Molecular characterization, differential movement and construction of
infectious cDNA clones of an Ohio isolate of Hosta virus X
Thesis
Presented in Partial Fulfillment of the Requirements for The Degree Master of Science in the Graduate School of The Ohio State University
By
Carola De La Torre Cuba, BSc.
The Ohio State University 2009
Thesis Committee: Dr. Dennis Lewandowski, Advisor Dr. Pierluigi Bonello Dr. Margaret G. Redinbaugh
Copyright by Carola De La Torre 2009 Abstract
Hostas (Hosta Tratt.) are the second most popular herbaceous perennial plant in the USA
with sales exceeding $32 million in 2008 (USDA Floriculture crops 2008 Summary, 2009).
Despite its relatively recent discovery in 1996, Hosta virus X (HVX) has already had a
significant economic impact on hosta growers and producers. HVX is easily mechanically
transmitted and can survive in the infected plants for years without showing symptoms. HVX
has been reported in many states including Ohio. Very little is known about HVX biology
with respect to diversity, symptom determinants and mechanisms of host resistance. The
objectives of this research were to 1) Screen for resistance against HVX in a number of hosta
cultivars, 2) Examine coat protein (CP) variability among Ohio isolates, 3) Molecular
characterize an Ohio HVX isolate and 4) Construct an infectious cDNA clone of HVX.
An Ohio HVX isolate, HVX-37, was selected for resistance screening, construction of
an infectious cDNA clone and phylogenetic comparisons. Local and long-distance movement
and accumulation of HVX-37 were determined for twenty-four hosta cultivars over three
growing seasons resulting in five types of responses. Four cultivars (H. sieboldiana
‘Elegans’, H. sieboldiana ‘Northern Exposure’, H. ‘Nightlife’ and H. ‘Olive Bailey
Langdon’) exhibited only infection of inoculated leaves. These cultivars are possible sources
of resistance for future breeding programs for resistance to HVX. The CP gene of ten Ohio
ii HVX isolates were found to be highly similar to all HVX isolates available in GenBank.
Molecular characterization of HVX-37 showed a typical potexvirus genome organization but with some intriguing differences between the replicase proteins of an isolate collected in
Korea (Accession No. AJ620114). Full-length cDNA clones of HVX-37 (pHVX) were constructed downstream of the T7 promoter sequence. In vitro RNA transcripts derived from pHVX were infectious to hostas and Nicotiana benthamiana Domin. plants, representing the first infectious clone for HVX.
iii
Dedicated to Rosa Postigo, my grandmother, and to all hosta lovers
iv Acknowledgements
I especially would like to thank my advisor, Dr. Dennis Lewandowski, whose guidance, excellent intellectual support and enthusiastic encouragement over the past two years made this thesis possible. I am also grateful for all his efforts in reviewing this text.
I am very grateful to my SAC Committee members, Dr. Peg Redinbaugh and Dr. Enrico Bonello for their useful inputs and accurate revision of this thesis.
I would like to thank Dr. Tea Meulia for all her help with the TEM and her helpful advice with the experiments. Thank you to Dr. J. Rob Fisher, Ohio Department of Agriculture, for kindly providing me with magnetic bead-conjugated anti-HVX antiserum.
I am very grateful to all my teachers in the Plant Pathology Department for giving me an excellent education and the firm basis that I will need to succeed in my career.
A special thank you to my lab partners: Mike Kelly (thank you for all the grinding and watering!), Chris Woltjen, Matt Wallhead, Jessica Schaffer, Amanda Hayes.
I am indebted to all my friends who have made Kottman Hall a very special place over these years: Nun, Gautam, Fiorella, Oscar, Chan Ho, Songbiao, Miguel, Anne Marie, Madge, Dr. Graham, Dr. Rhodes, Barry, Clara, Monica Lewandowski, Niqui, Ramona, Duan, Xenxi, Jinnan, Michelle.
Without any doubt, I would like to enormously thank my partner and best friend, Antonio Cabrera, for his invaluable help and for being there when I most needed.
Lastly, but very importantly, I wish to thank my parents Carlos and Amalia, my sister, Amanda, and my brother, Juan Pablo, who are a constant inspiration to me. Thank you for always being there for me every step of the way.
The research was supported in part by grants from the Ohio Plant Biotechnology Consortium and the OARDC SEEDS grant program.
v Vita
June 17th, 1982 …………………………………………….………Born – Lima, Peru
2005 …………………………………………………………....Bsc. Biology, Universidad
Nacional Agraria La Molina
2005 – 2007 …………………………………………………………...Research Assistant,
International Potato Center, Lima, Peru
2007 – present ………………………………………...Graduate Research Associate,
Department of Plant Pathology, OSU
Publications
De La Torre C, Lewandowski D. In vitro transcripts of a full-length cDNA clone of Hosta virus X are infectious to Hosta and Nicotiana benthamiana plants. 2009. Phytopathology 99:S27.
