Cycling at the Interface Between Neurodevelopment and Neurodegeneration

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Cell Death and Differentiation (2002) 9, 1294 ± 1306 ã 2002 Nature Publishing Group All rights reserved 1350-9047/02 $25.00 www.nature.com/cdd Review Cycling at the interface between neurodevelopment and neurodegeneration 1,3 2 ,1 MD Nguyen , WE Mushynski and J-P Julien* Introduction 1 Centre for Research in Neurosciences, Research Institute of the McGill Members of the Cyclin-dependent protein kinase (Cdk) family University Health Centre, Montreal General Hospital, 1650 Cedar Avenue, are small, serine/threonine kinases (30 ± 35 kDa), whose nine MontreÂal, QueÂbec, H3G 1A4, Canada members share greater than 40% identity. With the exception 2 Department of Biochemistry, McGill University, McIntyre Medical Sciences of Cdk3 and Cdk5, they are activated by a cyclin regulatory Building, 3655 Promenade Sir William Osler, MontreÂal, QueÂbec, H3G 1Y6, subunit1±3 (see Figure 2A). The Cdks are numbered in order Canada 3 Current address: Harvard Medical School, Department of Pathology, of their discovery, starting with Cdk1 (p34cdc2) and extending 200 Longwood Avenue, Boston, MA 02115 at present to Cdk9. The `Cdk' designation does not imply that * Corresponding author: J-P Julien. Tel: 934-1934 ext 44203; Fax: 514-934- the biological functions of Cdks are limited to mitosis. The 8265; E-mail: [email protected]. For correspondence use the Fedex no: classical Cdks, excepting Cdk5 and Cdk9, are also involved in 1316-8394-4. regulating cellular processes such as differentiation, senes- cence, and apoptosis through modification of gene transcrip- tion.2 In proliferating cells, misregulation of Cdks is associated Received 17.5.02; revised 23.7.02; accepted 23.7.02 with tumor formation, whereas their disappearance/inhibition Edited by G Melino in neuronal precursors coincides with terminal differentiation.4 Cdk5 is a unique member of the Cdk family. Although its Abstract cloning was based on sequence homology to the cell cycle kinase, Cdk1, Cdk5 does not play a critical role in cell cycle The discovery of cell cycle regulators has directed cell progression.1 It is not activated by a cyclin, although it can research into uncharted territory. In dividing cells, cell cycle- bind one such protein.5 The association of Cdk5 with one of associated protein kinases, which are referred to as cyclin- its neuron-specific co-activators, p35 or p39, is required in dependent-kinases (Cdks), regulate proliferation, differentia- processes such as neurite outgrowth, axonal migration, tion, senescence and apoptosis. In contrast, all Cdks in post- cortical lamination, control of cell adhesion, axonal transport, mitotic neurons, with the notable exception of Cdk5, are synaptic activity, neuronal adaptive changes and motor 1 silenced. Surprisingly, misregulation of Cdks occurs in functions. The prominent role of Cdk5 in the CNS stems from its unique co-activators and the broad spectrum of neurons in a wide diversity of neurological disorders, Cdk5-interacting molecules and substrates demonstrated by including Alzheimer's disease, Parkinson's disease and genetic studies in the mouse and fruitfly. Emerging evidence amyotrophic lateral sclerosis. Ectopic expression of these also points to a leading role for Cdk5 as well as other Cdks in proteins in neurons potently induces cell death with hallmarks neuronal apoptosis and degeneration. of apoptosis. Deregulation of the unique, cell cycle-unrelated This review will focus on the basic mechanisms Cdk5 by its truncated co-activator, p25 and p29, contributes to regulating the divergent roles of Cdks in the CNS and their neurodegeneration by altering the phosphorylation state of common involvement in neuronal apoptosis and neurode- non-membrane-associated proteins and possibly through the generation. induction of cell cycle proteins. On the other hand, cycling Cdks such as Cdk2, Cdk4 and Cdk6, initiate death pathways by Divergent regulation of Cdk5 and cell cycle derepressing E2F-1/Rb-dependent transcription at the neuro- Cdk activities nal G1/S checkpoint. Thus, Cdk5 and cycling Cdks may have Cdk activity is regulated by three distinct overlapping little in common in the healthy CNS, but they likely conspire in mechanisms, the critical step being their association with a leading neurons to their demise. co-activator. Phosphorylation/dephosphorylation events Cell Death and Differentiation (2002) 9, 1294 ± 1306. doi:10.1038/ prime Cdks for activation by regulatory subunits while a sj.cdd.4401108 family of Cdk-inhibitory subunits (CKIs) bind to and inactivate the Cdk-cyclin complex.1,6 Thus, formation of a Cdk1/cyclin B Keywords: cyclin-dependent-kinases; neurodevelopment; neuro- complex late in S-phase triggers phosphorylation of Cdk1 on degeneration; alzheimer; amyotrophic lateral sclerosis; cell cycle; Thr 14 and Tyr 15 by the dual-specificity kinases, Wee 1 and cytoskeleton Myt1, thereby inhibiting its activity.1,7 ± 9 In contrast, phosphor- ylation of Thr 161 in the T-loop of Cdk1 by the Cdk-activated Abbreviations: Cdks, cyclin-dependent-kinases; CKIs, CDK- kinase, CAK (CDK7-cyclin H) dramatically increases kinase Inhibitory subunits; AD, Alzheimer's disease activity.1,9 These three sites are phosphorylated throughout the G2-phase. Dephosphorylation of Thr 14 and Tyr 15 by the Cdks in the CNS MD Nguyen et al 1295 dual-specificity phosphatase, Cdc25, results in the activation lysine, histidine or arginine residue, respectively.1,15 Cdk5 of Cdk1/cyclin B coinciding with the onset of mitosis.10,11 shows a marked preference for a basic residue at position Finally, additional regulation by Cdk-inhibitory subunits (CKIs) +3.18 The human neurofilament heavy chain (NF-H), a major such as p21 and p27 (in the case of Cdk2) inhibit activation of cytoskeletal protein found in mature nerve cells, contains 35 the Cdk/cyclin complex.6 KSPXK repeats and is therefore a much better Cdk5 substrate The regulation of Cdk5 differs markedly from that of the than the mouse or rat homologs which contain one-third as cell cycle Cdks, despite its high level of sequence homology many such motifs.19 The only Cdk family members showing with the other family members. Thus, the Thr14 and Tyr15 phosphorylation sequence motif specificity identical to that sites in Cdk5 are not phosphorylated by Wee1 in vitro,andc- exhibited by Cdk5 are Cdk1, Cdk2. Others members of the Abl catalyzes the stimulatory phosphorylation of Tyr15 in family preferentially phosphorylate the KSPXX motif. Cdk5.12 Surprisingly, phosphorylation of Thr14 in Cdk5, Specificity in substrates recognition for mitotic Cdks is Cdk1 and Cdk2 by a kinase from calf thymus gland dictated by their association with cyclins subunits and by inactivates the three enzymes.13 The Ser159 residue in the cyclin-binding motif ZRXL and the LXCXE motif.6,20 Cdk5 occupies a position equivalent to the Thr161 and While the ZRXL motif is found in cell cycle-associated Thr160 phosphorylation sites in the conserved T-loop of proteins such as Cip/Kip CKI family, E2F-1 and pRb-related Cdk1 and Cdk2, respectively, and in vitro studies have proteins p107, p130, the LXCXE motif is part of the cyclin suggested that Cdk5 undergoes stimulatory phosphorylation protein.6,20 ± 22 This motif is also found in pRb-associated at this site by an unknown kinase, possibly casein kinase proteins such as transcription factors and is likely to serve I.6,14 However, structural analysis of a complex between a targeting function. Therefore, substrates for mitotic Cdks Cdk5 and p25, a truncated version of the p35 co-activator of are mainly cell cycle and transcription-related proteins. Cdk5, indicated that phosphorylation of Ser159 would Conversely, Cdk5 specificity for substrate recognition is disrupt the association of Cdk5 with its co-activator.15 In dictated by p35, p39 and by truncated forms of these co- addition to its distinct phosphorylation-dependent regulation, activators (see below). Cdk5 is not regulated by CKI because of its association with p35.16 However, a p35-binding protein that specifically inhibits the activation of Cdk5 has recently been reported.17 Cell cycle Cdks in the CNS and neurodegeneration Phosphorylation sequence motif The levels of Cdks, cyclins and CKI in dividing cells are tightly controlled to allow smooth progression through the cell cycle. speci®city of Cdks Conversely, the expression of cell cycle Cdks in the adult CNS Cdk5 is a proline-directed kinase which preferentially is negligible since they do not play a significant role in mature phosphorylates the consensus sequence (S/T)PX(K/H/R), neurons. As neurons differentiate, Cdk1 and Cdk2 are where S/T is a serine or threonine residue, P is the proline downregulated while Cdk5, p35 and p39 expression be- residue at position +1, X is any amino acid and K, H or R is a gins4,23,24 (see Figure 1). Some studies report the presence of Figure 1 Activity of cycling Cdks and Cdk5 during neurodevelopment and neurodegeneration. There is an inverse relation between the activity and expression of cycling Cdks, such as p34cdc2 (Cdk1), and Cdk5 during neurodevelopment. The activity and expression of p34cdc2 decreases progressively as those of Cdk5 increase. At the adult stage, Cdk5 is the main Cdk to be found active in the CNS through association with its neuron-specific co-activators p35 and p39. Aging, stress and genetic factors induce the progressive cleavage of p35 into p25, resulting in an increased Cdk5 activity. In parallel, activity and expression of cycling Cdks also increase progressively. The conversion of p35 into p25 results in loss of the p35/Cdk5
Recommended publications
  • Cyclin-Dependent Kinase 5 Decreases in Gastric Cancer and Its

