The N-Truncated C/Ebpα Isoform Correlates to the Expression Of

Home , CEBPA, CEBPE, Leucine zipper, RUNX1, XBP1

The Role of MicroRNA-181a in Acute Leukemia: Biological, Clinical, and Therapeutic Implications

Dissertation

Presented in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in the Graduate School of The Ohio State University

Christopher Jon Hickey, B.S.

The Molecular, Cellular, and Developmental Biology Graduate Program

The Ohio State University

2011

Dissertation Committee:

Guido Marcucci, M.D.; Advisor

Danilo Perrotti, M.D., Ph.D.

Lai-Chu Wu, D.Phil.

Kenneth Chan, Ph.D.

Christopher Jon Hickey

2011

ABSTRACT

Recent cytogenetic and molecular characterization along with gene expression profiling of acute myeloid leukemia (AML) patients have revealed previously unknown features associated with distinct subsets of the disease.

Among these newly discovered moleclar features were mutations within the

CCAAT/Enhancer Binding Protein Alpha (CEBPA) gene found in approximately

15% of patients lacking chromosomal abnormalities, thus characterized as cytogenetically normal AML. These mutations were shown to favorably impact the outcome of AML patients through unknown mechanisms. Notably, patients harboring CEBPA mutations also present with increased expression of microRNA-181a (miR-181a). High levels of miR-181a expression have been suggested to have tumor suppressor qualities in accord with CEBPA mutations.

Therefore, it is logical to hypothesize that a mechanistic correlation exists between miR-181a expression levels and CEBPA mutations which contribute to favorable outcomes associated to this subset of AML patients.

In this body of work, the correlation between different mutant isoforms of

C/EBPα and miR-181a was identified and the potential therapeutic implications described. Experimentally, miR-181a expression was found to be higher in those

ii cells expressing the N-truncated C/EBPα isoform. As a result of elevated miR-

181a expression, targeted transcripts coding for innate immune effector

molecules, Toll-Like Receptor 4 (TLR4) and Interleukin-1 Beta (IL-1β), were down modulated due to direct interaction of miR-181a. The miR-181a repression of these effector molecules ultimately contributed to the repression of the characteristic tumorigenic activity associated to NF-κB. Furthermore, smaller tumors were observed in mouse models xenografted with leukemia cells supplemented with miR-181a.

In an effort to recapitulate the therapeutic benefits involving miR-181a, an immunomodulatory compound, lenalidomide, was investigated as an agent to induce miR-181a expression in leukemia cells. Lenalidomide was found to induce the expression of the N-truncated C/EBPα isoform similar to the N- mutant isoforms observed in AML patients. The mechanism favoring the expression of the N-truncated C/EBPα isoform was identified and involved the activity of the translational subunit eIF4E. Following the lenalidomide treatment and subsequent induction of the N-truncated C/EBPα isoform, miR-181a expression was increased. The in vitro data implicating lenalidomide to increased miR-181a expression were validated in xenograft mouse models.

These tumors were found to have higher miR-181a expression and the tumors were physically smaller in size and weight. Finally, the in vivo mouse data were validated following analyses of miR-181a expression of individual leukemia

iii patients who participated in two separate clinical trials utilizing lenalidomide as

an anti-leukemia therapy.

The therapeutic benefits associated to lenalidomide were also found to be

applicable to acute lymphoblastic leukemia (ALL) cells which harbor the

tumorigenic chimera protein, TEL/AML1. In two different ALL cell lines, the

lenalidomide induction of miR-181a expression was found to lower the

expression of TEL/AML1, subsequently lowered the expression of the pro-

survival protein SURVIVIN, and ultimately induced apoptosis in those cells

treated with the therapeutic drug. Taken together, increasing the expression of

miR-181a has therapeutic benefits in acute leukemias. Indeed, this work served as a paradigm for designing and initiating clinical trials with lenalidomide followed by chemotherapy in distinct cohorts of AML patients with previously untreated or relapsed/refractory disease.

DEDICATION

Dedicated to my family.

ACKNOWLEDGEMENTS

I would like to extend my gratitude to my advisor Dr. Guido Marcucci.

With his guidance I was able to develop as a scientist and contribute to the ongoing efforts with resolving some of the enigmas surrounding acute leukemias.

At the onset of my endeavors, Dr. Marcucci first told me that he wanted me to teach him something about acute leukemia. This dissertation is to serve as a medium of instruction and insight thereby fulfilling his request bestowed upon me years ago when we initially embarked on our collaborative journey. As being his first graduate student and graduating with a doctorate, I am forever grateful for his willingness to accept me into his lab and to work in a collaborative fashion toward the same goal.

VITA

October 4, 1977....………………………………..………….Born in Columbus, Ohio

June 1996..…………………………………….………Gahanna-Lincoln High School

June 2001…………….……………………………..…..….……..B.S with Distinction.

Molecular Biology and Biology,

Otterbein College

September 2003 to present……………..………...... Graduate Research Associate,

The Ohio State University

December 2009………………………….…….……..…Oral Presentation, American

Society of Hematology

vii

PUBLICATIONS

1. Liu, S., Wu, LC., Pang, J., Santhanam, R., Schwind, S., Wu, YZ, Hickey, C.J., Yu, J., Becker, H., Maharry, K., Radmacher, M.D., Li, C., Whitman, S.P. Mishra, A., Stauffer, N., Eiring, A.M., Briesewitz, R., Baiocchi, R.A., Chan, K.K., Paschka, P., Caligiuri, M.A., Byrd, J.C., Croce, C.M., Bloomfield, C.D., Perrotti, D., Garzon, R., Marcucci, G. Sp1/NFkappaB/HDAC/miR-29b Regulatory Network in KIT-driven Myeloid Leukemia. Cancer Cell. 2010. Apr 13; 17(4): 333-47.

2. Eiring, A.M., Harb, J.G., Neviani, P., Garton, C., Oaks, J.J., Spizzo, R., Liu, S., Schwind, S., Santhanam, R., Hickey, C.J., Becker, H., Chandler, J.C., Andino, R., Cortes, J., Hokland, P., Huettner, C.S., Bhatia, R., Roy, D.C., Liebhaber, S.A., Caligiuri, M.A., Marcucci, G., Garzon, R., Croce, C.M., Calin, G.A., Perrotti, D. miR-328 Functions as an RNA Decoy to Modulate hnRNP E2 Regulation of mRNA Translation in Leukemia Blasts. Cell. 2010 Mar 5;140(5):652-65.

3. Schwind, S., Maharry, K., Radmacher, M.D., Mrozek, K., Holland, K.B., Margeson, D., Whitman, S.P., Hickey, C.J., Becker, H., Metzeler, K.H., Paschka, P., Baldus, C.D., Liu, S., Garzon, R., Powell, B.L., Kolitz, J.E., Carroll, A.J., Caligiuri, M.A., Larson, R.A., Marcucci, G., Bloomfield, C.D. Prognostic Significance of Expression of a Single microRNA, miR-181a, in Cytogenetically Normal Acute Myeloid Leukemia: a Cancer and Leukemia Group B Study. J. Clin. Oncol. 2010 Dec 20;28(36):5257-64.

4. Hickey, C.J., Schwind, S., Becker, H., Alachkar, H., Garzon, R., Wu, YZ, Liu, S., Perrotti, D., Marcucci, G. MicroRNA-181a Targets TEL/AML1 Expression and Impairs Cell Proliferation in t(12;21) Acute Lymphocytic Leukemia (ALL) Cells. Blood (ASH Annual Meeting). Oral Presentation. 2009; 114:Abstract 766.

FIELDS OF STUDY

Major Field: Molecular, Cellular, and Developmental Biology

viii

TABLE OF CONTENTS

ABSTRACT…………………………………………………….…………………………...ii

DEDICATION……………………………………………………….………………………v

ACKNOWLEDGEMENTS……………………………………………..……………………vi

VITA…………………………………………………………….………………………...vii

LIST OF TABLES…………………………………………………….…………………….xi

LIST OF FIGURES………………………………………………………………………...xii

CHAPTER 1: INTRODUCTION…………………………………………………………….. 1 1.1 Cancer and Leukemia Hallmarks and Statistics…………………………………...1 1.2 Leukemia and Hematopoiesis…………………………………………………….....4 1.3 Acute Myeloid Leukemia………..……………………………………………………9 1.4 Transcription Factors Involved in AML…………………………………………....15 1.5 Genetic Features in AML………….………………………………………………..17

CHAPTER 2:C/EBPα ISOFORMS ARE CORRELATED TO microRNA-181A EXPRESSION..21 2.1 CCAAT/Enhancer Binding Protein Superfamily………………………………….21 2.2 CCAAT/Enhancer Binding Protein Alpha…………………….……...……...... ….23 2.3 C/EBPα Post-Transcriptional Isoforms……………………………………………27 2.4 C/EBPα Post-Translational Modifications...... 32 2.5 C/EBPα Functional Characteristics...... 36 2.6 Experimental……...………………………………….………………………………40 2.7 Future Work…...…………………………………………………………….……….53

CHAPTER 3: MicroRNA-181A AND ITS ROLE IN AML…………………………………………...58 3.1 MicroRNA Discovery, Processing, and Characteristics in Hematopoiesis...... 58 3.2 MicroRNA in AML……………………………………………………………….…...63 3.3 MicroRNA-181 Family and Hematopoiesis……………………………….………65 3.4 MicroRNA-181a and Leukemia……………………………………………….……71 3.5 MicroRNA-181a and Targets Relating to the Innate Immune System…….…..73 3.6 Experimental……………………….………………………………………….……..77 3.7 Future Work…..………………………………..………………………………….…86

CHAPTER 4: LENALIDOMIDE INDUCES microRNA-181A THROUGH C/EBPα-p30 EXPRESSION………90 4.1 Lenalidomide: Second-Generation Immunomodulatory Compound…...... 90 4.2 Lenalidomide and Leukemia…………………..……………………………...... 93 4.3 Experimental………………………...…..…………………………...... 97 4.4 Future Work…………………………………………………………………………113

CHAPTER 5: ACUTE LYMPHOBLASTIC LEUKEMIA………..………………….………...... 118 5.1 Introduction and Background…………...…………….………..…..…….……….118 5.2 ALL Classification...…………….……………………………………….………….121 5.3 ALL Chromosomal Translocation: TEL/AML1………………..…………...... …125 5.4 Experimental……………………………….……………….……………….………132 5.5 Future Work………………………………..………………………...……………...145

REFERENCES………………………………………………………………………….....…………….147

LIST OF TABLES

1.1: WHO Classification of AML………………..…………………………………...12

1.2: FAB Classification of AML……………………………………………………….13

3.1: miR-181 Family Members……………………………………………………….67

5.1: WHO Classification for Acute Leukemias………………………………..…..122

LIST OF FIGURES

CHAPTER 1

1.1: Hierarchy of Hematopoiesis………………………………………………………6

CHAPTER 2

2.1: C/EBP Family…………………………………………………………………….23

2.2: C/EBPα and Domain Regions………………………………………………….26

2.3: Schematic Description of CEBPA Translation During Low/High Rates of Translation…………………………………………...... 29

2.4: Sumoylation Pathway……………………….………………………………...... 34

2.5: C/EBPα-p30 isoform is Correlated with Increased miR-181a Expression and Better Survival Probability…………………………………...42

2.6: Artificial Recapitulation of C/EBPα-p30 Induced miR-181a-1 Expression ..45

2.7: The Correlation Between C/EBPα-p30 Expression and miR-181a is a Common Feature………………………………………….49

2.8: The Compound CDDO Induces Both C/EBPα-p30 and miR-181a Expression…….. ……………………………………………………52

xii

CHAPTER 3

3.1: miR-181a Targets the TLR4 and IL1β Transcripts…………………………...78

3.2: miR-181a Represses NF-κB Activity and Downregulates miR-155 Expression………………………………………………………………………..81

3.3: miR-181a has Anti-Proliferative and Pro-Apoptotic Properties……………..85

CHAPTER 4

4.1: Lenalidomide Increases miR-181a Expression in Separate AML Cell Lines………………………………………………………………………………91

4.2: Structural Comparisons Between First- and Second-Generation Immunomodulatory Compounds……………………………………………….92

4.3: Lenalidomide Induces C/EBPα-p30 Expression and Increases miR-181a Expression………………………………………………………………………..99

4.4: The Translational Subunit eIF4E is Phosphorylated Following Lenalidomide Treatment and Has a Role in C/EBPα-p30 Translation…...102

4.5: Lenalidomide Increases both C/EBPα-p30 and miR-181a Expression in AML Patients……………………………………………………………………106

4.6: Lenalidomide has Anti-Tumor Properties in AML Xenografts That Coincide with an Increase in C/EBPα-p30 Protein and miR-181a Expression……..108

4.7: CARD8 is a Target of miR-181a and Possibly Inhibits Procaspase-9 Activation………………………………………………………………………..112

CHAPTER 5

5.1: The Maturation Process of B- and T-cells…………………………………..119

5.2: Schematic Diagram Detailing the t(12;21)(p13;q22) Translocation………127

UTR is a Target of miR-181a……………………………….133-׳The RUNX1-3 :5.3

xiii 5.4: miR-181a-1 Targets TEL/AML1 and Has Anti-Tumorigenic Properties in an ALL Cell line……………………………………………………………...136

5.5: Lenalidomide Induces miR-181a-1 Expression and Indirectly Decreases SURVIVIN Expression……………………………………………139

5.6: Lenalidomide Inhibits Tumorigenic Expression of TEL/AML1 and Promotes Apoptosis………………………………………………………141

xiv

Chapter 1

Introduction

1.1 Cancer and Leukemia: Hallmarks and Statistics

The disease that we refer to as “cancer” in the present day has been plaguing our species for millennia. The earliest recordings and descriptions of cancer are believed to date back to 2,500 B.C.1 during which time the “father of

medicine”, Imhotep, described eight cases of tumors of the breast.2 The

recordings were came to be known as “The Edwin Smith Papyrus”, named after

the discoverer of this ancient Egyptian textbook on surgery which dated back to

1600 B.C. The textbook is a collection of teaching methods about the human

body and related-diseases, including cancer, which were compiled by the ancient

Egyptians over hundreds of years prior to its scribing. Hence, the fight against cancer has been an ongoing challenge for thousands of years, and although we as humans still do not fully understand this disease and how to eradicate it from our existence, our knowledge has tremendously improved.

More recently, Hanahan and Weinberg published a seminal review describing the hallmarks of cancer.3 In it, they predict that our logic will prevail

over the curiosities associated to cancer during which time we will develop an

1 understanding for a small number of principles about the disease, which allows

cancer to be enigmatic today. In a more simplistic fashion of our understanding,

there are six essential changes within a cell, thereby granting the cell

malignancy:

- self-sufficiency in growth signals: autocrine growth signaling,

constitutive protein activation

- insensitivity to growth-inhibitory signals: inhibition of cell-cycle arrest

and cellular differentiation

- evasion of apoptosis (programmed cell death): altered regulatory

and/or effector components

- limitless replicative potential: telomere maintenance and possible

circumvention of senescence

- sustained angiogenesis: altered pro- and anti-angiogenic homeostasis

and modulation of proteolysis

- tissue invasion and metastasis: altered cell-to-cell adhesion molecules

and protease activation

In a follow-up review published a decade later, the same co-authors re- assessed their six hallmarks of cancer and addressed each hallmark individually as to their relevance today.4 In this more recent review, the authors advanced two additional hallmarks of cancer, referred to as “emerging hallmarks” of cancer,

2 and two characteristics referred to as “enabling characteristics”, which provide

the premalignant cells the propensity of becoming a tumor cell.

Emerging Hallmarks

- Reprogramming energy metabolism: diversion of glycolytic

intermediates to biosynthetic pathways

- Evading immune destruction: disabling the immune system designed

for detecting cancer cells

Enabling characteristics

- Genome instability: mutations occurring in the “caretakers” (i.e.,

checkpoint proteins) of the genome

- Tumor-promoting inflammation: supplying the tumor-microenvironment

with bioactive molecules

These characteristics might be more applicable to certain tumors and not others.

Under no uncertain terms, an inarguable description of cancer is that of a cell which no longer retains its intended function(s) and has the capacity to grow uncontrollably.

This year alone in the United States, an estimated 1.5 million people will receive a diagnosis of having cancer. (Cancer Facts and Figures 2011,

American Cancer Society, Inc.) Of the people who will be newly diagnosed, the majority will be men, 52%, versus women, 48%. An estimated 575,000 cancer- related deaths will occur this year, and once again the men will be the majority.

3 Notably, and of particular interest, a leukemia diagnosis will be received by

44,600 men and women this year. More specifically, these leukemias have been

categorized into four subtypes of leukemia: acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), acute myeloid leukemia (AML), and chronic myeloid leukemia (CML). For men, nearly half (5,440) of the leukemia-related

deaths (12,740) estimated to occur in 2011 will be attributed to AML, and a third

(3,610) for women (9,040) for the same disease. It is worth noting, the lowest

estimated number of deaths in the leukemia category is CML (270) for both men

and women, combined. This feature is mostly the result of our understanding of

this particular disease and the development of therapies targeting CML such as

the drug, Imatinib (Gleevec, Novartis). (Cancer Facts and Figures 2010,

American Cancer Society, Inc.) Indeed, the effort is currently ongoing to

advance our knowledge and understanding of AML with the pursuit of developing

therapies to reduce the number of AML-related deaths and getting this number

as being similar to the number of CML-related deaths, if not eradicated entirely.

1.2 Leukemia and Hematopoiesis

The history associated to the discovery of the disease known as leukemia

is not immune from conventional debate.5 This debate lasted nearly 150 years

until 1995 when the English pathologist, John Hughes Bennett, was credited by

the Leukemia Research Fund with the discovery and description of the blood

disorder. Bennett’s observations appeared in the Edinburgh Medical and

Surgical Journal in 1845 in which he described the presence of purulent matter in

4 the blood of two human cases. However, the German pathologist, Rudolph

Virchow published his findings four months later but in contrast to Bennett’s description, Virchow did not describe the excess of cells as purulent matter but rather excess cells that had originated in the blood. Finally, a French physician,

Alfred Donné, published in 1844 the observation of an excess of white blood cells in patient blood samples. These white blood cells he believed were not purulent matter but instead these were cells that had arrested during the maturation process required for the formation of blood cells. Hence, his observations and understanding for the accumulation of ‘intermediate cells’ were accurate and fitting to our current understanding of leukemia.

Leukemia (Greek: leukos meaning white and haima for blood) is a form of cancer of the blood or bone marrow which is characterized by having elevated levels of white blood cells. Cells contributing to this disease share a common feature which is their inability to fully differentiate into their intended cellular phenotype and therefore do not perform the required activities needed by the body. Thus, at some point during the developmental process, the required genes within the cell failed to function or to be properly expressed in a spatiotemporal format. This developmental sequence of events is referred as hematopoiesis

The process of hematopoiesis is a multi-step series of events for the production of various blood cells to serve a variety of functions for the human body. This process has often represented as a hierarchical scheme (Figure 1.1) with the apex as the location of the hematopoietic stem cells (HSC) which have self-renewing potential and multipotency, the ability to give rise to all lineages of

5 cells found in blood.6 In contrast, the base of this hierarchy is comprised of a diverse collection of cells, known as effector cells which perform very specific functions for the well-being of the organism. These cells include erythrocytes, platelets, and immunity-associated cells.

Figure 1.1 Hierarchy of Hematopoiesis. A schematic diagram representing the various stages involved in hematopoietic differentiation. The apical multipotential and undifferentiated stem cell has the ability for self-renewal or to differentiate into committed progenitors, common myeloid progenitors (CMPs) or common lymphoid progenitors (CLPs). Upon further differentiation, the CMPs supply the cells needed for thrombopoiesis, erythropoiesis, granulopoiesis, and monocytopoiesis. The CLPs contribute to the B-cell and T-cell populations through lymphopoiesis. The most differentiated cells are effector cells and perform various biological activities required by the human body. (image: public domain)

Located in this spatiotemporal frame, between the developments from the

HSC to the effector cells, are progenitor cells which undergo the maturation process giving rise to the more functional specific cell-types. These progenitor cells represent the “intermediate cells” which are identifiable by the surface

6 receptors expressed on their cellular membrane (e.g. CMP: Lin- CD34+ CD38+

IL3RAlow CD45RA-).6 In a sequential series of events, the HSCs lose the ability

of self-renewal and progressively lose lineage potential whereby the cell commits

to specificity while maturing to a certain cell-type lineage.

Over the course of evolution, hematopoiesis has emerged only once in

mammals during our existence, and it can be argued that the hierarchy

associated to hematopoiesis remains the same basic structure for other

mammals.7 Much of our knowledge regarding hematopoiesis is the result of extensive research using mouse models to develop our understanding.6 Mice

have been the preferred model in lieu of humans for reasons such as ethics and mouse cells can be pooled together in large quantities for the purpose to select and isolate the very few available HSCs in an organism. From the mouse model, the foundations were established for human hematopoietic research and characterization.

Currently, it is believed it takes 31 cellular divisions, from HSC to circulating blood cells.6 At each tier involving cellular divisions for development, the daughter cell has the option to remain at that stage of development as the

parent cell or to differentiate into a more committed cell.7 Hematopoiesis is

initiated by the differentiation of the HSC which gives rise to multipotent

progenitor cells6 (MMPs: Lin- CD34+ CD38- CD90- CD45RA-), thus maintaining

the ability to give rise to all lineages of cells needed for tissue development. The

first major division in this sequence of events occurs when the MMP cells transition from multipotent progenitors to oligopotent progenitors, in which the

7 cells will either take the characteristics of a common myeloid progenitor6 (CMP:

Lin- CD34+ CD38+ IL3RAlow CD45RA-) or common lymphoid progenitor6 (CLP:

Lin- CD34+ CD38+ CD10+). At this stage of development the cells are committed

for generating either myeloid precursors or lymphoid precursors, however it is a

matter of debate as to the potential of CLPs ability to revert to a CMP

population.8 The CMP has the potential to give rise to megakaryocyte and

erythroid progenitors6 (MEPs: Lin- CD34+ CD38+ IL3RA- CD45RA-) which can

produce blood platelets and erythrocytes. Moreover, CMPs also give rise to

granulocyte/macrophage progenitors6 (GMPs: Lin- CD34+ CD38+ IL3RA+

CD45RA-) which are responsible for the development of granulocytes

(neutrophils, eosinophils, and basophils) and monocytes (macrophages and

dendritic cells). The CLPs are known for the production of lymphoid progenitors

for B-cells, T-cells, and natural killer (NK) cells. Following further maturation,

these oligopotent progenitors (CMP and CLP) differentiate to the point in which

they will assume the characteristics of lineage restricted progenitors necessary

for the generation of the effector cells (i.e., neutrophils, erythrocytes, and NK

cells).

Recent research suggests that an earlier stage of development occurs

prior to the bifurcation between CMP and CLP and a newly named progenitor is

believed to give rise to CMPs and CLPs. This newly suggested progenitor is the

lymphoid primed multipotent progenitor (LMPP).9 The LMPP is located

downstream of the MMP. Several labs have reported that MMPs have the ability

to perform an earlier bifurcation, prior to the CMP and CLP bifurcation stage,

8 resulting in the pre-megakaryocyte/erythroid progenitor (MEP) and the LMPP.

The LMPP has the potential for B-cells, T-cells, natural killer cells, monocytes,

and granulocytes, which is in contrast to the megakaryocyte- and erythroid

lineage-restricted MMPs.10-12

The sequence of events to initiate the differentiation process can begin from the microenvironment, in which the HSC resides, by transmitting signals to the HSC.13 These signals are transmitted through cytokines and serve as

ligands to cognate receptors on the HSCs which enables the stem cells the

ability of self-renewal. Two important cytokines and receptors for this self-

renewal process are stem cell factor (SCF, cytokine) and thrombopoietin (TPO,

cytokine) which dock to the receptors, c-KIT14 and c-MPL15, respectively. In the

event that mutations occur within the gene coding for these receptors, the

receptor has the potential to transmit aberrant signals within the cells and

therefore undergo abnormal differentiation, if at all. As a result, the supply of

HSC within the organism can potentially become overpopulated16 and the ability

to produce effector cells can be severely damaged.17,18

1.3 Acute Myeloid Leukemia

A disruption at any stage in hematopoietic differentiation resulting in the

accumulation of cells is a disease bearing the name leukemia. Moreover, leukemia is a heterogenous disease involving aberrant development of blood and

immune cells. Among this large group of neoplasms, sub-categories have been given names which describe the location of aberrant differentiation. Among these

9 categories is acute myelogenous leukemia (AML). AML is a category of

leukemia with well-defined neoplasms involving precursor cells committed to the

myeloid line of hematopoiesis (i.e., progenitor cells for granulocytes, monocytes, erythroid, and megakaryocytes). The fundamental biological feature(s) of the sudden diseased cells in AML is the ability of continuous aberrant proliferation and/or early arrest during the differentiation process.19 This phenotype is

typically the result of multiple genetic changes within progenitor cells which are

necessary for healthy hematopoiesis. Commonly observed in AML is the

accumulation of undifferentiated, immature myeloid cells within the bone marrow

and peripheral blood. The inhibition during differentiation is regularly influenced

by aberrant mechanisms within cell signaling cascades and/or protein regulators

which are involved with the up- or down-regulation of targeted gene expression necessary for the cell to undergo passage along the developmental process from

HSC to effector cell. Currently, it is thought that one aberration in this

developmental process cannot initiate overt AML. More likely, more than one

aberration is needed to induce AML. In fact, this more-than-one aberration model is more commonly refered to as the “two-hit model”. The “two-hit model” suggests that one genetic aberration is not sufficient to induce leukemogenesis, however, a second genetic aberration in the same cell harboring the “first hit” may lead to the development of leukemia.20-22

The origins of AML has been traced back to a single leukemia initiating

cell (LIC).23,24 The LIC likely arrested in development and acquired the ability of self-renewal.25 More specifically to AML, it is likely this arrested development

10 and self-renewal capability occurred at some point between the CMPs and the

GMPs. If the aberrations occurred at an early stage, it is likely the effects will be

revealed due to the lack effector cells stemming from the CLP (B-cells and T-

cells). If this aberration occurred later in the process, beyond the GMPs, then

greater diversity of effector cells from the myeloid lineage would be observed

(e.g. megakaryocytes/erythrocytes, neutrophils, monocytes). Thus, it is likely a

cellular arrest occurred at the CMP/GMP boundary. Several published reports

are available supporting this hypothesis.26-29

Because AML is a heterogenous disease, two commonly used

classification systems are employed to stratify this disease into subgroups based

on common features. To begin, the suspected AML is classified according to the

World Health Organization (WHO) classification system.30 (Table 1.1) This

system considers morphology (shape of the cells), immunophenotype (various

receptors on the cell surface), genetics, and features displayed by the patient

upon presentation. Following this classification, the AML is further sub-

categorized using the French-American-British (FAB) classification system which separates the cases based on morphology.31 (see Table 1.2) The M0

designation for AML is given to those cells with less differentiation and are likely

to be near the CMP/GMP boundary in the differentiation process. The more

differentiated stages (M1-M7) progress in their description of arrest during the

cellular maturation process.

Table 1.1 WHO Classification of AML. The World Health Organization (WHO) classification system for describing the sub-types of adult acute myeloid leukemia (AML).. (adapted from Arber, DA., Brunning, RD., Le Beau, MM., Falini, B., Vardiman, JW., Porwit, A., Thiele, J., Bloomfield, CD. (Swerdlow HS, Campo E, et al., editors). WHO Classification of Tumours: Tumours of Haematopoietic and Lymphoid Tissues. Lyon:IARC Press, 2008.

The cells associated to AML are referred to as myeloblasts and have been

described with having common features which allows to stratify the larger group

AML, into more specified sub-groups. Myeloblasts are the precursor cells

12 contributing to AML and can be described as immature cells with large,

prominent nuclei and may contain granules. Common to myeloblasts are Auer

rods which may vary in accordance to the AML sub-type. Auer rods are

visualized as tiny rod-like structures in the cytoplasm of the afflicted cell and are

often associated to AML sub-types, M1-M4. A flow cytometric analysis utilizing

the cell surface receptors on the AML population of cells provides additional

information for classifying the severity of AML.32 The AML subtypes have

different cell surface receptor populations. However, the majority of AML cells

express CD34, HLA-DR, CD117, CD13, and CD33.

Table 1.2 FAB Classification of AML. The French-American-British (FAB) classification system for describing the sub-types of adult acute myeloid leukemia (AML) based on morphological features displayed by the leukemia cells. The numerical values are attributed to the frequency of incidence associated to the type of leukemia given as a diagnosis. The most undifferentiated cells are indicative of a M0 sub-type classification whereas the most differentiated sub-type is given a M7 description.

Understanding the karyotype (the arrangement of chromosomes within a

cell) of the AML disease is vital because various chromosomal translocations are common in AML and require different therapeutic regimens. The WHO classification system considers these chromosomal translocations to be

13 significant when categorizing the AML case are listed in Table 1.1. These subgoups of AML are associated with different prognoses and treatments regimens. Additional molecular characterizations might include real-time RT-

PCR analysis and fluorescence in situ hybridization (FISH). These techniques provide information regarding mutational status of prognostic genes (i.e., nucleophosmin NPM1, KIT, CEBPA). Notably, the mutational status of the regulator genes NPM1 and CEBPA are consider by the WHO as separate AML entities for classification.30 More recently and very relevant, the gene expression profiling of microRNAs for individual AML cases has been shown to be significant when diagnosing as well as assigning a prognosis.33,34 These gene expression profiles will be discuss in greater detail in later sections of this dissertation.

The prognoses vary for AML, however certain characteristics have been determined to be favorable or unfavorable. Favorable factors include: less than fifty years of age, no prior hematological disorder, mutations in either NPM1 or

CEBPA gene, and chromosomal translocations including, inv(16)(p13.1q22), t(16;16)(p13.1;q22), t(15;17)(q22;q12), t(8;21)(q22;q22). In contrast, unfavorable factors include: older than 60 years, previous hematological disorder(s) with a history of therapy, and mutations in the certain genes: FMS-like tyrosine kinase 3 with internal transmembrane duplication (FLT3/ITD), isocitrate dehydrogenase 1 or 2 (IDH1 or IDH2), Wilms tumor 1 (WT1), RUNX1, DNA methyltransferase 3A

(DNMT3A), and genetic overexpression of meningioma 1 (MN1) and brain and acute leukemia, cytoplasmic (BAALC).

14 Currently, there are two classes of mutations associated with the

development of leukemia, class I and class II.35 Class I mutations enable the

hematopoietic cells to have advantages in both proliferation and survival. These

mutations include constitutively active kinase tyrosine kinases such as BCR-ABL,

FLT3, c-KIT, and their downstream targets such as RAS. In contrast, class II mutations interfere with hematopoietic differentiation and possibly provide a survival advantage by augmenting terminal differentiation which evades apoptosis. Often these class II mutations involve the fusion of two transcription factors.36

1.4 Transcription Factors Involved in AML

Indeed, the microenvironment(s) play an important role for initiating the

spatiotemporal sequence of events involved with HSC differentiation. However,

the cellular responses to these microenvironmental cues are focused to the

expression of various genes, and these genes are expressed through the

activities of transcription factors. Transcription factors play an important role

during the sequential events involved with hematopoiesis because they are

responsible for the expression of genes necessary for the lineage commitment.

Currently, our knowledge is vast when pertaining to the roles transcription factors

have throughout hematopoiesis.8,37-39 Given the extent of information

ascertained regarding transcriptional regulation and hematopoiesis, this

dissertation will only focus (unless otherwise stated) on myeloid differentiation.

15 Several myeloid transcription factors have been reported as being

expressed in HSCs.40 Some of the earliest transcription factors expressed are

RUNX1, GATA-2, and TEL.13 At the first bifurcation, MMP and LMPP, the

erythroid-related genes have been reported to be downregulated in their

expression, perhaps indicating lineage commitment. In contrast to this observed

downregulation of erythroid-inducing transcription factors, the levels of specific

myeloid factors remain present within the progenitors.41 RUNX1 and has been

found to be expressed early (LMPP) in the series of events tied to differentiation.

RUNX1 has been shown to induce the lineage committing transcription factor

PU.1. The expression of PU.1 is required for the development of CMPs from

earlier precursors.42 Abundant expression of PU.1 favors the differentiation to

myeloid development which subsequently curtails potential effector cells from B- cell lineage.43 PU.1 serves as a regulator of differentiation having activities

downstream of RUNX1 and upstream of granulopoiesis regulators such as

CCAAT/Enhancer Binding Protein Alpha (C/EBPα) and GATA-1, -2.13 The

transition from CMP to GMP is facilitated by C/EBPα, moreover, PU.1 has been

shown to participate with C/EBPα when controlling the balance between

marcrophage and neutrophil differentiation.44 Interestingly, C/EBPα modulates the expression of PU.1.45 In fact, C/EBPα transcripts have been identified in

early hematopoiesis progenitors including HSCs, LMPPs, and GMPs, but not

erythroid progenitors, suggesting that C/EBPα does not have a role in late-term

progenitor cells involved with erythropoietic differentiation.46 Thus, the role which

16 C/EBPα contributes to the hematopoietic process and proper differentiation is

significant.