De La Torre C, Lewandowski D. Sequence comparisons between Hosta virus X (HVX) isolates and differential infection of hosta cultivars. 2008. Phytopathology 98:S45
Fields of Study
Major Field: Plant Pathology
vi Table of Contents
Abstract ………………………………………………………………………………...ii Dedication ………………………………………………………………………………..iv Acknowledgements ………………………………………………………………………...v Vita ………………………………………………………………………………………..vi List of Tables ………………………………………………………………………………..ix List of Figures ………………………………………………………………………………..xi
Chapter 1: Literature Review ………………………………………………………...1 Hosta ………………………………………………………………………...1 Hosta diversity ………………………………………………………...2 Pest and diseases of hosta ………………………………………………...3 Viral diseases of hostas ………………………………………………...5 Hosta virus X ………………………………………………………………...6
Chapter 2: Differential responses of hosta cultivars to Hosta virus X infection ...... 10 Introduction ………………………………………………………...... 10 Materials and methods ………………………………………...... 11 Preparation of inoculum ………………………………...... 12 Hosta cultivars ………………………………………...... 12 Inoculation of hosta cultivars …………………………...... 12 DAS-ELISA ………………………………………………...... 13 IC-RT-PCR ………………………………………………...... 14 Results ………………………………………………………...... 15 Discussion ………………………………………………………...... 17
Chapter 3: Sequence analysis of Hosta virus X isolates ………………………...... 32 Introduction ………………………………………………………...... 32 Materials and methods ………………………………………...... 35 Ohio HVX isolates ………………………………………...... 35 CP cDNA synthesis and RT-PCR amplification ………...... 35 Sequencing and assembly of CP consensus ………………...... 36 Multiple alignments of CP sequences ………...... 36 RT-PCR amplification of overlapping 5’ and 3’ terminal fragments of HVX-37 ……...………………………………………..37 Sequencing, assembly and annotation of the HVX-37 genome ...... 38
vii Results………..…………………………………………………….……….39 CP sequence comparisons of Ohio HVX isolates ..……………..39 CP sequence comparisons of all available HVX isolates……...... 40 HVX- 37 genome sequence analysis ………………………………40 Sequence comparison between HVX-37 and HVX-Kr……………..41 HVX replicase protein sequence comparison of HVX isolates with other potexviruses ……………………………………...... 42 Discussion ………………………………………………………………43
Chapter 4: In-vitro transcripts of full-length cDNA clones of Hosta virus X are infectious to hosta and Nicotiana benthamiana plants ………………………61 Introduction ………………………………………………………………61 Materials and methods ………………………………………………63 RNA extraction ………………………………………………63 cDNA synthesis ………………………………………………63 Long fusion PCR ………………………………………………65 Construction of pHVX ………………………………………65 In vitro transcription and plant inoculation ………………………67 DAS-ELISA ………………………………………………………68 IC-RT-PCR ………………………………………………………68 Plant-to-plant passage of in vitro RNA transcript-derived progeny 69 Sequencing of pHVX ………………………………………………69 Sequencing of progeny derived from pHVX ………………………70 Transmission electron microscopy ………………………………70 Results ………………………………………………………………………71 Construction of a full-length cDNA clone of HVX ………………71 Infectivity of transcripts derived from pHVX in hosta and N. benthamiana ……………………………………………....71 Sequence comparisons between pHVX and HVX-37 ………72 Sequence comparisons between progeny derived from pHVX and HVX-37 ………………………………………………………73 Discussion ………………………………………………………………73
References ………………………………………………………………………………85
viii List of Tables
Table 1.1. Potexvirus species isolated from ornamental hosts …………………….….9
Table 2.1. Infectivity and accumulation of HVX in inoculated and upper non-inoculated leaves of 24 different hosta cultivars and species. Type 1: Systemic infection both years; Type 2: Systemic infection second year only; Type 3:Localized infection year one and no systemic infection either year; Type 4:Systemic infection year one; no detectable infection year two; Type 5: No detectable infection year one; systemic infection year two ….…..……...... ….21
Table 2.2 Detection of HVX by DAS-ELISA of inoculated and upper non-inoculated leaves of individual hosta plants from cultivars classified as Type 1……....23
Table 2.3 Detection of HVX by DAS-ELISA of inoculated and upper non-inoculated leaves of individual hosta plants from cultivars classified as Type 2....……25
Table 2.4 Detection of HVX by DAS-ELISA of inoculated and upper non-inoculated leaves of individual hosta plants from cultivars classified as Type 3………27
Table 2.5 Detection of HVX by DAS-ELISA of inoculated and upper non-inoculated leaves of individual hosta plants from cultivars classified as Type 4…...….28
Table 2.6 Detection of HVX by DAS-ELISA of inoculated and upper non-inoculated leaves of individual hosta plants from cultivars classified as Type 5………29
Table 2.7 Detection of HVX by DAS-ELISA and IC-RT-PCR of individual hosta plants from Type 3, 4 and 5 cultivars………………...………………………...……..30
Table 3.1 HVX isolates used for CP sequence comparisons, location where plant was collected, cultivar name as indicated by the grower or researcher, symptoms of source plant and GenBank Accesion numbers……………………………………………………………47
Table 3.2. Sequences of primers used for RT-PCR and HVX-37 sequencing……………..48
ix Table 3.3. Percentage identities of the coat protein gene of HVX isolates collected from different locations. Multiple alignments were conducted using the Clustal W algorithm with an identity protein weight matrix. HVX isolates from: 1 Ohio (FJ403380-FJ403389); 2 Minnesota (AY181252); 3 Korea (AJ620114); 4 Poland (FJ821702, FJ821703, FJ821704, FJ821705) ……………………………..….……..51
