Regulation of Glycolysis/Fructolysis in Buffalo Spermatozoa
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent -
Effects of Glucagon, Glycerol, and Glucagon Plus Glycerol On
Iowa State University Capstones, Theses and Graduate Theses and Dissertations Dissertations 2011 Effects of glucagon, glycerol, and glucagon plus glycerol on gluconeogenesis, lipogenesis, and lipolysis in periparturient Holstein cows Nimer Mehyar Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/etd Part of the Biochemistry, Biophysics, and Structural Biology Commons Recommended Citation Mehyar, Nimer, "Effects of glucagon, glycerol, and glucagon plus glycerol on gluconeogenesis, lipogenesis, and lipolysis in periparturient Holstein cows" (2011). Graduate Theses and Dissertations. 11923. https://lib.dr.iastate.edu/etd/11923 This Thesis is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Effects of glucagon, glycerol, and glucagon plus glycerol on gluconeogenesis, lipogenesis, and lipolysis in periparturient Holstein cows by Nimer Mehyar A thesis submitted to graduate faculty in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Major: Biochemistry Program of Study Committee: Donald C. Beitz, Major Professor Ted W. Huiatt Kenneth J. Koehler Iowa State University Ames, Iowa 2011 Copyright Nimer Mehyar, 2011. All rights reserved ii To My Mother To Ghada Ali, Sarah, and Hassan -
Fructose Metabolism from a Functional
SSE #174 Sports Science Exchange (2017) Vol. 28, No. 174, 1-5 FRUCTOSE METABOLISM FROM A FUNCTIONAL PERSPECTIVE: IMPLICATIONS FOR ATHLETES Luke Tappy, MD | Department of Physiology, Faculty of Biology and Medicine, University of Lausanne, Service of Endocrinology, Diabetes and Metabolism | Lausanne University Hospital, and Cardio-metabolic Center, Broye Hospital | Estavayer-le-lac, Switzerland • Fructose was originally a seasonal natural nutrient, mainly consumed in summer and fall in fruits and vegetables. In the industrial era, it became a permanent constituent of our diet, essentially a constituent of added sugars (sucrose, high-fructose corn syrup). • Fructose cannot be directly metabolized by most cells in our body. It has to be processed first in the gut, liver and kidneys, where it is converted into glucose, lactate and fatty acids. • Too much dietary fructose along with excess energy intake and low physical activity can cause hepatic insulin resistance, hypertriglyceridemia and increased hepatic fat content. GAT11LOGO_GSSI_vert_fc_grn • In exercising athletes, net carbohydrate oxidation increases with glucose ingestion in a dose-dependent manner until a plateau is reached at about 1g/min. The addition of fructose to glucose drinks can further increase carbohydrate oxidation. • During exercise, substantial amounts of fructose can be converted into lactate in splanchnic organs if available and released in the systemic circulation to be oxidized in contracting muscles. This “reverse fructose-lactate Cori cycle” provides additional energy substrate to muscle during exercise. • Conversion of fructose into glucose and lactate in splanchnic organs is associated with enhanced splanchnic energy expenditure, while muscle energy efficiency is minimally altered. • During recovery after exercise, glucose and fructose mutually enhance their gut absorption and their storage as glycogen in the liver. -
• Glycolysis • Gluconeogenesis • Glycogen Synthesis
Carbohydrate Metabolism! Wichit Suthammarak – Department of Biochemistry, Faculty of Medicine Siriraj Hospital – Aug 1st and 4th, 2014! • Glycolysis • Gluconeogenesis • Glycogen synthesis • Glycogenolysis • Pentose phosphate pathway • Metabolism of other hexoses Carbohydrate Digestion! Digestive enzymes! Polysaccharides/complex carbohydrates Salivary glands Amylase Pancreas Oligosaccharides/dextrins Dextrinase Membrane-bound Microvilli Brush border Maltose Sucrose Lactose Maltase Sucrase Lactase ‘Disaccharidase’ 2 glucose 1 glucose 1 glucose 1 fructose 1 galactose Lactose Intolerance! Cause & Pathophysiology! Normal lactose digestion Lactose intolerance Lactose Lactose Lactose Glucose Small Intestine Lactase lactase X Galactose Bacteria 1 glucose Large Fermentation 1 galactose Intestine gases, organic acid, Normal stools osmotically Lactase deficiency! active