(12) United States Patent (10) Patent No.: US 8,343,739 B2 Katz Et Al

USOO834.3739B2

(12) United States Patent (10) Patent No.: US 8,343,739 B2 Katz et al. (45) Date of Patent: Jan. 1, 2013

(54) METABOLICALLY ENGINEERED CELLS Sengottuvelan et al., British Journal of Nutrition (2006), 96, pp. FOR THE PRODUCTION OF PINOSYLVIN 145-153. Roupe et al., Current Clinical Pharmacology, 2006, 1, pp. 81-101.* Abe, I., Watanabe, T. and Noguchi, H. (2004). “Enzymatic formation (75) Inventors: Michael Katz, Malmö (SE); Jochen of long-chain polyketide pyrones by plant type III polyketide Firster, Kobenhavn (DK); Helga David, synthases”. Phytochemistry. 6, 2447-2453. Kobenhavn (DK); Hans Peter Schmidt, Aggarwal BB, Bhardwaj A. Aggarwal RS. Seeram NP. Shishodia S. Holte (DK); Malin Sendelius, Lund Takada Y. (2004). “Role of resveratrol in prevention and therapy of (SE); Sara Peterson Bjorn, Lyngby cancer: preclinical and clinical studies'. Anticancer Res. 24, 1-60 (DK); Thomas Thomasen Durhuus, Review. Allina, S.M., Pri-Hadash, A., Theilmann, D.A., Ellis, B.E. and Kobenhavn (DK) Douglas, C.J. (1998) “4-coumarate: Coenzyme A ligase in hybrid poplar. Properties of enzymes, cDNA cloning, and analysis of recom (73) Assignee: Fluxome Sciences A/S, Lyngby (DK) binant clones”. Plant Physiol. 116, 743-754. Becker JV. Armstrong GO. van der Merwe MJ, Lambrechts MG, (*) Notice: Subject to any disclaimer, the term of this Vivier MA, Pretorius IS. (2003). "Metabolic engineering of Sac patent is extended or adjusted under 35 charomyces cerevisiae for the synthesis of the wine-related U.S.C. 154(b) by 519 days. antioxidant resveratrol'. FEMS Yeast Res. 4, 79-85. Chen DC. Beckerich JM, Gaillardin C. “One-step transformation of (21) Appl. No.: 12/374,659 the dimorphic yeast Yarrowia lipolytica." Appl Microbiol Biotechnol. 1997:48:232-5. Cochrane, F.C., Davin, L.B. and Lewis N.G. (2004). “The (22) PCT Filed: Jul.19, 2007 Arabidopsis phenylalanine ammonia lyase gene family: kinetic char acterization of the four PAL isoforms'. Phytochemistry 65, 1557 (86). PCT No.: PCT/EP2007/057484 1564. S371 (c)(1), Cordero Otero R. Gaillardin C., “Efficient selection of hygromycin B-resistant Yarrowia lipolytica transformants”. Appl Microbiol (2), (4) Date: Jun. 1, 2009 Biotechnol. 1996:46:143-8. Costa ML, Bedgar DL, Moinuddin SGA. Kim K. Cardenas CL. (87) PCT Pub. No.: WO2008/009728 Cochrane FC, Shockey J.M. Helms GL, Amakura Y. Takahashi Het PCT Pub. Date: Jan. 24, 2008 al., "Characterization in vitro and in vivo of the putative multigene 4-coumarate:CoA ligase network in Arabidopsis: Syringyllignin and (65) Prior Publication Data sinapatefsinapyl alcohol derivative formation”, Phytochemistry, 2005:66:2O72-2091. US 2009/0317881 A1 Dec. 24, 2009 Ehlting, J., Bittner, D., Wang, Q. Douglas, C.J., Somssich, I.E. and Kombrink, E. (1999). "Three 4-coumarate:coenzyme A ligases in (30) Foreign Application Priority Data Arabidopsis thaliana represents two evolutionary divergent classes in angiosperms”. The plant journal. 19, 9-20. Jul. 20, 2006 (GB) ...... 0614442.2 Fickers P. Le Dall MT, Gaillardin C, Thonart P. Nicaud JM., “New disruption cassettes for rapid gene disruption and marker rescue in the yeast Yarrowia lipolytica.” J Microbiol Methods. 2003:55:727 (51) Int. Cl. 37. CI2P 7/22 (2006.01) Gehlert, R., Schoppner, A. and Kindl, H. "Stilbene synthase from (52) U.S. Cl...... 435/156 Seedlings of Pinus Sylvestris purification and induction in response (58) Field of Classification Search ...... None to fungal infection'. Mol. Plant-Microbe Interaction 3 (1990) 444 See application file for complete search history. 449. (56) References Cited (Continued) U.S. PATENT DOCUMENTS Primary Examiner — Allison Ford 5,391,724 A 2f1995 Kindlet al. Assistant Examiner — Yvonne Pyla 5,500,367 A 3, 1996 Hain et al. (74) Attorney, Agent, or Firm — Iver P. Cooper 5,973,230 A 10, 1999 Kindlet al. 6,020,129 A 2/2000 Schroder et al. (57) ABSTRACT 7,604,968 B2 10/2009 Schmidt-Dannert et al. A genetically engineered micro-organism having an opera FOREIGN PATENT DOCUMENTS tive metabolic pathway producing cinnamoyl-CoA and pro JP 2005-53862 3, 2005 ducing pinosylvin therefrom by the action of a stilbene Syn KR 2004-0105110 12, 2004 thase is used for pinosylvin production. Said cinnamic acid WO WO 2006055322 8, 2006 may be formed from L-phenylalanine by a L-phenylalanine WO WO 2006089898 8, 2006 WO WO 20061249.99 11, 2006 ammonia lyase (PAL) which is one accepting phenylalanine WO WO 2006125 000 11, 2006 as a Substrate and producing cinammic acid therefrom, pref ZA 20048.194 10, 2004 erably such that if the PAL also accepts tyrosine as a substrate and forms coumaric acid therefrom, the ratio Km (phenylala OTHER PUBLICATIONS nine)/Km (tyrosine) for said PAL is less than 1:1 and if said Serazetdinova et al., Journal of Plant Physiology, 162 (2005), pp. micro-organism produces a cinammate-4-hydroxylase 985-10O2. enzyme (C4H), the ratio K(PAL)/K(C4H) is at least 2:1. Sengottuvelanet al., British Journal of Nutrition, 2006, 96, 145-153.* Roupe et al., Current Clinical Pharmacology, 2006, 1,81-101.* 27 Claims, 9 Drawing Sheets US 8,343,739 B2 Page 2