Table 3.4. Nucleotide sequence comparison between HVX-37 and HVX-Kr …….…53
Table 3.5. Comparison between HVX-37 and HVX-Kr deduced protein products ……….55
Table 3.6. Replicase aa sequence comparison among HVX- 37, HVX-Kr and 32 other potexvirus species …….………………………………………………………………....58
Table 4.1. Sequences of primers used for in vitro synthesis of HVX-37 cDNA and IC-RT-PCR.…………………………………………………………………………….……76
Table 4.2. Infectivity of HVX-7 progeny passage from an RNA transcript- inoculated H. ‘None Lovelier’ to 22 hosta cultivars………………………....…….………...78
Table 4.3. Forward primers used for pHVX-7 sequencing …………………….….…...…79
Table 4.4. Reverse primers used for pHVX-7 sequencing ..………………………….…..80
Table 4.5. Infectivity of in vitro transcripts of five full-length HVX cDNA clones …….…81
x List of Figures
Fig. 3.1. Schematic diagram of amplicons used for sequencing of HVX-37. Black solid bars represent PCR products. Arrows indicate position of primers used for amplification ……………………………………………..………………………………..49
Fig. 3.2. RT-PCR amplification of the coat protein ORF of 10 HVX isolates collected in Ohio. M: 1 Kb marker, 1: HVX-1, 2: HVX-2, 3: HVX-11, 4: HVX-20, 5: HVX-25, 6: HVX-35. 7: HVX-36, 8: HVX-37, 9: HVX-38, 10: HVX-39 ……….……………………………………………………...50
Fig. 3.3. Cladogram of CP nt sequence of HVX isolates built by Neighbor-joining method, Jukes –Cantor genetic distance model, 1000 bootstrap replicates with Plantago asiatica mosaic virus (PlAMV) as outgroup. Values on branches show consensus support percentage …………………………………………………………..…………..52
Fig. 3.4. HVX-37 replicase protein sequence showing methyltransferase (MT), helicase (HEL) and RNA dependant RNA Polymerase (RdRp) motifs ..………..……………54
Fig. 3.5. Pairwise alignment between HVX-37 and HVX-Kr replicase showing the variable region between both sequences (orange arrow). Solid green bar = conserved sequences; Black line = mismatches; - = gaps………………….…………………………..56
Fig. 3.6. Pairwise alignment of HVX-37 and HVX-Kr replicase showing the near direct repeat duplication within the HVX-Kr genome (Orange arrow). Solid green bar = conserved sequences; Black line = mismatches; - = gaps ..……………..57
Fig. 3.7. Phylogenetic tree of the replicase aminoacid sequence of 32 potexvirus species construced by Neighbor-joining method, 1000 bootstrap replicates, 93776 seed, complete deletion of gaps, p-distance model. Hosta virus X isolate HVX-37, Hosta virus X isolate HVX-Kr, YP_002308464; Bamboo mosaic virus (BaMV), NP_042582; Potato virus X (PVX) CAA80774; Alstroemeria virus X (AlsVX), YP_319827; Foxtail mosaic virus (FoMV), NP_040988; Opuntia virus X (OVX), YP_054407; Schlumbergera virus X (SchVX),YP_002341559; Cactus virus X (CVX), NP_148778; Zygocactus virus X (ZyVX), YP_054402: Allium virus X (AVX), YP_002647027; Clover yellow mosaic virus (ClYMV), NP_077079; Alternanthera mosaic virus (AltMV), ACS28233; Papaya mosaic virus (PapMV), NP_044330; Hydrangea ringspot virus
xi (HdRSV), YP_224084; Cassava common mosaic virus (CsCMV), NP_042695; Tulip virus X (TVX), NP_702988; Nandina mosaic virus (NaMV), AAX19931; Plantago asiatica mosaic virus (PlAMV), NP_620836; Strawberry mild yellow edge virus (SMYEV), NP_620642; Potato aucuba mosaic virus (PAMV), NP_619745; Cymbidium mosaic virus (CymMV), NP_054025; Pepino mosaic virus (PepMV), ACJ74161; Lettuce virus X (LeVX), YP_001960940; Narcissus mosaic virus (NMV), AAP51012; Chenopodium mosaic virus X (CMVX), YP_667844; Scallium virus X (ScaVX), NP_570726; Asparagus virus 3 (AV-3), YP_001715612; Mint virus X (MVX), YP_224134; Phaius virus X (PhaVX), YP_001655010; Lillium virus X (LVX), YP_263303; White clover mosaic virus (WClMV), NP_620715; Nerine virus X (NVX), YP_446992; Shallot virus X (ShVX), NP_620648 (outgroup) ……………………………………..…………………………60
Fig. 4.1. Schematic diagram of amplicons used for construction a full-length cDNA clone. Black solid bars represent PCR products. Arrows indicate position of primers used for amplification………………………………………………….77
Fig. 4.2. Detection of HVX replicase internal region by IC-RT-PCR in pHVX transcript inoculated N. benthamiana plants 10 dpi. M. 1 Kb DNA ladder; HVX-1 (lane 1); HVX-3 (lane 2); HVX-4 (lane 3); HVX-5 (lane 4); HVX-6 (lane 5); HVX-7 (lane 6) ; m. mock; p.HVX-37 infected N. benthamiana……………………..……….....…82
Fig. 4.3. Electron micrograph of virions from systemically infected leaves of Hosta ‘None Lovelier’ plants inoculated with the parental isolate HVX-37 (A) or in vitro transcripts of pHVX-7 (B)………………………………………………………83
Fig. 4.4. HVX-7 induced symptoms in Hosta ‘None Lovelier’. A. Leaf from a systemically infected plant inoculated with transcripts from pHVX-7, showing crinkle symptoms. B. Leaf from a mock-inoculated plant. Photo was taken during the second growing season (10 months after inoculation)....…………….84
xii Chapter 1
Literature review
Hosta
Hostas (Hosta Tratt.), also called Plantain Lily or Funkia, remain one of the most
important and popular herbaceous ornamental genera, with a wholesale value in excess of
$32 million in 2008 (USDA Floriculture crops 2008 Summary, 2009). Hostas are native
to Japan, Korea and China and were first introduced into Europe in the late 1700’s and
into the U.S. by the mid-1800’s. Hostas are now grown in many U.S states including
Ohio, Minnesota, Michigan, Illinois, Tennessee, and Oregon.
