DOCSLIB.ORG

University of Groningen Matters of the Heart: Genetic and Molecular

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
University of Groningen Matters of the Heart: Genetic and Molecular University of Groningen Matters of the heart: genetic and molecular characterisation of cardiomyopathies Posafalvi, Anna IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Publisher's PDF, also known as Version of record Publication date: 2015 Link to publication in University of Groningen/UMCG research database Citation for published version (APA): Posafalvi, A. (2015). Matters of the heart: genetic and molecular characterisation of cardiomyopathies. University of Groningen. Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons). The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license. More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne- amendment. Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum. Download date: 29-09-2021 CHAPTER 3 EXOME SEQUENCING Chapter 3.1 Hunting for novel disease genes in autosomal dominant cardiomyopathies: elucidating a role for the sarcomeric pathway Rowida Almomani*, Anna Posafalvi*, Paul A van der Zwaag, Carlo L Marcelis, Bert Baars, Johanna C Herkert, Rudolf A de Boer, Karin Y van Spaendonck-Zwarts, Maarten P van den Berg, Richard J Sinke, J Peter van Tintelen§, Jan DH Jongbloed§ * The first two authors contributed equally § The last two authors contributed equally ABSTRACT We performed exome sequencing and a haplotype sharing test on a group of twelve families with autosomal dominant cardiomyopathy and no previous genetic diagnosis in order to identify potentially novel disease genes. Our approach resulted in the identification of the genetic cause of disease in 6/12 families. We found truncating variants in TTN in two dilated cardiomyopathy families, a frame-shift mutation in FLNC and a double missense mutation in FHL2 in two arrhythmogenic cardiomyopathy families, and missense variants in the COBL and STARD13 genes in two dilated cardiomyopathy families, respectively, both of which are genes that have not been related to cardiac pathology before. Thorough data-mining suggests a possible role for all of these genes in the disease mechanism of late onset cardiomyopathies. By creating a co-expression network of the five genes using an expression-array- based bioinformatics database and software created in the department, we show that 100 of the 166 proteins included in our network have been annotated with a potential function in cardiac development and physiology. Of these 100 proteins, 28 are known as disease genes in various types of cardiomyopathy, and a role in sarcomere assembly seems to be the common molecular pathway connecting a large proportion of these genes. INTRODUCTION Dilated cardiomyopathy (DCM) is a progressive heart disease mainly characterised by left ventricular dilatation and impaired cardiac contraction, while arrhythmogenic right ventricular cardiomyopathy (ARVC) is a common cause of sudden cardiac death because of its association with ventricular arrhythmias (Hershberger et al, Basso et al). Currently, there are more than 50 genes linked to the pathogenesis of familial DCM. In the pre-NGS era these genes could only explain up to 20% of Dutch DCM cases (25% in familial cases and 8% in sporadic cases) (van Spaendonck et al, 2013), while including screening of the titin (TTN) gene improved this to 45-50% (Wilde & Behr, Posafalvi et al, van Spaendonck et al 2014). Our gene-panel-based Next Generation Sequencing (NGS) method, which was recently implemented into routine DNA diagnostics, resulted in the identification of mutations and likely pathogenic variants in up to 55% of DCM index patients (see chapter 4.1). On the other hand, to date there are still ‘only’ 13 ARVC genes known (te Rijdt et al). One of these is the desmosomal plakophilin 2 gene (PKP2), and mutations in this gene are the most frequent cause of familial ARVC, occurring in up to 70% of the patients (van Tintelen et al). Until recently, the yield of attempts to identify genetic mutations in ARVC patient CHAPTER 3.1 cohorts via traditional sequencing was only ~50% (Cox et al, Quarta et al). In this study our aim was to identify the disease gene in families currently considered “unsolved” (without a known genetic factor potentially explaining the phenotype). For this purpose, we used exome sequencing (ES), i.e. sequen- cing of all protein-coding regions of the genome, to identify (potentially novel) disease genes in inherited cardiomyopathy patients/families. Since the inheritance pattern in the families studied was most likely to be autosomal dominant, and ES is well known to result in a huge number of heterozygous variants (potential mutations as well as benign variants), the data analysis was much more challenging than identifying the cause of the disease in a recessive form of the disease (such as in the rare cases of consanguinity). Hence, it was of special importance to narrow down the search for causal variants into chromosomal regions of particular interest. For this purpose, we combined ES with a haplotype sharing test (HST). HST has previously been shown to be a crucial step for successfully identifying regions carrying causative genes in cardiomyopathy families that are too small for classical linkage analysis (van der Zwaag et al). We applied HST as a filtering method during data analysis, and this helped us to prioritize the long list of genes containing heterozygous variants. AUTOSOMAL DOMINANT CARDIOMYOPATHIES 111 Using this combined approach of ES and HST, we succeeded in identifying the disease gene or putative disease gene in six out of our twelve families with autosomal dominant cardiomyopathies. We identified five potential disease genes, of which three were novel, one had occasionally been associated with cardiomyopathies, and one was the known cardiomyopathy gene TTN, which was not routinely screened for at that time due to its enormous size. MATERIALS AND METHODS Patients Families were selected because multiple affected members were available for HST analysis and because, in all cases, previous Sanger sequencing approaches and, in most cases, gene-panel-based NGS had not resulted in the identification of a pathogenic mutation or likely pathogenic variant. Eleven families were recruited from the cardiomyopathy cohort of the University Medical Center Groningen, the Netherlands, and one family was recruited from the University Medical Center Nijmegen, the Netherlands. The DCM patients were diagnosed according to established clinical criteria (Mestroni et al). One family had ARVC fulfilling the task force criteria (TFC) (Marcus et al), and one family had five family members with suspected ARVC, but not yet fulfilling all of those criteria. Our approach included (1) for most families, pre-screening of patients using gene-panel-based NGS targeting 55 known cardiomyopathy genes, and subsequent selection of candidate patients/families (some families were analysed using our gene-panel-based approach during the course of this study); (2) HST of all available affected family members and subsequent data analysis; (3) ES of at least two family members who are as distantly related as possible; (4) identification of probable disease regions and genes; (5) confirmation and co-segregation analysis; (6) mutational screening of probable disease genes in additional patients; and (7) co-expression network analysis to obtain supportive evidence of pathogenicity. Targeted sequencing DNA samples isolated from peripheral blood of patients were sequenced for 55 known cardiomyopathy disease genes as formerly described by Sikkema- Raddatz et al and Posafalvi et al (manuscript in preparation, see also chapter 4.1). Data analysis was performed using the MiSeq reporter program (Illumina, San 112 EXOME SEQUENCING Diego, CA, USA), Next Gene software (v2.2.1, Softgenetics, State College, PA, USA) and Cartagenia software (Cartagenia, Leuven, Belgium), as described (Sikkema-Raddatz et al, chapter 4.1). Haplotype sharing test To establish haplotypes and to identify possible shared haplotypes, single nucleotide polymorphism (SNP) genotyping of the DNA samples was performed using the Human 610-quad beadchip® 610K SNP array (Illumina) according to the manufacturer’s protocols. The data was analysed using Microsoft® Office Excel 2007 (Microsoft, Redmond, WA, USA) software as previously described by van der Zwaag et al. The longest shared haplotypes (LSH) identified were used for “ranking” candidate variants in the last step of the exome sequencing data analysis. In this step we assume that the longer a shared region is between affected family members, the higher the chance that it contains the mutual causative mutation. In the cases in which the mutation identified was not localised in the 1st LSH, we checked if those chromosomal regions which ranked better than the one carrying the mutation contained
Load more

Recommended publications
  • FLNC Missense Variants in Familial Noncompaction Cardiomyopathy
    Cardiogenetics 2019; volume 9:8181 FLNC missense variants than 2 according to current echocardio- in familial noncompaction graphic criteria, or 2.3 on CMR.1,2 Correspondence: Jaap I. van Waning, Approximately 10% of patients diagnosed Department of Clinical Genetics, EE 2038, cardiomyopathy with NCCM have concurrent congenital Erasmus MC, POB 2040, 3000CA Rotterdam, heart defects (CHD).3,4 the Netherlands. Tel.: +3107038388 - Fax: +3107043072. Jaap I. van Waning,1 In 30-40% of cases diagnosed with E-mail: [email protected] Yvonne M. Hoedemaekers,2 NCCM a pathogenic variant can be identi- 2,3 4 Wouter P. te Rijdt, Arne I. Jpma, fied. Around 80% of these pathogenic vari- Acknowledgements: JVW was supported by a Daphne Heijsman,4 Kadir Caliskan,5 ants involve the same sarcomere genes, that grant from the Jaap Schouten Foundation. Elke S. Hoendermis,6 are the major causes for hypertrophic car- WPTR was supported by a Young Talent Program (CVON PREDICT) grant 2017T001 Tineke P. Willems,7 diomyopathy (HCM) and dilated cardiomy- - Dutch Heart Foundation. 8 opathy (DCM), in particular MYH7, Arthur van den Wijngaard, 5,6 3 MYBPC3 and TTN. Filamin C (FLNC) Albert Suurmeijer, Conflict of interest: the authors declare no plays a central role in muscle functioning Marjon A. van Slegtenhorst,1 potential conflict of interest. by maintaining the structural integrity of the Jan D.H. Jongbloed,2 muscle fibers. Pathogenic variants in FLNC Received for publication: 20 March 2019. Danielle F. Majoor-Krakauer,1 2 were found to be associated with a wide Revision received: 29 July 2019. Paul A.
    [Show full text]
  • RNA Sequencing Reveals a Slow to Fast Muscle Fiber Type Transition After Olanzapine Infusion in Rats
    RESEARCH ARTICLE RNA Sequencing Reveals a Slow to Fast Muscle Fiber Type Transition after Olanzapine Infusion in Rats Christopher J. Lynch1*, Yuping Xu1, Andras Hajnal2, Anna C. Salzberg3, Yuka Imamura Kawasawa4,5,6 1 Department of Cellular and Molecular Physiology, College of Medicine, Penn State University, Hershey, Pennsylvania, 17033, United States of America, 2 Department of Neural and Behavioral Sciences, College of Medicine, Penn State University, Hershey, Pennsylvania, 17033, United States of America, 3 Department a11111 of Public Health Sciences, College of Medicine, Penn State University, Hershey, Pennsylvania, 17033, United States of America, 4 Department of Pharmacology, College of Medicine, Penn State University, Hershey, Pennsylvania, 17033, United States of America, 5 Department of Biochemistry and Molecular Biology, College of Medicine, Penn State University, Hershey, Pennsylvania, 17033, United States of America, 6 The Institute for Personalized Medicine, College of Medicine, Penn State University, Hershey, Pennsylvania, 17033, United States of America * [email protected] OPEN ACCESS Citation: Lynch CJ, Xu Y, Hajnal A, Salzberg AC, Kawasawa YI (2015) RNA Sequencing Reveals a Abstract Slow to Fast Muscle Fiber Type Transition after Olanzapine Infusion in Rats. PLoS ONE 10(4): Second generation antipsychotics (SGAs), like olanzapine, exhibit acute metabolic side ef- e0123966. doi:10.1371/journal.pone.0123966 fects leading to metabolic inflexibility, hyperglycemia, adiposity and diabetes. Understand- Academic Editor: Guillermo López Lluch, ing how SGAs affect the skeletal muscle transcriptome could elucidate approaches for Universidad Pablo de Olavide, Centro Andaluz de mitigating these side effects. Male Sprague-Dawley rats were infused intravenously with ve- Biología del Desarrollo-CSIC, SPAIN hicle or olanzapine for 24h using a dose leading to a mild hyperglycemia.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Brief Genetics Report Haplotype Structures and Large
    Brief Genetics Report Haplotype Structures and Large-Scale Association Testing of the 5؅ AMP-Activated Protein Kinase Genes PRKAA2, PRKAB1, and PRKAB2 With Type 2 Diabetes Maria W. Sun,1,2 Jennifer Y. Lee,1,2 Paul I.W. de Bakker,1,2,3 Noe¨l P. Burtt,2 Peter Almgren,4 Lennart Råstam,5 Tiinamaija Tuomi,6 Daniel Gaudet,7 Mark J. Daly,2,8 Joel N. Hirschhorn,2,3,9 David Altshuler,1,2,3,8,10 Leif Groop,4,6 and Jose C. Florez1,2,8,10 AMP-activated protein kinase (AMPK) is a key molecular plasma glucose, or insulin sensitivity. Several nominal asso- regulator of cellular metabolism, and its activity is induced ciations of variants in PRKAA2 and PRKAB1 with BMI appear by both metformin and thiazolidinedione antidiabetic med- to be consistent with statistical noise. Diabetes 55:849–855, ications. It has therefore been proposed both as a putative 2006 agent in the pathophysiology of type 2 diabetes and as a valid target for therapeutic intervention. Thus, the genes that encode the various AMPK subunits are intriguing ype 2 diabetes arises from the complex interplay candidates for the inherited basis of type 2 diabetes. We therefore set out to test for the association of common of various pathophysiologic mechanisms involv- variants in the genes that encode three selected AMPK ing peripheral insulin resistance and relative subunits with type 2 diabetes and related phenotypes. Of Tinsulin insufficiency. The final expression of the the seven genes that encode AMPK isoforms, we initially diabetic phenotype is strongly influenced by inheritance; chose PRKAA2, PRKAB1, and PRKAB2 because of their however, with the exception of rare monogenic forms of higher prior probability of association with type 2 diabetes, diabetes, common type 2 diabetes is thought to have a based on previous reports of genetic linkage, functional polygenic architecture (1).
    [Show full text]
  • Nebulette Is a Powerful Cytolinker Organizing Desmin and Actin in Mouse Hearts
    M BoC | ARTICLE Nebulette is a powerful cytolinker organizing desmin and actin in mouse hearts Daniel A. Hernandeza,†, Christina M. Bennetta,†, Lyubov Dunina-Barkovskayaa, Tatjana Wedigb, Yassemi Capetanakic, Harald Herrmannb,d, and Gloria M. Conovera,* aDepartment of Biochemistry & Biophysics, Texas A&M University, College Station, TX 77843-3474; bDivision of Molecular Genetics, German Cancer Research Center (DKFZ), D-69120 Heidelberg, Germany; cCenter of Basic Research, Biomedi- cal Research Foundation Academy of Athens, Athens 11527, Greece; dInstitute of Neuropathology, University Hospital Erlangen, D-91054 Erlangen, Germany ABSTRACT In the hearts of patients bearing nebulette mutations, a severe general disorgani- Monitoring Editor zation in cardiomyocytes of the extrasarcomeric desmin intermediate filament system is fre- Robert D. Goldman quently observed. However, the molecular and functional relationship between the desmin Northwestern University cytoskeleton and nebulette-containing sarcomeres is still unclear. Here we report a high-affinity Received: Apr 18, 2016 in vitro interaction between nebulette and desmin filaments. A major interaction site has been Revised: Aug 31, 2016 mapped to the desmin α-helical rod domain, indicating that the filament core is directly in- Accepted: Oct 5, 2016 volved in the binding of nebulette. The disease-mutant desmin variants E245D and T453I ex- hibited increased binding affinity for nebulette, delayed filament assembly kinetics, and caused significant weakening of networks. In isolated chick cardiomyocytes and sections from canine heart, we revealed by ground-state depletion and confocal microscopies that module 5 of nebulette extends outward from Z-disk–associated desmin filaments toward the center of the sarcomere. Accordingly, in the myocardium of Des−/− mice, elevated levels of cardiac actin cor- related with alterations in the distribution of nebulette.
    [Show full text]
  • Downloaded from NCBI Website [31]
    Int. J. Mol. Sci. 2014, 15, 21788-21802; doi:10.3390/ijms151221788 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Article Interactome Mapping Reveals Important Pathways in Skeletal Muscle Development of Pigs Jianhua Cao, Tinghua Huang, Xinyun Li and Shuhong Zhao * Key Laboratory of Agricultural Animal Genetics, Breeding and Reproduction of Ministry of Education of China, College of Animal Science and Technology, Huazhong Agricultural University, 1 Shizishan St., Wuhan 430070, China; E-Mails: [email protected] (J.C.); [email protected] (T.H.); [email protected] (X.L.) * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +86-27-8738-7480; Fax: +86-27-8728-0408. External Editor: Mark L. Richter Received: 15 July 2014; in revised form: 19 October 2014 / Accepted: 6 November 2014 / Published: 26 November 2014 Abstract: The regulatory relationship and connectivity among genes involved in myogenesis and hypertrophy of skeletal muscle in pigs still remain large challenges. Presentation of gene interactions is a potential way to understand the mechanisms of developmental events in skeletal muscle. In this study, genome-wide transcripts and miRNA profiling was determined for Landrace pigs at four time points using microarray chips. A comprehensive method integrating gene ontology annotation and interactome network mapping was conducted to analyze the biological patterns and interaction modules of muscle development events based on differentially expressed genes and miRNAs. Our results showed that in total 484 genes and 34 miRNAs were detected for the duration from embryonic stage to adult in pigs, which composed two linear expression patterns with consensus changes.