    Cyclin-Dependent Kinase 5 Decreases in Gastric Cancer and Its

    Published OnlineFirst January 21, 2015; DOI: 10.1158/1078-0432.CCR-14-1950 Biology of Human Tumors Clinical Cancer Research Cyclin-Dependent Kinase 5 Decreases in Gastric Cancer and Its Nuclear Accumulation Suppresses Gastric Tumorigenesis Longlong Cao1,2, Jiechao Zhou2, Junrong Zhang1,2, Sijin Wu3, Xintao Yang1,2, Xin Zhao2, Huifang Li2, Ming Luo1, Qian Yu1, Guangtan Lin1, Huizhong Lin1, Jianwei Xie1, Ping Li1, Xiaoqing Hu3, Chaohui Zheng1, Guojun Bu2, Yun-wu Zhang2,4, Huaxi Xu2,4,5, Yongliang Yang3, Changming Huang1, and Jie Zhang2,4 Abstract Purpose: As a cyclin-independent atypical CDK, the role of correlated with the severity of gastric cancer based on tumor CDK5 in regulating cell proliferation in gastric cancer remains and lymph node metastasis and patient 5-year fatality rate. unknown. Nuclear localization of CDK5 was found to be significantly Experimental Design: Expression of CDK5 in gastric tumor decreased in tumor tissues and gastric cancer cell lines, and paired adjacent noncancerous tissues from 437 patients was whereas exogenously expression of nucleus-targeted CDK5 measured by Western blotting, immunohistochemistry, and real- inhibited the proliferation and xenograft implantation of time PCR. The subcellular translocation of CDK5 was monitored gastric cancer cells. Treatment with the small molecule during gastric cancer cell proliferation. The role of nuclear CDK5 NS-0011, which increases CDK5 accumulation in the nucleus, in gastric cancer tumorigenic proliferation and ex vivo xenografts suppressed both cancer cell proliferation and xenograft was explored. Furthermore, by screening for compounds in the tumorigenesis. PubChem database that disrupt CDK5 association with its nu- Conclusions: Our results suggest that low CDK5 expression is clear export facilitator, we identified a small molecular (NS-0011) associated with poor overall survival in patients with gastric that inhibits gastric cancer cell growth.
  • The Cryoelectron Microscopy Structure of the Human CDK-Activating Kinase