molecules • Primary lactase deficiency: อาการ! genetic defect, การสราง lactase ลด ลงเมออายมากขน, พบมากทสด! ปวดทอง, ถายเหลว, คลนไสอาเจยนภาย • Secondary lactase deficiency: หลงจากรบประทานอาหารทม lactose acquired/transient เชน small bowel เปนปรมาณมาก เชนนม! injury, gastroenteritis, inflammatory bowel disease! Absorption of Hexoses! Site: duodenum! Intestinal lumen Enterocytes Membrane Transporter! Blood SGLT1: sodium-glucose transporter Na+" Na+" •! Presents at the apical membrane ! of enterocytes! SGLT1 Glucose" Glucose" •! Co-transports Na+ and glucose/! Galactose" Galactose" galactose! GLUT2 Fructose" Fructose" GLUT5 GLUT5 •! Transports fructose from the ! intestinal lumen into enterocytes! -
THE AEROBIC (Air-Robic!) PATHWAYS
THE AEROBIC (air-robic!) PATHWAYS Watch this video on aerobic glycolysis: http://ow.ly/G5djv Watch this video on oxygen use: http://ow.ly/G5dmh Energy System 1 – The Aerobic Use of Glucose (Glycolysis) This energy system involves the breakdown of glucose (carbohydrate) to release energy in the presence of oxygen. The key to this energy system is that it uses OXYGEN to supply energy. Just like the anaerobic systems, there are many negatives and positives from using this pathway. Diagram 33 below summarises the key features of this energy system. When reading the details on the table keep in mind the differences between this and the previous systems that were looked at. In this way a perspective of their features can be appreciated and applied. Diagram 33: The Key Features of the Aerobic Glycolytic System Highlight 3 key features in the diagram that are important to the functioning of this system. 1: ------------------------------------------------------------------------------------------------------------------------------------------------------- 2: ------------------------------------------------------------------------------------------------------------------------------------------------------- 3: ------------------------------------------------------------------------------------------------------------------------------------------------------- Notes ---------------------------------------------------------------------------------------------------------------------------------------------------------- ---------------------------------------------------------------------------------------------------------------------------------------------------------- -
Energy Metabolism: Gluconeogenesis and Oxidative Phosphorylation
International Journal for Innovation Education and Research www.ijier.net Vol:-8 No-09, 2020 Energy metabolism: gluconeogenesis and oxidative phosphorylation Luis Henrique Almeida Castro ([email protected]) PhD in the Health Sciences Graduate Program, Federal University of Grande Dourados Dourados, Mato Grosso do Sul – Brazil. Leandro Rachel Arguello Dom Bosco Catholic University Campo Grande, Mato Grosso do Sul – Brazil. Nelson Thiago Andrade Ferreira Motion Science Graduate Program, Federal University of Mato Grosso do Sul Campo Grande, Mato Grosso do Sul – Brazil. Geanlucas Mendes Monteiro Heath and Development in West Central Region Graduate Program, Federal University of Mato Grosso do Sul Campo Grande, Mato Grosso do Sul – Brazil. Jessica Alves Ribeiro Federal University of Mato Grosso do Sul Campo Grande, Mato Grosso do Sul – Brazil. Juliana Vicente de Souza Motion Science Graduate Program, Federal University of Mato Grosso do Sul Campo Grande, Mato Grosso do Sul – Brazil. Sarita Baltuilhe dos Santos Motion Science Graduate Program, Federal University of Mato Grosso do Sul Campo Grande, Mato Grosso do Sul – Brazil. Fernanda Viana de Carvalho Moreto MSc., Nutrition, Food and Health Graduate Program, Federal University of Grande Dourados Dourados, Mato Grosso do Sul – Brazil. Ygor Thiago Cerqueira de Paula Motion Science Graduate Program, Federal University of Mato Grosso do Sul Campo Grande, Mato Grosso do Sul – Brazil. International Educative Research Foundation and Publisher © 2020 pg. 359 International Journal for Innovation Education and Research ISSN 2411-2933 September 2020 Vanessa de Souza Ferraz Motion Science Graduate Program, Federal University of Mato Grosso do Sul Campo Grande, Mato Grosso do Sul – Brazil. Tayla Borges Lino Motion Science Graduate Program, Federal University of Mato Grosso do Sul Campo Grande, Mato Grosso do Sul – Brazil. -