OTHER PUBLICATIONS Merkulov S. van Assema F. Springer J. Fernandez Del Carmen A. Gems, D., Johnstone, I.L. and Clutterhuck, A.J. (1991). "An autono Mooibroek H. Cloning and characterization of the Yarrowia mously replicating plasmid transforms Aspergillus nidulans at high lipolytica squalene synthase (SQSI) gene and functional frequency”. Gene 98, 61-67. complementation of the Saccharomyces cerevisiae erg9 mutation, Yest. 2000:16:197-206. Hain, R., Reif H.J., Krause, E., Langebartels, R., Kindl, H., Vornam, Mizutani M and Ohta D et al., 1998, “Two Isoforms of B., Wiese, W., Schmelzer, E., Schreier, P.H., Stocker, R.H. and NADPH:Cytochrome P450 Reductase in Arabidopsis thaliana. Gene Stenzel, K. (1993). Disease resistance results from foreign Structure, Heterologous Expression in Insect Cells, and Differential phytoalexin expression in a novel plant. Nature 361, 153-156. Regulation”, Plant Physiol. 116, 357-367. Hwang EL Kaneko M. OhnishiY. Horinouchi S. (2003). “Production Morita, H., Noguchi, H., Schröder, J. and Abe, I. (2001). “Novel of plant-specific flavanones by Escherichia coli containing an artifi polyketides synthesized with a higher plant stilbene synthase”. Eur:J. cial gene cluster'. Appl. Environ. Microbiol. 69,2699-706. Biochem. 268, 3759-3766. Hamberger, B. and Hahlbrock, K. (2004). “The 4-coumarate:CoA Müller S, Sandal T. Kamp-Hansen P. Dalbage H., "Comparison of ligase gene family in Arabidopsis thaliana comprises one rare, sinap expression systems in the yeasts Saccharomyces cerevisiae, ate-activating and three commonly occurring isoenzymes'. Proc. Hansenula polymorpha, Klyveromyces lactis, Schizosaccharomyces Natl. Acad. Sci. USA. 101, 2209-2214. pombe and Yarrowia lipolytica. Cloning of two novel promoters from Yarrowia lipolytica”. Yeast. 1998:14:1267-83. Hart, J. H. (1981), “Role of phytostilbenes in decay and disease Nicaud J.M. Madzak C. van den Broek P. Gysler C, Duboc P. resistance'. Annu. Rev. Phytopathology 19, 437-458. Niederberger P. Gaillardin C. "Protein expression and secretion in the Hart, J. H., Shrimpton, D. M. (1979). “Role of stilbenes in resistance yeast Yarrowia lipolytica''. FEMS Yeast Res. 2002:2:371-9. of wood to decay”. Phytopathology 69, 1138-1143. Pignède G. Wang HJ. Fudale F. Seman M. Gaillardin C, Nicaud J.M. Hemingway R.W., McGraw, G.W. and Barras, S. J. (1977). "Autocloning and amplification of LIP2 in Yarrowia lipolytica." “Polyphenols in Ceratocystis minor infected Pinus taeda: Fungal Appl. Environ Microbiol. 2000:66:3283-9. Metabolites, phloem and xylem phenols”. J. Agric. Food Chem... 25. Preisig-Muller, R., Sehwekendiek, A., Brehrn, I., Reif H.J. and 717-722. Kindl, H. (1999). “Characterization of a pine multigene family con Jeandet Petal, “Phytoalexins from the Vitaceae: biosynthesis... and taining elicitor-responsive stilbene synthase genes'. Plant Mol. Biol. metabolism”, Journal of Agricultural and food Chemistry, 50, No. 1999 39, 221-229. 10, 2731-2741. Pacher T. Seger C, Engelmeier D, Vajrodaya S, Hofer O. Greger H. (2002). "Antifungal stilbenoids from Stemona collinsae, 'JNat Prod. Jiang Hetal, "Metabolic engineering of the Phenylpropanoid path 65,820-827. way in Saccharomyces cerevisiae', Applied and environmental Raiber S, Schröder G. Schröder J. (1995). “Molecular and enzymatic Microbiology, Jun. 2005, 2962-2969. characterization of two stilbene synthases from Eastern white pine Juvvadi, P.R., Seshime, Y. Kitamoto, K. (2005). "Genomics reveals (Pinus strobus). A single Arg/His difference determines the activity traces of fungal phenylpropanoid-flavonoid metabolic pathway in the and the pH dependence of the enzymes'. FEBS Lett. 361,299-302. filamentous fungus Aspergillus oryzae, "J Microbiol. 43, 475-486. Richter, C., Wild, A. (1992). “Phenolic compounds in needles of Juretzek T. Le Dall M. Mauersberger S. Gaillardin C, Barth G. Norway spruce trees in relation to novel forest decline: I. Studies on Nicaud J., “Vectors for gene expression and amplification in the yeast trees from site of the Northern Black Forest”. Biochem. Biophys. Yarrowia lipolytica”. Yeast. 2001:18:97-113. Pfanz 188, 305-320. Kaneko, M. Ohnishi.Y. and Horinouchi, S., "Cinnamate:Coenzyine. Ro D.K., Douglas C.J. (2004). “Reconstitution of the entry point of A ligase from the Filamentous Bacteria Streptomyces coelicolor plant phenylpropanoid metabolism in yeast (Saccharomyces A3(2)”, J. Bact. 185, 20-27. (2003). cerevisiae): implications for control of metabolic flux into the Kindl, H. (1985) Biosynthesis of stilbenes. In Higuchi T. ed. phenylpropanoid pathway”. J. Biol. Chem. 279, 2600-2607. Biosynthesis and Biodegradation of Wood Components. Academic Rosemann, D., Helier, W. and Sandermann, H.(1991). “Biochemical Press, London, pp. 349-377. Plant Responses to Ozone. II. Induction of Stilbene Biosynthesis in Kodan, A., Kuroda, H. and Sakai, F. (2002). "A stilbene synthase Scots Pine (Pinus Sylvestris L.) Seedlings. Jr.” Plant Physiol. 97. from Japanese red pine (Pinus densiflora): Implications for 1280-1286. phytoalexin accumulationand down-regulation of flavonoid Roupe, K.A., Remsberg, C.M., Yáñez. J.A. and Davies, N.M. (2006). biosynthesis”. Proc. Natl. Acad. Sci. 99, 3335-3339. "Pharmacometrics of Stilbenes: Seguing Towards the Clinic'. Curr: Le Dall MT. Nicaud. JM, Gaillardin C., “Multiple-copy integration in Clin. Pharmac. 1, 81-101. the yeast Yarrowia lipolytica'. Curr Genet. 1994:26:38-44. Samappito, S. Page, J.E., Schmidt, J., De-Eknamkul. W. and Lee S.K. et al., “Antibacterial and antifungal activity of pinosylvin, a Kutchan, T.M. (2003). “Aromatic and pyrone polyketides synthe constituent of pine”, Fitoterapia 76 (2005) 258-260. sized by a stilbene synthase from Rheum tataricum". Phytochemistry 62,313-323. Lieutier, F. Sauvard, D., Brignolas, F. Picron, V.Yart, A., Bastien, C. Schanz, S., Schröder, G. and Schröder, J. (1992). .Stilbene synthase and Jay-Allemand, C. (1996) “Changes in phenolic metabolites of from Scot's pine (Pinus Sylvestris) FEBS Lett. 313, 71-74. Scots pine phloem induced by Ophiostoma brunneo-ciliatum, a bark Schöppner, A. and Kindl, H. (1984) “Purification and properties of a beetle-associated fungus'. Eur: J. For Pathol. 26, 145-158. Stilbene synthase from induced cell Suspension cultures of peanut'. J. Lindberg LE, Will for SM, Holmbom BR. (2004) “Antibacterial Biol. Chem. 259, 6806-6811. effects of knotwood extractives on paper mill bacteria'. J Ind Schröder G. Brown JWS, Schröder J. (1988). “Molecular analysis of Microbiol Biotechnol. 31, 137-147. resveratrol synthase. cDNA clones and relationship with chalcone Madzak C. Gaillardin C. Beckerich J.M., “Heterologous protein synthase”. Eur.J Biochem 172, 161-169. expression and secretion in the non-conventional yeast Yarrowia Seshime, Y. Juvvadi, P.R., Fujii, I. and Kitamoto, K. (2005). lipolytica: a review”. J Biotechnol. 2004: 109:63-81. "Genomic evidences for the existence of a phenylpropanoid meta Martin, V.J.J., Pitera, D.J. Withers, S.T., Newman, J.D. and Keasling, bolic pathway in Aspergillus Oryzue." Biochem. Biophys. Res Com J.D. (2003). “Engineering a mevalonate pathway in Escherichia coli mun. 337, 747-51. for production of terpenoids”. Nature biotechnology 21, 796-802. Skinnider, L. and Stoessl A. (1986). “The effect of the phytoalexins, Melchior F. Kindl H (1991), "Coordinate and elicitor dependent lubimin, (-)-maackiain, pinosylvin, and the related compounds expression of Stilbene synthase and phenylalanine ammonialyase dehydroloroglossol and hordatine M on human lymphoblastoid cell genes in Vitis cy. Optima.” Arch. Biochem. Biophy's 288, 552-557. lines”. Experientia 42, 568-570. Mellanen, P. Petanen, T., Lehtimaki, J., Makela, S., Bylund, G., Stojanovic, S., Sprinz, H. and Brede, O. (2001). “Efficiency and Holmbom, B. Mannila, E. Oikari, A. and Santti, R. (1996). “Wood mechanism of the anti-oxidant action of trans-resveratrol and its derived estrogens: Studies in vitro with breast cancer cell lines and in analogues in the radical liposome oxidation'. Arch. Biochem. vivo in trout'. Toxicol. App. Pharm. 136, 381-388. Biophy's. 391, 79-89. US 8,343,739 B2 Page 3