1.5 Genetic Features in AML

A recent development for predicting outcomes for patients with AML has

been through the determination of the gene expression profile (GEP).47,48 GEP

allows for a more intimate observation of the leukemia cell which was previously

unavailable. This novel approach permits the high-throughput data analysis for

multiple genes (i.e., NPM1, CEBPA, WT1, etc.) for various sub-types of AML and

groups them into similarities based on the expression. When performed on a

large-scale, patterns of gene expression and repression emerge according to

sub-type and chromosomal characteristics. However, GEP is not sensitive

enough to identify subtle mutations within genes. To achieve this particular

identification, DNA sequencing would be warranted.

GEP is performed through the use of DNA microarrays allowing for high-

throughput investigations examining the expression of thousands of gene are

now feasible. Indeed, GEP data corroborated conventional tactics used to gain

knowledge of known genes expressed in AML. Using GEP information,

researchers now have the ability to categorize the subtypes of AML into gene

expression signatures which aid in determining the best treatment options

currently available. GEP technology offers the ability for determining

characteristics of gene expression patterns which were previously unknown to

AML. Furthermore, GEP potentially offers the ability to make diagnostic and

17 prognostic predictions on a case-by-case basis with the privilege of customizing

a treatment regime based on previous data from this microarray technology.49

Using this information, patients can be afforded to have their disease “typed” with

currently known GEPs and as a result, gain more information as to how other

patients with a similar “type” of GEP responded to their individual treatments.

However, these novel uses attributed to GEP are currently still being investigated

and have yet to be implemented in the clinics.

The new era involving GEP ushered in more detailed AML subtypes which

were previously unknown.47,48,50 . Interestingly, GEP technology was able to show subtle differences between younger and older AML patients, and allowed to

stratify the data into risk groups.51 In this study, a hypothesis was derived suggesting the likelihood of p16INK4A (high/low expression in younger/older

patients, respectively) played a role in defending older AML blasts from cellular

and genomic damage. Thus, any change in expression of p16INK4A could

contribute to the oncogenic nature of the cells. Furthermore, breakthroughs in

GEP have allowed for predications in cytogenetically normal (CN) AML cases to

be significantly correlated to overall survival.52

Although the appeal for GEP is the high-throughput informative data, the biological relevance and understanding continues to be more fully developed.

Indeed, differences among transcript levels can be identified using microarrays, yet questions still remain as to the frequency of their translation into the functional effector molecule, which is the protein. More informative data would

be the proteomics of these AML cases. The data of proteomics certainly would

18 provide more insight to the internal activities within the cells. Adding to the

complexity of this idea would be the post-translational modifications of these proteins and how it relates to their functional properties and the overall phenotype of the leukemia cell. Such notions are decades away from becoming reality. However, GEP is a suitable launch pad for admirable endeavors.

The emergence of a new gene expression signature is currently being developed and the findings are regarded as significant. Recently, the expression of microRNA (miRs) (microRNAs are explained in Chapter 3 of this dissertation) signatures for AML subtypes have been published for AML cases with chromosomal translocations53, older patients with de novo cytogenetically normal

(CN) CN-AML harboring NPM1 mutations54, CN-AML in younger patients

harboring high-risk molecular features55, and the relevance of specific miRs

relating to overall survival for younger patients with CN-AML features.56 While

the expression profiles of miRs is still in the emerging stages, these

aforementioned studies will certainly contribute to the collection of data which

has yet to be assembled and compiled. Like the importance of

immunophenotyping AML cases, determining the miR expression profile for

individual AML cases is likely to be the normal practice of future clinical cases

thereby allowing for an additional layer of information to be considered when

characterizing, specifically, the kind of AML needing treatment thereby extending

the life-expectancy of the patient.

GEP has enabled researchers to pursue features associated to AML in a

high-throughput manner and formulate hypotheses based on trends that are

19 revealed in the profiling data. This holds true when profiling AML patients harboring CEBPA mutations. Trends in relapse-free survival and overall survival have been reported when describing various CEBPA mutations57 seen in AML patients without any cytogenetic abnormalities. Collectively, patients devoid of any cytogenetic features and harboring biallelic CEBPA mutations receive a prognosis which includes a favorable outcome.58 Therefore, it of interest to investigate the correlation between mutations in the CEBPA gene locus and how it favors the outcome for the patient. After having identified a possible mechanism attributed to the favorable outcome associated to CEBPA mutations, it would be advantageous to develop a method to manipulate the expression of wild-type CEBPA in patients afflicted with AML. The purpose for the manipulation of the CEBPA expression would be to mimic the therapeutic benefit seen in the patients harboring the mutated CEBPA genetic locus which seemingly provides them with a favorable prognosis.

Chapter 2

C/EBPα Isoforms are Correlated to microRNA-181a Expression

2.1 CCAAT/Enhancer Binding Protein Superfamily

CCAAT/Enhancer Binding Proteins (C/EBPs) form a subgroup of the basic

region/leucine zipper superfamily of transcription factors, also referred to as bZIP

proteins. The basic features for this superfamily include an N-terminal transactivation domain, a DNA binding domain referred to as a basic region (BR) or DNA binding domain (DBD), and a domain comprised of leucine amino acids.

A common feature found within the bZIP proteins is the nuclear localization

signal (NLS) contained within the DBD.59 In addition, the leucine rich domain

facilitates the dimerization with like proteins in which the leucine repeats

intercalate like a zipper, facilitated by the leucine repeats of their binding partners, therefore the result is a dimer protein complex. Indicative of its importance and relevance to C/EBP family members, the leucine zipper domain of the C/EBPs subgroup remains highly conserved with no variance. Recently, a common feature in a variety of bZIPs was characterized. This newly characterized protein domain of bZIPs is a carboxy-terminally located “tail” near

21 the leucine repeat domain. This “tail” feature is shared among the C/EBP family

members but the exact function of this tail has yet to be fully characterized.

The C/EBP subgroup of bZIP transcription factors is comprised of six

family members: C/EBPα, C/EBPβ, C/EBPγ, C/EBPδ, C/EBPε, and C/EBPζ. A

representative display of the six protein members and their respective domains is

displayed in Figure 2.1. These six proteins are found within the human genome

and have their individual gene locus designation: CEBPA (C/EBPα), CEBPB

(C/EBPβ), CEBPG (C/EBPγ), CEBPD (C/EBPδ), CEBPE (C/EBPε), and DDIT3

(C/EBPζ). These family members provide a diverse array of C/EBP proteins which facilitate various functions, including gene transactivation, cell-cycle modulation, programmed cell death, and cellular differentiation. Furthermore, diversity among individual isoforms (variants of the same protein) is well-known and these isoforms are mediated by alternative translational start sites within the mRNA transcript which is translated during C/EBP protein synthesis.60 The

translation rate of the CEBP transcript has been suggested to play an integral

role in the balance between the protein isoforms derived from the same transcript

and this will be discussed later in this chapter. A large amount of information has

been acquired regarding the C/EBP family members. The main focus of this

dissertation will be in regard to C/EBPα and the various roles it has in acute

myeloid leukemia.

Figure 2.1 C/EBP Family. The C/EBP family consists of six members (α-ζ) grouped together based on common domains. Three common domains are located at the C-terminus for every member and consists of a DNA binding domain (DBD) harboring a nuclear localization sequence (NLS), a basic leucine zipper domain facilitating dimerization, and a tail domain facilitating various interactions with non-C/EBP family-associated proteins. The C/EBPα member contains two transactivation domains (TAD) and C/EBPβ contains one TAD. Notably, C/EBPα two isoforms 61 are denoted by p42 (full-length) and p30 (truncated). Modified from Tsukada, et al., 2011.

2.2 CCAAT/Enhancer Binding Protein Alpha

The human CEBPA is located in human chromosome 19q13.1.62 The

gene is 2783 base pairs in length and contains no introns. The CEBPA locus

contains a GC-rich promoter63 and the expression is driven by lymphoid-

enhancer binding factor 1 (LEF-1)64 however, it is likely that other transcription

factors facilitate CEBPA expression as well. The expression of CEBPA is found

in a variety of tissues including (but not limited to) peripheral blood mononuclear

cells, liver, adipose tissue, lung, and mammary glands. In contrast, expression of

CEBPA is low in the brain, testis, and ovary.65 Following transcription, the mRNA

encoded by CEBPA contains four alternative translational start sites giving rise to

various sizes (isoforms) of C/EBPα.66 The differently sized isoforms retain the

same core structure known to be C/EBPα. However, the isoforms vary in size

23 and subsequently contain different structural domains within the isoform. Thus,

these domains contribute to the diversity of function found among the C/EBPα

isoforms.

C/EBPα is a transcription factor with DNA-binding potential. The DNA

-׳binding region recognizes the palindromic nucleotide sequence 5

In addition, research has established that C/EBPα has the 67.׳ATTGCGCAAT-3

ability to form heterodimers with non-C/EBPα functional proteins which facilitates

the recognition of a variety of alternative nucleotide sequences thereby allowing for greater diversity, yet precision, of C/EBPα-targeted gene expression68. Some

of these heterodimers associated with C/EBPα include, PU.1, RUNX1, C-JUN,

AP-1, and NF-κB-p50 subunits.68,69

During hematopoiesis, C/EBPα expression occurs at the CMP-GMP

transition and in progenitors for myelocytes and granulocytes.70 C/EBPα

modulates the expression of several lineage specific receptor genes such as G-

CSFR71 (granulocyte colony-stimulating factor) and M-CSFR72 (macrophage

colony-stimulating factor receptor). Furthermore, C/EBPα also regulates

granulopoetic genes such as neutrophil elastase,73 lactoferrin,74 and genes specific to eosinophils.75

Since the discovery of C/EBPα, the protein domains of C/EBPα have been

well-characterized. (Figure 2.2) The full-length (p42) isoform contains three

transactivation elements (TE) named TE-I, TE-II, and TE-III (These domains are

also referred as transactivation domains, TAD. Depending on the author, some reports will describe C/EBPα with having three transactivation elements69

24 whereas others will describe C/EBPα with having only two transactivation

elements.61 These domains contain regions necessary for protein-protein

interactions with various transcriptional regulators.76 TE-I and TE-II contain vital

regions for the interaction between C/EBPα and members of the RNA Pol II

transcriptional apparatus. TE-III is believed to contain a region which inhibits

transcription of regulators.77 However, this domain also facilitates the binding of

chromatin remodeling proteins thereby making the DNA within the chromatin

more accessible for the transcriptional apparatus. As described previously, the

DBD/NLS and bZIP domains are located at the C-terminal end of the C/EBPα

isoform and facilitates DNA binding and protein dimerization, respectively.

The truncated isoform (p30) is derived from an internal AUG codon within

the CEBPA transcript. This truncated isoform does not contain the first 120 N-

terminal amino acids found within the full-length (p42) isoform. The p30 isoform

is devoid of TE-I and TE-II, yet retains functional characteristics related to

transcription.78 In addition, p30 lacks anti-mitotic activity which is maintained in

the full-length isoform harboring domains necessary for the interactions with

E2F79 and CDK2/CDK480, which have roles in cellular proliferation.

Figure 2.2 C/EBPα and Domain Regions. Schematic diagram of the full-length C/EBPα sequence with noted amino acid positions (top) and relevant domains within the protein. Specific amino acid locations (i.e., S21, etc.) indicate locations of post-translational modifications with functional significance. Located near the N-terminus are three transactivation elements (TE-I, -II, -III) and near the C-terminus are the protein domains named basic region (BR) which facilitates DNA binding, and a basic leucine zipper (ZIP, LZ) domain to facilitate dimerization with similar leucine zipper proteins. Protein-interacting regions are represented in brackets. Image from Fuchs, 2007.69

The full-length isoform of C/EBPα, at present, is somewhat of a misnomer due to a recent discovery of an even longer isoform of C/EBPα, casually named ext-C/EBPα (see Figure 2.1, top). The ext-C/EBPα protein contains all of the reportedly known protein domains within the p42 isoform and is unique because the translational expression from the mRNA transcript is cued from a non-AUG codon but rather a codon containing the nucleotides GUG (humans). This protein isoform differs from other isoforms for having the ability to be retained in the nucleolus allowing ext-C/EBPα to carry out functions with other nucleolar

26 proteins for the purpose of enhancing rDNA expression.66 The ext-C/EBPα isoform is functionally dependent on a nucleolar localization signal located at the

N-terminus which contains the amino acid sequence, RRRR. This N-terminal extension provides a unique feature of the ext-C/EBPα isoform which is not found

in other C/EBPα members. Additionally, the phosphorylation of a serine residue

found in a highly conserved DBD/NLS span of amino acids contributes to the

nucleolar retention of ext-C/EBPα.

2.3 C/EBPα Post-Transcriptional Isoforms

Notably, the CEBPA and CEBPB transcripts contain alternative

end of the ׳translational start sites displayed by the codon AUG at the 5

messenger RNA (mRNA). These AUG codons code for the amino acid

methionine and are significant because they contain the message, to the

scanning ribosome, as to the proper location of where to begin the synthesis of

the peptide chain which will in turn become the protein. It has been shown these

alternative translational start sites within CEBPA and CEBPB are physiologically

relevant to cellular functions, including differentiation and maturation.81 In part,

the control of the C/EBP isoform expression is mediated by the upstream open

AUG codon located ׳reading frame (uORF) which contains a cis-regulatory 5

UTR) portion of both CEBPA and CEBPB-׳untranslated region (5 ׳within the 5

transcripts. During the translational process, the ribosomal subunit eIF4E

(eukaryotic initiation factor 4 E) scans the transcript for the first AUG. Once

identified, the amino acid methionine is put into position and the peptide

27 synthesis commences. However, when an in-frame alternative AUG is contained

downstream from the initial AUG within the transcript, it is possible for the eIF4E

subunit to disengage from the first peptide synthesis and re-initiate peptide

elongation beginning from the latter AUG codon and subsequently abolishing the

elongation of the first peptide chain. It is possible during these scenarios the

resulting translated protein product is a truncated protein relative to the full-length protein. However, this process of translation is influenced by a variety of factors and their rates of activity.

A mechanism for the variance during the translation process involving the

eIF4E and the CEBP transcripts has been proposed.81 Translation of the CEBP

transcripts is mediated by three influencing factors: the uORF containing the

AUG codon, the internal AUG codons, and the level of translational activity of

eIF4E. At times when the activity of the eIF4E is low, the protein translation is

bypassed from the uORF translational start site. However, the nearby

downstream AUG is recognized as the start site for translation initiation thereby

producing the full-length C/EBP isoform. In contrast, during increased rates of

activity, the eIF4E scanning is less specific and may not recognize the AUG just

downstream of the uORF as the initiation site and therefore will continue to

extend the peptide chain. However, the eIF4E subunit recognizes this more

distal AUG and re-initiates protein synthesis from this alternative AUG site. In

this manner, the truncated version of the C/EBP protein is produced. A diagram

portraying this proposed mechanism is illustrated in Figure 2.3. Furthermore,

although not included in this proposed mechanism, it is likely the further

28 downstream translational start site is easily recognized due to the absence of neighboring AUG codons. In support of this mechanism, high activity levels of eIF4E have been linked to the truncated isoform of C/EBPα in several tumor types and the truncated protein may not properly function like the full-length p42 isoform.81-83

Figure 2.3 Schematic Description of CEBPA Translation During Low/High Rates of Translation. During low rates of the translational activity, the scanning ribosome containing the eIF4E subunit, skips the AUG codon located upstream within the uORF (AUGu) and recognizes AUG1 as the starting point for protein synthesis, resulting in the full-length C/EBPα isoform. In contrast, during high rates of activity, the AUGu is recognized as the starting point for protein synthesis and the AUG1 codon is bypassed as the starting point. Although high rates of eIF4E activity starts translation from the AUGu, the downstream AUG2 codon is recognized as a new starting point of protein synthesis and protein synthesis is re-initiated, resulting in the truncated isoform of C/EBPα. Image from Calkhoven, et al., 2002.60

The eIF4E subunit is regularly fluctuating from an inactivated state to an actived state and can vary in rates between low and high.84 When inactivated, the eIF4E subunit is sequestered by the inhibitory 4E-BP1 (eIF4E-binding protein

1) and the translational complex is incomplete. However, when certain cellular signals are active, the 4E-BP1 becomes phosphorylated and the eIF4E subunit is

29 no longer bound to the 4E-BP1 protein. This liberates eIF4E allowing for the

formation of the translational multi-subunit complex referred to as eIF4F

containing the subunits, eIF4E, eIF4A and eIF4G.

The eIF4G subunit acts as a scaffolding protein facilitating the formation of

eIF4F. In addition, eIF4G brings eIF4E into close proximity to a kinase partner,

Mnk1 and Mnk2, which are kinases belonging to MAPK-interacting kinase family

(Mnk).85 The Mnks have been shown to phosphorylate eIF4E at the amino acid

serine 209 (S209).86 The eIF4E phosphorylated S209 residue is important

because it has been shown to be positively correlated with increased

translational activity.85,87 Based on co-crystal structure containing mRNA-eIF4E

complex, the function of the phosphorylated serine has been suggested to form a

salt-bridge with a proximal lysine residue thereby allowing eIF4E to form a

groove and clamp-like structure facilitating the stabilization of the mRNA-eIF4E

interaction.88 However, two reports have been published challenging the

meaning and function associated to phosphorylated serine 209 in eIF4E.

capped mRNA-׳Through the use of surface plasmon resonance, the affinity for 5 was observed to be reduced by eIF4E when containing phosphorylated serine

209.89 In a second report, the authors used synthetic analogs of the

oligonucleotides mimicking mRNA and measured the interaction frequency with a

synthetically-derived eIF4E in a phosphorylated or unphosphorylated state within

an in vitro system.90 The objective of this study was to make the assessment of

the electrostatic interactions between the various phosphorylated states of the

serine residue and the lysine residue believed to form a salt-bridge. The authors

30 concluded the distance between the salt-bridge formation between the two

residues was too large to facilitate any type of bridge87 and thereby arguing

against the clamp conformation hypothesis for eIF4E. Additionally, the

cap for the-׳phosphorylated serine 209 might lower the affinity of eIF4E to the 5 mRNA.89

Currently, the answer remains elusive as to how phosphorylated serine

209 in eIF4E contributes to the rate of translation of the mRNA. Following

cap of-׳phosphorylation of serine 209 the decrease in affinity from eIF4E to the 5

the transcript is plausible for reasons based on energy transfer. Theoretically, a

greater affinity (unphosphorylated) displayed by eIF4E could hinder the

translational rate of the transcript due to the increased energy threshold required

to separate the translational subunit from the translational start codon. In

contrast to the high affinity concept, a lower affinity (phosphorylated) threshold

would permit the subunit to quickly disengage from the translational start codon

and move to the adjacent codon resulting in less time required to elevate the

amount of energy needed to surpass the energy threshold attributed to the high

affinity proposal. In line with this threshold hypothesis and in regard to the

translation variance seen for CEBPA, during high eIF4E activity, it is likely the translational apparatus will not recognize the proximally located AUG codon because of the high rate of translation. This in turn will decrease the chances of recognizing the nearby more internal AUG, resulting in lower probability of re- initiating translation from the AUG codon for the full-length C/EBPα isoform.

However, a more distal AUG will have greater distance between the two

31 candidate translational start sites and increase the likelihood for the apparatus to

recognize the more downstream AUG. Thus, the result favors the truncated

C/EBPα isoform. In addition, this would facilitate more to time to pass allowing

for the replenishing of the pool of AUG anti-codons containing the initiator

methionine residue near the translational apparatus, thus favoring the re-initiation

for the truncated C/EBPα isoform.

2.4 C/EBPα Post-Translational Modifications

The post-translational modifications which have been observed on

C/EBPα have been extensively studied and characterized. These modifications,

specifically phosphorylation and sumoylation, have roles in the functioning of the

different isoforms. Several reports have been published describing the

phosphorylation of multiple serine residues within the C/EBPα protein66,91,92. The serine 21 is phosphorylated by the extracellular signal receptor kinsase 1/2

(ERK1/2) which induces a block in C/EBPα-dependent cellular differentiation.91

In addition, following phosphorylation of serine residue 248, enhanced C/EBPα-

dependent granulocytic differentiation results. The phosphorylation of serine 248

is likely mediated by protein kinase C (PKC).92 A prominent function of C/EBPα is to modulate cellular proliferation. A target serine involved in C/EBPα regulated

cellular proliferation is serine 193. When phosphorylated at serine 193, C/EBPα

binds to cyclin dependent kinase 2 (CDK2) and inhibits cellular proliferation by

inhibiting cell-cycle progression.93 However, when dephosphorylated, C/EBPα

binds to retinoblastoma (Rb) thereby sequestering it from the transcription factor,

32 E2F. Once liberated from the repressive Rb, E2F is able to induce the expression of genes necessary for cell cycle progression at the G1/S boundary.

Similar events were reported to occur in liver tumors. Following the dephosphorylation of serine 193 by protein phosphatase 2A (PP2A), the cells were no longer observed to be under the inhibition of C/EBPα-induced cell-cycle control.94

The post-translational modification known as sumoylation involves the covalent addition of a small ubiquitin-like modifier (SUMO) protein, 12 kD in size, which affects the function(s) of the target protein. In general, the sumoylation of

C/EBPα is believed to have an inhibitory role on the protein function. Notably, the transfer of a SUMO moiety is a complex series of events.95 (Figure 2.4)

First, the SUMO peptide undergoes an ATP-dependent activation process involving the E1 activating enzyme heterodimer comprised of AOS and UBA2.

Following activation, the SUMO is transferred to the E2-conjugating enzyme named UBC9. The final step is the transfer of the SUMO moiety to the target protein and this process is mediated by an E3 ligase.

Figure 2.4 The Sumoylation Pathway. A schematic diagram illustrating the step-wise process associated to the sumoylation of a target protein. 1. An ATP-dependent hydrolytic reaction which activates the SUMO (S) peptide at the glycine residue (G). 2. Activated SUMO is transferred to the E2-ubquitin conjugating enzyme, UBC9. The SUMO peptide is transferred (via E3 ligase) from UBC9 to the lysine residue within the target protein (K159 for C/EBPα). SENPs, sumo- specific peptidases catalytically remove the SUMO modification from the targeted protein and the cycle repeats. UBC9 expression is indirectly upregulated in response to C/EBPα-p30 expression and may be a key factor which facilitates functional differences between C/EBPα-p42 and C/EBPα-p30. Image from Khanna-Gupta, 2008.95

Following the sumoylation of the C/EBPα target site, lysine 159 (K159) which is contained within the TE-III domain (Figure 2.2), C/EBPα-p42 was shown to have reduced ability to inhibit cellular proliferation in hepatocytes.96 More recently, an intriguing study was conducted which involved the investigation between the roles of two C/EBPα isoforms, C/EBPα-p42 and C/EBPα-p30, in the context of sumoylation.97 Both isoforms have been shown to bind to the promoter of the lactoferrin gene. The sumoylated C/EBPα-p42 isoform has been shown to be constitutively bound to the lactoferrin promoter in an acute promyelocytic leukemia cell line. To facilitate experimental testing, the lactoferrin

34 promoter was cloned into a luciferase reporter expression plasmid. Using a

transfection approach, when either C/EBPα-p42 or C/EBPα-p30 was co- transfected with an expression plasmid coding for SUMO-1 (a member of the

SUMO family) less luciferase reporter activity was observed in the presence of

C/EBPα-p42. The co-transfection involving C/EBPα-p30 and SUMO-1 did not display as significant reduction in luciferase reporter activity as was seen for

C/EBPα-p42. Regardless of sumoylation modifications to C/EBPα-p30, this truncated isoform was found to bind less intensely compared to the full-length isoform. These findings provide support for the establishment of a basis for investigating the disparate roles between C/EBPα-p42 and C/EBPα-p30 following sumoylation.

Importantly, expression of C/EBPα-p30 was shown to be correlated with the expression of the E2 ligase UBC9 which is involved in the sumoylation process.97 Indeed, both C/EBPα isoforms can be sumoylated at lysine 15995,

however, a potential differential effect my result between the two isoforms

following sumoylation. It has been speculated these modifications alter the

protein-protein interactions exhibited between the two isoforms.95 Taken

together, C/EBPα-p30 indirectly upregulates UBC9, which facilitates the

sumoylation of either or both isoforms. However, differences in functionality

between sumoylated C/EBPα-p42 and C/EBPα-p30 are just now being revealed.

2.5 C/EBPα Functional Characteristics

The various roles C/EBPα has throughout hematopoiesis have been

extensively studied using a variety of model systems. Studies using mice in

which the C/EBPα expression was disrupted, the production of neutrophils was

observed to be blocked whereas all other blood components remained at their

normal stoichiotic levels.98 Several research groups have reported their

observations after having successfully generated a knockout CEBPA (C/EBPα-/-)

mouse model.99-102 Mice with this genetic deletion die shortly after birth99 and believed to be the result of inefficient glucose metabolism. In addition, the knockout models displayed defects in granulocyte development, pulmonary abnormalities including lack of surfactant-producing cells100,103 indicative of

aberrant cellular maturation, aberrant hepatocyte differentiation100,101, and

defects in glucose metabolism.102 Thus, C/EBPα is indispensible during several

developmental stages, more specifically, the events necessary for committed

granulopoiesis. In contrast, C/EBPα is not required for the maturation process of

committed granulocytes.104,105 Overexpression of C/EBPα in HSC cells favored

granulocytic differentiation and inhibited erythrocytic differentiation.106

At this point in our understanding of leukemia, it is clear that C/EBPα plays

a significant role in hematopoiesis. C/EBPα is involved in the three major

checkpoints associated to hematopoiesis: cell proliferation, differentiation, and

apoptosis.107 C/EBPα has been shown to have a role in the regulation of the hematopoietic stem cells (HSCs) self-renewal process.16 In this investigation,

36 HSCs were observed to be in abundance when C/EBPα was silenced. Mice

transplanted with HSCs harboring silenced CEBPA displayed a block in myeloid

differentiation and an accumulation of HSCs. Fittingly, these mice displayed features associated to leukemia. Finally, multiple reports are available describing the observations in cell lines following the re-introduction of C/EBPα.97,108,109

C/EBPα has significant roles during the hematopoietic process and the

differentiation process can be severely altered when a mutation occurs within the

CEBPA locus. Many reports are currently available describing these mutations

impacting the function of C/EBPα and related isoforms.110,111 Mutations within

the CEBPA gene are found in approximately 10-15% of all AML cases.55,112 The

majority of mutations in the AML M2 subtype involve CEBPA mutations resulting in the expression of the p30 protein isoform. The mechanism for this leukemia is centered on the expression of C/EBPα-p30 which believed to serve as a dominant-negative isoform by forming heterodimers with the full-length C/EBPα- p42 isoform (when a healthy allele is present). The formation of the C/EBPα- p42/ C/EBPα-p30 heterodimer has been suggested to inhibit the endogenous functions of C/EBPα-p42 involved in granulocytic differentiation.113

Human and mouse studies suggest that AML does not manifest from

complete ablation of the CEBPA locus, but rather, in part, mutations within the

gene impacting the protein structure and subsequently contributing to the

phenotypes associated to this disease.114 These mutations are commonly

divided into two categories; amino-terminal frame-shift mutations and carboxy-

terminal in-frame mutations. The N-terminally isolated frame shift mutations

37 result in an early termination of the full-length C/EBPα-p42 isoform and re-

initiation of protein translation at the more distal, internal, translational start site.

This mutation gives rise to the truncated C/EBPα-p30 isoform. The C-terminally

located mutations disrupt the basic region (DBD) and the leucine zipper domain

(bZIP). These mutations disrupt the DNA-binding affinity of C/EBPα for the

targeted oligonucleotide binding site within the promoter of a target gene. In

addition, mutations within the bZIP domain disrupt the dimerization between

C/EBPα and partner proteins thus inhibiting the functional properties attributed to

wild-type dimer functions. Germ-line CEBPA mutations have been reported in a

low-number of families.115,116 In these cases, the development of AML was

prolonged and might be the result of additional genetic mutations to produce

leukemia within these family members.

Several alternative mechanisms to influence the function of C/EBPα have

been described117-120. These proposed influential molecular mechanisms can affect the expression of CEBPA from the genetic locus and negate the CEBPA mutational status. One such repressive molecule affecting CEBPA expression is the protein product from the chromosomal translocation t(8;21) which produces the fusion protein AML1/ETO. AML1/ETO has been shown to suppress the expression of C/EBPα, possibly by inhibiting positive autoregulation at the

CEBPA promoter.117,118

Keeping with the chromosomal translocation description, t(9;22) results in

the fusion protein BCR-ABL which is a constitutively active tyrosine kinase

associated to chronic myeloid leukemia (CML). During the development of CML,

38 some patients experience a phenomenon referred to as blast crisis which refers

to the inhibition of granulocytic differentiation. During this event, C/EBPα is

downregulated but the mRNA coding for C/EBPα remains expressed within the

cell119. The BCR-ABL fusion gene induces the expression of the protein

heterogenous nuclear ribonucleoprotein E2 (hnRNP E2) which binds to the

CEBPA transcript thus preventing translation of the transcript to the C/EBPα

transcription factor.119 Similar to the repression of CEBPA and aside from the blast crisis event, CEBPA expression can also be inhibited by a different mechanism at the post-transcriptional level. Calreticulin binds to the GC-rich

portion of the CEBPA transcript thereby preventing translation and subsequently

inhibiting expression at the protein level.120 Thus, the blockage of the CEBPA

transcript is yet another process in which the expression of CEBPA expression is

modulated and negates the mutational status of the gene.

Finally, the half-life of C/EBPα has been shown to be a major factor in the

development of AML. Indeed, the oncoprotein Trib2 (Tribbles homologue 2) was

shown to associate with C/EBPα and contribute to the proteosome degradation

of the transcription factor.121 In contrast, the co-activator protein c-JUN Kinase 1

(JNK1) inhibited the ubiquitination and degradation of C/EBPα by

phosphorylating C/EBPα within the DBD.122

Taken together, there are various mechanisms which have been identified

that contribute the modulation of C/EBPα expression and funcationality. When

these events occur, it is likely the differentiation process will be altered in such a

manner that leukemogenesis is likely to occur. Therefore, the proper expression

39 and function of C/EBPα is vital for the well-being of the effector cells and the organism.

2.6 Experimental

Recently, it has been reported that approximately 15% of patients with

AML and without cytogenetic anomalies, commonly refered to as cytogenetically normal (CN) AML, harbor mutations within the CEBPA locus.55 These CEBPA

mutations have also been associated with better event-free survival and overall survival especially if present as “double mutations” (mutations involving both alleles). Our group was the first to report an increase of expression for miR-

181a in patients with mutated CEBPA. More recently, the prognostic significance

was evaluated for miR-181a expression in CN-AML patients.56 Increased miR-

181a was correlated with higher complete remission rates, longer overall survival, and a trend for longer disease-free survival.

Given that a similar trend was observed when describing a favorable prognosis linked to both CEBPA mutations and increased miR-181a expression, a hypothesis was derived. The formulated hypothesis suggested that a correlation exists between mutated CEBPA and miR-181a. While collecting data for this hypothesis, a thorough examination was imperative for detailing the

differences correlating miR-181a expression with either CEBPA wild-type, or mutations effecting the N-terminal, and C-terminal regions of the protein.

The miR-181a expression levels vary among CN-AML patients and those with higher miR-181a are predicted to have significantly better outcomes.56 In

40 addition, it was previously reported that CEBPA mutations, a favorable prognostic marker in CN-AML, were associated with higher miR-181a levels.55

These observations prompted the investigation for the type of impact the CEBPA mutation has on miR-181a expression. CN-AML patients with N-terminal CEBPA mutations (either present as a single or double mutations) had a significantly higher miR-181a expression than patients with a single C-terminal CEBPA mutation or wild-type CEBPA (P=0.046 and P<0.001, respectively; Figure 2.5.a).

Patients with N-terminal CEBPA mutations had a longer overall survival when compared to patients with single C-terminal CEBPA mutations (P=0.05) or wild- type CEBPA (P<0.001; Figure 2.5.b).

Figure 2.5 C/EBPα-p30 Isoform is Correlated with Increased miR-181a Expression and Better Survival Probability. a. Gene expression profile data of young CN-AML patients with a CEBPA wild-type, N-terminal mutation, or C-terminal mutation and the correlation these mutations have in terms of miR-181a expression. Patients with an N-terminal CEBPA mutation correlates to higher expression of miR-181a expression. b. A graphical representation comparing young CN-AML patients with CEBPA wild-type, N-terminal mutation, or C-terminal mutation and the correlation to survival probably in terms of years. Patients with N-terminal mutation had a significantly higher probability of longer survival when compared to those patients with wild-type or mutations coding for a C-terminal mutation in the CEBPA gene. c. Representative Western blot of young CN-AML bone marrow patient samples examining the expression of C/EBPα. The C/EBPα-p30 isoform is seen in the N-terminally mutated patient sample. d. The same patient samples described in c., quantitative real-time RT-PCR data showing a correlation between C/EBPα expression and miR-181a-1, -2 expression. Higher miR-181a-1 expression is correlated to the C/EBPα-p30 isoform

These data suggest a correlation exists between mutations within the

coding region specific for the N-terminus portion of C/EBPα and increased miR-

181a expression. Thus, an examination was performed using AML patient bone

marrow samples in which their CEBPA status had been previously been characterized. Western blot was used to examine the C/EBPα expression for a representative set of these samples. As expected, the N-terminally mutated

42 sample expressed the truncated isoform of C/EBPα whereas only the full-length isoforms were observed for both the wild-type and C-terminal patient samples.