Class 11 Biology Chapter- 13 Respiration in Plants
CLASS 11 BIOLOGY CHAPTER- 13 RESPIRATION IN PLANTS CELLULAR RESPIRATION: The process of conversion of the chemical energy of organic substances into a metabolically usable energy within living cells is called cellular respiration. TYPES OF CELLULAR RESPIRATION: (i) Aerobic respiration: The process of respiration which requires molecular oxygen. (ii) Anaerobic respiration: The process of respiration which does not require molecular oxygen and occurs in the cytoplasm. MECHANISM OF RESPIRATION: Following are the steps- 1. GLYCOLYSIS / EMP Pathway: It involves a series of closely integrated reactions in which hexose sugars(usually glucose) are converted into pyruvic acid. It is common in both aerobic and anaerobic reactions. It occurs in the cytoplasm. It does not require oxygen. Gollowing are the steps of GLYCLOLYSIS: (i) Conversion of glucose to Fructose-1,6-diphosphate: First phosphorylation: Glucose is converted to Glucose -6-phosphate in the presence of enzyme hexokinase and Mg++ ions and energy in the form of ATP. Isomerization: Glucose-6-phosphate is converted to Fructose-6-phosphate in the presence of phosphohexoisomerase. Second phosphorylation: Fructose-6-phosphate is converted to Fructose-1,6- diphosphate by the use of energy in the form of ATP. (ii) Formation of pyruvic acid from fructose -1,6-diphosphate: Cleavage: Fructose-1,6-diphosphate splits into 3-phosphoglyceraldehyde and Dihydroxyacetone phosphate in the presence of enzyme aldolase. Phosphorylation and oxidative dehydrogenase: 3-phosphoglyceraldehyde is converted to 1,3-biphosphoglyceric acid. ATP generation(first): 1,3-biphosphoglyceric acid is converted to 3-phosphoglyceric acid in the presence of Mg++ and phosphoglycerokinase . Isomerization: 3-phosphoglyceric acid is converted to 2-phosphoglyceric acid in the presence of Mg++. -
Fructose-Induced Increases in Expression of Intestinal Fructolytic and Gluconeogenic Genes Are Regulated by GLUT5 and KHK
Fructose-induced increases in expression of intestinal fructolytic and gluconeogenic genes are regulated by GLUT5 and KHK. Chirag Patel, Véronique Douard, Shiyan Yu, Phuntila Tharabenjasin, Nan Gao, Ronaldo P Ferraris To cite this version: Chirag Patel, Véronique Douard, Shiyan Yu, Phuntila Tharabenjasin, Nan Gao, et al.. Fructose- induced increases in expression of intestinal fructolytic and gluconeogenic genes are regulated by GLUT5 and KHK.. AJP - Regulatory, Integrative and Comparative Physiology, American Physio- logical Society, 2015, 309 (5), pp.R499-509. 10.1152/ajpregu.00128.2015. hal-01607831 HAL Id: hal-01607831 https://hal.archives-ouvertes.fr/hal-01607831 Submitted on 28 May 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Copyright Am J Physiol Regul Integr Comp Physiol 309: R499–R509, 2015. First published June 17, 2015; doi:10.1152/ajpregu.00128.2015. Fructose-induced increases in expression of intestinal fructolytic and gluconeogenic genes are regulated by GLUT5 and KHK Chirag Patel,1 Veronique Douard,1 Shiyan Yu,2 Phuntila Tharabenjasin,1 Nan Gao,2 and Ronaldo P. Ferraris1 1Department of Pharmacology and Physiology, New Jersey Medical School, Rutgers University, Newark, New Jersey; and 2Department of Biological Sciences, School of Arts and Sciences, Rutgers University, Newark, New Jersey Submitted 30 March 2015; accepted in final form 16 June 2015 Patel C, Douard V, Yu S, Tharabenjasin P, Gao N, Ferraris blood fructose is directly dependent on intestinal processing of RP. -
The Effect of 2-Desoxy-D-Glucose on Glycolysis and Respiration of Tumor and Normal Tissues