Suga T. Ohta. S., Munesada K. Ide N. Kurokawa M., Shimizu M., Verduyn C. Postma E. Scheffers WA, Van Dijken JP (1992). “Effect Ohta E. (1993). “Endogenous pine wood nematicidal substances in of benzoic acid on metabolic fluxes in yeasts: a continuous-culture pines, Pinus massoniana, P. strobus and P. palustris." study on the regulation of respiration and alcoholic fermentation'. Phytochemistry 33, 1395-1401. Yeast. 8,501-517. Tropf, S. Karcher, B., Schröder, G. and Schröder, J. (1995). “Reac Watts et al; Watts KT, Mits BN, Lee PC, Manning A.J. Schmidt tion mechanisms of homodimeric plant polyketide synthase Dannert C. (2006). “Discovery of a substrate selectivity Switch in (stilbenes and chalcone synthase). A single active site for the con tyrosine ammonia-lyase, a member of the aromatic amino acid lyase densing reaction is sufficient for synthesis of Stilbenes, chalcones, family”. Chem Biol. 13:1317-26. and 6'-deoxychalcones”. J. Biol. Chem. 270, 7922-7928. Wiese W. Vornam B. Krause E. Kindl H (1994). Structural organi Urban P. Wercek-Reichhart D, Teutsch HG. Durst F. Regnier S, Zation and differential expression of three Stilbene synthase genes Kazmaier M. Pompon D (1994). “Characterization of recombinant located on a 13 kb grapevine DNA fragment. Plant Mol Biol 26, plant cinnarnate 4-hydroxylase produced in yeast. Kinetic and spec 667-677. tral properties of the major plant P450 of the phenylpropanoid path way”. Eur, J Biochem. 222:843-50. * cited by examiner U.S. Patent Jan. 1, 2013 Sheet 1 of 9 US 8,343,739 B2

FIG. 1 U.S. Patent Jan. 1, 2013 Sheet 2 of 9 US 8,343,739 B2

L-phenylalanine

Cinnamic acid O2, NADPH

Coumaric acid ATP, CoA 4-COumaroyl-CoA

Malonyl-CoA CoA, CO2 C Sveratrol

FIG 2 U.S. Patent Jan. 1, 2013 Sheet 3 of 9 US 8,343,739 B2

L-phenylalanine

ES NH3 Cinnamic acid

ATP, CoA 8 ::: cinnamoyl-CoA

malonyl-CoA is CoA, CO2 <21 pinosylwin

FIG. 3 U.S. Patent Jan. 1, 2013 Sheet 4 of 9 US 8,343,739 B2

70 al Pinosylvin standard Pinosylvin 60 nanogram total

9 mir 6OO S. cerevisiae strain: FSSC-control (empty vectors) Supernatant

O : 9 tfit 2OOO ta S. cerevisiae strain: FSSC-PAL24CL1 VST1 Pinosylvin (From Grape) Supernatant

O X

20OO m S. cerevisiae Strain: pinosyviOS lin in f s | FSSC PAL24CWST | (From Grape) Cell extract

9 i U.S. Patent Jan. 1, 2013 Sheet 5 Of 9 US 8,343,739 B2

r U.S. Patent Jan. 1, 2013 Sheet 6 of 9 US 8,343,739 B2

FIG. 6A

Pinosylvin standard base peak chromatogram negative ESI

3 1200 Pinosylvin

800 Pinosylvin

400

O 5 10 15 20 m/z

FIG. 6B Pinosylvin standard negative ion trace at 21 1.0759 Da?e +/- 25 mDa

1400 g s 1200

1000

800 Pinosylvin

600

400

200

O 5 49 15 2O IZ. U.S. Patent Jan. 1, 2013 Sheet 7 of 9 US 8,343,739 B2

FIG. 6C

20000 - g n S. S. o is 5 c

15000 - NIS 8C st S ra wn wn sN 10000

5000

FIG 6D

16000 s y S. cerevisiae Strain: FSSC-PAL24CLVST o (From Grape) Supernatant negative ion trace at 21 1,0759 Da?e +/- 25 m Da 12000 Pinosylivin

U.S. Patent US 8,343,739 B2

US 8,343,739 B2 1. 2 METABOLICALLY ENGINEERED CELLS Pinosylvin is present in the wood pulp of eucalyptus-, FOR THE PRODUCTION OF PINOSYLVIN spruce- and pine trees such as Pinus Sylvestris, -densiflora.- taeda and -strobus. In pine species, the constitutive pino FIELD OF THE INVENTION Sylvin occurs exclusively in the heartwood (Kindl., 1985). However, the compound is induced in the sapwood, phloem, This invention relates generally to the production of the and needles as a response to wounding, fungal attack or polyphenol pinosylvin. Furthermore, it relates to the use of environmental stress Such as UV-radiation and oZone expo naturally occurring or recombinant micro-organisms that sure (Hart, 1981; Kindl., 1985; Richter and Wild, 1992: produce pinosylvin for production of food, feed and bever Lieutier et al., 1996; Rosemann et al., 1991). The compound ageS. 10 possesses potent anti-fungal activity against a wide assort ment of fungi (Lindberg et al., 2004: Pacher et al., 2002). BACKGROUND OF THE INVENTION Pinosylvin (FIG.1 trans-form) consists of two closely con nected phenol rings and belongs therefore to the polyphenols. Production of chemicals from micro-organisms has been Unlike most other hydroxy stilbenes, pinosylvin lacks a an important application of biotechnology. Typically, the 15 hydroxyl group in ring B (FIG. 1) and originates by conden steps in developing Such a bio-production method may sation of unsubstituted cinnamoyl-CoA with three molecules include 1) selection of a proper micro-organism host, 2) of malonyl-CoA. That said, pinosylvin is structurally similar elimination of metabolic pathways leading to by-products, 3) to the tri-hydroxy stilbene resveratrol, which is found in red deregulation of desired pathways at both enzyme activity wine (Aggarwal et al., 2004). Much data has been generated level and the transcriptional level, and 4) overexpression of demonstrating the health benefits of resveratrol. For instance appropriate enzymes in the desired pathways. In preferred resveratrol’s potent anticancer activity across many cancer aspects, the present invention has employed combinations of cell lines has well been established (Aggarwal et al., 2004). the steps above to redirect carbon flow from phenylalanine Given the similarity in structure with resveratrol, it is antici through enzymes of the plant phenylpropanoid pathway pated that pinosylvin possesses potent health benefits as well. which supplies the necessary precursor for the desired bio 25 Indeed pinosylvin’s effect on various cancers, including col synthesis of pinosylvin. orectal- and liver cancers, has been studied, and has indicated Pinosylvin (or pinosylvine or 3,5-dihydroxy-trans-stil it’s chemopreventative- and anti-leukemic activity (Skin bene) is a phytophenol belonging to the group of stilbene nider and Stoessl., 1986; Mellanen et al., 1996; Roupe et al., phytoalexins, which are low-molecular-mass secondary 2005 and 2006). Moreover, pinosylvin has anti-oxidant metabolites that constitute the active defence mechanism in 30 capacity as well, though to a lesser extent than, for instance, plants in response to infections or other stress-related events. resveratrol (Stojanovic et al., 2001). Stilbene phytoalexins contain the stilbene skeleton (trans-1, Presently, pinosylvin is mostly obtained in a mixture of 2-diphenylethylene) as their common basic structure: that various flavonoids that is extracted from the bark of pine. Said may be Supplemented by addition of other groups as well extraction is a labour intensive process with a low yield. In (Hart and Shrimpton, 1979, Hart, 1981). Stilbenes have been 35 preferred aspects, the present invention provides novel, more found in certain trees (angio-sperms, gymnosperms), but also efficient and high-yielding production processes. in Some herbaceous plants (in species of the Myrtaceae, Vita In plants, the phenylpropanoid pathway is responsible for ceae and Leguminosae families). Said compounds are toxic to the synthesis of a wide variety of secondary metabolic com pests, especially to fungi, bacteria and insects. Only few pounds, including lignins, Salicylates, coumarins, hydroxy plants have the ability to synthesize stilbenes, or to produce 40 cinnamic amides, pigments, flavonoids and phytoalexins. them in an amount that provides them sufficient resistance to Indeed formation of stilbenes in plants proceeds through the pests. phenylpropanoid pathway. The amino acid L-phenylalanine The synthesis of the basic stilbene skeleton is pursued by is converted into trans-cinnamic acid through the non-oxida stilbene syntheses, which comprises a small gene family in tive deamination by L-phenylalanine ammonia lyase (PAL) most species examined (Kodan et al. 2002). Stilbene synthe 45 (FIG. 2). From trans-cinnamic acid the pathway can branch ses appear to have evolved from chalcone syntheses, and into a resveratrol-forming route or into a pinosylvin forming belong to a polyketide synthase (PKS) superfamily that share route. In the first route trans-cinnamic acid is hydroxylated at more than 65% amino acid homology. Unlike the bacterial the para-position to 4-coumaric acid (4-hydroxycinnamic PKSs, both stilbene- and chalcone syntheses function as uni acid) by cinnamate-4-hydroxylase (C4H), a cytochrome modular PKSs with a single active site, forming relatively 50 P450 monooxygenase enzyme, in conjunction with NADPH: small homodimers (Tropfet al., 1995). Stilbene- and chal cytochrome P450 reductase (CPR). Subsequently, 4-cou cone syntheses use common Substrates, three malonyl-CoAS maric acid, is then activated to 4-coumaroyl-CoA by the and one cinnamoyl-CoA/p-coumaroyl-CoA, forming their action of 4-coumarate-CoA ligase (4CL). A resveratrol Syn products with similar reaction mechanisms (Kindl., 1985). thase (VST1), can then catalyze the condensation of a phe Stilbene syntheses can be classified into either a 4-couma 55 nylpropane unit of 4-coumaroyl-CoA with malonyl CoA, royl-CoA-specific type that has its highest activity with resulting in formation of resveratrol. In the latter route trans 4-coumaroyl-CoA as Substrate. Such as resveratrol synthase cinnamic acid is directly activated to cinnamoyl-CoA by the (EC 2.3.1.95), or a cinnamoyl-CoA-specific type that has its action of 4CL where a pinosylvin synthase (PST) subse highest activity with cinnamoyl-CoA as Substrate. Such as quently catalyzes the condensation of a phenylpropane unit of pinosylvin Synthase (EC 2.3.1.146). Genes encoding resvera 60 cinnamoyl-CoA with malonyl CoA, resulting information of trol syntheses have been described earlier for peanut (Arachis pinosylvin. hypogaea) (Schöppner and Kindl., 1984; Schröder et al., Stilbene synthases are rather promiscuous enzymes that 1988) and grapevine (Vitis vinifera) (Melchior and Kindl, can accept a variety of physiological and non-physiological 1991; Wiese et al., 1994) whereas genes encoding pinosylvin Substrates. For instance, addition of various phenylpropanoid synthase have been mostly described for pine (Pinus Sylves 65 CoA starteresters led to formation of several products invitro tris and -strobus) (Schanz et al., 1992; Raiber et al., 1995; (Ikuro et al., 2004: Morita et al., 2001). Likewise it has been Kodan et al., 2002: Hemingway et al., 1977). shown that resveratrol synthase from rhubarb (Rheum tartari US 8,343,739 B2 3 4 cum) indeed synthesized a small amount of pinosylvin when ligated coenzyme A to both trans-cinnamic acid and 4-cou cinnamoyl-CoA was used as Substrate instead of coumaroyl maric acid. In addition, the PAL from Rhodotorula rubra uses CoA (Samappito et al., 2003). both phenylalanine and tyrosine as the substrates. Therefore, Similarly, coumaroyl-CoA ligase can accept both cou E. coli cells containing the gene clusters and grown on glu maric acid and cinnamic acid as Substrate, albeit with a cata cose, produced Small amounts of two flavanones, pinocem lytic efficiency (K/K) that is 100 times less for cinnamic brin (0.29 g/l) from phenylalanine and naringenin (0.17 g/l) acid compared to coumaric acid (Allina et al., 1998; Ehlting from tyrosine. In addition, large amounts of their precursors, et al., 1999). We deduced from the above that it would be 4-coumaric acid and trans-cinnamic acid (0.47 and 1.23 possible to produce pinsoSylvin in a pathway that would mg/liter respectively), were accumulated. Moreover, the consist of a 4CL and a stilbene synthase, even one that is 10 yields of these compounds could be increased by addition of designated as a classical resveratrol synthase. phenylalanine and tyrosine. Recently, a yeast was disclosed that could produce resvera Also described are studies in which the enzyme properties trol from coumaric acid that is found in Small quantities in of pinosylvin Syntheses are studied by first cloning the genes grape must (Becker et al. 2003, ZA200408194). The produc into Escherichia coli. For instance, Raiber et al., 1995 report tion of 4-coumaroyl-CoA from exogenous 4-coumaric acid, 15 on stilbenes from Pinus strobus (Eastern white pine) that were and concomitant resveratrol, in laboratory strains of S. Cer investigated after heterologous expression in Escherichia evisiae, was achieved by co-expressing a heterologous coen coli. For this a P. Strobus cloNA library was screened with a Zyme-Aligase gene, from hybrid poplar, together with the stilbene synthase (STS) probe from Pinus Sylvestris and grapevine resveratrol synthase gene (VST1). The other sub amongst the isolated cDNAs two closely related STS genes, strate for resveratrol synthase, malonyl-CoA, is already STS1 and STS2, were found with five amino acid differences endogenously produced in yeast and is involved in de novo in the proteins. The genes were cloned on a plasmid and fatty-acid biosynthesis. The study showed that cells of S. expressed into E. coli, and cell extracts were subjected to cerevisiae could produce minute amounts of resveratrol, enzyme assays. It appeared that both proteins accepted cin either in the free form or in the glucoside-bound form, when namoyl-CoA as a Substrate and thus were considered as pino cultured in synthetic media that was Supplemented with 25 Sylvin syntheses, however they revealed large differences. 4-coumaric acid. STSI had only 3-5% of the activity of STS2, and its pH Given the promiscuity of the resveratrol synthase, it may be optimum was shifted to lower values (pH 6), and it synthe that said yeast could produce pinosylvin as well when fed sized with cinnamoyl-CoA a second unknown product. Site with Substantial amounts of cinnamic acid. However, com directed mutagenesis demonstrated that a single Arg-to-His mercial application of such a yeast would be hampered by the 30 exchange in STS1 was responsible for all of the differences. probable low pinosylvin yield, and the need for addition of In another study three STS cDNAs (PDSTS1, PDSTS2, and cinnamic acid, which is not abundantly present in industrial PDSTS3) from Pinus densiflora were isolated and the cDNAs media. Hence, to accelerate and broaden the application of were heterologously expressed in E. coli to characterize their pinosylvin as both a pharmaceutical and neutraceutical, it is enzymatic properties (Kodan et al., 2002). PDSTS3 appeared highly desirable to provide a yeast or other micro-organism 35 to be an unusual STS isozyme that showed the highest pino that can produce pinosylvin directly from glucose, without Sylvin-forming activity among the STSs tested. Furthermore, addition of cinnamic acid or any downstream cinnamic acid PDSTS3 was insensitive to product inhibition unlike derivative Such as cinnamoyl-CoA. PDSTS1 and PDSTS2. The unusual characteristics of A recent study (Ro and Douglas, 2004) describes the PDSTS3 could be ascribed to a lack of a C-terminal extension reconstitution of the entry point of the phenylpropanoid path 40 that normally is common to stilbene syntheses, which was way in S. cerevisiae by introducing PAL, C4H and CPR from caused by a frame-shift mutation. In yet another study a Poplar. The purpose was to evaluate whether multienzyme genomic DNA library was screened with pinosylvin synthase complexes (MECs) containing PAL and C4Harefunctionally cDNA pSP-54 as a probe (Mülleret al., 1999). After subclon important at this entry point into phenylpropanoid metabo ing, four different members were characterized by sequenc lism. By feeding the recombinant yeast with 3H]-phenyla 45 ing. The amino acid sequences deduced from genes PST-1, lanine it was found that the majority of metabolized 3H PST-2. PST-3 and PST-5 shared an overall identity of more phenylalanine was incorporated into 4-3H-coumaric acid, than 95%. and that phenylalanine metabolism was highly reduced by Differences in promoter strength were then analysed by inhibiting C4H activity. Moreover, PAL-alone expressers transient expression in tobacco protoplasts. Constructs used metabolized very little phenylalanine into cinnamic acid. 50 contained the bacterial-glucuronidase under the control of the When feeding 3H]-phenylalanine and 14C-trans-cinnamic promoters of pine genes PST-1, PST-2 and PST-3. Upon acid simultaneously to the triple expressers, no evidence was treatment with UV light or fungal elicitor, the promoter of found for channeling of the endogenously synthesized 3H PST-1 showed highest responsiveness and led to tissue-spe trans-cinnamic acid into 4-coumaric acid. Therefore, efficient cific expression in vascular bundles. The data Suggest that in carbon flux from phenylalanine to 4-coumaric acid via reac 55 pine the gene product of PST-1 is responsible for both the tions catalyzed by PAL and C4H does not appear to require stress response in seedlings and pinosylvin formation in the channeling through a MEC in yeast, and sheer biochemical heartwood. coupling of PAL and C4H seems to be sufficient to drive A further study showed that a stilbene synthase cloned carbon flux into the phenylpropanoid pathway. In yet another from Scots pine (Pinus Sylvestris) was earlier abortively study (Hwang et al., 2003) production of plant-specific fla 60 assigned as a dihydropinosylvin Synthase, while it showed to Vanones by Escherichia coli was achieved through expression be a pinosylvin Synthase. The previous mis-interpretation of an artificial gene cluster that contained three genes of a was caused by the influence of bacterial factors on the sub phenyl propanoid pathway of various heterologous origins; strate preference and the activity of the plant-specific protein PAL from the yeast Rhodotorula rubra, 4CL from the acti that was expressed in E. coli. After improvement of the nomycete Streptomyces coelicolor, and chalcone synthase 65 expression system, the Subsequent kinetic analysis revealed (CHS) from the licorice plant Glycyrrhiza echinata. These that cinnamoyl-CoA rather than phenylpropionyl-CoA was pathways bypassed C4H, because the bacterial 4CL enzyme the preferred substrate of the cloned stilbene synthase. Fur US 8,343,739 B2 5 6 thermore, extracts from P. Sylvestris contained factor(s) that Generally herein, unless the context implies otherwise, selectively influenced the substrate preference, i.e. the activ references to pinosylvin include reference to oligomeric or ity was reduced with phenylpropionyl-CoA, but not with glycosidically bound derivatives thereof. cinnamoyl-CoA. This explained the apparent differences Thus, in certain preferred embodiments, said stilbene syn between plant extracts and the cloned enzyme expressed in E. thase is a resveratrol synthase (EC 2.3.1.95) from a plant coli and cautions that factors in the natural and the new hosts belonging to the genus of Arachis, e.g. A. glabatra, A. may complicate the functional identification of cloned hypogaea, a plant belonging to the genus of Rheum, e.g. R. Sequences. tataricum, a plant belonging to the genus of Vitus, e.g. V. Furthermore, vectors are described with stilbene synthase labrusca, V. riparaia, V. vinifera, or any one of the genera 10 Pinus, Piceea, Lilium, Eucalyptus, Parthenocissus, Cissus, genes, which can mean resveratrol synthase and pinosylvin Calochortus, Polygonum, Gnetum, Artocarpus, Nothofagus, synthase, for the transformation of organisms and plants to Phoenix, Festuca, Carex, Veratrum, Bauhinia or Pterolo confer enhanced resistance against pests and wounding bium. (EP0309862 and EP0464461). The stilbene synthase may be one which exhibits a higher Also, further vectors are described that contain DNA 15 turnover rate with cinnamoyl-CoA as a Substrate than it does sequences that will hybridise to pinosylvin synthase of Pinus with 4-coumaroyl-CoA as a Substrate, e.g. by a factor of at Sylvestris (U.S. Pat. No. 5.391,724) and said vectors to be least 1.5 or at least 2. Thus, in further preferred embodiments, used for expression in a plant (U.S. Pat. No. 5,973,230). The said stilbene synthase is a pinosylvin synthase, Suitably from incorporation of PAL and 4CL together with a stilbene syn a tree species such as a species of Pinus, Eucalyptus, Picea or thase for the production of pinosylvin in a organism is not Maclura. In particular, the stilbene synthase may be a pino however disclosed. Nor are any pinosylvin producing micro Sylvin synthase (EC 2.3.1.146) from a plant belonging to the organisms. genus of Pinus, e.g. P. Sylvestris, P Strobes, P. densiflora, P. Recently, evidence was shown that the filamentous fungi A. taeda, a plant belonging to the genus of Picea, or any one of Oryzae contained the enzyme chalcone synthase (CHS) that is the genus Eucalyptus. normally involved in the biosynthesis of flavonoids, such as 25 Preferably, said cinnamic acid may be produced from naringenin, in plants (Juvvadi et al., 2005: Seshime et al., L-phenylalanine in a reaction catalysed by an enzyme in 2005). Indeed it was also shown that A. oryzae contained the which ammonia is produced and Suitably said cinnamic acid major set of genes responsible for phenylpropanoid-fla is formed from L-phenylalanine by a phenylalanine ammonia vonoid metabolism, i.e PAL, C4H and 4CL. However, there is lyase. no evidence that A. Oryzae contains a stilbene synthase. 30 In certain preferred embodiments, said L-phenylalanine Our co-pending application WO2006/089898 describes ammonia lyase is a L-phenylalanine ammonia lyase (EC resveratrol producing micro-organisms, especially yeasts. 4.3.1.5) from a plant or a micro-organism. The plant may belong to the genus of Arabidopsis, e.g. A. thaliana, a plant SUMMARY OF THE INVENTION belonging to the genus of Brassica, e.g. B. napus, B. rapa, a 35 plant belonging to the genus of Citrus, e.g. C. reticulate, C. The present invention now provides a micro-organism hav clementinus, C. limon, a plant belonging to the genus of ing an operative metabolic pathway comprising at least one Phaseolus, e.g. P. coccineus, P. vulgaris, a plant belonging to enzyme activity producingpinosylvin from cinnamic acid. In the genus of Pinus, e.g. P. banksiana, P. monticola, P. pinas preferred micro-organisms said pathway produces cinnamic ter, P. Sylvestris, P. taeda, a plant belonging to the genus of acid and produces pinosylvin therefrom. Especially, the 40 Populus, e.g. P balsamifera, P. deltoides, P. Canadensis, P invention provides the use of Such micro-organisms in pro kitakamiensis, P tremuloides, a plant belonging to the genus ducing pinosylvin. Such a micro-organism may be naturally of Solanum, e.g. S. tuberosum, a plant belonging to the genus occurring and may be isolated by Suitable screening proce of Prunus, e.g. P. avium, P. persica, a plant belonging to the dures such as degenerate PCR, Southern blotting and in silico genus of Vitus, e.g. Vitus vinifera, a plant belonging to the homology searches, but more preferably is genetically engi 45 genus of Zea, e.g. Z. may’s or other plant genera e.g. neered. Agastache, Ananas, Asparagus, Bromheadia, Bambusa, The invention includes methods of producing pinosylvin Beta, Betula, Cucumis, Camelia, Capsicum, Cassia, Catha from Such micro-organisms, and optionally isolating or puri ranthus, Cicer; Citrullus, Coffea, Cucurbita, Cynodon, Dau fying pinosylvin thereby produced. The culturing is prefer cus, Dendrobium, Dianthus, Digitalis, Dioscorea, Eucalyp ably conducted in the substantial absence of an external 50 tus, Gallus, Ginkgo, Glycine, Hordeum, Helianthus, Source of cinnamic acid. This implies also, the Substantial Ipomoea, Lactuca, Lithospermum, Lotus, Lycopersicon, absence of an external source of derivatives of cinnamic acid Medicago, Malus, Manihot, Medicago, Mesembryanthe formed therefrom in the phenylpropanoid pathway Such as mum, Nicotiana, Olea, Oryza, Pisum, Persea, Petroselinum, cinnamoyl-CoA. Phalaenopsis, Phyllostachys, Physcomitrella, Picea, Pyrus, 55 Quercus, Raphanus, Rehmannia, Rubus, Sorghum, Sphenos DETAILED DESCRIPTION OF PREFERRED tylis, Stellaria, Stylosanthes, Triticum, Trifolium, Triticum, EMBODIMENTS Vaccinium, Vigna, Zinnia. The micro-organism might be a fungus belonging to the genus Agaricus, e.g. A. bisporus, a Preferably, said pinosylvin or derivative is produced in a fungus belonging to the genus Aspergillus, e.g. A. Oryzae, A. reaction catalysed by an enzyme in which endogenous malo 60 nidulans, A. fumigatus, a fungus belonging to the genus Usti nyl-CoA is a Substrate, and preferably said pinosylvin is lago, e.g. U. maydis, a bacterium belonging to the genus produced from cinnamoyl-CoA. Rhodobacter, e.g. R. capsulatus, a bacterium belonging to the Said pinosylvin or derivative is preferably produced from genus Streptomyces, e.g. S. maritimus, a bacterium belonging cinnamoyl-CoA, preferably by a stilbene synthase synthase to the genus Photorhabdus, e.g. P. luminescens, a yeast which preferably is expressed in said micro-organism from 65 belonging to the genus Rhodotorula, e.g. R. rubra. nucleic acid coding for said enzyme which is not native to the Because, as described above, for the production of pino micro-organism. Sylvin we require production of cinnamic acid by a PAL US 8,343,739 B2 7 8 enzyme and also its conversion on to pinosylvin rather than In the case of a recombinant or natural organism with either the production of coumaric acid from tyrosine by a several PALS/TALs and C4H one can prepare a cell extract Substrate promiscuous PAL or by conversion ofcinnamic acid and measure the apparent catalytic turnover rates and Km by a C4H enzyme, micro-organisms for use in the invention values as a Sum total (or aggregated enzyme) apparent preferably have a PAL which favours phenylalanine as a enzyme PAL, TAL or C4H. From these estimated sum prop Substrate (thus producing cinnamic acid) over tyrosine (from erties it will be possible to determine if the organism will which it would produce coumaric acid). Preferably, therefore, produce mainly coumaric acid or cinnamic acid and thus the ratio K.