Taxonomy of the genus Hosta is a controversial issue. Hosta was first classified
in the Liliaceae family (Baker, 1870) and this classification is still in use by the Flora of
North America, Flora of China and The Missouri Botanical Garden’s VAST. A second
classification, based both on molecular and morphological aspects placed hostas in the
family Hostaceae (Mathew, 1988). The family Hostaceae is recognized by the
International Plant Names Index and is still used by some authors but has not been widely
accepted. A third, more recently conducted study by the Angiosperm Phylogeny group,
based on analysis of 18S rDNA, rbcL and atpB sequences classified hostas in the
Agavaceae family (APG II, 2003).
1 All known Hosta species are diploid (2n = 60), with the exception of H. ventricosa and H. clausa var. clausa which are tetraploid and triploid, respectively
(Zonnevald and Iren, 2001).
The number of hosta species has been discussed by different researchers.
Maekawa (1940) recognized 38 species, based only on morphological characteristics, whereas Fujita (1976) recognized 22 species based upon morphological, geographical and ecological aspects. The latter is supported by more recent hosta classifications based on isozymes recognizing 22-25 species (Chung et al, 1991) and genome size and pollen viability that suggests 23 species (Zonneveld and Iren, 2001). Hostas have been grouped into three subgenera: Hosta (one species), Bryocles (nine species), and Giboshi (13 species) (Zonneveld and Iren, 2001).
Hosta diversity
More than 7,000 hosta cultivars have been recognized (Zilis, 2009). Cultivars vary in mound size, leaf and flower colors and shapes. Mound sizes range from less than 8”
(dwarf or miniature) to 36” height (giant). Leaf colors include light green, chartreuse, blue-green, bright gold and yellow and some cultivars have margin colors different from the predominant blade color. Leaf blade shapes include linear, elliptic, rotund, lanceolate, ovate, heart-shaped, and triangular. Flowers can be white, purple or lavender and one of six different shapes (funnel, open funnel, narrow funnel, bell, semi-bell and trumpet).
Hostas are propagated by seeds or vegetatively propagated by adventitious shoots.
New varieties are created every year as products of hybridization within species and between species and cultivars. Among the favorite female parents are H. ‘Aspen Gold’,
2 ‘Blue Moon’, ‘Dorset Blue’, ‘Fascination’, ‘Frances Williams’, H. sieboldiana ‘Elegans’,
H. montana ‘Aureomarginata’, H. plantaginea. Also, among the favorite pollen parents are H. ‘Blue Moon’, ‘Dorset Blue’, ‘Halcyon’ and H. plantaginea (Zilis, 2009).
Crosses between hostas are assisted by pollen carriers such as honeybees and bumblebees in the landscape. A successful pollination will produce brown seeds that are fully mature after 5 or 6 weeks, while pods remain green until September or October when they turn brown and the plants start dormancy. Viable seeds are brown and have a swelled region near one end containing the embryo. In contrast, an unfertilized ovary will turn yellow and will abscise within 4 days after the cross. Non-viable seeds are flat and all white or black and white.
The number of seeds produced and germination rate vary by type. For example,
H. plantaginea produces more seeds (ca. 80 per pod) with lower viability (37.5%) than H. sieboldiana ‘Elegans’ (ca. 34 seeds per pod with 100% variability) (Zilis, 2009). Hosta seeds have long term viability if conserved at 40°F in sealed plastic bags (Zilis, 2009).
Germination does not require a previous treatment, but a stratification process with vermiculite can improve it.
Pests and diseases of hostas
Although hostas are known for being pest and disease resistant, a number of pathogens can cause damage under favorable conditions. Antrachnose is the most important fungal disease of hostas and is caused by fungi in the genus Colletotrichum (Gleason et al.,
2009). Symptoms are large and irregular leaf spots and defoliation with an advanced infection. Cultural practices during production to minimize anthracnose include water
3 management, avoiding high temperatures and removal of infected leaves. Protectant fungicides including chlorothalonil, iprodione, mancozeb can minimize damage if applied before symptoms appear (Gleason et al., 2009). No resistance is known for this disease. One of the most susceptible species is H. tokudama. Other less common foliar diseases are caused by Cercospora, Botrytis and Phytophthora.
Petiole rot caused by Sclerotium rolfsii and S. delphinii can rapidly kill a hosta plant. These fungi, which are difficult to eradicate, prefer warm and rainy weather when the resting fungal structures, called sclerotia, became active and the mycelium start growing. Fungal enzymes degrade the petiole base and the leaves start wilting and collapse. Management requires careful inspection of stock material, looking for wilting leaves and presence of sclerotia. Pentachloronitrobenzene and flutolanil are recommended to manage this disease (Mueller et al., 2005).
Fusarium rot of hostas is mainly caused by Fusarium hostae. Fungal spores survive in the soil for long periods which make it difficult to eradicate this pathogen.
Symptoms are similar to petiole rot. Diseased plants produce less leaves and roots are generally stunted and become discolored in the center. For management of this disease, only vigorous healthy looking plants should be used and any plant that appears infected should be destroyed. Because the fungus enters through wounds, it is recommended to disinfest tools when pruning leaves and avoid unnecessary tissue damage. Fungicides recommended are products containing thiophanate-methyl, fludioxonil or azoxystrobin
(Mueller et al., 2005).
Among the pests that attack hostas are whiteflies, aphids, ants. Animals such as deer, mice and voles can devour an entire plant. Slugs and snails are attracted to hostas in
4 high humidity climates, chewing large holes in the leaves. Snail management requires a good cleaning of the area. Metaldehyde and methiocarb are recommended to control snails. These chemicals can be mixed with bran or other snail food, but are also available in a pelletized form. Salt is lethal to slugs but also toxic to hostas. Among the hostas more resistant to snail damage are H. ‘Sum and Substance’, H. ‘Gold Regal’, H.
‘Invincible’ (Grenfell, 1990).
Viral diseases of hostas
Viruses from several genera (Tospovirus, Nepovirus, Tobravirus and Potexvirus) have been found naturally infecting hostas (Lockhart and Currier, 1996). Other than the potexvirus Hosta virus X (HVX), which has no known vector, each of these viruses is known to have a biological vector. The tospoviruses Impatiens necrotic spot virus
(INSV) and Tomato spotted wilt virus (TSWV) are vectored by thrips, often by the
Western flower thrips (Frakliniella occidentalis) (Sakurai, 2004; Van de Wetering et al.,
1999). The nepoviruses Tobacco ringspot virus (TRSV), Tomato ringspot virus
(ToRSV), and Arabis mosaic virus (ArMV) and the tobravirus Tobacco rattle virus
(TRV) are vectored by nematodes (Brown et al., 1993).
INSV has been reported infecting hostas from several commercial greenhouses
(Lockhart and Currier, 1996), perhaps not surprising with the common occurrence of
INSV throughout the U.S. floriculture industry. TSWV-infected hostas have been reported in Florida, where this tospovirus is more prevalent within the vegetable and ornamental industries (Momol et al., 2003). Both viruses cause concentric ringspots of different sizes that can grow to form irregular shapes in advanced infections. Besides
5 transmission by thrips, tospoviruses can also be transmitted through vegetative propagation (Derks and Lemmers, 1997).
ToRSV and TRSV produce small to large chlorotic spots in hosta. These viruses have been occasionally found in mixed infections with HVX, which appears to reduce symptom severity (Lockhart and Currier, 1996). ToRSV and TRSV are transmitted by
Xiphinema americanum (Brunt et al., 1996; Rush, 1970). ArMV-infected hostas were first identified from several gardens in Minnesota (Lockhart, 2006). ArMV causes bleaching symptoms similar to those caused by ToRSV and TRSV.
TRV-infected hostas were first reported in 1996. Leaf necrosis has been
associated with TRV infection, but further studies are needed to confirm this (Lockhart,
1996).
Hosta virus X
HVX is the most economically important virus infecting hostas. First reported by Currier and Lockhart (1996), HVX-infected hostas have been found throughout the Midwestern
U.S., in Canada, The Netherlands and South Korea. Infected hostas can be asymptomatic or exhibit a wide range of symptoms including stunting, enations, leaf twisting, distortion, ringspots, necrosis, and/or death (Currier and Lockhart, 1996; Ryu et al., 2002;
Lewandowski, 2008). Symptom type and severity appear to depend on the hosta cultivar and may appear several months to years after inoculation (Blanchette and Lockhart,
2003). The length of time needed for symptom expression in some cultivars, coupled
with a wide variety of symptoms in a host with a wide range of horticultural characteristics, likely contributed to the spread of HVX.
6 In a three-year study conducted by Blanchette and Lockhart (2003), hosta
reactions to HVX were classified in five categories: very susceptible, moderately
susceptible, slightly susceptible, resistant and immune, based on virus detection by
enzyme-linked immunosorbent assay (ELISA) and immunosorbent electron microscopy
1-3 years post-inoculation. If all plants of the same cultivar tested positive the first year,
that cultivar was considered very susceptible. If most or half of the plants of the same
cultivar were positive for HVX by the end of the second year, the cultivar was considered moderately or slightly susceptible, respectively. If no plants tested positive by the end of
the second year, but some were positive the third year, the cultivar was considered
resistant. Finally, if no plant was positive by the end of the third year, it was considered
to be immune to HVX (Blanchette and Lockhart, 2003).
Hosta virus X is among the 14 potexvirus species recognized by the International
Committee of Taxonomy of Viruses isolated from ornamental hosts (Table 1.1). Some
potexviruses have been found to infect ornamental plants from several families. For
instance, Alternanthera mosaic virus-infected creeping phlox (Phlox stolonifera), trailing
portulaca (Portulaca grandiflora), snapdragon (Antirrhinum majus), sunflower
(Helianthus annuus), love-lies bleeding (Amaranthus caudatus) (Hammond et al, 2006),
and angelonia (Angelonia Angustifolia) (Lockhart and Daughtrey, 2008) have been
found. In contrast, HVX natural host range is restricted to hostas, although Nicotiana
benthamiana Domin. has been experimentally infected (Currier and Lockhart, 1996). An
additional 23 species (19 dicots and five monocots) in eight plant families tested as
experimental hosts were not susceptible to HVX (Currier and Lockhart, 1996; Ryu et al.,
2002).
