DOCSLIB.ORG

Aves: Galliformes: Phasianidae) Based on the Complete Mitochondrial Genome

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Aves: Galliformes: Phasianidae) Based on the Complete Mitochondrial Genome See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/260607280 Taxonomic Status of Tetraophasis obscurus and Tetraophasis szechenyii (Aves: Galliformes: Phasianidae) Based on the Complete Mitochondrial Genome ARTICLE in ZOOLOGICAL SCIENCE · MARCH 2014 Impact Factor: 0.86 · DOI: 10.2108/zsj.31.160 · Source: PubMed CITATIONS READS 3 48 8 AUTHORS, INCLUDING: Chengzhong Yang Feiyun Tu Chongqing Normal University Institute of Wildlife Conservation http://ww… 15 PUBLICATIONS 28 CITATIONS 22 PUBLICATIONS 45 CITATIONS SEE PROFILE SEE PROFILE Yu Xu Bisong Yue Pingdingshan University Sichuan University 17 PUBLICATIONS 81 CITATIONS 180 PUBLICATIONS 1,193 CITATIONS SEE PROFILE SEE PROFILE All in-text references underlined in blue are linked to publications on ResearchGate, Available from: Yu Xu letting you access and read them immediately. Retrieved on: 24 February 2016 Taxonomic Status of Tetraophasis obscurus and Tetraophasis szechenyii (Aves: Galliformes: Phasianidae) Based on the Complete Mitochondrial Genome Author(s): Feiwei Liu , Lele Ma , Chengzhong Yang , Feiyun Tu , Yu Xu , Jianghong Ran , Bisong Yue and Xiuyue Zhang Source: Zoological Science, 31(3):160-167. 2014. Published By: Zoological Society of Japan DOI: http://dx.doi.org/10.2108/zsj.31.160 URL: http://www.bioone.org/doi/full/10.2108/zsj.31.160 BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, and environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published by nonprofit societies, associations, museums, institutions, and presses. Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of BioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use. Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiries or rights and permissions requests should be directed to the individual publisher as copyright holder. BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to critical research. ZOOLOGICAL SCIENCE 31: 160–167 (2014) ¤ 2014 Zoological Society of Japan Taxonomic Status of Tetraophasis obscurus and Tetraophasis szechenyii (Aves: Galliformes: Phasianidae) Based on the Complete Mitochondrial Genome Feiwei Liu1, Lele Ma1, Chengzhong Yang2, Feiyun Tu1, Yu Xu1, Jianghong Ran3, Bisong Yue3, and Xiuyue Zhang3* 1Sichuan Key Laboratory of Conservation Biology on Endangered Wildlife, College of Life Sciences, Sichuan University, Chengdu 610064, P.R. China 2Chongqing Key Laboratory of Animal Biology, College of Life Sciences, Chongqing Normal University, Chongqing 400047, P.R. China 3Key Laboratory of Bio-Resources and Eco-Environment, Ministry of Education, College of Life Sciences, Sichuan University, Chengdu 610064, P.R. China Tetraophasis szechenyii and T. obscurus are endangered phasianid birds endemic to China. Histor- ically, the question of whether T. obscurus and T. szechenyii are valid species or subspecies has been controversial. In order to clarify their phylogenetic relationship, we sequenced the complete mitochondrial genome of T. obscurus and, using the complete mitochondrial genome of T. szechenyii, which our lab had already sequenced, conducted Bayesian and maximum-likelihood phylogenetic analyses based on the sequences of 12 concatenated heavy-strand encoded protein-coding genes. Genetic distance and divergence time between the two species were also calculated. The complete mitochondrial genome of T. obscurus was 16,707 bases (accession no.: NC_018034), and its struc- ture was similar to mitochondrial genomes reported for other phasianids. The genetic distance between T. obscurus and T. szechenyii was 0.028, and