Cycling at the Interface Between Neurodevelopment and Neurodegeneration
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Cyclin-Dependent Kinase 5 Decreases in Gastric Cancer and Its
Published OnlineFirst January 21, 2015; DOI: 10.1158/1078-0432.CCR-14-1950 Biology of Human Tumors Clinical Cancer Research Cyclin-Dependent Kinase 5 Decreases in Gastric Cancer and Its Nuclear Accumulation Suppresses Gastric Tumorigenesis Longlong Cao1,2, Jiechao Zhou2, Junrong Zhang1,2, Sijin Wu3, Xintao Yang1,2, Xin Zhao2, Huifang Li2, Ming Luo1, Qian Yu1, Guangtan Lin1, Huizhong Lin1, Jianwei Xie1, Ping Li1, Xiaoqing Hu3, Chaohui Zheng1, Guojun Bu2, Yun-wu Zhang2,4, Huaxi Xu2,4,5, Yongliang Yang3, Changming Huang1, and Jie Zhang2,4 Abstract Purpose: As a cyclin-independent atypical CDK, the role of correlated with the severity of gastric cancer based on tumor CDK5 in regulating cell proliferation in gastric cancer remains and lymph node metastasis and patient 5-year fatality rate. unknown. Nuclear localization of CDK5 was found to be significantly Experimental Design: Expression of CDK5 in gastric tumor decreased in tumor tissues and gastric cancer cell lines, and paired adjacent noncancerous tissues from 437 patients was whereas exogenously expression of nucleus-targeted CDK5 measured by Western blotting, immunohistochemistry, and real- inhibited the proliferation and xenograft implantation of time PCR. The subcellular translocation of CDK5 was monitored gastric cancer cells. Treatment with the small molecule during gastric cancer cell proliferation. The role of nuclear CDK5 NS-0011, which increases CDK5 accumulation in the nucleus, in gastric cancer tumorigenic proliferation and ex vivo xenografts suppressed both cancer cell proliferation and xenograft was explored. Furthermore, by screening for compounds in the tumorigenesis. PubChem database that disrupt CDK5 association with its nu- Conclusions: Our results suggest that low CDK5 expression is clear export facilitator, we identified a small molecular (NS-0011) associated with poor overall survival in patients with gastric that inhibits gastric cancer cell growth. -
The Cryoelectron Microscopy Structure of the Human CDK-Activating Kinase
The cryoelectron microscopy structure of the human CDK-activating kinase Basil J. Grebera,b,1,2, Juan M. Perez-Bertoldic, Kif Limd, Anthony T. Iavaronee, Daniel B. Tosoa, and Eva Nogalesa,b,d,f,2 aCalifornia Institute for Quantitative Biosciences (QB3), University of California, Berkeley, CA 94720; bMolecular Biophysics and Integrative Bio-Imaging Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720; cBiophysics Graduate Group, University of California, Berkeley, CA 94720; dDepartment of Molecular and Cell Biology, University of California, Berkeley, CA 94720; eQB3/Chemistry Mass Spectrometry Facility, University of California, Berkeley, CA 94720; and fHoward Hughes Medical Institute, University of California, Berkeley, CA 94720 Edited by Seth A. Darst, Rockefeller University, New York, NY, and approved August 4, 2020 (received for review May 14, 2020) The human CDK-activating kinase (CAK), a complex composed of phosphoryl transfer (11). However, in addition to cyclin binding, cyclin-dependent kinase (CDK) 7, cyclin H, and MAT1, is a critical full activation of cell cycle CDKs requires phosphorylation of the regulator of transcription initiation and the cell cycle. It acts by T-loop (9, 12). In animal cells, these activating phosphorylations phosphorylating the C-terminal heptapeptide repeat domain of are carried out by CDK7 (13, 14), itself a cyclin-dependent ki- the RNA polymerase II (Pol II) subunit RPB1, which is an important nase whose activity depends on cyclin H (14). regulatory event in transcription initiation by Pol II, and it phos- In human and other metazoan cells, regulation of transcription phorylates the regulatory T-loop of CDKs that control cell cycle initiation by phosphorylation of the Pol II-CTD and phosphor- progression. -
Calmodulin-Dependent Protein Kinase II–Protein Phosphatase 1 Switch Facilitates Specificity in Postsynaptic Calcium Signaling