(Figure 2.5.c) Upon further investigation, the expression levels of miR-181a were analyzed using quantitative real-time RT-PCR. To better characterize which isotype of miR-181a was increased in response to the N-terminally mutated

C/EBPα isoform, both isotypes (miR-181a-1 and miR-181a-2; refer to Chapter

3.3 for a description of the miR-181a isotypes) of this microRNA were analyzed from the same patient bone marrow samples analyzed for C/EBPα expression and detailed in Figure 2.5.c. In Figure 2.5.d, an increase of miR-181a-1 expression was associated to the N-terminally mutated C/EBPα when compared to the wild-type C/EBPα. Interestingly, a slight increase in miR-181a-1 expression was seen in the C-terminally mutated C/EBPα isoform and this is consistent with the in silico data displayed in Figure 2.5.a. Taken together, the observations made in silico correlating miR-181a expression to various mutations within the CEBPA locus were confirmed using a sample set of AML bone marrow

samples characterized with having either C/EBPα wild-type, or mutations within

the coding regions for the N-terminus or C-terminus of the C/EBPα protein.

To further validate these results, constructs expressing either wild-type, N-

terminally mutated or C-terminally mutated C/EBPα isoforms were attained. The

CEBPA genes from patients characterized with having a mutation, were PCR-

amplified and ligated into a murine stem cell virus (MSCV) expression vector,

thus allowing for constitutive expression of the protein. A schematic diagram of

the various mutants is displayed in Figure 2.6.a. Notably, the two N-terminally

43 mutated C/EBPα isoforms are coded by genes with a frame-shift mutation within the coding region specific for the N-terminus of C/EBPα. The frame-shift disrupts the open reading frame causing re-initiation of translation to occur at the internal translational start site therefore resulting in the expression of N-terminally truncated protein (depicted by the bent arrows in Figure 2.6.a). In regard to the

C-terminally mutated C/EBPα isoform, an amino acid substitution was identified within the highly conserved nuclear localization sequence for C/EBPα.59 This

amino acid substitution involved the highly conserved arginine residue, changed

to a leucine residue, and might have a significant role in the cellular localization

of C/EBPα, thus disrupting the endogenous function of C/EBPα.

Figure 2.6 Artificial Recapitulation of C/EBPα-p30 Induced miR-181a-1 Expression. a. Schematic diagram of C/EBPα expressed from an expression vector containing the CEBPA gene isolated from AML patients with identified CEBPA mutations or wild-type CEBPA. Transactivation elements (TE-I, -II, -III), basic DNA-binding region, and leucine zipper regions are characterized along the protein diagram. The internal translational start site is depicted by bent arrows and specific for the N-terminally truncated C/EBPα-p30 isoform. The sequence of amino acids containing the nuclear localization sequence is shown; highly conserved N and R residues are shown in blue, mutant R300L is shown red. b. Confocal microscope images showing the localization of the constitutively expressed C/EBPα isoforms described in a. and expressed in the leukemia cell line, K562. All isoforms (green) except R300L are localized to the nucleus (blue). c. Western blot of cellular fractions depicting the localization of the C/EBPα isoforms from the expression vectors described in a. Notice all isoforms are localized to the nucleus except for R300L which is predominately cytoplasmic. UBC9 serves as a positive-control for C/EBPα-p30 expression. Ku-70 and Actin serve as internal loading controls. d. Quantitative real-time RT- PCR analysis for miR-181a isotypes expressed in the K562 transiently transfected with the expression constructs described in a. Notably, miR-181-1 expression is highest in those cells transiently expressing the C/EBPα-p30 isoform.

The leukemia cell line, K562, was selected for experiments involving the transient expression of the aforementioned CEBPA-containing plasmid constructs because this cell line does not express endogenous C/EBPα. Thus,

K562 is a suitable cell line for the investigation due to the lack of inference by an

45 endogenous C/EBPα. Following transient transfection of the C/EBPα expression

plasmids, cells were fixed and the cellular localization for C/EBPα was assessed using confocal microscopy. The nuclear localization of the wild-type and N-

terminal mutants were localized to the nucleus, as expected. (Figure 2.6.b)

Interestingly, the C-terminal mutant, R300L, displayed a majority of the

localization to the cytoplasm. This observation is in accord with the amino acid

change within the nuclear localization sequence. These observations were

supported by the Western blot data obtained following cellular fractionation.

(Figure 2.6.c) Indeed, the wild-type and N-terminal mutants were identified in the

nuclear extracts and not in the cytoplasm. In contrast, but in line with the

confocal microscopy observations, the majority of the R300L expression isoform

was seen in the cytoplasmic portion with slight localization in the nuclear

extracts. Notably, the nuclear protein UBC9 was found to have increased

expression for the cells expressing the N-terminal C/EBPα isoforms. Fittingly,

the nuclear UBC9 protein expression was found to be indirectly increased upon

N-terminal C/EBPα mutant expression and not by the full-length isoform.97 Thus,

UBC9 expression serves as a positive-control for the activity of C/EBPα-p30

during investigations analyzing the differences between the C/EBPα isoforms.

The aforementioned in silico data suggested that N-terminal mutations favor the expression of miR-181a, relative to wild-type and C-terminal mutations.

Therefore, the miR-181a expression was analyzed for the K562 cells transiently expressing the various C/EBPα isoforms. More specifically, the miR-181a isotypes were differentiated between the chromosome 1 locus (miR-181a-1) and

46 chromosome 9 locus (miR-181a-2). As expected the expression levels for miR-

181a were higher in those cells expressing the N-terminal mutants. Moreover, the isotype for the miR-181a originated from the chromosome 1 locus. (Figure

2.6.d) Interestingly, the expression of miR-181a-1 closely mimicked the expression of the positive-control protein, UBC9, in which expression of the protein and miR-181a-1 were found to be the highest in the N-terminal C/EBPα isoform containing the H24Afs mutation. The next highest expression for both

UBC9 and miR-181a-1 was observed in those cells expressing the C/EBPα truncated isoform containing the P23Qfs mutation. A slight increase in the expression for both UBC9 and miR-181a-1 was observed for the wild-type and C- terminally mutated isoforms of C/EBPα. This is likely to be an effect from the slight expression of the N-truncated C/EBPα isoform expressed and observed in the Western blot data. The data collected at this point in the investigation strongly correlates the expression of C/EBPα-p30 to the expression of miR-181a-

To validate these data, two additional monocytic cell lines, THP-1 and

U937, were used as model systems for this investigation. The THP-1 cells were transduced with expression constructs123 to stably express HA-tagged C/EBPα- p42 or C/EBPα-p30 isoforms. The U937 cell line derivatives were designed to express C/EBPα-30 under the control of a tetracycline on/off system.113 In the absence of tetracycline, C/EBPα-p30 expression is expected to occur. In contrast, in the presence of tetracycline, the endogenous C/EBPα full-length

(p42) isoform is expected. The empty vector serves as a negative control and

47 these cells express only the U937 endogenous C/EBPα-p42 isoform. Either

U937 derivative (tet on/off: C/EBPα-p30 or empty vector) endogenously express

C/EBPα-p42 regardless of tetracycline treatment. This specific model system is useful for identifying cellular responses, including gene expression, upon

C/EBPα-p30 expression.

In accord to the previous observations, the results in Figure 2.7 strongly suggested that miR-181a-1 expression is correlated to the expression of

C/EBPα-p30, regardless of experimental model. As seen in Figure 2.7.a,

Western blot confirmed equal expression of the stably expressed HA-tagged

C/EBPα constructs in THP-1 cells. The Northern blot data (Figure 2.7.a) revealed an increased miR-181a-1 expression and was supported by the quantitative real-time RT-PCR data displaying the expression of miR-181a in the

THP-1 cells following transduction. (Figure 2.7.b) Furthermore, we showed that in the absence of tetracycline, the expression of C/EBPα-p30 was observed in

U937 cells. (Figure 2.7.c) As expected, the induction of UBC9 expression was increased concurrently with the cellular expression of C/EBPα-p30. Northern blot was used to examine total RNA for the expression of miR-181a-1. Indeed, an increase of precursor miR-181a-1 expression was identified for the cells with increased C/EBPα-p30 expression. These results were validated through quantitative real-time RT-PCR while assessing miR-181a expression. (Figure

2.7.d) Taken together, these THP-1 and U937 results support the previous data involving K562 cells and the transient expression of the C/EBPα isoforms seen in

Figure 2.6. The results suggest that induced miR-181a gene expression in

48 response to C/EBPα-p30, is a general feature in both bone marrow patient

samples as well as in vitro AML models..

Figure 2.7 The Correlation Between C/EBPα-p30 Expression and miR-181a is a Common Feature. a. Western blot and Northern blot data of THP-1 cells stably expressing HA-tagged C/EBPα-p42 or C/EBPα-p30 isoforms. Northern blot shows an increase in miR-181a-1 expression for those cells expressing the HA-tagged C/EBPα-p30. Similar miR-181a-1 expression levels are seen in the cells expressing either the control vector or the HA-tagged C/EBPα-p42 isoform. b. Quantitative real-time RT-PCR after examining the expression of miR- 181a in those THP-1 cells described in a. In line with the Northern blot data, miR-181a expression was found to be highest in those THP-1 cells expressing the HA-tagged C/EBPα-p30 isoform. c. Western blot and Northern blot data for U937 derivative cells expressing either empty vector (EV) or the tetracycline-off C/EBPα-p30 isoform. UBC9 was used as a positive-control for the expression of C/EBPα-p30. Northern blot data correlates increased miR-181a-1 expression with C/EBPα-p30 expression. These data are supported by the quantitative real-time RT-PCR data d. which examined the expression of miR-181a for those cells described in c. Actin and snRNA U6 were used as loading controls for Western and Northern blot, respectively.

49 Based on the data collected, the ability to recapitulate the observations

made while examining the patient bone marrow samples was achieved artificially

by the transient expression of C/EBPα-p30 resulting in the expression of miR-

181a. The next objective focused on modulating the expression of C/EBPα-p30

using a chemical approach. To this end, no chemical compound is currently

known to induce the transition from the C/EBPα-p42 isoform to the C/EBPα-p30

isoform. Therefore, an alternative approach was employed to demonstrate the

C/EBPα-p30 influence on miR-181a expression. This novel approach involved the reciprocal event, to alter the expression of C/EBPα-p30 and favor the expression of the full-length C/EBPα-42 isoform. In turn, this transition would presumably be seen at the level of miR-181a expression with the expectation that miR-181a would decrease during the transition from the C/EBPα-p30 isoform to the C/EBPα-p42 isoform.

To explore this possibility, the leukemic cell line HL60 was used as a model cell line for the chemical manipulation of C/EBPα expression. HL60 cells are of particular interest because these cells express endogenous C/EBPα-p30 more abundantly than the C/EBPα-p42 isoform. The chemical compound selected for these experiments is the triterpenoid compound, 2-cyano-3,12- dioxooleana-1,9-dien-28-oic acid (CDDO) based on a previous study which reported the conversion from C/EBPα-p30 to C/EBPα-p42 in HL60 cells following treatment with CDDO.124 A considerable amount of research has investigated

the effects of CDDO in a variety of tumors.125-127 The data collected suggests

that CDDO induces apoptosis as well as differentiation when used as a

50 therapeutic agent against myeloid leukemia.128,129 Based on previous reports and the therapeutic benefits described following the application of this compound, CDDO was selected as the chemical agent to facilitate the expression of C/EBPα-p42 over C/EBPα-p30 in the HL60 cell line.

HL60 cells were treated with 1µM of CDDO for a 12-hour interval and cells were collected every hour meant to be analyzed using Western blot and quantitative real-time RT-PCR. Upon examination of the Western blot data, the

C/EBPα-p42 expression was noticeably induced throughout the first 7 hours, and decreased thereafter, achieiving a lower expression level than the untreated control. The decrease in the C/EBPα-p42 coincided with the increase of C/EBPα- p30 and UBC9 expression approximatively 5 hours following treatment, at which time miR-181a-1 expression also increased. Indeed, miR-181a-1 expression reached maximum expression levels when C/EBPα-p42 was nearly undetectable, suggesting that increased expression of this microRNA was related to the increase in the C/EBPα-p30/C/EBPα-p42 ratio. Furthermore, it is likely the

C/EBPα-p30/C/EBPα-p42 ratio was influenced by the involvement of UBC9.

Although there was a preferential increase in miR-181a-1 concurrently with increase in the C/EBPα-p30/C/EBPα-p42 ratio, miR-181a-2 expression also increased slightly. Noteworthy, these HL60 and CDDO experiments were reproducible with similar results.

Figure 2.8 The Compound CDDO Induces Both C/EBPα-p30 and miR-181a-1 Expression. a. Western blot of HL60 cells treated with CDDO and hourly assessments of protein expression. C/EBPα-p30 expression was increased as a cellular response to the CDDO treatment. Also, the expression of UBC9 (positive control for C/EBPα-p30 expression) increased following CDDO treatment and C/EBPα-p30 induction. b. Quantitative real-time RT-PCR data collected from the same HL60 cells described in a. An increase in miR-181a-1 expression was seen in these cells with increased C/EBPα-p30 expression.

Based on the collective evidence presented hereto, it is reasonable to

infer the following: a correlation exists in AML patient bone marrow samples

linking miR-181a expression to the N-terminally mutated isoform of C/EBPα.

This observation was confirmed after examining the endogenous expression of

C/EBPα and miR-181a among a representative set of AML bone marrow

samples from patients characterized with having mutations in the regions

afflicting either the N-terminus or C-terminus of the protein and translated into their respective C/EBPα isoforms. This correlation between C/EBPα-p30 and miR-181a was recapitulated artificially using transiently expressed constructs mimicking, in part, the protein expression seen in the AML bone marrow patient samples. Moreover, similar results were obtained while using two different cells

52 lines manipulated to express either C/EBPα isoform. The stably expressed

C/EBPα-p30 was correlated to miR-181a expression in THP-1 cells. Additionally, the tetracycline on/off cell line derivative with induced C/EBPα-p30 expression resulted in elevated miR-181a expression. Finally, the increased C/EBPα- p30/C/EBPα-p42 ratio which occured following treatment of CDDO, increased miR-181a expression. Taken together, it is reasonable to conclude that a correlation exists between C/EBPα-p30 and miR-181a expression. Furthermore, the data suggests that C/EBPα-p30 expression occurs prior to miR-181a expression. Thus, it is likely the transcriptional activity innate to C/EBPα-p30 likely has a direct role in the expression of miR-181a. Additional research investigating the putative interaction between C/EBPα-p30 and the miR-181a promoter is necessary to infer any additional conclusions regarding the direct involvement C/EBPα-p30 might have on miR-181a expression.

2.7 Future Work

It would be of interest to more fully understand the relationship between

C/EBPα-p30 and miR-181a-1. More specifically, it is almost imperative to dissect the promoter of miR-181a-1 to conclusively determine the mechanisms through which C/EBPα-p30 contributes to miR-181a-1 expression. Currently, the promoter for miR-181a-1 has yet to be described. The appropriate approach to accomplish this task would begin by utilizing a computer-based algorithms designed to predict interactions between protein(s) and DNA sequences of interest. With this approach, the field of possible candidate proteins involved as

53 either transcription factor or co-activator is narrowed considerably. Upon

identification of a putative C/EBPα-binding site, the oligonucleotide sequence

should be cloned into an expression plasmid harboring a coding region for a

luciferase reporter. Once the construct has been created, the putative binding

site should then be mutated to confirm that binding is abolished, subsequently

silencing any luciferase reporter activity enhanced by the C/EBPα-p30 isoform.

The results from this investigation would likely provide insight as to the binding

and transactivation from C/EBPα-p30 at this particular nucleotide sequence.

To support the identification of the miR-181a-1 promoter from the data

obtained after the luciferase reporter activity assay, two additional experiments

would be of interest. Conducting an electrophoretic mobility shift assay (EMSA)

for this nucleotide sequence would provide data revealing in vitro interactions

between proteins from cell lysates and the suspected C/EBPα binding site within the oligonucleotide sequence. These cell lysates should contain exogenous

C/EBPα-p30 in which binding would be enhanced relative to the empty vector control. Furthermore, chromatin immunoprecipitation (ChIP) assays would add additional support from an in vivo aspect. Having performed these experiments and obtaining similar data from these approaches, it is likely to be accepted that the region of interest is a bona fide promoter of miR-181a-1 and inducible expression occurs in the presence of C/EBPα-p30.

It is likely C/EBPα-p30 interacts with additional proteins to facilitate the expression of miR-181a-1. Thus, it would be of interest to identify the proteins associated to C/EBPα-p30. Several approaches should be initiated to resolve

54 this query. One such approach should utilize column chromatography. This

approach is feasible because large amounts of cell lysates are attainable for analysis due to the ability of maintaining cell cultures of a particular cell line and treating them with either CDDO or vehicle. At a pre-determined time point in which the majority of the C/EBPα-p30 isoform is expressed, protein lysates should be isolated and subjected to protein selection (C/EBPα) through column chromatography. The bound C/EBPα and accessory proteins should then be fractioned off the column and identified through various methods including

Western blot or more likely mass spectrophotometry.

The results from this investigation will likely provide details as to why the

N-truncated isoform, and not the full-length counterpart, favors miR-181a-1 expression. Perhaps the difference between C/EBPα accessory proteins is linked to the N-terminus of the C/EBPα isoforms. Indeed, the 120 amino acid N- terminus of C/EBPα has domains which facilitate protein-protein interactions.

(Figure 2.2) Perhaps the accessory proteins utilizing this region of C/EBPα might be responsible for the differences observed regarding the activities associated to

C/EBPα-p30 and C/EBPα-p42 and their influence on miR-181a-1 expression.

Furthermore, the 120 amino acid region contains domains facilitating interactions with candidate proteins such as E2F (transcription factor), Rb (cell-cycle regulator and E2F-interacting protein), CBP/p300 (chromatin modifier), and

TBP/TF-IIB (TATA-Binding Protein/Transcription Factor-IIB).

A worthy pursuit would involve the examination detailing the interaction between TBP/TF-IIB and the different C/EBPα isoforms, in terms of C/EBPα

55 gene activation. One possible hypothesis might describe C/EBPα-p42 acting as a TBP/TF-IIB quenching protein thereby prohibiting TBP/TF-IIB to function

properly with RNA polymerase II. Indeed, miR-181a-1 expression is dependent on RNA polymerase II. (see Chapter 3.1). Reports have been published

describing gene-specific regulators, also having a role in the formation of

TBP/TF-IIB, and these regulators also modulate the formation of transcriptional

complexes.130-132 C/EBPα is undoubtedly a gene-specific regulator. Moreover,

TF-IIB is required for recognition of the transcriptional initiation start site along

the targeted DNA sequence.133 Therefore, in the absence of TF-IIB, possibly due

to the sequestering by C/EBPα, TF-IIB-dependent transcription is not easily performed possibly due to the unavailable TF-IIB, which facilitates TBP to recognize and bind to TATA-boxes within the promoters of genes.132 Thus, the

full-length C/EBPα isoform may have inhibitory properties which are not found

with C/EBPα-p30 because it lacks the N-terminal portion of the protein which

facilitates the protein-protein interaction with TBP/TF-IIB.

Another promising project worthy of investigation includes the

characterization of the half-life for both C/EBPα isoforms following the application

of CDDO. The premise of this investigation is revealed in Figure 2.8 which

details the presence of C/EBPα-p30 expression with having a longer half-life than the C/EBPα-p42 isoform. As seen during later periods of the CDDO treatment

timepionts, and shortly after the increase expression of only the C/EBPα-p30

isoform (not C/EBPα-p42), miR-181a-1 expression increased in a remarkable

fashion. These data suggested that C/EBPα-p30 likely has a role in the

56 expression of miR-181a-1, and these data are supported by the earlier data

presented in Figures 2.5 and 2.6. Thus, it would interesting to determine if the

sustained presence of C/EBPα-p30 is the result of de novo translation from the

CEBPA transcript or if this feature is the result of a much longer half-life

attributed to C/EBPα-p30 which is not seen for C/EBPα-p42. Experiments involving pulse-chase protein labeling would provide valuable insight when searching for the answer to this query.

Additional investigations should detail the transcriptional events from the

CEBPA gene locus, in an effort to determine if the increase of C/EBPα

expression is the result of de novo transcription from the CEBPA locus. An

alternative mechanism opposite of de novo transcription, could be that C/EBPα-

p30 expression is due to increased translation of previously transcribed

transcripts which have been stabilized within the cellular milieu and made

available for enhanced translational activity as a result of CDDO treatment. This

inquiry could be answered through the use of transcription inhibitory compounds

which do not permit de novo mRNA synthesis, followed by application of CDDO,

thereby allowing for the analysis of the C/EBPα expression over time. The future

of these investigations discriminating between the half-lifes of C/EBPα-p30 and

C/EBPα-p42 is very exciting and many avenues are worthy of pursuit.

Chapter 3

MicroRNA-181a and its role in AML

3.1 MicroRNA Discovery,Processing, and Characteristics in Hematopoiesis

In the phylum Eukarya, evolutionary conserved microRNAs (miRs) are

genes which encode a class of small untranslated regulatory ribonucleic acids

(RNAs) spanning in length of 18-25 nucleotides.134-136 The founding member of

miRs, lin-4, was reported in 1993 using Caenorhabditis elegans as a model

system for understanding cell lineage of differentiation in nematodes.137 In this

report, the authors identified the gene lin-4 as an essential non-protein coding

transcript with being a significant regulator for the expression of the protein lin-14

in four species of Caenorhabditis. Later it was shown that lin-14 contained

untranslated region ׳multiple lin-4 anti-sense nucleotide sequences within the 3

UTR) of the transcript and these sequences were required by lin-4 to mediate-׳3) the down-regulation of lin-14 expression.138 Within a decade since the discovery

of the novel function displayed by lin-4, additional miRs have been discovered

across several biological systems and have been shown to have a place in

scientific research.135,139-141

58 The mechanism of miR manifestation and processing is an orchestrated

series of events. MicroRNAs are contained within various locations of a host

gene (exons and introns), transcribed by RNA polymerase II, and

characteristically are composed of long nucleotide sequences referred to as

primary microRNAs (pri-miRs) which can be as large as 1 kilobases in length.135

These long transcripts undergo a maturation process through a series of events

shortening their length at each step in the process. Located within the nucleus,

the pri-miR, is processed by the ‘microprocessor complex’ which is a protein

complex containing the RNAse III-like protein named Drosha, and the protein

DGCR8 (DiGeorge syndrome critical region gene 8). Following this step in

processing, the resulting product is 60-70 nucleotides in length with a hairpin-like

structure and referred to as the precursor microRNA (pre-miR).142 The double-

stranded, single molecule, pre-miR is then exported from the nucleus, mediated by exportin-5, to the cytoplasm where it is recognized by an additional processing

complex containing the endonuclease protein, DICER, TAR RNA-binding protein

(TRBP) and Argonaute 2 (AGO2). After being recognized by the DICER complex, the pre-miR is unwound and the two strands are likely separated by the

‘slicer’ domain AGO2.143,144 This stage of processing produces the single-strand

mature form of the miRNA which is bound to Ago2, and serves as the core

component of the RISC (RNA-induced silencing complex).136 Although the exact

mechanism has yet to be elucidated, current models suggest the mature miR,

bound to RISC, directs the complex to an sequence within the RNA transcript

which is complementary to the ‘seed’ sequence (‘seed’ sequence is located at

59 end of the miR). Once the base pairing has been established, RISC is ׳the 5

believed to function in one of two ways. Either, the translation of the mRNA

transcript is repressed due to the blockage elicited by RISC on the transcript,

thereby preventing the translational machinery from reading the transcript which

is necessary when producing a protein; ultimately silencing expression.

Alternatively, the mRNA transcript can be cleaved by RISC rendering it unable to

produce a recognizable transcript required for translation.145 Additional

hypotheses include the ability of RISC to de-stabilize the mRNA transcript by

end of the transcript, leading to the decay ׳facilitating the deadenylation of the 3

of the entire transcript146, or the possibly of the RISC complex directing the

transcript for decay directly by an unknown mechanism.147 Determining these exact mechanisms for miRNA gene silencing has yet to be established. It is probable that multiple mechanisms for gene silencing occur within the cellular milieu at any given time or instance.

MicroRNAs are involved in various cellular processes including,

proliferation, differentiation, apoptosis, senescence, and hematopoiesis.136 The

hematopoietic cellular process is an appealing model system to use when

evaluating miR function because this differentiation process involves precise

expression of transcriptional regulators driving the cells into specific lineages.

These transcriptional regulators are under the influence of miR expression.135

Studies have shown the presence of miRs in early embryonic stem cells (ES)148

and hematopoietic stem cells (HSC).149 Disruption of the endogenous miR levels

within the HSC has been demonstrated to be detrimental to the hematopoietic

60 process and as a result led to a decrease of effector cells stemming from

common progenitors.150 Thus, conceptually, disruption of the miR expression

levels, either directly or indirectly, enables a few selected cells a survival

advantage which disrupts the differentiation process; thus fitting the criteria

necessary when defining leukemia.

Several studies have shown that miR expression occurs in parallel to the

differentiation process.148,149,151 Two selected studies serve as examples for the

various roles miRs have in the differentiation process. A comparison study was

conducted exploring the expression of a variety of miRs in progenitors including

HSC (CD34+/CD38-) and total CD34+ progenitors.151 The results showed using

undifferentiated cells (CD34+/CD38-) the expression of nine miRs which were

increased to four times the expression levels observed in differentiated (CD34+)

cells. In contrast, CD34+ cells displayed four times the amount of expression for

22 miRs when compared to CD34+/CD38-. Thus, a gradient for several miRs

was observed and the miRs were suggested to have roles in the transition from

CD34+/CD38- to the more differentiated lineage of CD34+. Using a more

differentiated lineage, megakaryocyte/erythroid progenitors (MEPs), the

expression levels of miR-150 was shown to influence the fate of the progenitor

cells through the modulation of MYB, a transcription factor involved with erythroid

differentiation.152 When the expression of miR-150 was low, levels of MYB were elevated thereby promoting erythroid differentiation. In contrast, when miR-150 expression was high, MYB expression was low thereby favoring the differentiation of the progenitors to megakaryocytic differentiation. This feature

61 suggested that MYB expression is under the control of miR-150 thus adding to

our knowledge that cellular differentiation is under strict control of miR

expression.

At a different stage of hematopoiesis, a significant amount of data has

been collected through several studies involving myelocytic differentiation, which

in turn, contributes to our understanding of the various roles miRs have at this

level of development. The earliest progenitors for granulocyte/monocyte

differentiation are common myeloid progenitors (CMPs). From this stage of

development, a few transcription regulatory factors including PU.1, C/EBPα, and

RUNX1, have a role in the progression from CMPs to either granulocytic or

myeloid cells.13 Notably, the expression of RUNX1 favors the differentiation from

the CMP cell to the monocytic lineage. Conversely, miR-27 (regulated by

C/EBPα; granulocytic modulator) has been demonstrated to modulate the

expression of RUNX1153. The expression of miR-27 increases as the progenitor differentiates into the granulocytic progenitor stage. As a result, the expression of RUNX1 is ablated. Experimentally, using myeloid progenitors, it was reported when miR-27 expression is antagonized, RUNX1 expression is increased and subsequently hindering the granuloycytic differentiation process153. Similar

studies were conducted for other myeloid regulators such as PU.1 (miR-424)154

and C/EBPα (miR-124a).155 Clearly, miR expression patterns fluctuate even

throughout the latter stage of hematopoiesis. Their expression patterns

modulate the expression of regulators necessary for proper differentiation. In a

similar fashion, aberrant miR expression mimics those phenotypes evoked by

62 mutations involving transcriptional regulators rendering them devoid of

endogenous function. Given the heterogeneity associated to AML, it is

conceivable that a significant portion of this heterogenous disease involves miR expression, whether they are normally expressed and aberrantly expressed.

3.2 MicroRNA in AML

Recently, a great deal of attention has been focused on using several approaches to sort the heterogeneity of AML starting with the cytogenetic features, and sub-categorizing these features based on miR-expression profiles.

Not exclusively, but in a manner closely related to reverse-genetics, gene expression microarray platforms have allowed for the determination of miR expression in AML sub-types with various cytogenetic abnormalities. The miR- expression profiles have been delineated as efforts are made while working backwards through the transcriptional machinery and cellular networks while attempting to understand how certain genetic aberrations correlate to the miR expression.

Currently, several reports have been published regarding miR expression and various sub-groups of AML. A relatively large-scale study involving 215 de novo AML cases were grouped into cytogenetically/molecularly defined sub- populations (e.g. CEBPA mutations, NPM1 mutations, t(8;21), and t(15;17)) and the expression signatures of 260 miRs and multiple mRNAs were described threby enabling a comparison to be established between the expression patterns of miRs and mRNA transcripts156. Indeed, a correlation was reported to exist

63 between miRs and these sub-types of AML. Notably, the second most highly

expressed miR (2.30-fold) in the CEBPA mutation sub-group was miR-181a.

Additionally, AML cases harboring the aberration inv(16) was associated with

downregulated let-7. FLT3-ITD correlated to an upregulation of miR-155

(oncogenic miR) but this increase of miR-155 was found to be independent of downstream signaling from FLT3-ITD157. Supporting this notion, lowly expressed

miRs-191 and -199a were associated to a poor prognosis for de novo AML

patients harboring the FLT3-ITD mutation, which was also associated to poor prognosis. Thus for example, a poor prognosis might detail, a FLT3/ITD

mutation and low expression of miR-191 and miR-199a.

Shortly after the relatively large-scale study investigating the miR expression correlation to AML sub-populations, a more focused investigation was conducted involving miR expression profiles correlating to CEBPA mutation

status in 175 younger de novo AML patients with normal cytogenetics and having

high-risk molecular features.55 The results from this study described a favorable

prognostic value associated to those patients harboring CEBPA mutations and

were independent of other molecular prognosticators. Furthermore, this study

observed a positive-correlation between CEBPA mutations and members of the

miR-181 family. These data are in accord with the previously mentioned AML

patient data correlating to an increase of miR-181a expression associated to

CEBPA mutations156 (also see Chapter 2). Given two independent studies

reported a likely connection between members of the miR-181-family to CEBPA

mutations and one of the studies showed a possible beneficial aspect of miR-181

64 to AML patients, it is within reason to infer that miR-181a likely contributes a

positive role in the differentiation process which makes this miR an attractive

regulator to study.

3.3 MicroRNA-181 Family and Hematopoiesis

The miR-181 family consists of six members located on various

chromosomes within the human genome. These members are named hsa

(Homo sapiens) along with the 181 designation follow by a letter (i.e., a, b, c, d) and number which differentiates between similar miR-181 entities. Serving as an example to the nomenclature is, hsa-miR-181a-1. The genetic locus of each individual miR-181 family member is described with the chromosomal location in parentheses: hsa-miR-181a-1 (chromosome 1:198828173-198828282), hsa-

miR-181a-2 (chromosome 9:127454721-127454830), hsa-miR-181b-1

(chromosome 1:198828002-198828111), hsa-miR-181b-2 (chromosome

9:127455989-127456077), hsa-miR-181c (chromosome 19:13985513-

13985622), and hsa-miR-181d (chromosome 19:13985689-13985825). More commonly, the hsa-miR-181-family is referred to as miR-181 (sans hsa, unless necessary) along with the respective letter designation and hyphenated numeral.

The positions of these miRs are unique due to their chromosomal arrangement.

Both miR-181a-1 and miR-181b-1 are in tandem to each other, with miR-181a-1

located upstream to miR-181b-1 by fewer than 200 base pairs along

chromosome 1. The host gene for miR-181a-1, -b-2 is RP11-21E23.1-001 and although likely codes for a novel transcript, this host gene is presently

65 uncharacterized. The coding regions for miR-181a-1, -b-2 are located within the

second intron of the host gene. Similarly, miR-181a-2 and miR-181b-2, and,

miR-181c and miR-181d, are arranged in tandem to each other along their

respective chromosomes. Due to their proximity to each other along the

chromosome, it is likely these tandemly arranged miRs share a common

promoter region and expressed from the same transcript. However, this notion

for the genetic expression has yet to be experimentally demonstrated.

The six miR-181 members are grouped into a family on the basis of

having similar “seed” sequences within the mature form of the oligonucleotide.

The oligonucleotide sequences are detailed in Table 3.1. The effectiveness of

miR-181 gene silencing is dependent on two criteria: the quantity of complement

UTR region (e.g., 15 distinct locations within-׳seed” regions present within the 3“ a single mRNA transcript facilitating the interactions with miR-181) and the quality of complementary base pair interactions that can be established between

UTR of targeted mRNA transcript. For-׳the “seed” sequence of the miR and the 3

example, if all 8 nucleotides from the “seed” sequence of miR-181 establishes an

UTR of the targeted-׳interaction with a nucleotide sequence within the 3

transcript, that interaction is referred to as an 8-mer. Consequently, it is likely the

duplex containing the miR-181 and mRNA transcript will be subjected to the

endonuclease cleavage activity exhibited by the RNase H domain contained

within Argo2. Alternatively, if a less-than perfect complementary match is

UTR of-׳established between only 7 nucleotides between the miR-181 and the 3 the targeted transcript, the incomplete pairing is referred to as a 7-mer. Less-

66 UTR-׳than perfect base pairing between the “seed” sequence of miR-181 and 3 of the transcript is likely to silence gene expression by interfering with the translational machinery prohibiting translation of the transcript and not endonuclease cleavage.