the divergence time of T. obscurus and T. szechenyii was 1.75 Myr. Considering the genetic distance and divergence time, as well as geo- graphical distribution and morphological differences, we suggest that T. obscurus and T. szechenyii are two valid species. The Pleistocene glacial events in the Hengduan Mountains region may have played an important role in the speciation of T. obscurus and T. szechenyii. Key words: Tetraophasis obscurus, Tetraophasis szechenyii, mitochondrial genome, phylogenetic anal- ysis, species identification Phasianidae), also endemic to China, is distributed in Sichuan, INTRODUCTION Qinghai, Yunnan Provinces and Tibet, inhabiting conifer- The chestnut-throated partridge, Tetraophasis obscurus ous forest, alpine meadows, and rhododendron scrub (Lei (Galliformes: Phasianidae), a bird endemic to China, Cate- and Lu, 2006; Meng et al., 2008; Wen et al., 2009; Wen gory I in the List of Chinese State Key Protected Wild Ani- and Liu, 2010). The holotype specimen of this bird was cap- mals, is distributed in Gansu, southeast Tibet, southwestern tured in western Sichuan and was described as another new Sichuan, southern Qinghai, and northwest Yunnan in China species of Tetraophasis by Madarász (1886). The genus (MacKinnon et al., 2000; Lei and Lu, 2006; Meng et al., Tetraophasis then consisted of two species: T. obscurus 2008; Wen et al., 2009; Wen and Liu, 2010). This bird and T. szechenyii. However, it has been controversial mainly inhabits coniferous forests, mixed coniferous and whether T. szechenyii is a valid species or a subspecies of broadleaf forests, and rhododendron scrub at about 4600 T. obscurus (Johnsgard, 1998). Zheng et al. (1965) deter- m.a.s.l. (Lei and Lu, 2006; Wen et al., 2009; Wen and Liu, mined that they were two different subspecies based on 2010). This species was first found in Baoxing, Sichuan morphological features and geographic distributions. Zhao Province, and named Lophophorus obscurus by Verreaux (1995) suggested that T. szechenyii and T. obscurus were (1869). Based on its morphological differences from other two species in his “Manual for the Birds of China,” which species in Lophophorus, Elliot (1872) classified it into the was supported by Lei et al. (2002), Lei and Lu (2006), Zheng genus Tetraophasis, as Tetraophasis obscurus. The buff- (2002a), and Zheng (2002b), but they did not provide new throated partridge, Tetraophasis szechenyii (Galliformes: evidence for the taxonomic relationship of these two bird taxa. There is little molecular data available to support a * Corresponding author. Tel. : +86-28-85412488; phylogenetic relationship of the two taxa, except for a short Fax : +86-28-85414886; DNA sequence (cyt b, 828 bp), which was used to analyze E-mail: [email protected] their evolutionary relationship (Wen et al., 2009; Wen and doi:10.2108/zsj.31.160 Liu, 2010), and their findings supported that T. szechenyii Mitogenome of T. obscurus and Phylogeny 161 and T. obscurus were two different Table 1. Seven primer pairs for PCR amplification of the mtDNA of Tetraophasis obscurus. species. However, short sequence Primer sequence (5’-3’) data may lead to misleading conclu- Primer name sions regarding the resolution of their Forward (F) Reverse (R) taxonomic relationship due to the lim- UP-1* ACCATTATTAACATAAAACCCC TAGCTTAAAAGGCTAGTGCTG ited phylogenetic information provided UP-2* GTAACAAGGTAAGTGTACCGGAAGG GCTAGGGAGAGGATTTGAACCTC (Cummings et al., 1995; Zardoya and UP-3* TTCGAAGCAACCCTAATCCCAAC AGGCCAAATTGAGCGGATTTTCC Meyer, 1996; Saitoh et al., 2000). ZC-47 ATCATCGGTCAAATAGCATCC AGTGGGTTCTTGATGGTGGT Mitochondrial DNA is a useful molec- ZC-84 CACCTGAGAAATCCAACAAGC TGTTTCTGGTGGCAGGTTG ular marker due to its maternal inher- ZC-5 GCCAAAAGCCTCACACACAT