The Effect of 2-Desoxy-D-glucose on Glycolysis and Respiration of Tumor and Normal Tissues GLADYSE. WOODWARDANDMARIET. HUDSON (Biochemical Research Foundation, Newark, Delaware) Inhibition of metabolism by structural analogs end of each experiment. Reaction rates are expressed of metabolites is one of the newer concepts of of dry tissue/hour, and are based on the initial steady rate. chemotherapy. It seems possible that this concept The symbols, QCOJ.Qco2>an<l Q<v are used to express, re spectively, the rates of anaerobic glycolysis, aerobic glycolysis, might be applied to cancer by use of structural and respiration. The Q values as given in the tables are from analogs of glucose to inhibit the glycolysis of the single or duplicate determinations. tumor cell, since tumor tissue in contrast to most normal tissues possesses the ability to glycolyze RESULTS glucose at a high rate both anaerobically and EFFECTop 2DG ONGLYCOLYSIS aerobically (7). It was found that 2DG in the maximum concen 2-Desoxy-D-glucose (2DG) is a structural ana tration used with each tissue did not significantly log of glucose, differing from glucose only at the affect the endogenous glycolysis of any of the tis second carbon atom by the absence of one oxygen sues studied. Calculation of the degree of inhibi atom. This analog has been shown (2) to compete tion of glucose or fructose utilization, therefore, is with glucose in the yeast fermentation system and, based on the Q values from which the correspond thereby, to inhibit fermentation of glucose. In a ing blank Q value has been subtracted. -
(12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al
US 2014O155567A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk et al. (43) Pub. Date: Jun. 5, 2014 (54) MICROORGANISMS AND METHODS FOR (60) Provisional application No. 61/331,812, filed on May THE BIOSYNTHESIS OF BUTADENE 5, 2010. (71) Applicant: Genomatica, Inc., San Diego, CA (US) Publication Classification (72) Inventors: Mark J. Burk, San Diego, CA (US); (51) Int. Cl. Anthony P. Burgard, Bellefonte, PA CI2P 5/02 (2006.01) (US); Jun Sun, San Diego, CA (US); CSF 36/06 (2006.01) Robin E. Osterhout, San Diego, CA CD7C II/6 (2006.01) (US); Priti Pharkya, San Diego, CA (52) U.S. Cl. (US) CPC ................. CI2P5/026 (2013.01); C07C II/I6 (2013.01); C08F 136/06 (2013.01) (73) Assignee: Genomatica, Inc., San Diego, CA (US) USPC ... 526/335; 435/252.3:435/167; 435/254.2: (21) Appl. No.: 14/059,131 435/254.11: 435/252.33: 435/254.21:585/16 (22) Filed: Oct. 21, 2013 (57) ABSTRACT O O The invention provides non-naturally occurring microbial Related U.S. Application Data organisms having a butadiene pathway. The invention addi (63) Continuation of application No. 13/101,046, filed on tionally provides methods of using Such organisms to produce May 4, 2011, now Pat. No. 8,580,543. butadiene. Patent Application Publication Jun. 5, 2014 Sheet 1 of 4 US 2014/O155567 A1 ?ueudos!SMS |?un61– Patent Application Publication Jun. 5, 2014 Sheet 2 of 4 US 2014/O155567 A1 VOJ OO O Z?un61– Patent Application Publication US 2014/O155567 A1 {}}} Hººso Patent Application Publication Jun. -
Fatty Acid Biosynthesis
BI/CH 422/622 ANABOLISM OUTLINE: Photosynthesis Carbon Assimilation – Calvin Cycle Carbohydrate Biosynthesis in Animals Gluconeogenesis Glycogen Synthesis Pentose-Phosphate Pathway Regulation of Carbohydrate Metabolism Anaplerotic reactions Biosynthesis of Fatty Acids and Lipids Fatty Acids contrasts Diversification of fatty acids location & transport Eicosanoids Synthesis Prostaglandins and Thromboxane acetyl-CoA carboxylase Triacylglycerides fatty acid synthase ACP priming Membrane lipids 4 steps Glycerophospholipids Control of fatty acid metabolism Sphingolipids Isoprene lipids: Cholesterol ANABOLISM II: Biosynthesis of Fatty Acids & Lipids 1 ANABOLISM II: Biosynthesis of Fatty Acids & Lipids 1. Biosynthesis of fatty acids 2. Regulation of fatty acid degradation and synthesis 3. Assembly of fatty acids into triacylglycerol and phospholipids 4. Metabolism of isoprenes a. Ketone bodies and Isoprene biosynthesis b. Isoprene polymerization i. Cholesterol ii. Steroids & other molecules iii. Regulation iv. Role of cholesterol in human disease ANABOLISM II: Biosynthesis of Fatty Acids & Lipids Lipid Fat Biosynthesis Catabolism Fatty Acid Fatty Acid Degradation Synthesis Ketone body Isoprene Utilization Biosynthesis 2 Catabolism Fatty Acid Biosynthesis Anabolism • Contrast with Sugars – Lipids have have hydro-carbons not carbo-hydrates – more reduced=more energy – Long-term storage vs short-term storage – Lipids are essential for structure in ALL organisms: membrane phospholipids • Catabolism of fatty acids –produces acetyl-CoA –produces reducing -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG