Detection and Counting of Nitrobacter Populations in Soil by PCR
Total Page：16
File Type：pdf, Size：1020Kb
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, June 1995, p. 2093–2098 Vol. 61, No. 6 0099-2240/95/$04.0010 Copyright q 1995, American Society for Microbiology Detection and Counting of Nitrobacter Populations in Soil by PCR VALERIE DEGRANGE* AND RENE BARDIN Laboratoire d’Ecologie Microbienne, URA Centre National de la Recherche Scientifique 1450, Universite´ Claude Bernard Lyon I, 69622 Villeurbanne Cedex, France Received 14 September 1994/Accepted 23 March 1995 Although the biological conversion of nitrite to nitrate is a well-known process, studies of Nitrobacter populations are hindered by their physiological characteristics. This report describes a new method for detecting and counting Nitrobacter populations in situ with the PCR. Two primers from the 16S rRNA gene were used to generate a 397-bp fragment by amplification of Nitrobacter species DNA. No signal was detected from their phylogenetic neighbors or the common soil bacteria tested. Extraction and purification steps were optimized for minimal loss and maximal purity of soil DNA. The detection threshold and accuracy of the molecular method were determined from soil inoculated with 10, 102,or103Nitrobacter hamburgensis cells per g of soil. Counts were also done by the most-probable-number (MPN)-Griess and fluorescent antibody methods. PCR had a lower detection threshold (102 Nitrobacter cells per g of soil) than did the MPN-Griess or fluorescent antibody method. When PCR amplification was coupled with the MPN method, the counting rate reached 65 to 72% of inoculated Nitrobacter cells. Tested on nonsterile soil, this rapid procedure was proved efficient. A better understanding of the nitrification process could provide genomic, taxonomic, and phylogenetic data on the help to reduce excess nitrate production and ensuing losses genus Nitrobacter (26, 28, 31). This approach is a potential due to denitrification or leaching of water-soluble nitrate an- alternative to existing methods for the study of these microor- ions (2, 21). Improved control of nitrification should lead to ganisms in situ (25). better plant productivity with fewer risks of eutrophication and This work was designed to develop a procedure for counting domestic water pollution. The microorganisms involved in this Nitrobacter populations in the soil, based on genomic tools, by process have been classically grouped into the Nitrobacteri- PCR coupled with the MPN method (PCR-MPN). We aceae family (44). One group of bacteria oxidizes ammonia to adapted a method of extracting and purifying Nitrobacter DNA nitrite, and another oxidizes nitrite to nitrate (36, 44). An from soil and identified the optimal conditions of amplification important member of the latter group, the genus Nitrobacter,is to ensure optimal counting precision. present in freshwater, seawater, and soil, where it is the only known nitrite oxidizer (36, 44). Species of this genus grow chemolithotrophically as well as chemo-organotrophically (44). MATERIALS AND METHODS There have been several studies on the metabolism, survival, Bacterial strains. The bacterial strains used are listed in Table 1. Nitrobacter 21 and growth of nitrite oxidizers in pure cultures and on their strains were grown at 288C in a mineral medium with2gofNaNO2 liter (38); nitrifying activity in various environments (13, 20), but fewer strain X14 was grown under mixotrophic conditions (3). studies have dealt with natural Nitrobacter populations. Al- Soils. Two soils were used in this work. One was a sandy calcareous soil from the alluvial plain of the Ain and Rhoˆne rivers (Loyettes, Rhoˆne), likely to though the biological conversion of nitrite to nitrate is a well- accumulate nitrites because of Nitrobacter activity inhibition (12). The other was known process, studies of Nitrobacter populations are currently an agricultural sandy loam soil (La Coˆte Saint Andre´, Ise`re) (Table 2). hampered by inadequate methods of detection and counting. Oligonucleotide primers. The oligonucleotides used for PCR priming were This failure is due in part to the unfavorable physiological selected by comparing the total 16S rRNA sequences of Nitrobacter species (Nitrobacter winogradskyi, Nitrobacter hamburgensis, and Nitrobacter genomic spe- characteristics of these bacteria, namely, slow growth, small cies strain 2) with the phylogenetic neighbors of this genus (Rhodopseudomonas biomass, and susceptibility of cultures to contamination (2, 36). palustris, Bradyrhizobium japonicum, Photorhizobium thompsonianum, and The only way to count Nitrobacter populations in soil, the Agrobacterium tumefaciens) (31) (Table 1). The two primers selected were a most-probable-number (MPN)-Griess procedure, is time con- Nitrobacter-specific primer (59 TTTTTTGAGATTTGCTAG 39 [FGPS12699]) and a nonspecific primer (59 CTAAAACTCAAAGGAATTGA 39 [FGPS872] suming and selective (4, 16), and there is no antibody against [31]). (FGPS refers to the small subunit 16S rRNA gene, and the number is the the whole Nitrobacter genus (18, 25, 27). 