GGGTGACCGAAGAATCAGAAT itance (Hassanin et al., 2005), rela- ZC-6 CGACCAGGAGTATTTTACGGAC GCACTGAGTCGTTCGGGTT tively small, easy amplification and * Universal primers for bird moderate evolutionary rate (Boore et al., 1999). Therefore, mitochondrial DNA has been widely Table 2. List of species and GenBank sequence accession num- used in molecular genetics and phylogenetic relationship bers used for phylogenetic analysis. research (Armstrong et al., 2001; Huang et al., 2009; Bao et Species GenBank No. al., 2010). In the present study, we sequenced the complete mitochondrial genome of T. obscurus to allow a detailed Alectoris chukar FJ752426 comparison with the complete mitochondrial genome of T. Alectura lathami* NC_007227 szechenyii, which our lab had already sequenced. Based on Anas platyrhynchos* NC_009684 the complete mitochondrial DNA sequence of the two spe- Arborophila rufipectus NC_012453 cies of Tetraophasis, along with the complete mitochondrial Bambusicola fytchii FJ752423 sequences of 32 other species in Phasianidae, we recon- Bambusicola thoracica NC_011816 structed their phylogenetic relationships. We hoped that the Bonasa bonasia FJ752435.1 knowledge of the mitochondrial genome sequence of T. Chrysolophus amherstiae FJ752434 obscurus could contribute to the clarification of the species Chrysolophus pictus FJ752433 status of T. obscurus and T. szechenyii, as well as their rela- Coturnix chinensis NC_004575 tionships to other genera, such as Lophophorus. Coturnix japonica NC_003408 Francolinus pintadeanus NC_011817 MATERIALS AND METHODS Gallus gallus NC_001323 Sample and DNA extraction Gallus lafayettei NC_007239 The muscle sample of a male T. obscurus was obtained from Gallus sonneratii NC_007240 the Chengdu Bird Conservation Center. Total DNA was extracted Gallus varius NC_007238 following the
Load more

Recommended publications
  • 1471-2148-10-132.Pdf
    Shen et al. BMC Evolutionary Biology 2010, 10:132 http://www.biomedcentral.com/1471-2148/10/132 RESEARCH ARTICLE Open Access AResearch mitogenomic article perspective on the ancient, rapid radiation in the Galliformes with an emphasis on the Phasianidae Yong-Yi Shen1,2,3, Lu Liang1,2,3, Yan-Bo Sun1,2,3, Bi-Song Yue4, Xiao-Jun Yang1, Robert W Murphy1,5 and Ya- Ping Zhang*1,2 Abstract Background: The Galliformes is a well-known and widely distributed Order in Aves. The phylogenetic relationships of galliform birds, especially the turkeys, grouse, chickens, quails, and pheasants, have been studied intensively, likely because of their close association with humans. Despite extensive studies, convergent morphological evolution and rapid radiation have resulted in conflicting hypotheses of phylogenetic relationships. Many internal nodes have remained ambiguous. Results: We analyzed the complete mitochondrial (mt) genomes from 34 galliform species, including 14 new mt genomes and 20 published mt genomes, and obtained a single, robust tree. Most of the internal branches were relatively short and the terminal branches long suggesting an ancient, rapid radiation. The Megapodiidae formed the sister group to all other galliforms, followed in sequence by the Cracidae, Odontophoridae and Numididae. The remaining clade included the Phasianidae, Tetraonidae and Meleagrididae. The genus Arborophila was the sister group of the remaining taxa followed by Polyplectron. This was followed by two major clades: ((((Gallus, Bambusicola) Francolinus) (Coturnix, Alectoris)) Pavo) and (((((((Chrysolophus, Phasianus) Lophura) Syrmaticus) Perdix) Pucrasia) (Meleagris, Bonasa)) ((Lophophorus, Tetraophasis) Tragopan))). Conclusions: The traditional hypothesis of monophyletic lineages of pheasants, partridges, peafowls and tragopans was not supported in this study.
    [Show full text]
  • 2011, Article ID 423938, 16 Pages Doi:10.4061/2011/423938
    SAGE-Hindawi Access to Research International Journal of Evolutionary Biology Volume 2011, Article ID 423938, 16 pages doi:10.4061/2011/423938 Research Article A Macroevolutionary Perspective on Multiple Sexual Traits in the Phasianidae (Galliformes) Rebecca T. Kimball, Colette M. St. Mary, and Edward L. Braun Department of Biology, University of Florida, P.O. Box 118525, Gainesville, FL 32611, USA Correspondence should be addressed to Rebecca T. Kimball, [email protected]fl.edu Received 2 October 2010; Accepted 26 February 2011 Academic Editor: Rob Kulathinal Copyright © 2011 Rebecca T. Kimball et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Traits involved in sexual signaling are ubiquitous among animals. Although a single trait appears sufficient to convey information, many sexually dimorphic species exhibit multiple sexual signals, which may be costly to signalers and receivers. Given that one signal may be enough, there are many microevolutionary hypotheses to explain the evolution of multiple signals. Here we extend these hypotheses to a macroevolutionary scale and compare those predictions to the patterns of gains and losses of sexual dimorphism in pheasants and partridges. Among nine dimorphic characters, including six intersexual signals and three indicators of competitive ability, all exhibited both gains and losses of dimorphism within the group. Although theories of intersexual selection emphasize gain and elaboration, those six characters exhibited greater rates of loss than gain; in contrast, the competitive traits showed a slight bias towards gains. The available models, when examined in a macroevolutionary framework, did not yield unique predictions, making it difficult to distinguish among them.
    [Show full text]
  • SICHUAN (Including Northern Yunnan)
    Temminck’s Tragopan (all photos by Dave Farrow unless indicated otherwise) SICHUAN (Including Northern Yunnan) 16/19 MAY – 7 JUNE 2018 LEADER: DAVE FARROW The Birdquest tour to Sichuan this year was a great success, with a slightly altered itinerary to usual due to the closure of Jiuzhaigou, and we enjoyed a very smooth and enjoyable trip around the spectacular and endemic-rich mountain and plateau landscapes of this striking province. Gamebirds featured strongly with 14 species seen, the highlights of them including a male Temminck’s Tragopan grazing in the gloom, Chinese Monal trotting across high pastures, White Eared and Blue Eared Pheasants, Lady Amherst’s and Golden Pheasants, Chinese Grouse and Tibetan Partridge. Next were the Parrotbills, with Three-toed, Great and Golden, Grey-hooded and Fulvous charming us, Laughingthrushes included Red-winged, Buffy, Barred, Snowy-cheeked and Plain, we saw more Leaf Warblers than we knew what to do with, and marvelled at the gorgeous colours of Sharpe’s, Pink-rumped, Vinaceous, Three-banded and Red-fronted Rosefinches, the exciting Przevalski’s Finch, the red pulse of Firethroats plus the unreal blue of Grandala. Our bird of the trip? Well, there was that Red Panda that we watched for ages! 1 BirdQuest Tour Report: Sichuan Including Northern Yunnan 2018 www.birdquest-tours.com Our tour began with a short extension in Yunnan, based in Lijiang city, with the purpose of finding some of the local specialities including the rare White-speckled Laughingthrush, which survives here in small numbers. Once our small group had arrived in the bustling city of Lijiang we began our birding in an area of hills that had clearly been totally cleared of forest in the fairly recent past, with a few trees standing above the hillsides of scrub.
    [Show full text]
  • A High-Quality Assembly Reveals Genomic Characteristics, 1
    A High-Quality Assembly Reveals Genomic Characteristics, 1 Phylogenetic Status and Causal Genes for White Feather of 2 Indian Peafowl shaojuan Liu South China Agricultural University College of Animal Science hao Chen Jiangxi Science and Technology Normal University School of Life Science jing Ouyang Jiangxi Science and Technology Normal University School of Life Science min Huang South China Agricultural University College of Animal Science hui Zhang South China Agricultural University College of Animal Science sumei Zheng South China Agricultural University College of Animal Science suwang Xi Jiangxi Agricultural University College of Animal Science and Technology hongbo Tang Jiangxi Science and Technology Normal University School of Life Science yuren Gao Jiangxi Science and Technology Normal University School of Life Science yanpeng Xiong Jiangxi Science and Technology Normal University School of Life Science di Cheng Jiangxi Agricultural University College of Animal Science and Technology kaifeng Chen Jiangxi Agricultural University College of Animal Science and Technology bingbing Liu South China Agricultural University College of Animal Science wanbo Li Jimei University xueming Yan Jiangxi Science and Technology Normal University School of Life Science huirong Mao ( [email protected] ) Jiangxi Agricultural University https://orcid.org/0000-0003-2588-1521 jun Ren South China Agricultural University College of Animal Science Research Keywords: Indian peafowl, Genome assembly, Phylogeny, PMEL, White feather Posted Date: July
    [Show full text]
  • Early Holocene Chicken Domestication in Northern China
    Early Holocene chicken domestication in northern China Hai Xianga, Jianqiang Gaob, Baoquan Yuc, Hui Zhoud, Dawei Caid, Youwen Zhanga, Xiaoyong Chena, Xi Wanga, Michael Hofreitere,1, and Xingbo Zhaoa,1 aNational Engineering Laboratory for Animal Breeding, Ministry of Agricultural Key Laboratory of Animal Genetics, Breeding, and Reproduction, College of Animal Science and Technology, China Agricultural University, Beijing 100193, China; bHebei Provincial Institute of Cultural Relic, Shijiazhuang 050031, China; cXushui County Office for Preservation of Ancient Monuments, Xushui 072550, China; dAncient DNA Laboratory, Research Center for Chinese Frontier Archaeology, College of Life Science, Jilin University, Changchun 130023, China; eFaculty of Mathematics and Natural Sciences, Institute for Biochemistry and Biology, University of Potsdam, 14476 Potsdam, Germany; and Department of Biology, University of York, Heslington, York YO10 5DD, United Kingdom Edited by Elizabeth Matisoo-Smith, Otago School of Medical Sciences, Dunedin, New Zealand, and accepted by the Editorial Board October 23, 2014 (received for review June 24, 2014) Chickens represent by far the most important poultry species, yet of chicken domestication in particular regions over the world the number, locations, and timings of their domestication have have also been worked out using ancient DNA analysis (14–17). remained controversial for more than a century. Here we report However, the oldest chicken sequences analyzed to date are only ancient mitochondrial DNA sequences from the earliest archaeo- around 4,000 y old, substantially postdating the beginning of logical chicken bones from China, dating back to ∼10,000 B.P. The chicken domestication. results clearly show that all investigated bones, including the old- Therefore, we chose 39 ancient chicken bones from three est from the Nanzhuangtou site, are derived from the genus Gal- archaeological sites in the area of the Yellow River (Cishan, lus, rather than any other related genus, such as Phasianus.