    The Cryoelectron Microscopy Structure of the Human CDK-Activating Kinase

    The cryoelectron microscopy structure of the human CDK-activating kinase Basil J. Grebera,b,1,2, Juan M. Perez-Bertoldic, Kif Limd, Anthony T. Iavaronee, Daniel B. Tosoa, and Eva Nogalesa,b,d,f,2 aCalifornia Institute for Quantitative Biosciences (QB3), University of California, Berkeley, CA 94720; bMolecular Biophysics and Integrative Bio-Imaging Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720; cBiophysics Graduate Group, University of California, Berkeley, CA 94720; dDepartment of Molecular and Cell Biology, University of California, Berkeley, CA 94720; eQB3/Chemistry Mass Spectrometry Facility, University of California, Berkeley, CA 94720; and fHoward Hughes Medical Institute, University of California, Berkeley, CA 94720 Edited by Seth A. Darst, Rockefeller University, New York, NY, and approved August 4, 2020 (received for review May 14, 2020) The human CDK-activating kinase (CAK), a complex composed of phosphoryl transfer (11). However, in addition to cyclin binding, cyclin-dependent kinase (CDK) 7, cyclin H, and MAT1, is a critical full activation of cell cycle CDKs requires phosphorylation of the regulator of transcription initiation and the cell cycle. It acts by T-loop (9, 12). In animal cells, these activating phosphorylations phosphorylating the C-terminal heptapeptide repeat domain of are carried out by CDK7 (13, 14), itself a cyclin-dependent ki- the RNA polymerase II (Pol II) subunit RPB1, which is an important nase whose activity depends on cyclin H (14). regulatory event in transcription initiation by Pol II, and it phos- In human and other metazoan cells, regulation of transcription phorylates the regulatory T-loop of CDKs that control cell cycle initiation by phosphorylation of the Pol II-CTD and phosphor- progression.
  • Calmodulin-Dependent Protein Kinase II–Protein Phosphatase 1 Switch Facilitates Specificity in Postsynaptic Calcium Signaling

    Calmodulin-Dependent Protein Kinase II–Protein Phosphatase 1 Switch Facilitates Specificity in Postsynaptic Calcium Signaling

    An ultrasensitive Ca2؉͞calmodulin-dependent protein kinase II–protein phosphatase 1 switch facilitates specificity in postsynaptic calcium signaling J. Michael Bradshaw*†‡, Yoshi Kubota*, Tobias Meyer†, and Howard Schulman* Departments of *Neurobiology and †Molecular Pharmacology, Stanford University School of Medicine, Stanford, CA 94305 Edited by Roger A. Nicoll, University of California, San Francisco, CA, and approved July 21, 2003 (received for review May 7, 2003) The strength of hippocampal synapses can be persistently in- hence would provide a distinct Ca2ϩ activation region for creased by signals that activate Ca2؉͞calmodulin-dependent pro- CaMKII compared with other Ca2ϩ-activated enzymes at the tein kinase II (CaMKII). This CaMKII-dependent long-term potenti- synapse. In fact, it has been hypothesized that the signaling ation is important for hippocampal learning and memory. In this network controlling CaMKII autophosphorylation is a bistable work we show that CaMKII exhibits an intriguing switch-like type of switch that allows CaMKII to remain autophosphory- activation that likely is important for changes in synaptic strength. lated long after Ca2ϩ returns to a basal level (16). We found that autophosphorylation of CaMKII by itself showed a In this work we demonstrate experimentally that CaMKII 2؉ Ϸ ϩ steep dependence on Ca concentration [Hill coefficient (nH) 5]. responds in a switch-like fashion to Ca2 : CaMKII transitions 2؉ Ϸ However, an even steeper Ca dependence (nH 8) was observed rapidly from little to near-total autophosphorylation over a when autophosphorylation is balanced by the dephosphorylation narrow range of Ca2ϩ. Interestingly, this switch-like response was activity of protein phosphatase 1 (PP1).
  • PI3K Catalytic Isoform Alteration Promotes the LIMK1-Related