59 coordinate of the oligonucleotide corresponding to the sequences deposited in The PCR (24) is a technique which amplifies a few target GenBank under the accession numbers LL11661, LL11662, and LL11663 [31]. A DNA sequences to make them detectable and quantifiable. prime after the number indicates that the primer is complementary to the rRNA.) The synthetic oligonucleotides were obtained from the Centre de Ge´- This method has been used to detect pathogenic microorgan- ne´tique Mole´culaire et Cellulaire, Universite´ Lyon I, Lyon, France. isms in food (14), in clinical samples (19), and, more recently, DNA extraction from pure cultures. DNA was extracted and purified as de- in soil and sediment (9, 33, 42). It has been used in conjunction scribed by Brenner et al. (7), except that achromopeptidase (Wako Pure Chem- with the MPN method to count Agrobacterium populations in ical, Dallas, Tex.) was added to the lysis mixture (39). PCR amplification of pure DNA. Pure DNA from Nitrobacter species (N. soil (33). Molecular biology techniques have also been used to winogradskyi, Nitrobacter agilis, N. hamburgensis, and Nitrobacter genomic species strain 2), their phylogenetic neighbors (Rhodopseudomonas palustris, Bradyrhi- zobium japonicum, Photorhizobium thompsonianum, and Agrobacterium tume- * Corresponding author. Mailing address: Laboratoire d’Ecologie faciens), and common soil bacteria (Pseudomonas fluorescens, Burkholderia cepacia, Azospirillum lipoferum, Azospirillum brasilense, Flavobacterium sp., Xan- Microbienne, URA Centre National de la Recherche Scientifique thomonas albilineans, Rhizobium meliloti, Bacillus azotoformans, and Streptomy- 1450, Universite´ Claude Bernard Lyon I, 43 boul. du 11 Novembre ces lividans) was amplified by PCR in a total volume of 50 ml under a layer of 1918, 69622 Villeurbanne Cedex, France. Phone: 72 43 13 77. Fax: 72 paraffin oil. One microliter of template DNA was added in a mixture of 13 PCR 43 12 23. amplification buffer (103 buffer contains 100 mM Tris-HCl [pH 8.3], 500 mM 2093 2094 DEGRANGE AND BARDIN APPL.ENVIRON.MICROBIOL. TABLE 1. Bacterial strains used primary antibacterial-specific antibody prepared in rabbits was followed by a second fluorescent anti-rabbit antibody. Reactive cells were examined and Source or counted with a Zeiss Universal microscope equipped for epifluorescence. Strain a reference Soil DNA extraction and purification. Protocols for soil DNA extraction were Nitrobacter winogradskyi WT (5ATCC 25391T) ...................... ATCC tested on nonsterile soils of La Coˆte Saint Andre´ and Loyettes (Picard et al. [33] and Nesme [29]). A direct method of extraction, including only physical treat- Nitrobacter agilis (5ATCC 14123) ............................................ ATCC ments, was adopted. Nitrobacter hamburgensis............................................................. 3 The largest amounts of soil DNA were obtained from 600 mg of dried soil, Nitrobacter genomic species strain 2 LL................................... 18 extracted as three batches of 200 mg which were then pooled during purification. Rhodopseudomonas palustrisT (5DSM123T) ........................... DSM The dried soil was ground with a freezer-mill (SPEX, Metuchen, N.J.) and Bradyrhizobium japonicum USDA 110 ..................................... USDA sonicated with a Cup Horn in extraction buffer (50 mM Tris, 20 mM disodium Photorhizobium thompsonianum BTAi1 ................................... 11 EDTA [pH 8.0], 100 mM NaCl, 1% [wt/vol] polyvinylpolypyrrolidone [Sigma Agrobacterium tumefaciens C58.................................................. CFBP Chemical Co., St. Louis, Mo.]) at 2/10 maximum power (600 W; Bioblock, Pseudomonas fluorescens AK15 ................................................. 45 Illkirch, France) for 4 min at 50% of active cycles. The cell debris was removed by centrifugation (3,835 3 g for 5 min), and the supernatant containing DNA was Burkholderia cepacia (5ATCC 25416) ..................................... ATCC saved. The pellet was resuspended in extraction buffer and subjected to three Azospirillum lipoferum 4B........................................................... 1 successive thermal shocks (liquid nitrogen and boiling water). The DNA was Azospirillum brasilense (5ATCC 29145) .................................. ATCC removed from the lysed pellet by three washes with extraction buffer. Finally, Flavobacterium sp. (5ATCC 33514)......................................... ATCC DNA was precipitated with ethanol and resuspended in 100 ml of TE buffer (pH Xanthomonas