An ultrasensitive Ca2؉͞calmodulin-dependent protein kinase II–protein phosphatase 1 switch facilitates specificity in postsynaptic calcium signaling J. Michael Bradshaw*†‡, Yoshi Kubota*, Tobias Meyer†, and Howard Schulman* Departments of *Neurobiology and †Molecular Pharmacology, Stanford University School of Medicine, Stanford, CA 94305 Edited by Roger A. Nicoll, University of California, San Francisco, CA, and approved July 21, 2003 (received for review May 7, 2003) The strength of hippocampal synapses can be persistently in- hence would provide a distinct Ca2ϩ activation region for creased by signals that activate Ca2؉͞calmodulin-dependent pro- CaMKII compared with other Ca2ϩ-activated enzymes at the tein kinase II (CaMKII). This CaMKII-dependent long-term potenti- synapse. In fact, it has been hypothesized that the signaling ation is important for hippocampal learning and memory. In this network controlling CaMKII autophosphorylation is a bistable work we show that CaMKII exhibits an intriguing switch-like type of switch that allows CaMKII to remain autophosphory- activation that likely is important for changes in synaptic strength. lated long after Ca2ϩ returns to a basal level (16). We found that autophosphorylation of CaMKII by itself showed a In this work we demonstrate experimentally that CaMKII 2؉ Ϸ ϩ steep dependence on Ca concentration [Hill coefficient (nH) 5]. responds in a switch-like fashion to Ca2 : CaMKII transitions 2؉ Ϸ However, an even steeper Ca dependence (nH 8) was observed rapidly from little to near-total autophosphorylation over a when autophosphorylation is balanced by the dephosphorylation narrow range of Ca2ϩ. Interestingly, this switch-like response was activity of protein phosphatase 1 (PP1). -
PI3K Catalytic Isoform Alteration Promotes the LIMK1-Related
ANTICANCER RESEARCH 37 : 1805-1818 (2017) doi:10.21873/anticanres.11515 PI3K Catalytic Isoform Alteration Promotes the LIMK1-related Metastasis Through the PAK1 or ROCK1/2 Activation in Cigarette Smoke-exposed Ovarian Cancer Cells GA BIN PARK 1 and DAEJIN KIM 2 1Department of Biochemistry, Kosin University College of Medicine, Busan, Republic of Korea; 2Department of Anatomy, Inje University College of Medicine, Busan, Republic of Korea Abstract. Aim: To investigate the molecular mechanisms Several studies have shown a strong correlation between by which long-term exposure to cigarette smoke extract cigarette smoke (CS) and cancer metastasis through the (CSE) contributes to ovarian cancer metastasis. Materials induction of numerous factors involved in migration activity and Methods: Western blot analysis for diverse p110 (1-3). The exposure to CS induces the epithelial- isoforms of phosphoinositide 3-kinase (PI3K)-related mesenchymal transition (EMT) process and up-regulates the signaling pathway and epithelial-mesenchymal transition expression of EMT markers, including N-cadherin and (EMT) markers was performed to analyze the underlying vimentin (4, 5). Cigarette smoke extract (CSE) treatment mechanisms. Migratory activity of CSE-exposed ovarian significantly induces interleukin-8 (IL-8) and transforming cancer cells was determined by transendothelial migration growth factor-beta 1 (TGF- β1 ) production and profoundly and invasion assay. Results: After exposure to CSE for four suppresses the proliferation and growth of erythroid and weeks, CaOV3 (primary) and SKOV3 (metastatic) ovarian granulocyte-macrophage progenitors (6). Stimulation with cancer cells showed enhanced mesenchymal characteristics CSE in human lung fibroblast cells induces the expression and produced EMT-related cytokines [intwerleukin-8 (IL-8), of phosphorylated Smad3, a main downstream target of the vascular endothelial growth factor (VEGF) and TGF- β1 receptor, which results in the secretion of vascular transforming growth factor-beta 1 (TGF- β1 )]. -
Circular RNA Hsa Circ 0005114‑Mir‑142‑3P/Mir‑590‑5P‑ Adenomatous