    PI3K Catalytic Isoform Alteration Promotes the LIMK1-Related

    ANTICANCER RESEARCH 37 : 1805-1818 (2017) doi:10.21873/anticanres.11515 PI3K Catalytic Isoform Alteration Promotes the LIMK1-related Metastasis Through the PAK1 or ROCK1/2 Activation in Cigarette Smoke-exposed Ovarian Cancer Cells GA BIN PARK 1 and DAEJIN KIM 2 1Department of Biochemistry, Kosin University College of Medicine, Busan, Republic of Korea; 2Department of Anatomy, Inje University College of Medicine, Busan, Republic of Korea Abstract. Aim: To investigate the molecular mechanisms Several studies have shown a strong correlation between by which long-term exposure to cigarette smoke extract cigarette smoke (CS) and cancer metastasis through the (CSE) contributes to ovarian cancer metastasis. Materials induction of numerous factors involved in migration activity and Methods: Western blot analysis for diverse p110 (1-3). The exposure to CS induces the epithelial- isoforms of phosphoinositide 3-kinase (PI3K)-related mesenchymal transition (EMT) process and up-regulates the signaling pathway and epithelial-mesenchymal transition expression of EMT markers, including N-cadherin and (EMT) markers was performed to analyze the underlying vimentin (4, 5). Cigarette smoke extract (CSE) treatment mechanisms. Migratory activity of CSE-exposed ovarian significantly induces interleukin-8 (IL-8) and transforming cancer cells was determined by transendothelial migration growth factor-beta 1 (TGF- β1 ) production and profoundly and invasion assay. Results: After exposure to CSE for four suppresses the proliferation and growth of erythroid and weeks, CaOV3 (primary) and SKOV3 (metastatic) ovarian granulocyte-macrophage progenitors (6). Stimulation with cancer cells showed enhanced mesenchymal characteristics CSE in human lung fibroblast cells induces the expression and produced EMT-related cytokines [intwerleukin-8 (IL-8), of phosphorylated Smad3, a main downstream target of the vascular endothelial growth factor (VEGF) and TGF- β1 receptor, which results in the secretion of vascular transforming growth factor-beta 1 (TGF- β1 )].
  • Circular RNA Hsa Circ 0005114‑Mir‑142‑3P/Mir‑590‑5P‑ Adenomatous

    Circular RNA Hsa Circ 0005114‑Mir‑142‑3P/Mir‑590‑5P‑ Adenomatous

    ONCOLOGY LETTERS 21: 58, 2021 Circular RNA hsa_circ_0005114‑miR‑142‑3p/miR‑590‑5p‑ adenomatous polyposis coli protein axis as a potential target for treatment of glioma BO WEI1*, LE WANG2* and JINGWEI ZHAO1 1Department of Neurosurgery, China‑Japan Union Hospital of Jilin University, Changchun, Jilin 130033; 2Department of Ophthalmology, The First Hospital of Jilin University, Jilin University, Changchun, Jilin 130021, P.R. China Received September 12, 2019; Accepted October 22, 2020 DOI: 10.3892/ol.2020.12320 Abstract. Glioma is the most common type of brain tumor APC expression with a good overall survival rate. UALCAN and is associated with a high mortality rate. Despite recent analysis using TCGA data of glioblastoma multiforme and the advances in treatment options, the overall prognosis in patients GSE25632 and GSE103229 microarray datasets showed that with glioma remains poor. Studies have suggested that circular hsa‑miR‑142‑3p/hsa‑miR‑590‑5p was upregulated and APC (circ)RNAs serve important roles in the development and was downregulated. Thus, hsa‑miR‑142‑3p/hsa‑miR‑590‑5p‑ progression of glioma and may have potential as therapeutic APC‑related circ/ceRNA axes may be important in glioma, targets. However, the expression profiles of circRNAs and their and hsa_circ_0005114 interacted with both of these miRNAs. functions in glioma have rarely been studied. The present study Functional analysis showed that hsa_circ_0005114 was aimed to screen differentially expressed circRNAs (DECs) involved in insulin secretion, while APC was associated with between glioma and normal brain tissues using sequencing the Wnt signaling pathway. In conclusion, hsa_circ_0005114‑ data collected from the Gene Expression Omnibus database miR‑142‑3p/miR‑590‑5p‑APC ceRNA axes may be potential (GSE86202 and GSE92322 datasets) and explain their mecha‑ targets for the treatment of glioma.
  • (PDE 1 B 1) Correlates with Brain Regions Having Extensive Dopaminergic Innervation