7 The genome of one HVX isolate (HVX-Kr, AJ620114) has been completely
sequenced. Genome organization and sequence comparisons indicate that HVX is a distinct species in the genus Potexvirus (Park and Ryu, 2003). The HVX genome consists of one ca. 6.5 kb single-stranded RNA. The genome contains five open reading frames
encoding in order: the viral replicase protein, the so-called triple gene block (TGB)
proteins involved in movement (Verchot-Lubicz et al, 2007) and a coat protein (CP)
(Park and Ryu, 2003). The 3’-terminus of HVX-Kr consists of a 109 nt untranslated
region (UTR) followed by a variable length poly(A) tail (Park and Ryu, 2003).
8 Virus Host a Reference b Alternanthera mosaic virus Alternanthera pungens Geering and Thomas, 1999 Bamboo mosaic virus Bambusa multiplex Lin et al., 1977 Cactus virus X Ferocactus cylindraceus Attathom et al., 1978 Clover yellow mosaic virus Trifolium repens Johnson, 1942 Commelina virus X Commelina diffusa Stone, 1980 Cymbidium mosaic virus Cymbidium sp. Jensen, 1950 Daphne virus X Daphne cneorum Forster and Milne, 1978 Hosta virus X Hosta sp. Currier and Lockhart,1996 Hydrangea ringspot virus Hydrangea macrophylla Brierley, 1954 Lily virus X Lilium formosanum Stone, 1980 Narcissus mosaic virus Narcissus pseudonarcissus Brunt, 1966 Nerine virus X Nerine sarniensis Maat, 1976 Tulip virus X Tulipa sp. Mowat, 1982 White clover mosaic virus Trifolium repens Pierce, 1935 a Host of isolate b Reference to isolation report
Table 1.1. Potexvirus species isolated from ornamental hosts.
9 Chapter 2
Differential responses of hosta cultivars to Hosta virus X infection
Introduction
Hostas (Hosta Tratt.), family Agavaceae, an important component of the USA
ornamental market with a wholesale value in excess of $32 million in 2008 (USDA
Floriculture crops 2008 Summary, 2009) are widely cultivated for their diversity in leaf shape and color patterns, shade tolerance, resistance to pests and large number of named varieties (>7000). Hostas are native to Korea, Japan and China and were introduced in the
USA during the 18th century. Hostas are mainly propagated through adventitious shoots.
Hosta virus X (HVX), potexvirus, is the most important virus infecting hostas.
Described for first time in 1996 (Currier and Lockhart, 1996), this virus now is found widely spread in the U.S. It has also been found in Korea and Poland. Secondary spread resulting from incomplete information about this virus has undoubtedly affected propagators, retailers and consumers.
HVX has been introduced into a number of popular hosta cultivars. So far, more than 56 hosta cultivars have been found to be susceptible to this virus (Blanchette and
Lockhart, 2003; Lewandowski, 2008). HVX-infected hostas can be asymptomatic or show different symptoms including green spots, mottling, mosaic and leaf necrosis, which appears to vary by hosta cultivar.
10 Avoiding the sale and planting of infected hostas, and destroying infected plants can help to minimize the spread of HVX and the significant losses to growers. However, in locations were hostas are grown in large quantities, sanitation methods can not be as effective. For many years, the use of resistant cultivars has been an important tool for virus control. With respect to HVX, three Hosta cultivars (Color Glory, Blue Angel,
Frances Williams) are reported to be resistant to HVX. Nevertheless, because of the genetic diversity of hostas, it is likely that additional resistant species and/or varieties exist that may be useful for breeding programs.
The objective of this study was to screen 22 hosta cultivars for resistance to HVX.
We hypothesized that resistance to HVX could occur at the levels of replication, cell-to- cell movement and/or long-distance movement.
Materials and Methods
HVX isolate
A symptomatic H. ‘Sum and Substance’ plant submitted to the C. Wayne Ellett Plant anad Pest Diagnostic Clinic in 2006 that tested positive for HVX by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) using a commercially available reagent set (Agdia, Inc) was used as the source isolate for the host range experiments. The source plant of this isolate, designated HVX-37, was maintained in a greenhouse in Columbus, Ohio throughout this study.
11 Preparation of inoculum
Fresh HVX-37 infected H. ‘Sum and Substance’ leaves showing mosaic symptoms were
ground in inoculation buffer (10 mM sodium phosphate, pH 7.2 plus 1% celite) at 1:5
(wt/vol) and directly used for inoculation of hosta cultivars.
Hosta cultivars
We selected twenty-four different hosta cultivars (Table 2.1). We attempted to choose
cultivars that had different genetic backgrounds and morphological characteristics including leaf color (blue, green, or yellow), leaf pattern (presence or absence of white margins) and size (small, medium, or large). Most cultivars were hybrids, but we also included two species from Japan: H. montana and H. sieboldiana and one from China: H. plantaginea. No data were available for most cultivars with respect to resistance or susceptibility to HVX.
Inoculation of hosta cultivars
All cultivars were obtained from tissue culture liners derived from virus-indexed mother plants in June of 2007 (Q and Z Nursery, Inc., Rochelle, IL). There was variability in size and age when the plants arrived. Plants were transplanted to 5.5 inch pots in Metro-Mix
360 (Sun Gro Horticulture) and maintained in the greenhouse for two weeks until the roots were well developed. In mid-June, two to seven plants of twenty-two different cultivars were inoculated with HVX-37. Pots were randomly arranged prior inoculation.
As controls, the susceptible hosta cultivars ‘Patriot’ and ‘Sum and Substance’ were inoculated. The two youngest expanded leaves of each plant were rub-inoculated with
12 HVX-37 inoculum using a sterile cotton swab, after previously dusting the leaves with silicon carbide (wounding agent). Inoculated leaves were rinsed with water and inoculated plants were maintained in the greenhouse throughout this study. Plants were observed for the development of symptoms in inoculated and upper non-inoculated leaves.