(׳3→׳miR Family Member Oligonucleotide Sequence (5

miR-181a-1 AACAUUCAACGCUGUCGGUGAG

miR-181a-2 AACAUUCAACGCUGUCGGUGAG

miR-181b-1 AACAUUCAUUGCUGUCGGUGGG

miR-181b-2 AACAUUCAUUGCUGUCGGUGGG

miR-181c AACAUUCAACCUGUCGGUGAGU

miR-181d AACAUUCAUUGUUGUCGGUGGG

Table 3.1 miR-181 Family Members. The miR-181 family is comprised of six members, left column. miR-181a and miR-181b have two isotypes denoted by -1 and -2. The oligonucleotide ׳3→׳sequence for each individual member is described in the right column and presented in a 5 format. The “seed” sequence for the miR-181 family member is highlighted in blue font.

Given the novelty of miR-directed gene silencing and the recent discoveries pertaining to the miR-181 family, the function of these miRs is still being investigated. Indeed, the identification regarding the expression patterns of miR-181a within hematopoiesis provides insight as to what is required by the cell, thus providing a phenotype of the cells undergoing the differentiation process. It is reasonable to infer these phenotypes are a result of the gene silencing evoked by miR-181a onto the target gene transcripts. The identification

67 of miR gene transcript targets is of great interest when correlating a phenotype

displayed by the cell to the molecular activities occurring within the cell.

Insomuch, computer-based algorithms have been created to facilitate the

prediction of various miRs to their putative target transcripts.

Computer algorithms provide some initial insight when studying miR-181a

UTR transcript targets. Although several computer algorithms are currently-׳3 being developed to improve our searches for miR-181a targets, some commonly used computer-based algorithms are miRBase158, Targetscan159, Pictar160, and

miRanda.161 These algorithms use known nucleotide sequence data and match

these sequences to “seed” sequences within various miRs. As a result, these computer programs seemingly predict in silico miR targets for miRs. Thus, the in silico data provide an acceptable starting point when exploring miR targets.

Consequently, demonstrating these mRNA transcripts are bona fide miR targets requires experimental data obtained from the physical science conducted in the laboratory.

Reports describing mRNA transcript targets of miR-181a are beginning to

evolve, however, at this stage the characterization of miR-181a is still in its

infancy. Currently, a commonly accepted set of experiments performed to

UTR of a putative transcript is a bona fide target of a-׳demonstrate a particular 3

particular miR is to perform a luciferase reporter assay. This involves cloning the

.UTR of the target gene into a luciferase reporter expression vector-׳genomic 3

Following the cloning procedure, site-directed mutagenesis is performed to

mutate the complementary “seed” nucleotide sequence in an attempt to abolish

68 the targeted downregulation induced by the candidate miR. Finally, the

luciferase expression vectors are co-transfected with a separate expression

vector containing the coding sequence for the pre-miR genomic sequence. If the

UTR is a bona fide target, the luciferase reporter activity is expected to-׳3

decrease in the presence of the miR candidate. However, when the mutated

luciferase reporter expression vector is co-transfected with the expression vector

containing the coding sequence for the pre-miR, the luciferase reporter

expression is expected not to decreasd due to the lack of complementary

sequence for the candidate miR. Additional experiments should be performed to

validate the involvement of the miR to the targeted transcript. These

experiments include assessment of the target mRNA expression through

quantitative real-time RT-PCR and protein identification of the target gene

through the use of Western blot.

Like with many other miRs, miR-181 has a role in the hematopoietic process. Strong expression of miR-181 was reported to occur in CD34+ cells.149

Based on this finding, miR-181a has been suggested to block differentiation in

progenitor cells.149 In contrast, miR-181 has been reported to be expressed at

the latter stages during hematopoiesis162. The expression of miR-181a was

found to be downregulated early in the differentiation process, which likely

permits differentiation, but was expressed at higher levels during the

differentiation process at the lymphoid progenitor stage prior to bifurcation. This

increased expression at bifurcation could favor one lineage versus the other. It

has been reported that miR-181 is preferentially expressed during B-cell

69 development.163 During B-cell development, miR-181a expression is high in pro-

B lymphocytes, but as the differentiation continues to the pre-B stage, miR-181a

was found to decrease.162,164

In a separate investigation using CD34+ cells from umbilical cord blood

(UCB), the cells were stimulated to differentiate along the erythroid lineage using a series of growth factor cocktails and the miR expression was assessed.165

Among the data collected in this investigation, it was shown that three miR-181

family members were increased in expression during the differentiation process.

Two of the members, miR-181a and miR-181b, were expressed greater than

two-fold during erythroid differentiation. These data were supported by an

independent study demonstrating the same phenomenon of miR-181

involvement in erythroid differentiation.166 In contrast, miR-181 was not detected to be modulated during myeloid differentiation in a murine model system.167

Indeed, differences between murine and human miR expression patterns have

been reported when examining miR expression in hematopoeisis.149,162

Supporting this finding, miR-181 was found to be restricted to murine B-

lymphocytes but found to be expressed in human normal B-cells, T-cells,

monocytes, and granulocytes.162 Based on these observations, the expression

of miR-181 is likely to have roles in the human developmental processes of B-

lymphocytes, T-lymphocytes, myelocytes, and erythrocytes. Undoubtedly, more

research is necessary regarding the functional roles miR-181-family members

have in hematopoiesis thereby elucidating their contribution to the differentiation

process.

3.4 microRNA-181a and Leukemia

Several studies have been published reporting observations made for

miR-181 expression during leukmogenesis. The foundations for these studies

were established using a variety of leukemia cell lines which have been studied

in great detail over multiple years. In 2005, Ramkissoon et al., published their

results for selected miR expression in several leukemia cell lines through the use

of Northern blot analysis.162 Indeed, differences in miR-181a expression were

reported among the various cell lines. The highest expression of miR-181a was

found in the lineage of T-cell lines including a heterogenous array of

lymphoma/leukemia diseases. The second-highest expression of miR-181a was

found in B-cell lines. Notably, no miR-181a expression was identified in two

Burkitt lymphoma cell lines whereas high expression was revealed in two acute

lymphoblastic leukemia lines. The lowest expression of miR-181a was seen

(with the exception of one cell line: HL-60) in cell lines of myelocytic, monocytic,

megakaryocytic, and erythroid lineages. HL-60 is an acute myelogenous

leukemia cell line with high expression of miR-181a. Interestingly, HL-60

expresses the N-truncated isoform of C/EBPα. Two years later, an independent

study using a microarray platform was employed to examine the expression of

miR-181-family members using a variety of cell lines.149 Indeed, similar expression levels of miR-181a were described in some of the same cell lines.

Thus, the more recent and sophisticated analysis validated the earlier Northern blot data.

71 As mentioned earlier, miR-181a has been suggested to serve a role in

erythroid differentiation. Recently, a report was published demonstrating,

experimentally, that miR-181a was correlated to erythroid differentiation. The

UTR of Lin28.168 Lin28 is an-׳authors observed miR-181a targeting the 3

oncogene and associated to cellular transformation169 and maintenance of an

undifferentiated state.168 In this hematopoietic scenario, miR-181a serves as a

tumor suppressor gene. Similarly, using a glioma cell line as a model system,

Shi et al., demonstrated that miR-181a functions as a tumor suppressor.170

Recently it was reported, transiently expressed miR-181a was demonstrated to

sensitize glioma to radiation therapy.171 In support of these findings, Ouyang et

al., using an astrocyte cell line, demonstrated experimentally a sensitizing

mechanism involving miR-181a in which two anti-apoptotic proteins, Bcl2 and

Mcl1, were downregulated due to miR-181a.172 These two investigations support

the notion that miR-181a acts as a tumor suppressor by directly targeting the

transcripts from oncogenes to silence their expression. Other transcripts

experimentally shown to be bona fide targets of miR-181a include: Prox1, a

master regulator of lymphatic endothelial cell173; Hox-A11, a repressor of

differentiation174; RB1, tumor suppressor; and RBAK, transcriptional binding

partner of RB175. Moreover, miR-181a also targets a general functional domain coded in many zinc finger genes.176 The zinc finger transcripts are unique

targets because evidence has been shown that miR-181a targets these

transcripts in the open-reading frame (ORF) of the transcript and not within the

UTR. Moreover, this mechanism of miR-181a gene silencing is suspected to-׳3

72 occur for a variety of transcripts encoding zinc finger proteins due to the codon

TGT (cysteine) which are abundant in zinc finger coding transcripts and code for miR-181a complement sequences.176

3.5 MicroRNA-181a and Targets Relating to the Innate Immune System

As time progresses, more targets of miR-181a are being discovered through the step-wise process of computer-based algorithms and experimental application. Recently in a study describing miR-181a expression as a prognosticator for outcome in AML, a correlation was revealed linking miR-181a expression to two proteins of interest which may contribute to the disease.177 An inverse correlation was observed between the expression of miR-181a and genes coding for regulators of the innate immune system, Toll-Like Receptor 4

(TLR4) and Interleukin-1 Beta (IL1β). TLR4 is believed to be a oncoprotein in some cases due to the ability to elicit inflammatory response within the cell, thus creating a favorable environment for the cell to transform and grow uncontrollably178. TLR4 has been shown to promote the tumor progression in ovarian cancer179 and is believed to have a role in the blockage of myeloid differentiation of progenitor cells and HSCs during severe sepsis.180 Given these findings, it is of profound interest to investigate the potential interplay between miR-181a and TLR4.

Toll-Like Receptors are an evolutionary conserved receptor protein associated to the innate and adaptive immune systems. The receptors are comprised of three functional domains: an extracellular leucine-rich repeat (LRR)

73 domain which recognizes and binds to likely pathogens, a transmembrane

domain, and a cytoplasmic toll/interleukin-1 receptor (TIR) domain which

functionally interacts with immune signaling molecules within the cell.181 In

humans, there are 10 TLRs expressed.181 Notably, TLR4 is highly expressed in

cells associated in hematopoietic differentiation, specifically monocytes,

lymphocytes, and macrophages.182,183 From an immuno-preventative standpoint, the functional significance of TLR4 is most closely associated to the recognition of lipopolysaccharide (LPS)184 but has also been shown to recognize heat-shock

protein 70185 and fibronectin.186

Two different signaling cascades can result regarding the LPS-induced

TLR4 activation181. LPS is a surface molecule bound to the outer membrane of

Gram-negative bacteria. When in the circulatory system, LPS is recognized and

bound by the LPS-binding protein (LBP) which is recognized by the cell surface

protein, CD14. CD14 catalyzes the transfer of the LPS molecule to the myeloid-

differentiation protein-2 (MD-2) which is catalyzed by CD14. TLR4 then

recognizes the LPS-MD-2 complex and subsequently homodimerizes with the

cytoplasmic domain of another TLR4 molecule thereby eliciting a signal to the

interior of the cell. At this point, there are two pathways from which the signaling

occurs by the TLR4 complex, the MyD88-dependent and MyD88-independent

pathway, both which have different endpoints181. The MyD88-dependent

pathway is initiated following the TLR4 homodimerization. The cytoplasmic

proteins, MyD88 and Mal, are recruited to the TLR4 complex, and the protein

complex then forms a complex with IL-1R-associated kinase 1(IRAK) and IRAK-

74 2, which is facilitated by IRAK-4. IRAK-1 then becomes phosphorylated by

IRAK-4, dissociates from the complex, and IRAK-1 forms a complex with TNF-

Associated Factor-6 (TRAF6). Now activated, TRAF6 associates with TAK-

2((TGF-β-activated kinase)-1 binding protein-2 (TAB2)) which in turn activates the TAK-1 protein. Activated TAK-1 forms a complex with the Inhibitory-binding protein κB kinase (IKK)α and IKKβ, which collectively are bound to NEMO, a scaffolding protein. Next, the IKKβ subunit phosphorylates the Inhibitor of NF-κB

α (IκBα) subunit which in turn is liberates the NF-κB subunit complex. The NF-κB

complex then translocates into the nucleus and NF-κB-targeted gene expression

is the result. Some of these NF-κB targeted genes are expressed in response to

inflammation and cells likely respond to these activated genes in a proliferative

manner.

Alternatively, the MyD88-independent pathway also activates NF-κB but in

a delayed manner. Primarily, the endpoint for the MyD88-independent pathway

is target gene expressed by Interferon Regulatory Factor 3 (IRF3). This

alternative signaling cascade is initiated at the TLR4 complex by an associated

protein named TIR-related Adapter Molecule (TRAM)187 which facilitates the

connection between TLR4 and TRIF (TIR-domain-containing adaptor protein inducing IFN-β). It has been suggested that TRIF binds with TANK-Binding

Protein Kinase-1 (TBK1) and IRF3.181 TBK1 has been proposed to

phosphorylate IRF3, which subsequently allows IRF3 to bind to Interferon-

Sensitive Response Elements (ISRE) within the nucleus, which are also known

as IRF3 inducible genes.181 Notably, many of the details regarding the MyD88-

75 independent pathway needs to be developed further to have a clearer

understanding.188 However, the MyD88-independent pathway has been

correlated to the expression of tumor necrosis factor-α (TNF-α). Notably, TLR4

has been shown to increase the production of tumor necrosis factor-α (TNF-α)

which is a potent inflammatory cytokine.189 Moreover, the pro-inflammatory

environment could result in immunosuppressive responses thereby leaving the

potentially carcinogenic environment unchecked by the immune system and

allowing for uncontrolled growth.190

TLR4 has been reported to be expressed AML cells191 and NF-κB

activities have been reported to directly induce gene expression of anti-apoptotic proteins in multiple myeloma cells through an autocrine manner involving IL1β.192

Thus, it would be of great interest to acquire the ability to decrease TLR4 and

IL1B gene expression and subsequently the activity of NF-κB which is likely facilitating survival advantages to leukemic cells. It is reasonable to surmise that miR-181a would likely provide therapeutic purposes, on two levels, to cells with

UTR and-׳active NF-κB. First, miR-181a could possibly target TLR4 at the 3 downregulate the protein expression thereby eliminating the receptors contribution to the NF-κB activity. Second, miR-181a could likely target THE

UTR which in turn would eliminate the contribution of-׳IL1B transcript at the 3

IL1β when inducing inflammation and NF-κB activity. Taken together, it is of great interest to use miR-181a as a therapeutic molecule to alleviate these inflammatory and carcinogenic characteristics involving NF-κB activities.

76 3.6 Experimental

Previously, we reported that miR-181a expression was found be negatively correlated with the expression of genes coding for innate immune effector molecules.56,177 These effector molecules have been linked to aberrant

activity which reportedly supports malignant growth. Thus, a hypothesis was

formulated in which higher levels of miR-181a would lead to lower expression

levels of genes coding for these innate immunity effector molecules in AML

blasts thereby combating leukemia growth. To show experimentally the targeting

activity of miR-181a on transcripts for innate immunity, TLR4 and IL1B were

selected as candidate targets since these genes were previously implicated with

promoting proliferation and survival of malignant cells.179,180,188,193,194 Both TLR4

and IL1B transcripts harbor a 7-mer binding site in their 3′-UTR for miR-181a195

(Figures 3.1.a and 3.1.b) however, these findings were not validated at the

bench.

Figure 3.1 miR-181a Targets the TLR4 and IL1Β Transcripts. a,b A schematic layout showing the TLR4 (a) and IL1Β (b) mRNA 3'-untranslated regions (UTRs). Red font indicates sequences of conserved 7-mer miR-181a found within the TLR4 and IL1Β 3'-UTRs in different species. c Luciferase reporter activity of TLR4 and IL1Β constructs harboring wild-type or mutated 3'-UTR seed sequences after co-transfection with miR-181a expression vector or control vector. d,e Relative TLR4 and IL1Β mRNA expression in THP-1 cells upon forced miR-181a expression. f Western blot for TLR4 protein expression in THP-1 cells upon forced miR-181a expression. g IL- 1β protein expression measured by ELISA, in LPS-stimulated THP-1 cells following forced miR- 181a expression. h,i Relative quantitative real-time RT-PCR results for TLR4 and IL1Β mRNA expression in AML patient blasts following forced miR-181a expression.

To prove that TLR4 and IL1Β are miR-181a targets, a miR-181a expression vector was co-transfected with a TLR4 or IL1Β wild-type 3′-UTR

luciferase reporter construct in HEK 293T cells. This experiment resulted in

78 reduced luciferase reporter activity compared to those cells transfected with a

control expression vector. The luciferase reporter activity remained unchanged in

cells co-transfected with TLR4 or IL1Β reporter constructs containing mutated

sequences complementary to miR-181a. (Figure 3.1.c) Consistent with these results, decreased levels of TLR4 and IL1Β mRNA were observed following forced miR-181a expression in THP-1 cells (Figures 3.1.d and 3.1.e). Notably, the miR-181a expression levels achieved with the expression vector in these

THP-1 cells were comparable to those observed in CN-AML patients tested by quantitative real-time RT-PCR (data not shown). MiR-181a-mediated downregulation of TLR4 and IL1Β expression was also confirmed at the protein level (Figures 3.1.f. and 3.1.g) and validated in AML patient blasts (Figures 3.1.h. and 3.1.i). Altogether, these results reveal that TLR4 and IL1Β are bona fide targets of miR-181a.

Both TLR4 and IL-1β proteins participate in the activation of NF-κB signaling188,196 which has been shown to play a key role in myeloid

leukemogenesis.197,198 To demonstrate the impact of forced miR-181a

expression on NF-κB activity, an NF-κB luciferase reporter construct was co-

transfected with a miR-181a expressing vector or control vector in the

monocyte/macrophage cell line, RAW 264.7, which expresses TLR4. Following

co-transfection with miR-181a-expressing or control vectors, the cells were

stimulated with lipopolysaccharide (LPS), a known activator of the NF-κB

signaling cascade mediated by TLR4.188 As shown in Figure 3.2.a, the NF-κB

luciferase reporter activity was decreased in the presence of miR-181a in LPS-

79 stimulated cells. It has been reported the phosphorylated serine 32 residue of

IκBα initiates signal-induced degradation of the NF-κB inhibitor, thereby leading

to subsequent activation of the NF-κB complex which is recognized by the phosphorylation of NF-κB-p65 subunit.197,198 Forced miR-181a expression in

THP-1 cells decreased phosphorylation for both IκBα and NF-κB-p65 when compared to their respective total protein levels. (Figure 3.2.b) Thus, it is likely that miR-181a augments the ability of the cell to initiate NF-κB signaling.

Figure 3.2 miR-181a Represses NF-κB Activity and Downregulates miR-155 Expression. a NF-κB responsive luciferase activity in RAW 264.7 co-transfected with a miR-181a construct and cultured with or without LPS. b Western blot of phosphorylated and total levels of IκBα and NF- κB-p65 following LPS stimulation after forced expression of miR-181a in THP-1 cells. The ratios show phosphorylated protein levels normalized to total protein levels. c Quantitative real-time RT- PCR results of miR-155 expression in THP-1 and MV4-11 cells transiently overexpressing miR- 181a. d miR-155 expression in AML blasts following miR-181a forced expression assessed using quantitative real-time RT-PCR. e miR-155 and miR-181a expression in AML blasts transfected with anatgomiR-181a or a non-targeting (scramble) oligonucleotide and expression was determined using quantitative real-time RT-PCR. f Differences in baseline miR-155 expression levels in BM samples from CALGB molecular high-risk CN-AML patients according to their CEBPA mutation status (N, patients with N-terminal mutations or concurrent N-terminal and C- terminal mutations; C, patients with C-terminal mutations only; wt, wild-type). g Effect of forced miR-181a expression and knockdown of NF-κB enrichment on the BIC/miR-155 promoter measured using quantitative real-time RT-PCR. h,i Effects of siRNA targeting h TLR4 or i IL1Β expression in THP-1 cells. Graphs are quantitative real-time RT-PCR data of miR-155 expression levels in THP-1 cells following downregulation of siRNA targeted TLR4 or IL1Β transcripts.

Figure 3.2 miR-181a Represses NF-κB Activity and Downregulates miR-155 Expression.

NF-κB transactivation is known to positively influence the expression of several genes including those encoding miRNAs. The B-cell integration cluster

(BIC) gene harbors the coding region of the oncogenic miRNA, miR-155.199,200

Forced expression of miR-155 in normal murine hematopoietic stem cells has

82 been shown to enhance myeloproliferation.150 Moreover, higher expression of

this miR-155 was previously associated with FLT3-ITD and blast proliferation in

myelomonocytic and monocytic AML subtypes.150,201 Based on this information,

an experiment was performed testing for changes in miR-155 expression as

further evidence for the activity exerted by miR-181a on NF-κB downstream

function. Indeed, forced miR-181a expression led to miR-155 downregulation in both AML cell lines and patient blasts. (Figures 3.2.c and 3.2.d) In contrast, expression of miR-155 was increased in AML blasts treated with an antisense

oligonucleotide to miR-181a (hereafter referred to as antagomiR-181a) that decreased the miR-181a endogenous levels (Figure 3.2.e). Consistent with these

results and those of the miR-181a expression levels in CEBPA molecular

subsets of CN-AML patients (Figure 2.4.a) miR-155 expression was significantly

lower in patients with CEBPA N-terminal mutations compared with patients

harboring CEBPA C-terminal mutations (P=0.046) or CEBPA wild-type

(P<0.0001). (Figure 3.2.f) Moreover, using chromatin immunoprecipitation (ChIP) assays, it was a revealed that a decrease in binding of NF-κB-p65/p50 complex on the miR-155/BIC promoter following forced miR-181a expression (Fig. 3g).

Conversely, miR-181a downregulation by antagomiR-181a resulted in enrichment of the NF-κB-p65/p50 complex on the miR-155/BIC promoter. (Figure

3.2.g) Finally, siRNA-mediated downregulation of the TLR4 and IL1B transcripts recapitulated the effects seen during elevated miR-181a expression which in turn resulted in decreased miR-155 expression (Figures 3.2.h and 3.2.i).

83 A putative anti-leukemia activity from miR-181a can be included in a hypothesis based on the evidence that a better outcome is associated with higher miR-181a levels in CN-AML patients.56 Support for this hypothesis was

shown by a reduction in cell growth (Figure 3.3.a), reduced colony forming ability

(Figure 3.3.b), and disrupted cell-cycle progression (Figure 3.3.c) in THP-1 cells when forced to express miR-181a compared to cells transfected with a control vector. Similar results were observed in AML patient blasts transfected with the same control vector or miR-181a constructs. Blasts expressing the miR-181a construct were found to display more than double the amount of annexin V when compared to the control. (Figure 3.3.d) Silencing of either TLR4 or IL1Β through siRNA techniques also led to a reduction of colony formation, albeit to a lesser extent than forced miR-181a expression unless both genes were silenced concurrently (data not shown). The leukemia repressing activity of miR-181a was validated in vivo by engrafting THP-1 cells supplemented with a miR-181a- expressing vector, into NOD/SCID mice. After 6 weeks, mice receiving the miR-

181a-transfected cells developed significantly smaller tumors when compared with mice xenografted with cells transfected with a control vector (Figures 3.3.e and 3.3.f).

Figure 3.3 miR-181a has Anti-proliferative and Pro-apoptotic Properties. a Relative growth and b colony formation ability of THP-1 cells overexpressing miR-181a or a control vector. c Cell cycle analysis in THP-1 cells overexpressing miR-181a. THP-1 cells overexpressing miR-181a display cell-cycle arrest at the sub-G1 phase. d Flow cytometry analysis following annexin V staining for AML patient blasts overexpressing miR-181a. e,f Tumor sizes and weights from mice xenografted with THP-1 cells overexpressing miR-181a.

The proof-of-concept was demonstrated by showing higher miR-181a

expression suppresses innate immune signaling in AML blasts through the

silencing of the TLR4 and IL1B genes. These genes have been previously

implicated in leukemia growth likely through aberrant activation of NF-κB

85 signaling. Consistent with these results, it was shown that elevated miR-181a

expression decreased NF-κB activity both in vitro and in vivo, downregulated NF-

κB targets (e.g., miR-155), attenuated cell proliferation and colony forming ability,

all of which support the hypothesis that miR-181a contributes to attenuation of

leukemia growth in vivo. Reports have been published describing inappropriate

innate immune and inflammatory signaling linked to oncogenesis202-204 and have shown a role for miRNAs in aberrant regulation of innate immune mechanisms in clonal myeloid cells.205 In the MDS 5q- syndrome, increased innate immune

signaling due to the loss of miR-145 and miR-146a was found to contribute to the disease. The loss of these miRNAs increased the expression of innate immune mediators TIRAP and TRAF6 (TLR signaling pathway), thereby providing the unregulated conduits necessary for aberrant leukemogenic NF-κB activity.205

Consistent with this report, forced expression of miR-181a resulted in downregulation of TLR4 and IL1B and decreased downstream activation of NF-

κB. Hence, one can reasonably surmise that inappropriate activation of innate immunity signaling pathways is a common pathophysiological feature of at least some clonal myeloid diseases and may represent a novel therapeutic target.

3.7 Future Work

In an effort to strengthen these findings regarding miR-181a and the downregulation of both TLR4 and lL1B, it would be of interest to involve as a control, an off-target microRNA which is not predicted to target the 3′-UTR of either of these aforementioned transcripts. The expected results would include

86 that neither of the expression patterns for the targets would be altered in the presence of the off-target miRNA. In doing so, the claim of specificity of miR-

181a to TLR4 and lL1B would be strengthened. In addition, to demonstrate

conclusively that miR-181a is the functional microRNA influencing the expression

of TLR4 and lL1B, it would be of interest to involve as a control, a siRNA

targeting the DICER protein. The addition of this control would inhibit the

DICER-dependent processing of the precursor miR-181a to the functional mature

form thereby ablating any functional properties associated to mature miR-181a.

The expected results would include the unchanged expression of both TLR4 and

lL1B in those cells transfected with DICER siRNA, subsequently silencing DICER

expression and rendering miR-181a inactive for gene modulation. With the

addition of these two controls, off-target miRNA and siRNA silencing of DICER,

the results describing the miR-181a regulation of TLR4 and lL1B would be

bolstered. However, given the amount of work already contributed in obtaining

these results and shared in this chapter, repeating these experiments with the

two additional controls is not very practical at this time.

Additional suggested experiments, on a much larger scale, would involve

efforts to characterize the influence(s) miR-181a has within the confines of the

cellular milieu. This approach would include cell lines from various phases in the

hematological differentiation process and manipulate these cells to stably

expressing miR-181a. This establishment of miR-181a expression can easily be

achieved by transducing into the cell, a miR-181a construct constitutively

expressed from a chosen promoter, or from an inducible promoter. After

87 determining the expression for miR-181a, the expression levels of all the primary-

, secondary-, tertiary-target genes influenced by miR-181a expression could be determined using an affymetrix system designed to generate large amounts of data regarding the expression of genes within the cell. While performing this analysis, gene expression profiles can be determined and compared to various controls, one being an empty vector control relative to the miR-181a construct.

Indeed, gene expression patterns are likely to be revealed following this comparison. Furthermore, these miR-181a transduced cell lines can be subjected to proteomics analysis. The details in this analysis would provide insight as to which proteins are influenced by the increased expression of miR-

181a. Indeed, there are differences in gene expression patterns among posttranscriptional and post-translational events, and these differences would likely be seen in the data revealed through the proteomic analysis. The results obtained from the affymetrix study and the proteomics study should be subjected to a comparison analysis between the two platforms. By performing this comparison, it is likely that differences will be revealed at the transcript level and the protein level, i.e., a gene found to be highly expressed at the mRNA level but silenced at the protein level. These future experiments would certainly provide an intriguing project for any investigator.

While advancing the proposed study detailing the analysis of the expression patterns from stably expressed miR-181a cell lines, it would be interesting to compare these results to AML patient data collected through gene expression profiles assembled from previous investigations. The information

88 obtained would provide valuable insight as to the meaning of the data that was

obtained from a controlled environment (i.e., laboratory produced cell lines

expressing miR-181a) to those AML patients experiencing the disease first-hand.

Most notably, the focus should include the genes involved in the innate immune system thereby providing insight as to the dynamics within these artificial and real-world settings. In the end, the data should be compiled between cell lines expressing miR-181a and those patients with characterized AML subtypes, and displayed in a Venn diagram format showing similarities and dissimilarities of gene expression for putative innate immune miR-181a targets, either at the transcript or protein level,.

Taking this a step further, these stably expressing miR-181a cells could represent those patients diagnosed with AML displaying elevated levels of miR-

181a. Using the cell line as a model system, experimental therapies could be tested using the cell lines which would be stably expressing miR-181a. In turn, this experimental idea would facilitate an effort to predict how a patient with high miR-181a expression might respond to the same therapy.

Chapter 4

Lenalidomide induces miR-181a through C/EBPα-p30 Expression

4.1 Lenalidomide: Second-Generation Immunomodulatory Compound

Having identified an anti-leukemia role for miR-181a and demonstrated that miR-181a is induced by the truncated isoform of C/EBPα, the next objective was to devise a method for modulating the expression of miR-181a in AML cells

and increase sensitivity to chemotherapy. Currently, there are no synthetic

miRNAs to increase miR-181a expression and/or to modulate aberrant innate

immune signaling approved for clinical use. Thus, a search was conducted for

FDA-approved anti-leukemia compounds which could act as modulators of miR-

181a expression. One compound was identified to increase the expression

levels of miR-181a in three individual AML cell lines. (Figure 4.1) The

immunomodulatory compound, lenalidomide (Revlimid®, Celgene Corp.) was

found to be of particular interest for the ability to increase the expression of miR-

181a.

90 THP-1 MV4-11 HL60

7.0 7.0

6.0 6.0 Expression Expression 5.0 Expression 5.0

4.0 4.0 181a 181a 181a - - - 3.0 3.0 Fold Difference miR miR miR 2.0 2.0 Relative Gene Expression Relative

1.0 1.0 Relative Relative Relative Relative 0.0 Relative Vehicle 3.0 uM Lenalidomide 0.0 1 vehicle Lenalidomide vehicle Lenalidomide vehicle Lenalidomide

Figure 4.1 Lenalidomide Increases miR-181a Expression in Three Separate AML Cell Lines. Quantitative real-time RT-PCR data for miR-181a expression in three separate leukemia cell lines treated with 3.0 µM lenalidomide for 24 hours.

Lenalidomide is a second-generation immunomodulatory therapeutic

agent which is a derivative of thalidomide, the first-generation immunomodulatory agent. Thalidomide gained popularity in the 1950’s for use as an anti-emetic agent when treating pregnancy-related morning sickness206. However, near the

end of the same decade reports were accumulating describing the deformation of

newborn babies presenting with phocomelia and a link to thalidomide was

suggested to exist207. In response, thalidomide was removed from the market at

the beginning of the next decade. Much later, reports were published with results

from investigations attempting to understand the link between thalidomide and

the physical deformities.208,209 In a recent report, the authors offer an explanation

which suggested that thalidomide, or related metabolites, generate reactive

oxygen species (ROS) within the cellular milieu, cause a de-repression of

apoptosis signaling, and ultimately enable apoptosis to occur during limb

formation, thus leading to limb truncation.209 The authors noted however, the

anti-angiogenic properties associated to thalidomide may also have a role with

91 the induction of apoptosis. Indeed, thalidomide was experimentally shown to have anti-inflammatory and anti-angiogenic properties210,211 which gave this immunomodulatory agent appeal. It has been reported that thalidomide downregulated the production of tumor necrosis factor-alpha (TNF-α), a target gene of the TLR4 pathway and inflammatory cytokine with connections to angiogenesis.212 Subsequently, thalidomide received FDA approval in 1997 as a therapeutic agent for treatment of erythema nodosum leprosum (ENL)206 which is characterized, in part, by patients presenting with high levels of TNF-α. Thus, thalidomide was able to have a role in the reduction of TNF-α production. As a result, a renewed interest of thalidomide was born and efforts were made to improve the drug effectiveness while minimizing toxicity.

Figure 4.2 Structural Comparisons between First- and Second-Generation Immunomodulatory Compounds. Thalidomide is a first-generation immunomodulatory compounds and served as the parent molecule for the second-generation immunomodulatory compounds, lenalidomide and pomalidomide. For lenalidomide, structural modifications include the addition of an amino group and removal of the carbonyl group (arrows). Pomalidomide is a hybrid compound between thalidomide and lenalidomide, which includes the addition of the amino group (arrow) like lenalidomide but retains the carbonyl moiety (arrow) from the thalidomide structure.

In the late 1990’s, thalidomide was used as a parent structure for the development of second-generation immunomodulatory agents206,213. Two agents

92 were developed as a result from these efforts, lenalidomide and pomalidomide.

(Figure 4.2) Lenalidomide was the structural result after the addition of an amino

group and the removal of a carbonyl group to the parent structure, thalidomide.