ONCOLOGY LETTERS 21: 58, 2021 Circular RNA hsa_circ_0005114‑miR‑142‑3p/miR‑590‑5p‑ adenomatous polyposis coli protein axis as a potential target for treatment of glioma BO WEI1*, LE WANG2* and JINGWEI ZHAO1 1Department of Neurosurgery, China‑Japan Union Hospital of Jilin University, Changchun, Jilin 130033; 2Department of Ophthalmology, The First Hospital of Jilin University, Jilin University, Changchun, Jilin 130021, P.R. China Received September 12, 2019; Accepted October 22, 2020 DOI: 10.3892/ol.2020.12320 Abstract. Glioma is the most common type of brain tumor APC expression with a good overall survival rate. UALCAN and is associated with a high mortality rate. Despite recent analysis using TCGA data of glioblastoma multiforme and the advances in treatment options, the overall prognosis in patients GSE25632 and GSE103229 microarray datasets showed that with glioma remains poor. Studies have suggested that circular hsa‑miR‑142‑3p/hsa‑miR‑590‑5p was upregulated and APC (circ)RNAs serve important roles in the development and was downregulated. Thus, hsa‑miR‑142‑3p/hsa‑miR‑590‑5p‑ progression of glioma and may have potential as therapeutic APC‑related circ/ceRNA axes may be important in glioma, targets. However, the expression profiles of circRNAs and their and hsa_circ_0005114 interacted with both of these miRNAs. functions in glioma have rarely been studied. The present study Functional analysis showed that hsa_circ_0005114 was aimed to screen differentially expressed circRNAs (DECs) involved in insulin secretion, while APC was associated with between glioma and normal brain tissues using sequencing the Wnt signaling pathway. In conclusion, hsa_circ_0005114‑ data collected from the Gene Expression Omnibus database miR‑142‑3p/miR‑590‑5p‑APC ceRNA axes may be potential (GSE86202 and GSE92322 datasets) and explain their mecha‑ targets for the treatment of glioma. -
(PDE 1 B 1) Correlates with Brain Regions Having Extensive Dopaminergic Innervation
The Journal of Neuroscience, March 1994, 14(3): 1251-l 261 Expression of a Calmodulin-dependent Phosphodiesterase lsoform (PDE 1 B 1) Correlates with Brain Regions Having Extensive Dopaminergic Innervation Joseph W. Polli and Randall L. Kincaid Section on Immunology, Laboratory of Molecular and Cellular Neurobiology, National Institute on Alcohol Abuse and Alcoholism, Rockville, Maryland 20852 Cyclic nucleotide-dependent protein phosphorylation plays PDE implies an important physiological role for Ca2+-regu- a central role in neuronal signal transduction. Neurotrans- lated attenuation of CAMP-dependent signaling pathways mitter-elicited increases in cAMP/cGMP brought about by following dopaminergic stimulation. activation of adenylyl and guanylyl cyclases are downre- [Key words: CAMP, cyclase, striatum, dopamine, basal gulated by multiple phosphodiesterase (PDE) enzymes. In ganglia, DARPP-321 brain, the calmodulin (CaM)-dependent isozymes are the major degradative activities and represent a unique point of Cyclic nucleotides, acting as “second messengers”or via direct intersection between the cyclic nucleotide- and calcium effects, regulate a diverse array of neuronal functions, from ion (Ca*+)-mediated second messenger systems. Here we de- channel conductance to gene expression. Hydrolysis of 3’,5’- scribe the distribution of the PDEl Bl (63 kDa) CaM-depen- cyclic nucleotidesto 5’-nucleosidemonophosphates is the major dent PDE in mouse brain. An anti-peptide antiserum to this mechanismfor decreasingintracellular cyclic nucleotide levels. isoform immunoprecipitated -3O-40% of cytosolic PDE ac- This reaction is catalyzed by cyclic nucleotide phosphodiester- tivity, whereas antiserum to PDElA2 (61 kDa isoform) re- ase (PDE) enzymes that constitute a large superfamily (Beavo moved 60-70%, demonstrating that these isoforms are the and Reifsynder, 1990). -
Mitosis Vs. Meiosis
Mitosis vs. Meiosis In order for organisms to continue growing and/or replace cells that are dead or beyond repair, cells must replicate, or make identical copies of themselves. In order to do this and maintain the proper number of chromosomes, the cells of eukaryotes must undergo mitosis to divide up their DNA. The dividing of the DNA ensures that both the “old” cell (parent cell) and the “new” cells (daughter cells) have the same genetic makeup and both will be diploid, or containing the same number of chromosomes as the parent cell. For reproduction of an organism to occur, the original parent cell will undergo Meiosis to create 4 new daughter cells with a slightly different genetic makeup in order to ensure genetic diversity when fertilization occurs. The four daughter cells will be haploid, or containing half the number of chromosomes as the parent cell. The difference between the two processes is that mitosis occurs in non-reproductive cells, or somatic cells, and meiosis occurs in the cells that participate in sexual reproduction, or germ cells. The Somatic Cell Cycle (Mitosis) The somatic cell cycle consists of 3 phases: interphase, m phase, and cytokinesis. 