DAS-ELISA
To determine if the inoculated plants had become infected with HVX, inoculated leaves and upper non-inoculated leaves were tested by DAS-ELISA at 28 and 56 dpi, respectively. Samples were taken from two inoculated leaves and two upper leaves. Each sample consisted of two half-leaves corresponding to two inoculated or upper young leaves, respectively. Samples were ground in 5 volumes of cold general extraction buffer
[GEB; 1.3 g sodium sulfite anhydrous, 20.0 g polyvinylpolypyrrolidone, 0.2 g sodium azide, 2.0 g powdered egg (chicken) albumin, 20.0 g Tween-20, per liter of distilled water, pH 7.4] and tested by DAS-ELISA using commercially available HVX reagent set
(Agdia, Inc).
Plants were maintained in the greenhouse during the winter; all surviving plants were re-sampled the following growing season (2008) and tested by DAS-ELISA. In
2009, leaves and roots of all cultivars that tested negative in 2008 were re-tested by DAS-
ELISA. Leaf samples consisted of a pool of half-leaves of two different leaves from the same plant. Root samples consisted of a pool of four roots from the same plant. Each root was divided in two parts: root tip (2 cm from the tip) and an proximal part (approximately
7 cm in length). Leaf and root samples were weighted and ground in 5 volumes of cold
13 GEB and processed separately. Leaf samples that tested negative by DAS-ELISA in 2009
were re-tested by immunocapture reverse-transcription polymerase chain reaction (IC-
RT-PCR).
IC-RT-PCR
One ml of sap was incubated with 20 µl of magnetic beads (sheep anti rabbit anti-Hosta
virus X antibodies). Magnetic beads were kindly provided by Dr. J. Rob Fisher (Ohio
Department of Agriculture). Tubes were incubated at room temperature for 2 hours with
gentle agitation and then were placed on a magnetic rack. Beads were washed with 1 ml
of PBS-S (0.1M Na2HPO4, 0.03M NaH2PO4, 50 g sucrose, per liter of distilled water, pH
7.4) , three times after transferring the sap to another tube. After the final wash, beads
were suspended in 500 μl of PBS-S. A reverse transcription cocktail, containing 4 μl 5X
Moloney Murine Leukemia Virus- Reverse Transcriptase (MMLV-RT) buffer, 2 μl 5
mM dNTPs, 0.5 μl random hexamers, 1 μl BSA (1 mg/ml), 1 μl DTT (0.1mM), 0.5 μl
RNAsin, and 1 μl MMLV-RT in a 20 μl reaction, was added to each tube containing the
beads. Tubes were incubated for 1 hour at 42°C and subsequently placed on a magnetic
rack. cDNA was transferred to a new 1.5 ml microcentrifuge tube. Two µl of cDNA were
amplified by PCR using primers within the replicase ORF H-16
(5’AACGCAATCATGCTCTTCCT) and H-17 (5’AAGTCCCACTGAGCTTTGACA) in
a 50 μl reaction containing 5 µl of 10X PCR buffer, 1 mM MgCl2, 20 pmol dNTPs, and 2
U of Taq DNA Polymerase (Promega Corp.). Samples were denatured for 2 min at 95°C
and subjected to 30 cycles (95°C, 30 sec; 50°C, 30 sec; 72°C, 1 min) followed by a final
5 min extension at 72°C. PCR products were analyzed in a 1% agarose 1X TAE (40 mM
14 Tris/Acetate, 1 mM EDTA, pH 8.0) gel and compared to a 1 to 10 kb DNA marker ladder
(Promega Corp).
Results
Infectivity of HVX
This study was conducted over a 24-month period. Plants were inoculated in June 2007 and analyzed during the 2007, 2008 and 2009 growing seasons. During the first year, local and systemic infection were evaluated by testing the inoculated and the new emergent leaves, respectively. Twenty-one cultivars out of the 24 inoculated cultivars tested positive for HVX in the inoculated leaves, but only ten became systemically infected within 56 dpi (Table 2.1). No symptoms were present in any of the plants that tested positive for HVX within 56 dpi. Unlike all of the other cultivars inoculated, none of the three H. plantaginea plants inoculated with HVX-37 tested positive for HVX in
2007. There was plant-to-plant variability within some cultivars with respect to whether inoculated or upper non-inoculated leaves were detectably infected in 2007 (Tables 2.2 -
2.6).
In 2008, all surviving plants were re-tested by DAS-ELISA to determine which cultivars had become systemically infected by HVX. The ten cultivars that were systemically infected in 2007 remained infected in 2008. Seven out of the eleven
cultivars that were only locally infected within the first 56 dpi had become systemically
infected by HVX (Table 2.1). However, the remaining four cultivars: H. ‘Olive Bailey
Langdon’, ‘Nightlife’, H. sieboldiana ‘Elegans’ and H. sieboldiana ‘Northern Exposure’
tested negative for HVX in the new emergent leaves. Also, one out of three H.
15 plantaginea plants was systemically infected by HVX in 2008, although none were
detectably infected in 2007.
Based on 2007 and 2008 data, cultivars were grouped into five types based upon
the pattern of HVX infection: Type 1 – Systemic infection both years; Type 2 – Systemic
infection second year only; Type 3 – Localized infection year one and no systemic
infection either year; Type 4 – Systemic infection year one; no detectable infection year
two; Type 5 – No detectable infection year one; systemic infection year two.
