6 (Lattie et al., 2012). A moderate course of ME/CFS is experienced by most of the patients in this study (81.3%) that could be because of the level of IL-6, which is not significantly elevated. It is possible that a virus infection causes a cellular immunity dysfunction, which induces virus reactivation. Subsequently, viral proteins facilitate cytokine secretion, resulting in emergence of ME/CFS typical symptoms, such as fatigue, fever, sleep and cognitive disorders (Bansal et al., 2012). Chronic pain can be caused by inflammatory signals that are spread by glial cells, whereas inflammatory cytokines and neuronal stimulation can activate glial cells (Yasui et al., 2014; Glassford, 2017). Besides chronic fatigue for more than six months, which all patients with diagnosed ME/CFS have, impaired memory, decreased concentration and sleep disturbances are the most frequently observed symptoms in these patients. The presence of typical ME/CFS symptoms is reported more frequently among patients in the Netherlands and the United Kingdom. Besides these symptoms, cognitive dysfunction, sleep disturbances and post-exertional malaise are most frequent reported and are acknowledged to be essential symptoms of ME/CFS (Collin et al., 2016).
89 The analysis of single HHV-6, HHV-7 and B19V infection does not reveal any statistically significant differences in occurrence of typical ME/CFS clinical symptoms among patients with a persistent infection in latent and active phase. Patients with a persistent HHV-6 infection in an active phase compared to a latent phase frequently have impaired memory (77.3% vs 65.5%) and sleep disturbances (81.8% vs 76.2%), respectively. However, following symptoms are observed in more patients with HHV-6 infection in latent than in active phase: decreased concentration (73.8% vs 63.6%), lymphadenopathy (57.1% vs 45.5%), and headache of a new type (44% vs 40.9%), respectively. Although the difference is not significant, decreased concentration (73.5% vs 68.1%), sleep disturbances (77.9% vs 67.2%) and subfebrility (61.8% vs 55.2%) is observed more in patients with a persistent HHV-7 infection in active than in latent phase, respectively. Inversely, impaired memory (68.1% vs 64.7%), lymphadenopathy (54.3% vs 45.6%), muscle pain (57.8% vs 47.1%), multi-joint pain (47.4% vs 44.1%) and headache of a new type (44% vs 39.7%) are observed in more patients with a persistent HHV-7 infection in latent than in active phase, respectively. Impaired memory and subfebrility are ascertained more often in patients with active (70.6% and 58.8%) than in patients with a latent/persistent B19V infection (50% and 37.5%), respectively. A similar tendency in occurrence of lymphadenopathy and multi-joint pain is observed in patients with active (50% and 44.1%) and a latent/persistent (41.7% and 37.5%) B19V infection, respectively. Post-exertional malaise and muscle pain are detected in slightly more patients with a latent/persistent B19V infection (62.5% and 58.3%) than patients with an active B19V infection (52.9% and 47.1%). In addition, patients with B19V genomic sequence and antibodies to NS1 protein significantly more frequently have multi-joint pain (55%) than patients with B19V genomic sequence and without NS1 antibodies (21.1%) (p = 0.0294). Muscle pain and lymphadenopathy are more frequently observed in patients with (65% and 65%) than without (42.1% and 31.6%) presence of NS1 antibodies (p = 0.1517 and p = 0.0369, respectively). Such B19V associated ME/CFS clinical manifestations as fatigue, lymphadenopathy, joint and muscle pain could be consequences to B19V infection. Reports are published on B19V as a cause of ME/CFS typical clinical symptoms, therefore in some studies B19V is reported to be one of the trigger factors for at least part of ME/CFS patients, that corresponds to the results of our study (Matano et al., 2003; Appel et al., 2007; Fremont et al., 2009). Further analysing the occurrence of ME/CFS typical symptoms in case of HHV-6/HHV-7/B19V co-infection, a significant difference is not found between the groups of patients with a persistent co-infection in latent and active phase. However, multi-joint pain
90 is observed in more patients with a persistent single infection in latent than in active phase (p = 0.0452) and in more patients with a persistent double and triple infection in active than in latent phase, though without statistical significance. In addition, headache of a new type is present in more patients with a persistent triple co-infection in latent than in active phase (p = 0.0052). Subfebrility is present in more patients with a persistent single, double and triple co-infection in active than in latent phase, though predominance is not statistically significant. Taking into account that diagnosis of ME/CFS was set up at least six months after the onset of the first symptoms and samples were collected even longer period after the onset of ME/CFS, a clear difference between a persistent infection in latent and active phase is difficult to identify. These results may indicate a possible role of a persistent infection in ME/CFS development or consequences of a virus infection that could be in an active phase during the onset of this disease and is in a latent phase on sample collection time although the clinical symptoms persist. A lack of statistical differences comparing clinical symptoms between groups of ME/CFS patients with a persistent infection in latent and active phase could also be due to the diagnostic criteria - all patients have to have chronic fatigue for at least six months and four out of eight typical ME/CFS symptoms, therefore a variation of symptom frequency is limited. Noteworthy is also a fact that various numbers of patients – from six up to 54 patients in analysed groups with latent and active single, double and triple infection that affect statistical analysis. The frequency of ME/CFS clinical symptoms also is different between various countries and depends on patient characteristics, comorbidities and patient-reported measures. It is still not clear whether a group of symptoms leads to chronic illness or symptoms are developed during a chronic illness (Collin et al., 2016). Such flu-like symptoms as fatigue, joint, muscle and extremities pain, tender lymph nodes and headache are present not just in a majority of patients in other studies, but also in many patients from this study. Friedberg with colleagues report immune and viral factors as the most frequent causes of ME/CFS in patients with short and long duration of this illness, whereas persistent stress as second most frequent etiological factor for ME/CFS is mentioned (Friedberg et al., 2000). It is necessary to conduct longitudinal studies in order to assess immune functions and symptom severity variations over time, what in some studies already is showed (Hardcastle et al., 2015; Mensah et al., 2017). Moreover, results should be compared not only between ME/CFS patients and controls, but also with other comorbidities, like multiple sclerosis or depression to assess specificity of suggested biomarkers (Fischer et al., 2014).
91 A biomarker must be selected considering costs and a possibility to use it in clinics, because expensive and very complex methods will most likely not be incorporated in routine practice (Fischer et al., 2014). Therefore, chosen methods in this study are cost-effective for routine analysis in laboratories. Controlled trials in future will enable assessment of antiviral therapy and resulting in clinical improvement will approve association with the disease (Clark, 2016). Considering ME/CFS heterogeneity, use of biomarkers will enable to define subtypes of the disease. In addition, longitudinal and standardized studies determining phenotype and measures of ME/CFS course and therapy effectiveness with follow-up measurements in dynamics should be accomplished. This will allow prognosis of the disease development and promote development of a specific definition for diagnostics and a treatment plan (Fischer et al., 2014).
92 5. CONCLUSIONS
1. No evidence of XMRV infection in patients with ME/CFS and apparently healthy individuals is found, therefore the hypothesis on XMRV association with ME/CFS development is denied. 2. Persistent HHV-6 and HHV-7 infection in an active phase is presented significantly more frequently and with a higher viral load among patients with ME/CFS than apparently healthy individuals, and HHV-6B is prevalent in Latvian ME/CFS patients. 3. A more common finding of B19V (genotype 1) active infection with a higher B19V load in ME/CFS patients than in apparently healthy individuals and the coincidence of the infection time with the onset of the disease symptoms point to B19V as a possible trigger factor in ME/CFS development. 4. HHV-6, HHV-7 and B19V persistent co-infection in an active phase is significantly more widespread among patients with ME/CFS compared to healthy donors and is characterized by a higher viral load and level of cytokines in comparison to the latent phase of infection. Therefore, markers of HHV-6, HHV-7 and B19V infection could be used as one of biomarkers in ME/CFS diagnostics. 5. The level of cytokines is elevated in patients with ME/CFS indicating immune response to inflammation that could be caused by a viral infection. Also persistent HHV-6, HHV-7 and B19V co-infection in an active phase might significantly influence elevation of pro-inflammatory and anti-inflammatory cytokine levels, which can lead to immune disturbances and the development of ME/CFS symptoms. 6. ME/CFS patients with viral infection markers are more likely to disclose the clinical symptoms of the disease defined in the diagnostic criteria, which are also common with respect to the appropriate virus infection. 7. A higher HHV-6 and HHV-7 load and a significantly elevated level of pro-inflammatory cytokines TNF-α, IL-12 and anti-inflammatory cytokine IL-10 in patients with a more severe ME/CFS clinical course advocate on the involvement of these viral infections in ME/CFS development.
93 6. RECOMMENDATIONS
1. To improve knowledge of general practitioners in Latvia about ME/CFS to assure recognition and proper diagnostics of this illness. 2. To inform society about ME/CFS existence and characteristics to increase tolerance and understanding of this disease. 3. To use more than one ME/CFS case definition in diagnostics to assure sensitivity and specificity of diagnosis. 4. To analyse the presence of active HHV-6, HHV-7 and B19V infection markers in patients with ME/CFS to assess potential etiological factors and manage treatment strategies according to disease severity and infection activity phase, considering necessity of antiviral treatment application.