(phenylalanine)/K(tyrosine) for the PAL is less which product resveratrol or pinosylvin would be the out than 1:1, preferably less 1:5, e.g. less than 1:10. As usual, K. come when 4CL and VST are expressed in this organism. The 10 turnover rate will now be expressed as moles product/(mole is the molar concentration of the Substrate (phenylalanine or total protein/time) instead of when using pure enzymes moles tyrosine respectively) that produces half the maximal rate of product/(mol pure enzyme/time). Therefore, the preferred product formation (V). ratio K.(phenylalanine)/K(tyrosine) for the PAL less than The presence of C4H is not helpful to the production of 1:1 can be applied to the aggregate PAL activity where more pinosylvin, but need not beforbidden provided that the diver 15 than one PAL is present and the preferred ratio K(PAL)/ sion of cinnamic acid away from pinosylvin production K(C4H) greater than 2 can be applied to the aggregate of toward formation of resveratrol via coumaric acid is not the PAL and/or C4H activity (as modulated by CPR) where excessive. Therefore, preferably C4H production is either more than one PAL and/or C4H activity is present. absent or such that K(PAL)/K(C4H) is greater than 2, Preferably, the micro-organism has no exogenous C4H, i.e. preferably greater than 4. As usual, in each case, K is has not been genetically modified to provide expression of a V/Enzyme, where Enzyme is the concentration of the C4H enzyme. Any C4H production there may then be will be relevant enzyme. native to the organism. Optionally, the micro-organism with By way of illustration, typical Km values for A. thaliana out exogenous C4H may also lack endogeous C4H. Lack of phenylalanine ammonia lyase PAL2 and its homologue endogenous C4H may be due to a native C4H capability PALL are around 60 uM with phenylalanine as substrate 25 having been deleted by genetic engineering or gene silencing (Cochrane et al., 2004) and more than 1000 uM when using methods or simply because the organism naturally lacks the tyrosine as substrate (Watts et al., 2006). The catalytic turn C4H genes, since the enzyme is not part of its metabolism. over rate K for A. thaliana PAL2 is 192 mol cinnamic Also, as seen above, the presence of CPR is not helpful to acid/mole enzyme PAL2 when converting phenylalanine to the production of pinosylvin and its overexpression, while not cinnamic acid (Cochraneetal, 2004) but K is minute for the 30 forbidden is not generally desirable. Accordingly, the micro conversion of tyrosine to coumaric acid. A PAL with the organism preferably has no endogenous CPR, no exogenous above kinetic properties is specific for phenylalanine as sub CPR or has no overexpression of native CPR, or may have strate and gives exclusively cinnamic acid formation from reduced expression of native CPR. phenylalanine and undetectable levels of coumaric acid from Suitably, said L-phenylalanine ammonia lyase is expressed tyrosine. 35 in said micro-organism from nucleic acid coding for said The typical turnover rate for the hydroxylase reaction cata enzyme which is not native to the micro-organism. lyzed by C4H is 25 moles coumaric acid product/mole Preferably, cinnamoyl-CoA is formed in a reaction cataly enzyme/minute when native yeast CPR activity supports the sed by an enzyme in which ATP and CoA are substrates and reaction (Urban et al., 1994). The activity of C4H may be ADP is a product and suitably cinnamoyl-CoA is formed in a limited by NADPH availability and this may be increased if 40 reaction catalysed by a 4-coumarate-CoA ligase (also the enzyme cytochrome P450 hydroxylase (CPR) is overex referred to as 4-coumaroyl-CoA ligase). Known 4-couma pressed. If CPR is overexpressed as exemplified in the litera rate-CoA ligase enzymes accept either 4-coumaric acid or ture by 5 to 20 times (Mizutani et al., 1998, Urban et al., 1994) cinnamic acid as Substrates and produce the corresponding the catalytic turnover rates for the C4H reaction converting CoA derivatives. Generally, such enzymes are known as cinnamic acid to coumaric acid increases to 125 mole cou 45 4-coumarate-CoA ligase whether they show higher activity maric acid product/mole enzyme/minute and 530 mole cou with 4-coumaric acid as Substrate or with cinnamic acid as maric acid product/mole enzyme? minute, respectively. substrate. However, we refer here to enzymes having that The outcome of the combined reaction PAL-C4H-CPR Substrate preference as cinnamate-CoA ligase enzymes (or will depend on the catalytic numbers and the amount of each cinnamoyl-CoA-ligase). One such enzyme is described for enzyme present, especially the amount of CPR Supporting the 50 instance in Aneko et al., 2003. electron donation, NADPH, for the C4H. An efficient PAL Said 4-coumarate-CoA ligase or cinnamate-CoA ligase will give ca 192 moles cinnamic acid/mole PAL/minute and may be a 4-coumarate-CoA ligase?cinnamate-CoA ligase the C4H enzyme following in the sequence will convert ca 25 (EC 6.2.1.12) from a plant, a micro-organism or a nematode. moles of this cinnamic acid/mole C4H/minute into coumaric The plant may belong to the genus of Abies, e.g. A. beshan acid with native CPR activity. Thus the dominant product 55 Zuensis, B. firma, B. holophylla, a plant belonging to the from the combined reaction PAL-C4H-CPR will be cinnamic genus of Arabidopsis, e.g. A. thaliana, a plant belonging to acid (167 moles cinnamic acid/mole PAL enzyme/minute and the genus of Brassica, e.g. B. napus, B. rapa, B. Oleracea, a 25 moles coumaric acid/mole enzyme C4H/minute with plant belonging to the genus of Citrus, e.g. C. Sinensis, a plant native CPR activity. Higher CPR activity will lead to more belonging to the genus of Larix, e.g. L. decidua, L. gmelinii, C4H activity per mole C4H enzyme and ultimately to pure 60 L. griffithiana, L. himalaica, L. kaempferi, L. laricina, L. coumaric acid if overexpressed at high levels. A CPR over mastersiana, L. Occidentalis, L. potaninii, L. Sibirica, L. Spe expressed only five times as in the Mizutani paper (Mizutani ciosa, a plant belonging to the genus of Phaseolus, e.g. P et al., 1998) would result in 125 moles coumaric acid/mole acultifolius, P. coccineus, a plant belonging to the genus of C4H/minute and only 67 moles cinnamic acid would be the Pinus, e.g. P armandii P. banksiana, P. pinaster, a plant result from the PAL per minute. Thus the CPR must at least be 65 belonging to the genus of Populus, e.g. P. balsamifera, P overexpressed ca 8 times for (undesired) pure coumaric acid tomentosa, P tremuloides, a plant belonging to the genus of production. Solanum, e.g. S. tuberosum, a plant belonging to the genus of US 8,343,739 B2 10 Vitus, e.g. Vitus vinifera, a plant belonging to the genus of metabolite in a reaction catalysed by a second enzyme in Zea, e.g. Z. mays, or other plant genera e.g. Agastache, Amor which ATP and CoA is a substrate, and ADP is a product, and pha, Cathaya, Cedrus, Crocus, Festuca, Glycine, Juglans, in which said third metabolite is transformed into a fourth Keteleeria, Lithospermum, Lolium, Lotus, Lycopersicon, metabolite in a reaction catalysed by a third enzyme in which Malus, Medicago, Mesembryanthemum, Nicotiana, Nothot endogenous malonyl-CoA is a Substrate. suga, Oryza, Pelargonium, Petroselinum, Physcomitrella, The micro-organisms described above include ones con Picea, Prunus, Pseudollarix, Pseudotsuga, Rosa, Rubus, taining one or more copies of a heterologous DNA sequence Ryza, Saccharum, Suaeda, Thelungiella, Triticum, Tsuga. encoding phenylalanine ammonia lyase operatively associ The micro-organism might be a filamentous fungi belonging ated with an expression signal, and containing one or more to the genus Aspergillus, e.g. A. flavus, A. nidulans, A. Oryzae, 10 copies of a heterologous DNA sequence encoding 4-couma A. fumigatus, a filamentous fungus belonging to the genus rate-CoA-ligase or cinnamate-CoA ligase operatively associ Neurospora, e.g. N. Crassa, a fungus belonging to the genus ated with an expression signal, and containing one or more Yarrowia, e.g. Y lipolytica, a fungus belonging to the genus of copies of a heterologous DNA sequence encoding a stilbene Mycosphaerella, e.g. M. graminicola, a bacterium belonging synthase, which may be resveratrol synthase, operatively to the genus of Mycobacterium, e.g. M. bovis, M. leprae, M. 15 associated with an expression signal. tuberculosis, a bacterium belonging to the genus of Neisseria, Alternatively, the micro-organisms described above e.g. N. meningitidis, a bacterium belonging to the genus of include ones containing one or more copies of a heterologous Streptomyces, e.g. S. coelicolor, a bacterium belonging to the DNA sequence encoding phenylalanine ammonia lyase genus of Rhodobacter, e.g. R. Capsulatus, anematode belong operatively associated with an expression signal, and contain ing to the genus Ancylostoma, e.g. A. Ceylanicum, a nematode ing one or more copies of a heterologous DNA sequence belonging to the genus Caenorhabditis, e.g. C. elegans, a encoding 4-coumarate-CoA-ligase or cinnamate-CoA ligase nematode belonging to the genus Haemonchus, e.g. H. Con operatively associated with an expression signal, and contain tortus, a nematode belonging to the genus Lumbricus, e.g. L. ing one or more copies of a heterologous DNA sequence rubellus, a nematode belonging to the genus Meilodogyne, encoding pinosylvin Synthase operatively associated with an e.g. M. hapla, a nematode belonging to the genus Strongyloi 25 expression signal. dus, e.g. S. ratti, S. Stercoralis, a nematode belonging to the In the present context the term “micro-organism' relates to genus Pristionchus, e.g. P. pacificus. microscopic organisms, including bacteria, microscopic Whilst the micro-organism may be naturally occurring, fungi, including yeast. preferably at least one copy of at least one genetic sequence More specifically, the micro-organism may be a fungus, encoding a respective enzyme in said metabolic pathway has 30 and more specifically a filamentous fungus belonging to the been recombinantly introduced into said micro-organism. genus of Aspergillus, e.g. A. niger; A. awamori, A. Oryzae, A. Additionally or alternatively to introducing coding nidulans, a yeast belonging to the genus of Saccharomyces, sequences coding for a said enzyme, one may provide one or e.g. S. cerevisiae, S. kluyveri, S. bayanus, S. exiguus, S. more expression signals, such as promoter sequences, not sevazzi, S. uvarum, a yeast belonging to the genus Kluyvero natively associated with said coding sequence in said organ 35 myces, e.g. K. lactis K. marxianus var. marxianus, K. ther ism. Thus, optionally, at least one copy of a genetic sequence motolerans, a yeast belonging to the genus