Pomalidomide is a hybrid structure of the two molecules, thalidomide and

lenalidomide. For lenalidomide, the addition and removal of the moieties to/from

the parent structure is believed to contribute to the stability of the molecule which

has a half-life of 3.9 hours.206 Relative to thalidomide, lenalidomide is 50,000-

fold more potent for the inhibition of TNF-α.214 Lenalidomide is also known for

the ability to stimulate the proliferation of T-cells specific for the production of

Th1-type cytokines aimed at attacking tumors.215 Additionally, anti-angiogenesis

has been attributed to lenalidomide and independent of the immunomodulatory

effects.216 Aside from the effects of inhibiting TNF-α, the immunomodulatory effects, and anti-angiogenic activities associated to lenalidomide, currently very little is known regarding the mechanisms describing the anti-tumor facilitated by

the drug.217

4.2 Lenalidomide and Leukemia

Relating to myeloid leukemia, lenalidomide has been shown to be an effective agent both in vitro and in vivo. Lenalidomide has been shown to

downregulate NF-κB activity in multiple myeloma (MM) cell lines218 and shown to provide a synergistic effect when used in combination with another anti-NF-κB agent.219 In addition, lenalidomide provided an additional therapeutic benefit to

MM cells which were resistant to rapamycin due to interleukin-6 inhibiting

93 rapamycin effectiveness.220 Attributed to lenalidomide, the downregulation of

kinase/Akt-׳mitogen-activated protein kinase (MAPK) and phosphatidylinositol 3

kinase (PI3K/Akt) pathways were identified as the likely contributors for the

supplemental effectiveness in MM cells resistant to rapamycin.220 Thus,

lenalidomide likely has a role in the mammalian target of rapamycin (mTOR)

signaling cascade.

Two recent reports describing the contributions attributed to lenalidomide

have been described for a subgroup (del 5q) of myelodysplastic syndromes

(MDS).221,222 Myelodysplatic syndromes are a heterogenous hematological

disease involving aberrant hematopoiesis which often (30-40%) results in

AML.223,224 A great interest has been established with finding various forms of chemotherapeutic agents for treating MDS because characteristically, MDS has either a short-term or no response to chemotherapy.221 Therefore, few

chemotherapies are effective in patients with MDS. Lenalidomide is an agent

with potential therapeutic applications when treating MDS 5q-. Using an in vitro

system comparing MDS 5q- cells to healthy patient blasts, lenalidomide

effectively inhibited the growth of the MDS 5q- blasts whereas the growth profiles

of the healthy cells remained unchanged225. The mechanism for this difference

was suggested to involve the upregulation of SPARC expression (a known tumor

suppressor in AML226) effecting only 5q- blasts yet exerting no effects on the

healthy blasts, which was previously reported.226 In addition, the gene

expression profile for MDS 5q- responding to lenalidomide treatment showed a

94 significant (P=0.0008) deregulated response in genes associated to hematological lineage.221

Lenalidomide has been described to influence erythroid differentiation. In

one report, gene expression profiles were described for MDS patients with and

without a 5q deletion who were treated with lenalidomide.222 The aim of the

study was to establish a gene expression signature to predict which patients

would respond to lenalidomide treatment. Pre-treated and treated bone marrow

aspirates containing mononuclear cells were analyzed. The results showed an

increase in genes which are specific to terminal erythroid differentiation,

regardless of MDS 5q-. Furthermore, the authors reported that lenalidomide acts

directly on the hematopoietic progenitor cells enabling them to favor

erythropoiesis. Supporting this finding, lenalidomide was found to favor red

blood cell production in the clinical setting227,228 thus enabling the patients to

have transfusion independence. The authors speculate this physiological

response to lenalidomide could be the result of the promotion of differentiation or

apoptosis.222

Launching an investigation into understanding the effects and

mechanisms that lenalidomide has on AML has a justifiable basis. Previously,

miR-181a was shown to inhibit expression of TLR4 (dissertation Chapter 3).

When stimulated by LPS, TLR4 has been shown to induce TNF-α expression as a result of TLR4-initiated signaling cascade.229 Additionally, TLR4 has been

shown to be expressed in nearly all hematopoietic-derived cells found within in the bone marrow.193 Experimentally, thalidomide was shown to decrease TNF-α

95 levels in peripheral blood mononuclear cells (PBMC).214,230 On this end, a

correlation was suspected to occur between thalidomide and TNF-α. In support

of this correlation, thalidomide received FDA approval for the treatment of ENL

patients, known for having elevated levels of TNF-α. Additional justification is

provided by clinical results from gene expression profiling of MDS patients treated with lenalidomide.222. The gene expression profile results suggest that cells were favoring erythroid differentiation as one of many responses to the therapy. With this in mind, gene expression profiles describing the expression of miRNAs throughout the hematopoietic process report increased expression of miR-181a for erythroid progenitor cells165,166 and subsequent decreased

expression as the erythroid cells complete terminal differentiation. Thus, miR-

181a is likely to have a role in erythropoiesis. Finally, it was demonstrated first-

hand that lenalidomide is capable of inducing miR-181a expression in AML cell

lines. (Figure 4.1) Based on the current evidence collected on this end, an

investigation was launched to understand the mechanisms associated to

lenalidomide.

Having shown that C/EBPα-p30 regulates the expression of miR-181a, the hypothesis was formulated suggesting that following pharmacological induction of C/EBPα-p30 expression in AML blasts harboring wild-type CEBPA, higher levels of miR-181a expression would result thereby recapitulating those results observed in AML patient blasts with N-terminal CEBPA mutations. Currently, no compound is known for having the capacity of directly inducing C/EBPα-p30 expression or applying synthetically-derived miR-181a directly to the cells with

96 the intent of treating patients. Unlike CDDO, lenalidomide has FDA approval for the treatment of transfusion-dependent myelodysplastic syndromes (MDS) with

5q deletions resulting in transfusion-independence due, in part, to increased

erythroid differentiation. Moreover, genes involved in erythroid differentiation

were recently found to be associated with CEBPA mutations and higher miR-

181a expression177. Therefore, a connection likely exists between lenalidomide- induced erythroid differentiation, induction of CEBPA gene expression, and miR-

181a upregulation. Taken together all the evidence currently available,

lenalidomide was believed to be a likely candidate to induce C/EBPα-p30

expression and in turn initiate miR-181a upregulation.

4.3 Experimental

The observations of induced miR-181a expression in Figure 4.1 were

intriguing results for the lenalidomide trials. The concentration of lenalidomide

(3.0 µM) used in vitro is an achievable concentration used in the clinic231

therefore, this concentration of lenalidomide used for these trials is a relevant concentration for the investigation. Next, the expression of a known miR-181a

target gene, TLR4, was examined to facilitate a determination to be made

regarding the miR-181a influence on target gene expression at the protein level

following lenalidomide treatment. TLR4 expression was examined at the protein level following lenalidomide treatment. The Western blot in figure 4.3.a (upper)

clearly demonstrated a decrease in TLR4 protein in the AML cell line THP-1.

These data correspond to the miR-181a expression observed in the same cell

97 line following lenalidomide treatment. (Figure 4.1) Furthermore, an examination

was conducted to determine if an in vivo biological response is achievable based

on this same principle, which suggested that miR-181a expression is increased

following lenalidomide treatment, and in turn, downregulates TLR4 expression

leading to a presumable decrease of NF-κB activity following LPS-stimulation.

To test this principle, a transgenic mouse model was selected which has been engineered to harbor three NF-κB response elements from the Igκ light chain promoter fused in tandem to a modified firefly luciferase cDNA nucleotide sequence.232 Using a specially designed In Vivo Imaging System (IVIS), these

mice were designed, in part, for observations to be made regarding in vivo NF-κB

activity following LPS stimulation. Therefore, transgenic mice (n=3; lenalidomide

and vehicle) or the control counterpart (Balb/c) were pre-treated (intraperitoneal, i.p.) with lenalidomide (50 mg/kg) for three days prior to LPS stimulation (i.p.) and then imaged five-hours later. Indeed, a decrease in NF-κB activity

(yellow/orange/red) was observed in the mice pre-treated with lenalidomide.

(Figure 4.3.a, lower) These results are consistent with previous in vitro data

(Chapter 3; Figure 3.2.a) and support the hypothesis that NF-κB activity was repressed following LPS stimulation due to a decrease in TLR4 expression brought on by the expression miR-181a.

Figure 4.3 Lenalidomide Induces C/EBPα-p30 Expression and Increases miR-181a expression. a. Western blot for TLR4 expression in THP-1 cells treated with 3.0 µM lenalidomide for 24 hours. TLR4 expression is decreased in the lenalidomide treated cells. b. Transgenic mice harboring an NF-κB promoter fused to a luciferase reporter gene, intended to provide in vivo NF-κB activity data following LPS stimulation. Pre-treated (lenalidomide) mice or vehicle control mice were examined for NF-κB activity after LPS stimulation. Noticeable decreased NF-κB activity is associated to lenalidomide treated cells. c. Western blot analysis for cells treated with lenalidomide followed by hourly collections. The expression of C/EBPα-p30 and UBC9 (positive control for C/EBPα-p30 expression) was induced following treatment. c. Quantitative real-time RT-PCR analysis for miR-181a expression in AML blasts treated with either lenalidomide or vehicle control. Lenalidomide induced miR-181a expression in three separate AML patient blast samples.

In an effort to investigate the influence of C/EBPα-p30 serving as the potential source for the miR-181a expression in response to lenalidomide,

C/EBPα protein expression analysis was performed on an hourly interval using

99 an AML cell line (HL60) and AML blasts. Cultured cells were treated with

lenalidomide and hourly collections were performed followed by Western blot

analysis. Upon examination of the C/EBPα expression, a noticeable increase in

C/EBPα-p30 expression was revealed in both trials. (Figure 4.3.b) Similar

results were observed for two different AML patient blasts treated with

lenalidomide in like fashion. (data not shown) For both HL60 and AML patient

blasts, the induction of the C/EBPα isoform expression appears to reach a

maximum between 8 and 9 hours following application of lenalidomide. Fitting to

the expression data of C/EBPα-p30, the expression of UBC9 increased nearly

concurrently with the expression of the C/EBPα-p30 isoform. The expression of

UBC9 is indicative of C/EBPα-p30 gene expression and serves as a positive

control97 as explained in Chapter 2.4 of this dissertation.

As mentioned earlier, similar C/EBPα-p30 inductions following lenalidomide treatment were observed in three different AML patient blasts.

Based on this information, the expression of miR-181a was analyzed. Indeed,

quantitative RT-PCR data revealed that miR-181a expression was found to increase in all blast samples after 12 and 24 hours following lenalidomide treatment. (Figure 4.3.c) Taken together, these data are indicative of having unveiled cellular responses specific to the anti-leukemia agent, lenalidomide.

These responses include the induction of miR-181a expression likely driven by

C/EBPα-p30 isoform expression.

To understand the molecular mechanisms associated to the induction of the C/EBPα-p30 isoform, an examination was conducted regarding the

100 phosphorylation status of eIF4E. Detailed in Chapter 2, a mechanism81 was

proposed to explain the variance seen during the translation of the CEBPA

transcripts. The activity from the eIF4E subunit within the translation complex

was the focus and rates of translation by eIF4E were likely the reason for the

variance between full-length and N-truncated C/EBPα isoforms. The

phosphorylation of eIF4E serine 209 (S209) was positively correlated to

increased eIF4E activity during the translation of the CEBPA transcripts85,87.

Therefore, the AML cell line, THP-1, was selected to examine this possible mechanism because THP-1 predominantly expresses the full-length C/EBPα-p42 isoform with minimal expression of the truncated isoform. Thus, this cell line has the capacity of producing either C/EBPα isoform and likely to demonstrate the transition from the basal expression of C/EBPα-p42 to the putative lenalidomide- induced expression of C/EBPα-p30 following lenalidomide treatment. As expected, a noticeable induction of C/EBPα-p30 expression occurred shortly after lenalidomide treatment. (Figure 4.4.a) Fitting to the hypothesis, a concurrent increase of phosphorylated eIF4E was revealed following lenalidomide treatment. These data were supported by the immunoprecipitation experiments selecting for total eIF4E in THP-1 cells 4 hours following either vehicle or lenalidomide treatment. (Figure 4.4.b) From these data, it is reasonable to infer that C/EBPα-p30 expression is the result of increased activity of eIF4E which favors the translation of the truncated isoform following lenalidomide treatment.

101 Figure 4.4 The Translational Subunit eIF4E is Phosphorylated Following Lenalidomide Treatment and Has a Role in C/EBPα-p30 Translation. a. Western blot of THP-1 lysates following lenalidomide treatment. The translational subunit eIF4E was phosphorylated at serine 209 in response to lenalidomide treatment. Concurrently, C/EBPα translation increased and reflected in both isoforms. b. Immunoprecipitation selecting for total eIF4E and followed with Western blot identifying the phosphorylation at serine 209 of eIF4E. Phosphorylation of eIF4E was nearly doubled 4 hours following lenalidomide treatment. c. AML patient blasts were transfected with siRNA targeting MKNK1, the gene which codes for the kinase responsible for the phosphorylation of eIF4E serine 209, followed by lenalidomide treatment. Both phosphorylation of eIF4E (serine 209) and C/EBPα translation were inhibited following the silencing of MKNK1.

It is likely that increased phosphorylation of eIF4E occurs in AML patient

blasts due to the observed induction of C/EBPα-p30 expression following

lenalidomide treatment. Therefore, using AML patient blasts, the lenalidomide-

inducible phosphorylation of eIF4E was examined. In addition, the expression of

MNK1 which is the kinase responsible for the phosphorylation of eIF4E86 was

also examined. AML patient blasts were subjected to siRNA transfection aimed

at silencing the expression the kinase MNK1 (MKNK1). Following siRNA transfection, the AML patient blasts were allowed to recover for 24 hours prior to

lenalidomide treatment. Protein expression was assessed six hours following

lenalidomide treatment. As expected, phosphorylation of MNK1 was observed

for blasts with the negative siRNA control and treated with lenalidomide.

Accordingly, phosphorylated eIF4E was seen in these same cells. As revealed in

102 Figure 4.4.c, C/EBPα-p30 expression was induced for these siRNA negative

control cells following treatment of lenalidomide. In contrast, no lenalidomide- inducible C/EBPα-p30 expression was observed in those blasts pre-treated with siRNA targeting MKNK1 expression. Subsequently, phosphorylated MNK1 and phosphorylated eIF4E was not observed in those blasts with silenced MNK1 expression and lenalidomide treatment. These data support the hypothesis that induced expression of C/EBPα-p30 is the result of MNK1 phosphorylation at serine 209 within the eIF4E translational subunit. Taken together, lenalidomide appears to have a role in the phosphorylating events leading up to the specific

phosphorylation of serine 209 of eIF4E and subsequently influences the activity

of this subunit within the translational complex.

The evidence suggesting that miR-181a expression increased as a result

of lenalidomide was rather convincing but the significance of these results

remains unanswered. Therefore, an investigation was performed using patient

bone marrow samples who participated in two separate clinical trials. In one

clinical trial, older patients with relapse or refractory AML received 50 mg/oral

tablet/daily (higher concentration than 3.0 µM used for laboratory experiments)

lenalidomide on an OSU clinical trial.231 The RNA from these bone marrow

samples was isolated and quantitative real-time RT-PCR was performed to

assess the miR-181a expression for these patients prior to treatment and eight

days following the start of the lenalidomide treatment. As expected, on day eight

following induction of the lenalidomide therapy, an increase in miR-181a

expression was observed for five patients. (Figure 4.5.a) These patients

103 collectively, displayed an increase of nearly 12-fold (P=0.032) overall expression of miR-181a on day 8 of lenalidomide treatment. To validate these results, a separate cohort of patients from a second clinical trial was assessed for miR-

181a expression. In this OSU clinical trial, younger AML patients with relapse or refractory AML, and older patients with untreated AML were given the maximum tolerated dose of lenalidomide, oral tablet/daily. Bone marrow samples were

collected prior to treatment and on day 5 following the onset of induction therapy.

The RNA from these samples was collected and the expression of miR-181a was

assessed using quantitative real-time RT-PCR. Similar to the previous clinical

trial, the collective (n=5) miR-181a expression was increased within the bone

marrow samples. More specifically, higher expression of miR-181a was

observed in those patients observed with having achieved complete remission

(CR). (Figure 4.5.b) These miR-181a data were supported by the expression

analysis of miR-181a targets IL1Β and TLR4. Notably, the expected inverse

correlation between miR-181a and the target transcripts were revealed in the CR

patient set and not in the respective counterpart (no CR). Next, the expression of

C/EBPα was examined for three selected bone marrow samples from patients

analyzed in Figure 4.5.b. In accord to the aforementioned data regarding

C/EBPα expression in response to lenalidomide, Western blot data revealed

C/EBPα expression was increased by day 5 of treatment. Although both

isoforms were observed in these samples, it has previously been shown that

C/EBPα-p30 is the isoform responsible for the induction of miR-181a expression.

(Figures 2.4.c and 2.4.d; Figures 2.5.c and 2.5.d; Figures 2.6.c. and 2.6.d) All

104 together, the evidence obtained from the bone marrow patient samples support the hypothesis that lenalidomide induces miR-181a expression in a laboratory setting as well as in a clinical setting. Moreover, although preliminary at this point in time, it is intriguing that an observable correlation was identified between patients treated with lenalidomide and having achieved CR, in conjunction with

having elevated levels of miR-181a. These observations are in accord to the

hypothesis suggesting that miR-181a is a tumor suppressor with therapeutic value.

105

Figure 4.5 Lenalidomide Increases Both C/EBPα-p30 and miR-181a Expression in AML Patients. a, Quantitative real-time RT-PCR assessment for miR-181a expression of bone marrow samples of patients before and after treatment with lenalidomide. b Bone marrow patient samples from a separate clinical trial than assessed in a. Quantitative real-time RT-PCR was used to assess mature miR-181a expression (left). The same method was used to determine the precursor miR-181a isotypes for the same patient set (middle, right). Patients were grouped as responders (CR) or non-responders (no CR). c. Quantitative real-time RT-PCR analysis for the gene expression of bona fide targets of miR-181a. An inverse correlation to miR-181a expression was identified for the CR sub-population seen in b. d. Western blot identifying the C/EBPα status for three patients described in b and c. In response to lenalidomide, C/EBPα expression was increased on Day 5 following lenalidomide treatment.

The anti-leukemia activity of lenalidomide was recapitulated, in NOD/SCID mice injected subcutaneously with the AML cell line THP-1 (10x106 cells). Four weeks after engraftment, lenalidomide (50 mg/kg) or vehicle was injected directly into the tumors twice weekly for two weeks. The average size of the

106 lenalidomide-treated tumors (57.5± 0.06 mm) was significantly decreased when compared to the vehicle-treated tumors (166.8± 1.08 mm; P=0.008; paired t-test).

(Figures 4.6.a and 4.6.b) Moreover, tumor sizes after lenalidomide

administration were decreased by approximately 45%. (Figure 4.6.b) The

xenografts treated with lenalidomide were found to have increased C/EBPα-p30

expression. Consistent with the in vitro results, when compared to vehicle-treated

xenografted tumors, a significant (P<0.05) increase in miR-181a expression was

found only in those tumors (n=5) which were treated with lenalidomide. (Figure

4.6.c) Finally, the protein expression of TLR4 was lower in the lenalidomide

treated xenografts found to have increased expression of miR-181a. (Figure

4.6.d)

107

Figure 4.6 Lenalidomide has Anti-Tumor Properties in AML Xenografts That Coincide with an Increase of C/EBPα-p30 Protein and miR-181a Expression. a. Human tumors xenografted into murine models and later treated with lenalidomide (50 mg/kg) or vehicle (negative control). b. Statistical analysis for the in vivo tumor growth for the human tumors xenografted into murine models (described in a.). c. Quantitative real-time RT-PCR analysis of miR-181a expression for the lenalidomide or vehicle treated xenografted tumors (described in a.). d. Western blot analysis for TLR4 and C/EBPα expression from xenografted THP-1 tumors treated with lenalidomide or vehicle control.

The data presented in this chapter demonstrated a novel therapeutic use for lenalidomide, an analog of a parent drug, thalidomide. Sixty years ago thalidomide had been admonished, however, in the absence of thalidomide the second-generation of immunomodulatory drugs would have likely never been

108 conceived. Today, lenalidomide is gaining notoriety for having beneficial uses

when used as an agent in the fight leukemia. At the present time, our

understanding of how lenalidomide alters the cellular mechanisms, has yet to be

fully understood. It is reasonable that not only one explanation will suffice when

explaining a mechanism for lenalidomide but it is likely that multiple mechanisms

occur depending on the various cell types. For example, current investigations

are being conducted researching how solid tumors respond to lenalidomide.233-236

Recently, it has been shown in several solid tumor cell lines (colon, breast, ovary,

etc.) that lenalidomide enhanced the activity of natural killer (NK) cells when co-

cultured with tumors coated with recognition antibodies.237 The aim of this

experiment was to assess how lenalidomide affected the ability of NK cells to

perform antibody-dependent cell-mediated cytotoxicity (ADCC). Indeed,

lenalidomide enhanced NK-dependent ADCC on those cells coated with

cetuximab (anti-epidermal growth factor receptor, anti-EGFR). Thus, this

experiment alone presents proof-of-principle for future experiments involving the

combination of lenalidomide and cetuximab for the treatment of solid tumors

expressing EGFR.

In regard to hematological malignancies, it would be of interest to explore

a therapeutic combination of lenalidomide and CDDO (Chapter 2). Both of these

agents have been found to increase the expression of C/EBPα-p30 and in turn

miR-181a expression. Furthermore, miR-181a was shown in this dissertation to have a role as a tumor suppressor. Although the CDDO investigations did not explore the apoptotic pathways, a separate report was published describing the

109 affects of CDDO on chronic lymphoblastic leukemia blasts. In the published

report, following CDDO application, it was shown that the intrinsic apoptotic

pathway was induced and involved the activation of procaspase-9, a known

apical caspase associated to the intrinsic apoptotic pathway.238 It was not known

at the time when the report was published, but demonstrated in here in Chapter

2, that CDDO increased the expression of miR-181a. In support of these

findings, on this end, evidence has been collected demonstrating that miR-181a

targeted CARD8, a procaspase-9 associated protein. The function of CARD8 is

disputed in the literature239-241 and evidence has been presented suggesting that

CARD8 serves as a protector of procaspase-9 cleavage and ultimately shields

procaspase-9 from activation.239,242 In the absence of CARD8, procaspase-9 is

cleaved and activated which subsequently initiates the intrinsic apoptotic

pathway. Thus, if CARD8 could be silenced through miR-181a involvement, it is

likely the cells would undergo intrinsic apoptosis as a result of procaspase-9

activation. In addition, CARD8 overexpression has been described in several

forms of cancer.241 Finally, anti-apoptotic CARD8 protein is also known, as

caspase recruitment domain-containing protein 8, and previously predicted in

silico to be a miR-181a target.177

Experimentally on this end, CARD8 expression was decreased in THP-1

cells during elevated levels of miR-181a expression. (Figure 4.7.a.) Furthermore,

UTR of CARD8 was shown to be a bona fide target of miR-181a (Figure-׳the 3

4.7.b) and caspase-9 activity (intrinsic apoptotic initiation) was increased following lenalidomide treatment of AML cells. (Figure 4.7.c) It is tempting to

110 speculate the reason for the increase of caspase-9 activation was the result of

lenalidomide-induce upregulation of miR-181a expression, which in turn targeted

transcripts of CARD8, thereby silencing the expression of CARD8 and leaving

procaspase-9 vulneralbe to molecules which induce cleavage and activation of

caspase-9. These results likely could be applicable to the aforementioned

CDDO study which reported the activation of procaspase-9 in response to the

CDDO (both drugs, CDDO and lenalidomide, are miR-181a inducers). In Figure

2.8, it was shown that CDDO induced miR-181a expression. Thus, it is plausible

the report describing the CDDO-induced caspase-9 activation was likely due to increased of miR-181a expression and subsequent CARD8 silencing.

Taken together, it would be of great interest to explore, lenalidomide and

CDDO, either in combination or alternating applications. Additionally, either of

these drugs could possibly serve as a therapeutic alternative during instances

when patients have been found to be resistant to either lenalidomide or CDDO.

111

Figure 4.7 CARD8 is a Target of miR-181a and Possibly Inhibits Procaspase-9 Activation. a. Western blot (upper) displaying CARD8 expression in THP-1 cells transiently transfected with miR-181a expression plasmid. The downregulation of CARD8 expression is dose-dependent on the amount of miR-181a expression construct transfected. Quantitative real-time RT-PCR analysis of miR-181a expression (lower) for the same transfected THP-1 cells analyzed in the UTR wild-type or mutant (mut) of-׳Western blot. b. Luciferase reporter activity assay. The 3 CARD8 was cloned into a luciferase reporter construct and co-transfected with expression plasmids driving miR-181a expression. A decrease in luciferase reporter activity was seen for .UTR and co-transfected with miR-181a. c-׳those cells with wild-type (not mutant) CARD8 3 Caspase-9 activity assay for THP-1 cells treated with either vehicle or lenalidomide and then monitored for 72 hours.

112 4.4 Future Work

Over the course of this dissertation, the expression of UBC9 was often

used as a positive control when investigating C/EBPα-p30 expression. As reported in Chapter 2.4, UBC9 was described to facilitate the sumoylation of

C/EBPα-p42 and this general process was detailed in Figure 2.4. In a previous report, sumoylated C/EBPα-p42 was shown to bind more tightly to the lactoferrin

promoter than sumoylated C/EBPα-p30.95 Indeed, this mechanism may not just

be isolated to the lactoferrin promoter but it may be applicable to the miR-181a-1

promoter because similar observations detailing C/EBPα-p42 , C/EBPα-p30, and

UBC9 were described in this Chapter 4. The results presented here, suggest that miR-181a-1 expression occurs in the presence of C/EBPα-p30, which also

concurrently has increased UBC9 expression. It is reasonable to investigate the

sumoylation status of the C/EBPα isoforms following lenalidomide treatment.

The data presented hereto suggests a particular mechanism exists and attributed

to lenalidomide: the induction of C/EBPα-p30 expression along with the presence

of residual C/EBPα-p42, lenalidomide favors the near concurrent expression of

C/EBPα-p30 and UBC9, and finally lenalidomide favors miR-181a-1 expression.

Therefore, all the ingredients are present following lenalidomide treatment to

justify an investigation exploring this sumoylation phenomenon.

Correlative experiments could involve the transient transfection of HA-

tagged-SUMO-1, -2, -3, -4, expression constructs followed by treatment with

lenalidomide. Co-immunoprecipitation studies selecting for HA-tagged-SUMO-

associated proteins would permit inferences to be made about the sumoylation

113 status of either of the C/EBPα isoforms following co-transfection and

lenalidomide treatment. Finally, dependent on the sumoylation experiments,

similar experiments emulating the report for the lactoferrin promoter could be

conducted but focusing on the DNA oligonucleotide regions for the promoter of

miR-181-1. The results from these proposed experiments might provide insight

as to why miR-181a-1 was preferentially upregulated in the presence of C/EBPα-

p30 and not C/EBPα-p42 following lenalidomide treatment.

Keeping with the interests of preferential C/EBPα-p30 expression, a recent

report described the pseudokinase protein, Tribbles 2 (Trib2), as a possible

mediator influencing the C/EBPα-p42/ C/EBPα-p30 ratio.121 Trib2 was shown to

decrease the expression of C/EBPα-p42 yet unaffecting the C/EBPα-p30

expression in the leukemia cell line U937.121 The function of Trib2 was

investigated based on work conducted using the Drosophila C/EBPα homologue,

slbo. The slbo expression turnover was likely to be mediated by tribbles.243 In

AML patients with wild-type CEBPA expression but with features similar to mutated CEBPA, TRIB2 was found to be highly expressed.121 From these

clinical findings, an investigation to understand the relationship between TRIB2

and C/EBPα was performed. In a mouse model, it was revealed that Trib2

participated in the degradation process of C/ebpα-p42 and similar findings were

not observed when investigating C/ebpα-p30, thus sustained expression of

C/ebpα-p30 was reported. In a later report, Trib2 was found to facilitate the

interaction between C/EBPα-p42 and the E3 ligase, COP1 (constitutive

morphogenesis 1), which subsequently resulted in the destruction of C/EBPα-

114 p42.244 Thus, the participation of TRIB2 and COP1 contribute to the modulation between C/EBPα-42 and C/EBPα-p30. It would be of considerable interest to determine the involvement, if any, TRIB2 or COP1 might play within the cell following lenalidomide treatment, provided that current data show lenalidomide favors the expression of C/EBPα-p30 and alters the C/EBPα-p42/ C/EBPα-p30 ratio.

Notably, UBC9 (E2 ligase) has been conclusively shown to be upregulated following lenalidomide treatment and, concurrently, in the presence of C/EBPα- p30. Keeping with the thought of the UBC9 E2 ligase, COP1 is an E3 ligase responsible for the destruction of the C/EBPα-p42. Thus, it is likely that a similar pathway involving both E2 and E3 ligases are activated and contribute to the degradation of the C/EBPα-p42 isoform in response to lenalidomide treatment.

To investigatigate this matter, co-immunoprecipitation assays selecting for either

C/EBPα-p42 alone or both C/EBPα isoforms should be conducted to investigate if TRIB2 interacts with these proteins over a period of time. Furthermore, because TRIB2 was found to participate in the degradation of C/EBPα-p42, it would be of interest to pre-treat cells with siRNA directed at TRIB2 with the intention of silencing this protein, followed by the treatment with lenalidomide. It would be interesting to observe the expression of C/EBPα-p42 in these siRNA treated cells following lenalidomide treatment. Perhaps, the cells treated with the negative control (not affecting TRIB2 expression) results would reveal a decrease in the expression of C/EBPα-p42 but elevated levels of C/EBPα-p30 expression in the cells. In contrast, while using the siRNA targeting TRIB2, one

115 possible outcome is the absence of decreased expression for C/EBPα-p42 and prolonged expression of the C/EBPα-p42 isoform, following lenalidomide treatment. This affect would be indicative in Western blots and the C/EBPα-p42 and C/EBPα-p30 ratio would reflect this change in expression pattern following

TRIB2 knockdown. Similar results could be performed focusing on the siRNA silencing of the E2 ligase, UBC9, or the E3 ligase, COP1.

An additional post-translational modification worthy of investigating is the phosphorylation status of either C/EBPα isoform following lenalidomide treatment. The phosphorylation events detailed to occur for the C/EBPα isoforms were described earlier in Chapter 2. Two serine sites are of considerable interest due to their location within the C/EBPα protein, serines 193 (TE-III) and 248

(near the DBD). The phosphorylation status of serine 193 was found to have a role in the dynamics of cellular proliferation between C/EBPα and Rb.93

Furthermore, Rb interacts with E2F which is a known transcription factor.

However, the interaction between Rb and E2F was reportedly abolished when

C/EBPα serine 193 was dephosphorylated thereby favoring the interaction to develop between C/EBPα and Rb. This resulted in the liberation of E2F and allowed E2F to proceed with transcriptional activation of the associated target genes. Admittedly, both C/EBPα isoforms harbor this serine residue and therefore may not discriminate individual functions among the isoforms.

However, it is a question worthy of pursuit and may provide insight to C/EBPα-

p30 association to miR-181a-1 gene expression.

116 An additional serine residue of notable interest is serine 248. This serine

location is slightly N-terminal of the DNA-binding domain within C/EBPα. Given

the location and the importance of DNA binding, in addition to the differences in

miR-181a-1 expression observed between the two C/EBPα-p42 and C/EBPα-p30

isoforms, understanding the post-translational modifications near the DNA-

binding domain is of considerable interest in terms of miR-181a-1 expression.

The serine 248 residue has been shown to be phosphorylated by protein kinase

C.92 However, data (not shown) obtained through experimenting with lenalidomide suggests that lenalidomide does not function through the PKC

signaling cascade. Despite the lack of PKC activation, the investigation is still

worthwhile due to the proximity of this serine to the DNA binding domain.

117

Chapter 5

Acute Lymphoblastic Leukemia

5.1 Introduction and Background

Acute lymphoblastic leukemia (ALL) is a rapidly developing,

heterogeneous, malignant disease with its origins from a single hematopoietic

progenitor cell partially committed to either B-cell or T-cell lineage in which the

maturation process is disrupted. Most ALL cases are of B-cell lineage whereas

T-cell lineage accounts for approximately 15-20% of the ALL diagnoses.245 The

two lineages differ by their location of origin, B-cells originate from within bone marrow whereas the T-cells have their origins in the thymus. During the maturation process, precursor B- and T-cells are triggered from multiple signals

(i.e., cytokines, plasma membrane receptors, etc.) to initiate sequential events

involving gene rearrangements and activation/silencing of gene expression

regulators. These activities within the cell facilitate and commit the B- or T-cell

to the developmental process. Figure 5.1 illustrates a schematic representation of the B- and T-cell maturation process. During this process, B- and T-cells

undergo a series of gene rearrangements allowing for the diversity of receptor

proteins to be constructed and later localized to the cell surface or within the

118 cell where it is able to facilitate the recognition/detection of foreign substances

enabling the body to combat various pathogens. During this time of gene

rearrangement, disruption of critical genes necessary for the development and

maturation of the B- and T-cells are damaged and subsequently abrogates

proper cellular maturation. The result of this damaged maturation process is

the accumulation of unspecific B- or T-cells which no longer function to their normal capacity, rapidly grow in population, and cause the condition termed, leukemia. The focus of this chapter will primarily involve ALL associated to B- cells.

Figure 5.1 The Maturation Process of B- and T-cells. a. A part of the B-cell maturation process includes the B-cell lymphoid progenitor stage which differentiates to mature B-cells. b. T-cells have origins in the Pro-T-cell stage and develops to the mature T-cell single positive medullary cells. The identity of cell surface receptors are represented by the CD#, cluster of differentiation number. Image from Pui and Jeha, 2007.246

119 Prior to 1950, childhood leukemia was not differentiated into more

specific terms which could offer better characterization of the disease. During

this time, death was almost certain within three months of the initial diagnosis.

