Adjuvanted Corn Nanoparticle Enhances the Breadth of Inactivated

Poly(I:C) adjuvanted corn nanoparticle enhances the breadth of inactivated

influenza virus vaccine immune response in pigs

Thesis

Presented in Partial Fulfillment of the Requirements for the Degree Master of Science in

the Graduate School of The Ohio State University

Ninoshkaly Feliciano Ruiz, B.S. BiomedSc

Graduate Program in Comparative and Veterinary Medicine

The Ohio State University

2020

Thesis Committee

Dr. Renukaradhya J. Gourapura, Advisor

Dr. Feng Qu

Dr. Scott P. Kenney

Copyrighted by

Ninoshkaly Feliciano Ruiz

2020

Abstract

Influenza A virus (IAV) is known for causing respiratory viral infections in a broad spectrum of birds and mammals, including humans and pigs. Pig acts as a mixing vessel for the generation of new reassortant IAV viruses of pandemic potential, like the 2009

H1N1 virus strain. The most common method to control of IAV in farms is by the intramuscular (IM) immunization of pig with killed multivalent IAV vaccine. However,

IM immunization induces poor mucosal secretory IgA (SIgA) antibody response in the airways and thus confers highly variable levels of protection. Intranasal (IN) immunization studies using nanoparticle-based IAV vaccines in pigs have shown to increase the specific mucosal SIgA antibody response, cell-mediated immune response and enhances the production of pro-inflammatory cytokines. In this study, we overview the pig immune system to fight IAV infections, different vaccination strategies and several adjuvants that have been tested in pig against swine influenza. Recently, we develop and characterized a sweet corn-derived cationic alpha-D-glucan nanoparticle

(Nano-11) and established its adjuvant potential in mice and pigs. With the objective of improving cross-reactivity of the Nano-11 based killed IAV antigens (Nano-11-KAg) vaccine induced immune responses, in this study, we assessed the combinatorial effect

Nano-11 adsorbed with both KAg and a secondary adjuvant poly(I:C) Nano-11-KAg- poly(I:C) in induction of the mucosal and systemic immune responses and efficacy ii against a heterologous IAV challenge infection in pigs. Our data showed that Nano-11-

KAg-poly(I:C) vaccine elicited cross-reactive SIgA production in the nasal passage and lungs and IgG antibody in the lungs against vaccine virus (H1N2-OH10), challenge virus

(H1N1-OH7), and a heterosubtypic H3N2-OH4 SwIAV. In addition, Nano-11-KAg- poly(I:C) vaccine augmented mRNA expression of the cytokines IL-2, IL-6, IL-10, IL-

13, and TNF-α, and the transcription factor GATA3 in tracheobronchial lymph nodes compared to a commercial multivalent SwIAV vaccine. Also, Nano-11-KAg-poly(I:C) elicited high levels of virus neutralizing antibodies in bronchoalveolar lavage fluid and the frequency of IFNγ secreting γδ T cells. However, reduction in microscopic lung lesions and heterologous challenge virus load in both the Nano-11-KAg and commercial vaccine received animals was partial. In summary, compared to our earlier study using

Nano-11-KAg vaccine, addition of poly(I:C) improved the cross-reactive antibody and cytokine responses in intranasal immunized pigs. Future studies will be aimed at improving the breadth of immunity of Nano-11-KAg vaccine using KAg of multivalent

SwIA strains in pigs.

iii

Acknowledgments

First of all, I want to thank my advisor Dr. Gourapura for his support and guidance during the past two years. I met Dr. Gourapura two years before starting my master's degree as an undergrad student through the Summer Research Opportunity Program (SROP) during summer 2016 and 2017. Many things happened in my life before starting the program at

OSU that led me to wonder if I could come and study in the United States. In my last semester of bachelor (2017), the University of Puerto Rico participated in a national strike for four months, causing a delay in the graduation date. Then on September 20,

2017, Puerto Rico was hit by a category 5 hurricane, called María an atmospheric event that changed our lives forever. During the emergency, I wondered if it was still possible to finish my OSU application on time because in PR everything was paralyzed, we had neither electricity, water nor internet, my hopes of taking the GRE exam and finishing my undergrad coursework on time were fading. As soon as I got a signal on my cell phone, I wrote an email to Dr. Gourapura to let him know the situation. I also called Pamela

Thomas (SROP manager) to let her know that I was still interested in grad school and if she could help me in the process. Thanks to the help of Dr. Gourapura and Pamela, today,

I am closer to achieving my goal to complete my master's degree in the Comparative and

Veterinary Medicine Program.

I will always be grateful to Dr. Santosh Dhakal, a Ph.D. student in Dr. Gourapura’s Lab.

Santosh played a crucial role in my training as a student. He taught me how to correctly use a pipette all the way until how to draw blood from pigs and extract the immune cells.

I also want to thank Shristi Ghimire (past lab technician in our lab) for her help in the laboratory and for being that key person that took my hand when my world crashed to the floor when I almost lost my father due to a heart attack. I thank my coworkers Dr. Sankar

Renu, Ph.D. student Yi Han and Jennifer Schrock, for their help during animal trials, for making the lab more enjoyable and for light moments when the experiments did not work, and results were not as expected. My appreciation also goes to the animal care staff

Dr. Juliette Hanson, Sara Talmadge, Megan Strother, and the department secretary staffs

Hannah Gehman and Robin Weimer.

Food Animal Health Research Program (FAHRP) is a small department with few students where we share similar experiences in the labs. That is why I want to thank the graduate students KC, Kush, Abundo, and Gary for sharing their advice regarding academic writing, to help me find housing in Columbus, suggestions for my master's coursework, and for cheers and unplanned group therapies during our graduate studies.

Wooster has given me beautiful experiences and friendship that will last forever. Outside the scope of the laboratory, I want to thank my friends Edna and Adriana Alfaro for being like my sisters and making me feel at home. I also include Camila, Lourdes, Seyed

Hashem, Yosmer, and Erick for planning the adventures and parties that cheered our weekends. I also recognized the efforts of my family, especially my parents and my grandparents, who came to visit me or bought me the flight ticket for a weekend so I

v could spend time with them. Thanks to all who in one way or another have helped me during this time, and I hope to continue with my studies always with God ahead.

Vita

2013-2017……...... B.S., Biomedicine, University of Puerto Rico at Ponce

May 2018 to present ...... M.S. Comparative and Veterinary Medicine (CVM), The

Ohio State University

Publications

1. Renu S*, Feliciano-Ruiz N*, Ghimire S, Han Y, Schrock J, Dhakal S, Patil V,

Krakowka S, Renukaradhya G.J. (2020). Poly(I:C) adjuvanted corn nanoparticle

enhances the breadth of inactivated influenza virus vaccine immune response in

pigs. Manuscript submitted to Frontiers in immunology.

*contributed equally

2. Renu S, Feliciano-Ruiz N, Ghimire S, Han Y, Schrock J, Dhakal S, Patil V,

Krakowka S, Renukaradhya G.J. (2020). Poly(I:C) augments inactivated influenza

virus-chitosan nanovaccine induced cell mediated immune response in pigs

vaccinated intranasally, Veterinary Microbiology, doi:

https://doi.org/10.1016/j.vetmic.2020.108611

3. S. Dhakal, S. Renu, S. Ghimire, Y.S. Lakshmanappa, B.T. Hogshead, N.

Feliciano-Ruiz, F. Lu, H. HogenEsch, S. Krakowka, C.W. Lee, G.J.

Renukaradhya. (2018). Mucosal Immunity and Protective Efficacy of Intranasal

vii

Inactivated Influenza Vaccine is Improved by Chitosan Nanoparticle Delivery in

Pigs. Frontiers in Immunology; 2018; 9: 934.

4. Dhakal, S., Cheng, X., Salcido, J., Renu, S., Bondra, K., Lakshmanappa, Y. S.,

Misch, C., Ghimire, S., Feliciano-Ruiz, N., Hogshead, B., Krakowka, S., Carson,

K., McDonough, J., Lee, C. W. and Renukaradhya, G. J. (2018). Liposomal

nanoparticle-based conserved peptide influenza vaccine and monosodium urate

crystal adjuvant elicit protective immune response in pigs. Int J Nanomedicine, 13,

6699-6715. doi:10.2147/IJN.S178809.

Fields of Study

Major Field: Comparative and Veterinary Medicine

Immunology and Vaccine Development

viii

Table of Contents

Abstract ...... ii

Acknowledgments ...... iv

Vita ...... vii

Table of Contents ...... ix

List of Tables...... xiv

List of Figures ...... xv

Chapter 1. Introduction ...... 1

1.1 Influenza A virus ...... 1

1.1.1 IAV nomenclature ...... 2

1.1.2 IAV structure and protein function ...... 2

1.1.3 IAV mechanism of infection ...... 3

1.1.4 Role of pigs in IAV diversification ...... 4

1.2 IAV infection in pigs ...... 5

1.2.1 Pathological signs of SwIAV ...... 6

1.2.2 Overview of the immune system ...... 7

1.2.3 Pigs innate immune response to IAV infection ...... 8

1.2.4 Pigs humoral immune response to IAV infection...... 11

1.2.5 Pigs cellular immune response to IAV infection ...... 12

1.3 Current inactivated multivalent SwIAV vaccines and other vaccination approaches ...... 13

1.3.1 Whole inactivated multivalent vaccines (WIV) ...... 13

1.3.2 Interference of maternal antibodies in vaccines ...... 15

1.3.3 Subunit vaccines ...... 16

1.3.4 Nucleic acid-based vaccines ...... 17

1.3.5 Live-attenuated influenza vaccines (LAIV) ...... 18

1.4 Intranasal immunization and the use of nanoparticles in vaccinology ...... 19

1.4.1 Why Intranasal immunization? ...... 19

1.4.2 Why Nanoparticles? ...... 20

1.5 Adjuvants in vaccinology ...... 21

1.5.1 Overview of adjuvants ...... 21

1.5.2 Mineral salts: Aluminum hydroxide ...... 21

1.5.3 Emulsion adjuvants: Freund’s Complete Adjuvant and Liposomes ...... 22

1.5.4 Immune-potentiator adjuvants: CpG oligodeoxynucleotides (CpG-ODN) and

Polyinosine-polycytidylic acid (Poly(I:C)) ...... 23

1.5.5 Polymeric Adjuvants: Poly (lactic-co-glycolic acid) (PLGA), Chitosan (CS)

and Alpha-D-glucan nanoparticle (Nano-11) ...... 25

Chapter 2. Poly(I:C) adjuvanted corn nanoparticle enhances the breadth of inactivated influenza virus vaccine immune response in pigs ...... 29

2.1 Abstract ...... 30

2.2 Introduction ...... 30

2.3 Materials and methods ...... 33

2.3.1 Preparation of influenza viruses, conserved peptides, adjuvant poly(I:C) and

commercial swine flu vaccine ...... 33

2.3.2 Formulation of Nano-11-KAg-poly(I:C) and Nano-11-peptides-poly(I:C) .... 33

2.3.3 In vitro generation and treatment of porcine dendritic cells (DCs) ...... 34

2.3.4 Vaccination and virus challenge trial in pigs ...... 35

2.3.5 Enzyme-linked immunosorbent assay (ELISA) assay ...... 36

2.3.6 Flow cytometry analyses ...... 36

2.3.7 Quantitative reverse transcription PCR (qRT-PCR) analyses ...... 37

2.3.8 Virus neutralization test (VNT) titer and infectious virus titration ...... 37

2.3.9 Histopathology of lungs ...... 38

2.3.10 Statistical analyses ...... 38 xi

2.3.11 Ethics statement ...... 39

2.4 Results...... 39

2.4.1 Preparation of poly(I:C) adjuvanted Nano-11 based influenza nanovaccines 39

2.4.2 Nano-11-KAg-poly(I:C) treatment increased the innate and Th1 cytokines mRNA expression in porcine DCs ...... 40

2.4.3 Nano-11-KAg-poly(I:C) nanovaccine augmented cross-reactive SIgA antibody response ...... 41

2.4.4 Nano-11-KAg-poly(I:C) nanovaccine increased the IgG antibody response in lungs but not in serum ...... 44

2.4.5 IFNγ secretion by lymphocytes of poly(I:C) adjuvanted Nano-11 based influenza nanovaccinates ...... 46

2.4.6 Poly(I:C) adjuvanted Nano-11 based influenza nanovaccinates increased the

Th1 and Th2 cytokines mRNA expression in TBLN ...... 48

2.4.7 Nano-11-KAg-poly(I:C) nanovaccination increased the virus neutralization test titers in the lung (but not in serum) with comparable virus load in the airways to that of commercial vaccine ...... 50

2.5 Discussion ...... 52

2.6 Author contributions ...... 57

2.7 Acknowledgement ...... 57

2.8 Funding ...... 57

xii

2.9 Disclosures ...... 57

2.10 Supplementary materials ...... 58

Bibliography ...... 60

xiii

List of Tables

Table 1 Sequence and isoelectric point of influenza virus specific conserved T cell and B cell peptides ...... 58

Table 2 Sequence of the primers used in qRT-PCR analyses ...... 59

xiv

List of Figures

Figure 1. Porcine DCs treated with Nano-11-KAg-poly(I:C) increased the cytokines mRNA expression...... 41

Figure 2. Poly(I:C) adjuvanted Nano-11-KAg vaccine induced increased cross-reactive SIgA antibody response...... 43

Figure 3. Commercial influenza vaccine augmented systemic IgG response and Nano-11- KAg-poly(I:C) vaccine in lower respiratory tract...... 45

Figure 4. Recall IFN-γ secreting lymphocyte response in Nano-11 and commercial influenza vaccinated/virus challenged pigs...... 47

Figure 5. Cytokines and transcription factor mRNA expression in the tracheobronchial lymph nodes of pigs vaccinated with Nano-11 or commercial influenza vaccine and virus challenged...... 49

Figure 6. Nano-11-KAg-poly(I:C) and commercial influenza vaccines induced increased virus neutralization test titers in BAL fluid and blood of pigs, respectively...... 51

Chapter 1. Introduction

1.1 Influenza A virus

Aquatic wild birds, particularly the migrating waterfowl, are considered to be the natural reservoirs for all IAV subtypes; the realization of this came from extensive surveillance performed in birds during the Newcastle disease outbreak in poultry in US California [1,

2]. IAV belongs to the Orthomyxoviridae family, four genera of IAV exist, among them only A, B, and C genera can cause respiratory illness in humans, while genera D has only been isolated from cattle and is not a threat to humans. IAV is of enormous concern since it is capable of infecting a broad spectrum of birds and mammals resulting in pandemics across the world. Being "The Spanish flu” in 1918 was the worst pandemic reported in history, and “The 2009 H1N1 Pandemic” is the most recent pandemic related to influenza. Every year IAV infects 10-20% of the world's population resulting in 250,000-

500,000 deaths, representing a substantial threat and economic burden to public health.

During the 2018-2019 flu season the Center for Disease Control (CDC) and Prevention of the United States (U.S) reported 35.5 million cases of influenza illness that resulted in

34,200 death. In the U.S, the total estimated cost towards control of annual influenza epidemics is around 26.8-87.1 billion dollars per year [3, 4].

1.1.1 IAV nomenclature

IAV identification and subtyping starts by recovering isolated virus in cell culture

(MDCK cell for mammalian samples) or embryonated chicken eggs (for avian samples).

Hemagglutination (HA) assay is performed to detect or quantify the presence of IAV and subtyping of specific IAV is determined by real time RT-PCR) [5]. IAV protein antigen type is based on the presence and diversity of the two major “spike-like" glycoproteins extend from virus surface: Hemagglutinin (HA) and Neuraminidase (NA). Up to date, 16

HA and 9 NA subtypes of these glycoproteins have been isolated from aquatic birds [6].

The nomenclature of Influenza A is composed by the type of host, geographical region of origin, number of lineages, year of isolation and protein antigen type by letter HxNx. For example: SW/OH/24366/2007 (H1N1-OH7) is a swine origin type A influenza isolated in

Ohio, lineage 24366 of the year 2007 of H1N1 subtype. In North America the IAV subtypes endemic in swine population are H1N1, H1N2 and H3N2. H1N1 and H3N2

IAV subtypes can be divided into four different genetic clusters: , , , 1, 2 and I, II,

III ,IV, respectively [7, 8].

1.1.2 IAV structure and protein function

IAV is a spherical (100nm diameter), segmented (8 single-stranded RNA segments), negative oriented RNA virus. IAV RNA segments are numbered in order of their decreasing length and ten different viral proteins are transcribed from the segments

[9].The envelope of IAV is composed of HA, NA, and matrix protein 2 (M2) Proteins.

HA binds to sialic acid (SA) receptors present in the host cell surface initiating the binding process, NA mediates the cleavage of terminal SA receptors preventing the

2 aggregation of viral buds at the host cell membrane, and mediating the release of new virus particles [10]. Uncoating of the IAV is mediated by M2 protein, a transmembrane ion channel that allows acidification of the viral capsid. The internal matrix of IAV is mainly composed of Matrix 1 protein (M1). Inside the capsid is the viral ribonucleoprotein complex. The ribonucleoprotein complex refers to the viral RNA segments surrounded by nucleoprotein (NP), polymerase acidic protein (PA), polymerase basic protein 1 (PB1) and polymerase basic protein 2 (PB2) [9, 11]. The NP contains a nuclear localization signal that directs the viral RNA into the host nucleus, where viral transcription occurs [12]. PB1 is an RNA dependent RNA polymerase (RdRp) mediating viral RNA segment polymerization, while PB2 and PA are involved in cap-snatching mechanism. PB2 recognizes the 5'cap from host mRNA and PA endonucleases cut and insert the host 5'cap segment into the viral mRNA [13]. Nonstructural protein (NS) is another essential protein encoded by the IAV, and there are two types of this protein.