    (PDE 1 B 1) Correlates with Brain Regions Having Extensive Dopaminergic Innervation

    The Journal of Neuroscience, March 1994, 14(3): 1251-l 261 Expression of a Calmodulin-dependent Phosphodiesterase lsoform (PDE 1 B 1) Correlates with Brain Regions Having Extensive Dopaminergic Innervation Joseph W. Polli and Randall L. Kincaid Section on Immunology, Laboratory of Molecular and Cellular Neurobiology, National Institute on Alcohol Abuse and Alcoholism, Rockville, Maryland 20852 Cyclic nucleotide-dependent protein phosphorylation plays PDE implies an important physiological role for Ca2+-regu- a central role in neuronal signal transduction. Neurotrans- lated attenuation of CAMP-dependent signaling pathways mitter-elicited increases in cAMP/cGMP brought about by following dopaminergic stimulation. activation of adenylyl and guanylyl cyclases are downre- [Key words: CAMP, cyclase, striatum, dopamine, basal gulated by multiple phosphodiesterase (PDE) enzymes. In ganglia, DARPP-321 brain, the calmodulin (CaM)-dependent isozymes are the major degradative activities and represent a unique point of Cyclic nucleotides, acting as “second messengers”or via direct intersection between the cyclic nucleotide- and calcium effects, regulate a diverse array of neuronal functions, from ion (Ca*+)-mediated second messenger systems. Here we de- channel conductance to gene expression. Hydrolysis of 3’,5’- scribe the distribution of the PDEl Bl (63 kDa) CaM-depen- cyclic nucleotidesto 5’-nucleosidemonophosphates is the major dent PDE in mouse brain. An anti-peptide antiserum to this mechanismfor decreasingintracellular cyclic nucleotide levels. isoform immunoprecipitated -3O-40% of cytosolic PDE ac- This reaction is catalyzed by cyclic nucleotide phosphodiester- tivity, whereas antiserum to PDElA2 (61 kDa isoform) re- ase (PDE) enzymes that constitute a large superfamily (Beavo moved 60-70%, demonstrating that these isoforms are the and Reifsynder, 1990).
  • Mitosis Vs. Meiosis

    Mitosis Vs. Meiosis

    Mitosis vs. Meiosis In order for organisms to continue growing and/or replace cells that are dead or beyond repair, cells must replicate, or make identical copies of themselves. In order to do this and maintain the proper number of chromosomes, the cells of eukaryotes must undergo mitosis to divide up their DNA. The dividing of the DNA ensures that both the “old” cell (parent cell) and the “new” cells (daughter cells) have the same genetic makeup and both will be diploid, or containing the same number of chromosomes as the parent cell. For reproduction of an organism to occur, the original parent cell will undergo Meiosis to create 4 new daughter cells with a slightly different genetic makeup in order to ensure genetic diversity when fertilization occurs. The four daughter cells will be haploid, or containing half the number of chromosomes as the parent cell. The difference between the two processes is that mitosis occurs in non-reproductive cells, or somatic cells, and meiosis occurs in the cells that participate in sexual reproduction, or germ cells. The Somatic Cell Cycle (Mitosis) The somatic cell cycle consists of 3 phases: interphase, m phase, and cytokinesis. 1. Interphase: Interphase is considered the non-dividing phase of the cell cycle. It is not a part of the actual process of mitosis, but it readies the cell for mitosis. It is made up of 3 sub-phases: • G1 Phase: In G1, the cell is growing. In most organisms, the majority of the cell’s life span is spent in G1. • S Phase: In each human somatic cell, there are 23 pairs of chromosomes; one chromosome comes from the mother and one comes from the father.
  • 9. Atypical Dusps: 19 Phosphatases in Search of a Role