94 7. LIST OF PUBLICATIONS
7.1. Papers in journals included in the international databases
1. Chapenko, S., Krumina, A., Logina, I., Rasa, S., Chistjakovs, M., Sultanova, A., Viksna, L. and Murovska, M. Association of active human herpesvirus-6, -7 and parvovirus B19 infection with clinical outcomes in patients with myalgic encephalomyelitis/chronic fatigue syndrome. Advances in Virology. 2012, 2012, 1–7. 2. Rasa, S., Nora-Krukle, Z., Chapenko, S., Krumina, A., Roga, S., Murovska, M. No evidence of XMRV provirus sequences in patients with myalgic encephalomyelitis/chronic fatigue syndrome and individuals with unspecified encephalopathy. New Microbiologica. 2014, 37, 17–24. 3. Prusty, B. K., Gulve, N., Rasa, S., Murovska, M., Hernandez, P. C., Ablashi, D. V. Possible Chromosomal and Germline Integration of Human Herpesvirus 7 (HHV-7). The Journal of General Virology. 2017, 98 (2), 266–274.
7.2. Papers in other journals and collections of articles
1. Rasa, S., Chapenko, S., Krumina, A., Chistyakovs, M., Viksna, L., Logina, I., Gintere, S., Murovska, M. Role of beta-herpesviruses infection in the development of chronic fatigue syndrome/myalgic encephalomyelitis. Immunomodulating Human Herpesviruses and their Role in Human Pathologies. 2011, 16–20. 2. Chistyakovs, M., Čapenko, S., Sultanova, A., Rasa, S., Krūmiņa, A., Murovska, M. Beta-herpesviruses HHV-6 and HHV-7 infection and cytokines level changes in plasma from patients with chronic fatigue syndrome. Collection of Scientific Papers: Research articles in medicine & pharmacy, 2010: Medical Basic Sciences. 2011, 2, 121–125. 3. Rasa, S., Čapenko, S., Krūmiņa, A., Kozireva, S., Murovska, M. Association of parvovirus B19 with chronic fatigue syndrome. Collection of Scientific Papers: Research articles in medicine & pharmacy, 2011: Internal Medicine. Surgery. Medical Basic Sciences. Stomatology. Pharmacy. 2012, 1, 217–224. 4. Rasa, S., Čapenko, S., Krūmiņa, A., Nora-Krūkle, Z., Murovska, M. Xenotropic murine leukemia virus related virus, human herpesvirus-6, herpesvirus-7 and parvovirus B19 association with chronic fatigue syndrome/myalgic encephalomyelitis. Collection of Scientific Papers: Research articles in medicine & pharmacy, 2012: Internal Medicine. Surgery. Medical Basic Sciences. Stomatology. Pharmacy. 2013, 2, 242–249. 5. Krumina, A., Vasiljeva, G., Ivanovs, A., Gintere, S., Kovalchuka, L., Rasa, S., Chapenko, S., Murovska, M., Viksna, L, Logina, I. Assessment of Value of Fatigue Severity and Symptoms in Patients with Chronic Fatigue Syndrome/Myalgic Encephalomyelitis and Fibromyalgia. British Journal of Medicine & Medical Research. 2014, 4 (36), 5866–5877. 6. Rasa, S., Čapenko, S., Krūmiņa, A., Nora-Krūkle, Z., Roce, A., Murovska, M. Interleukin-10 level in blood plasma in case of beta-herpesvirus co-infection in patients with myalgic encephalomyelitis/chronic fatigue syndrome. Collection of Scientific Papers: Research articles in medicine & pharmacy, 2013: Internal Medicine. Surgery. Medical Basic Sciences. Stomatology. Pharmacy. 2014, 204–211.
95
7. Rasa, S., Chapenko, S., Vanaga, A., Mihailova, M., Logina, I., Krumina, A., Murovska, M. Human parvovirus B19 infection status in patients with myalgic encephalomyelitis/chronic fatigue syndrome and fibromyalgia. Collection of Scientific Papers: Research articles in medicine & pharmacy, 2014: Internal Medicine. Surgery. Medical Basic Sciences. Stomatology. Pharmacy. 2014, 55–63.
7.3. Presentations at international conferences/congresses
1. Logina, I., Krumina, A., Chapenko, S., Rasa, S., Chistyakov, M., Sultanova, A., Murovska, M. Pain in chronic fatigue syndrome/myalgic encephalomyelitis patients: relation to active HHV-6, HHV-7 and parvovirus B19 infection/co-infection. European Journal of Pain Supplements 5, DOI:10.1016/S1754-3207(11)70434-5. Abstract of Pain in Europe VII. The Congress of the European Federation of IASP. Hamburg, Germany, September 21–24, 2011, pp.127. 2. Murovska, M., Chapenko, S., Krumina, A., Logina, I., Rasa, S., Chistyakov, M., Sultanova, A., Viksna, L. Presence of Active HHV-6, HHV-7 and Parvovirus B19 infection/Co-infection in patients with Chronic Fatigue Syndrome/Myalgic Encephalomyelitis. CFS/ME Biennial International Conference Translating Evidence into Practice Syllabus. Canada, Ontario, Ottawa, September 22–25, 2011. 3. Rasa, S., Chapenko, S., Nora-Krukle, Z., Krumina, A., Murovska, M. Detection of XMRV, HHV-6 and HHV-7 genomic sequences in blood of patients with chronic fatigue syndrome/myalgic encephalomyelitis. 22nd Annual Meeting of the Society for Virology programme. Essen, Germany, March 14–17, 2012, pp. 543. 4. Rasa, S., Nora-Krukle, Z., Chapenko, S., Krumina, A., Murovska, M. Detection of xenotropic murine leukemia virus-related gene sequences in blood of patients with chronic fatigue syndrome/myalgic encephalomyelitis in Latvia. International Medical Meeting Abstract Book. Riga, Latvia, September 7–9, 2012, pp. 48. 5. Rasa, S., Krumina, A., Nora-Krukle, Z., Chapenko, S., Murovska, M. Association of human herpesvirus-6 and 7 and parvovirus B19 with chronic fatigue syndrome/myalgic encephalomyelitis. School of Translational Immunology Abstract Book. Belgrade, Serbia, September 19–21, 2012, pp. 149. 6. Rasa, S., Chapenko, S., Nora-Krukle, Z., Krumina, A., Viksna, L., Murovska, M. Co-infection of HHV-6 and HHV-7 in patients with myalgic encephalomyelitis/chronic fatigue syndrome. 8th International Conference on HHV-6&7 Program Book. Paris, France, April 8–10, 2013, pp.76. 7. Rasa, S., Chapenko, S., Krumina, A., Viksna, L., Murovska, M. Occurrence of typical clinical symptoms and markers of human parvovirus B19 infection in patients with myalgic encephalomyelitis/chronic fatigue syndrome. IACFS/ME 11th Biennial International Conference Translating Science into Clinical Care Syllabus. San Francisco. California, USA, March 20–23, 2014, pp. 24. 8. Rasa, S., Chapenko, S., Vanaga, A., Mihailova, M., Krumina, A., Logina, I., Murovska, M. Serologically approved parvovirus B19 infection status in viremic cases of patients with myalgic encephalomyelitis/chronic fatigue syndrome and fibromyalgia. 15th Biennial International Parvovirus Workshop Abstract Book. Bordeaux, France, June 22–26, 2014, P-15. 9. Murovska, M., Rasa, S., Cistjakovs, M., Roga, S., Krumina, A., Logina, I., Chapenko, S. Possible involvement of human herpesvirus-6 infection in the development of myalgic encephalomyelitis/chronic fatigue syndrome, fibromyalgia and encephalopathy. International Union of Microbiological Societies Congresses Abstracts Resumes. Montreal, Canada, July 27–August 1, 2014, pp. 613. 96
10. Rasa, S., Chapenko, S., Zazerska, Z., Krumina, A., Murovska, M. Evidence of human parvovirus B19 infection in patients with myalgic encephalomyelitis/chronic fatigue syndrome. Program & Poster Abstracts Thirty-First Annual Clinical Virology Symposium and Annual Meeting of the Pan American Society for Clinical Virology. 31st Clinical Virology Symposium. Daytona Beach, USA, April 26–29, 2015, pp. 90–91. 11. Rasa, S., Chapenko, S., Zazerska, Z., Vilmane, A., Krumina, A., Murovska, M. Level of TNF- alpha in myalgic encephalomyelitis/chronic fatigue syndrome patients with beta-herpesviruses infection. 1st Baltic Conference Immunological modelling: theory and practice programme and abstracts. Riga, Latvia, May 13–15, 2015, pp 88–89. 12. Murovska, M., Nora-Krukle, Z., Gravelsina, S., Rasa, S., Zazerska, Z., Chapenko, S., Lin, Y.C., Lin, J.H., Liu, H.F. Parvovirus B19 detection frequency and genotype analysis in various Latvian patients’ cohorts. XVIth International Parvovirus Workshop abstracts. Ajaccio, Corsica, France, June19–23, 2016, pp. 77. 13. Rasa, S., Chapenko, S., Krumina, A., Zazerska, Z., Murovska, M. Occurrence, phase and status of human parvovirus B19 infection in patients with myalgic encephalomyelitis/chronic fatigue syndrome. Journal of Clinical Virology, Abstracts of the 19th Annual Meeting of the European Society for Clinical Virology. Lisbon, Portugal, September 14–17, 2016, 82, S141.