    [Show full text]
  • Assembly and Maintenance of Sarcomere Thin Filaments and Associated Diseases
    International Journal of Molecular Sciences Review Assembly and Maintenance of Sarcomere Thin Filaments and Associated Diseases Kendal Prill and John F. Dawson * Centre for Cardiovascular Investigations, Department of Molecular and Cellular Biology, University of Guelph, Guelph, ON N1G 2W1, Canada; [email protected] * Correspondence: [email protected] Received: 17 December 2019; Accepted: 12 January 2020; Published: 15 January 2020 Abstract: Sarcomere assembly and maintenance are essential physiological processes required for cardiac and skeletal muscle function and organism mobility. Over decades of research, components of the sarcomere and factors involved in the formation and maintenance of this contractile unit have been identified. Although we have a general understanding of sarcomere assembly and maintenance, much less is known about the development of the thin filaments and associated factors within the sarcomere. In the last decade, advancements in medical intervention and genome sequencing have uncovered patients with novel mutations in sarcomere thin filaments. Pairing this sequencing with reverse genetics and the ability to generate patient avatars in model organisms has begun to deepen our understanding of sarcomere thin filament development. In this review, we provide a summary of recent findings regarding sarcomere assembly, maintenance, and disease with respect to thin filaments, building on the previous knowledge in the field. We highlight debated and unknown areas within these processes to clearly define open research questions. Keywords: sarcomere assembly; sarcomere maintenance; sarcomere thin filaments; thin filament assembly; thin filament maintenance; thin filament turnover; actin turnover; chaperone; sarcomere; myopathy 1. Introduction Striated muscle requires the coordination of hundreds of proteins not only for cellular function but also for assembly of the contractile sarcomere units within the myofibril.
    [Show full text]
  • The Role of Z-Disc Proteins in Myopathy and Cardiomyopathy
    International Journal of Molecular Sciences Review The Role of Z-disc Proteins in Myopathy and Cardiomyopathy Kirsty Wadmore 1,†, Amar J. Azad 1,† and Katja Gehmlich 1,2,* 1 Institute of Cardiovascular Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham B15 2TT, UK; [email protected] (K.W.); [email protected] (A.J.A.) 2 Division of Cardiovascular Medicine, Radcliffe Department of Medicine and British Heart Foundation Centre of Research Excellence Oxford, University of Oxford, Oxford OX3 9DU, UK * Correspondence: [email protected]; Tel.: +44-121-414-8259 † These authors contributed equally. Abstract: The Z-disc acts as a protein-rich structure to tether thin filament in the contractile units, the sarcomeres, of striated muscle cells. Proteins found in the Z-disc are integral for maintaining the architecture of the sarcomere. They also enable it to function as a (bio-mechanical) signalling hub. Numerous proteins interact in the Z-disc to facilitate force transduction and intracellular signalling in both cardiac and skeletal muscle. This review will focus on six key Z-disc proteins: α-actinin 2, filamin C, myopalladin, myotilin, telethonin and Z-disc alternatively spliced PDZ-motif (ZASP), which have all been linked to myopathies and cardiomyopathies. We will summarise pathogenic variants identified in the six genes coding for these proteins and look at their involvement in myopathy and cardiomyopathy. Listing the Minor Allele Frequency (MAF) of these variants in the Genome Aggregation Database (GnomAD) version 3.1 will help to critically re-evaluate pathogenicity based on variant frequency in normal population cohorts.
    [Show full text]
  • Defining Functional Interactions During Biogenesis of Epithelial Junctions
    ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Inhibition of Β-Catenin Signaling Respecifies Anterior-Like Endothelium Into Beating Human Cardiomyocytes Nathan J
    © 2015. Published by The Company of Biologists Ltd | Development (2015) 142, 3198-3209 doi:10.1242/dev.117010 RESEARCH ARTICLE STEM CELLS AND REGENERATION Inhibition of β-catenin signaling respecifies anterior-like endothelium into beating human cardiomyocytes Nathan J. Palpant1,2,3,*, Lil Pabon1,2,3,*, Meredith Roberts2,3,4, Brandon Hadland5,6, Daniel Jones7, Christina Jones3,8,9, Randall T. Moon3,8,9, Walter L. Ruzzo7, Irwin Bernstein5,6, Ying Zheng2,3,4 and Charles E. Murry1,2,3,4,10,‡ ABSTRACT lineages. Anterior mesoderm (mid-streak) gives rise to cardiac and endocardial endothelium, whereas posterior mesoderm (posterior During vertebrate development, mesodermal fate choices are regulated streak) gives rise to the blood-forming endothelium and vasculature by interactions between morphogens such as activin/nodal, BMPs and (Murry and Keller, 2008). Wnt/β-catenin that define anterior-posterior patterning and specify Well-described anterior-posterior morphogen gradients, downstream derivatives including cardiomyocyte, endothelial and including those of activin A/nodal and BMP4, are thought to hematopoietic cells. We used human embryonic stem cells to explore pattern mesoderm subtypes (Nostro et al., 2008; Sumi et al., 2008; how these pathways control mesodermal fate choices in vitro. Varying Kattman et al., 2011). Such gradients are proposed to specify doses of activin A and BMP4 to mimic cytokine gradient polarization anterior mesodermal fates like cardiomyocytes versus posterior in the anterior-posterior axis of the embryo led to differential activity mesodermal fates like blood. Remarkably, a recent study showed of Wnt/β-catenin signaling and specified distinct anterior-like (high activin/ that ectopic induction of a nodal/BMP gradient in zebrafish embryos low BMP) and posterior-like (low activin/high BMP) mesodermal was sufficient to create an entirely new embryonic axis that could populations.
    [Show full text]
  • Communication Pathways in Human Nonmuscle Myosin-2C 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Authors: 25 Krishna Chinthalapudia,B,C,1, Sarah M
    1 Mechanistic Insights into the Active Site and Allosteric 2 Communication Pathways in Human Nonmuscle Myosin-2C 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Authors: 25 Krishna Chinthalapudia,b,c,1, Sarah M. Heisslera,d,1, Matthias Prellera,e, James R. Sellersd,2, and 26 Dietmar J. Mansteina,b,2 27 28 Author Affiliations 29 aInstitute for Biophysical Chemistry, OE4350 Hannover Medical School, 30625 Hannover, 30 Germany. 31 bDivision for Structural Biochemistry, OE8830, Hannover Medical School, 30625 Hannover, 32 Germany. 33 cCell Adhesion Laboratory, Department of Integrative Structural and Computational Biology, The 34 Scripps Research Institute, Jupiter, Florida 33458, USA. 35 dLaboratory of Molecular Physiology, NHLBI, National Institutes of Health, Bethesda, Maryland 36 20892, USA. 37 eCentre for Structural Systems Biology (CSSB), German Electron Synchrotron (DESY), 22607 38 Hamburg, Germany. 39 1K.C. and S.M.H. contributed equally to this work 40 2To whom correspondence may be addressed: E-mail: [email protected] or 41 [email protected] 42 43 1 44 Abstract 45 Despite a generic, highly conserved motor domain, ATP turnover kinetics and their activation by 46 F-actin vary greatly between myosin-2 isoforms. Here, we present a 2.25 Å crystal pre- 47 powerstroke state (ADPVO4) structure of the human nonmuscle myosin-2C motor domain, one 48 of the slowest myosins characterized. In combination with integrated mutagenesis, ensemble- 49 solution kinetics, and molecular dynamics simulation approaches, the structure reveals an 50 allosteric communication pathway that connects the distal end of the motor domain with the 51 active site.
    [Show full text]