    [Show full text]
  • Habitat Preference of the Sole Wild Population of Francolinus Bicalcaratus Ayesha in the Palearctic: Implications for Conservation and Management
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by I-Revues Revue d’Ecologie (Terre et Vie), Vol. 71 (3), 2016 : 288-297 HABITAT PREFERENCE OF THE SOLE WILD POPULATION OF FRANCOLINUS BICALCARATUS AYESHA IN THE PALEARCTIC: IMPLICATIONS FOR CONSERVATION AND MANAGEMENT 1* 2 1 3 Saâd HANANE , Nabil ALAHYANE , Najib MAGRI , Mohamed-Aziz EL AGBANI 3 & Abdeljebbar QNINBA 1 Forest Research Center, High Commission for Water, Forests and Desertification Control, Avenue Omar Ibn El Khattab, BP 763, 10050, Rabat-Agdal, Morocco. 2 Faculté des Sciences de Rabat, 4 Avenue Ibn Battouta, BP 1014 RP, 10090, Agdal-Rabat, Morocco. 3 Université Mohammed V-Agdal, Institut Scientifique de Rabat, Avenue Ibn Battouta, BP 703, 10090, Agdal-Rabat, Morocco. * Corresponding author. E-mail : [email protected] ; phone: +212 660 125799 ; Fax: +212 537 671151 RÉSUMÉ.— Préférence d’habitat de la seule population sauvage de Francolinus bicalcaratus ayesha dans le Paléarctique : implications pour sa conservation et sa gestion.— Le Francolin à double éperon (Francolinus bicalcaratum ayesha) est un oiseau en danger critique d’extinction et endémique du Maroc, où il habite les forêts de chêne-liège. Ses populations ont été réduites principalement en raison de la chasse et de la destruction des habitats. La caractérisation de l’habitat utilisé par ces oiseaux indigènes peut optimiser les programmes futurs de réintroduction. La méthode de détection auditive a été utilisée sur des transects pour localiser les mâles chanteurs. Nous avons analysé les facteurs qui déterminent la présence du Francolin à double éperon dans le Nord-Ouest du Maroc en considérant 13 variables explicatives.
    [Show full text]
  • The Occurrence of Hazel Grouse in the Boreal Forest
    Acta Universitatis Agriculturae Sueciae SlLVESTRlA 1 5 8 vltR ,C f JLto « SLU The Occurrence of Hazel Grouse in the Boreal Forest Effects of habitat composition at several spatial scales Johan Åberg S w ed ish university of Agricultural Sc ie n c e s \SLU </M , ^ *S U The occurrence of hazel grouse in the boreal forest: effects of habitat composition at several spatial scales Johan Åberg Akademisk avhandling som for vinnande av filosofie doktorsexamen kommer att offentligen försvaras i Sal FU 26, Undervisningshuset, SLU, Uppsala, fredagen den 3 november 2000, kl. 10.00. Abstract This thesis presents data on factors determining the occurrence and dynamics of hazel grouse populations at several spatial scales in five landscapes with different management regimes. In a forested area with a low degree of habitat variation the relationship between occurrence of hazel grouse and type of habitat was best explained at scales equal or larger than the home range, compared to smaller spatial scales. At this spatial scale the hazel grouse preferred spruce stands 20-69 years old and those older than 90 years, having 5-40% deciduous trees. More specifically the presence of hazel grouse in a habitat patch was positively influenced by a high amcunt of vertical ground cover, rich field layer vegetation and the presence of alder. At the landscape scale the occurrence of hazel grouse in habitat patches in intensively managed landscapes was negatively affected by increasing distance between suitable habitats both in an agriculture-dominated landscape and in a forest-dominated landscape. The threshold distances for hazel grouse movements were about 200 m in the agricultural landscape and about 10 times longer in the forested landscape, suggesting a strong effect of different types of matrix.
    [Show full text]
  • Phylogeography of Regional Fauna on the Tibetan Plateau: a Review
    Available online at www.sciencedirect.com Progress in Natural Science 19 (2009) 789–799 www.elsevier.com/locate/pnsc Review Phylogeography of regional fauna on the Tibetan Plateau: A review Shujuan Yang a,*, Hailiang Dong b,c, Fumin Lei d a State Key Laboratory of Geological Processes and Mineral Resources, China University of Geosciences, Beijing 100083, China b Geomicrobiology Laboratory, China University of Geosciences, Beijing 100083, China c Department of Geology, Miami University, Oxford, OH 45056, USA d Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China Received 4 July 2008; received in revised form 24 September 2008; accepted 10 October 2008 Abstract The studies of uplift and glaciations of the Tibetan Plateau are summarized, and a series of recent case studies of the endemic species based on DNA sequences are detailed. In general, these molecular data show that all the organisms originated from Early Pliocene to Late Miocene, and then multi-stages of divergence/speciation occurred within each taxa following their original occupation on the pla- teau, mainly as a result of periodic glacial cycles and geographic isolation. The regional fauna may have undergone several range con- tractions and expansions during the Pleistocene glaciations. However, the population expansion and refugia may vary in space, time, and extent. The regional fauna of the Tibetan Plateau may be combinations of ancient movement from adjacent zoogeographical regions, speciation in situ, and postglacial colonization from adjacent areas. Geomorphic and climatic changes on the plateau definitely have a remarkable influence on the regional and adjacent biogeographic patterns, and the mechanism is very complex.