7.4. Presentations at local conferences/congresses
1. Svilpe, S., Krūmiņa, A., Čistjakovs, M., Rasa, S., Čapenko, S., Murovska, M., Logina, I. Evaluation of neurological symptoms in patients with myalgic encephalomyelitis/chronic fatigue syndrome. Rīga Stradiņš University scientific conference abstracts 2010. Riga, Latvia, March 18–19, 2010, pp. 161. 2. Chistyakovs, M., Rasa, S., Chapenko, S., Krumina, A., Sultanova, A., Murovska, M. Plasma Levels of Various Cytokines and Activation of Immunomodulating Beta-herpesviruses in Patients with Chronic Fatigue Syndrome. Rīga Stradiņš University scientific conference abstracts 2010. Riga, Latvia, March 18–19, 2010, pp. 196. 3. Rasa, S., Čapenko, S., Krūmiņa, A., Kozireva, S., Murovska, M. Association of Parvovirus B19 with chronic fatigue syndrome. Rīga Stradiņš University scientific conference abstracts 2011. Riga, Latvia, April 14–15, 2011, pp. 220. 4. Krūmiņa, A., Logina, I., Svilpe, S., Gintere, S., Čapenko, S., Rasa, S., Čistjakovs, M., Sultanova, A., Vīksna, L., Murovska, M. Findings of active HHV-6, HHV-7 and parvovirus B19 co-infections in patients with myalgic encephalomyelitis/chronic fatigue syndrome. 3rd United World Latvian scientists congress and 4th Letonika congress Medicine section “Medical science and Latvian public health in XXI century” abstracts. Riga, Latvia, October 24–27, 2011, pp. 54–55. 5. Rasa, S., Čapenko, S., Krūmiņa, A., Nora-Krūkle, Z., Roce, A., Murovska, M. Interleukin-10 expression level in case of beta-herpesviruses co-infection in patients with myalgic encephalomyelitis/chronic fatigue syndrome. Rīga Stradiņš University scientific conference abstracts 2013. Riga, Latvia, March 21-22, 2013, pp. 189. 6. Rasa, S., Čapenko, S., Nora-Krūkle, Z., Mihailova, M., Logina, I., Krūmiņa, A., Murovska, M. Human parvovirus B19 infection status in patients with myalgic encephalomyelitis/chronic fatigue syndrome and fibromyalgia. Rīga Stradiņš University scientific conference abstracts 2014. Riga, Latvia, April 10–11, 2014, pp. 207. 7. Rasa, S., Čapenko, S., Zazerska, Z., Krūmiņa, A., Murovska, M. Human parvovirus B19 infection occurrence and load in patients with myalgic encephalomyelitis/chronic fatigue syndrome and apparently healthy individuals. Rīga Stradiņš University scientific conference abstracts 2015. Riga, Latvia, March 26–27, 2015, pp. 206.
97 8. REFERENCES
1. Ablashi, D. V. Viral studies of chronic fatigue syndrome. Clinical Infectious Diseases. 1994, 18, 130–133. 2. Ablashi, D. V., Agut, H., Alvarez-Lafuente, R. et al., Classification of HHV-6A and HHV-6B as distinct viruses. Archives of Virology. 2014, 159, 863–870. 3. Ablashi, D. V., Eastman, H. B., Owen, C. B. et al. Frequent HHV-6 reactivation in multiple sclerosis (MS) and chronic fatigue syndrome (CFS) patients. Journal of Clinical Virology. 2000, 16 (3), 179–191. 4. Ablashi, D. V., Salahuddin, S. Z., Josephs, S. F. et al. Human herpesvirus-6 (HHV-6). In Vivo. 1991, 5 (3), 193–199. 5. Agut, H., Bonnafous, P., Gautheret-Dejean, A. Update on infections with human herpesviruses 6A, 6B, and 7. Medecine et maladies infectieuses. 2017, 47 (2), 83–91. 6. Alberts, B. Retraction. Science. 2011, 334 (6063), 1636. 7. Albright, F., Light, K., Light, A. et al. Evidence for a heritable predisposition to Chronic Fatigue Syndrome. BMC Neurology. 2011, 11: 62. 8. Allander, T., Tammi, M.T., Eriksson, M. et al. Cloning of a human parvovirus by molecular screening of respiratory tract samples. Proceedings of the National Academy of Sciences of the United States of America. 2005, 102 (36), 12891–12896. 9. Aoki, R., Kobayashi, N., Suzuki, G. et al. Human herpesvirus 6 and 7 are biomarkers for fatigue, which distinguish between physiological fatigue and pathological fatigue. Biochemical and Biophysical Research Communications. 2016, 478 (1), 424–430. 10. Appel, S., Chapman, J., Shoenfeld, Y. Infection and vaccination in chronic fatigue syndrome: myth or reality? Autoimmunity. 2007, 40 (1), 48–53. 11. Arroll, M. A., Howard, A. A preliminary prospective study of nutritional, psychological and combined therapies for myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS) in a private care setting. BMJ Open. 2012, 2 (6), e001079. 12. Attard, L., Bonvicini, F., Gelsomino, F. et al. Paradoxical response to intravenous immunoglobulin in a case of Parvovirus B19-associated chronic fatigue syndrome. Journal of Clinical Virology. 2015, 62, 54–57. 13. Avellaneda Fernandez, A., Perez Martín, A., Izquierdo Martínez, M. et al. Chronic fatigue syndrome: aetiology, diagnosis and treatment. BMC Psychiatry. 2009, 9 (1), S1. 14. Bakken, I. J., Tveito, K., Gunnes, N. et al. Two age peaks in the incidence of chronic fatigue syndrome/myalgic encephalomyelitis: a population-based registry study from Norway 2008–2012. BMC Medicine. 2014, 12, 167. 15. Bansal, A. S., Bradley, A. S., Bishop, K. N. et al. Chronic fatigue syndrome, the immune system and viral infection. Brain, Behavior and Immunity. 2012, 26 (1), 24–31. 16. Barah, F., Vallely, P. J., Chiswick, M. L. et al. Association of human parvovirus B19 infection with acute meningoencephalitis. Lancet. 2001, 358, 729–730. 17. Barah, F., Whiteside, S., Batista, S., Morris, J. Neurological aspects of human parvovirus B19 infection: a systematic review. Reviews in Medical Virology. 2014, 24 (3), 154–168. 18. Bassi, N., Amital, D., Amital, H. et al. Chronic fatigue syndrome: characteristics and possible causes for its pathogenesis. The Israel Medical Association Journal. 2008, 10 (1), 79–82. 19. Battini, J. L., Rasko, J. E., Miller, A. D. A human cell-surface receptor for xenotropic and polytropic murine leukemia viruses: possible role in G protein-coupled signal transduction. Proceedings of the National Academy of Sciences of the United States of America. 1999, 96 (4), 1385–1390.
98 20. Berneman, Z.N., Gallo, R. C., Ablashi, D. V. et al. Human herpesvirus 7 (HHV-7) strain JI: independent confirmation of HHV-7. Journal of Infectious Diseases. 1992, 166, 690–691. 21. Bested, A. C, Marshall, L. M. Review of Myalgic Encephalomyelitis/Chronic Fatigue Syndrome: an evidence-based approach to diagnosis and management by clinicians. Reviews on Environmental Health. 2015, 30 (4), 223–249. 22. Biganzoli, P., Ferreyra, L., Sicilia, P. et al. IgG subclasses and DNA detection of HHV-6 and HHV-7 in healthy individuals. Journal of Medical Virology. 2010, 82 (10), 1679–1683. 23. Brandtzaeg, P., Osnes, L., Ovstebo, R. et al. Net inflammatory capacity of human septic shock plasma evaluated by a monocyte-based target cell assay: identification of interleukin-10 as a major functional deactivator of human monocytes. The Journal of Experimental Medicine. 1996, 184, 51–60. 24. Brenu, E. W., Staines, D. R., Baskurt, O. K. et al. Immune and hemorheological changes in chronic fatigue syndrome. Journal of Translational Medicine. 2010, 8, 1. 25. Brenu, E. W., van Driel, M. L., Staines, D. R. et al. Immunological abnormalities as potential biomarkers in Chronic Fatigue Syndrome/Myalgic Encephalomyelitis. Journal of Translational Medicine, 2011, 9, 81. 26. Broderick, G., Fuite, J., Kreitz, A. et al. A formal analysis of cytokine networks in Chronic Fatigue Syndrome. Brain, Behavior, and Immunity. 2010. 24 (7), 1209–1217. 27. Broderick, G., Katz, B. Z., Fernandes, H. et al. Cytokine expression profiles of immune imbalance in post-mononucleosis chronic fatigue. Journal of Translational Medicine. 2012, 10, 191. 28. Brown, K. E., Anderson, S. M., Young, N. S. Erythrocyte P antigen: cellular receptor for B19 parvovirus. Science. 1993, 262, 5130, 114–117. 29. Buchwald, D., Ashley, R. L., Pearlman, T. et al. Viral serologies in patients with chronic fatigue and chronic fatigue syndrome. Journal of Medical Virology. 1996, 50 (1), 25–30. 30. Buchwald, D., Cheney, P. R., Peterson, D. L. et al. A chronic illness characterized by fatigue, neurologic and immunologic disorders, and active human herpesvirus type 6 infection. Annals of Internal Medicine. 1992, 116 (2), 103–113. 31. Burbelo, P. D., Bayat, A., Wagner, J. et al. No serological evidence for a role of HHV-6 infection in chronic fatigue syndrome. American Journal of Translatioinal Research. 2012, 4 (4), 443–451. 32. Cameron, B., Flamand, L., Juwana, H. et al. Serological and virological investigation of the role of the herpesviruses EBV, CMV and HHV-6 in post-infective fatigue syndrome. Journal of Medical Virology. 2010, 82 (10), 1684–1688. 33. Campadelli-Fiume, G., Mirandola, P., Menotti, L. Human Herpesvirus 6: An Emerging Pathogen. Emerging Infectious Diseases. 1999, 5, 353–366. 34. Carruthers, B. M., van de Sande, M. I., De Meirleir, K. L. et al. Myalgic Encephalomyelitis: International Consensus Criteria. Journal of Internal Medicine. 2011, 270 (4), 327–338. 35. Carruthers, M., Kumar Jain, A., De Meirleir, K. et al. Myalgic encephalomyelitis/chronic fatigue syndrome: clinical working case definition, diagnostic and treatment protocols. Journal of Chronic Fatigue Syndrome. 2003, 11 (1), 7–115. 36. Caselli, E., Di Luca, D. Molecular biology and clinical associations of Roseoloviruses human herpesvirus 6 and human herpesvirus 7. The New Microbiologica. 2007, 30 (3), 173–187. 37. Castro-Marrero, J., Sáez-Francàs, N., Santillo, D., Alegre, J. Treatment and management of chronic fatigue syndrome/myalgic encephalomyelitis: all roads lead to Rome. British Journal of Pharmacology. 2017, 174 (5), 345–369. 38. Chapenko, S., Krumina, A., Kozireva, S. et al. Activation of human herpesviruses 6 and 7 in patients with chronic fatigue syndrome. Journal of Clinical Virology. 2006, 37 (1), 47–51.