Nonstructural protein 1 (NS1) is an immunomodulatory protein responsible for suppressing the host immune system, and Nonstructural protein 2 (NS2) helps in the export of viral ribonucleoproteins from host nucleus (Reviewed in [14]).

1.1.3 IAV mechanism of infection

IAV infection starts with the binding of HA protein to SA receptors present on surface of the respiratory epithelial cells. The binding of HA with SA receptors triggers receptor- mediated endocytosis which leads to the formation of the endosome. A drop in pH inside the endosome activates the M2 protein allowing acidification of the viral interior resulting in the uncoating of viral capsid. This drop in pH also causes a conformational

3 change in HA protein required for fusion of the viral and endosome membrane and release of the viral genetic material into the cytoplasm [15]. The NS protein contains a nuclear localization sequence that engages nuclear importins from host allowing the entrance of the viral genetic material into the cell nucleus where replication and transcription occurs. During transcription, the negatively oriented viral RNA is converted to complementary RNA facilitating priming of the strain [12]. Cap snatching and reiterative stuttering are the two mechanisms used by IAV to create the viral mRNA and avoid its recognition from the host immune system. During cap snatching, PB2 polymerase recognizes the 5' cap from cellular mRNA, and PA polymerase cleaves the

10-13 nucleotides [16]. This 5' cap serves as a primer for PB1 polymerase binding and starts the polymerization of the viral mRNA. The viral mRNA is completed when PB1 encounters 5-7 uracil bases and converts them to adenine, which results in the creation of a 3' poly-A tail [17]. The majority of viral mRNA is translated by cytosolic ribosomes, while external proteins are translated by endoplasmic ribosomes. Viral proteins are then exported from the nucleus and concentrated in the lipid raft of the host membrane leading to the formation of viral buds [18]. Finally, the NA protein cleaves the SA receptors preventing aggregation of viral bud and facilitates the release of new IAV particles.

1.1.4 Role of pigs in IAV diversification

Antigenic drift and antigenic shift are the two primary mechanisms responsible for great diversity among IAV subtypes. The main driver for antigenic drift is the lack of proofreading mechanism by the RdRp. In each replication cycle of IAV, mutations are introduced in the genome that can result in amino acid substitutions. These amino acid

4 substitutions usually are concentrated on the viral surface HA protein, allowing IAV to escape pre-existing immunity or alter HA specificity facilitating host jump. For example, avian IAV strains capable of infecting humans present a Q226/G228 amino acid substitution [19]. Pigs can play a significant role during IAV diversification and adaptation because of the presence and distribution of SA receptors in their airways.

Human and swine-origin IAV strains preferentially bind to -2,6-linked SA receptors, while avian-origin IAV strains preferentially bind to -2,3-linked SA receptors [20].

Antigenic shift occurs when the same animal cells are infected at the same time with two different IAV subtypes allowing exchange of IAV RNA segments, resulting in the creation of a novel virus strains with pandemic potential [21]. In pigs, α2,6-linked SA receptors predominate in the upper respiratory tract, and α2,3-SA receptors are more abundant in the lower respiratory tract [22]. The triple reassortant 2009 pandemic H1N1

SwIAV spillover to humans is evidence that pigs can act as a mixing vessel for mammalian and avian influenza viruses [23, 24].

1.2 IAV infection in pigs

Swine influenza A virus (SwIAV) is the term given to the IAV strains predominantly infecting pigs. SwIAV infection in pigs causes low mortality (1%-4%) but associated with high morbidity rates. SwIAV infection is usually complicated by opportunistic pathogens, and the fever caused by the infection can affect the quality of semen in boars, induce abortion in sows and cause piglet mortality. In herds that are in good condition, loss in body weight gain is responsible for the major economic burden to the swine industry. The estimated cost to treat SwIAV infection in farms can be around $10.31 per

5 head [25]. The treatment consists of use of antimicrobials to reduce secondary bacterial infections, expectorants to help in breathing, and avoiding herd crowding which helps to reduce stress and reduce losses.

1.2.1 Pathological signs of SwIAV

SwIAV infection in pigs experimentally inoculated (intranasally and intratracheally) with

6 o high infection dose (10 TCID50) is characterized by rise in body temperature (> 40 C) during the first 3-5 days post-infection (PI), associated with red eyes, coughing, mucosal discharge, difficulty in breathing and depression [26]. The infection of the bronchial epithelial cells with IAV does not occur until 24 hours PI, and the majority of viral particles start budding from the cells reaching the acute phase at day 4 PI [27]. These challenged pigs have been shown to shed virus until day 7 PI. Influenza virus isolated from nasal swab, lung lysate, and bronchoalveolar lavage fluid (BAL fluid) can be measured by qRT-PCR or cell culture techniques. Madin-Darby canine kidney (MDCK) cell line is the most widely used for influenza virus research due to its high expression of

SA receptors; the virus titer is usually expressed in TCID50 (tissue culture infective dose

50%) [28].Enlargement of tracheobronchial lymph nodes (TBLN) and lung pathology can be observed in euthanized pigs at 3-7 days PI. Macroscopic lung consolidation characterized by dark red patches mostly in the cranial and medial lobes, observed from

4-15 days PI [29]. Microscopic lesions of lungs infected with IAV are usually scored for:

(i) Interstitial pneumonia caused by infiltration and accumulation of leukocytes in the alveolar capillaries, which can result in (ii) Atelectasis, collapse of pulmonary parenchyma. (iii) Peri-bronchial and perivascular cuffing characterized by mononuclear

6 cell infiltration and thickening of the bronchi-vascular bundle, (iv) Bronchial exudate refers to the accumulation of necrotic material in the bronchial lumen, and (v) syncytium characterized by the formation of a large vacuoles [26, 30].

1.2.2 Overview of the immune system

The immune system is the defense mechanism that protects the host from invading pathogens, diseases and cancer. Innate immunity refers to a nonspecific rapid immune response without immunological memory. Adaptive immunity is the specific immune response mediated by humoral (antibody-mediated) and cell mediated (T-cell) immune responses that requires at least a week to become activated, it retains immunological memory and can be found only in jawed vertebrates.

The mucosal immune system is an evolutionary mechanism developed by higher mammals to prevent systemic inflammatory immune responses against commensal pathogens or food antigens, and also provide protection against potential pathogens without the need of stimulating a systemic immune response. The mucosal immune system is considered the largest immune organ but also the principal port of entrance for pathogens. It is composed of a single layer of epithelial cells covered with mucus and antimicrobial peptides, that can be divided into inductive and effector sites. The inductive sites are characterized by collective aggregation of mucosa- associated lymphoid tissues

(MALT), containing naïve B and T cells. The gut-associated lymphoid tissues (GALT) and nasopharyngeal-associated lymphoid tissue (NALT) are part of the MALT. The effector site of the mucosal immune system is located in the lamina propria and glandular tissue and contain antigen presenting cells (APC), IgA-producing plasma cells, memory

B cells and T cells. What characterized mucosal immune system from the peripheral immune system, is the anatomical compartmentalization of the mucosal lymphoid tissues and the specific homing mechanism used to maintain the separation of different T cell subtypes. Also the mucosal immune system is characterized by the presence of secretory

IgA antibody, which overlays the mucus layer and help in neutralization of pathogens and toxic products [31, 32].

1.2.3 Pigs innate immune response to IAV infection

Innate immunity is a non-specific first line of defense against any invading pathogen and serves as a bridge for activation of the adaptive immune system. The first hurdle IAV has to overcome is the physical barrier of the airways. The epithelium lining the airways is composed of ciliated pseudostratified columnar epithelial cells and secretory cells attached to each other by tight junctions. Tight junctions serve as a mechanical barrier preventing change during infection and allowing communication between cells [33]. The mucus secreted by goblet cells and the unidirectional movement of the ciliated epithelial cells create the mucociliary escalator, the first line of defense against IAV infection. The mucus secreted by goblet cells allows the pathogen to have contact with antimicrobial peptides like mucins (Muc), ß-defensins, and surfactant proteins (SP) [34]. ß-defensins disrupt pathogen integrity by forming pores in membranes, while Muc5AC and SP proteins (SP-A and SP-B) due to the presence of SA motif in their structure bind to IAV

HA proteins leading to the formation of large aggregates of viral particles. The formation of large aggregates results in the inhibition of IAV attachment and enhance neutrophils phagocytosis activity [35, 36]. Microfold (M) cells are antigen sampling cells present in

8 the follicle-associated epithelium (FAE) of NALT and GALT. M cells transfer antigen found in the airway lumen to APC and lymphoid cells present by vesicular transcytosis

[37, 38].

The pattern recognition receptors (PRR’s) are part of the innate immune system, and their central role is to sense and recognize pathogen-associated molecular patterns

(PAMPs) on the microbes. They are highly expressed on APC like macrophages and dendritic cells (DC's). The most common PRRs are Toll-like receptors (TLR), nucleotide- binding and oligomerization domain (NOD)-like receptors and retinoic acid-inducible gene-I protein (RIG-I).

TLRs receptors can be expressed on the cell surface (TLR-1, 2, 4, 5, 6 and 10) or endosomal membranes compartments (TLR-3, 7 and 8) of the cells. All TLRs except

TLR-3 use the myeloid differentiation primary response 88 (MyD88) adaptor protein to initiate a signaling pathway, leading to translocation of the transcription factors: nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB), activator protein 1 (AP-

1), and the interferon regulatory factor (IRF) to the nucleus resulting in the production of proinflammatory cytokines. Proinflammatory cytokines have a plethora of functions like mediate the activation of natural killer cells (NK) to kill infected cells, activation of macrophages to enhance phagocytosis and antigen presentation, and also can lead to activation of the complement system.

IAV components can be sensed by TLR-3, 7, 8, RIG-I receptor, and NOD-like receptor family pyrin domain containing 3 (NLRP3) [39]. TLR-3 is expressed on the surface and endosome compartments of bronchial and alveolar epithelial cells and can recognize

9 dsRNA segments. Activation of TLR-3 leads to the secretion of type I interferon (IFN-1) and Interleukin 6 (IL-6), which can result in pathology. TLR-7 and 8 are expressed on the endosomal compartment of bronchial epithelial cells, and its activation increases the production of type III IFN and IL-6. Activation of TLR-7 does not control IAV infection but helps in the stimulation of memory B cells [40].

RIG-I is the primary receptor involved in recognition of IAV ssRNA segments. It is expressed in bronchial epithelial cells, and its signaling pathway is carried by the mitochondrial antiviral-signaling adaptor protein (MAVS). Triggering of this receptor results in activation of the transcription factors 7 (IRF7), and NF-κB, causing the expression of a variety of interferon-stimulated genes (ISG) that create an antiviral state and leads to direct activation of the inflammasome complex [41]. The inflammasome complex is a highly regulated inflammatory process composed of NLRP3 receptor,

Apoptosis-Associated Speck-Like Protein Containing A CARD (PYCARD) adaptor protein, and caspase 1 (Reviewed: [42]). NLRP3 receptors are present in the cytosol of airway epithelium and can recognize the ss-RNA segments of IAV. NLRP3 activation leads to the production of pro-inflammatory cytokines IL-1β, IL-18, or pyroptosis, a lytic programmed cell death. NLRP3 activation requires tree specific signal. The priming signal is provided by PRR receptors when they recognize PAMPs (LPS, dsRNA) or cytokines (TNFα, IL-1β), leading to transcriptional upregulation of the inflammasome components (NLRP3, caspase 1 and pro-IL-1β) by NF-κB translocation into the nucleolus. The activation signal occurs when the oligomerized NLRP3 complex directly detect damage-associated molecular patterns (DAMPs), particulates, crystals, K+ efflux,

10 and Ca+2 flux. Recently, it has been shown that the NLRP3 receptors can be activated by

IAV infection, but for this to happen a third signal is required that involves the IAV- encoded M2 ion channel [43].

1.2.4 Pigs humoral immune response to IAV infection

In experimentally infected pigs, the majority of the antibodies are created against the two major IAV surface glycoproteins (HA and NA) and their main role is to neutralize IAV infection. The role of neutralizing antibodies is to prevent the virus from infecting cells by blocking virus attachment, promoting virus aggregation, and preventing virus uncoating in the endosome.

HA-specific IgG antibody titers of at least 80, can be detected in serum after 7 days post infection (PI), increasing to 320-640 antibody titers after 14-21days PI , and the HA- specific IgA antibody titers in nasal swab can be detected around day 4 PI [44-46].

Antibodies against conserved internal proteins can be detected in serum after 30 days PI, and mucosal IgG and IgA specific influenza antibodies in BAL fluid of infected pig can be detected after day 21 PI [47].

Non-neutralizing antibodies play an essential role in the control and clearance of IAV infection by the use of the antibody-dependent cellular cytotoxicity (ADCC) mechanism.

ADCC is a mechanism mediated by the Fc receptors that actively lyses cells whose membrane-surface proteins have been targeted with IAV specific antibodies. Activation of FcR IIIa in NK cells results in the production of granzyme B and perforin, that triggers IAV infected cell apoptosis. Also, activation of the NK results in the production of TNFα and IFN cytokines priming the adaptive immune response (reviewed: [3]).

1.2.5 Pigs cellular immune response to IAV infection

Dendritic cells (DC’s) act as a bridge between the innate and adaptive immune response.

The presence of PRRs on DC’s cell surface allows them to recognize a variety of

PAMPs. Lung DC’s are activated against IAV infection primarily by the recognition of dsRNA segments or by the presence of DAMP's molecules released from infected cells.

Lung DC’s obtain IAV antigens by phagocytosis of infected/dying cells or by direct infection with IAV [48, 49]. Once lung DC’s recognize IAV antigens they migrate to draining lymph nodes following a chemokine gradient (CCR-7 upregulated) and present antigens via the major histocompatibility complex II (MHC-II) and MHC-I. The capability of DC’s to induce activation of cytotoxic T cells (CTLs) and T helper (Th) memory cells is by their ability to cross-present extracellular antigen peptides using the

MHC-I complex [50].

CTLs clear IAV infection by eliminating infected epithelial cells. CTLs activity is mediated by granule exocytosis and Fas-ligand (FasL) mediated apoptosis. The granule exocytosis mechanism is composed of perforins and granzymes used by both CTLs and

Th cells to clear IAV infection. Perforins create pores in the membrane of the infected cell allowing the entrance of granzymes, which target cell apoptosis by cleaving pro- caspases into their apoptotic-active form. The binding of the T-cell receptor (TCR) with the MHC-I complex of infected cells or APC upregulates the expression of FasL in the T cell surface. The binding of FasL with Fas receptors in the infected cell/APC leads to the recruitment and cleavage of pro-caspase 8, resulting in the activation of the mitochondrial apoptotic pathway.

Th cells fight indirectly against IAV infection by cytokine production (IFNγ, TNFα and

IL-10) and B cell stimulation [51]. IFNγ is the principal proinflammatory cytokine secreted by CTLs and Th cells and has been shown to activate macrophages, upregulate the expression of MHC molecules and promote antibody isotype switching [52]. IL-10 is mainly produced by CTLs and their role is immunoregulatory, involved in downregulation of MHC complex, inhibition of cell proliferation and control secretion of pro-inflammatory cytokines [53]. The Tumor Necrosis Factor alpha (TNFα) can serve as a pro- or anti-inflammatory cytokine by contributing to tissue damage during IAV infection or inducing apoptosis by binding to TNFR-1 of infected cells [51, 54].

Experimental studies in vaccinated pigs demonstrated that T cell response, especially

CTLs could reduce viral shedding, lung pathology, and flu symptoms in the absence of neutralizing antibodies [55, 56]. In a longitudinal experiment of intranasally infected pigs with H1N2, the frequency of CD4+ T cell in tracheobronchial lymph nodes (TBLN) increases by day 4-9 PI, while CD8+ T cells in lungs increase by day 6 PI [29].

1.3 Current inactivated multivalent SwIAV vaccines and other vaccination approaches

1.3.1 Whole inactivated multivalent vaccines (WIV)

Intramuscular (IM) immunization is the most common method to control SwIAV in farms. WIV vaccines, usually contains the major IAV subtypes circulating in the US swine population: H1N1, H1N2, and H3N2. IM immunization of pigs with killed influenza virus strains have been shown to confer protection against identical or similar virus strains and produce a strong IgG antibody response in serum; but is a poor inducer of mucosal IgA antibody response and T cell response which is crucial to neutralize and 13 stop IAV infection and transmission [46]. The IAV strains included in WIV vaccines have to be grown in embryonated chicken eggs or MDCK cells, which take a considerable amount of time to extract vaccine antigen. Due to the mutagenic nature of

IAV and the coexistent of different IAV subtypes in the swine population Influenza WIV vaccines has to be continuously updated. The majority of antibodies induced by WIV vaccines are against HA surface protein, which undergoes frequent antigenic drift, escaping pre-existing immunity in herds. Ideally, a well-matched HA vaccine will create neutralizing antibodies against the HA protein that will interfere with IAV infection and clear the virus from the respiratory tract [57, 58]. In contrast to human influenza surveillance, there is not a standard system to identify and keep up to date the SwIAV vaccines. One of the reasons that make swine influenza surveillance complicated is the co-existence of different subtypes of IAV. FluSure XP®, MaxiVac Excell® 5.0 and

ImmunSTAR® are some of the vaccines licensed in the US to treat SwIAV infection, these vaccines are given by IM route and are composed of multivalent IAV strains with a

Freund's incomplete adjuvant in their formulation [46]. For example, Zoetis FluSure

XP® is a SwIAV vaccine widely used in the US, recently updated on 2013 based on the surveillance performed on the HA gene [8, 59]. FluSure XP is a whole inactivated multivalent oil-in-water adjuvant vaccine given intramuscularly twice (gap of 3 weeks) to healthy herds (3 weeks of age or older), pregnant sows and gilts to prevent or reduce the severity of IAV infection [60]. This vaccine formulation contains the IAV clusters more prevalent in the US swine population: H1N1 gamma, H1N2 delta-1 and the two new

H3N2 cluster IV-A and IV-B.