Candida, e.g. C. encoding a L-phenylalanine ammonia lyase is operatively utilis C. tropicalis, C. albicans, C. lipolytica, C. versatilis, a linked to an expression signal not natively associated with yeast belonging to the genus Pichia, e.g. P. stipidis, P. pas said genetic sequence in said organism. toris, P Sorbitophila, or other yeast genera, e.g. Cryptococ Expression signals include nucleotide sequences located 40 cus, Debaronryces, Hansenula, Pichia, Yarrowia, Zygosac upstream (5' non-coding sequences), within, or downstream charonryces or Schizosaccharonryces. Concerning other (3' non-coding sequences) of a coding sequence, and which micro-organisms a non-exhaustive list of suitable filamentous influence the transcription, RNA processing or stability, or fungi is Supplied: a species belonging to the genus Penicilli translation of the associated coding sequence. Such urn, Rhizopus, Fusariurn, Fusidium, Gibberella, Mucor, sequences may include promoters, translation leader 45 Mortierella, Trichoderma. sequences, introns, and polyadenylation recognition Concerning bacteria a non-exhaustive list of Suitable bac Sequences. teria is given as follows: a species belonging to the genus Optionally, at least one copy of a genetic sequence encod Bacillus, a species belonging to the genus Escherichia, a ing a 4-coumarate-CoA ligase or cinnamate-CoA ligase, species belonging to the genus Lactobacillus, a species whether native or not, is operatively linked to an expression 50 belonging to the genus Lactococcus, a species belonging to signal not natively associated with said genetic sequence in the genus Corynebacterium, a species belonging to the genus said organism. Acetobacter, a species belonging to the genus Acinetobacter, Optionally, at least one copy of a genetic sequence encod a species belonging to the genus Pseudomonas, etc. ing a stilbene synthase, which may be a resveratrol synthase, The preferred micro-organisms of the invention may be S. whether native or not, is operatively linked to an expression 55 cerevisiae, A. niger, A. Oryzae, E. coli, L. lactis or B. subtilis. signal not natively associated with said genetic sequence in The constructed and engineered micro-organism can be said organism. cultivated using commonly known processes, including Optionally, at least one copy of a genetic sequence encod chemostat, batch, fed-batch cultivations, etc. ing a pinosylvin Synthase, whether native or not, is opera Thus, the invention includes a method for producing pino tively linked to an expression signal not natively associated 60 Sylvin comprising contacting a micro-organism cell with a with said genetic sequence in said organism. carbon substrate in the substantial absence of an external In certain aspects the invention provides a metabolically Source of cinnamic acid, said cell having the capacity to engineered micro-organism of the kind described, having an produce pinosylvin under the conditions, in which the micro operative metabolic pathway in which a first metabolite is organism may be selected from the group consisting of fungi transformed into a second metabolite in a reaction catalysed 65 and bacteria, especially yeast. by a first enzyme, said reaction step producing ammonia, and Pinosylvin so produced may optionally be isolated or puri in which said second metabolite is transformed into a third fied and suitable methods include solvent extraction with US 8,343,739 B2 11 12 n-hexane, followed by sequential extraction with 100% ether, expression and selection of improved mutants by Screening acetone, methanol and water, and chromatographic purifica for the desired property, or by imposing self selection condi tion on a silicagel column usingan-hexane/ethyl acetate (2/1) tions under which organisms expressing an improved activity system (Suga et al. 1993). will have a Survival advantage. Said carbon substrate is optionally selected from the group References herein to the absence or substantial absence or of fermentable carbon Substrates consisting of monosaccha lack of Supply of a Substance, e.g. of cinnamic acid, include rides, oligosaccharides and polysaccharides, e.g. glucose, the substantial absence of derivatives thereof such as cin fructose, galactose, Xylose, arabinose, mannose, Sucrose, lac namic acid esters (including thioesters), e.g. cinnamoyl-CoA, tose, erythrose, threose, and/or ribose. Said carbon substrate which may be metabolised to the substance or which are may additionally or alternatively be selected from the group 10 immediate products of further metabolism of the substance. of non-fermentable carbon Substrates including ethanol, In particular, lack of cinnamic acid implies lack of cin acetate, glycerol, and/or lactate. Said non-fermentable carbon namoyl-CoA. substrate may additionally or alternatively be selected from Pinosylvin produced according to the invention may be the group of amino acids and may be phenylalanine. cis-pinosylvin or trans-pinosylvin, which are expected to be In an alternative aspect, the invention includes a method for 15 formed from cis-cinnamic acid and trans-cinnamic acid producing pinosylvin through heterologous expression of respectively. Alternatively, cis-pinosylvin may be formed nucleotide sequences encoding phenylalanine ammonia from trans-cinnamic acid by a process including isomerisa lyase, 4-coumarate-CoA ligase and resveratrol synthase and tion. But it is to be expected that the trans-form will normally also a method for producingpinosylvin through heterologous predominate. expression of nucleotide sequences encoding phenylalanine ammonia lyase, 4-coumarate-CoA ligase and pinosylvin Syn BRIEF DESCRIPTION OF THE DRAWINGS thase. Pinosylvin, includingpinosylvin so produced, may be used To assist in the ready understanding of the above descrip as a nutraceutical in a food product, e.g. a dairy product or a tion of the invention reference has been made to the accom beverage such as beer or wine. Accordingly, the invention 25 panying drawings in which: includes a food product containing microbially produced FIG. 1 shows the chemical structure of pinosylvin; pinosylvin. FIG. 2 shows the phenylpropanoid pathway utilising res The invention further includes a micro-organism compo Veratrol synthase acting on coumaroyl-CoA, leading to res sition comprising micro-organism cells and at least 1.5 mg/g Veratrol; and pinosylvin on a dry weight basis. For instance, yeast or yeast 30 FIG.3 shows the phenylpropanoid pathway utilising pino containing or yeast derived preparations containing pino Sylvin Synthase or resveratrol synthase acting on cinnamoyl Sylvin, or pinosylvin so produced, may be provided for CoA, leading to pinosylvin. human or animal consumption, e.g. in dry form, Suitably as FIG. 4 shows the HPLC-chromatograms of supernatant unit oral dosage forms such as yeast containing tablets or and cell extract of S. cerevisiae strains FSSC-PAL4CLVST1, capsules, which may contain for instance at least 0.5g of said 35 grown on 100 g/l galactose. A chromatogram of 60 nanogram yeast, e.g. 1-3g. of pure pinosylvin is included. Any wild type enzyme referred to herein may be substi FIG. 5 shows the HPLC-chromatograms of a cell extract of tuted by a mutant form thereof. Suitably having an amino acid S. cerevisiae strain FSSC-PAL4CLRES, grown on 100 g/1 homology relative to the named wild type enzyme of at least galactose. A chromatogram of 60 nanogram of pure pino 50%, more preferably at least 60%, more preferably at least 40 Sylvin is included. 70%, more preferably at least 80%, more preferably still at FIG. 6 shows the LC-MS data for pure pinosylvin and least 90% or at least 95%, whilst of course maintaining the pinosylvin produced by S. cerevisiae strain FSSC required enzyme activity of the wild type. This may include PAL4CLVST1, grown on 100 g/l galactose. Both base peak maintaining any Substrate preference of the wild type, e.g. for chromatograms, and negative ion-traces at M/Z 211.0759 phenylalanine over tyrosine or for cinnamic acid over cou 45 Dafe are shown. maric acid or for cinnamoyl-CoA over coumaroyl-CoA. Any FIG. 7 shows HPLC chromatograms obtained in Example wild type coding sequence coding for an enzyme referred to 16. herein may be substituted with a sequence coding for the FIG. 8 shows the HPLC analysis of extracted product from same enzyme but in which the codon usage is adjusted. This the fermentation of a pinosylvin producing strain of E. coli applies both to wild type enzymes mentioned herein and 50 (upper panel) and a control strain (lower panel). mutant forms as discussed above. Nucleotide sequences cod The invention will be further described and illustrated by ing for mutant forms of wild type enzymes are preferably the following non-limiting examples. homologous with the wild type nucleotide sequence of the corresponding wildtype enzyme to the extent of at least 50%, EXAMPLES more preferably at least 60%, more preferably at least 70%, 55 more preferably at least 80%, more preferably still at least Example 1 90% or at least 95%. Mutant forms of enzymes may have a level of enzyme Isolation of Genes Encoding PAL, 4CL, RES and activity largely unchanged from that of the wild type enzyme VST1 or may be selected to have a higher level of activity. Conser 60 vative substitutions of amino acids of the wild type enzyme Phenylalanine ammonia lyase (PAL2) (Cochrane et al., may be made in accordance with known practice. Enzymes 2004; SEQ ID NO: 1, 2), 4-coumarate:CoenzymeA ligase having improved activity may be developed by directed evo (4CL1) (Hamberger and Hahlbrock 2004; Ehlting et al., lution techniques as known in the art, random changes in the 1999: SEQ ID NO: 3, 4) were isolated via PCR from A. enzyme being produced by methods such as introducing ran 65 thaliana cDNA (BioCat, Heidelberg, Germany) using the dom genetic changes in the coding for the enzyme in a Suit primers in table 1. PAL2 and 4CL1 were chosen amongst able test organism such as E. coli or S. cerevisiae followed by several A. thaliana homologues due to favourable kinetic US 8,343,739 B2 13 14 parameters towards cinnamic acid and cinnamoyl-CoA, sites (table 1). The amplified PAL2 PCR product was digested respectively (Cochrane et al., 2004; Hamberger and Hahl with EcoR1/Spe1 and ligated into EcoR1/Spe1 digested brock 2004; Ehlting et al., 1999). pESC-URA vector (Stratagene), resulting in vector pBSC The coding sequence of resveratrol synthase (RES) from URA-PAL2. The sequence of the gene was verified by Rhubarb, Rheum tataricum (Samappito et al., 2003: SEQID sequencing of two different clones. NO: 5, 6) was codon optimized for expression in S. cerevisiae Example 3 using the online service backtranslation tool at www.en telechon.com, yielding sequence SEQID NO: 7.8. Oligos for Construction of a Yeast Vector for Expression of the synthetic gene assembly were constructed at MWG Bio 4CL1 tech and the synthetic gene was assembled by PCR using a 10 slightly modified method protocol of from Martin et al. The gene encoding 4CL1 was isolated as described in (2003) described below. example 1. The amplified 4CL1 PCR-product was digested TABLE 1. Primers and restriction sites for the amplification of genes