99 39. Chapenko, S., Krumina, A., Logina, I. et al. Association of active human herpesvirus-6, -7 and parvovirus B19 infection with clinical outcomes in patients with myalgic encephalomyelitis/chronic fatigue syndrome. Advances in Virology. 2012, 2012, 1–7. 40. Chia, J., Chia, A., Voeller, M. et al. Acute enterovirus infection followed by myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS) and viral persistence. Journal of Clinical Pathology. 2010, 63 (2), 165–168. 41. Chisholm, C., Lopez, L. Cutaneous infections caused by Herpesviridae: a review. Archives of Pathology and Laboratory Medicine. 2011, 135 (10), 1357–1362. 42. Choy, E. H., Panayi, G. S. Cytokine pathways and joint inflammation in rheumatoid arthritis. The New England Journal of Medicine. 2001, 344, 907–916. 43. Christley, Y., Duffy, T., Martin, C. R. A review of the definitional criteria for chronic fatigue syndrome. Journal of Evaluation in Clinical Practice. 2010, 18 (1), 25–31. 44. Clark, D. A. Clinical and laboratory features of human herpesvirus 6 chromosomal integration. Clinical Microbiology and Infection. 2016, 22 (4), 333–339. 45. Clark, D. A. Human herpesvirus 6. Reviews in Medical Virology. 2000, 10, 155–173. 46. Clauw, D. Innovative Treatments in CFS. Neuroimmune Mechanisms and Chronic Fatigue Syndrome. 2003, 12, 97–101. 47. Collin, S. M., Nikolaus, S., Heron, J. et al. Chronic fatigue syndrome (CFS) symptom-based phenotypes in two clinical cohorts of adult patients in the UK and The Netherlands. Journal of Psychosomatic Research. 2016, 81, 14–23. 48. Committee on the Diagnostic Criteria for Myalgic Encephalomyelitis/Chronic Fatigue Syndrome, Board on the Health of Select Populations, Institute of Medicine. In: Beyond Myalgic Encephalomyelitis/Chronic Fatigue Syndrome: Redefining an Illness. The National Academies Collection: Reports funded by National Institutes of Health. National Academies Press (US) Copyright 2015 by the National Academy of Sciences. All rights reserved., Washington (DC), 2015. doi:10.17226/19012. 49. Cooling, L. L., Koerner, T. A., Naides, S. J. Multiple glycosphingolipids determine the tissue tropism of parvovirus B19. The Journal of Infectious Diseases. 1995, 172 (5), 1198–1205. 50. Corcoran, C., Hardie, D., Yeats, J., Smuts, H. Genetic variants of human parvovirus B19 in South Africa: circulation of three genotypes and identification of a novel subtype of genotype 1. Journal of Clinical Microbiology. 2010, 48 (1), 137–142. 51. Cossart, Y. E., Field, A. M., Cant, B., Widdows, D. Parvovirus-like particles in human sera. Lancet. 1975, 1, 72–73. 52. Couper, K. N., Blount, D. G., Riley, E. M. IL-10: the master regulator of immunity to infection. Journal of Immunology. 2008, 180 (9), 5771–5777. 53. Craig, T., Kakumaku S. Chronic fatigue Syndrome: Evaluation and Treatment. American family physician. 2002, 6, 1083–1090. 54. Curriu, M., Carrillo, J., Massanella, M. et al. Screening NK-, B- and T-cell phenotype and function in patients suffering from chronic fatigue syndrome. Journal of Translational Medicine. 2013, 11, 68. 55. De Bolle, L., Naesens, L., De Clercq, E. Update on human herpesvirus 6 biology, clinical features, and therapy. Clinical Microbiology Reviews. 2005, 18 (1), 217–245. 56. Deiss, V., Tratschin, J. D., Weitz, M., Siegl, G. Cloning of the human parvovirus B19 genome and structural analysis of its palindromic termini. Virology. 1990, 175, 247–254. 57. Demettre, E., Bastide, L., D'Haese, A. et al. Ribonuclease L proteolysis in peripheral blood mononuclear cells of chronic fatigue syndrome patients. The Journal of Biological Chemistry. 2002, 277 (38), 35746–35751.
100 58. Di Luca, D., Zorzenon, M., Mirandola, P. et al. Human herpesvirus 6 and human herpesvirus 7 in chronic fatigue syndrome. Journal of Clinical Microbiology. 1995, 33 (6), 1660–1661. 59. Dong, B., Kim, S., Hong, S. et al. An infectious retrovirus susceptible to an IFN antiviral pathway from human prostate tumors. Proceedings of the National Academy of Sciences of the United States of America. 2007, 104, 1655–1660. 60. Drulovic, J., Savic, E., Pekmezovic, T. et al. Expression of T(H)1 and T(H)17 cytokines and transcription factors in multiple sclerosis patients: Does baseline T-Bet mRNA predict the response to interferon beta-treatment? Journal of Neuroimmunology. 2009, 215 (1-2), 90–95. 61. Elfaitouri, A., Shao, X., Mattsson Ulfstedt, J. et al. Murine gammaretrovirus group G3 was not found in Swedish patients with myalgic encephalomyelitis/chronic fatigue syndrome and fibromyalgia. PloS ONE. 2011, 6 (10), e24602. 62. Endo, A., Watanabe, K., Ohye, T. et al. Molecular and virological evidence of viral activation from chromosomally integrated human herpesvirus 6A in a patient with X-linked severe combined immunodeficiency. Clinical Infectious Diseases. 2014, 59, 545–548. 63. Fischer, D. B., William, A. H., Strauss, A. C. et al. Chronic Fatigue Syndrome: The Current Status and Future Potentials of Emerging Biomarkers. Fatigue. 2014, 2 (2), 93–109. 64. Fletcher, M. A., Zeng, X. R., Barnes, Z. et al. Plasma cytokines in women with chronic fatigue syndrome. Journal of Transplantational Medicine. 2009, 7, 96. 65. Fluge, O., Risa, K., Lunde, S. et al. B-lymphocyte depletion in myalgic encephalopathy/chronic fatigue syndrome. An open-label phase II study with rituximab maintenance treatment. PLoS One. 2015, 10 (7), e0129898. 66. Fremont, M., Metzger, K., Hulstaert, J., De Meirleir, K. Detection of herpesviruses and parvovirus B19 in gastric and intestinal mucosa of chronic fatigue syndrome patients. In Vivo. 2009, 23, (2), 209–213. 67. Frenkel, N., Schirmer, E. C., Wyatt, L. S. et al. Isolation of a new herpesvirus from human CD4+ T cells. Proceedings of the National Academy of Sciences of the United States of America. 1990, 87 (2), 748–752. 68. Friedberg, F. Chronic fatigue syndrome, fibromyalgia, and related illnesses: a clinical model of assessment and intervention. Journal of Clinical Psychology. 2010, 66 (6), 641–665. 69. Fukuda, K., Straus, S. E., Hickie, I. et al. The chronic fatigue syndrome: a comprehensive approach to its definition and study. Annals of Internal Medicine. 1994, 121, 953– 959. 70. Furukawa, M., Yasukawa, M., Yakushijin, Y., Fujita, S. Distinct effects of human herpesvirus 6 and human herpesvirus 7 on surface molecule expression and function of CD4+ T cells. Journal of Immunology. 1994, 152, 5768–5775. 71. Furuta, R. A., Miyazawa, T., Sugiyama, T. et al. No association of xenotropic murine leukemia virus-related virus with prostate cancer or chronic fatigue syndrome in Japan. Retrovirology. 2011, 8: 20. 72. Geraudie, B., Charrier, M., Bonnafous, P. et al. Quantitation of human herpesvirus-6A, -6B and -7 DNAs in whole blood, mononuclear and polymorphonuclear cell fractions from healthy blood donors. Journal of Clinical Virology. 2012, 53 (2), 151–155. 73. Glaser, R., Kiecolt-Glaser, J. K. Stress-associated immune modulation: relevance to viral infections and chronic fatigue syndrome. The American Journal of Medicine. 1998, 105 (3A), 35S–42S. 74. Glaser, R., Padgett, D. A., Litsky, M. L. et al. Stress-associated changes in the steady-state expression of latent Epstein-Barr virus: implications for chronic fatigue syndrome and cancer. Brain, Behavior and Immunity. 2005, 19 (2), 91–103. 75. Glassford, J. A. The Neuroinflammatory Etiopathology of Myalgic Encephalomyelitis/Chronic Fatigue Syndrome (ME/CFS). Frontiers in Physiology. 2017, 8, 88.
101 76. Gompels, U. A., Nicholas, J., Lawrence, G. et al. The DNA sequence of human herpesvirus-6: structure, coding content, and genome evolution. Virology. 1995, 209 (1), 29–51. 77. Gravel, A., Dubuc, I., Morissette, G. et al. Inherited chromosomally integrated human herpesvirus 6 as a predisposing risk factor for the development of angina pectoris. Proceedings of the National Academy of Sciences of the United States of America. 2015, 112 (26), 8058–8063. 78. Gravel, A., Hall, C. B., Flamand, L. Sequence analysis of transplacentally acquired human herpesvirus 6 DNA is consistent with transmission of a chromosomally integrated reactivated virus. The Journal of Infectious Diseases. 2013, 207 (10), 1585–1589. 79. Green, S., Malkovska, I., O’Sullivan, M., Brown, K. Rhesus and pig-tailed macaque parvoviruses: identification of two new members of the erythrovirus genus in monkeys. Virology. 2000, 269, 105–112. 80. Groom, H. C., Bishop, K. N. The tale of xenotropic murine leukemia virus-related virus. The Journal of General Virology. 2012, 93 (5), 915–924. 81. Groom, H. C., Boucherit, V. C., Makinson, K. et al. Absence of xenotropic murine leukaemia virus-related virus in UK patients with chronic fatigue syndrome. Retrovirology. 2010, 7, 10. 82. Guindon, S., Dufayard, J. F., Lefort, V. et al. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Systematic Biology. 2010, 59, 307–321. 83. Halpin, P., Williams, M. V., Klimas, N. G. et al. Myalgic encephalomyelitis/chronic fatigue syndrome and gulf war illness patients exhibit increased humoral responses to the herpesviruses-encoded dUTPase: Implications in disease pathophysiology. Journal of Medical Virology. 2017, 89 (9), 1636–1645. 84. Hardcastle, S. L., Brenu, E. W., Johnston, S. et al. Longitudinal analysis of immune abnormalities in varying severities of Chronic Fatigue Syndrome/Myalgic Encephalomyelitis patients. Journal of Translational Medicine. 2015, 13, 299. 85. Hemauer, A., Gigler, A., Searle, K. et al. Seroprevalence of parvovirus B19 NS1-specific IgG in B19-infected and uninfected individuals and in infected pregnant women. Journal of Medical Virology. 2000, 60 (1), 48–55. 86. Hohn, O., Strohschein, K., Brandt, A. U. et al. No evidence for XMRV in German CFS and MS patients with fatigue despite the ability of the virus to infect human blood cells in vitro. PloS ONE. 2010, 5 (12), e15632. 87. Holmes, G. P., Kaplan, J. E., Gantz, N. M. et al. Chronic fatigue syndrome: A working case definition. Annals of Internal Medicine. 1988, 108, 387–389. 88. Hong, P., Li, J., Li, Y. Failure to detect Xenotropic murine leukaemia virus-related virus in Chinese patients with chronic fatigue syndrome. Virology Journal. 2010, 7, 224. 89. Hornig, M., Montoya, J. G., Klimas, N. G. et al. Distinct plasma immune signatures in ME/CFS are present early in the course of illness. Science Advances. 2015, 1(1), e1400121. 90. Hüfner, K., Arbusow, V., Himmelein, S. et al. The prevalence of human herpesvirus 6 in human sensory ganglia and its co-occurrence with alpha-herpesviruses. Journal of Neurovirology. 2007, 13 (5), 462–467. 91. Ito, K., Shimizu, N., Watanabe, K. et al. Analysis of viral infection by multiplex polymerase chain reaction assays in patients with liver dysfunction. Internal medicine (Tokyo, Japan). 2013, 52 (2), 201–211. 92. Jason, L. A., Kin, C. P., Taylor, R. R., Kennedy, C. Defining chronic fatigue syndrome: methodological challenges. Journal of Chronic Fatigue Syndrome. 2000, 7 (3), 17–32. 93. Johnston, S., Brenu, E. W., Staines, D., Marshall-Gradisnik, S. The prevalence of chronic fatigue syndrome/ myalgic encephalomyelitis: a meta-analysis. Clinical Epidemiology. 2013, 5, 105–110. 94. Kaufer, B. B., Flamand, L. Chromosomally integrated HHV-6: impact on virus, cell and organismal biology. Current opinion in virology. 2014, 9, 111–118. 102 95. Kavelaars, A., Kuis, W., Knook, L. et al. Disturbed neuroendocrine-immune interactions in chronic fatigue syndrome. The Journal of Clinical Endocrinology & Metabolism. 2000, 85, (2), 692–696. 96. Kearney, M. F., Spindler, J., Wiegand, A. et al. Multiple sources of contamination in samples from patients reported to have XMRV infection. PloS ONE. 2012, 7 (2), e30889. 97. Kerr, J. R. Phatogenesis of human parvovirus B19 in rheumatic disease. Annals of the Rheumatic Diseases. 2000, 59, 672–683. 98. Kerr, J. R. The role of parvovirus B19 in the pathogenesis of autoimmunity and autoimmune disease. Journal of Clinical Pathology. 2016, 69 (4), 279–291. 99. Kerr, J. R., Barah, F., Mattey, D. L. et al. Circulating tumour necrosis factor-alpha and interferon-gamma are detectable during acute and convalescent parvovirus B19 infection and are associated with prolonged and chronic fatigue. The Journal of General Virology. 2001, 82 (12), 3011–3019. 100. Kerr, J. R., Gough, J., Richards, S. C. et al. Antibody to parvovirus B19 nonstructural protein is associated with chronic arthralgia in patients with chronic fatigue syndrome/myalgic encephalomyelitis. The Journal of General Virology. 2010, 91 (4), 893–897. 101. Kerr, J. R., Petty, R., Burke, B. et al. Gene expression subtypes in patients with chronic fatigue syndrome/myalgic encephalomyelitis. The Journal of Infectious Diseases. 2008, 197 (8), 1171–1184. 102. Kerr, J. R., Tyrrell, D. A. Cytokines in parvovirus B19 infection as an aid to understanding chronic fatigue syndrome. Current Pain and Headache Reports. 2003, 7 (5), 333–341. 103. Knox, K., Carrigan, D., Simmons, G. et al. No evidence of murine-like gammaretroviruses in CFS patients previously identified as XMRV-infected. Science. 2011, 333 (6038), 94–97. 104. Koelle, D. M., Barcy, S., Huang, M. L. et al. Markers of viral infection in monozygotic twins discordant for chronic fatigue syndrome. Clinical Infectious Diseases. 2002, 35 (5), 518–525. 105. Kogelnik, A. M., Loomis, K., Hoegh-Petersen, M. et al. Use of valganciclovir in patients with elevated antibody titers against Human Herpesvirus-6 (HHV-6) and Epstein-Barr Virus (EBV) who were experiencing central nervous system dysfunction including long-standing fatigue. Journal of Clinical Virology. 2006, 37 (1), 33–38. 106. Komaroff, A. L. Chronic fatigue syndromes: relationship to chronic viral infections. Journal of Virological Methods. 1988, 21 (1-4), 3–10. 107. Komaroff, A. L. Is human herpesvirus-6 trigger for chronic fatigue syndrome? Journal of Clinical Virology. 2006, 37, 39–46. 108. Kondo, K., Hayakawa, Y., Mori, R. et al. Detection by polymerase chain reaction amplification of human herpesvirus 6 DNA in peripheral blood of patients with exanthem subitum. Journal of Clinical Microbiology. 1990, 28, 970–974. 109. Kozireva, S. V., Zestkova, J. V., Mikazane, H. J. et al. Incidence and clinical significance of parvovirus B19 infection in patients with rheumatoid arthritis. The Journal of Rheumatology. 2008, 35, (7), 1265–1270. 110. Kozireva, S., Nemceva, G., Danilane, I. et al. Prevalence of Blood- Borne Viral Infections (Cytomegalovirus, Human Herpesvirus-6, Human Herpesvirus-7, Human Herpesvirus-8, Human T-Cell Lymphotropic Virus- I/II, Human Retrovirus-5) Among Blood Donors in Latvia. Annals of Hematology. 2001, 80, 669–673. 111. Krueger, G. R., Ablashi, D. Human Herpesvirus-6, Second Edition, General Virology, Epidemiology and Clinical Pathology. Perspectives in Medical Virology. Netherlands: Elseviere, 2006. – Pp. 251–262. 112. Krueger, G. R., Ablashi, D. V. Human herpesvirus-6: a short review of it biological behaviour. Intervirology. 2003, 46, 257–269.
103 113. Kurtzman, G. J., Friekhofen, N. K., Kimball, J. et al. Pure red-cell aplasia of 10 years duration due to persistent parvovirus B19 infection and its cure with immunoglobulin. The New England Journal of Medicine. 1989, 321, 519–523. 114. Lattie, E. G., Antoni, M. H., Fletcher, M. A. et al. Stress management skills, neuroimmune processes and fatigue levels in persons with chronic fatigue syndrome. Brain, Behavior, and Immunity. 2012, 26 (6), 849–858. 115. Lerner, A. M. Beqaj, S. H., Deeter, R. G., Fitzgerald, J. T. IgM serum antibodies to human cytomegalovirus nonstructural gene products p52 and CM2(UL44 and UL57) are uniquely present in a subset of patients with chronic fatigue syndrome. In Vivo. 2002, 16 (3), 153–159. 116. Lerner, A. M., Beqaj, S. H., Deeter, R. G., Fitzgerald, J. T. IgM serum antibodies to Epstein-Barr virus are uniquely present in a subset of patients with chronic fatigue syndrome. In Vivo. 2004, 18 (2), 101–106. 117. Levine, S., Eastman, H., Ablashi, D. V. Prevalence of IgM and IgG Antibody to HHV-6 and HHV-8 and Results of Plasma PCR to HHV-6 and HHV-7 in a Group of CFS Patients and Healthy Donors. Journal of Chronic Fatigue Syndrome. 2001, 9 (1–2), 31–40. 118. Lidbury, B. A., Kita, B., Lewis, D. P. et al. Activin B is a novel biomarker for chronic fatigue syndrome/myalgic encephalomyelitis (CFS/ME) diagnosis: a cross sectional study. Journal of Translational Medicine. 2017, 15 (1), 60. 119. Liefeldt, L., Plentz, A., Klempa, B. et al. Recurrent high level parvovirus B19/genotype 2 viremia in a renal transplant recipient analyzed by real-time PCR for simultaneous detection of genotypes 1 to 3. Journal of Medical Virology. 2005, 75 (1), 161–169. 120. Lo, S. C., Pripuzova, N., Li B. et al. Detection of MLV-related virus gene sequences in blood of patients with chronic fatigue syndrome and healthy blood donors. Proceedings of the National Academy of Sciences of the United States of America. 2010, 107 (36), 15874–15879. 121. Lo, S. C., Pripuzova, N., Li B. et al. Retraction for Lo et al. Detection of MLV-related virus gene sequences in blood of patients with chronic fatigue syndrome and healthy blood donors. Proceedings of the National Academy of Sciences of the United States of America. 2012, 109 (1), 346. 122. Loebel, M., Eckey, M., Sotzny, F. et al. Serological profiling of the EBV immune response in Chronic Fatigue Syndrome using a peptide microarray. PloS One. 2017, 12 (6), 1–17. 123. Lombardi, V. C., Ruscetti, F. W., Das Gupta, J. et al. Detection of Infectious Retrovirus, XMRV, in Blood Cells of Patients with Chronic Fatigue Syndrome. Science. 2009, 326 (5952), 585–589. 124. Lorusso, L., Mikhaylova, S. V., Capelli, E. et al. Immunological aspects of chronic fatigue syndrome. Autoimmunity Reviews. 2009, 8 (4), 287–291. 125. Luo, Y., Qiu, J. Human parvovirus B19: a mechanistic overview of infection and DNA replication. Future Virology. 2015, 10 (2), 155–167. 126. Lyall, E. G., Cubie, H. A. Human herpesvirus-6 DNA in the saliva of paediatric oncology patients and controls. Journal of Medical Virology. 1995, 47 (4), 317–322. 127. Maes, M. A new case definition of Neuro-Inflammatory and Oxidative Fatigue (NIOF), a neuroprogressive disorder, formerly known as chronic fatigue syndrome or Myalgic Encephalomyelitis: results of multivariate pattern recognition methods and external validation by neuro-immune biomarkers. Neuro Endocrinology Letters. 2015, 36 (4), 320–329. 128. Maes, M., Mihaylova, I., Kubera, M. et al. IgM-mediated autoimmune responses directed against anchor-age epitopes are greater in myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS) than in major depression. Metabolic Brain Disease. 2012, 27 (4), 415–423 (b).
104 129. Maes, M., Twisk, F. N., Kubera, M., Ringel, K. Evidence for inflammation and activation of cell-mediated immunity in Myalgic Encephalomyelitis/Chronic Fatigue Syndrome (ME/CFS): increased interleukin-1, tumor necrosis factor-α, PMN-elastase, lysozyme and neopterin. Journal of Affective Disorders. 2012, 136 (3), 933–939. 130. Magalhaes Ide, M., Martins, R. V., Vianna, R. O. et al. Detection of human herpesvirus 7 infection in young children presenting with exanthema subitum. Memorias do Instituto Oswaldo Cruz. 2011, 106, 371–373. 131. Mainan, F. A. Simultaneous measurement of antibodies to Epstein-Barr virus, human herpesvirus 6, herpes simplex virus types 1 and 2, and 14 enteroviruses in chronic fatigue syndrome: is there evidence activation of a nonspecific polyclonal immune response? Clinical Infectious Diseases. 1994, 19 (3), 448–453. 132. Manaresi, E., Gallinella, G., Zerbini, M. et al. IgG immune response to B19 parvovirus VP1 and VP2 linear epitopes by immunoblot assay. Journal of Medical Virology. 1999, 57, 174–178. 133. Masuda, A., Munemoto, T., Yamanaka, T. et al. Psychosocial characteristics and immunological functions in patients with postinfectious chronic fatigue syndrome and noninfectious chronic fatigue syndrome. Journal of Behavioral Medicine. 2002, 25 (5), 477–485. 134. Matano, S., Kinoshita, H., Tangawa, K. et al. Acute parvovirus B19 infection mimicking chronic fatigue syndrome. Internal Medicine. 2003, 42 (9), 903–905. 135. Meeus, M., Nijs, J., Huybrechts, S., Truijen, S. Evidence for generalized hyperalgesia in chronic fatigue syndrome: a case control study. Clinical Rheumatology. 2010, 29 (4), 393–398. 136. Megaw, A. G., Rapaport, D., Avidor, B. et al. The DNA sequence of the RK strain of human herpesvirus 7. Virology. 1998, 244 (1), 119–132. 137. Mensah, F. K. F., Bansal, A. S., Ford, B., Cambridge, G. Chronic fatigue syndrome and the immune system: Where are we now? Neurophysiologie Clinique/Clinical Neurophysiology. 2017, 47 (2), 131–138. 138. Milrad, S. F., Hall, D. L., Jutagir, D. R. et al. Poor sleep quality is associated with greater circulating pro-inflammatory cytokines and severity and frequency of chronic fatigue syndrome/myalgic encephalomyelitis (CFS/ME) symptoms in women. Journal of Neuroimmunology. 2017, 303, 43–50. 139. Mirandola, P., Menegazzi, P., Merighi, S. et al. Temporal mapping of transcripts in herpesvirus 6 variants. Journal of Virology. 1998, 72 (5), 3837–3844. 140. Modrow, S., Dorsch, S. Antibody responses in parvovirus B19 infected patients. Pathologie- Biologie (Paris). 2002, 50, 326–331. 141. Momoeda, M., Wong, S., Kawase, N. et al. A putative nucleoside triphosphate- binding domain in the nonstructural protein of B19 parvovirus is required for cytotoxicity. Journal of Virology. 1994, 68, 8443–8446. 142. Montoya, J. G., Neely, M. N., Gupta, S. et al. Antiviral therapy of two patients with chromosomally-integrated human herpesvirus-6A presenting with cognitive dysfunction. Journal of Clinical Virology. 2012, 55 (1), 40–45. 143. Morch, K., Hanevik, K., Rivenes, A. C. et al. Chronic fatigue syndrome 5 years after giardiasis: differential diagnoses, characteristics and natural course. BMC Gastroenterology. 2013, 12 (13), 28. 144. Morey, A. L., Ferguson, D. J., Fleming, K. A. Ultrastructural features of fetal erythroid precursors infected with parvovirus B19 in vitro: evidence of cell death by apoptosis. The Journal of Pathology. 1993, 169 (2), 213–220.
105
145. Morinet, F., Corruble, E. Chronic Fatigue Syndrome and Viral Infections. An International Perspective on the Future of Research in Chronic Fatigue Syndrome. Ed. by Snell C. R. ISBN: 978-953-51-0072-0 – Croatia: InTech, 2012. – Pp. 1–12. Available from: http://www.intechopen.com/books/an-international-perspective-on-the-future-of-research-in- chronic-fatigue-syndrome/chronic-fatigue-syndrome-and-viral-infections. 146. Munakata, Y., Kato, I., Saito, T. et al. Human parvovirus B19 infection of monocytic cell line U937 and antibody-dependent enhancement. Virology. 2006, 345, 251–257. 147. Myhill, S., Booth, N. E., McLaren-Howard, J. Targeting mitochondrial dysfunction in the treatment of Myalgic Encephalomyelitis/Chronic Fatigue Syndrome (ME/CFS) – a clinical audit. Internal Journal of Clinical and Experimental Medicine. 2013, 6 (1), 1–15. 148. Nakamura, T., Schwander, S.K., Donnelly, R. et al. Cytokines across the night in chronic fatigue syndrome with and without fibromyalgia. Clinical and Vaccine Immunology. 2010, 17 (4), 582–587. 149. Nastke, M. D., Becerra, A., Yin, L. et al. Human CD4+ T cell response to human herpesvirus 6. Journal of Virology. 2012, 86 (9), 4776–4792. 150. Nevala, W. K., Vachon, C. M., Leontovich, A. A. et al. Evidence of systemic Th2-driven chronic inflammation in patients with metastatic melanoma. Clinical Cancer Research. 2009, 15 (6), 1931–1939. 151. Nicolson, G. L., Gan, R., Haier, J. Multiple co-infections (Mycoplasma, Chlamydia, human herpes virus-6) in blood of chronic fatigue syndrome patients: association with signs and symptoms. APMIS: Acta Pathologica, Microbiologica et Immunologica Scandinavica. 2003, 111 (5), 557–566. 152. Nijs, J., Fremont, M. Intracellular immune dysfunction in myalgic encephalomyelitis/chronic fatigue syndrome: state of the art and therapeutic implications. Expert Opinion on Therapeutic Targets. 2008, 12 (3), 281–289. 153. Nishihara, K. Disclosure of the major causes of mental illness-mitochondrial deterioration in brain neurons via opportunistic infection. Journal of Biological Physics and Chemistry. 2012, 12, 11-18. 154. Nora-Krukle, Z., Chapenko, S., Logina, I. et al. Human herpesvirus 6 and 7 reactivation and disease activity in multiple sclerosis. Medicina (Kaunas). 2011, 47 (10), 527–531. 155. Oakes, B., Hoagland-Henefield, M., Komaroff, A. L. et al. Human endogenous retrovirus-K18 superantigen expression and human herpesvirus-6 and human herpesvirus-7 viral loads in chronic fatigue patients. Clinical Infectious Diseases. 2013, 56 (10), 1394–1400. 156. Odom, C. I., Gaston, D. C., Markert, J. M., Cassady, K. A. Human herpesviridae methods of natural killer cell evasion. Advances in Virology. 2012, 2012, 359869. 157. Otani, N., Okuno, T. Human herpesvirus 6 infection of CD4+ T-cell subsets. Microbiology and Immunology. 2007, 51, 993–1001. 158. Ozawa, K. J., Ayub, J., Yu-Shu, H. et al. Novel transcription map for the B19 (human) pathogenic parvovirus. Journal of Virology. 1987, 61, 2395–2406. 159. Patarca, R. Cytokines and chronic fatigue syndrome. Annals of the New York Academy of Sciences. 2001, 933, 185–200. 160. Patarca, R., Sandler, D., Walling, J. et al. Assessment of immune mediator expression levels in biological fluids and cells: a critical appraisal. Critical Reviews in Oncogenesis. 1995, 6 (2), 117–149. 161. Patarca-Montero, R., Antoni, M., Fletcher, M. A., Klimas, N. G. Cytokine and other immunologic markers in chronic fatigue syndrome and their relation to neuropsychological factors. Applied Neuropsychology. 2001, 8 (1), 51–64.
106 162. Pattison, J. R., Jones, S. E., Hodgson, J. et al. Parvovirus infections and hypoplastic crisis in sickle-cell anaemia. Lancet. 1981, 1, 664–665. 163. Pfeiffer, B., Thomson, B., Chandran, B. Identification and characterization of a cDNA derived from multiple splicing that encodes envelope glycoprotein gp105 of human herpesvirus 6. Journal of Virology. 1995, 69, 3490–3500. 164. Pfrepper, K. I., Enders, M., Motz, M. Human parvovirus B19 serology and avidity using a combination of recombinant antigens enables a differentiated picture of the current state of infection. Journal of veterinary medicine B, Infectious diseases and veterinary public health. 2005, 52 (7–8), 362–365. 165. Pier, G. B., Lyczak, J. B., Wetzler, L. M. Immunology, Infection, and Immunity. Washington, DC, American Society for Microbiology Press, 2004. – Pp. 349–368. 166. Politou, M., Koutras, D., Kaparos, G. et al. Seroprevalence of HHV-6 and HHV-8 among blood donors in Greece. Virology Journal. 2014, 11, 153. 167. Prusty, B. K., Gulve, N., Rasa, S. et al. Possible Chromosomal and Germline Integration of Human Herpesvirus 7 (HHV-7). The Journal of General Virology. 2017, 98 (2), 266–274. 168. Prusty, B. K., Krohne, G., Rudel, T. Reactivation of chromosomally integrated human herpesvirus-6 by telomeric circle formation. PLoS Genetics. 2013, 9 (12), e1004033 b. 169. Prusty, B. K., Siegl, C., Hauck, P. et al. Chlamydia trachomatis infection induces replication of latent HHV-6. PLoS One. 2013, 8 (4), e61400. 170. Reeves, W. C., Stamey, F. R., Black, J. B. et al. Human herpesviruses 6 and 7 in chronic fatigue syndrome: a case-control study. Clinical Infectious Diseases. 2000, 31 (1), 48–52. 171. Rein, A. Murine Leukemia Viruses: Objects and Organisms. Advances in Virology. 2011, 2011, 403419. 172. Richardson, G., Epstein, D., Chew-Graham, C. et al. Cost-effectiveness of supported self-management for CFS/ME patients in primary care. BMC Family Practice. 2013, 14, 12. 173. Richman, D. D., Whitley, R. J., Hayden, F. G. Clinical Virology. – 2nd ed. – Washington, ASM Press, 2002. – Pp. 463–478. 174. Roizman, B., Carmichael, L. E., Deinhardt, F. et al. Herpesviridae. Definition, provisional nomenclature, and taxonomy. The Herpesvirus Study Group, the International Committee on Taxonomy of Viruses. Intervirology. 1981, 16 (4), 201–217. 175. Russell, L., Broderick, G., Taylor, R. et al. Illness progression in chronic fatigue syndrome: a shifting immune baseline. BMC Immunology. 2016, 17, 3. 176. Sairenji, T., Nagata, K. Viral infections in chronic fatigue syndrome. Nihon Rinsho. 2007, 65 (6), 991–996. 177. Sairenji, T., Yamanishi, K., Tachibana, Y. et al. Antibody responses to Epstein-Barr virus, human herpesvirus 6 and human herpesvirus 7 in patients with chronic fatigue syndrome. Intervirology. 1995, 38 (5), 269–273. 178. Salahuddin, S. Z., Ablashi, D. V., Markham, P. D. et al. Isolation of a new virus, HBLV, in patients with lymphoproliferative disorders. Science. 1986, 234 (4776), 596–601. 179. Sanders, P., Korf, J. Neuroaetiology of chronic fatigue syndrome: an overview. The World Journal of Biological Psychiatry. 2008, 9 (3), 165–171. 180. Santoro, F., Kennedy, P. E., Locatelli, G. et al. CD46 is a cellular receptor for human herpesvirus 6. Cell. 1999, 99, 817–827. 181. Sato, E., Furuta, R. A., Miyazawa, T. An endogenous murine leukemia viral genome contaminant in a commercial RT-PCR kit is amplified using standard primers for XMRV. Retrovirology. 2010, 7, 110.
107 182. Satterfield, B. C., Garcia, R. A., Jia, H. et al. Serologic and PCR testing of persons with chronic fatigue syndrome in the United States shows no association with xenotropic or polytropic murine leukemia virus-related viruses. Retrovirology. 2011, 8, 12. 183. Schneider, C. L., Hudson, A. W. The human herpesvirus-7 (HHV-7) U21 immunoevasin subverts NK-mediated cytoxicity through modulation of MICA and MICB. PloS Pathogens. 2011, 7 (11), e1002362. 184. Schwarz, T. F., Roggendorf, B., Hottentrager, B. et al. Immunoglobulins in the prophylaxis of parvovirus B19 infection. The Journal of Infectious Diseases. 1990, 162, 12–14. 185. Secchiero, P., Carrigan, D. R., Asano, Y. et al. Detection of human herpesvirus 6 in plasma of children with primary infection and immunosuppressed patients by polymerase chain reaction. The Journal of Infectious Diseases. 1995, 171 (2), 273–280. 186. See, D. M., Tilles, J. G. Alpha-Interferon treatment of patients with chronic fatigue syndrome. Immunological Investigations. 1996, 25 (1–2), 153–164. 187. Servant-Delmas, A., Lefrere, J. J., Morinet, F., Pillet, S. Advances in human B19 erythrovirus biology. Journal of Virology. 2010, 84, 9658–9665. 188. Silverman, R. H., Nguyen, C., Weight, C. J., Klein E. A. The human retrovirus XMRV in prostate cancer and chronic fatigue syndrome. Nature Reviews Urology. 2010, 7, 392–402. 189. Singh, I. R. Detecting retroviral sequences in chronic fatigue syndrome. Viruses. 2010, 2, 2404–2408. 190. Soderlund, M., Brown, C. S., Spaan, W. J. et al. Epitope type-specific IgG responses to capsid proteins VP1 and VP2 of human parvovirus B19. The Journal of Infectious Diseases. 1995, 172, 1431–1436. 191. Soderlund-Venermo, M., Hokynar, K., Nieminen, J. et al. Persistence of human parvovirus B19 in human tissues. Pathologie-Biologie. 2002, 50, 307–316. 192. Steffen, I., Tyrrell, D. L., Stein, E. et al. No Evidence for XMRV Nucleic Acids, Infectious Virus or Anti-XMRV Antibodies in Canadian Patients with Chronic Fatigue Syndrome. PloS ONE. 2011, 6 (11), e27870. 193. Stewart, C. C., Cookfair, D. L., Hovey, K. M. et al. Predictive immunophenotypes: disease-related profile in chronic fatigue syndrome. Cytometry. Part B, Clinical Cytometry. 2003, 53 (1), 26–33. 194. Streiter, M., Malecki, M., Prokop, A. et al. Does human bocavirus infection depend on helper viruses? A challenging case report. Virology Journal. 2011, 8, 417. 195. Sultanova, A., Cistjakovs, M., Gravelsina, S. et al. Association of active human herpesvirus-6 (HHV-6) infection with autoimmune thyroid gland diseases. Clinical Microbiology and Infection. 2017, 23 (1), 50.e1–50.e5. 196. Takahashi, Y., Murai, C., Shibata, S. et al. Human parvovirus B19 as a causative agent for rheumatoid arthritis. Proceedings of the National Academy of Sciences of the United States of America. 1998, 95, 8227–8232. 197. Tamura, K., Stecher, G., Peterson, D. et al. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Molecular Biology and Evolution. 2013, 30, 2725–2729. 198. Tang, H., Serada, S., Kawabata, A. et al. CD134 is a cellular receptor specific for human herpesvirus-6B entry. Proceedings of the National Academy of Sciences of the United States of America. 2013, 110 (22), 9096–9099. 199. Tejada-Simon, M. V., Zang, Y. C., Hong, J. et al. Cross-reactivity with myelin basic protein and human herpesvirus-6 in multiple sclerosis. Annals of Neurology. 2003, 53 (2), 189–197. 200. Ter Wolbeek, M., van Doornen, L.J., Kavelaars, A. et al. Longitudinal analysis of pro- and anti-inflammatory cytokine production in severely fatigued adolescents. Brain, Behavior and Immunity. 2007, 21 (8), 1063–1074.