1.3.2 Interference of maternal antibodies in vaccines

Vaccination of breeding sows, with the goal of transferring protection to piglets by colostrum is a common strategies farmers used to control SwIAV infection in breed-to- wean farms [61, 62]. The presence of these maternal antibodies can have a negative effect on vaccine efficacy by interfering with the development and activation of the piglet immune system at an early stage. A study performed by the Loeffen group [63] indicates that maternally derived antibodies (MDA) can protect piglets against clinical consequences of a primary influenza infection, but in a secondary infection, this MDA piglets can shed virus for a longer time, develop a weaker immune response and have a reduced overall growth performance in comparison to pigs without maternal antibodies.

In an experiment performed by Kitikoon et al. (2006) [64], pigs IM vaccinated in the presence of MDA showed to reduce humoral and T cell response and increase SwIAV induced pneumonia in comparison to pigs vaccinated in the absence of maternal antibodies. Rajao et al.(2016) [65] showed that MDA could induce vaccine-associated enhanced respiratory disease (VAERD) syndrome in piglets. In this experiment seropositive sows to H1N1pdm09 were boosted with homologous virus by vaccination or intranasal infection, their piglets were then challenged with a homologous or heterologous virus strain. The group of piglets who obtained MDA from the mother receiving WIV vaccine developed VAERD syndrome after being challenge with heterologous virus strain [65]. Vaccine-associated enhanced respiratory disease

(VAERD) syndrome is characterized by severe respiratory diseases, prolonged fever and flu symptoms in pigs [66]. The exact mechanism of VAERD syndrome is unknown but it

15 has been associated with the presence of poor neutralizing antibodies of low avidity against IAV surface glycoproteins. This poor cross-reactive antibody response can be stimulated by the HA mismatched between vaccine strain and challenge strain [67]. A study performed by Khurana et al., suggested that antibody dependent enhanced illness is induced by strain specific non-neutralizing antibody, likely by the post-fusion form HA2 specific non-neutralizing antibody [68].

1.3.3 Subunit vaccines

The goal of subunit vaccines is to create broadly neutralizing antibodies and T cell responses against highly conserved viral epitopes. The advantages of subunit vaccine is that they can reduce the amount of time and antigen required during vaccine formulation and can also serve as an "universal vaccine," eliminating annual vaccine updates [69].

Experiments using highly conserved epitopes from influenza proteins like HA1 and HA2 stem, NA, NP, and M2e proteins have shown to induce the production of broad cross- reactive Abs and protective immunity against challenge viruses [70]. IN immunization of mice with consensus M2e peptide conjugated to gold nanoparticles using CpG as an adjuvant significantly increased specific M2e IgG antibody response in serum, increased mucosal IgA in nasal wash, and IgG antibodies in the lungs conferred protection against

H1N1, H3N2 or H5N1 challenge virus dose [71]. Valkenburg et al. (2016) [72] designed and tested the protective efficacy of an oil-in-water adjuvanted HA mini-stem vaccine, which resulted in the production of broadly cross-reactive neutralizing Ab response and protection against lethal heterologous IAV challenge in mice. The problem with highly conserved epitopes in vaccines is that they are poorly immunogenic, and high amounts of

16 antigen and repeated booster doses are required to achieve immunity [73]. One of the reasons why peptides are poorly immunogenic is because due to their small size, the epitopes are unable to form a cross-link between B-cell receptors (BCR). BCR cross- linking is required to stimulate affinity maturation that leads to the production of epitope- specific antibodies. One way to solve this problem is by linking the epitope peptides in a virus like particle, inactivated toxins or nanoparticles that will allow the cross-link between BCR [74]. For this reason, a suitable adjuvant and vaccine delivery system is required to trigger the immune response.

1.3.4 Nucleic acid-based vaccines

The main goal of nucleic acid-based vaccines is to generate a specific immune response to an antigen without the necessity of exposing the host to a pathogen. The most common technique is to inoculate the animal by IM or subcutaneous route with a DNA plasmid encoding for the Ag of interest. This DNA plasmid will be taken by muscle or keratinocytes cells and integrated into the cell genome; eventually this DNA sequence will be transcribed and translated into an immunizing protein. These proteins are then recognized by immune cells that build an immune response against them. The advantage of DNA vaccine is that they are stable, highly pure DNA can be prepared, and antibodies against specific IAV internal proteins are elicited [75]. Pigs immunized intradermally with a polyvalent influenza DNA vaccine ,encoding six different genes of pandemic origin IAV strain, developed antibodies against internal proteins, increased HI and neutralizing antibody titers, increased the frequency of IFNγ producing cells and reduced viral shedding after challenge [76-78]. This type of vaccine faces strong ethical concerns

17 since we do not know where the DNA sequence will be inserted in the genome, and if there is a risk to develop an anti-DNA immune response.

1.3.5 Live-attenuated influenza vaccines (LAIV)

LAIV are given by IN route and contain attenuated IAV particles capable of infecting and replicating at very low levels in the respiratory tract of vaccinated animals without causing illness. The advantage of LAIV vaccines is that they can mimic IAV natural infection and stimulate a balanced cell-mediated and humoral immune response [46,

79].Three types of attenuations to IAV have been developed and tested in swine: cold- adapted, NS-1 protein truncation, and elastase-dependent LAIV vaccines [70]. For example, IN immunization of pigs with a LAIV vaccine containing temperature-sensitive mutations in the PB2 and PB1 genes of a triple reassortant virus, H3N2, shows an increase in neutralizing IgG and IgA Ab titers in serum and significantly increased frequency of IFNγ and Th memory cells in comparison to WIV vaccinated pigs after challenge [80]. Another advantage of the LAIV vaccine is that it can be used in the presence of maternal antibodies and has not been shown to enhance VARED syndrome

[79, 81]. Ingelvac Provenza is the first commercially available LAIV vaccine for use in swine [82]. This IAV vaccine contains a truncated NS1 protein which makes the virus more susceptible to type I IFN. Provenza immunized piglets positive to maternal antibody have shown to significantly reduce viral shedding after being challenged at the age of 12 weeks with the heterologous H1N2 or H3N2 virus strain [81]. The major concern against the use of LAIV vaccine is the possibility of strain reversion during virus

18 replication and strain reassortment between the vaccine strains and strains circulating in the field.

1.4 Intranasal immunization and the use of nanoparticles in vaccinology

1.4.1 Why Intranasal immunization?

Intranasal (IN) route is suitable for immunization against IAV to protect the respiratory tract since it mimics the natural route of infection. IN delivered vaccines have shown to effectively control influenza [83, 84]. IN route of immunization reduces safety risks and the need of trained personnel for vaccination [85, 86].The respiratory tract is highly vascularized with low concentration of degrading enzymes and slow rates of phagocytosis and clearance by M2 macrophages, which give enough time for the vaccine

Ag to interact with APC and cross the air-blood barrier [87]. IN administered vaccines activates T and B cells in NALT resulting in the production of a cross-reactive secretory

IgA (SIgA) antibody and T cell response [84, 88]. However, IN immunization has to face several anatomical and mechanical barriers like the unidirectional mucociliary escalator and the presence of several antimicrobial peptides in the mucus, which clears exogenous particles before they reach the body [89, 90].

Subunit vaccines are considered to be safer and more cost-effective than traditional WIV vaccines. The peptides present in subunit vaccines can be easily synthesized and can significantly reduce the amount of antigen required for vaccine formulation, since only peptides capable of stimulating specific T cell and B cell mediated immune response will be included [74]. However, IN delivery of inactivated or split virus antigens are poorly

19 immunogenic, and requires a suitable adjuvant and vaccine delivery system to trigger the immune response [88].

1.4.2 Why Nanoparticles?

Nanoparticles are 1-1000 nanometer (nm) diameter particles with different immunostimulatory and immunomodulatory properties that can improve vaccine efficiency. IN immunization studies using nanoparticle-based vaccines have shown to increase specific mucosal IgA antibody responses, cell mediated responses and to enhance production of pro-inflammatory cytokines [55, 91-98]. Nanoparticles of desired shape, diameter, size, surface charge, and materials can be synthesized to modulate the immune response. Noncationic particles of ~ 30 nm in size have been shown to translocate easily to lymph nodes and cross the air-blood barrier, while nanoparticles of

20–50 nm size have been shown to be preferentially taken up by lung DC’s and traffic into the lymph nodes [99, 100]. The surface charge of the nanoparticle can affect the fate of the particle and modulate the immune response. For example, in an experiment polyvinyl alcohol modified gold nanoparticles with positive charge were preferentially uptaken by murine APC in comparison with negative charged gold nanoparticles [101].

Modification and expression of specific receptors in the nanoparticle surface enhanced antigen uptake and presentation by specialized cells of the immune system [102].

Nanoparticles can reduce the amount of Ag required in a vaccine formulation, protect Ag from degradation, helps in slow release of cargo, and allow co-delivery with other immunostimulatory particles to achieve a synergistic immune response. For example, IN immunization of pigs with killed SwIAV antigen encapsulated in a chitosan nanoparticle

20 was shown to elicit strong mucosal IgA and systemic IgG antibody response in lungs of challenged pigs [97]. While IN immunization of pigs with SwIAV H1N2 antigen encapsulated in PLGA nanoparticle showed an increase in the frequency of T- helper/memory and CTLs in pigs [93]. Vaccine development is a complex and challenging process and finding a suitable correct adjuvant capable of inducing a humoral and cell mediated immune response is crucial for protection against divergent IAV strains.

1.5 Adjuvants in vaccinology

1.5.1 Overview of adjuvants

Adjuvants are agents added to vaccines with the goal of enhancing an immune response

[103]. Based in McLean et al. report, the global production capacity for pandemic influenza vaccine is around 1.5 billion doses; which is not enough to immunize the entire susceptible human population especially when a minimum of two flu shots are required to achieve protective immunity [104]. The addition of adjuvants to vaccine can reduce the amount of Ag required, increasing global supplies for vaccine, reduce the number of immunizations, protect Ag from degradation, and can be used to stimulate a Th2 or Th1 immune response [103]. Adjuvants are classified based on their function as a delivery system, immunostimulatory properties, or both like in the case of mucosal adjuvants.

1.5.2 Mineral salts: Aluminum hydroxide

Aluminum hydroxide is the most common and safest adjuvant approved by United States

Food Drug Administration (US FDA) for vaccine use. Aluminum hydroxide adjuvant is characterized by induction of a Th2 response, protection of antigens from degradation,

21 activation of the innate immune system by the inflammasome pathway, induction of depot formation, and elicits a danger signal that recruits APC [105]. The disadvantages of aluminum-derived adjuvants is that they cannot be frozen or lyophilized to be stored for a longer time, have some level of toxicity, have limited adsorption capacity by the physicochemical properties of the antigen, and do not induce a strong T cell-mediated immune response [106]. Some individuals immunized with aluminum hydroxide adjuvanted vaccines have suffered from severe allergic reaction at the injection side mediated by IgE antibody response.

1.5.3 Emulsion adjuvants: Freund’s Complete Adjuvant and Liposomes

water-in-oil adjuvants form emulsions composed by hydrophilic and hydrophobic phases, stabilized with surfactants. Water-in-oil adjuvants induce a strong antibody response. The first water-in-oil adjuvant described was Freund’s Complete Adjuvant

(FCA) and Freund’s Incomplete Adjuvant (FIA); FCA adjuvants contain heat-inactivated mycobacteria while FIA does not. This type of adjuvants works by forming a depot at the injection site; the slow release of Ag by oil droplets leads to cells infiltration creating a local inflammatory response [107]. The major disadvantage of Freund’s adjuvant is the formation of ulcers and abscesses at the injection site as a result of an extended local inflammatory response [108]. Also, Freund’s adjuvants contain mineral oils contaminated with aromatic hydrocarbons that can be carcinogenic. For this reason, other types of water-in-oil adjuvant using metabolizable oils have been created with the goal of increasing safety and to reduce inflammation problems, the MF59 adjuvant is one such example [109]. MF59 is a squalene based emulsion that does not form a depot at the site

22 of injection, has been shown to be safe and induce strong humoral response [110, 111].

MF59 has been licensed in Europe for human use and was incorporated in the influenza vaccine Fluad®.

Liposomes are spherical vesicles composed of cholesterol and non-toxic natural phospholipids with one or more lipid bilayers containing an aqueous center. They work by forming a depot at the site of injection and help in Ag presentation. Liposome have several advantages, they can be easily prepared or modified to target specific cells by manipulating overall charge of a particle, are biodegradable and less toxic [112]. In a recent study, IN immunization of pigs with liposome-based SwIAV adjuvanted with a monosodium urate crystal vaccine containing ten highly conserved IAV epitope peptides, significantly improved serum HI titers, increased mucosal IgA antibody levels and reduced viral shedding in the upper and lower respiratory tract of vaccinated

/challenged pigs [96].

1.5.4 Immune-potentiator adjuvants: CpG oligodeoxynucleotides (CpG-ODN) and Polyinosine-polycytidylic acid (Poly(I:C))

Immune-potentiator adjuvants work by directly stimulating the innate immune system, usually serving as agonist molecules for the PRR’s receptors found in our body.

CpG oligodeoxynucleotides (CpG-ODN) are synthetic single-stranded DNA molecules that mimic the unmethylated CpG motifs found in bacterial DNA. CpG-ODN is recognized by the endosomal TLR-9, and the signaling pathway is through the adaptor proteins MyD88, interleukin-1 receptor-associated kinase (IRAK), and TNF receptor associated factors 6 (TRAF-6). Activation of these receptors leads to the stimulation of costimulatory proteins and production of proinflammatory cytokines [113]. Four 23 different classes of CpG-ODN have been created to induce different types of immune responses; for example, Class D CpG-ODN have shown to induce maturation of DC’s and enhance secretion of TNFα but do not have any effect on B cell activity, while class

C CpG-ODN do stimulate B cells [113]. In human clinical trials, the experimental vaccine for hepatitis B (Engerix-B®) adjuvanted with CpG-ODN induced higher antibody titers after fewer doses in comparison to the licensed Engerix-B® vaccine adjuvanted with aluminum hydroxide [114]. In a pig study, IN immunization of polyanhydride SwIAV vaccine co-administered with CpG-ODN adjuvant elicited mucosal IgA antibody responses after booster immunization and increased frequency of

IFN-γ secreting cells after challenge infection [95].

Polyinosine-polycytidylic acid (Poly(I:C)) is a synthetic double-stranded RNA (dsRNA) molecule with an average size 1.5-8 kb; recognized by TLR-3, RIG-I, and melanoma differentiation-associated antigen 5 (MDA5) receptors, expressed by cells of the innate immune system. The ability of Poly(I:C) to induce strong T cell response is due to the selective expression of TLR-3 in myeloid DC's, these cells have the ability to cross- present exogenous antigens in MHC- I complex , and stimulate CD8+ T cells [115].

Poly(I:C) can be an excellent adjuvant option in the case of protein-based subunit vaccines. For example, IM immunization of pigs with B4 epitope and Poly(I:C) adjuvated vaccine was shown to elicit a humoral and cellular immune response in foot- and-mouth disease virus (FMDV) challenged pigs, conferring cross-protection [116]. In another study, IN immunization of Poly (I:C) adjuvanted inactivated bivalent SwIAV vaccine in maternal antibody positive pigs significantly increased mucosal antibody

24 response and reduce viral shedding in the lower and upper respiratory tracts of vaccinated/ challenged pigs [117]. Poly(I:C) has also been used as an intertumoral therapy. For example, mice with transplanted AB1-HA tumor treated with Poly(I:C) shown to delay tumor growth and induce tumor resolution in a CD8+ T cell-dependent manner [118]. Different types Poly(I:C) molecules have been developed with the aim of reducing toxicity, tolerance, or manipulate poly(I:C) mechanism of immunogenicity

[119]. For example, rintatolimod is a derivative from Poly(I:C), that contains a mismatch in the uracil and guanosine base pair. The mismatch in rintatolimod results in a decrease in the molecule half-life time and also restricted the molecule to transmit the signal exclusively through TLR-3 [120]. Experimental trials in mice and monkeys immunized

IN with rintatolimod adsorbed with H5N1 IAV have shown to significantly increase IgA antibody responses and confers protection against heterologous and homologous challenge virus [121, 122]. IN immunization of FluMist® and rintatolimod in humans have been shown to increase by four-fold the specific secretory IgA antibody response against homologous virus [123].

1.5.5 Polymeric Adjuvants: Poly (lactic-co-glycolic acid) (PLGA), Chitosan (CS) and Alpha-D-glucan nanoparticle (Nano-11)

Polymers are molecules composed of several similar subunits bonded together. Polymers can be naturally existing like Nano-11 or chitosan found in shells of crustaceans, insects, and fungi or they can be synthesized like in the case of poly (lactic-co-glycolic acid)

(PLGA) particles.