A common treatment available at that time included blood transfusions,

however, patient death typically resulted from either hemorrhage or bodily

infection. In retrospect, the majority of childhood leukemia is believed to be

more accurately classified as ALL and was estimated to be the diagnosis for

nearly 80% of all childhood leukemia diagnosed during the 1950’s.247 This

point in history proved to be significant because it marked as the turning-point

for the awareness of childhood leukemia and foundations were beginning to be established for our understanding of this disease. As our understanding improved, the development of treatments followed and the prognosis of the

disease improved considerably with introduction of chemotherapy. Currently, the event-free survival for ALL in children is estimated to be as high as

85%.248,249 ALL is commonly presented in children between the ages of 2-5 years and is more likely to be found in boys rather than girls.250,251 Within the

last 10 years, several studies have been published investigating a link between

ALL and socio-economic demographics, as well as rural versus urban

environments, however more data is needed to evoke any conclusive

correlations.252-254 However, ALL is also present in adults.255 Unfortunately,

the prognoses for adult ALL cases are significantly worse than for children, with

only 30% of the adult cases achieving long-term survival

120 Most children diagnosed with ALL present with symptoms which are

non-specific such as fever, headache, musculoskeletal pain, and swollen lymph

nodes. Various lymph nodes throughout the body may also be swollen and

indicative of spreading of the disease. In addition, these children are anemic,

neutropenic, and/or thrombocytopenic.256 A proper diagnosis includes a blood component characterization and bone marrow aspiration/biopsy thereby allowing for a determination to be made regarding the staging, phenotype, and

cytogenetic aberrations.

5.2 ALL Classification

Two main classifications have been given when diagnosing a child with

suspected leukemia, acute lymphoblastic leukemia (ALL) and acute

myelogenous leukemia (AML). In rare instances, the leukemia can be a hybrid

of both ALL and AML, in which case it is referred to as mixed-lineage leukemia

(MLL). Two schemes are commonly used when characterizing ALL. In one,

the WHO classification uses the cytogenetic characteristics and surface

receptors to classify the various subtypes of ALL. Alternatively, the French-

American-British (FAB) classification scheme largely depends on the morphology of the suspected leukemia cells when viewed using a microscopic approach.31,257,258

The World Health Organization (WHO) adopted a classification system

which centers on the immunophenotype and genotype of the leukemia cells.259

The immunophenotype classification identifies surface antigens on the cells

121 then categorizes the cells into groups based on either having or not having

specific antigens commonly referred to as “cluster of differentiation” (CD)

followed by a number (e.g. CD15). This CD# antigen is recognized by

monoclonal antibodies and identified through the use of flow cytometry. Table

5.1 summarizes the WHO classifications for ALL.

Table 5.1 WHO Classification for Acute Leukemias. Three main categories of acute leukemia are stratified according to the subtype cytogenetic description. (adapted from Borowitz, MJ., Bene, MC., Harris, NL., Porwit, A., Matutes, E., and Borowitz, MJ., Chan, JKC. (Swerdlow HS, Campo E, et al., editors). WHO Classification of Tumours: Tumours of Haematopoietic and Lymphoid Tissues. Lyon:IARC Press, 2008.

The FAB classification system categorizes lymphoblasts based on the

morphology, relative to a healthy lymphocyte, and are given the designation L1,

L2, or L3. An ‘L1’ designation includes a description of the cell being larger in

appearance (twice the size of its healthy counterpart), misshaped nucleus,

122 condensed chromatin, and the cytoplasm usually appears with less intense staining. The ‘L1’ designation is common in pediatric cases.260 An ‘L2’ designation describes the lymphoblast as being even larger than ‘L1’, with or without an oval-shaped prominent nucleus which can number more than one per cell, and chromatin dispersed throughout the cell. The cytoplasmic appearance is abundant with less intensity of staining than healthy lymphocytes. Depending on the stratification of criteria, children with an ‘L2’ classification have a poorer prognosis, when compared to ‘L1’.261 The ‘L3’ classification describes the lymphoblast as large, intense blue staining in the cytoplasm. In addition, the nuclei are large with a defined edges. The large size and dark blue staining of the cytoplasm, due to numerous vacuoles within the cell, make the ‘L3’ distinctive from the ‘L1’ and ‘L2’ classifications. The ‘L1’ characterization is the most common subtype whereas the ‘L3’ is the rarest subtype.258

Using both classification systems, one approach is likely to be used followed by the second to confirm the characterization. The two systems, FAB and WHO, which are currently used for classification of this disease are clear indications of our advancement for understanding this type of leukemia.

123 Common to ALL are chromosomal aberrations, thus cytogenetic analysis

has become an important component when characterizing the leukemia.

Typically, these chromosomal rearrangements result in somatic mutations and

not found to be germline.262 The chromosomal aberrations associated to ALL

include (but not limited to) hyperdiploidy (>50 chromosomes), hypodiploidy

(<30-45 chromosomes), and pseudodiploidy (46 chromosomes).263-265 Patients

with hyperdiploidy characterization are typically found to have early pre-B or pre-B cell ALL and receive a favorable prognosis.249 In contrast, 5-6% of ALL patients are classified as to being hypodiploid and stratified into three subgroups: near-haploidy, low hypodiploidy, and high hypodiploidy.265 The two

former subgroups have a lower percentage of event-free survival whereas the

latter has a much higher percentage of event-free survival.265 This disparity

among the subgroups exemplifies the importance of a proper diagnosis for the

kind of ALL in a patient. Pseudodiploidy is a term used to describe cells with 46

chromosomes but harboring structural anomalies within the chromosome and is

the largest cytogenetic subgroup of pediatric ALL.263 Methods commonly used for detecting these chromosomal abnormalities include, fluorescence in situ hybridization (FISH)266, real-time reverse transcription polymerase chain reaction (real-time RT-PCR)267, and microarray analysis for gene expression

profiling.268 The majority of these aberrations are the result of chromosomal

translocations.

124 5.3 ALL Chromosomal Translocation: TEL/AML1

Chromosomal translocations are a common feature in ALL and various

translocations have been identified in association to this disease. Moreover,

recurrent chromosomal translocations are indicative for prognostic

significance.269 As a result of chromosomal translocations, normal gene

expression is augmented. Commonly, these disrupted genes code for and are

closely associated to, transcriptional regulatory proteins.269 These transcription

factors control cellular differentiation by facilitating the expression of other

important proteins needed for the maturation of the B lymphocyte. In contrast,

a single chromosomal translocation has the capacity to predispose cells for the

development of leukemia, notably the chromosomal translocation

t(12;21)(p13;q22) resulting in the fusion of two genes ETV6 (TEL) and RUNX1

(AML1) which codes for the TEL/AML1 fusion protein and considered to be a

class II mutation in leukemia development.36,270

The deleterious effect of this chimeric protein harboring fused

transcription factors is displayed within the cell on two levels. First, the fused

protein no longer retains the intrinsic ability to recognize particular protein

partners or docking sites along nucleotide sequences thereby abolishing the

transcription capability. Second, the fused proteins can interfere with the

endogenous activity of their non-mutated partners which are transcribed from

the second (presumably healthy) allele within the genome. In essence, these

fusion proteins have the ability to quench the activities associated to their protein partners.

125 One chromosomal translocation of particular interest and is commonly

associated to ALL is referred to as the t(12;21)(p13;q22) translocation resulting in the fusion of two transcription factors ETV6 and RUNX1. The fusion product,

ETV6/RUNX1 is intimately linked to pediatric ALL. Two reports were published nearly at the same time in 1995 reporting the discovery of in-frame genetic lesions involving two genes, ETV6 and RUNX1 (fusion protein product referred to as TEL/AML1), as a result of the translocation t(12;21)(p13;q22) found to be present in precursor B-cell acute lymphoblastic leukemia.271,272 The

t(12;21)(p13;q22) translocation is unique because this translocation harbors the

to the RUNX1 gene. (Figure ׳to the ETV6 gene, which lies 5 ׳RUNX1 gene 3

5.2) This arrangement is unique because most translocations involving RUNX1

position to its fusion partner and the ׳has the RUNX1 coding sequence in the 5 breakpoint region in RUNX1 occurs within the nucleotide sequence coding for

region of ׳the C-terminus portion of the protein and subsequently excludes the 3

RUNX1.273,274 Importantly, the breakpoint region of these non-TEL/AML1

UTR region. In ׳fusion chimeras containing RUNX1 eliminates the RUNX1 3

contrast, the TEL/AML1 (fusion gene product referred to as: ETV6/RUNX1)

UTR of RUNX1 which is significant for reasons ׳fusion transcript contains the 3 discussed later.

126

Figure 5.2 Schematic Diagram Detailing the t(12;21)(p13;q22) Translocation. The ETV6 gene codes for the TEL protein comprised of two notable domains, Pointed and ETS, which provide functionality to TEL. The RUNX1 gene codes for the AML1 protein which contains a Runt domain and transactivation domain. The fusion of these two genes is displayed as the ETV6/RUNX1 fusion gene coding for the fusion protein TEL/AML1. The ETV6/RUNX1 fusion UTR) which harbors׳untranslated region (3 ׳gene is unique due to the inclusion of the RUNX1 3 a nucleotide sequence that is recognized by miR-181a. (arrows indicate the break points and fusion points for the genes)

The t(12;21)(p13;q22) translocation is the most common genetic lesion

in pediatric ALL and associated to a favorable prognosis.275 This translocation

has a frequency of 20-25% in precursor B-cells. Current thought based on

several lines of evidence favors the notion that t(12;21)(p13;q22) occurs in

utero thereby predisposing children to leukemia,276 although not exclusive.

However, the t(12;21)(p13;q22) translocation is not sufficient to induce overt

ALL.277-279 This translocation is suggested to be the “first hit” in a “two-hit model” model of oncogenesis.20 More related to t(12;21)(p13;q22)

translocation, this “two-hit model” is supported by studies involving monozygotic

twins sharing the same ETV6/RUNX1 fusion gene breakpoint and later

developed ALL.280,281 Moreover, the “second hit” is believed to be the deletion

127 in the expression for the healthy ETV6 (TEL) allele which has endogenous function as a tumor suppressor. Thus, cell harboring the t(12;21)(p13;q22) translocation likely have a selective growth advantage due to the complete absence of TEL expression.282-286

The ETV6 (ets variant gene 6) gene codes for the transcription factor

named TEL (Translocation Ets Leukemia gene). To avoid confusion with the

abbreviation for telomere, the gene was renamed from TEL to ETV6.287 ETV6

is located within the short arm of chromosome 12 which is a focal point for

chromosomal rearrangements associated to several hematological

malignancies.288 Adding to this thought, TEL is the fusion partner of several other proteins believed to contribute to a variety of hematological diseases.

The protein structure of TEL contains a C-terminally located ets domain which has DNA-binding properties and partly enables TEL to function as a transcription factor.289 In addition, this domain also provides a scaffold for

protein-protein interactions. Similarly, the N-terminally located pointed (helix-

loop-helix, HLH; sterile alpha motif, SAM) domain has been implicated with

facilitating homo- and heterodimerization along with other transcription

factors.290,291

The RUNX1 (Runt-related transcription factor 1) is also referred to as

AML1, PEBP2αB (polyoma virus enhancer-binding protein 2αB), and CBFα2

(core-binding factor α2). RUNX1 (protein named: AML1), a master regulator of hematopoesis,274 is located in human chromosome 21 in a region where frequent chromosomal breaks occur.273,292 AML1 directly recognizes nucleotide

128 sequences known as PEBP1 sites and these sites are commonly located cis to other promoter elements specific for hematopoietic genes.292 As a transcription

factor, AML1 is believed to serve as a scaffold protein which facilitates the

binding of other proteins which subsequently lead to the formation of a

transcriptional complex to promote targeted gene expression.293 These genes

activated by AML1 include, interleukin-2 (IL-2)294, granulocyte-macrophage

colony-stimulating factor (GM-CSF)295, and granzyme B.296 To promote gene

expression, AML1 forms a heterodimer with CBFβ which is mediated by the

RHD (runt homology domain) located at the N-terminus of AML1 protein. Other

cofactors attributed to AML1-induced gene activation include p300/CBF, LEF-1

(lymphoid enhancer binding factor)297, and ALY (AML-1 interacting protein).298

In contrast to its gene activation abilities, AML1 also has the capacity for

repressing gene expression which utilizes two domains located at either

terminus of the protein. The N-terminally located RHD serves as a docking-site

for the gene repressing histone deacetylases (HDACs), SUV39H1,299 SIN3A and SIN3B.300 At the C-terminus of AML1, gene repression is facilitated

through the WRPY amino acid motif which is recognized by the protein TLE1

(transducin-like enhancer of split-1).301 TLE1 is a protein capable of repressing

gene expression through the recruitment of HDACs to the promoters of genes

involved in the differentiation process.302

AML1 (RUNX1) serves as an important regulator in human adult

hematopoiesis. A breadth of knowledge regarding RUNX1 has been obtained

through the use of mouse models. Homozygous deletion of Runx1 within mice

129 proved to be lethal by E12.5 resulting in hemorrhage and defective

hematopoesis.303 However, in a conditional knockout model of Runx1,

immature hematopoietic progenitors304 developed normally suggesting that

RUNX1 is not necessary for the maintenance of hematopoietic stem cells

(HSC) but necessary for their maturation. More specifically, AML1 was found not to be required for the development of common myeloid progenitors (CMPs) but indespensible for common lymphoid progenitors (CLPs) which give rise to precursor T-cells and precursor B-cells.292 Thus, the targeted gene expression

provided by AML1 is necessary for the hematopoietic development early in the

maturation process for B lymphoblasts.

From the recent advances over the past two decades, molecular

analysis has revealed common breakpoint regions within both the ETV6 and

RUNX1 genes thereby giving rise to the ETV6/RUNX1 fusion product. The

breakpoint region in ETV6 is localized between exon 5 and exon 6, more

specifically in the intronic region spanning 15 kilobases.305 The breakpoint region in RUNX1 is believed to occur frequently between exon1 and exon 2, in the intronic region.306 The fusion gene, ETV6/RUNX1 is driven by the native

ETV6 promoter which is believed to involve SP1 and/or AP-2.305,307

An emergence of interest has recently developed with a focus on

understanding and developing therapies involving the manipulation of

microRNAs (miRs) in various forms of leukemia.308 Recently, miR expression

profile signatures were established from patients diagnosed with ALL.309,310 More

specifically, TEL/AML1 was found to have a role in the repression of miRs -494

130 and -320a resulting in the expression of the prosurvival protein, SURVIVIN,

which has been shown to be a target of miRs -494 and -320a.311 Upon silencing

of TEL/AML1 expression, the expression levels of the aforementioned miRs were

increased, SURVIVIN expression was reduced, and subsequently resulted in the

cells undergo apoptosis. In a separate report, using an ALL cell line model

expressing TEL/AML1, the overexpression of endogenous miR-125b was shown

to provide a survival advantage and was postulated to be the result of a second-

hit, which was believed to be necessary to confer leukemia in a TEL/AML1 background.312 Thus, two recent reports provided evidence which signify the

importance of understanding the role microRNAs serve in ALL and how targeting

these miRs could be advantageous.

Recently, miR-181a expression was shown to aberrantly occur in AML

patient blasts.56,177 Here in this report evidence is presented showing that miR-

UTR) of RUNX1 contained within-׳untranslated region (3-׳181a-1 targets the 3

ETV6/RUNX1 fusion transcript. As a result of the miR-181a-1 induced downregulation of TEL/AML1, an increased incident of apoptosis occurred in those cells with elevated levels of miR-181a-1. Additionally, miR-181a-1

demonstrated a potential role serving as a therapeutic molecule for ALL cells

harboring the t(12;21)(p13;q22) translocation. By increasing the expression of

miR-181a-1, the expression of TEL/AML1 decreased thereby eliminating the

initial “first-hit” which likely predisposed these cells to leukemogenesis. Finally

the immunomodulatory agent, lenalidomide, was used to induce the expression

of miR-181a, which in turn downregulates TEL/AML1 expression thereby

131 abolishing the repressive nature exerted by TEL/AML1 on the miR-494

promoter and allowing for miR-494 expression, subsequently decreasing

SURVIVIN expression, thereby causing the cells to undergo apoptosis. Thus, lenalidomide induction of miR-181a should be used experimentally as a novel therapeutic approach for the treatment of ALL with the t(12;21)(p13;q22) translocation.

5.4 Experimental

Using the computer algorithm TargetScan5.1, targets for miR-181a-1 were

searched and RUNX1 was identified as a candidate target with having the

complement seed sequence necessary for miR-181a-1 recognition. (Figure

5.3.a) Upon further examination, this nucleotide sequence is highly conserved within mouse, chimpanzee, and human. To demonstrate experimentally that

UTR, the complementary seed sequence-׳miR-181a-1 targets the RUNX1 3

UTR was cloned into a luciferase reporter expression-׳within the RUNX1 3

vector. In addition, a mutant complementary seed sequence was generated in a

separate expression vector to demonstrate specificity of miR-181a-1 mediated silencing. HEK 293T cells were co-transfected with luciferase expression vectors

UTR of RUNX1 and a miR-181a-1-׳containing either wild-type or mutant 3

expression vector, followed by an assessment of luciferase reporter activity. As

expected, luciferase reporter activity was reduced when co-transfected with miR-

181a-1. (Figure 5.3.b.) In contrast, a reduction in luciferase activity was not

observed when miR-181a-1 was co-transfected with the luciferase reporter

132 UTR complementary seed sequence. Moreover, the-׳containing the mutant 3

evidence for miR-181a-1 specificity was strengthened when the luciferase

reduction was found to be dose-dependent according to the increasing amounts

of miR-181a-1 expression plasmid co-transfected with a constant quantity of the

luciferase reporter.

UTR is a Target of miR-181a-1. a. The complement nucleotide-׳Figure 5.3 The RUNX1-3 UTR is a highly conserved sequence between three representative-׳sequence in the RUNX1-3 species. b. Luciferase reporter activity assay in 293T cells co-transfected with wild-type or -UTR along with various concentrations (1µg to 10µg) of a miR-׳mutant versions of RUNX1-3 181a-1 expression plasmid. A dose-dependent decrease in luciferase reporter assay for the wild- UTR is seen in response to increased amounts of transfected miR-181a-1-׳type RUNX1-3 plasmid. c. Western blot for AML1 (RUNX1) expression in THP-1 cells transiently transfected with two different amounts (1µg and 5µg) of the miR-181a-1 expression plasmid. The numerical values are indicative of the AML1 protein expression (relative to Actin and vector only control). Notably, a dose-dependent decrease in AML expression was identified.

UTR of RUNX1, the-׳Having confirmed that miR-181a-1 targets the 3

protein expression was examined to determine if this downregulation was

identifiable at the protein level. The monocytic THP-1 cell line was used as a

model cell line due to the endogenous expression of AML1, which is coded by

RUNX1. Indeed, a dose-dependent reduction of the AML1 protein expression

133 was observed in those cells transiently expressing the miR-181a-1 plasmid.

(Figure 5.3.c) An assessment of miR-181a-1 expression in these transfected cells was performed through the use of quantitative real-time RT-PCR. Indeed, miR-181a-1 expression was elevated 200 (1µg) and 500 (5µg) times, relative to the control. (data not shown) The evidence collected thus far suggested that

UTR of RUNX1 and is capable of reducing the-׳miR-181a-1 targets the 3

expression of this target at the protein level.

It is reasonable to infer that expression of AML1 was reduced in response

to miR-181a-1. Thus, it is likely that miR-181a-1 is capable of reducing the

expression of TEL/AML1 (ETV6/RUNX1) because the fusion transcript harbors

UTR of RUNX1. In an effort to answer this question, the B cell precursor-׳the 3

ALL cell line, REH, was used as a model system for testing this hypothesis. The

REH cell line harbors the t(12;21)(p13;q22) translocation and expresses the

fusion transcript encoded by the fused genes, ETV6/RUNX1, giving rise to the

TEL/AML1 fusion protein. Three separate approaches using transient

transfections were undertaken to manipulate the expression of TEL/AML1.

Small-interfering RNAs (siRNAs)313 specific for the ETV6/RUNX1 transcripts

were used to downregulate the expression of the fusion gene transcript.

Similarly, a synthetic oligonucleotide precursor (pre-miR-181a-1) designed to

give rise to the mature miR-181a-1, was used and expected to recapitulate the

affects seen with the siRNA targeting the ETV6/RUNX1 transcript. In contrast,

an oligonucleotide designed to interfere with miR-181a-1 expression (hereafter

134 referred to as antagomiR-181a) was also utilized and intended to reduce the

endogenously expressed miR-181a-1 within the cell.

Following transient transfection of the REH cells with the various

oligonucleotides, the protein expression was assessed through Western blot.

(Figure 5.4.a) TEL/AML1 expression was reduced when either siRNA targeting

the fusion transcript or pre-miR-181a-1 was transiently transfected. In contrast,

TEL/AML1 was increased when antagomiR-181a-1 was transfected. The expression of miR-181a was assessed through the use of quantitative real-time

RT-PCR. As expected, the miR-181a expression levels remained unchanged in the transfections involving either the negative controls or siRNA directed toward the TEL/AML1 transcript. (Figure 5.4.b) In contrast, miR-181a expression was significantly lower in the cells transfected with the antagomiR-181a. Moreover, the expression levels of miR-181a were found to be the highest among the conditions, when the precursor for miR-181a-1 was transfected into the cells.

Therefore the conclusion was drawn based on the evidence which suggested

UTR of the TEL/AML1 transcript and this reduction-׳that miR-181a-1 targets the 3

in expression was revealed at the protein level.

135

Figure 5.4 MiR-181a-1 Targets TEL/AML1 and Has Anti-Tumorigenic Properties in an ALL Cell line. a. Western blot examining TEL/AML1 and SURVIVIN expression in REH following various transfection conditions. The numerical values are the quantification of the protein expression relative to Actin and the negative control. b. Quantitative real-time RT-PCR measuring the expression of miR-181a in the same REH transfections (described in a.). c. Quantification real-time RT-PCR measuring the expression of SURVIVIN expression in those REH cells described in a. and b. d. Apoptosis flow cytometry data identifying Annexin-PE and 7- AAD staining for those REH cells described in a, b, and c. The REH cells transfected with miR- 181a-1 displayed the highest amount of cells undergoing early apoptosis (upper left) and late apoptosis (upper right).

Two previous reports have implicated the anti-apoptotic protein,

SURVIVIN, as a point of interest when analyzing TEL/AML1 expression.311,313 It has been reported that SURVIVIN expression was indirectly modulated by the expression of TEL/AML1. Upon silencing TEL/AML1 expression, the expression

136 of SURVIVIN was reduced and coincided with the cell undergoing apoptosis.

Therefore, the expression of SURVIVIN was examined in those REH cells

transiently transfected with siRNA for TEL/AML1 transcript, pre-miR-181a-1, or antagomiR-181a. Indeed, similar results were observed in which the SURVIVIN expression was reduced following transfection of siRNA or miR-181a-1 targeting the TEL/AML1 transcript. (Figures 5.4.a and 5.4.c.) In contrast, SURVIVIN was upregulated following the transfection of antagomiR-181a. Notably, it was revealed that a larger population of cells experienced apoptosis following the transient transfection of siRNA silencing TEL/AML1 (56%) and miR-181a-1

(61%). (Figure 5.4.d.) In contrast, the negative controls displayed 27% apoptotic

cells. Interestingly, a lower quantity of cells, relative to the negative controls, was

observed to undergo apoptosis following the transient transfection of antagomiR-

181a-1. Although the difference is small between the percentages for the

negative control and antagomiR-181a-1, these data further support the

hypothesis that miR-181a-1 contributes to cell to undergo apoptosis. Taken

together, evidence has been provided demonstrating that miR-181a-1 targets the

TEL/AML1 transcript and is suitable for directly downregulating TEL/AML1

expression. Furthermore, as a result of this reduced TEL/AML1 expression, the

cells were more likely to undergo apoptosis, perhaps as a response to lower

SURVIVIN levels within the cell.

The immunomodulatory agent, lenalidomide has been shown to increase

the expression of miR-181a-1 in AML cells. Therefore, it was of great interest to

see if this phenomenon was applicable to the ALL cell, REH. The REH cells

137 were grown in culture and treated with lenalidomide (3.0 µM) every 24 hours over

the course of seven days. Cells were collected every day and the RNA was

assessed for the expression of miR-181a, TEL/AML1, miR-494 (repressed by

UTR of SURVIVIN), and the anti-apoptotic protein-׳TEL/AML1; targets 3

SURVIVIN. Indeed, an increase in miR-181a expression was revealed over a

seven day time course. (Figure 5.5.a.) It is likely this increase in miR-181a

expression might have continued, however collections were only conducted for

seven days. In accord to the siRNA data, an inverse correlation between miR-

181a expression and TEL/AML1 expression was observed. (Figure 5.5.b, upper)

In support of the data presented by Diakos, et al.311, an increase of miR-494

expression occurred almost spontaneously following the decrease in TEL/AML1

expression. (Figure 5.5.b, middle) Fitting to the expression of miR-494, a decrease in SURVIVIN expression was observed shortly after the increase in

UTR of-׳miR-494 expression, thereby supporting the hypothesis that the 3

SURVIVIN is a target of miR-494. (Figure 5.5.b, lower) Additional support for

this hypothesis was revealed by the event in which the miR-494 expression

decreased over the course of time and the expression of SURVIVIN reflected this

change with a slight increase of expression, although still lower than basal

expression. Taken together, the ALL cell line REH demonstrated a similar

response to lenalidomide as was seen in AML cells, in which miR-181a

expression levels were increased. Moreover, the decrease in TEL/AML1

transcript expression is likely the result of the increased miR-181a expression.

The miR-494 expression was likely increased in response to the decline in

138 TEL/AML1 transcript expression. In turn, the elevated miR-494 targeted the

SURVIVIN transcript and the expression was lowered.

Figure 5.5 Lenalidomide Induces miR-181a Expression and Indirectly Decreases SURVIVIN Expression. a. Quantitative real-time RT-PCR data displaying the expression of miR-181a for REH in response to 3.0 µM lenalidomide treatment daily for seven days. Increased miR-181a expression occured within the ALL cells in response to the lenalidomide. b. A decrease in TEL/AML1 expression (upper) was observed. An increase of miR-494 expression (middle) and subsequently a decrease in SURVIVIN expression (lower) was detailed over the 7-day time course of 3.0 µM lenalidomide treatment in REH cells. (abbreviations: V=vehicle; L=lenalidomide).

Next, experiments were conducted to determine if this TEL/AML1

transcript downregulation attributed to lenalidomide was isolated to only REH

cells or could it be a general phenomenon. To explore this possibility, an

experiment was conducted using an additional ALL cell line, UOC-B6 (provided by Dr. O.Krejci), which harbors the t(12;21)(p13;q22) translocation, and like REH, is a precursor B-cell model cell line.314 Both cell lines were treated with 3.0 µM

139 lenalidomide once daily for seven days. Cells were collected and the cellular

response was analyzed using quantitative real-time RT-PCR, Western blot analysis, and flow cytometry. By day six of the investigation, a significant increase of expression for both miR-181a and miR-494 was observed in both cell lines. (Figures 5.6.a. and 5.6.b.) The UOC-B6 cell line had higher expression of both miR-181a and miR-494, which presumably correlated to a greater reduction

of TEL/AML1 and SURVIVIN expression. A noticeable decrease in TEL/AML1 expression was identified in both cell lines (Figures 5.6.a. and 5.6.b.), suggesting a response to increased levels of miR-181a. Moreover, a decrease in SURVIVIN expression was revealed, and this feature was likely due to the increase in miR-

494 expression. Finally, both cell lines were subjected to immunostaining in an effort to understand any apoptotic responses which may occur within the cell on

day seven of the treatment. In accord to the observations of decreased

SURVIVIN expression, increases of apoptotic cells were observed in either cell

line treated with lenalidomide. (Figures 5.6.e. and 5.6.f.) The REH cell line did

show a modest increase of cells undergoing early apoptosis (21.5%) and the

UOC-B6 cell line had a higher quantity of cells undergoing apoptosis. The UOC-

B6 cells were most likely transitioning from early apoptosis to late apoptosis

(60%). Taken together, the features associated with lenalidomide induction of

miR-181a expression appear to be a general phenomenon which occurs in

multiple ALL cell lines. Furthermore, this immunomodulatory agent appears to

induce apoptosis in cells by lowering SURVIVIN expression and thereby lowering

the apoptotic threshold within a cell.

140

Figure 5.6 Lenalidomide Inhibits Tumorigenic Expression of TEL/AML1 and Promotes Apoptosis. a,b Quantitative real-time RT-PCR results analyzing miR-181a and miR-494 expression in REH and UOC-B6 cells after six days of daily lenalidomide (3.0 µM) application. A significant increase of expression for both miR-181a and miR-494 occurred in response to lenalidomide for both cell lines. c,d Western blot analysis of the expression for TEL/AML1 was shown to be decreased in both cell lines treated with lenalidomide. In addition, the prosurvival protein SURVIVIN expression was lower in those cells treated with the drug. The protein expression analysis for TEL/AML1 and SURVIVIN was at the same time point described in a,b. e,f Apoptosis flow cytometry data identifying Annexin-PE and 7-AAD staining for both ALL cell lines treated with either vehicle or lenalidomide, the day following the time point described in a,b. An increased quantity of early apoptotic cells (upper left) was observed in the REH cells. A larger increase of apoptotic cells were seen (upper right) in the UOC-B6 cells treated with lenalidomide.

In this report, miR-181a-1 has been experimentally shown to target the

UTR region of RUNX1. The evidence provided displayed a dose-dependent-׳3 response of luciferase reporter activity when the amount of miR-181a-1

141 expression plasmid ranged from 1 µg to 10 µg. Furthermore, using an AML cell

line which expresses the RUNX1 gene at the protein level (AML1), a dose-

dependent reduction of AML1 expression occurred in response to various amounts of miR-181-1. Further investigations involved the ALL cell line REH,

which harbors the t(12;21)(p13;q22) translocation and expresses the

TEL/AML1 fusion transcript at both the mRNA and protein levels. These cells were transiently transfected with three different oligonucleotides: a previously reported siRNA313 directed at the TEL/AML1 transcript, a synthetic precursor

miR-181a-1, and a miR-181a-1 antagonist. Using these oligonucleotides, data

was collected revealing the ability to modulate the expression of TEL/AML1

following these various transfections. In addition, supporting data was provided

in which the expression of a prosurvival gene, SURVIVIN, was influenced

indirectly by the manipulation of TEL/AML1 expression, using the

aforementioned oligonucleotides. Furthermore, in those cells transfected with

miR-181a-1, a greater reduction in SURVIVIN was observed along with a

higher percentage of cells undergoing apoptosis. Taken together, the data

presented here indicates that miR-181a is fully capable, if not better than

siRNA, at silencing the expression of TEL/AML1, which in turn, indirectly

downregulates SURVIVIN expression, and increases the quantity of apoptotic

cells.

Extending this mechanism, the data presented here provides evidence

of a therapeutic use for the anti-leukemia agent, lenalidomide. Indeed, using

two ALL cells lines harboring the t(12;21)(p13;q22) fusion gene, an increase of

142 miR-181a expression was identified following daily applications of the drug. In response to the increased levels of miR-181a, a decrease in TEL/AML1 expression was observed. Subsequently, miR-494 expression was increased following the decrease of TEL/AML1 expression. As a result to higher levels of miR-494, a known target of miR-494, SURVIVIN, was shown to be much lower in those ALL cells treated with lenalidomide. Fittingly, higher percentages of cells experiencing cell death in the absence of SURVIVIN were observed.

Taken together, the attributes associated to lenalidomide are not just isolated to

AML. The therapeutic benefits are also applicable to ALL cells. The benefits of lenalidomide to ALL cells include lower levels of TEL/AML1 expression, which is tumorigenic, and the decrease in SURVIVIN expression, subsequently prompting the treated cells to undergo apoptosis.

Testing the affects of lenalidomide on ALL patient blasts afflicted with the t(12;21)(p13;q22) translocation would be of considerable interest. Currently, the cure rate for children afflicted with ALL has been estimated to be as high as

80%.315,316 As such, there is still one-fifth of the afflicted children who are in

need of treatment options. One treatment option might include the anti- leukemia agent, lenalidomide. Here lenalidomide was shown to increase the expression of miR-181a, downmodulate TEL/AML, and reduce SURVIVIN

expression, via miR-494. An additional and possible benefit from lenalidomide waiting to be investigated involves the SUMO-conjugating enzyme UBC9,

which has been demonstrated to increase in response to lenalidomide

treatment. UBC9, has been shown to post-translationally modify TEL, thereby

143 favoring its cellular localization to the cytoplasm and not the nucleus.317 This

potential mechanism could conceivably favor the nuclear export of TEL/AML1,

thereby alleviating the repressive nature TEL/AML1 has on the miR-494. In

turn, miR-494 could be expressed and directed for the silencing of SURVIVIN.

Notably, a significant increase in UBC9 expression was revealed to occur over

the first five days in both ALL cell lines, REH and UOC-B6, following treatment

with lenalidomide. (data not shown) Moreover, in the UOC-B6 cells treated with lenalidomide, the upregulation of UBC9 expression occurred throughout the seven day treatment period. The UBC9 induction, in combination with elevated

expression of miR-181a which prohibits the expression TEL/AML1, is likely to

induce the ALL cells to undergo apoptosis. Thus, treating t(12;21)(p13;q22)

ALL with lenalidomide could offer a two-tiered therapeutic mechanism, miR-

181a-mediated silencing of TEL/AML1 expression and UBC9-mediate shuttling

of TEL/AML1 out of the nucleus which favors miR-494 expression, thereby

benefitting those 20% of children who currently do not have treatment options

available to them.