1. Interphase: Interphase is considered the non-dividing phase of the cell cycle. It is not a part of the actual process of mitosis, but it readies the cell for mitosis. It is made up of 3 sub-phases: • G1 Phase: In G1, the cell is growing. In most organisms, the majority of the cell’s life span is spent in G1. • S Phase: In each human somatic cell, there are 23 pairs of chromosomes; one chromosome comes from the mother and one comes from the father. -
9. Atypical Dusps: 19 Phosphatases in Search of a Role
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Digital.CSIC Transworld Research Network 37/661 (2), Fort P.O. Trivandrum-695 023 Kerala, India Emerging Signaling Pathways in Tumor Biology, 2010: 185-208 ISBN: 978-81-7895-477-6 Editor: Pedro A. Lazo 9. Atypical DUSPs: 19 phosphatases in search of a role Yolanda Bayón and Andrés Alonso Instituto de Biología y Genética Molecular, CSIC-Universidad de Valladolid c/ Sanz y Forés s/n, 47003 Valladolid, Spain Abstract. Atypical Dual Specificity Phosphatases (A-DUSPs) are a group of 19 phosphatases poorly characterized. They are included among the Class I Cys-based PTPs and contain the active site motif HCXXGXXR conserved in the Class I PTPs. These enzymes present a phosphatase domain similar to MKPs, but lack any substrate targeting domain similar to the CH2 present in this group. Although most of these phosphatases have no more than 250 amino acids, their size ranges from the 150 residues of the smallest A-DUSP, VHZ/DUSP23, to the 1158 residues of the putative PTP DUSP27. The substrates of this family include MAPK, but, in general terms, it does not look that MAPK are the general substrates for the whole group. In fact, other substrates have been described for some of these phosphatases, like the 5’CAP structure of mRNA, glycogen, or STATs and still the substrates of many A-DUSPs have not been identified. In addition to the PTP domain, most of these enzymes present no additional recognizable domains in their sequence, with the exception of CBM-20 in laforin, GTase in HCE1 and a Zn binding domain in DUSP12. -
Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G 12
The Journal of Neuroscience, August 15, 2002, 22(16):6863–6875 Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G␣ ␣ 12 and G 13 by Rho-Independent and Rho-Dependent Mechanisms C. Laura Sayas, Jesu´ s Avila, and Francisco Wandosell Centro de Biologı´a Molecular “Severo Ochoa”, Consejo Superior de Investigaciones Cientı´ficas, Universidad Auto´ noma de Madrid, Cantoblanco, Madrid 28049, Spain ␣ ␣ ␣ ␣ Glycogen synthase kinase-3 (GSK-3) was generally considered tively active G 12 (G 12QL) and G 13 (G 13QL) in Neuro2a cells a constitutively active enzyme, only regulated by inhibition. induces upregulation of GSK-3 activity. Furthermore, overex- Here we describe that GSK-3 is activated by lysophosphatidic pression of constitutively active RhoA (RhoAV14) also activates ␣ acid (LPA) during neurite retraction in rat cerebellar granule GSK-3 However, the activation of GSK-3 by G 13 is blocked by neurons. GSK-3 activation correlates with an increase in GSK-3 coexpression with C3 transferase, whereas C3 does not block ␣ tyrosine phosphorylation. In addition, LPA induces a GSK-3- GSK-3 activation by G 12. Thus, we demonstrate that GSK-3 is ␣ ␣ mediated hyperphosphorylation of the microtubule-associated activated by both G 12 and G 13 in neuronal cells. However, ␣ protein tau. Inhibition of GSK-3 by lithium partially blocks neu- GSK-3 activation by G 13 is Rho-mediated, whereas GSK-3 ␣ rite retraction, indicating that GSK-3 activation is important but activation by G 12 is Rho-independent. The results presented not essential for the neurite retraction progress. GSK-3 activa- here imply the existence of a previously unknown mechanism of ␣ tion by LPA in cerebellar granule neurons is neither downstream GSK-3 activation by G 12/13 subunits. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