    [Show full text]
  • Mountains of Asia a Regional Inventory
    International Centre for Integrated Asia Pacific Mountain Mountain Development Network Mountains of Asia A Regional Inventory Harka Gurung Copyright © 1999 International Centre for Integrated Mountain Development All rights reserved ISBN: 92 9115 936 0 Published by International Centre for Integrated Mountain Development GPO Box 3226 Kathmandu, Nepal Photo Credits Snow in Kabul - Madhukar Rana (top) Transport by mule, Solukhumbu, Nepal - Hilary Lucas (right) Taoist monastry, Sichuan, China - Author (bottom) Banaue terraces, The Philippines - Author (left) The Everest panorama - Hilary Lucas (across cover) All map legends are as per Figure 1 and as below. Mountain Range Mountain Peak River Lake Layout by Sushil Man Joshi Typesetting at ICIMOD Publications' Unit The views and interpretations in this paper are those of the author(s). They are not attributable to the International Centre for Integrated Mountain Development (ICIMOD) and do not imply the expression of any opinion concerning the legal status of any country, territory, city or area of its authorities, or concerning the delimitation of its frontiers or boundaries. Preface ountains have impressed and fascinated men by their majesty and mystery. They also constitute the frontier of human occupancy as the home of ethnic minorities. Of all the Mcontinents, it is Asia that has a profusion of stupendous mountain ranges – including their hill extensions. It would be an immense task to grasp and synthesise such a vast physiographic personality. Thus, what this monograph has attempted to produce is a mere prolegomena towards providing an overview of the regional setting along with physical, cultural, and economic aspects. The text is supplemented with regional maps and photographs produced by the author, and with additional photographs contributed by different individuals working in these regions.
    [Show full text]
  • Species Interactions Slow Warming-Induced Upward Shifts of Treelines on the Tibetan Plateau
    Species interactions slow warming-induced upward shifts of treelines on the Tibetan Plateau Eryuan Lianga,b,c,1, Yafeng Wanga, Shilong Piaoa,c, Xiaoming Lua, Jesús Julio Camarerod, Haifeng Zhua, Liping Zhub,c, Aaron M. Ellisone, Philippe Ciaisf, and Josep Peñuelasg,h aKey Laboratory of Alpine Ecology and Biodiversity, Institute of Tibetan Plateau Research, Chinese Academy of Sciences, Beijing 100101, China; bKey Laboratory of Tibetan Environment Changes and Land Surface Processes, Institute of Tibetan Plateau Research, Chinese Academy of Sciences, Beijing 100101, China; cCAS Center for Excellence in Tibetan Plateau Earth Sciences, Beijing 100101, China; dInstituto Pirenaico de Ecología, Consejo Superior de Investigaciones Científicas (IPE-CSIC), 50059 Zaragoza, Spain; eHarvard Forest, Petersham, MA 01366; fLaboratoire des Sciences du Climat et de l’Environnement, Commissariat a l’Energie Atomique CNRS, l’Université de Versailles Saint-Quentin, 91191 Gif sur Yvette, France; gCSIC, Global Ecology Unit Centre de Recerca Ecològica i Aplicacions Forestals (CREAF)-CSIC-UAB, Cerdanyola del Vallès, E-08193 Catalonia, Spain; and hCREAF, Cerdanyola del Vallès, E-08193 Catalonia, Spain Edited by Christopher B. Field, Carnegie Institution of Washington, Stanford, CA, and approved March 3, 2016 (received for review October 19, 2015) The alpine treeline is commonly regarded as being sensitive to conditions also limit upward shifts in alpine treelines (17–19). climatic warming because regeneration and growth of trees at Species competition often is an important force driving stand dy- treeline generally are limited by low temperature. The alpine tree- namics and suppression (e.g., refs. 20–23). Theoretically, altered lines of the Tibetan Plateau (TP) occur at the highest elevations disturbance regimes and interactions between trees and shrubs or (4,900 m above sea level) in the Northern Hemisphere.
    [Show full text]
  • Intergeneric Galliform Hybrids: a Review
    INTERGENERIC GALLIFORM HYBRIDS : A REVIEW BY TONY J. PETERLE Henry Seebohm, in “The Birds of Siberia” (1901: Sol-502), makes this cogent observa- tion: “The subject of the interbreeding of nearly-allied birds in certain localities where their geographical ranges meet or overlap, and the almost identical subject of the existence of intermediate forms in the intervening district between the respective geographical ranges of nearly-allied birds, is one which has not yet received the attention which it deserves from ornithologists. The older brethren of the fraternity have always pooh-pooh’d any attempt to explain some of these complicated facts of nature by the theory of interbreeding, and have looked upon the suggestion that hybridisation was anything but an abnormal circumstance as one of the lamest modes of getting out of an ornithological difficulty.” The following sum- mary will show that interbreeding of galliform genera has often been observed: indeed that two wholly different intergeneric hybrids, one of the Old World, one of the New, have been recovered so often that they can hardly be considered ‘abnormal’ except in a very limited sense. The Old World hybrid referred to results from the crossing of the Blackcock (Lyvurus) and Capercaillie (Tetrao). DeWinton (1894: 448) said that “of all hybrids among birds in a wild state this one seems to be the most frequent.” Authors seem to be in agreement that the hybrid results principally, if not always, from the interbreeding of male Lyrurus with fe- male Tetreo in areas throughout which (a) extension of range is taking place, or (b) one or the other genus is rare, e.g., Scotland, where Tetrao has been introduced following extirpation (Millais, 1906: 55-56; DeWinton, 1894).
    [Show full text]
  • And a Host List of These Parasites
    Onderstepoort Journal of Veterinary Research, 74:315–337 (2007) A check list of the helminths of guineafowls (Numididae) and a host list of these parasites K. JUNKER and J. BOOMKER* Department of Veterinary Tropical Diseases, Faculty of Veterinary Science, University of Pretoria Private Bag X04, Onderstepoort, 0110 South Africa ABSTRACT JUNKER, K. & BOOMKER, J. 2007. A check list of the helminths of guineafowls (Numididae) and a host list of these parasites. Onderstepoort Journal of Veterinary Research, 74:315–337 Published and personal records have been compiled into a reference list of the helminth parasites of guineafowls. Where data on other avian hosts was available these have been included for complete- ness’ sake and to give an indication of host range. The parasite list for the Helmeted guineafowls, Numida meleagris, includes five species of acanthocephalans, all belonging to a single genus, three trematodes belonging to three different genera, 34 cestodes representing 15 genera, and 35 nema- todes belonging to 17 genera. The list for the Crested guineafowls, Guttera edouardi, contains a sin- gle acanthocephalan together with 10 cestode species belonging to seven genera, and three nema- tode species belonging to three different genera. Records for two cestode species from genera and two nematode species belonging to a single genus have been found for the guineafowl genus Acryllium. Of the 70 helminths listed for N. meleagris, 29 have been recorded from domestic chick- ens. Keywords: Acanthocephalans, cestodes, check list, guineafowls, host list, nematodes, trematodes INTRODUCTION into the southern Mediterranean region several mil- lennia before turkeys and hundreds of years before Guineafowls (Numididae) originated on the African junglefowls from which today’s domestic chickens continent, and with the exception of an isolated pop- were derived.
    [Show full text]