144 5.5 Future Work

One of the most notable conundrums regarding this lenalidomide study

and ALL cells involves the mechanism(s) responsible for the upregulation of

miR-181a. Previously, the miR-181a expression was shown to be influenced

by the C/EBPα-p30 isoform. However, the expression of CEBPA is not

characteristically observed in ALL cells. Indeed, in the present investigation,

the identification for C/EBPα expression was conducted using a Western blot

approach. As expected, no C/EBPα expression was observed. (data not

shown) Thus remains the question as to how miR-181a expression is

increased following lenalidomide treatment. To resolve this issue, further

investigations within the miR-181a promoter need to occur. Using a computer-

based algorithm, the miR-181a promoter region should be analyzed while

identifying any likely transcription factors associated to the B- and T-cell lineage development. Such candidates would include PU.1, GATA-3, and most notable

XBP-1.

The X-box-Binding Protein 1 (XBP1) is an essential transcription factor for the maturation of B-cells.13,318 It has been reported that XBP1 is specifically

required for the differentiation of precursor B-cells to terminal B lymphocytes.319

The REH and UOC-B6 cells used in the present study are precursor B-cells. It is likely both of these ALL cell lines have defects in the expression of XBP1, rendering them undifferentiated precursor B-cells and akin to AML cells as they

have defects in the C/EBPα protein function rendering them undifferentiated

myeloid cells. Indeed, a common feature may be shared between C/EBPα and

145 XBP1, and perhaps they have mutual roles in the differentiation process for their respective lineage. Moreover, both C/EBPα and XBP1 proteins are members of the bZIP family. Equally as intriguing, the consensus target sequence, of genes dependent on the XBP1 transcriptional activity, is very similar to the C/EBPα consensus sequence. The consensus sequence for

see Chapter 2.2 for) 320.׳CCAAT(N9)CCACG-3-׳XBP1 target promoters is: 5 comparison) Therefore, it is reasonable to be interested in XBP1 as a candidate protein when trying to elucidate the reasons behind increased expression of miR-181a in ALL cells.

Taken together, although the putative C/EBPα-binding site within the

miR-181a-1 promoter has yet to be fully identified and characterized, it is likely

that a C/EBPα recognition site is present in the promoter due to the correlation

demonstrated between C/EBPα-p30 and miR-181a-1 expression. Furthermore,

ALL cells respond to lenalidomide in a similar manner by increasing miR-181a

expression, as seen in AML cells. It is possible that XBP1, a transcription

factor similar in nature to C/EBPα (bZIP family members) can bind to the

promoter of miR-181a thereby driving the expression. The consensus

sequences recognized by these two transcription factors, C/EBPα and XBP1,

are remarkably similar and favor the possibility that the two transcription factors

mutually share the binding site located within the miR-181a-1 promoter. Thus,

it is of significant interest to detail the roles XBP1 has in the promotion of miR-

181a expression in ALL following the treatment of lenalidomide.

146

REFERENCES

1. Sullivan R. A brief journey into medical care and disease in ancient Egypt. J R Soc Med. 1995;88:141-145. 2. Bugyi B. [The Edwin Smith papyrus]. Orv Hetil. 1972;113:1079-1080. 3. Hanahan D, Weinberg RA. The hallmarks of cancer. Cell. 2000;100:57-70. 4. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell;144:646-674. 5. Degos L. John Hughes Bennett, Rudolph Virchow. and Alfred Donne: the first description of leukemia. Hematol J. 2001;2:1. 6. Seita J, Weissman IL. Hematopoietic stem cell: self-renewal versus differentiation. Wiley Interdiscip Rev Syst Biol Med;2:640-653. 7. Dingli D, Pacheco JM. Modeling the architecture and dynamics of hematopoiesis. Wiley Interdiscip Rev Syst Biol Med;2:235-244. 8. Ceredig R, Rolink AG, Brown G. Models of haematopoiesis: seeing the wood for the trees. Nat Rev Immunol. 2009;9:293-300. 9. Adolfsson J, Mansson R, Buza-Vidas N, et al. Identification of Flt3+ lympho- myeloid stem cells lacking erythro-megakaryocytic potential a revised road map for adult blood lineage commitment. Cell. 2005;121:295-306. 10. Papathanasiou P, Attema JL, Karsunky H, Xu J, Smale ST, Weissman IL. Evaluation of the long-term reconstituting subset of hematopoietic stem cells with CD150. Stem Cells. 2009;27:2498-2508. 11. Kiel MJ, Yilmaz OH, Iwashita T, Yilmaz OH, Terhorst C, Morrison SJ. SLAM family receptors distinguish hematopoietic stem and progenitor cells and reveal endothelial niches for stem cells. Cell. 2005;121:1109-1121. 12. Lai AY, Kondo M. Asymmetrical lymphoid and myeloid lineage commitment in multipotent hematopoietic progenitors. J Exp Med. 2006;203:1867-1873. 13. Orkin SH, Zon LI. Hematopoiesis: an evolving paradigm for stem cell biology. Cell. 2008;132:631-644. 14. Ratajczak MZ, Luger SM, DeRiel K, Abrahm J, Calabretta B, Gewirtz AM. Role of the KIT protooncogene in normal and malignant human hematopoiesis. Proc Natl Acad Sci U S A. 1992;89:1710-1714. 15. Solar GP, Kerr WG, Zeigler FC, et al. Role of c-mpl in early hematopoiesis. Blood. 1998;92:4-10.

147 16. Zhang P, Iwasaki-Arai J, Iwasaki H, et al. Enhancement of hematopoietic stem cell repopulating capacity and self-renewal in the absence of the transcription factor C/EBP alpha. Immunity. 2004;21:853-863. 17. Koipally J, Kim J, Jones B, et al. Ikaros chromatin remodeling complexes in the control of differentiation of the hemo-lymphoid system. Cold Spring Harb Symp Quant Biol. 1999;64:79-86. 18. Nichogiannopoulou A, Trevisan M, Friedrich C, Georgopoulos K. Ikaros in hemopoietic lineage determination and homeostasis. Semin Immunol. 1998;10:119-125. 19. Scandura JM, Boccuni P, Cammenga J, Nimer SD. Transcription factor fusions in acute leukemia: variations on a theme. Oncogene. 2002;21:3422-3444. 20. Knudson AG. Stem cell regulation, tissue ontogeny, and oncogenic events. Semin Cancer Biol. 1992;3:99-106. 21. Knudson AG. Hereditary cancer: two hits revisited. J Cancer Res Clin Oncol. 1996;122:135-140. 22. Tomlinson IP, Roylance R, Houlston RS. Two hits revisited again. J Med Genet. 2001;38:81-85. 23. Fialkow PJ, Singer JW, Adamson JW, et al. Acute nonlymphocytic leukemia: heterogeneity of stem cell origin. Blood. 1981;57:1068-1073. 24. van Lom K, Hagemeijer A, Smit EM, Lowenberg B. In situ hybridization on May-Grunwald Giemsa-stained bone marrow and blood smears of patients with hematologic disorders allows detection of cell-lineage-specific cytogenetic abnormalities. Blood. 1993;82:884-888. 25. Bonnet D, Dick JE. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat Med. 1997;3:730-737. 26. Lapidot T, Sirard C, Vormoor J, et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature. 1994;367:645-648. 27. Bhatia M, Wang JC, Kapp U, Bonnet D, Dick JE. Purification of primitive human hematopoietic cells capable of repopulating immune-deficient mice. Proc Natl Acad Sci U S A. 1997;94:5320-5325. 28. Mulloy JC, Cammenga J, MacKenzie KL, Berguido FJ, Moore MA, Nimer SD. The AML1-ETO fusion protein promotes the expansion of human hematopoietic stem cells. Blood. 2002;99:15-23. 29. Tonks A, Pearn L, Tonks AJ, et al. The AML1-ETO fusion gene promotes extensive self-renewal of human primary erythroid cells. Blood. 2003;101:624-632. 30. Vardiman JW, Thiele J, Arber DA, et al. The 2008 revision of the World Health Organization (WHO) classification of myeloid neoplasms and acute leukemia: rationale and important changes. Blood. 2009;114:937-951. 31. Bennett JM, Catovsky D, Daniel MT, et al. Proposals for the classification of the acute leukaemias. French-American-British (FAB) co-operative group. Br J Haematol. 1976;33:451-458. 32. Kaleem Z, Crawford E, Pathan MH, et al. Flow cytometric analysis of acute leukemias. Diagnostic utility and critical analysis of data. Arch Pathol Lab Med. 2003;127:42-48. 33. Chen J, Odenike O, Rowley JD. Leukaemogenesis: more than mutant genes. Nat Rev Cancer;10:23-36.

148 34. Yendamuri S, Calin GA. The role of microRNA in human leukemia: a review. Leukemia. 2009;23:1257-1263. 35. Speck NA, Gilliland DG. Core-binding factors in haematopoiesis and leukaemia. Nat Rev Cancer. 2002;2:502-513. 36. Zelent A, Greaves M, Enver T. Role of the TEL-AML1 fusion gene in the molecular pathogenesis of childhood acute lymphoblastic leukaemia. Oncogene. 2004;23:4275-4283. 37. Brown G, Hughes PJ, Michell RH, Rolink AG, Ceredig R. The sequential determination model of hematopoiesis. Trends Immunol. 2007;28:442-448. 38. Mercer EM, Lin YC, Benner C, et al. Multilineage priming of enhancer repertoires precedes commitment to the B and myeloid cell lineages in hematopoietic progenitors. Immunity;35:413-425. 39. Mercer EM, Lin YC, Murre C. Factors and networks that underpin early hematopoiesis. Semin Immunol. 40. Miyamoto T, Iwasaki H, Reizis B, et al. Myeloid or lymphoid promiscuity as a critical step in hematopoietic lineage commitment. Dev Cell. 2002;3:137-147. 41. Mansson R, Hultquist A, Luc S, et al. Molecular evidence for hierarchical transcriptional lineage priming in fetal and adult stem cells and multipotent progenitors. Immunity. 2007;26:407-419. 42. Rosenbauer F, Tenen DG. Transcription factors in myeloid development: balancing differentiation with transformation. Nat Rev Immunol. 2007;7:105-117. 43. DeKoter RP, Singh H. Regulation of B lymphocyte and macrophage development by graded expression of PU.1. Science. 2000;288:1439-1441. 44. Laslo P, Spooner CJ, Warmflash A, et al. Multilineage transcriptional priming and determination of alternate hematopoietic cell fates. Cell. 2006;126:755-766. 45. Wang X, Scott E, Sawyers CL, Friedman AD. C/EBPalpha bypasses granulocyte colony-stimulating factor signals to rapidly induce PU.1 gene expression, stimulate granulocytic differentiation, and limit proliferation in 32D cl3 myeloblasts. Blood. 1999;94:560-571. 46. Friedman AD. Transcriptional control of granulocyte and monocyte development. Oncogene. 2007;26:6816-6828. 47. Bullinger L, Dohner K, Bair E, et al. Use of gene-expression profiling to identify prognostic subclasses in adult acute myeloid leukemia. N Engl J Med. 2004;350:1605- 1616. 48. Valk PJ, Verhaak RG, Beijen MA, et al. Prognostically useful gene-expression profiles in acute myeloid leukemia. N Engl J Med. 2004;350:1617-1628. 49. de Jonge HJ, Huls G, de Bont ES. Gene expression profiling in acute myeloid leukaemia. Neth J Med;69:167-176. 50. Wilson CS, Davidson GS, Martin SB, et al. Gene expression profiling of adult acute myeloid leukemia identifies novel biologic clusters for risk classification and outcome prediction. Blood. 2006;108:685-696. 51. de Jonge HJ, de Bont ES, Valk PJ, et al. AML at older age: age-related gene expression profiles reveal a paradoxical down-regulation of p16INK4A mRNA with prognostic significance. Blood. 2009;114:2869-2877.

149 52. Metzeler KH, Hummel M, Bloomfield CD, et al. An 86-probe-set gene- expression signature predicts survival in cytogenetically normal acute myeloid leukemia. Blood. 2008;112:4193-4201. 53. Li Z, Lu J, Sun M, et al. Distinct microRNA expression profiles in acute myeloid leukemia with common translocations. Proc Natl Acad Sci U S A. 2008;105:15535- 15540. 54. Becker H, Marcucci G, Maharry K, et al. Favorable prognostic impact of NPM1 mutations in older patients with cytogenetically normal de novo acute myeloid leukemia and associated gene- and microRNA-expression signatures: a Cancer and Leukemia Group B study. J Clin Oncol;28:596-604. 55. Marcucci G, Maharry K, Radmacher MD, et al. Prognostic significance of, and gene and microRNA expression signatures associated with, CEBPA mutations in cytogenetically normal acute myeloid leukemia with high-risk molecular features: a Cancer and Leukemia Group B Study. J Clin Oncol. 2008;26:5078-5087. 56. Schwind S, Maharry K, Radmacher MD, et al. Prognostic significance of expression of a single microRNA, miR-181a, in cytogenetically normal acute myeloid leukemia: a Cancer and Leukemia Group B study. J Clin Oncol;28:5257-5264. 57. Marcucci G, Haferlach T, Dohner H. Molecular genetics of adult acute myeloid leukemia: prognostic and therapeutic implications. J Clin Oncol;29:475-486. 58. Schlenk RF, Dohner K, Krauter J, et al. Mutations and treatment outcome in cytogenetically normal acute myeloid leukemia. N Engl J Med. 2008;358:1909-1918. 59. Williams SC, Angerer ND, Johnson PF. C/EBP proteins contain nuclear localization signals imbedded in their basic regions. Gene Expr. 1997;6:371-385. 60. Calkhoven CF, Muller C, Leutz A. Translational control of gene expression and disease. Trends Mol Med. 2002;8:577-583. 61. Tsukada J, Yoshida Y, Kominato Y, Auron PE. The CCAAT/enhancer (C/EBP) family of basic-leucine zipper (bZIP) transcription factors is a multifaceted highly- regulated system for gene regulation. Cytokine;54:6-19. 62. Hendricks-Taylor LR, Bachinski LL, Siciliano MJ, et al. The CCAAT/enhancer binding protein (C/EBP alpha) gene (CEBPA) maps to human chromosome 19q13.1 and the related nuclear factor NF-IL6 (C/EBP beta) gene (CEBPB) maps to human chromosome 20q13.1. Genomics. 1992;14:12-17. 63. Timchenko N, Wilson DR, Taylor LR, et al. Autoregulation of the human C/EBP alpha gene by stimulation of upstream stimulatory factor binding. Mol Cell Biol. 1995;15:1192-1202. 64. Skokowa J, Cario G, Uenalan M, et al. LEF-1 is crucial for neutrophil granulocytopoiesis and its expression is severely reduced in congenital neutropenia. Nat Med. 2006;12:1191-1197. 65. Birkenmeier EH, Gwynn B, Howard S, et al. Tissue-specific expression, developmental regulation, and genetic mapping of the gene encoding CCAAT/enhancer binding protein. Genes Dev. 1989;3:1146-1156. 66. Muller C, Bremer A, Schreiber S, Eichwald S, Calkhoven CF. Nucleolar retention of a translational C/EBPalpha isoform stimulates rDNA transcription and cell size. Embo J;29:897-909.

150 67. Koldin B, Suckow M, Seydel A, von Wilcken-Bergmann B, Muller-Hill B. A comparison of the different DNA binding specificities of the bZip proteins C/EBP and GCN4. Nucleic Acids Res. 1995;23:4162-4169. 68. Cai DH, Wang D, Keefer J, Yeamans C, Hensley K, Friedman AD. C/EBP alpha:AP-1 leucine zipper heterodimers bind novel DNA elements, activate the PU.1 promoter and direct monocyte lineage commitment more potently than C/EBP alpha homodimers or AP-1. Oncogene. 2008;27:2772-2779. 69. Fuchs O. Growth-inhibiting activity of transcription factor C/EBPalpha, its role in haematopoiesis and its tumour suppressor or oncogenic properties in leukaemias. Folia Biol (Praha). 2007;53:97-108. 70. Suh HC, Gooya J, Renn K, Friedman AD, Johnson PF, Keller JR. C/EBPalpha determines hematopoietic cell fate in multipotential progenitor cells by inhibiting erythroid differentiation and inducing myeloid differentiation. Blood. 2006;107:4308- 4316. 71. Smith LT, Hohaus S, Gonzalez DA, Dziennis SE, Tenen DG. PU.1 (Spi-1) and C/EBP alpha regulate the granulocyte colony-stimulating factor receptor promoter in myeloid cells. Blood. 1996;88:1234-1247. 72. Zhang DE, Hetherington CJ, Meyers S, et al. CCAAT enhancer-binding protein (C/EBP) and AML1 (CBF alpha2) synergistically activate the macrophage colony- stimulating factor receptor promoter. Mol Cell Biol. 1996;16:1231-1240. 73. Wang W, Wang X, Ward AC, Touw IP, Friedman AD. C/EBPalpha and G-CSF receptor signals cooperate to induce the myeloperoxidase and neutrophil elastase genes. Leukemia. 2001;15:779-786. 74. Khanna-Gupta A, Zibello T, Simkevich C, Rosmarin AG, Berliner N. Sp1 and C/EBP are necessary to activate the lactoferrin gene promoter during myeloid differentiation. Blood. 2000;95:3734-3741. 75. McNagny KM, Sieweke MH, Doderlein G, Graf T, Nerlov C. Regulation of eosinophil-specific gene expression by a C/EBP-Ets complex and GATA-1. Embo J. 1998;17:3669-3680. 76. Nerlov C, Ziff EB. CCAAT/enhancer binding protein-alpha amino acid motifs with dual TBP and TFIIB binding ability co-operate to activate transcription in both yeast and mammalian cells. Embo J. 1995;14:4318-4328. 77. Iniguez-Lluhi JA, Pearce D. A common motif within the negative regulatory regions of multiple factors inhibits their transcriptional synergy. Mol Cell Biol. 2000;20:6040-6050. 78. Calkhoven CF, Snippe L, Ab G. Differential stimulation by CCAAT/enhancer- binding protein alpha isoforms of the estrogen-activated promoter of the very-low-density apolipoprotein II gene. Eur J Biochem. 1997;249:113-120. 79. Slomiany BA, D'Arigo KL, Kelly MM, Kurtz DT. C/EBPalpha inhibits cell growth via direct repression of E2F-DP-mediated transcription. Mol Cell Biol. 2000;20:5986-5997. 80. Wang H, Iakova P, Wilde M, et al. C/EBPalpha arrests cell proliferation through direct inhibition of Cdk2 and Cdk4. Mol Cell. 2001;8:817-828. 81. Calkhoven CF, Muller C, Leutz A. Translational control of C/EBPalpha and C/EBPbeta isoform expression. Genes Dev. 2000;14:1920-1932.

151 82. Rosenwald IB, Chen JJ, Wang S, Savas L, London IM, Pullman J. Upregulation of protein synthesis initiation factor eIF-4E is an early event during colon carcinogenesis. Oncogene. 1999;18:2507-2517. 83. Raught B, Gingras AC, James A, Medina D, Sonenberg N, Rosen JM. Expression of a translationally regulated, dominant-negative CCAAT/enhancer-binding protein beta isoform and up-regulation of the eukaryotic translation initiation factor 2alpha are correlated with neoplastic transformation of mammary epithelial cells. Cancer Res. 1996;56:4382-4386. 84. Van Der Kelen K, Beyaert R, Inze D, De Veylder L. Translational control of eukaryotic gene expression. Crit Rev Biochem Mol Biol. 2009;44:143-168. 85. Scheper GC, Proud CG. Does phosphorylation of the cap-binding protein eIF4E play a role in translation initiation? Eur J Biochem. 2002;269:5350-5359. 86. Ueda T, Watanabe-Fukunaga R, Fukuyama H, Nagata S, Fukunaga R. Mnk2 and Mnk1 are essential for constitutive and inducible phosphorylation of eukaryotic initiation factor 4E but not for cell growth or development. Mol Cell Biol. 2004;24:6539-6549. 87. Sonenberg N, Dever TE. Eukaryotic translation initiation factors and regulators. Curr Opin Struct Biol. 2003;13:56-63. 88. Marcotrigiano J, Gingras AC, Sonenberg N, Burley SK. Cocrystal structure of the messenger RNA 5' cap-binding protein (eIF4E) bound to 7-methyl-GDP. Cell. 1997;89:951-961. 89. Scheper GC, van Kollenburg B, Hu J, Luo Y, Goss DJ, Proud CG. Phosphorylation of eukaryotic initiation factor 4E markedly reduces its affinity for capped mRNA. J Biol Chem. 2002;277:3303-3309. 90. Zuberek J, Wyslouch-Cieszynska A, Niedzwiecka A, et al. Phosphorylation of eIF4E attenuates its interaction with mRNA 5' cap analogs by electrostatic repulsion: intein-mediated protein ligation strategy to obtain phosphorylated protein. Rna. 2003;9:52-61. 91. Radomska HS, Basseres DS, Zheng R, et al. Block of C/EBP alpha function by phosphorylation in acute myeloid leukemia with FLT3 activating mutations. J Exp Med. 2006;203:371-381. 92. Behre G, Singh SM, Liu H, et al. Ras signaling enhances the activity of C/EBP alpha to induce granulocytic differentiation by phosphorylation of serine 248. J Biol Chem. 2002;277:26293-26299. 93. Wang GL, Timchenko NA. Dephosphorylated C/EBPalpha accelerates cell proliferation through sequestering retinoblastoma protein. Mol Cell Biol. 2005;25:1325- 1338. 94. Wang GL, Iakova P, Wilde M, Awad S, Timchenko NA. Liver tumors escape negative control of proliferation via PI3K/Akt-mediated block of C/EBP alpha growth inhibitory activity. Genes Dev. 2004;18:912-925. 95. Khanna-Gupta A. Sumoylation and the function of CCAAT enhancer binding protein alpha (C/EBP alpha). Blood Cells Mol Dis. 2008;41:77-81. 96. Sato Y, Miyake K, Kaneoka H, Iijima S. Sumoylation of CCAAT/enhancer- binding protein alpha and its functional roles in hepatocyte differentiation. J Biol Chem. 2006;281:21629-21639.

152 97. Geletu M, Balkhi MY, Peer Zada AA, et al. Target proteins of C/EBPalphap30 in AML: C/EBPalphap30 enhances sumoylation of C/EBPalphap42 via up-regulation of Ubc9. Blood. 2007;110:3301-3309. 98. Zhang DE, Zhang P, Wang ND, Hetherington CJ, Darlington GJ, Tenen DG. Absence of granulocyte colony-stimulating factor signaling and neutrophil development in CCAAT enhancer binding protein alpha-deficient mice. Proc Natl Acad Sci U S A. 1997;94:569-574. 99. Wang ND, Finegold MJ, Bradley A, et al. Impaired energy homeostasis in C/EBP alpha knockout mice. Science. 1995;269:1108-1112. 100. Flodby P, Barlow C, Kylefjord H, Ahrlund-Richter L, Xanthopoulos KG. Increased hepatic cell proliferation and lung abnormalities in mice deficient in CCAAT/enhancer binding protein alpha. J Biol Chem. 1996;271:24753-24760. 101. Timchenko NA, Harris TE, Wilde M, et al. CCAAT/enhancer binding protein alpha regulates p21 protein and hepatocyte proliferation in newborn mice. Mol Cell Biol. 1997;17:7353-7361. 102. Kimura T, Christoffels VM, Chowdhury S, et al. Hypoglycemia-associated hyperammonemia caused by impaired expression of ornithine cycle enzyme genes in C/EBPalpha knockout mice. J Biol Chem. 1998;273:27505-27510. 103. Martis PC, Whitsett JA, Xu Y, Perl AK, Wan H, Ikegami M. C/EBPalpha is required for lung maturation at birth. Development. 2006;133:1155-1164. 104. Zhang P, Nelson E, Radomska HS, et al. Induction of granulocytic differentiation by 2 pathways. Blood. 2002;99:4406-4412. 105. Collins SJ, Ulmer J, Purton LE, Darlington G. Multipotent hematopoietic cell lines derived from C/EBPalpha(-/-) knockout mice display granulocyte macrophage- colony-stimulating factor, granulocyte- colony-stimulating factor, and retinoic acid- induced granulocytic differentiation. Blood. 2001;98:2382-2388. 106. Schwieger M, Lohler J, Fischer M, Herwig U, Tenen DG, Stocking C. A dominant-negative mutant of C/EBPalpha, associated with acute myeloid leukemias, inhibits differentiation of myeloid and erythroid progenitors of man but not mouse. Blood. 2004;103:2744-2752. 107. Trivedi AK, Pal P, Behre G, Singh SM. Multiple ways of C/EBPalpha inhibition in myeloid leukaemia. Eur J Cancer. 2008;44:1516-1523. 108. Tavor S, Park DJ, Gery S, Vuong PT, Gombart AF, Koeffler HP. Restoration of C/EBPalpha expression in a BCR-ABL+ cell line induces terminal granulocytic differentiation. J Biol Chem. 2003;278:52651-52659. 109. Schepers H, Wierenga AT, van Gosliga D, Eggen BJ, Vellenga E, Schuringa JJ. Reintroduction of C/EBPalpha in leukemic CD34+ stem/progenitor cells impairs self- renewal and partially restores myelopoiesis. Blood. 2007;110:1317-1325. 110. Leroy H, Roumier C, Huyghe P, Biggio V, Fenaux P, Preudhomme C. CEBPA point mutations in hematological malignancies. Leukemia. 2005;19:329-334. 111. Koschmieder S, Halmos B, Levantini E, Tenen DG. Dysregulation of the C/EBPalpha differentiation pathway in human cancer. J Clin Oncol. 2009;27:619-628. 112. Reckzeh K, Cammenga J. Molecular mechanisms underlying deregulation of C/EBPalpha in acute myeloid leukemia. Int J Hematol;91:557-568.

153 113. Pabst T, Mueller BU, Zhang P, et al. Dominant-negative mutations of CEBPA, encoding CCAAT/enhancer binding protein-alpha (C/EBPalpha), in acute myeloid leukemia. Nat Genet. 2001;27:263-270. 114. Nerlov C. C/EBPalpha mutations in acute myeloid leukaemias. Nat Rev Cancer. 2004;4:394-400. 115. Sellick GS, Spendlove HE, Catovsky D, Pritchard-Jones K, Houlston RS. Further evidence that germline CEBPA mutations cause dominant inheritance of acute myeloid leukaemia. Leukemia. 2005;19:1276-1278. 116. Smith ML, Cavenagh JD, Lister TA, Fitzgibbon J. Mutation of CEBPA in familial acute myeloid leukemia. N Engl J Med. 2004;351:2403-2407. 117. Drescher B, Nagel S, Krauter J, Heidenreich O, Ganser A, Heil G. AML1/ETO inhibits AML1/CCAAT-enhancer binding protein-alpha mediated activation of the CD11c promoter and represses CD11c expression in HL60 cells. Haematologica. 2003;88:956-958. 118. Heidenreich O, Krauter J, Riehle H, et al. AML1/MTG8 oncogene suppression by small interfering RNAs supports myeloid differentiation of t(8;21)-positive leukemic cells. Blood. 2003;101:3157-3163. 119. Perrotti D, Cesi V, Trotta R, et al. BCR-ABL suppresses C/EBPalpha expression through inhibitory action of hnRNP E2. Nat Genet. 2002;30:48-58. 120. Helbling D, Mueller BU, Timchenko NA, et al. The leukemic fusion gene AML1- MDS1-EVI1 suppresses CEBPA in acute myeloid leukemia by activation of Calreticulin. Proc Natl Acad Sci U S A. 2004;101:13312-13317. 121. Keeshan K, He Y, Wouters BJ, et al. Tribbles homolog 2 inactivates C/EBPalpha and causes acute myelogenous leukemia. Cancer Cell. 2006;10:401-411. 122. Trivedi AK, Bararia D, Christopeit M, et al. Proteomic identification of C/EBP- DBD multiprotein complex: JNK1 activates stem cell regulator C/EBPalpha by inhibiting its ubiquitination. Oncogene. 2007;26:1789-1801. 123. Keeshan K, Santilli G, Corradini F, Perrotti D, Calabretta B. Transcription activation function of C/EBPalpha is required for induction of granulocytic differentiation. Blood. 2003;102:1267-1275. 124. Koschmieder S, D'Alo F, Radomska H, et al. CDDO induces granulocytic differentiation of myeloid leukemic blasts through translational up-regulation of p42 CCAAT enhancer binding protein alpha. Blood. 2007;110:3695-3705. 125. Lapillonne H, Konopleva M, Tsao T, et al. Activation of peroxisome proliferator- activated receptor gamma by a novel synthetic triterpenoid 2-cyano-3,12-dioxooleana- 1,9-dien-28-oic acid induces growth arrest and apoptosis in breast cancer cells. Cancer Res. 2003;63:5926-5939. 126. Suh N, Wang Y, Honda T, et al. A novel synthetic oleanane triterpenoid, 2-cyano- 3,12-dioxoolean-1,9-dien-28-oic acid, with potent differentiating, antiproliferative, and anti-inflammatory activity. Cancer Res. 1999;59:336-341. 127. Ito Y, Pandey P, Sporn MB, Datta R, Kharbanda S, Kufe D. The novel triterpenoid CDDO induces apoptosis and differentiation of human osteosarcoma cells by a caspase-8 dependent mechanism. Mol Pharmacol. 2001;59:1094-1099.

154 128. Ito Y, Pandey P, Place A, et al. The novel triterpenoid 2-cyano-3,12-dioxoolean- 1,9-dien-28-oic acid induces apoptosis of human myeloid leukemia cells by a caspase-8- dependent mechanism. Cell Growth Differ. 2000;11:261-267. 129. Suh WS, Kim YS, Schimmer AD, et al. Synthetic triterpenoids activate a pathway for apoptosis in AML cells involving downregulation of FLIP and sensitization to TRAIL. Leukemia. 2003;17:2122-2129. 130. Lin YS, Green MR. Mechanism of action of an acidic transcriptional activator in vitro. Cell. 1991;64:971-981. 131. Sundseth R, Hansen U. Activation of RNA polymerase II transcription by the specific DNA-binding protein LSF. Increased rate of binding of the basal promoter factor TFIIB. J Biol Chem. 1992;267:7845-7855. 132. Imbalzano AN, Zaret KS, Kingston RE. Transcription factor (TF) IIB and TFIIA can independently increase the affinity of the TATA-binding protein for DNA. J Biol Chem. 1994;269:8280-8286. 133. Pinto I, Ware DE, Hampsey M. The yeast SUA7 gene encodes a homolog of human transcription factor TFIIB and is required for normal start site selection in vivo. Cell. 1992;68:977-988. 134. Garzon R, Marcucci G, Croce CM. Targeting microRNAs in cancer: rationale, strategies and challenges. Nat Rev Drug Discov;9:775-789. 135. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004;116:281-297. 136. Pelosi E, Labbaye C, Testa U. MicroRNAs in normal and malignant myelopoiesis. Leuk Res. 2009;33:1584-1593. 137. Lee RC, Feinbaum RL, Ambros V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 1993;75:843-854. 138. Wightman B, Ha I, Ruvkun G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 1993;75:855-862. 139. Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T. Identification of novel genes coding for small expressed RNAs. Science. 2001;294:853-858. 140. Wang CY, Chen YQ, Liu Q. Sculpting the meristem: the roles of miRNAs in plant stem cells. Biochem Biophys Res Commun;409:363-366. 141. Chawla G, Sokol NS. MicroRNAs in Drosophila development. Int Rev Cell Mol Biol;286:1-65. 142. Han J, Lee Y, Yeom KH, et al. Molecular basis for the recognition of primary microRNAs by the Drosha-DGCR8 complex. Cell. 2006;125:887-901. 143. Muljo SA, Kanellopoulou C, Aravind L. MicroRNA targeting in mammalian genomes: genes and mechanisms. Wiley Interdiscip Rev Syst Biol Med;2:148-161. 144. Song JJ, Smith SK, Hannon GJ, Joshua-Tor L. Crystal structure of Argonaute and its implications for RISC slicer activity. Science. 2004;305:1434-1437. 145. Yekta S, Shih IH, Bartel DP. MicroRNA-directed cleavage of HOXB8 mRNA. Science. 2004;304:594-596. 146. Wu L, Fan J, Belasco JG. MicroRNAs direct rapid deadenylation of mRNA. Proc Natl Acad Sci U S A. 2006;103:4034-4039.