The Regulatory Roles of Phosphatases in Cancer
Oncogene (2014) 33, 939–953 & 2014 Macmillan Publishers Limited All rights reserved 0950-9232/14 www.nature.com/onc REVIEW The regulatory roles of phosphatases in cancer J Stebbing1, LC Lit1, H Zhang, RS Darrington, O Melaiu, B Rudraraju and G Giamas The relevance of potentially reversible post-translational modifications required for controlling cellular processes in cancer is one of the most thriving arenas of cellular and molecular biology. Any alteration in the balanced equilibrium between kinases and phosphatases may result in development and progression of various diseases, including different types of cancer, though phosphatases are relatively under-studied. Loss of phosphatases such as PTEN (phosphatase and tensin homologue deleted on chromosome 10), a known tumour suppressor, across tumour types lends credence to the development of phosphatidylinositol 3--kinase inhibitors alongside the use of phosphatase expression as a biomarker, though phase 3 trial data are lacking. In this review, we give an updated report on phosphatase dysregulation linked to organ-specific malignancies. Oncogene (2014) 33, 939–953; doi:10.1038/onc.2013.80; published online 18 March 2013 Keywords: cancer; phosphatases; solid tumours GASTROINTESTINAL MALIGNANCIES abs in sera were significantly associated with poor survival in Oesophageal cancer advanced ESCC, suggesting that they may have a clinical utility in Loss of PTEN (phosphatase and tensin homologue deleted on ESCC screening and diagnosis.5 chromosome 10) expression in oesophageal cancer is frequent, Cao et al.6 investigated the role of protein tyrosine phosphatase, among other gene alterations characterizing this disease. Zhou non-receptor type 12 (PTPN12) in ESCC and showed that PTPN12 et al.1 found that overexpression of PTEN suppresses growth and protein expression is higher in normal para-cancerous tissues than induces apoptosis in oesophageal cancer cell lines, through in 20 ESCC tissues. -
Understanding and Exploiting Post-Translational Modifications for Plant Disease Resistance
biomolecules Review Understanding and Exploiting Post-Translational Modifications for Plant Disease Resistance Catherine Gough and Ari Sadanandom * Department of Biosciences, Durham University, Stockton Road, Durham DH1 3LE, UK; [email protected] * Correspondence: [email protected]; Tel.: +44-1913341263 Abstract: Plants are constantly threatened by pathogens, so have evolved complex defence signalling networks to overcome pathogen attacks. Post-translational modifications (PTMs) are fundamental to plant immunity, allowing rapid and dynamic responses at the appropriate time. PTM regulation is essential; pathogen effectors often disrupt PTMs in an attempt to evade immune responses. Here, we cover the mechanisms of disease resistance to pathogens, and how growth is balanced with defence, with a focus on the essential roles of PTMs. Alteration of defence-related PTMs has the potential to fine-tune molecular interactions to produce disease-resistant crops, without trade-offs in growth and fitness. Keywords: post-translational modifications; plant immunity; phosphorylation; ubiquitination; SUMOylation; defence Citation: Gough, C.; Sadanandom, A. 1. Introduction Understanding and Exploiting Plant growth and survival are constantly threatened by biotic stress, including plant Post-Translational Modifications for pathogens consisting of viruses, bacteria, fungi, and chromista. In the context of agriculture, Plant Disease Resistance. Biomolecules crop yield losses due to pathogens are estimated to be around 20% worldwide in staple 2021, 11, 1122. https://doi.org/ crops [1]. The spread of pests and diseases into new environments is increasing: more 10.3390/biom11081122 extreme weather events associated with climate change create favourable environments for food- and water-borne pathogens [2,3]. Academic Editors: Giovanna Serino The significant estimates of crop losses from pathogens highlight the need to de- and Daisuke Todaka velop crops with disease-resistance traits against current and emerging pathogens.