108 201. Tomic, S., Brkic, S., Maric, D., Mikic, A. N. Lipid and protein oxidation in female patients with chronic fatigue syndrome. Archives of Medical Science. 2012, 8 (5), 886–891. 202. Tomsone, V., Logina, I., Millers, A. et al. Association of human herpesvirus 6 and human herpesvirus 7 with demyelinating diseases of the nervous system. Journal of Neurovirology. 2001, 7 (6), 564–569. 203. Traylen, C. M., Patel, H. R., Fondaw, W. et al. Virus reactivation: a panoramic view in human infections. Future Virology. 2011, 6 (4), 451–463. 204. Trinchieri, G. Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific adaptive immunity. Annual Reviews of Immunology. 1995, 13, 251–276. 205. Tweedy, J., Spyrou, M. A., Hubacek, P. et al. Analyses of germline, chromosomally integrated human herpesvirus 6A and B genomes indicate emergent infection and new inflammatory mediators. The Journal General Virology. 2015, 96 (2), 370–389. 206. Underhill, R. A. Myalgic encephalomyelitis, chronic fatigue syndrome: An infectious disease. Medical Hypotheses. 2015, 85 (6), 765–773. 207. Urisman, A., Molinaro, R. J., Fischer, N. et al. Identification of a Novel Gammaretrovirus in Prostate Tumors of Patients Homozygous for R462Q RNASEL Variant. PLOS Pathogens. 2006, 2 (3), e25. 208. Van den Bosch, G., Locatelli, G., Geerts, L. et al. Development of reverse transcriptase PCR assays for detection of active human herpesvirus 6 infection. Journal of Clinical Microbiology. 2001, 39 (6), 2308–2310. 209. Van Kuppeveld, F. J., de Jong, A. S., Lanke, K. H. et al. Prevalence of xenotropic murine leukaemia virus-related virus in patients with chronic fatigue syndrome in the Netherlands: retrospective analysis of samples from an established cohort. BMJ. 2010, 340, c1018. 210. Vandamme, A. M., Fransen, K., Debaisieux, L. et al. Standardisation of primers and an algorithm for HIV-1 diagnostic PCR evaluated in patients harbouring strains of diverse geographical origin. The Belgian AIDS Reference Laboratories. Journal of Virology Methods. 1995, 51 (2–3), 305–316. 211. Visser, J., Graffelman, W., Blauw, B. et al. LPS-induced IL-10 production in whole blood cultures from chronic fatigue syndrome patients is increased but supersensitive to inhibition by dexamethasone. Journal of Neuroimmunology. 2001, 119 (2), 343–349. 212. von Poblotzki, A., Hemauer, A., Gigler, A. et al. Antibodies to the nonstructural protein of parvovirus B19 in persistently infected patients: implications for pathogenesis. The Journal of Infectious Diseases. 1995, 172, 1356–1359. 213. Wallace, H. L. 2nd, Natelson, B., Gause, W., Hay J. Human herpesviruses in chronic fatigue syndrome. Clinical and Diagnostic Laboratory Immunology. 1999, 6 (2), 216–223. 214. Ward, K. N. Human herpesviruses-6 and -7 infections. Current Opinion in Infectious Diseases. 2005, 18, 247–252. 215. Watt, T., Oberfoell, S., Balise, R. et al. Response to valganciclovir in chronic fatigue syndrome patients with human herpesvirus 6 and Epstein-Barr virus IgG antibody titers. Journal of Medical Virology. 2012, 84 (12), 1967–1974. 216. White, A. T., Light, A. R., Hughen, R. W. et al. Severity of symptom flare after moderate exercise is linked to cytokine activity in chronic fatigue syndrome. Psychophysiology. 2010, 47 (4), 615–624. 217. White, P. D., Goldsmith, K., Johnson, A. L. et al. Recovery from chronic fatigue syndrome after treatments given in the PACE trial. Psychological Medicine. 2013, 43 (10), 2227–2235. 218. Williams, D. A. Cognitive Behavioral Therapy. Neuroimmune Mechanisms and Chronic Fatigue Syndrome. 2003, 12, 103–108.
109 219. Winger, A., Kvarstein, G., Wyller, V. B. et al. Health related quality of life in adolescents with chronic fatigue syndrome: a cross-sectional study. Health and Quality of Life Outcomes. 2015, 13, 96. 220. Wyatt, L. S., Rodriguez, W. J., Balachandran, N., Frenkel, N. Human herpesvirus 7: antigenic properties and prevalence in children and adults. Journal of Virology. 1991, 65 (110), 6260–6265. 221. Wyller, V. B. The chronic fatigue syndrome – an update. Acta Neurologica Scandinavica. Supplementum. 2007, 187, 7–14. 222. Wyller, V. B., Helland, I. B. Relationship between autonomic cardiovascular control, case definition, clinical symptoms, and functional disability in adolescent chronic fatigue syndrome: an exploratory study. BioPsychoSocial Medicine. 2013, 7 (1), 5. 223. Yalcin, S., Karpuzoglu, T., Suleymanlar, G. et al. Human herpesvirus 6 and human herpesvirus 7 infections in renal transplant recipients and healthy adults in Turkey. Archives of Virology. 1994, 136, 183–190. 224. Yamanishi, K., Okuno, T., Shiraki, K. Identification of human herpesvirus-6 as a causal agent for exanthem subitum. Lancet. 1988, 1, 1065–1067. 225. Yanagi, K., Harada, S., Ban, F. et al. High prevalence of antibody to human herpesvirus-6 and decrease in titer with increase in age in Japan. Journal of Infectious Diseases. 1990, 161 (1), 153–154. 226. Yasui, M., Yoshimura, T., Takeuchi, S. et al. A chronic fatigue syndrome model demonstrates mechanical allodynia and muscular hyperalgesia via spinal microglial activation. Glia. 2014, 62 (9), 1407–1417. 227. Zhang, L., Gough, J., Christmas, D. et al. Microbial infections in eight genomic subtypes of chronic fatigue syndrome/myalgic encephalomyelitis. Journal of Clinical Pathology. 2010, 63 (2), 156–164. 228. Zhu, J., Paul, W. E. CD4 T cells: fates, functions, and faults. Blood. 2008, 112 (5), 1557–1569. 229. Zuckerman, J., Banatvala, J. E., Pattison, J. R. Principles and Practice of Clinical Virology. 3rd ed. Chichester, New York: J. Wiley WILEY, 1995. – Pp 1–3, 135–151.
110
ACKNOWLEDGEMENTS
I would like to express my gratitude to my supervisor Dr. med., Assoc. Professor Modra Murovska for guidance, support, motivation and contribution, as well as to Senior Researcher Dr. habil. biol. Svetlana Chapenko for training, consultation and collaboration at work. I would like to thank Professor Angelika Krūmiņa, Professor Ludmila Vīksna and Professor Ināra Logina for providing the clinical material and for contribution in preparation of clinical section, as well as to my colleagues in Rīga Stradiņš University, A. Kirchenstein Institute of Microbiology and Virology for support during PhD studies. I would like to express my gratitude to Vice-Rector for Science, Professor Iveta Ozolanta and Scientific Secretary Ingrīda Kreile for support during doctoral studies. This study was funded in parts by the projects: Taiwan-Latvia-Lithuania Cooperation Project “Establishing of the Framework to Track Molecular Epidemiology of Parvoviruses and to Correlate Sequence Variability with Different Clinical Manifestations” No.6.2.-25/2013/0039, RSU ZP 13/2013 “Association of fibromyalgia and myalgic encephalomyelitis/chronic fatigue syndrome with beta-herpesviruses (HHV-6A, HHV-6B, HHV-7) and parvovirus B19V infection”, “Support for doctoral study programs and research degrees RSU” (2009/0147/1DP/1.1.2.1.2/09/IPIA/VIAA/009), BALTINFECT “Unlocking infectious diseases research potential at Rīga Stradiņš University” (Grant agreement no: 316275) within the European Union 7th Framework Programme and COST Action 15111.
111