155 147. Huntzinger E, Izaurralde E. Gene silencing by microRNAs: contributions of translational repression and mRNA decay. Nat Rev Genet;12:99-110. 148. Wang Y, Keys DN, Au-Young JK, Chen C. MicroRNAs in embryonic stem cells. J Cell Physiol. 2009;218:251-255. 149. Georgantas RW, 3rd, Hildreth R, Morisot S, et al. CD34+ hematopoietic stem- progenitor cell microRNA expression and function: a circuit diagram of differentiation control. Proc Natl Acad Sci U S A. 2007;104:2750-2755. 150. O'Connell RM, Rao DS, Chaudhuri AA, et al. Sustained expression of microRNA-155 in hematopoietic stem cells causes a myeloproliferative disorder. J Exp Med. 2008;205:585-594. 151. Liao R, Sun J, Zhang L, et al. MicroRNAs play a role in the development of human hematopoietic stem cells. J Cell Biochem. 2008;104:805-817. 152. Lu J, Guo S, Ebert BL, et al. MicroRNA-mediated control of cell fate in megakaryocyte-erythrocyte progenitors. Dev Cell. 2008;14:843-853. 153. Feng J, Iwama A, Satake M, Kohu K. MicroRNA-27 enhances differentiation of myeloblasts into granulocytes by post-transcriptionally downregulating Runx1. Br J Haematol. 2009;145:412-423. 154. Rosa A, Ballarino M, Sorrentino A, et al. The interplay between the master transcription factor PU.1 and miR-424 regulates human monocyte/macrophage differentiation. Proc Natl Acad Sci U S A. 2007;104:19849-19854. 155. Hackanson B, Bennett KL, Brena RM, et al. Epigenetic modification of CCAAT/enhancer binding protein alpha expression in acute myeloid leukemia. Cancer Res. 2008;68:3142-3151. 156. Jongen-Lavrencic M, Sun SM, Dijkstra MK, Valk PJ, Lowenberg B. MicroRNA expression profiling in relation to the genetic heterogeneity of acute myeloid leukemia. Blood. 2008;111:5078-5085. 157. Garzon R, Garofalo M, Martelli MP, et al. Distinctive microRNA signature of acute myeloid leukemia bearing cytoplasmic mutated nucleophosmin. Proc Natl Acad Sci U S A. 2008;105:3945-3950. 158. Kozomara A, Griffiths-Jones S. miRBase: integrating microRNA annotation and deep-sequencing data. Nucleic Acids Res;39:D152-157. 159. Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP, Bartel DP. MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007;27:91-105. 160. Krek A, Grun D, Poy MN, et al. Combinatorial microRNA target predictions. Nat Genet. 2005;37:495-500. 161. John B, Enright AJ, Aravin A, Tuschl T, Sander C, Marks DS. Human MicroRNA targets. PLoS Biol. 2004;2:e363. 162. Ramkissoon SH, Mainwaring LA, Ogasawara Y, et al. Hematopoietic-specific microRNA expression in human cells. Leuk Res. 2006;30:643-647. 163. Chen CZ, Li L, Lodish HF, Bartel DP. MicroRNAs modulate hematopoietic lineage differentiation. Science. 2004;303:83-86. 164. Havelange V, Garzon R. MicroRNAs: emerging key regulators of hematopoiesis. Am J Hematol;85:935-942.

156 165. Choong ML, Yang HH, McNiece I. MicroRNA expression profiling during human cord blood-derived CD34 cell erythropoiesis. Exp Hematol. 2007;35:551-564. 166. Lu J, Getz G, Miska EA, et al. MicroRNA expression profiles classify human cancers. Nature. 2005;435:834-838. 167. Shi B, Prisco M, Calin G, et al. Expression profiles of micro RNA in proliferating and differentiating 32D murine myeloid cells. J Cell Physiol. 2006;207:706-710. 168. Li X, Zhang J, Gao L, et al. MiR-181 mediates cell differentiation by interrupting the Lin28 and let-7 feedback circuit. Cell Death Differ. 169. Viswanathan SR, Powers JT, Einhorn W, et al. Lin28 promotes transformation and is associated with advanced human malignancies. Nat Genet. 2009;41:843-848. 170. Shi L, Cheng Z, Zhang J, et al. hsa-mir-181a and hsa-mir-181b function as tumor suppressors in human glioma cells. Brain Res. 2008;1236:185-193. 171. Chen G, Zhu W, Shi D, et al. MicroRNA-181a sensitizes human malignant glioma U87MG cells to radiation by targeting Bcl-2. Oncol Rep;23:997-1003. 172. Ouyang YB, Lu Y, Yue S, Giffard RG. miR-181 targets multiple Bcl-2 family members and influences apoptosis and mitochondrial function in astrocytes. Mitochondrion. 173. Kazenwadel J, Michael MZ, Harvey NL. Prox1 expression is negatively regulated by miR-181 in endothelial cells. Blood;116:2395-2401. 174. Naguibneva I, Ameyar-Zazoua M, Polesskaya A, et al. The microRNA miR-181 targets the homeobox protein Hox-A11 during mammalian myoblast differentiation. Nat Cell Biol. 2006;8:278-284. 175. Schnall-Levin M, Rissland OS, Johnston WK, Perrimon N, Bartel DP, Berger B. Unusually effective microRNA targeting within repeat-rich coding regions of mammalian mRNAs. Genome Res;21:1395-1403. 176. Huang S, Wu S, Ding J, et al. MicroRNA-181a modulates gene expression of zinc finger family members by directly targeting their coding regions. Nucleic Acids Res;38:7211-7218. 177. Marcucci G, Radmacher MD, Maharry K, et al. MicroRNA expression in cytogenetically normal acute myeloid leukemia. N Engl J Med. 2008;358:1919-1928. 178. Chen R, Alvero AB, Silasi DA, Mor G. Inflammation, cancer and chemoresistance: taking advantage of the toll-like receptor signaling pathway. Am J Reprod Immunol. 2007;57:93-107. 179. Wang AC, Su QB, Wu FX, Zhang XL, Liu PS. Role of TLR4 for paclitaxel chemotherapy in human epithelial ovarian cancer cells. Eur J Clin Invest. 2009;39:157- 164. 180. Rodriguez S, Chora A, Goumnerov B, et al. Dysfunctional expansion of hematopoietic stem cells and block of myeloid differentiation in lethal sepsis. Blood. 2009;114:4064-4076. 181. Palsson-McDermott EM, O'Neill LA. Signal transduction by the lipopolysaccharide receptor, Toll-like receptor-4. Immunology. 2004;113:153-162. 182. Simmons DL, Tan S, Tenen DG, Nicholson-Weller A, Seed B. Monocyte antigen CD14 is a phospholipid anchored membrane protein. Blood. 1989;73:284-289.

157 183. Wright SD, Ramos RA, Tobias PS, Ulevitch RJ, Mathison JC. CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS binding protein. Science. 1990;249:1431-1433. 184. Latz E, Visintin A, Lien E, et al. Lipopolysaccharide rapidly traffics to and from the Golgi apparatus with the toll-like receptor 4-MD-2-CD14 complex in a process that is distinct from the initiation of signal transduction. J Biol Chem. 2002;277:47834-47843. 185. Medzhitov R, Preston-Hurlburt P, Janeway CA, Jr. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature. 1997;388:394- 397. 186. Netea MG, van Deuren M, Kullberg BJ, Cavaillon JM, Van der Meer JW. Does the shape of lipid A determine the interaction of LPS with Toll-like receptors? Trends Immunol. 2002;23:135-139. 187. Oshiumi H, Sasai M, Shida K, Fujita T, Matsumoto M, Seya T. TIR-containing adapter molecule (TICAM)-2, a bridging adapter recruiting to toll-like receptor 4 TICAM-1 that induces interferon-beta. J Biol Chem. 2003;278:49751-49762. 188. Akira S, Takeda K. Toll-like receptor signalling. Nat Rev Immunol. 2004;4:499- 511. 189. Klein Klouwenberg P, Tan L, Werkman W, van Bleek GM, Coenjaerts F. The role of Toll-like receptors in regulating the immune response against respiratory syncytial virus. Crit Rev Immunol. 2009;29:531-550. 190. Kinlen L. Infections and immune factors in cancer: the role of epidemiology. Oncogene. 2004;23:6341-6348. 191. Schmitt A, Li L, Giannopoulos K, et al. Quantitative expression of Toll-like receptor-2, -4, and -9 in dendritic cells generated from blasts of patients with acute myeloid leukemia. Transfusion. 2008;48:861-870. 192. Karin M, Cao Y, Greten FR, Li ZW. NF-kappaB in cancer: from innocent bystander to major culprit. Nat Rev Cancer. 2002;2:301-310. 193. Maratheftis CI, Andreakos E, Moutsopoulos HM, Voulgarelis M. Toll-like receptor-4 is up-regulated in hematopoietic progenitor cells and contributes to increased apoptosis in myelodysplastic syndromes. Clin Cancer Res. 2007;13:1154-1160. 194. Beauchemin V, Villeneuve L, Rodriguez-Cimadevilla JC, et al. Interleukin-6 production by the blast cells of acute myeloblastic leukemia: regulation by endogenous interleukin-1 and biological implications. J Cell Physiol. 1991;148:353-361. 195. Lewis BP, Shih IH, Jones-Rhoades MW, Bartel DP, Burge CB. Prediction of mammalian microRNA targets. Cell. 2003;115:787-798. 196. Turzanski J, Grundy M, Russell NH, Pallis M. Interleukin-1beta maintains an apoptosis-resistant phenotype in the blast cells of acute myeloid leukaemia via multiple pathways. Leukemia. 2004;18:1662-1670. 197. Ting AY, Endy D. Signal transduction. Decoding NF-kappaB signaling. Science. 2002;298:1189-1190. 198. Guzman ML, Neering SJ, Upchurch D, et al. Nuclear factor-kappaB is constitutively activated in primitive human acute myelogenous leukemia cells. Blood. 2001;98:2301-2307.

158 199. Gatto G, Rossi A, Rossi D, Kroening S, Bonatti S, Mallardo M. Epstein-Barr virus latent membrane protein 1 trans-activates miR-155 transcription through the NF- kappaB pathway. Nucleic Acids Res. 2008;36:6608-6619. 200. Rahadiani N, Takakuwa T, Tresnasari K, Morii E, Aozasa K. Latent membrane protein-1 of Epstein-Barr virus induces the expression of B-cell integration cluster, a precursor form of microRNA-155, in B lymphoma cell lines. Biochem Biophys Res Commun. 2008;377:579-583. 201. Garzon R, Calin GA, Croce CM. MicroRNAs in Cancer. Annu Rev Med. 2009;60:167-179. 202. El Gazzar M, McCall CE. MicroRNAs distinguish translational from transcriptional silencing during endotoxin tolerance. J Biol Chem;285:20940-20951. 203. Rakoff-Nahoum S, Medzhitov R. Regulation of spontaneous intestinal tumorigenesis through the adaptor protein MyD88. Science. 2007;317:124-127. 204. Chen H, Li M, Campbell RA, et al. Interference with nuclear factor kappa B and c-Jun NH2-terminal kinase signaling by TRAF6C small interfering RNA inhibits myeloma cell proliferation and enhances apoptosis. Oncogene. 2006;25:6520-6527. 205. Starczynowski DT, Kuchenbauer F, Argiropoulos B, et al. Identification of miR- 145 and miR-146a as mediators of the 5q- syndrome phenotype. Nat Med;16:49-58. 206. Tageja N. Lenalidomide - current understanding of mechanistic properties. Anticancer Agents Med Chem;11:315-326. 207. Kotla V, Goel S, Nischal S, et al. Mechanism of action of lenalidomide in hematological malignancies. J Hematol Oncol. 2009;2:36. 208. Parman T, Wiley MJ, Wells PG. Free radical-mediated oxidative DNA damage in the mechanism of thalidomide teratogenicity. Nat Med. 1999;5:582-585. 209. Knobloch J, Ruther U. Shedding light on an old mystery: thalidomide suppresses survival pathways to induce limb defects. Cell Cycle. 2008;7:1121-1127. 210. Tweedie D, Frankola KA, Luo W, Li Y, Greig NH. Thalidomide Analogues Suppress Lipopolysaccharide-Induced Synthesis of TNF-alpha and Nitrite, an Intermediate of Nitric Oxide, in a Cellular Model of Inflammation. Open Biochem J;5:37-44. 211. Frankola KA, Greig NH, Luo W, Tweedie D. Targeting TNF-alpha to elucidate and ameliorate neuroinflammation in neurodegenerative diseases. CNS Neurol Disord Drug Targets;10:391-403. 212. Sampaio EP, Sarno EN, Galilly R, Cohn ZA, Kaplan G. Thalidomide selectively inhibits tumor necrosis factor alpha production by stimulated human monocytes. J Exp Med. 1991;173:699-703. 213. Zeldis JB, Knight R, Hussein M, Chopra R, Muller G. A review of the history, properties, and use of the immunomodulatory compound lenalidomide. Ann N Y Acad Sci;1222:76-82. 214. Muller GW, Chen R, Huang SY, et al. Amino-substituted thalidomide analogs: potent inhibitors of TNF-alpha production. Bioorg Med Chem Lett. 1999;9:1625-1630. 215. Schafer PH, Gandhi AK, Loveland MA, et al. Enhancement of cytokine production and AP-1 transcriptional activity in T cells by thalidomide-related immunomodulatory drugs. J Pharmacol Exp Ther. 2003;305:1222-1232.

159 216. Dredge K, Marriott JB, Macdonald CD, et al. Novel thalidomide analogues display anti-angiogenic activity independently of immunomodulatory effects. Br J Cancer. 2002;87:1166-1172. 217. Robak T. Application of new drugs in chronic lymphocytic leukemia. Mediterr J Hematol Infect Dis;2:e2010011. 218. Mitsiades N, Mitsiades CS, Poulaki V, Anderson KC, Treon SP. Intracellular regulation of tumor necrosis factor-related apoptosis-inducing ligand-induced apoptosis in human multiple myeloma cells. Blood. 2002;99:2162-2171. 219. Rajkumar SV, Jacobus S, Callander NS, et al. Lenalidomide plus high-dose dexamethasone versus lenalidomide plus low-dose dexamethasone as initial therapy for newly diagnosed multiple myeloma: an open-label randomised controlled trial. Lancet Oncol;11:29-37. 220. Raje N, Kumar S, Hideshima T, et al. Combination of the mTOR inhibitor rapamycin and CC-5013 has synergistic activity in multiple myeloma. Blood. 2004;104:4188-4193. 221. Pellagatti A, Jadersten M, Forsblom AM, et al. Lenalidomide inhibits the malignant clone and up-regulates the SPARC gene mapping to the commonly deleted region in 5q- syndrome patients. Proc Natl Acad Sci U S A. 2007;104:11406-11411. 222. Ebert BL, Galili N, Tamayo P, et al. An erythroid differentiation signature predicts response to lenalidomide in myelodysplastic syndrome. PLoS Med. 2008;5:e35. 223. Heaney ML, Golde DW. Myelodysplasia. N Engl J Med. 1999;340:1649-1660. 224. Ebert BL. Deletion 5q in myelodysplastic syndrome: a paradigm for the study of hemizygous deletions in cancer. Leukemia. 2009;23:1252-1256. 225. Verhelle D, Corral LG, Wong K, et al. Lenalidomide and CC-4047 inhibit the proliferation of malignant B cells while expanding normal CD34+ progenitor cells. Cancer Res. 2007;67:746-755. 226. DiMartino JF, Lacayo NJ, Varadi M, et al. Low or absent SPARC expression in acute myeloid leukemia with MLL rearrangements is associated with sensitivity to growth inhibition by exogenous SPARC protein. Leukemia. 2006;20:426-432. 227. List A, Dewald G, Bennett J, et al. Lenalidomide in the myelodysplastic syndrome with chromosome 5q deletion. N Engl J Med. 2006;355:1456-1465. 228. List A, Kurtin S, Roe DJ, et al. Efficacy of lenalidomide in myelodysplastic syndromes. N Engl J Med. 2005;352:549-557. 229. Nahid MA, Satoh M, Chan EK. MicroRNA in TLR signaling and endotoxin tolerance. Cell Mol Immunol;8:388-403. 230. Muller GW, Corral LG, Shire MG, et al. Structural modifications of thalidomide produce analogs with enhanced tumor necrosis factor inhibitory activity. J Med Chem. 1996;39:3238-3240. 231. Blum W, Klisovic RB, Becker H, et al. Dose escalation of lenalidomide in relapsed or refractory acute leukemias. J Clin Oncol;28:4919-4925. 232. Carlsen H, Moskaug JO, Fromm SH, Blomhoff R. In vivo imaging of NF-kappa B activity. J Immunol. 2002;168:1441-1446. 233. Sanborn SL, Gibbons J, Krishnamurthi S, et al. Phase I trial of docetaxel given every 3 weeks and daily lenalidomide in patients with advanced solid tumors. Invest New Drugs. 2009;27:453-460.

160 234. Tohnya TM, Ng SS, Dahut WL, et al. A phase I study of oral CC-5013 (lenalidomide, Revlimid), a thalidomide derivative, in patients with refractory metastatic cancer. Clin Prostate Cancer. 2004;2:241-243. 235. Dahut WL, Aragon-Ching JB, Woo S, et al. Phase I study of oral lenalidomide in patients with refractory metastatic cancer. J Clin Pharmacol. 2009;49:650-660. 236. Henry JY, Lu L, Adams M, et al. Lenalidomide enhances the anti-prostate cancer activity of docetaxel in vitro and in vivo. Prostate. 237. Wu L, Parton A, Lu L, Adams M, Schafer P, Bartlett JB. Lenalidomide enhances antibody-dependent cellular cytotoxicity of solid tumor cells in vitro: influence of host immune and tumor markers. Cancer Immunol Immunother;60:61-73. 238. Inoue S, Snowden RT, Dyer MJ, Cohen GM. CDDO induces apoptosis via the intrinsic pathway in lymphoid cells. Leukemia. 2004;18:948-952. 239. Pathan N, Marusawa H, Krajewska M, et al. TUCAN, an antiapoptotic caspase- associated recruitment domain family protein overexpressed in cancer. J Biol Chem. 2001;276:32220-32229. 240. Razmara M, Srinivasula SM, Wang L, et al. CARD-8 protein, a new CARD family member that regulates caspase-1 activation and apoptosis. J Biol Chem. 2002;277:13952-13958. 241. Damiano JS, Reed JC. CARD proteins as therapeutic targets in cancer. Curr Drug Targets. 2004;5:367-374. 242. Yamamoto M, Torigoe T, Kamiguchi K, et al. A novel isoform of TUCAN is overexpressed in human cancer tissues and suppresses both caspase-8- and caspase-9- mediated apoptosis. Cancer Res. 2005;65:8706-8714. 243. Rorth P, Szabo K, Texido G. The level of C/EBP protein is critical for cell migration during Drosophila oogenesis and is tightly controlled by regulated degradation. Mol Cell. 2000;6:23-30. 244. Keeshan K, Bailis W, Dedhia PH, et al. Transformation by Tribbles homolog 2 (Trib2) requires both the Trib2 kinase domain and COP1 binding. Blood;116:4948-4957. 245. Graux C. Biology of acute lymphoblastic leukemia (ALL): clinical and therapeutic relevance. Transfus Apher Sci;44:183-189. 246. Pui CH, Jeha S. New therapeutic strategies for the treatment of acute lymphoblastic leukaemia. Nat Rev Drug Discov. 2007;6:149-165. 247. Simone JV. History of the treatment of childhood ALL: a paradigm for cancer cure. Best Pract Res Clin Haematol. 2006;19:353-359. 248. Siegel R, Ward E, Brawley O, Jemal A. Cancer statistics, 2011: the impact of eliminating socioeconomic and racial disparities on premature cancer deaths. CA Cancer J Clin;61:212-236. 249. Pui CH, Robison LL, Look AT. Acute lymphoblastic leukaemia. Lancet. 2008;371:1030-1043. 250. Swensen AR, Ross JA, Severson RK, Pollock BH, Robison LL. The age peak in childhood acute lymphoblastic leukemia: exploring the potential relationship with socioeconomic status. Cancer. 1997;79:2045-2051. 251. McNeil DE, Cote TR, Clegg L, Mauer A. SEER update of incidence and trends in pediatric malignancies: acute lymphoblastic leukemia. Med Pediatr Oncol. 2002;39:554- 557; discussion 552-553.

161 252. Urayama KY, Ma X, Selvin S, et al. Early life exposure to infections and risk of childhood acute lymphoblastic leukemia. Int J Cancer;128:1632-1643. 253. Greaves M. Infection, immune responses and the aetiology of childhood leukaemia. Nat Rev Cancer. 2006;6:193-203. 254. Adelman AS, McLaughlin CC, Wu XC, Chen VW, Groves FD. Urbanisation and incidence of acute lymphocytic leukaemia among United States children aged 0-4. Br J Cancer. 2005;92:2084-2088. 255. Pui CH. Recent research advances in childhood acute lymphoblastic leukemia. J Formos Med Assoc;109:777-787. 256. Maitra A, McKenna RW, Weinberg AG, Schneider NR, Kroft SH. Precursor B- cell lymphoblastic lymphoma. A study of nine cases lacking blood and bone marrow involvement and review of the literature. Am J Clin Pathol. 2001;115:868-875. 257. Bennett JM, Catovsky D, Daniel MT, et al. The morphological classification of acute lymphoblastic leukaemia: concordance among observers and clinical correlations. Br J Haematol. 1981;47:553-561. 258. Miller DR, Leikin S, Albo V, Sather H, Hammond D. Prognostic importance of morphology (FAB classification) in childhood acute lymphoblastic leukaemia (ALL). Br J Haematol. 1981;48:199-206. 259. Kebriaei P, Anastasi J, Larson RA. Acute lymphoblastic leukaemia: diagnosis and classification. Best Pract Res Clin Haematol. 2002;15:597-621. 260. Lilleyman JS, Hann IM, Stevens RF, et al. Cytomorphology of childhood lymphoblastic leukaemia: a prospective study of 2000 patients. United Kingdom Medical Research Council's Working Party on Childhood Leukaemia. Br J Haematol. 1992;81:52- 57. 261. Lilleyman JS, Hann IM, Stevens RF. The clinical significance of blast cell morphology in childhood lymphoblastic leukaemia. Med Pediatr Oncol. 1986;14:144- 147. 262. Cheng Q, Yang W, Raimondi SC, Pui CH, Relling MV, Evans WE. Karyotypic abnormalities create discordance of germline genotype and cancer cell phenotypes. Nat Genet. 2005;37:878-882. 263. Pui CH, Crist WM, Look AT. Biology and clinical significance of cytogenetic abnormalities in childhood acute lymphoblastic leukemia. Blood. 1990;76:1449-1463. 264. Raimondi SC, Zhou Y, Mathew S, et al. Reassessment of the prognostic significance of hypodiploidy in pediatric patients with acute lymphoblastic leukemia. Cancer. 2003;98:2715-2722. 265. Harrison CJ, Moorman AV, Broadfield ZJ, et al. Three distinct subgroups of hypodiploidy in acute lymphoblastic leukaemia. Br J Haematol. 2004;125:552-559. 266. Pui CH, Campana D, Evans WE. Childhood acute lymphoblastic leukaemia-- current status and future perspectives. Lancet Oncol. 2001;2:597-607. 267. Moorman AV, Ensor HM, Richards SM, et al. Prognostic effect of chromosomal abnormalities in childhood B-cell precursor acute lymphoblastic leukaemia: results from the UK Medical Research Council ALL97/99 randomised trial. Lancet Oncol;11:429- 438. 268. Mullighan CG, Phillips LA, Su X, et al. Genomic analysis of the clonal origins of relapsed acute lymphoblastic leukemia. Science. 2008;322:1377-1380.

162 269. Armstrong SA, Look AT. Molecular genetics of acute lymphoblastic leukemia. J Clin Oncol. 2005;23:6306-6315. 270. Hong D, Gupta R, Ancliff P, et al. Initiating and cancer-propagating cells in TEL- AML1-associated childhood leukemia. Science. 2008;319:336-339. 271. Romana SP, Mauchauffe M, Le Coniat M, et al. The t(12;21) of acute lymphoblastic leukemia results in a tel-AML1 gene fusion. Blood. 1995;85:3662-3670. 272. Golub TR, Barker GF, Bohlander SK, et al. Fusion of the TEL gene on 12p13 to the AML1 gene on 21q22 in acute lymphoblastic leukemia. Proc Natl Acad Sci U S A. 1995;92:4917-4921. 273. Yamagata T, Maki K, Mitani K. Runx1/AML1 in normal and abnormal hematopoiesis. Int J Hematol. 2005;82:1-8. 274. Lutterbach B, Hiebert SW. Role of the transcription factor AML-1 in acute leukemia and hematopoietic differentiation. Gene. 2000;245:223-235. 275. Szczepanski T, Harrison CJ, van Dongen JJ. Genetic aberrations in paediatric acute leukaemias and implications for management of patients. Lancet Oncol;11:880- 889. 276. van Delft FW, Horsley S, Colman S, et al. Clonal origins of relapse in ETV6- RUNX1 acute lymphoblastic leukemia. Blood;117:6247-6254. 277. Andreasson P, Schwaller J, Anastasiadou E, Aster J, Gilliland DG. The expression of ETV6/CBFA2 (TEL/AML1) is not sufficient for the transformation of hematopoietic cell lines in vitro or the induction of hematologic disease in vivo. Cancer Genet Cytogenet. 2001;130:93-104. 278. Tsuzuki S, Seto M, Greaves M, Enver T. Modeling first-hit functions of the t(12;21) TEL-AML1 translocation in mice. Proc Natl Acad Sci U S A. 2004;101:8443- 8448. 279. Sabaawy HE, Azuma M, Embree LJ, Tsai HJ, Starost MF, Hickstein DD. TEL- AML1 transgenic zebrafish model of precursor B cell acute lymphoblastic leukemia. Proc Natl Acad Sci U S A. 2006;103:15166-15171. 280. Greaves MF, Maia AT, Wiemels JL, Ford AM. Leukemia in twins: lessons in natural history. Blood. 2003;102:2321-2333. 281. Maia AT, Ford AM, Jalali GR, et al. Molecular tracking of leukemogenesis in a triplet pregnancy. Blood. 2001;98:478-482. 282. Romana SP, Le Coniat M, Poirel H, Marynen P, Bernard O, Berger R. Deletion of the short arm of chromosome 12 is a secondary event in acute lymphoblastic leukemia with t(12;21). Leukemia. 1996;10:167-170. 283. Greaves MF, Wiemels J. Origins of chromosome translocations in childhood leukaemia. Nat Rev Cancer. 2003;3:639-649. 284. Fenrick R, Wang L, Nip J, et al. TEL, a putative tumor suppressor, modulates cell growth and cell morphology of ras-transformed cells while repressing the transcription of stromelysin-1. Mol Cell Biol. 2000;20:5828-5839. 285. Lopez RG, Carron C, Oury C, Gardellin P, Bernard O, Ghysdael J. TEL is a sequence-specific transcriptional repressor. J Biol Chem. 1999;274:30132-30138. 286. Raynaud S, Cave H, Baens M, et al. The 12;21 translocation involving TEL and deletion of the other TEL allele: two frequently associated alterations found in childhood acute lymphoblastic leukemia. Blood. 1996;87:2891-2899.

163 287. Bohlander SK. ETV6: a versatile player in leukemogenesis. Semin Cancer Biol. 2005;15:162-174. 288. Kobayashi H, Montgomery KT, Bohlander SK, et al. Fluorescence in situ hybridization mapping of translocations and deletions involving the short arm of human chromosome 12 in malignant hematologic diseases. Blood. 1994;84:3473-3482. 289. Wasylyk B, Hahn SL, Giovane A. The Ets family of transcription factors. Eur J Biochem. 1993;211:7-18. 290. Tran HH, Kim CA, Faham S, Siddall MC, Bowie JU. Native interface of the SAM domain polymer of TEL. BMC Struct Biol. 2002;2:5. 291. Kim CA, Phillips ML, Kim W, et al. Polymerization of the SAM domain of TEL in leukemogenesis and transcriptional repression. Embo J. 2001;20:4173-4182. 292. Kurokawa M. AML1/Runx1 as a versatile regulator of hematopoiesis: regulation of its function and a role in adult hematopoiesis. Int J Hematol. 2006;84:136-142. 293. Lenny N, Westendorf JJ, Hiebert SW. Transcriptional regulation during myelopoiesis. Mol Biol Rep. 1997;24:157-168. 294. Uchida H, Zhang J, Nimer SD. AML1A and AML1B can transactivate the human IL-3 promoter. J Immunol. 1997;158:2251-2258. 295. Hohaus S, Petrovick MS, Voso MT, Sun Z, Zhang DE, Tenen DG. PU.1 (Spi-1) and C/EBP alpha regulate expression of the granulocyte-macrophage colony-stimulating factor receptor alpha gene. Mol Cell Biol. 1995;15:5830-5845. 296. Wargnier A, Legros-Maida S, Bosselut R, et al. Identification of human granzyme B promoter regulatory elements interacting with activated T-cell-specific proteins: implication of Ikaros and CBF binding sites in promoter activation. Proc Natl Acad Sci U S A. 1995;92:6930-6934. 297. Giese K, Kingsley C, Kirshner JR, Grosschedl R. Assembly and function of a TCR alpha enhancer complex is dependent on LEF-1-induced DNA bending and multiple protein-protein interactions. Genes Dev. 1995;9:995-1008. 298. Bruhn L, Munnerlyn A, Grosschedl R. ALY, a context-dependent coactivator of LEF-1 and AML-1, is required for TCRalpha enhancer function. Genes Dev. 1997;11:640-653. 299. Reed-Inderbitzin E, Moreno-Miralles I, Vanden-Eynden SK, et al. RUNX1 associates with histone deacetylases and SUV39H1 to repress transcription. Oncogene. 2006;25:5777-5786. 300. Lutterbach B, Westendorf JJ, Linggi B, Isaac S, Seto E, Hiebert SW. A mechanism of repression by acute myeloid leukemia-1, the target of multiple chromosomal translocations in acute leukemia. J Biol Chem. 2000;275:651-656. 301. Imai Y, Kurokawa M, Tanaka K, et al. TLE, the human homolog of groucho, interacts with AML1 and acts as a repressor of AML1-induced transactivation. Biochem Biophys Res Commun. 1998;252:582-589. 302. Fraga MF, Berdasco M, Ballestar E, et al. Epigenetic inactivation of the Groucho homologue gene TLE1 in hematologic malignancies. Cancer Res. 2008;68:4116-4122. 303. Okuda T, van Deursen J, Hiebert SW, Grosveld G, Downing JR. AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis. Cell. 1996;84:321-330.

164 304. Ichikawa M, Asai T, Saito T, et al. AML-1 is required for megakaryocytic maturation and lymphocytic differentiation, but not for maintenance of hematopoietic stem cells in adult hematopoiesis. Nat Med. 2004;10:299-304. 305. Baens M, Peeters P, Guo C, Aerssens J, Marynen P. Genomic organization of TEL: the human ETS-variant gene 6. Genome Res. 1996;6:404-413. 306. van Dongen JJ, Macintyre EA, Gabert JA, et al. Standardized RT-PCR analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal residual disease. Report of the BIOMED-1 Concerted Action: investigation of minimal residual disease in acute leukemia. Leukemia. 1999;13:1901-1928. 307. Sawinska M, Ladon D. Mechanism, detection and clinical significance of the reciprocal translocation t(12;21)(p12;q22) in the children suffering from acute lymphoblastic leukaemia. Leuk Res. 2004;28:35-42. 308. Mian YA, Zeleznik-Le NJ. MicroRNAs in leukemias: emerging diagnostic tools and therapeutic targets. Curr Drug Targets;11:801-811. 309. Zanette DL, Rivadavia F, Molfetta GA, et al. miRNA expression profiles in chronic lymphocytic and acute lymphocytic leukemia. Braz J Med Biol Res. 2007;40:1435-1440. 310. Mi S, Lu J, Sun M, et al. MicroRNA expression signatures accurately discriminate acute lymphoblastic leukemia from acute myeloid leukemia. Proc Natl Acad Sci U S A. 2007;104:19971-19976. 311. Diakos C, Zhong S, Xiao Y, et al. TEL-AML1 regulation of survivin and apoptosis via miRNA-494 and miRNA-320a. Blood;116:4885-4893. 312. Gefen N, Binder V, Zaliova M, et al. Hsa-mir-125b-2 is highly expressed in childhood ETV6/RUNX1 (TEL/AML1) leukemias and confers survival advantage to growth inhibitory signals independent of p53. Leukemia;24:89-96. 313. Diakos C, Krapf G, Gerner C, et al. RNAi-mediated silencing of TEL/AML1 reveals a heat-shock protein- and survivin-dependent mechanism for survival. Blood. 2007;109:2607-2610. 314. Zaliova M, Madzo J, Cario G, Trka J. Revealing the role of TEL/AML1 for leukemic cell survival by RNAi-mediated silencing. Leukemia;25:313-320. 315. Pui CH, Evans WE. Treatment of acute lymphoblastic leukemia. N Engl J Med. 2006;354:166-178. 316. Silverman LB, Gelber RD, Dalton VK, et al. Improved outcome for children with acute lymphoblastic leukemia: results of Dana-Farber Consortium Protocol 91-01. Blood. 2001;97:1211-1218. 317. Wood LD, Irvin BJ, Nucifora G, Luce KS, Hiebert SW. Small ubiquitin-like modifier conjugation regulates nuclear export of TEL, a putative tumor suppressor. Proc Natl Acad Sci U S A. 2003;100:3257-3262. 318. Glimcher LH. XBP1: the last two decades. Ann Rheum Dis;69 Suppl 1:i67-71. 319. Reimold AM, Ponath PD, Li YS, et al. Transcription factor B cell lineage-specific activator protein regulates the gene for human X-box binding protein 1. J Exp Med. 1996;183:393-401. 320. Lacroix M, Leclercq G. About GATA3, HNF3A, and XBP1, three genes co- expressed with the oestrogen receptor-alpha gene (ESR1) in breast cancer. Mol Cell Endocrinol. 2004;219:1-7.

165

166