    9. Atypical Dusps: 19 Phosphatases in Search of a Role

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Digital.CSIC Transworld Research Network 37/661 (2), Fort P.O. Trivandrum-695 023 Kerala, India Emerging Signaling Pathways in Tumor Biology, 2010: 185-208 ISBN: 978-81-7895-477-6 Editor: Pedro A. Lazo 9. Atypical DUSPs: 19 phosphatases in search of a role Yolanda Bayón and Andrés Alonso Instituto de Biología y Genética Molecular, CSIC-Universidad de Valladolid c/ Sanz y Forés s/n, 47003 Valladolid, Spain Abstract. Atypical Dual Specificity Phosphatases (A-DUSPs) are a group of 19 phosphatases poorly characterized. They are included among the Class I Cys-based PTPs and contain the active site motif HCXXGXXR conserved in the Class I PTPs. These enzymes present a phosphatase domain similar to MKPs, but lack any substrate targeting domain similar to the CH2 present in this group. Although most of these phosphatases have no more than 250 amino acids, their size ranges from the 150 residues of the smallest A-DUSP, VHZ/DUSP23, to the 1158 residues of the putative PTP DUSP27. The substrates of this family include MAPK, but, in general terms, it does not look that MAPK are the general substrates for the whole group. In fact, other substrates have been described for some of these phosphatases, like the 5’CAP structure of mRNA, glycogen, or STATs and still the substrates of many A-DUSPs have not been identified. In addition to the PTP domain, most of these enzymes present no additional recognizable domains in their sequence, with the exception of CBM-20 in laforin, GTase in HCE1 and a Zn binding domain in DUSP12.
  • Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G 12

    Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G 12

    The Journal of Neuroscience, August 15, 2002, 22(16):6863–6875 Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G␣ ␣ 12 and G 13 by Rho-Independent and Rho-Dependent Mechanisms C. Laura Sayas, Jesu´ s Avila, and Francisco Wandosell Centro de Biologı´a Molecular “Severo Ochoa”, Consejo Superior de Investigaciones Cientı´ficas, Universidad Auto´ noma de Madrid, Cantoblanco, Madrid 28049, Spain ␣ ␣ ␣ ␣ Glycogen synthase kinase-3 (GSK-3) was generally considered tively active G 12 (G 12QL) and G 13 (G 13QL) in Neuro2a cells a constitutively active enzyme, only regulated by inhibition. induces upregulation of GSK-3 activity. Furthermore, overex- Here we describe that GSK-3 is activated by lysophosphatidic pression of constitutively active RhoA (RhoAV14) also activates ␣ acid (LPA) during neurite retraction in rat cerebellar granule GSK-3 However, the activation of GSK-3 by G 13 is blocked by neurons. GSK-3 activation correlates with an increase in GSK-3 coexpression with C3 transferase, whereas C3 does not block ␣ tyrosine phosphorylation. In addition, LPA induces a GSK-3- GSK-3 activation by G 12. Thus, we demonstrate that GSK-3 is ␣ ␣ mediated hyperphosphorylation of the microtubule-associated activated by both G 12 and G 13 in neuronal cells. However, ␣ protein tau. Inhibition of GSK-3 by lithium partially blocks neu- GSK-3 activation by G 13 is Rho-mediated, whereas GSK-3 ␣ rite retraction, indicating that GSK-3 activation is important but activation by G 12 is Rho-independent. The results presented not essential for the neurite retraction progress. GSK-3 activa- here imply the existence of a previously unknown mechanism of ␣ tion by LPA in cerebellar granule neurons is neither downstream GSK-3 activation by G 12/13 subunits.
  • Table S1. List of Oligonucleotide Primers Used

    Table S1. List of Oligonucleotide Primers Used

    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
  • The Regulatory Roles of Phosphatases in Cancer

    The Regulatory Roles of Phosphatases in Cancer

    Oncogene (2014) 33, 939–953 & 2014 Macmillan Publishers Limited All rights reserved 0950-9232/14 www.nature.com/onc REVIEW The regulatory roles of phosphatases in cancer J Stebbing1, LC Lit1, H Zhang, RS Darrington, O Melaiu, B Rudraraju and G Giamas The relevance of potentially reversible post-translational modifications required for controlling cellular processes in cancer is one of the most thriving arenas of cellular and molecular biology. Any alteration in the balanced equilibrium between kinases and phosphatases may result in development and progression of various diseases, including different types of cancer, though phosphatases are relatively under-studied. Loss of phosphatases such as PTEN (phosphatase and tensin homologue deleted on chromosome 10), a known tumour suppressor, across tumour types lends credence to the development of phosphatidylinositol 3--kinase inhibitors alongside the use of phosphatase expression as a biomarker, though phase 3 trial data are lacking. In this review, we give an updated report on phosphatase dysregulation linked to organ-specific malignancies. Oncogene (2014) 33, 939–953; doi:10.1038/onc.2013.80; published online 18 March 2013 Keywords: cancer; phosphatases; solid tumours GASTROINTESTINAL MALIGNANCIES abs in sera were significantly associated with poor survival in Oesophageal cancer advanced ESCC, suggesting that they may have a clinical utility in Loss of PTEN (phosphatase and tensin homologue deleted on ESCC screening and diagnosis.5 chromosome 10) expression in oesophageal cancer is frequent, Cao et al.6 investigated the role of protein tyrosine phosphatase, among other gene alterations characterizing this disease. Zhou non-receptor type 12 (PTPN12) in ESCC and showed that PTPN12 et al.1 found that overexpression of PTEN suppresses growth and protein expression is higher in normal para-cancerous tissues than induces apoptosis in oesophageal cancer cell lines, through in 20 ESCC tissues.
  • Understanding and Exploiting Post-Translational Modifications for Plant Disease Resistance

    Understanding and Exploiting Post-Translational Modifications for Plant Disease Resistance

    biomolecules Review Understanding and Exploiting Post-Translational Modifications for Plant Disease Resistance Catherine Gough and Ari Sadanandom * Department of Biosciences, Durham University, Stockton Road, Durham DH1 3LE, UK; [email protected] * Correspondence: [email protected]; Tel.: +44-1913341263 Abstract: Plants are constantly threatened by pathogens, so have evolved complex defence signalling networks to overcome pathogen attacks. Post-translational modifications (PTMs) are fundamental to plant immunity, allowing rapid and dynamic responses at the appropriate time. PTM regulation is essential; pathogen effectors often disrupt PTMs in an attempt to evade immune responses. Here, we cover the mechanisms of disease resistance to pathogens, and how growth is balanced with defence, with a focus on the essential roles of PTMs. Alteration of defence-related PTMs has the potential to fine-tune molecular interactions to produce disease-resistant crops, without trade-offs in growth and fitness. Keywords: post-translational modifications; plant immunity; phosphorylation; ubiquitination; SUMOylation; defence Citation: Gough, C.; Sadanandom, A. 1. Introduction Understanding and Exploiting Plant growth and survival are constantly threatened by biotic stress, including plant Post-Translational Modifications for pathogens consisting of viruses, bacteria, fungi, and chromista. In the context of agriculture, Plant Disease Resistance. Biomolecules crop yield losses due to pathogens are estimated to be around 20% worldwide in staple 2021, 11, 1122. https://doi.org/ crops [1]. The spread of pests and diseases into new environments is increasing: more 10.3390/biom11081122 extreme weather events associated with climate change create favourable environments for food- and water-borne pathogens [2,3]. Academic Editors: Giovanna Serino The significant estimates of crop losses from pathogens highlight the need to de- and Daisuke Todaka velop crops with disease-resistance traits against current and emerging pathogens.