Restriction Restriction Primer for amplification of gene: site: site: (Restriction sites are underlined) Gene primer Wector

5 - CGGAATTCTCATGGATCAAATCGAAGCAATGTT PAL2 EcoR1 EcoR1

5 - CGACTAGTTTAGCAAATCGGAATCGGAGC PAL2 Spe1 Spe1

5 - GCTCTAGACCT ATGGCGCCACAAGAACAAGCAGTTT 4CL1 Xa1 Spe1

s' - GCGGATCCCCT TCACAATCCATTTGCTAGTTT TGCC 4CL1 BamH1 Bg1II

5 - CC GGATCCAAATGGCCCCAGAAGAGAGCAGG RES BamH1 BamH1

5 - CG CTCGAGTTAAGTGATCAATGGAACCGAAGACAG RES Xho1 Xho1

SEC ID Nos 11-16

Primers from MWG for the assembly of the synthetic gene with Xball/BamH1 and ligated into Spel/BglII digested were dissolved in MILLI-QR reagent grade water to a con pESC-TRP vector (Stratagene), resulting in vector pBSC centration of 100 pmoleful. An aliquot of 5 uI of each primer TRP-4CL1. Two different clones of pESC-TRP-4CL1 were was combined in a totalmix and then diluted 10-fold with 35 sequenced to Verify the sequence of the cloned gene. MILLI-QR reagent grade water. The gene was assembled via PCR using 5 uI diluted totalmix per 50 uI as template for fusion DNA polymerase (Finnzymes). The PCR programme Example 4 was as follows: Initial 98°C. for 30s., and then 30 cycles with 98°C. for 10 s., 40°C. for 1 min, and 72° C. at 1 min./1000 40 Construction of a Yeast Vector for Expression of basepairs, and a final 72°C. for 5 min. From the resulting PCR 4CL1 and RES reaction, 20LI was purified on 1 agarose gel. The result was a PCR smear and the regions around the wanted size were cut The gene encoding RES was isolated as described in out from agarose gel and purified using the QiaQuick Gel example 1. The amplified synthetic RES gene was digested Extraction Kit (Qiagen). A final PCR with the outerprimers in 45 table 1 rendered the required RES gene. Point mutations were with BamH1/Xhol and ligated into BamH1/Xhol digested corrected using the Quickchange site directed mutagenesis II pESC-TRP-4CL1 (example 3). The resulting plasmid, pESC kit (Stratagene, La Jolla, Calif.). TRP-4CL1-RES, contained the genes encoding 4CL1 and The VST1 gene encoding Vitis vinifera (grapevine) res RES under the control of the divergent GAL1/GAL10 pro Veratrol synthase (Hain et al., 1993) was synthesized by Gen 50 moter. The sequence of the gene encoding VST1 was verified Script Corporation (Piscataway, N.J.). The amino acid by sequencing of two different clones of plSC-TRP-4CL1 sequence (SEQID NO: 10) was used as template to generate VST1. a synthetic gene codon optimized for expression in S. cerevi siae (SEQID NO:9). The synthetic VST1 gene was delivered Example 5 inserted in E. colipUC57 vector flanked by BamH1 and Xho1 55 restriction sites. The synthetic gene was purified from the pUC57 vector by BamH1/Xhol restriction and purified from Construction of a Yeast Vector for Expression of agarose gel using the QiaCuick Gel Extraction Kit (Qiagen). 4CL1 and VST1

Example 2 60 The gene encoding VST1 was isolated as described in example 1. The purified and digested VST1 gene was ligated Construction of a Yeast Vector for Expression of into BamH1/Xhol digested pESC-TRP-4CL1 (example 3). PAL2 The resulting plasmid, pFSC-TRP-4CL1-VST1, contained the genes encoding 4CL1 and VST1 under the control of the The gene encoding PAL2, isolated as described in example 65 divergent GAL1/GAL10 promoter. The sequence of the gene 1, was reamplified by PCR using forward- and reverse prim encoding VST1 was verified by se