Poly (lactic-co-glycolic acid) (PLGA) is a hydrophobic, negatively charged synthetic polymer composed of lactic acid and glycolic acid. Because these products are naturally 25 found in our body, very low cytotoxicity levels have been associated with the particle and, for this reason, PLGA has been approved by the FDA and European Medicine

Agency (EMA) for drug delivery. PLGA nanoparticles range in size from 100 to 250 nm, have high encapsulation efficacy but poor loading efficacy [124]. What makes PLGA nanoparticles an ideal adjuvant and carrier is the prolonged-sustained release of antigen, increasing bioavailability, and it protects antigen from enzymatic or hydrolytic degradation [125]. Also, it has been shown that PLGA adjuvanted vaccines are able to induce a strong T cell response due to the capability of cross-presentation when the nanoparticle is internalized by DC’s. For example, IN immunized pigs with PLGA adjuvanted vaccine entrapped with inactivated porcine reproductive and respiratory syndrome (PRRS) virus coadministered with mycobacterial proteins elicited broad cross- protection against the challenge virus [126]. While in another study, IN immunization of pigs with an adjuvanted PLGA SwIAV vaccine induced a strong cell-mediated immune response against the heterologous challenge virus [93].

Chitosan (CS) nanoparticle is a polysaccharide extracted from crustaceans composed of

β-(1,4)-2-acetamido-D-glucose and β-(1,4)-2-amino- D-glucose units. The mucoadhesive property of CS nanoparticles is due to the presence of amino and carboxyl groups. The amino group confers the cationic nature to the particle and the carboxylic group foment formation of hydrogen bonds between CS nanoparticle and glycoproteins found in the mucus [127]. The adhesive nature of CS nanoparticles improves drug bioavailability by fomenting prolonged and constant release of cargo [128]. Degradation of the CS nanoparticle by enzyme catalysis has been cataloged as a nontoxic polymer approved by

26 the FDA for wound dressings [128, 129]. Due to its small size (100-400 nm), the CS nanoparticle is efficiently uptaken by M cells and APC cells [87]. Pigs IN immunized with and adjuvanted CS nanoparticle killed antigen SwIAV vaccine showed a strong mucosal cross-reactive antibody response, reduced the viral shedding and lung pathology of challenged pigs [97].

Alpha-D-glucan nanoparticle (Nano-11) is a positive charge amphiphilic nanoparticle

(70-80nm), obtained from phytoglycogen (PG). PG is a glucose molecule found in

Kernel-sugary-1, a variation of sweet corn [130]. The deficiency in the isoamylase-type starch debranching enzyme in the sugary-1 plant is what makes the abnormal and highly branched PG molecule [131, 132]. Nano-11 preparation starts with grinding the corn seed to extract the PG. The PG particles are then reacted with octenyl succinic anhydride

(OSA), to confer hydrophobicity and negative charge, leading to the formation of phytoglycogen octenyl succinate (PG-OS). Finally, PG-OS is reacted with 3-chloro-2- hydroxypropyl)-trimethylammonium chloride (CHPTAC) to add the positive charge to the particle forming PG-OS-CHPTAC [130].

Using Transmission electron microscopy (TEM), Nano-11 reveals a round shape with irregular surface, particles ranging in size from 30-110 nm, and the zeta-potential value range from +7 to +15mV. Due to the positive nature and irregular surface, Nano-11 possesses a high absorptive capacity, which can facilitate vaccine entrapment and reduce antigen loss during vaccine confection [94, 133]. Invitro studies performed in bone marrow-derived dendritic cells (BMDCs) from mice have shown that Nano-11 has a low level of cytotoxicity and enhances antigen uptake. Also, Nano-11 shows the capability to

27 induce expression of costimulatory molecules (CD-40 and CD-80/CD-86) and stimulates production of pro-inflammatory cytokines like IL-1, probably mediated by the NLRP3 inflammasome pathway [130. Similarly, in-vitro studies performed in porcine derived

DC’s have shown the capability of Nano-11 to stimulate the production of proinflammatory cytokines like IFN-(, TNF-(, and IL-1( {Dhakal, 2019 #39]. Similarly, in vitro studies performed in porcine derived DC’s have shown the capability of Nano-11 to stimulate the production of proinflammatory cytokines like IFNγ, TNF-α, and IL-1ß. A localized transient pro-inflammatory response at the injection site of IM vaccinated mice with fluorescently-labeled Nano-11 has been reported by in vivo imaging studies [133].

IM vaccination trials in mice have shown that Nano-11 has similar adjuvant properties to aluminum hydroxide and increases the systemic IgG Ab titers in serum [133]. Also, IM vaccinated pigs with Nano-11+ OVA increased the systemic IgG1 and IgG2 antibodies levels in serum [94]. While, IN immunization of pigs with Nano-11 containing inactivated SwIAV H1N2 virus has shown to increase mucosal IgA antibody response in pigs[94]. Both routes of immunization with Nano-11 have failed in the production of a strong T cell immune response, crucial to achieve cross-protective immunity.

Chapter 2. Poly(I:C) adjuvanted corn nanoparticle enhances the breadth of inactivated influenza

virus vaccine immune response in pigs

Sankar Renua,1, Ninoshkaly Feliciano-Ruiza,1, Fangjia Lub, Shristi Ghimirea, Yi Hana, Jennifer

Schrocka, Santosh Dhakala, Veerupaxagouda Patila, Steven Krakowkac, Harm HogenEschb,

Gourapura J. Renukaradhyaa,* a Food Animal Health Research Program, Ohio Agricultural Research and Development Center,

1680 Madison Avenue, Wooster, OH 44691, USA, and Department of Veterinary Preventive

Medicine, College of Veterinary Medicine, The Ohio State University, Columbus, OH 43210,

USA. b Department of Comparative Pathobiology, College of Veterinary Medicine, Purdue

University, West Lafayette, IN, USA. c The Department of Veterinary Biosciences, College of

Veterinary Medicine, The Ohio State University, Columbus, OH 43210, USA.

1 Contributed equally

Number of words: 4335; Number of figures: 6; Number of tables: 0

*Correspondence:

Dr. Gourapura J. Renukaradhya [email protected]

2.1 Abstract

Swine Influenza A virus (SwIAV) cause respiratory infection in pigs and responsible for major economic burden to the swine industry. Intramuscular immunization of pigs with a commercial killed influenza virus strains containing vaccine induces poor mucosal IgA antibody response and confer highly variable levels of protection. However, intranasal immunization of pigs with influenza killed antigen absorbed on Nano-11 showed to induce cross-reactive SIgA response in the nasal passage, but it did not induce IgG antibodies in the serum and lungs or cross-reactive T cell response. To improve the cross-reactivity of Nano-11-KAg or ten conserved influenza virus

T and B cell peptides we added a secondary adjuvant to the vaccine formulation. We show that the addition of the TLR3 agonist poly(I:C) to the Nano-11-KAg vaccine formulation resulted in a cross-reactive SIgA in the nasal passages and lungs and increase the IgG antibody levels in lung parenchyma and BAL fluid against H1N2-OH10, H1N1-OH7, and H3N2-OH4 SwIAV strains.

In addition, Nano-11-KAg-poly(I:C) vaccine formulation augmented mRNA expression of the cytokines IL-2, IL-6, IL-10, IL-13, and TNF-α, and the transcription factor GATA3 in the tracheobronchial lymph nodes of pigs compared to the commercial vaccine. Also, Nano-11-

KAg-poly(I:C) elicited high levels of virus neutralizing antibodies in BAL fluid, increase the frequency of the IFNγ secreting γδ T cells and partially reduced microscopic lung lesions and heterologous challenge virus load of intranasal immunized/challenged pigs. In summary, compared to our earlier study with Nano-11-KAg vaccine, the addition of poly(I:C) to the vaccine formulation improved the cross-reactive antibody and cytokine responses in intranasal immunized pigs.

2.2 Introduction

Virulent swine influenza A virus (SwIAV) infection causes acute febrile respiratory disease in pigs of all ages, and is a serious economic burden to the global pork industry [23, 134]. Pigs are

30 highly susceptible to influenza virus infection owing to the presence of receptors for both mammalian (swine/human) and avian origin viruses in the respiratory tract epithelial cells [24].

The H1N1, H1N2, and H3N2 are the commonly circulating influenza virus subtypes in pigs

[135]. The triple reassortant 2009 pandemic H1N1 SwIAV spillover to humans is evidence that pigs can act as a mixing vessel for mammalian and avian influenza viruses [23, 24]. Continuous antigenic drift and shift in influenza viruses complicates disease control strategies et al., 2013;

United States Department of Agriculture, February 2016). This vaccine is given by intramuscular route and contains the IAV clusters prevalent in the US swine population: H3N2 IV-A and B,

H1N1 gamma, and H1N2 delta-1. Commercial inactivated SwIAV vaccines have shown to confer protection against identical or similar virus strains and induce a strong IgG antibody response in serum [46, 136]. However, the commercial vaccine is a poor inducer of secretory

IgA (SIgA) antibodies in the airways where the virus actually enters the body and replicates.

Virus-specific cell-mediated immune responses that contribute to clearing the mutated and reassorted SwIAVs are poor, presumably because antigens in the commercial vaccine do not enter the endogenous pathway of antigen presenting cells (APCs) [136, 137]. It is accepted that developing SwIAV specific cross-reactive immune response in pigs through vaccination is the most convenient and effective method to mitigate disease outbreaks which will help the swine industry and reduce the public health risk.

Intranasally (IN) delivered vaccines mimic the natural infection and have been demonstrated to effectively control influenza [83, 84]. These vaccines primarily target nasal-associated lymphoid tissues (NALT) which have abundant APCs, T and B cells. Activated T and B cells in the NALT reach the effector site and elicit cross-reactive SIgA antibody and T cell responses [84, 88].

However, IN delivered inactivated or split virus antigens are poorly immunogenic, and they need a suitable adjuvant and vaccine delivery system to trigger an immune response [88].

Recently, we developed and characterized sweet corn-derived cationic alpha-D-glucan nanoparticles (Nano-11) and established its adjuvant potential in both mice and pigs [94, 130,

133]. Nano-11 is effectively phagocytized by dendritic cells (DCs), increases the expression of co-stimulatory molecules CD80 and CD86, and induces the secretion of IL-1β [130]. Protein antigen adsorbed to Nano-11 induced a comparable antibody response to standard aluminum hydroxide adjuvant upon intramuscular injection in mice [133].In our recent study in pigs, killed

SwIAV antigen (KAg) adsorbed on Nano-11 (Nano-11-KAg) delivered IN induced cross- reactive SIgA response in the nasal passage but it did not induce IgG antibodies in the serum and lungs or cross-reactive T cell response [94].SwIAV-KAg encapsulated in PLGA and polyanhydride nanoparticles delivered IN induced robust T cell response but the antibody response was poor in pigs [93, 98]. In another study, highly conserved influenza virus peptides encapsulated in PLGA or liposome nanoparticles delivered IN in pigs elicited epitope-specific T cell responses but not antibody responses [55, 96].

By taking advantages of the different immunostimulatory properties of adjuvanted nanoparticles we proposed the combination of Nano-11 with Poly (I:C). Poly(I:C) is a synthetic double stranded RNA molecule recognized by toll-like receptor (TLR)-3 that leads to the activation of

NF-kB pathway and production of type I interferon (IFN-I) a potent inducer of antibody response and isotype switching [138, 139]. IN immunization of pigs with Poly(I:C) adjuvanted SwIAV

KAg vaccine showed to significantly increase mucosal antibody response and reduce viral shedding in the lower and upper respiratory tracts of pigs [117].

In this study, we assessed the combinatorial effect of Nano-11 with poly(I:C) adjuvant has on the mucosal and systemic immune response. We also evaluated the protection induced by IN delivered of SwIAV-KAg (Nano-11-KAg-poly(I:C)) and a pool of viral peptides (Nano-11- peptides-poly(I:C)) vaccine in nursery pigs.

2.3 Materials and methods

2.3.1 Preparation of influenza viruses, conserved peptides, adjuvant poly(I:C) and commercial swine flu vaccine

Using a Madin-Darby Canine Kidney epithelial (MDCK) cells the field isolates of influenza viruses A/Swine/OH/FAH10-1/10 (H1N2-OH10), A/Swine/OH/24366/2007 (H1N1-OH7), and

A/Turkey/OH/313053/2004 (H3N2-OH4) were propagated. Briefly, MDCK cells grown virus cell-free supernatant was clarified, sucrose density gradient ultracentrifuged, and in phosphate- buffered saline (PBS) virus pellet was suspended. Before the virus inactivation using binary ethyleneimine the virus titer was checked in MDCK cells [93]. Using a micro-BCA protein assay kit (Thermo Scientific, MA, USA) antigen concentration was examined after inactivation and confirmed its non-replication on MDCK cells as described previously [93].

The influenza virus specific conserved T cell and B cell peptides (peptides) (Table 1, in supplementary material) were custom synthesized by Ohio Peptide(OH, USA) and dissolved in recommended acidic and alkaline buffer and the aliquots (1 mg/mL) were stored at -80°C until use as described previously [96]. Poly(I:C) HMW powder was acquired from Invivogen (CA,

USA), dissolved, and aliquots were stored as per the company instruction. The FluSure XP® commercial inactivated influenza vaccine was purchased from Zoetis (MI, USA).

2.3.2 Formulation of Nano-11-KAg-poly(I:C) and Nano-11-peptides-poly(I:C)

The Nano-11 based nanovaccines formulation was prepared as reported previously (Lu et al.,

2015) with few modifications. For Nano-11-KAg-poly(I:C) preparation, 16 mg Nano-11 powder

33 was dissolved in 8 mL (2 mg/mL) of 3-(N-morpholino) propanesulfonic acid (MOPS) pH 7.4 buffer under magnetic stirring. The inactivated H1N2-OH10 SwIAV KAg 2 mg in 1 mL MOPS buffer followed by 1.8 mg poly(I:C) (1 mg/mL) in endotoxin free water were added dropwise using an insulin syringe. Similarly, the Nano-11-peptides-poly(I:C) particle was prepared by using 40 mg Nano-11, 5 mg pooled peptides (0.5 mg each of 10 peptides) and 2.1 mg poly(I:C).

After one hour of magnetic stirring, the Nano-11-KAg-poly(I:C) and Nano-11-peptides-poly(I:C) particles were obtained in the pellet after centrifugation at 10,000 rpm for 30 min. The supernatant in the formulations were checked for the unbound KAg or peptides by using a micro-

BCA protein assay kit, and poly(I:C) by measuring adsorbance in the NanoDrop™ 2000c

Spectrophotometer (Thermo Fisher Scientific, MA, USA) as reported previously [93, 130].

2.3.3 In vitro generation and treatment of porcine dendritic cells (DCs)

Porcine DCs were generated from peripheral blood mononuclear cells (PBMCs) as described previously [140] with some modifications. In brief, PBMCs were isolated from blood collected from three conventional sows in EDTA and plated at 10 million cells/well in RPMI containing

10% FBS in 12-well cell culture plates overnight at 37°C in 5% CO2 incubator. The floating cells were removed and attached cells were treated with stimulation medium containing cytokines GM-CSF (25 ng/mL) and interleukin (IL) 4 (10 ng/mL) (Kingfisher Biotech, Inc., MN,

USA). On the 3rd day half the culture media was replaced with fresh cytokines containing stimulation medium. On day 6, medium was removed, all the cells were washed and treated with

1 ml of either medium (control), medium containing Nano-11 (80 μg/ml), Nano-11 (80 μg/ml) adsorbed with KAg (10 μg/ml), Nano-11 (80 μg/ml) adsorbed with poly(I:C) (10 μg/ml) or

Nano-11 (80 μg/ml) adsorbed with both KAg (10 μg/ml) and poly(I:C) (10 μg/ml) [Nano-11-

KAg; Nano-11-poly(I:C); and Nano-11-KAg-poly(I:C)] for 24 h at 37°C. Total RNA was

34 extracted from the treated cells and used for mRNA expression analyses by qRT-PCR as described below.

2.3.4 Vaccination and virus challenge trial in pigs

The procedure of vaccine trial in pigs was followed as reported previously [93]. Briefly, SwIAV and its antibody free caesarian-delivered colostrum-deprived piglets were raised in our Ohio

Agricultural Research and Development Center biosafety level-2 facility. At the age of 5 weeks male and female piglets (n=23) were randomly distributed into five experimental groups as follows, (i) mock control (n=4); (ii) soluble poly(I:C) (300 μg to each piglet) (n=4); (iii) Nano-

7 11-KAg-poly(I:C) (10 TCID50 equivalent of KAg and 300 μg poly(I:C) to each piglets) (n=5);

(iv) Nano-11-peptides-poly(I:C) (50 μg each of 10 peptides and 300 μg poly(I:C) to each piglets)

(n=5); and (v) Commercial FluSure XP® vaccine (n=5). Experimental pigs were vaccinated IN through both nostrils by using a spray mist delivery device (Prima Tech USA, NC) as reported previously [93]. The commercial vaccine was IM delivered as per the manufacturer’s instructions. After three weeks of first dose of vaccination pigs were boosted with the same dose of vaccine and route. Two weeks later except mock other experimental pigs were challenged

6 with a virulent SwIAV SW/OH/24366/2007 (H1N1-OH7) 6×10 TCID50 by both IN and intratracheal routes (50% virus delivered by each route).The virus challenged pigs were monitored daily for clinical flu signs (fever, labored breathing, sneezing and reduced feed intake) and euthanized at day post-challenge (DPC) 6. During necropsy nasal swab, blood samples for serum and isolation of peripheral blood mononuclear cells (PBMCs), lung sample for preparing lung lysate and histopathology, BAL fluid, and tracheobronchial lymph nodes (TBLN) in

RNAlater were collected; samples were processed as reported previously [93].

2.3.5 Enzyme-linked immunosorbent assay (ELISA) assay

Detection of specific antibodies in various pig samples were carried out as reported previously

[97]. Briefly, SwIAV H1N2-OH10, H1N1-OH7, or H3N2-OH4 KAg pre-titrated amounts (10

μg/mL) was coated in 96-well plates (Greiner bio-one, NC, USA) and blocked with 5% skim milk containing 0.05% Tween-20 for 2h at room temperature (RT) after the overnight incubation at 4oC. After three times washed with buffer, samples were then serially diluted using 2.5% dry milk at a start dilution of 1:2 for nasal swab and 1:50 dilution for serum, BAL, and lung lysate samples. Fifty μl/well of corresponding diluted samples were added to the coated plates (in duplicates wells) and incubated overnight at 4oC. Next day, plates were washed and incubated at

RT for 2 hrs (50 μl/well) with goat anti-pig IgA conjugated with HRP (Bethyl Laboratories Inc.,

TX) at a concentration of 1:2000 or Peroxidase AffiniPure Goat Anti-Swine IgG (H+L)

(Jackson ImmunoResearch Laboratories Inc., PA) at a concentration of 1:8000; antibodies were diluted in 2.5% dry milk in PBS-Tween. After incubation, plates were washed and 1:1 mixture of peroxidase substrate solution B and TMB peroxidase substrate (KPL, MD, USA) was added and the reaction was stopped after 10-15 minutes by adding 1 M phosphoric acid solution. Using the ELISA Spectramax microplate reader, the optical density (OD) values were measured at 450 nm (Molecular devices, CA, USA). The corrected OD value was obtained after subtraction of the blank value.

2.3.6 Flow cytometry analyses

The isolated PBMCs were stimulated with vaccine virus (H1N2-OH10) at 0.1 multiplicity of infection (MOI) for 48 h and immunostained for different lymphocyte subsets as described previously [93]. In brief, cells were blocked with pig serum, stained with porcine lymphocyte specific surface markers followed by intracellular IFNγ. The stained cells were fixed, washed and acquired in BD Aria II flow cytometer (BD Biosciences, CA, USA). Using FlowJo software

(Tree Star, OR, USA) the data was analyzed. Fluorescent labeled antibodies used in flow cytometry were anti-porcine CD3, CD4α and CD8α procured from Southernbiotech (AL, USA), and CD8β, δ chain and IFNγ monoclonal antibodies from BD Biosciences (CA, USA).

2.3.7 Quantitative reverse transcription PCR (qRT-PCR) analyses

Total RNA was extracted from the treated porcine DCs and TBLN using TRIzol reagent

(Invitrogen, CA, USA). The cDNA was converted from 1 or 2 μg of total RNA and the target genes TNF-, IL-1ß, IFNγ, GATA3, IL-2, IL-6, IL-10 and IL-13, and housekeeping gene β-actin

(Table 2, in supplementary material) expression were attained by qRT-PCR (Applied

Biosystems, CA, USA) using the SYBR Green Supermix kit (Bio-Rad Laboratories, CA, USA).

The fold changes were calculated as described previously [141].

2.3.8 Virus neutralization test (VNT) titer and infectious virus titration

The assays were performed as reported previously [55, 93]. Prior to the assay, inactivation of complement activity in BAL fluid samples was performed (56 °C water bath for 30 minutes).

The 96-well tissue culture plates seeded with MDCK cells (2x104 cells/well) in DMEM enriched media incubated in a 370C humidified 5% CO2 incubator overnight were used. Serial two-fold diluted BAL fluid samples, using serum-free DMEM media, were incubated for 2hrs at 370C humidified 5% CO2 incubator with 100 TCID50/100L of the H1N1-OH7 virus. Then the suspension was transferred into a 96-well plate containing a confluent monolayer of MDCK cells supplemented with DMEM serum-free medium containing 2ug/mL TPCK-trypsin (Sigma, lot#050M7020U). The cell plates remain in 370C humidified 5% CO2 incubator for 36 hrs. For virus titration, ten-fold serial diluted BAL fluid and lung lysate samples were added into MDCK cells and incubated for 48 h. The cells were fixed with 80% acetone and immunostained with

(50L/well) the primary antibody M058 (#M058, CalBioreagents, CA) at a concentration

1:5,000 for 2 hrs at 37 °C 5% CO2 incubator. Cells were then washed and incubated for 1.5 hrs with (50L/well) the secondary antibody Alexa Fluor 488 conjugated goat anti-mouse IgG (H +

L) antibody (Life Technologies, OR) at 37 °C 5% CO2 incubator. Finally, 50 L/well of mounting media Glycerol: PBS pH=8 based (proportion 6:4) was added to the immunostained cell plates. The fluorescent to infection was recorded using fluorescent microscope, (IX51,

Olympus, Tokyo, Japan) and infectious titer was determined using the Reed and Muench method [142]. Previously describe [143] and [93].

2.3.9 Histopathology of lungs

The procedure was performed as described previously [93]. The left side lung of each pig was infused with 10% natural buffer formalin, and portions of the apical, cardiac and diaphragmatic lobes were collected. Tissues were trimmed, dehydrated, and embedded in paraffin to make blocks. Five-micrometer sections were created and stained with hematoxylin and eosin (H&E) stain. Stained slides were examined microscopically for lesions such as interstitial pneumonia, bronchial exudates, and peribronchial and perivascular accumulation of mononuclear inflammatory cells by a board certificated veterinary pathologist (SK). The lesions were scored as follows: 0- no changes; 0.5- observed changes but too mild; 1- minimal changes; 2- moderate changes; 3- marked changes. Final lung lesions score of each pig was determined by taking the average of three lung lobes score. Representative lung images of each experimental group were taken using a phase contrast microscope.

2.3.10 Statistical analyses

Statistical analyses of ELISA data were carried out using two-way ANOVA followed by

Bonferroni test using the GraphPad Prism 5 (GraphPad Software, Inc., CA, USA). The remaining data were analyzed by adapting one-way analysis of variance followed by Tukey's

38 post-hoc comparison test. A p<0.05 was considered statistically significant. Data were presented as the mean ± SEM of four to five pigs.

2.3.11 Ethics statement

Accordance with the recommendations of Public Health Service Policy, United States

Department of Agriculture Regulations, the National Research Council’s Guide for the Care and

Use of Laboratory Animals, and the Federation of Animal Science Societies’ Guide for the

Care and Use of Agricultural Animals in Agricultural Research and Teaching the animal study was carried out. We followed all relevant institutional, state, and federal regulations and policies regarding animal care and use at The Ohio State University. Pigs were maintained, samples collected, and euthanized in accordance with the approved protocol of the Institutional Animal

Care and Use Committee at The Ohio State University (Protocol number 2015A00000120).

2.4 Results

2.4.1 Preparation of poly(I:C) adjuvanted Nano-11 based influenza nanovaccines

We evaluated different ratios of Nano-11 and KAg (1:1, 2:1, 4:1 and 8:1) to prepare the optimal vaccine formulation based on nanoparticle size, surface charge and antigen adsorption efficiency.

We observed that 2:1 ratio yielded 487 nm size particles, + 19.2 mV charge and 84.2% KAg adsorption efficiency. While, 8:1 ratio of Nano-11 and KAg provided particles of 214 nm size, net positive surface charge of 20.4 mV, and 93% KAg adsorption efficiency. Thus, based on our initial formulation optimization study results we used the 8:1 ratio of Nano-11 and KAg or pooled ten peptides to prepare the nanovaccines formulation to use in an in vitro, and in vivo vaccine trial in pigs. Poly(I:C) was adsorbed 100% on Nano-11 particles. The poly(I:C) adjuvanted nanovaccines, Nano-11-KAg-poly(I:C) and Nano-11-peptides-poly(I:C), had approximately 93% and 72% antigen adsorption efficiency, respectively.

2.4.2 Nano-11-KAg-poly(I:C) treatment increased the innate and Th1 cytokines mRNA expression in porcine DCs

Initially to evaluate whether binding of poly(I:C) on Nano-11 enhances the activation of APCs, and poly(I:C) does not interfere with co-adsorbed KAg binding, an in vitro experiment was performed on porcine DCs. DCs treated with Nano-11-KAg-poly(I:C) had a significantly augmented (P<0.001) TNF- mRNA expression compared to all the controls such as Nano-11,

Nano-11-KAg and Nano-11-poly(I:C) (Figure 1A). The IL-1ß mRNA expression was significantly enhanced (P<0.001 and P<0.01) in both Nano-11-KAg and Nano-11-KAg-poly(I:C) treated cells compared to other three controls including the Nano-11-poly(I:C) (Figure 1B).

While both Nano-11-poly(I:C) and Nano-11-KAg-poly(I:C) treatment significantly increased

(P<0.001 and P<0.05) IFNγ gene expression compared to medium, Nano-11 and Nano-11-KAg treatment. Interestingly, Nano-11-poly(I:C) significantly (P<0.01) induced the higher expression of IFNγ than Nano-11-KAg-poly(I:C) treatment (Figure 1C).

A TNF- B IL-1

40 40  ***  *** ** 30 30 *** **

20 20

10 10

mRNAexpression mRNAexpression

Relative levels of IL-1 Relative levelsof TNF- 0 0 1 2 3 4 5 1 2 3 4 5

C IFN * 80 *** **  1. Control 60 2. Nano-11 40 3. Nano-11-KAg

20 4. Nano-11-poly(I:C) mRNAexpression

Relative levels of IFN 5. Nano-11-KAg-poly(I:C) 0 1 2 3 4 5

Figure 1. Porcine DCs treated with Nano-11-KAg-poly(I:C) increased the cytokines mRNA expression. Porcine PBMCs derived DCs were treated with medium (control), Nano-11, Nano-11-KAg, Nano-11-poly(I:C), or Nano-11-KAg-poly(I:C) for 24 h and different cytokine mRNA expression were analyzed by qRT-PCR. The fold-change in mRNA expression levels of (A) TNF-; (B) IL-1ß; and (C) IFNγ was determined. Each bar is the mean ± SEM of 3 pigs and the data were analyzed by one-way ANOVA followed by Tukey’s post hoc comparison test. Asterisk refers to statistical difference between the indicated treatment groups (*P < 0.05, **P < 0.01 and ***P < 0.001). 2.4.3 Nano-11-KAg-poly(I:C) nanovaccine augmented cross-reactive SIgA antibody response

Homologous (H1N2-OH10), heterologous (H1N1-OH7), and heterosubtypic (H3N2-OH4)

SwIAV antigen specific cross-reactive SIgA antibody levels were increased in Nano-11-KAg- poly(I:C) vaccinated pigs at the tested serial dilutions of nasal swab, lung lysate, and BAL fluid samples compared to other vaccinates (Figure 2A-I). In Nano-11-KAg-poly(I:C), Nano-11-

41 peptides-poly(I:C), and commercial vaccines delivered pigs a significantly increased (P<0.05) homologous (H1N2-OH10), heterologous (H1N1-OH7), and heterosubtypic (H3N2-OH4)

SwIAV specific nasal SIgA antibody levels compared to controls at 1:2 diluted samples (Figure

2A-C). The cross-reactive nasal IgA was higher in the group vaccinated with Nano-11-KAg- poly(I:C) than in the other vaccine groups (Figure 2A-C).

The homologous (H1N2-OH10) and heterologous (H1N1-OH7), but not heterosubtypic (H3N2-

OH4) virus specific SIgA antibody levels in lung lysate samples (represents response in lung parenchyma) were significantly increased (P<0.05) in the Nano-11-KAg-poly(I:C) group compared to the commercial vaccine group (Figure 2D-F). Similarly, Nano-11-KAg-poly(I:C) vaccinated animals compared with the soluble poly(I:C) with challenge (mock-challenge) and commercial vaccine groups had significantly increased homologous (H1N2-OH10), heterologous

(H1N1-OH7), and heterosubtypic (H3N2-OH4) virus specific SIgA in BAL fluid (P<0.05)

(Figure 2G-I).

A IgA in nasal swab B IgA in nasal swab C IgA in nasal swab 0.75 (H1N2-OH10) 0.75 (H1N1-OH7) 0.75 (H3N2-OH4) b c b c b d e i d e e g g h

0.50 0.50 0.50 b d b e

450nm 450nm

450nm b e

OD OD 0.25 0.25 0.25

0.00 0.00 0.00 2 4 8 16 32 64 2 4 8 16 32 64 2 4 8 16 32 64 Dilutions D Dilutions E F Dilutions IgA in lung lysate b c IgA in lung lysate 1.0 I g A i n l u n g l y s a t e 1.0 (H1N1-OH7) 1 . 0 i b e (H1N2-OH10) ( H 3 N 2 - O H 4 ) h i 0.8 b 0 . 8 0.8 b

0.6 0.6 0 . 6

450nm

OD OD OD 0.4 0.4 0 . 4

0.2 0.2 0 . 2

0.0 0.0 0 . 0

50 50 50 100 200 400 800 100 200 400 800 1600 100 200 400 800 1600 1600 Dilutions Dilutions D i l u t i o n s G H I IgA in BAL fluid 1.5 IgA in BAL fluid I g A i n B A L fl u i d 1.5 1 . 5 b e (H1N2-OH10) (H1N1-OH7) ( H 3 N 2 - O H 4 ) h i IgA nasal swab DPC-6 b i (H3bN i2-OH-4) b e Ig1.0A nasal swha bi DPC-6 1.0 1 . 0

(H3N2-OH-4) b 450nm

450nm i

IgA nasal swab DPC-6 450nm OD

OD 0.8 (H3N2-OH-4) OD 0.5 b0.5 c 0 . 5 0.8 d e 0.6 f g b c MMoocckk d e m 0.8 0.0 0.0 n 0 . 0 0.6 f g 0 PPoloyl(yI(:IC:C) )+ +C hCh 50 5 50 50 b c 4 100 200 400 800 100 200 400 800 100 200 400 800 1600 0.4 b e 1600 1600

D MMoocckk m NKaAnog- 1N1a-KnoA-g1-1p owlyit(hI :PCo) l+y C(Ih:C)+ Ch

d e Dilutions Dilutions D i l u t i o n s

n O f g 0 PPoloyl(yI(:IC:C) )+ +C hCh 0.6 5 NPaenpo-ti1d1e-ps eNpatindoes--1p1o lwyi(tIh: CP)o +ly C(Ih:C) + Ch 4 0.4 b e D MMoocckk NKaAnog- 1N1a-KnoA-g1-1p owlyit(hI :PCo) l+y C(Ih:C)+ Ch

m 0.2 CComommmerecricali avla vcaccincei n+e C +h Ch

n O 0 PPoloyl(yI(:IC:C) )+ +C hCh NPaenpo-ti1d1e-ps eNpatindoes--1p1o lwyi(tIh: CP)o +ly C(Ih:C) + Ch 5 4 0.4 b e D Figure0.2 2. Poly(I:C)NKaAnog- 1N1a-KnoA-g1-1p owadjuvantedlyit(hI :PCo) l+y C(Ih:C)+ C hNanoCC-o11mommme-reKAgcricali avla vcac civaccinencei n+e C +h Ch induced increased cross-reactive SIgA O NPaenpo-ti1d1e-ps eNpatindoes--1p1o lwyi(tIh: CP)o +ly C(Ih:C) + Ch0.0 antibody response. 2 4 8 16 32 64 0.2 Pigs wereC vaccinatedComommmerecricali avla vcaccinc eitwice n+e C +h Ch with poly(I:C) adjuvanteddilutions Nano-11 based nanovaccines or 0.0 commercial2 4vaccine8 16 32 and64 challenged at 35 days post prime vaccination. Samples collected at day post-challengedil usixtion swere used for SIgA antibody analysis. Secretory IgA antibody response in 0.0 2 4 8 16 32 64 nasal swab, lung lysate, and BAL fluid samples against (A,D,G) H1N2-OH10; (B,E,H) H1N1- dilutions 43

OH7; and (C,F,I) H3N2-OH4 SwIAVs were analyzed by ELISA. Data represent the mean value of four to five pigs ± SEM. Statistical analysis was carried out using two-way ANOVA followed by Bonferroni test. Each letter indicates the significant difference between the groups at the indicated dilution. b, c, and d indicate the difference between mock group compared to Nano-11- KAg-poly(I:C) + Ch, Nano-11-peptide-poly(I:C) + Ch, and Commercial vaccine +Ch, respectively. e and g indicate the difference between poly(I:C) + Ch compared to Nano-11-KAg- poly(I:C) + Ch, and Commercial vaccine +Ch, respectively. h and i indicate the difference between Nano-11-KAg-poly(I:C) + Ch compared to Nano-11-peptide-poly(I:C) + Ch and Commercial vaccine +Ch, respectively. A p<0.05 was considered statistically significant. Ch- Challenge.

2.4.4 Nano-11-KAg-poly(I:C) nanovaccine increased the IgG antibody response in lungs but not in serum

Serum IgG antibody response against H1N2-OH10, H1N1-OH7, and H3N2-OH4 SwIAVs were significantly increased (P<0.05) in commercial vaccine immunized pigs compared to the other vaccine groups (Figure 3A-C). However, both the Nano-11-KAg-poly(I:C) and commercial vaccine induced significantly increased (P<0.05) IgG antibody levels in the lung parenchyma against the homologous (H1N2-OH10), heterologous (H1N1-OH7), and heterosubtypic (H3N2-

OH4) virus compared to mock pigs (Figure 3D-F). The IgG antibody levels in BAL fluid against

H1N2-OH10, H1N1-OH7, and H3N2-OH4 viruses were increased at all the tested dilutions in

Nano-11-KAg-poly(I:C) immunized pigs compared to the other groups including the commercial vaccine (Figure 3G-I). Notably, the H1N2-OH10 specific IgG antibody response in BAL fluid was significantly increased (P<0.05) in the Nano-11-KAg-poly(I:C) group compared with animals that received the commercial vaccine (Figure 3G).

A B Ig G i n s e r u m C IgG in serum ( H 1 N 1 - O H 7 ) I g G i n s e r u m 2.5 (H1N2-OH10) 2 . 5 2 . 5 ( H 3 N 2 - O H 4 ) d g d d j d g d d g d g d g d d g d g 2.0 d g 2 . 0 j 2 . 0 j d g i j d g d g i j d g i j d g j j j

1.5 1 . 5 1 . 5

450nm

OD OD OD 1.0 1 . 0 1 . 0

0.5 0 . 5 0 . 5

0.0 0 . 0 0 . 0

50 10 0 20 0 40 0 80 0 50 50 16 00 100 200 400 800 1600 100 200 400 800 1600 Dilutions D i l u t i o n s D i l u t i o n s D E F I g G i n l u n g l y s a t e I g G i n l u n g l y s a t e I g G i n l u n g l y s a t e 2 . 0 2 . 0 2 . 0 ( H 1 N 2 - O H 1 0 ) ( H 1 N 1 - O H 7 ) ( H 3 N 2 - O H 4 ) b d g i b d j 1 . 5 1 . 5 1 . 5 g j b d d g g j

j b d 450nm

450nm 1 . 0

450nm 1 . 0 1 . 0 b d d j

OD OD OD d

0 . 5 0 . 5 0 . 5

0 . 0 0 . 0 0 . 0 50 50 50 100 200 400 800 100 200 400 800 1600 100 200 400 800 1600 1600 D i l u t i o n s D i l u t i o n s D i l u t i o n s G H I 1.5 IgG in BAL fluid 1 . 5 I g G i n B A L fl u i d 1.5 IgG in BAL fluid (H1N2-OH10) b d ( H 3 N 2 - O H 4 ) b h b I g h A n a (H1N1-OH7)sal swab DPC-6 i (H3N2-OH-4) d b h b h IgA nasal iswba hb DPC-6 1 . 0 1.0 1.0

(H3N2-OiH-4) b h

450nm 450nm IgA nasal swab DPC-6 450nm

0.8 OD OD (H3N2-OH-4) OD 0 . 5 0.5 0.5 b c 0.8 d e 0.6 f g b c MMoocckk d e m 0.8 0 . 0 0.0 0.0n 0.6 f g 0 PPoloyl(yI(:IC:C) )+ +C hCh 5 50 100 200 400 800

50 4 1600 b c 100 200 400 800 0.4 50 100 200 400 800 1600 b e 1600

MD Moocckk m NKaAnog- 1N1a-KnoA-g1-1p owlyit(hI :PCo) l+y C(Ih:C)+ Ch

d e Dilutions Dilutions D i l u t i o n s

n O f g 0 PPoloyl(yI(:IC:C) )+ +C hCh 0.6 5 NPaenpo-ti1d1e-ps eNpatindoes--1p1o lwyi(tIh: CP)o +ly C(Ih:C) + Ch 4 0.4 b e D MMoocckk NKaAnog- 1N1a-KnoA-g1-1p owlyit(hI :PCo) l+y C(Ih:C)+ Ch

m 0.2 CComommmerecricali avla vcaccincei n+e C +h Ch

n O

0 PPoloyl(yI(:IC:C) )+ +C hCh NPaenpo-ti1d1e-ps eNpatindoes--1p1o lwyi(tIh: CP)o +ly C(Ih:C) + Ch 5 4 0.4 b e D 0.2 NKaAnog- 1N1a-KnoA-g1-1p owlyit(hI :PCo) l+y C(Ih:C)+ Ch CComommmerecricali avla vcaccincei n+e C +h Ch O Figure 3. CommercialNPaenpo-ti1d1e-ps eNpatind oeinfluenzas--1p1o lwyi(tIh: CP)o +ly C( Ih:vaccineC) + Ch 0 .augmented0 systemic IgG response and Nano-11-KAg- poly(I:C) vaccine in lower respiratory tract. 2 4 8 16 32 64 0.2 CComommmerecricali avla vcaccincei n+e C +h Ch dilutions Pigs were0.0 vaccinated twice with poly(I:C) adjuvanted Nano-11 based nanovaccines or commercial vaccine2 4 8 1and6 32 challenged64 at 35 days post prime vaccination. Samples collected at day dilutions 0.0 2 4 8 16 32 64 45 dilutions post-challenge six were used for IgG antibody analysis. The IgG antibody response in serum, lung lysate, and BAL fluid samples against (A,D,G) H1N2-OH10; (B,E,H) H1N1-OH7; and (C,F,I) H3N2-OH4 SwIAVs were analyzed by ELISA. Data represent the mean value of four to five pigs ± SEM. Statistical analysis was carried out using two-way ANOVA followed by Bonferroni test. Each letter indicates the significant difference between the groups at the indicated dilution. b and d indicate the difference between mock group compared to Nano-11- KAg-poly(I:C) + Ch, and Commercial vaccine +Ch, respectively. g indicate the difference between poly(I:C) + Ch compared to Commercial vaccine +Ch. h and i indicate the difference between Nano-11-KAg-poly(I:C) + Ch compared to Nano-11-peptide-poly(I:C) + Ch and Commercial vaccine +Ch, respectively. j indicates difference between Nano-11-peptide- poly(I:C) + Ch) compared to Commercial vaccine +Ch. A p<0.05 was considered statistically significant. Ch- Challenge. 2.4.5 IFNγ secretion by lymphocytes of poly(I:C) adjuvanted Nano-11 based influenza nanovaccinates

The frequency of IFNγ secreting T-helper/memory (CD3+CD4+CD8+) cells was significantly increased (P<0.01) in animals vaccinated with the commercial vaccine (Figure 4A). On the other hand, a higher frequency of IFNγ secreting γδ T cells was noticed in Nano-11-KAg-poly(I:C) vaccinates although this did not reach statistical significance (Figure 4B).

A T -h e lp e r /m e m e o r y c e lls B + + + + + (C D 3 C D 4 C D 8  IF N  ) I F N    T c e lls 1 0 * * 6 * *

s 8

e e

c 4

+ 6

2 % 2 %

0 0 1 2 3 4 5 1 2 3 4 5 P ig g r o u p s P ig g r o u p s

1. Mock 2. Poly(I:C) + Ch 3. Nano-11-KAg-poly(I:C) + Ch 4. Nano-11-peptides-poly(I:C) + Ch 5. Commercial vaccine + Ch

Figure 4. Recall IFN-γ secreting lymphocyte response in Nano-11 and commercial influenza vaccinated/virus challenged pigs. PBMCs isolated at post-challenge day 6 were stimulated with H1N2-OH10 SwIAV, immunostained and analyzed for the frequency of IFN-γ secreting (A) memory/T-helper cells (CD3+CD4+CD8+); and (B) γδ T cells by flow cytometry. Data represent the mean value of four to five pigs ± SEM. Statistical analysis was carried out using one-way analysis of variance followed by Tukey's post-hoc comparison. Asterisk refers to statistical difference between the two indicated groups (**p < 0.01). Ch: challenge.

2.4.6 Poly(I:C) adjuvanted Nano-11 based influenza nanovaccinates increased the Th1 and Th2 cytokines mRNA expression in TBLN

We determined the mRNA expression of the cytokines IL-2, IL-6, TNF, IL-10 and IL-13 as well as the transcription factor GATA3 in the TBLN. IL-13 and GATA3 are associated with Th2 responses and IL-2 and TNF with Th1 responses, whereas IL-10 is an immunosuppressive cytokine and IL-6 a proinflammatory cytokine. Both the Nano-11-KAg-poly(I:C) and Nano-11- peptides-poly(I:C) immunization significantly increased (P<0.05 and P<0.01) IL-13 mRNA compared to commercial vaccine and mock group (Figure 5A). Nano-11-KAg-poly(I:C) nanovaccine also had increased GATA3 mRNA expression compared to other groups (Figure

5C). The expression of IL-10 mRNA was significantly higher (P<0.05 and P<0.01) in both the

Nano-11 based influenza vaccine groups compared with the mock group (Figure 5B). TNF-α cytokine gene expression was increased in Nano-11-KAg-poly(I:C) vaccinates compared to other groups, and it was significantly increased (P<0.05) compared with the mock group (Figure 5D).

Notably, both Nano-11-KAg-poly(I:C) a Nano-11-peptides-poly(I:C) groups had significantly increased (P<0.01) IL-2 mRNA expression compared to mock and commercial vaccine administered animals (Figure 5E). IL-6 gene expression was increased by both the Nano-11 influenza vaccine groups compared to other vaccinates (Figure 5F).

A I L -1 3 B I L -1 0 C * * * * * G A T A 3

1 0 * * * 1 5 * * 1 5 n

f 8

s l s 1 0

e 1 0

e v

r 6

i 4 A t 5

a 5

e R

R 2 m

0 0 0 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5

D T N F - E F I L -2 I L -6 4 1 5 0 2 5

* * * n

f * * 2 0

i 3 s

s * *

l s

e 1 0 0

e v

r * * 1 5

x 2

i 1 0

A t

a 5 0

l e

R 1

R m

0 0 0 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5

1. Mock 2. Poly(I:C) + Ch 3. Nano-11-KAg-poly(I:C) + Ch 4. Nano-11-peptides-poly(I:C) + Ch 5. Commercial vaccine + Ch

Figure 5. Cytokines and transcription factor mRNA expression in the tracheobronchial lymph nodes of pigs vaccinated with Nano-11 or commercial influenza vaccine and virus challenged. The mRNA expression levels of (A) IL-13; (B) IL-10; (C) GATA3; (D) TNF-α; (E) IL-2; and (F) IL-6 was determined by qRT-PCR. Data represent the mean value of four to five pigs ± SEM. Statistical analysis was carried out using one-way analysis of variance followed by Tukey's post-hoc comparison. Asterisk refers to statistical difference between the two indicated groups (*p < 0.05, and **p < 0.01). Ch: challenge.

2.4.7 Nano-11-KAg-poly(I:C) nanovaccination increased the virus neutralization test titers in the lung (but not in serum) with comparable virus load in the airways to that of commercial vaccine

The Nano-11-KAg-poly(I:C) vaccine elicited enhanced SIgA and IgG antibody levels in the lungs of pigs which was reflected in significantly higher (P<0.05) VNT titer in the BAL fluid

(Figure 6A). Corresponding to high specific IgG antibody response induced by commercial vaccine in serum a significantly higher (P<0.01) VNT titer was observed (Figure 6B). The virulent heterologous (H1N1-OH7) challenge virus load in the nasal swab, BAL fluid, and lung lysate samples of both Nano-11 and commercial influenza vaccines administered groups were partially reduced, with numerical (but not statistically significant) reduced load by the commercial vaccine compared to other groups (Figure 6C-E). We did not observe any influenza related visible clinical signs in any of the virus challenged experimental pigs, while the microscopic lung lesions such as interstitial pneumonia, peri-bronchial, perivascular and bronchial exudate inflammation were partially reduced by both Nano-11 based influenza and commercial vaccinated pigs (Figure 6F).

A B V N T tite r in B A L flu id V N T tite r in s e r u m (H 1 N 1 -O H 7 ) (H 1 N 1 -O H 7 ) 1 0 1 0 * *

8 8 1. Mock

l a a * c 2. Poly(I:C) + Ch

c 6 6

S 2

2 3. Nano-11-KAg-poly(I:C) + Ch g

g 4 4 o

o 4. Nano-11-peptides-poly(I:C) + Ch

L L 2 2 5. Commercial vaccine + Ch

0 0 1 2 3 4 5 1 2 3 4 5 C D E F N a sa l S w a b B A L flu id L u n g le s io n s c o r e s

6 6 6 L u n g ly s a te 1 0

L L

L 8

0 5

4 5 4 5

4 r

o D

D 6

1 &

2 2 1 2

o o

o 2

L L

0 0 0 0 2 3 4 5 2 3 4 5 2 3 4 5 2 3 4 5

Figure 6. Nano-11-KAg-poly(I:C) and commercial influenza vaccines induced increased virus neutralization test titers in BAL fluid and blood of pigs, respectively. Virus neutralization antibody titer in (A) BAL fluid; (B) Serum. Challenge live SwIAV titer in (C) Nasal Swab; (D) BAL fluid; and (E) Lung lysate. (F) Severity of lung lesions based on evaluation of hematoxylin and eosin-stained sections. Data represent the mean value of four to five pigs ± SEM. Statistical analysis was carried out using one-way analysis of variance followed by Tukey's post-hoc comparison. Asterisk refers to statistical difference between the two indicated groups (*p < 0.05, and **p < 0.01). Ch: challenge. 51

2.5 Discussion

Polysaccharide structured Nano-11 particles are derived from the kernel of a genetic variant of sweet corn, sugary-1 [130]. A simple chemical modification of the surface was used to synthesize the amphiphilic and cationic Nano-11 particles [130]. Mice injected

IM with Nano-11 particles developed a moderate local inflammatory response, which resolved in about two weeks with no signs of systemic distribution or long-term deposition of particles at the injection site, suggesting its safety in animals [133]. We did not observe any clinical signs of adverse reactions after IM or IN administration of the

Nano-11 formulated vaccines to pigs. Nano-11-KAg delivered IN with no additional adjuvant induced cross-reactive SIgA response only in the nasal passage but not in BAL fluid, and failed to elicit systemic IgG and cross-reactive T cell responses [94]. Therefore, in this study our goal was to improve the efficacy of Nano-11 influenza vaccines by incorporating the adjuvant poly(I:C) in the formulation, and also to evaluate the responses to conserved peptides delivered in Nano-11 particles.

The positively charged Nano-11 particles readily adsorb negatively charged molecules such as protein antigens and nucleic acids [130]. Increasing the ratio of Nano-11 to antigen leads to high antigen adsorption efficiency and smaller nanometer sized particles

[94]. In this study, high Nano-11 to KAg ratio (8:1) was used compared to our earlier preparation (2:1 ratio) which resulted in approximately 10% higher KAg adsorption efficiency and reduced particle size from 487 nm to 214 nm compared with a 2:1 ratio

[94]. The adsorption efficiency of peptides was lower than for KAg. The adsorption did

52 not cause much change in the net positive surface charge on the Nano-11 vaccine particles.

The nasal passage is the primary gateway of influenza virus entry and secreted specific

SIgA antibodies in the airways minimizes the entry of virus to susceptible cells in the body [144, 145]. Compared to our previous study in pigs using Nano-11-KAg [94], the

Nano-11-KAg-poly(I:C) formulation induced a cross-reactive SIgA secretion in the BAL fluid and IgG antibodies in serum and lungs. In addition, both the Nano-11-KAg- poly(I:C) and Nano-11-peptdies-poly(I:C) formulations induced Th1 and Th2 cytokine mRNA expression in TBLN. Five conserved influenza virus B cell peptides incorporated in Nano-11-peptides-poly(I:C) vaccine failed to elicit a substantial antibody response either in the airways or in blood of pigs. In our earlier study too, identical influenza virus peptides encapsulated in PLGA and liposome nanoparticles delivered IN failed to elicit antibody response [55, 96].

As expected, the commercial IM delivered vaccine induced a robust systemic serum IgG response and also IgG in the lung parenchyma, but it did not induce significant SIgA secretion in the airways [117, 146]. An IN delivered influenza vaccine induced high avidity SIgA antibodies and provided protection against a heterologous influenza challenge in mice, while the injectable vaccine elicited serum IgG but no SIgA secretion

[146]. The combination of nanoparticles and TLR ligands can elicit broad and strong humoral immunity through expansion of T follicular helper cells in the germinal center

[147]. Poly(I:C) co-administered with inactivated influenza virus IN induced cross- reactive SIgA and systemic IgG antibodies, while parenteral delivery failed to elicit SIgA

53 secretion in mice [138, 148, 149]. In mice, influenza specific IgG acts as a backup for

SIgA antibody mediated influenza virus protection in the nasal passages, whereas IgG antibody is dominant in the lung [144]. Local airway SIgA and systemic IgG levels in chickens are increased by co-delivery of a TLR agonist with an inactivated avian influenza virus [150]. Moreover, co-administration of soluble poly(I:C) with SwIAV-

KAg IN induced SIgA and serum IgG antibody response comparable to a commercial vaccine in pigs [117].

In this study, the group that received soluble poly(I:C) only and challenged with virus is our control challenge infection pig group, because poly(I:C) alone does not induce viral antigen specific immunity to a challenge virus inoculated two weeks later. This is based on multiple previous vaccine trials that included challenge infections to naïve pigs [55,

93, 96-98]. The response in naive animals was similar to the group that received poly(I:C) formulation only.

The cell mediated immune response is needed to rescue infected animals and to prevent complications associated with influenza [150]. Immunity to influenza virus in pigs is mainly mediated by T-helper/memory cells which possess cytolytic function [93, 151,

152]. To clear influenza virus from the lungs of pigs, IFNγ secreted by cytotoxic T lymphocytes (CTLs), T-helper/memory, and γδ T cells play a major role [93]. Both the

Nano-11-KAg-poly(I:C) and Nano-11-peptides-poly(I:C) nanovaccines enhanced the

IFNγ secreting γδ T cell population, while the commercial vaccine increased the IFNγ secreting T-helper/memory cells frequency. In an earlier study, Nano-11-KAg without poly(I:C) induced both CTLs and T-helper/memory cells response specific to vaccine

54 virus [94], while our current studies show that the addition of poly(I:C) to Nano-11-KAg triggered only γδ T cell responses along with Th1 and Th2 cytokines mRNA expression in TBLN. Influenza virus delivered IN with TLR3 agonist induced a similar homologous virus specific T cell response in mice [148].

The induction of IL-2, IL-4, IL-10, TGFβ, and IL-21 cytokines promotes B cell proliferation and specific class switched plasma cells with long-lived memory B cells

[145]. Addition of poly(I:C) in Nano-11-KAg augmented in vitro TNFα, IL-1β and IFNγ mRNA expression in treated monocyte derived porcine DCs, and in vivo in vaccinated pig lymphoid tissues (TBLN) observed enhanced IL-2, IL-13, IL-10 and TNFα gene expression. While in our earlier study in Nano-11-KAg vaccinated pigs any such cytokines gene expression was not detected in TBLN, although in vitro treated porcine

DCs secreted TNFα, IL-1β, IL-10, IL-6 and IL-12 cytokines [94]. Based on this study, it is clear that the poly(I:C) adsorbed on Nano-11-KAg or Nano-11-peptides enhanced several cytokines gene expression which likely augmented humoral and cell mediated immune responses compared to earlier study with only Nano-11-KAg [94]. Similarly, in mice poly(I:C) administered with influenza virus antigen IN augments IFN, INFß,

IFNγ, IL-4, IL-6, and IL-12 p40 mRNA expression [149]. In chickens, vaccination with avian influenza virus and poly(I:C) enhanced IL-6, IL-12, and IFNγ cytokine gene expression compared to non-adjuvanted vaccination [150].

It is important to note that the multivalent inactivated influenza commercial vaccine used for comparative analysis in our study contains H1N1, H1N2, and H3N2 SwIAVs. The

HA gene sequence analysis data revealed that the H1N1-OH07 challenge virus has

95.2%, 77.9% and 53% HA genetic identity to the commercial vaccine H1N1, H1N2 and

H3N2 viruses, respectively. Whereas our Nano-11-KAg vaccine containing only the

H1N2-OH10 virus with 77% HA genetic identity to the H1N1-OH07 challenge virus.

This suggests that the commercial vaccine elicited immune responses mostly against the homologous virus, while Nano-11-KAg- poly(I:C) vaccine induced significant cross- reactive antibody and cytokine responses. Microscopic lung lesions and challenge virus load were partially reduced in both poly(I:C) adjuvanted Nano-11 and commercial multivalent influenza vaccinates, indicating that the Nano-11-KAg- poly(I:C) vaccine induced immune response did not translate into significant cross-protection. This suggests the need for further studies using multivalent SwIAVs-KAg in the Nano-11-

KAg- poly(I:C) formulation in pigs. The Nano-11-peptides-poly(I:C) vaccine reduced the challenge virus load and lung lesions comparable to Nano-11-KAg-poly(I:C) vaccinates, consistent with our previous vaccine trial using PLGA encapsulated peptides vaccine

[55].

In conclusion, addition of poly(I:C) to a Nano-11-KAg vaccine formulation delivered IN augmented homologous, heterologous and heterosubtypic virus specific humoral response in the airways and systemic and Th1 and Th2 cytokines gene expression in the lung draining lymph nodes of pigs and provided partial cross-protective immunity. Future studies are aimed at improving the cross-protective efficacy of Nano-11-KAg vaccine by using multivalent SwIAVs KAg and split virus antigens along with other potent secondary adjuvants to better protect pigs against field virus infections compared to commercial multivalent SwIAV vaccines.

2.6 Author contributions

SR, HH and GR conceived and designed the research work and wrote the manuscript.

SR, NF and JS did the experiments and analyzed the data. FL and HH synthesized and analyzed the Nano-11 particles. Vaccination and challenge trial in pigs, sample collection and processing were helped by SR, NF, SG, YI and SD. VP did the flow cytometry data analyses. SK provided the insights of histopathology analyses and examined the lung sections. All authors read and agreed the manuscript for publication.

2.7 Acknowledgement

We are thankful to Dr. Juliette Hanson, Sara Talmadge, Megan Strother, Dr. John M.

Ngunjiri, Amir Ghorbani, Mahesh KC, Kara J. M. Taylor and Michael C. Abundo for their help in animal studies.

2.8 Funding

This work was supported by the National Pork Board. Salaries and research support were provided by state and federal funds appropriated to OARDC, The Ohio State University.

2.9 Disclosures

HH has a patent on Nano-11 and is cofounder of ZeaVaxx LLC, a start-up company aimed at further developing nanoparticle vaccine adjuvants. The other authors declare no financial conflict of interest.

2.10 Supplementary materials

Table 1 Sequence and isoelectric point of influenza virus specific conserved T cell and B cell peptides

Isoelectric S.No Peptides Sequence point

1 NP44-52 (T cell) CTELKLSDY 4.37

2 PB1542-551 (T cell) ATAQMALQLF 5.57

3 PB1591-599 (T cell) VSDGGPNLY 3.8

4 M136-45 (T cell) NTDLEALMEW 3.57

5 PB2197-205 (T cell) VAGGTGSVY 5.49

SSDNGTCYPGDFIDYEELRE 6 HA (B cell) 3.89 159-92 QLSSVSSFERFEIF

NSENGTCYPGDFIDYEELRE 7 HA (B cell) 3.94 187-120 QLSSVSSFEKFEIF

NPENGTCYPGYFADYEELR 8 HA (B cell) 4.06 1101-134 EQLSSVSSFERFEIF

SLLTEVETPIRNGWECKCN 9 M2e (B cell) 4.18 DSSD

RIENLNKKVDDGFLDIWTY 10 HA276-130 (B cell) NAELLVLLENERTLDYHDS 5.18 NVKNLYEKVRSQLKNNA

Table 2 Sequence of the primers used in qRT-PCR analyses

S.No Oligo name Sequence (5’ 3’)

CAGCCTCCTGAAACTGGAATAT (F) 1 β-actin TCAGCAACAAGGTCTACAATCC (R)

GTCATTGCTCTCACCTGCTT (F) 2 IL-13 TTGGTGTCTCGGATGTGCTT (R)

GCATCCACTTCCAGGCCA (F) 3 IL-10 CTTCCTCATCTTCATCGTCA (R)

TGCGGGCTCTACCACAAAAT (F) 4 GATA3 TAACCCGAGTAAAATGTGC (R)

CGTTGTAGCCAATGTCAAAGCC (F) 5 INF TGCCCAGATTCAGCAAAGTCCA (R) GATTTACAGTTGCTTTTGAA (F) 6 IL-2 GTTGAGTAGATGCTTTGACA (R) CCAGGAACCCAGCTATGAAC (F) 7 IL-6 CTGCACAGCCTCGACATT (R)

Bibliography

1. Webster, R.G., Bean, W. J., Gorman, O. T., Chambers, T. M., & Kawaoka, , Evolution and ecology of influenza A viruses. Microbiological reviews, 1992. 56 p. 152–179. 2. Slemons, R.D., D. C. Johnson, J. S. Osborn, and F. Hayes, Type A influenza viruses isolated from wild fre-flying ducks in California. Avian Dis., 1974. 18: p. 119-125. 3. Jegaskanda, S., et al., Fc or not Fc; that is the question: Antibody Fc-receptor interactions are key to universal influenza vaccine design. Hum Vaccin Immunother, 2017. 13(6): p. 1-9. 4. Molinari, N.A., et al., The annual impact of seasonal influenza in the US: measuring disease burden and costs. Vaccine, 2007. 25(27): p. 5086-96. 5. Eisfeld, A.J., G. Neumann, and Y. Kawaoka, Influenza A virus isolation, culture and identification. Nature Protocols, 2014. 9(11): p. 2663-2681. 6. Rajao, D.S., A.L. Vincent, and D.R. Perez, Adaptation of Human Influenza Viruses to Swine. Front Vet Sci, 2018. 5: p. 347. 7. Lorusso, A., et al., Genetic and antigenic characterization of H1 influenza viruses from United States swine from 2008. J Gen Virol, 2011. 92(Pt 4): p. 919-30. 8. Anderson, T.K., et al., Population dynamics of cocirculating swine influenza A viruses in the United States from 2009 to 2012. Influenza Other Respir Viruses, 2013. 7 Suppl 4: p. 42-51. 9. Dou, D., et al., Influenza A Virus Cell Entry, Replication, Virion Assembly and Movement. Front Immunol, 2018. 9: p. 1581. 10. Rossman, J.S. and R.A. Lamb, Influenza virus assembly and budding. Virology, 2011. 411(2): p. 229-36. 11. Lee C.W., S.Y.M., Avian influenza virus. Microbiol. Infect. Dis., 2009(32): p. 301–310. 12. Cros JF, G.-S.A., Palese P. , An unconventional NLS is critical for the nuclear import of the influenza A virus nucleoprotein and ribonucleoprotein. . Traffic 2005(6): p. 205–13. 13. Yángüez, E., Rodriguez, P., Goodfellow, I., & Nieto, A. , Influenza virus polymerase confers independence of the cellular cap-binding factor eIF4E for viral mRNA translation. Virology,, 2012. 422: p. 297-307. 14. Klemm, C., et al., Immunomodulatory Nonstructural Proteins of Influenza A Viruses. Trends Microbiol, 2018. 26(7): p. 624-636. 15. Rust, M.J., et al., Assembly of endocytic machinery around individual influenza viruses during viral entry. Nat Struct Mol Biol, 2004. 11(6): p. 567-73. 16. Reich, S., et al., Structural insight into cap-snatching and RNA synthesis by influenza polymerase. Nature, 2014. 516(7531): p. 361-6. 17. Poon, L.L., et al., Direct evidence that the poly(A) tail of influenza A virus mRNA is synthesized by reiterative copying of a U track in the virion RNA template. J Virol, 1999. 73(4): p. 3473-6. 60

18. York, A. and E. Fodor, Biogenesis, assembly, and export of viral messenger ribonucleoproteins in the influenza A virus infected cell. RNA Biol, 2013. 10(8): p. 1274-82. 19. Matrosovich, M., et al., Early alterations of the receptor-binding properties of H1, H2, and H3 avian influenza virus hemagglutinins after their introduction into mammals. J Virol, 2000. 74(18): p. 8502-12. 20. Gambaryan A, Y.S., Lvov D, Tuzikov A, Chinarev A, Pazynina G, et al. , Receptor specificity of influenza viruses from birds and mammals: new data on involvement of the inner fragments of the carbohydrate chain. Virology 2005: p. 276–83. 21. Mena, I., et al., Origins of the 2009 H1N1 influenza pandemic in swine in Mexico. Elife, 2016. 5. 22. Nelli, R.K., et al., Comparative distribution of human and avian type sialic acid influenza receptors in the pig. BMC Vet Res, 2010. 6: p. 4. 23. Mastin, A., et al., Prevalence and risk factors for swine influenza virus infection in the English pig population. PLoS Curr, 2011. 3: p. RRN1209. 24. Trebbien, R., L.E. Larsen, and B.M. Viuff, Distribution of sialic acid receptors and influenza A virus of avian and swine origin in experimentally infected pigs. Virol J, 2011. 8: p. 434. 25. Donovan, T., Influenza isolate selection methodology for timely autogenous vaccine use. Amer Assoc Swine Vet Conf 2008. 2020(January 13): p. 551-561. 26. Janke, B.H., Influenza A virus infections in swine: pathogenesis and diagnosis. Vet Pathol, 2014. 51(2): p. 410-26. 27. Kolesnikova, L., et al., Influenza virus budding from the tips of cellular microvilli in differentiated human airway epithelial cells. J Gen Virol, 2013. 94(Pt 5): p. 971-6. 28. Abdoli, A., et al., Determining influenza virus shedding at different time points in madin-darby canine kidney cell line. Cell J, 2013. 15(2): p. 130-5. 29. Talker, S.C., et al., Influenza A Virus Infection in Pigs Attracts Multifunctional and Cross-Reactive T Cells to the Lung. J Virol, 2016. 90(20): p. 9364-82. 30. Winkler, G.C. and N.F. Cheville, Ultrastructural morphometric investigation of early lesions in the pulmonary alveolar region of pigs during experimental swine influenza infection. Am J Pathol, 1986. 122(3): p. 541-52. 31. Janeway CA Jr, T.P., Walport M, et al., Immunobiology: The Immune System in Health and Disease. . 5th ed. The mucosal immune system. 2001, New York: Garland Science. 32. McGhee, J.R. and K. Fujihashi, Inside the mucosal immune system. PLoS Biol, 2012. 10(9): p. e1001397. 33. Roche, W.R., et al., Cell adhesion molecules and the bronchial epithelium. Am Rev Respir Dis, 1993. 148(6 Pt 2): p. S79-82. 34. Denney, L. and L.P. Ho, The role of respiratory epithelium in host defence against influenza virus infection. Biomed J, 2018. 41(4): p. 218-233. 35. Ehre, C., et al., Overexpressing mouse model demonstrates the protective role of Muc5ac in the lungs. Proc Natl Acad Sci U S A, 2012. 109(41): p. 16528-33. 61

36. Hartshorn, K.L., et al., Mechanisms of anti-influenza activity of surfactant proteins A and D: comparison with serum collectins. Am J Physiol, 1997. 273(6): p. L1156-66. 37. Date, Y., et al., NALT M cells are important for immune induction for the common mucosal immune system. Int Immunol, 2017. 29(10): p. 471-478. 38. Neutra, M.R., M cells in antigen sampling in mucosal tissues. Curr Top Microbiol Immunol, 1999. 236: p. 17-32. 39. Chen, X., et al., Host Immune Response to Influenza A Virus Infection. Front Immunol, 2018. 9: p. 320. 40. Jeisy-Scott, V., et al., TLR7 recognition is dispensable for influenza virus A infection but important for the induction of hemagglutinin-specific antibodies in response to the 2009 pandemic split vaccine in mice. J Virol, 2012. 86(20): p. 10988-98. 41. Poeck, H., et al., Recognition of RNA virus by RIG-I results in activation of CARD9 and inflammasome signaling for interleukin 1 beta production. Nat Immunol, 2010. 11(1): p. 63-9. 42. Swanson, K.V., M. Deng, and J.P.Y. Ting, The NLRP3 inflammasome: molecular activation and regulation to therapeutics. Nature Reviews Immunology, 2019. 19(8): p. 477-489. 43. Ichinohe, T., I.K. Pang, and A. Iwasaki, Influenza virus activates inflammasomes via its intracellular M2 ion channel. Nat Immunol, 2010. 11(5): p. 404-10. 44. Lee, B.W., et al., Class specific antibody response to influenza A H1N1 infection in swine. Vet Microbiol, 1995. 43(2-3): p. 241-50. 45. Janke, B.H., Diagnosis of swine influenza. Swine Health Prod, 2000. 8: p. 79–84. 46. Sandbulte, M.R., et al., Optimal Use of Vaccines for Control of Influenza A Virus in Swine. Vaccines (Basel), 2015. 3(1): p. 22-73. 47. Larsen, D.L., et al., Systemic and mucosal immune responses to H1N1 influenza virus infection in pigs. Vet Microbiol, 2000. 74(1-2): p. 117-31. 48. Hargadon, K.M., et al., Major histocompatibility complex class II expression and hemagglutinin subtype influence the infectivity of type A influenza virus for respiratory dendritic cells. J Virol, 2011. 85(22): p. 11955-63. 49. Manicassamy, B., et al., Analysis of in vivo dynamics of influenza virus infection in mice using a GFP reporter virus. Proc Natl Acad Sci U S A, 2010. 107(25): p. 11531-6. 50. Hao, X., T.S. Kim, and T.J. Braciale, Differential response of respiratory dendritic cell subsets to influenza virus infection. J Virol, 2008. 82(10): p. 4908- 19. 51. Hufford, M.M., et al., The effector T cell response to influenza infection. Curr Top Microbiol Immunol, 2015. 386: p. 423-55. 52. Baumgarth, N. and A. Kelso, In vivo blockade of gamma interferon affects the influenza virus-induced humoral and the local cellular immune response in lung tissue. J Virol, 1996. 70(7): p. 4411-8. 53. Sun, J., et al., Effector T cells control lung inflammation during acute influenza virus infection by producing IL-10. Nat Med, 2009. 15(3): p. 277-84. 62

54. Damjanovic, D., et al., Negative regulation of lung inflammation and immunopathology by TNF-alpha during acute influenza infection. Am J Pathol, 2011. 179(6): p. 2963-76. 55. Hiremath, J., et al., Entrapment of H1N1 Influenza Virus Derived Conserved Peptides in PLGA Nanoparticles Enhances T Cell Response and Vaccine Efficacy in Pigs. PLoS One, 2016. 11(4): p. e0151922. 56. Morgan, S.B., et al., Aerosol Delivery of a Candidate Universal Influenza Vaccine Reduces Viral Load in Pigs Challenged with Pandemic H1N1 Virus. J Immunol, 2016. 196(12): p. 5014-23. 57. Waffarn, E.E. and N. Baumgarth, Protective B cell responses to flu--no fluke! J Immunol, 2011. 186(7): p. 3823-9. 58. Reeth, K.V., et al., Genetic relationships, serological cross-reaction and cross- protection between H1N2 and other influenza A virus subtypes endemic in European pigs. Virus Res, 2004. 103(1-2): p. 115-24. 59. United States Department of Agriculture, V.S., Animal and Plant Health Inspection Service, Influenza A virus in swine surveillance: fiscal year 2015 quarterly report. February 2016. 60. Micah L. Jansen, D.Z.I., Updated FluSure XP ® Offers Cross-Protection in Pigs Challenged with Contemporary Cluster IV-A H3N2 Swine Influenza Virus. January 2017. 61. USDA, Swine2006,PartII:ReferenceofSwineHealthandHealthManagement Practices in the United States. 2006. 62. Chamba Pardo, F.O., et al., Effect of strain-specific maternally-derived antibodies on influenza A virus infection dynamics in nursery pigs. PLoS One, 2019. 14(1): p. e0210700. 63. Loeffen, W.L., et al., Effect of maternally derived antibodies on the clinical signs and immune response in pigs after primary and secondary infection with an influenza H1N1 virus. Vet Immunol Immunopathol, 2003. 92(1-2): p. 23-35. 64. Kitikoon, P., et al., The immune response and maternal antibody interference to a heterologous H1N1 swine influenza virus infection following vaccination. Vet Immunol Immunopathol, 2006. 112(3-4): p. 117-28. 65. Rajao, D.S., et al., Heterologous challenge in the presence of maternally-derived antibodies results in vaccine-associated enhanced respiratory disease in weaned piglets. Virology, 2016. 491: p. 79-88. 66. Rajao, D.S., et al., Vaccine-associated enhanced respiratory disease is influenced by haemagglutinin and neuraminidase in whole inactivated influenza virus vaccines. J Gen Virol, 2016. 97(7): p. 1489-1499. 67. Smatti, M.K., A.A. Al Thani, and H.M. Yassine, Viral-Induced Enhanced Disease Illness. Frontiers in Microbiology, 2018. 9(2991). 68. Khurana, S., et al., Vaccine-induced anti-HA2 antibodies promote virus fusion and enhance influenza virus respiratory disease. Sci Transl Med, 2013. 5(200): p. 200ra114. 69. Wong, S.S. and R.J. Webby, Traditional and new influenza vaccines. Clin Microbiol Rev, 2013. 26(3): p. 476-92. 63

70. Rajão, D.S. and D.R. Pérez, Universal Vaccines and Vaccine Platforms to Protect against Influenza Viruses in Humans and Agriculture. Frontiers in microbiology, 2018. 9: p. 123-123. 71. Tao, W., et al., Consensus M2e peptide conjugated to gold nanoparticles confers protection against H1N1, H3N2 and H5N1 influenza A viruses. Antiviral Res, 2017. 141: p. 62-72. 72. Valkenburg, S.A., et al., Stalking influenza by vaccination with pre-fusion headless HA mini-stem. Sci Rep, 2016. 6: p. 22666. 73. Mallajosyula, J.K., et al., Single-dose monomeric HA subunit vaccine generates full protection from influenza challenge. Hum Vaccin Immunother, 2014. 10(3): p. 586-95. 74. Malonis, R.J., J.R. Lai, and O. Vergnolle, Peptide-Based Vaccines: Current Progress and Future Challenges. Chem Rev, 2019. 75. Bolhassani, A. and S.R. Yazdi, DNA immunization as an efficient strategy for vaccination. Avicenna J Med Biotechnol, 2009. 1(2): p. 71-88. 76. Karlsson, I., et al., Protective effect of a polyvalent influenza DNA vaccine in pigs. Vet Immunol Immunopathol, 2018. 195: p. 25-32. 77. Bragstad, K., et al., A polyvalent influenza A DNA vaccine induces heterologous immunity and protects pigs against pandemic A(H1N1)pdm09 virus infection. Vaccine, 2013. 31(18): p. 2281-8. 78. Borggren, M., et al., A polyvalent influenza DNA vaccine applied by needle-free intradermal delivery induces cross-reactive humoral and cellular immune responses in pigs. Vaccine, 2016. 34(32): p. 3634-40. 79. Vincent, A.L., et al., Live attenuated influenza vaccine provides superior protection from heterologous infection in pigs with maternal antibodies without inducing vaccine-associated enhanced respiratory disease. J Virol, 2012. 86(19): p. 10597-605. 80. Loving, C.L., et al., Heightened adaptive immune responses following vaccination with a temperature-sensitive, live-attenuated influenza virus compared to adjuvanted, whole-inactivated virus in pigs. Vaccine, 2012. 30(40): p. 5830-8. 81. Kaiser, T.J., et al., Influenza A virus shedding reduction observed at 12 weeks post-vaccination when newborn pigs are administered live-attenuated influenza virus vaccine. Influenza Other Respir Viruses, 2019. 13(3): p. 274-278. 82. Ishii, Y., et al., Inhibition of tumor growth in vivo and in vitro by macrophages from rats treated with a streptococcal preparation, OK-432. Gann, 1976. 67(1): p. 115-9. 83. Heritage, P.L., et al., Comparison of murine nasal-associated lymphoid tissue and Peyer's patches. Am J Respir Crit Care Med, 1997. 156(4 Pt 1): p. 1256-62. 84. Takaki, H., et al., Mucosal Immune Response in Nasal-Associated Lymphoid Tissue upon Intranasal Administration by Adjuvants. J Innate Immun, 2018. 10(5- 6): p. 515-521. 85. Amorij JP, H.W., Frijlink HW, Wilschut JC, Huckriede A., Needle-free influenza vaccination. Lancet Infect Dis ;, 2010. 10: p. 699–711.

86. Rahn, J., et al., Vaccines against influenza A viruses in poultry and swine: Status and future developments. Vaccine, 2015. 33(21): p. 2414-24. 87. Blank, F., et al., Interaction of biomedical nanoparticles with the pulmonary immune system. J Nanobiotechnology, 2017. 15(1): p. 6. 88. Wu, H.Y., H.H. Nguyen, and M.W. Russell, Nasal lymphoid tissue (NALT) as a mucosal immune inductive site. Scand J Immunol, 1997. 46(5): p. 506-13. 89. Kilburn, K.H., A hypothesis for pulmonary clearance and its implications. Am Rev Respir Dis, 1968. 98(3): p. 449-63. 90. Holt, P.G., et al., Regulation of immunological homeostasis in the respiratory tract. Nat Rev Immunol, 2008. 8(2): p. 142-52. 91. Mapletoft, J.W., et al., Intranasal immunization of mice with a bovine respiratory syncytial virus vaccine induces superior immunity and protection compared to those by subcutaneous delivery or combinations of intranasal and subcutaneous prime-boost strategies. Clin Vaccine Immunol, 2010. 17(1): p. 23-35. 92. Giri, P.K., et al., Comparative evaluation of intranasal and subcutaneous route of immunization for development of mucosal vaccine against experimental tuberculosis. FEMS Immunol Med Microbiol, 2005. 45(1): p. 87-93. 93. Dhakal, S., et al., Biodegradable nanoparticle delivery of inactivated swine influenza virus vaccine provides heterologous cell-mediated immune response in pigs. J Control Release, 2017. 247: p. 194-205. 94. Dhakal, S., et al., Corn-derived alpha-D-glucan nanoparticles as adjuvant for intramuscular and intranasal immunization in pigs. Nanomedicine, 2019. 16: p. 226-235. 95. Dhakal, S., et al., Evaluation of CpG-ODN-adjuvanted polyanhydride-based intranasal influenza nanovaccine in pigs. Vet Microbiol, 2019. 237: p. 108401. 96. Dhakal, S., et al., Liposomal nanoparticle-based conserved peptide influenza vaccine and monosodium urate crystal adjuvant elicit protective immune response in pigs. Int J Nanomedicine, 2018. 13: p. 6699-6715. 97. Dhakal, S., et al., Mucosal Immunity and Protective Efficacy of Intranasal Inactivated Influenza Vaccine Is Improved by Chitosan Nanoparticle Delivery in Pigs. Front Immunol, 2018. 9: p. 934. 98. Dhakal, S., et al., Polyanhydride nanovaccine against swine influenza virus in pigs. Vaccine, 2017. 35(8): p. 1124-1131. 99. Bastola, R., et al., Vaccine adjuvants: smart components to boost the immune system. Arch Pharm Res, 2017. 40(11): p. 1238-1248. 100. Choi, H.S., et al., Rapid translocation of nanoparticles from the lung airspaces to the body. Nat Biotechnol, 2010. 28(12): p. 1300-3. 101. Rodriguez-Lorenzo, L., et al., Fluorescence-encoded gold nanoparticles: library design and modulation of cellular uptake into dendritic cells. Small, 2014. 10(7): p. 1341-50. 102. Cruz, L.J., et al., Targeted PLGA nano- but not microparticles specifically deliver antigen to human dendritic cells via DC-SIGN in vitro. J Control Release, 2010. 144(2): p. 118-26.

103. Reed, S.G., M.T. Orr, and C.B. Fox, Key roles of adjuvants in modern vaccines. Nat Med, 2013. 19(12): p. 1597-608. 104. McLean, K.A., et al., The 2015 global production capacity of seasonal and pandemic influenza vaccine. Vaccine, 2016. 34(45): p. 5410-5413. 105. De Gregorio, E., E. Tritto, and R. Rappuoli, Alum adjuvanticity: unraveling a century old mystery. Eur J Immunol, 2008. 38(8): p. 2068-71. 106. Sivakumar, S.M., et al., Vaccine adjuvants - Current status and prospects on controlled release adjuvancity. Saudi Pharm J, 2011. 19(4): p. 197-206. 107. Apostolico Jde, S., et al., Adjuvants: Classification, Modus Operandi, and Licensing. J Immunol Res, 2016. 2016: p. 1459394. 108. Billiau, A. and P. Matthys, Modes of action of Freund's adjuvants in experimental models of autoimmune diseases. J Leukoc Biol, 2001. 70(6): p. 849-60. 109. Spickler, A.R. and J.A. Roth, Adjuvants in veterinary vaccines: modes of action and adverse effects. J Vet Intern Med, 2003. 17(3): p. 273-81. 110. Calabro, S., et al., Vaccine adjuvants alum and MF59 induce rapid recruitment of neutrophils and monocytes that participate in antigen transport to draining lymph nodes. Vaccine, 2011. 29(9): p. 1812-23. 111. Shah, R.B., Luis & O’Hagan, Derek & Amiji, Mansoor, Emulsions as Vaccine Adjuvants. 2015. 112. Schwendener, R.A., Liposomes as vaccine delivery systems: a review of the recent advances. Ther Adv Vaccines, 2014. 2(6): p. 159-82. 113. Bode, C., et al., CpG DNA as a vaccine adjuvant. Expert Rev Vaccines, 2011. 10(4): p. 499-511. 114. Halperin, S.A., et al., Comparison of the safety and immunogenicity of hepatitis B virus surface antigen co-administered with an immunostimulatory phosphorothioate oligonucleotide and a licensed hepatitis B vaccine in healthy young adults. Vaccine, 2006. 24(1): p. 20-6. 115. Lock, L.S.K.L., priming of T cells by exogenous antigen cross- presented on MHC class I molecules,. Immunology, 2006. 18(1): p. 85–91. 116. Cao, Y., et al., Poly(I:C) combined with multi-epitope protein vaccine completely protects against virulent foot-and-mouth disease virus challenge in pigs. Antiviral Res, 2013. 97(2): p. 145-53. 117. Thomas, M., et al., Poly I:C adjuvanted inactivated swine influenza vaccine induces heterologous protective immunity in pigs. Vaccine, 2015. 33(4): p. 542-8. 118. Currie, A.J., et al., Targeting the effector site with IFN-alphabeta-inducing TLR ligands reactivates tumor-resident CD8 T cell responses to eradicate established solid tumors. J Immunol, 2008. 180(3): p. 1535-44. 119. Martins, K.A., S. Bavari, and A.M. Salazar, Vaccine adjuvant uses of poly-IC and derivatives. Expert Rev Vaccines, 2015. 14(3): p. 447-59. 120. Gowen, B.B., et al., TLR3 is essential for the induction of protective immunity against Punta Toro Virus infection by the double-stranded RNA (dsRNA), poly(I:C12U), but not Poly(I:C): differential recognition of synthetic dsRNA molecules. J Immunol, 2007. 178(8): p. 5200-8.

121. Ichinohe, T., et al., Intranasal immunization with H5N1 vaccine plus Poly I:Poly C12U, a Toll-like receptor agonist, protects mice against homologous and heterologous virus challenge. Microbes and Infection, 2007. 9(11): p. 1333-1340. 122. Ichinohe, T., et al., Intranasal administration of adjuvant-combined vaccine protects monkeys from challenge with the highly pathogenic influenza A H5N1 virus. J Med Virol, 2010. 82(10): p. 1754-61. 123. Overton, E.T., et al., Intranasal seasonal influenza vaccine and a TLR-3 agonist, rintatolimod, induced cross-reactive IgA antibody formation against avian H5N1 and H7N9 influenza HA in humans. Vaccine, 2014. 32(42): p. 5490-5495. 124. Danhier, F., et al., PLGA-based nanoparticles: an overview of biomedical applications. J Control Release, 2012. 161(2): p. 505-22. 125. Slutter, B., et al., Nasal vaccination with N-trimethyl chitosan and PLGA based nanoparticles: nanoparticle characteristics determine quality and strength of the antibody response in mice against the encapsulated antigen. Vaccine, 2010. 28(38): p. 6282-91. 126. Binjawadagi, B., et al., Adjuvanted poly(lactic-co-glycolic) acid nanoparticle- entrapped inactivated porcine reproductive and respiratory syndrome virus vaccine elicits cross-protective immune response in pigs. Int J Nanomedicine, 2014. 9: p. 679-94. 127. Wang, J.J., et al., Recent advances of chitosan nanoparticles as drug carriers. Int J Nanomedicine, 2011. 6: p. 765-74. 128. Dudhani, A.R. and S.L. Kosaraju, Bioadhesive chitosan nanoparticles: Preparation and characterization. Carbohydrate Polymers, 2010. 81(2): p. 243- 251. 129. Kean, T. and M. Thanou, Biodegradation, biodistribution and toxicity of chitosan. Adv Drug Deliv Rev, 2010. 62(1): p. 3-11. 130. Lu, F., et al., Dendrimer-like alpha-d-glucan nanoparticles activate dendritic cells and are effective vaccine adjuvants. J Control Release, 2015. 204: p. 51-9. 131. Scheffler, S.L., et al., In vitro digestibility and emulsification properties of phytoglycogen octenyl succinate. J Agric Food Chem, 2010. 58(8): p. 5140-6. 132. Huang, L. and Y. Yao, Particulate structure of phytoglycogen nanoparticles probed using amyloglucosidase. Carbohydrate Polymers, 2011. 83(4): p. 1665- 1671. 133. Lu, F., et al., Alpha-D-glucan nanoparticulate adjuvant induces a transient inflammatory response at the injection site and targets antigen to migratory dendritic cells. NPJ Vaccines, 2017. 2: p. 4. 134. Janke, B.H., Clinicopathological features of Swine influenza. Curr Top Microbiol Immunol, 2013. 370: p. 69-83. 135. Vincent, A.L., et al., Swine influenza viruses a North American perspective. Adv Virus Res, 2008. 72: p. 127-54. 136. Van Reeth, K. and W. Ma, Swine influenza virus vaccines: to change or not to change-that's the question. Curr Top Microbiol Immunol, 2013. 370: p. 173-200.

137. Heinen, P.P., et al., Analysis of the quality of protection induced by a porcine influenza A vaccine to challenge with an H3N2 virus. Vet Immunol Immunopathol, 2001. 82(1-2): p. 39-56. 138. Asahi-Ozaki, Y., et al., Intranasal administration of adjuvant-combined recombinant influenza virus HA vaccine protects mice from the lethal H5N1 virus infection. Microbes Infect, 2006. 8(12-13): p. 2706-14. 139. Le Bon, A., et al., Type i interferons potently enhance humoral immunity and can promote isotype switching by stimulating dendritic cells in vivo. Immunity, 2001. 14(4): p. 461-70. 140. Nedumpun, T., P. Ritprajak, and S. Suradhat, Generation of potent porcine monocyte-derived dendritic cells (MoDCs) by modified culture protocol. Veterinary Immunology and Immunopathology, 2016. 182: p. 63-68. 141. Renu, S., et al., Surface engineered polyanhydride-based oral Salmonella subunit nanovaccine for poultry. Int J Nanomedicine, 2018. 13: p. 8195-8215. 142. L.J. Reed, L.M., L.J. REED, H. MUENCH A SIMPLE METHOD OF ESTIMATING FIFTY PER CENT ENDPOINTS. American Journal of Epidemiology, May 1938. 27(3): p. 493–497. 143. Gauger, P.C. and A.L. Vincent, Serum Virus Neutralization Assay for Detection and Quantitation of Serum-Neutralizing Antibodies to Influenza A Virus in Swine, in Animal Influenza Virus, E. Spackman, Editor. 2014, Springer New York: New York, NY. p. 313-324. 144. Renegar, K.B., et al., Role of IgA versus IgG in the control of influenza viral infection in the murine respiratory tract. J Immunol, 2004. 173(3): p. 1978-86. 145. van Riet, E., et al., Mucosal IgA responses in influenza virus infections; thoughts for vaccine design. Vaccine, 2012. 30(40): p. 5893-900. 146. Muramatsu, M., et al., Comparison of antiviral activity between IgA and IgG specific to influenza virus hemagglutinin: increased potential of IgA for heterosubtypic immunity. PLoS One, 2014. 9(1): p. e85582. 147. Moon, J.J., et al., Enhancing humoral responses to a malaria antigen with nanoparticle vaccines that expand Tfh cells and promote germinal center induction. Proc Natl Acad Sci U S A, 2012. 109(4): p. 1080-5. 148. Ichinohe, T., et al., Cross-protection against H5N1 influenza virus infection is afforded by intranasal inoculation with seasonal trivalent inactivated influenza vaccine. J Infect Dis, 2007. 196(9): p. 1313-20. 149. Ichinohe, T., et al., Synthetic double-stranded RNA poly(I:C) combined with mucosal vaccine protects against influenza virus infection. J Virol, 2005. 79(5): p. 2910-9. 150. Liang, J., et al., Comparison of 3 kinds of Toll-like receptor ligands for inactivated avian H5N1 influenza virus intranasal immunization in chicken. Poult Sci, 2013. 92(10): p. 2651-60. 151. De Bruin, T.G., et al., Cytolytic function for pseudorabies virus-stimulated porcine CD4+ CD8dull+ lymphocytes. Viral Immunol, 2000. 13(4): p. 511-20. 152. Olin, M.R., et al., Gammadelta lymphocyte response to porcine reproductive and respiratory syndrome virus. Viral Immunol, 2005. 18(3): p. 490-9. 68