In 2009, Types 3, 4 and 5 cultivars were tested to determine if any of these plants
had become infected by HVX following delayed systemic accumulation. In this
experiment, both leaves and roots were tested. Consistent results were found for all plants tested (Table 2.7), i.e, if the leaves tested negative for HVX, the roots also tested negative. We found that leaves and roots of H. sieboldiana ‘Elegans’, H. ‘Olive Bailey
Langdon, H. Nightlife, H. sieboldiana ‘Northern Exposure’, H. Wily Willy and H. montana ‘Chodai Ginyo’ tested negative for HVX. Leaves and roots of the two H. plantaginea plants that were negative for HVX in 2007 and 2008 remained negative.
However, the H. plantaginea plant that tested positive for HVX in 2008 remained positive in 2009 and HVX was detected in both leaves and roots. One H. ‘Midnight Ride’ plant was used as a positive control. Leaves and roots of H. ‘Midnight Ride’ were positive for HVX. These results were confirmed by IC-RT-PCR using primers within the
HVX replicase gene.
16 Discussion
Based on this study, the infection and movement profiles of HVX have been defined for
24 Hosta species or cultivars. These cultivars were categorized into five types based upon
the ability to locally and/or systemically infect the plants over three growing seasons.
In addition to H. ‘Patriot’ and ‘Sum and Substance’, which are known to be
susceptible cultivars, eight additional tested cultivars had the Type 1 infection profile.
Plants in this group tested positive for HVX in the inoculated leaves within 28 dpi and
upper non-inoculated leaves within 56 dpi, indicating that HVX replicated and moved
systemically during the first growing season. The fact that each of these cultivars also
tested positive for HVX in 2008 indicated that a systemic infection had been established.
Unlike Type 1 cultivars, Type 2 cultivars showed a delay in the infection of the
upper non-inoculated leaves. Although, systemic infection was not confirmed until 2008,
we cannot exclude the possibility that HVX moved systemically in the first season
beyond 56 dpi. Some of HVX-positive plants had low levels of infection of inoculated
leaves. However, it is impossible to determine whether the delayed systemic movement was caused by a reduced level of infectivity, cell-to-cell or long distance movement, or
combination of these processes.
In contrast to Type 2 cultivars, the four Type 3 cultivars evaluated in this study
only tested positive for HVX in the inoculated leaves in 2007 and have never tested
positive for HVX in upper non-inoculated leaves (2007-2009). HVX-negative roots in
2009 suggest that HVX was incapable of entering or exiting the roots, thereby blocking systemic spread. Reduced cell-to-cell movement and/or failure to infect certain cell types
can prevent entry into the vascular system (Dawson and Hilf, 1992). Our results for H.
17 sieboldiana ‘Elegans’ are similar to the results found for Blanchette and Lockhart (2003), who found that no plant of their four HVX-inoculated H. sieboldiana ‘Elegans’ plants become infected during a three year period of evaluation. Blanchette and Lockhart categorized this cultivar as immune. In this study we have determined that H. sieboldiana ‘Elegans’ is not immune, because HVX was able to locally infect the inoculated leaves but not the upper non-inoculated leaves. From a practical standpoint, this may be a sufficient level of resistance to prevent HVX spread within or from this cultivar to other susceptible cultivars during propagation and handling.
All type 3 cultivars share a common H. sieboldiana ‘Elegans’ genetic background. Hosta cultivars ‘Northern Exposure’ and ‘Olive Bailey Langdon’ are sports of H. sieboldiana ‘Elegans’, whereas H. ‘Nightlife’ is a hybrid between H. sieboldiana
‘Elegans’ and H. ‘Invincible’. The significance of this result is that it suggests that H.
sieboldiana may be a source of resistance to HVX.
Type 4 included H. montana ‘Chodai Ginyo’ and H. ‘Wily Willy’, which were
characterized by detectable systemic HVX accumulation in the first growing season
(2007) but not in the two subsequent seasons. Even though no systemic infection was
detected in these cultivars in 2008 and 2009, it is not possible to rule out that these
cultivars might eventually become systemically infected in a subsequent growing season.
Because HVX had previously moved into upper non-inoculated leaves, it is possible that
there is a latent infection in the roots below the level of detection methods used in this
study. Alternatively, as only a portion of the root system was tested, it remains possible
that HVX is restricted to roots that were not tested.
18 Type 5 has one member, H. plantaginea, which tested negative for HVX in all leaves tested the first season. However, one out of three inoculated H. plantaginea plants tested positive in the next season. These results are consistent with the findings of
Blanchette and Lockhart (2003), who did not detect HVX until the second year after inoculation, and only in half of the plants tested.
Blanchette and Lockhart (2003) found that it is necessary to evaluate hosta cultivars over more than one growing season to determine if a cultivar eventually becomes systemically infected with HVX. In this study, we not only have looked at cultivar responses to HVX infection during three consecutive seasons, but we have also looked at shorter times post-inoculation in an attempt to define more subtle differences between cultivars. Our approach had made it possible to distinguish among cultivars that became systemically infected within 56 dpi (Types 1 and 4) and cultivars that need a longer time to become systemically infected (Types 2 and 5). Interestingly, this study found four cultivars (Type 3) that were not systemically infected within three growing seasons.
Based on this study, Type 3 cultivars offer the greatest potential as sources of resistance for breeding programs for several reasons. First, all Type 3 cultivars in this study have a common genetic background (H. sieboldiana ‘Elegans’), suggesting that the inability of HVX to move long distances and accumulate in upper non-inoculated leaves is a genetically heritable trait. Second, the type of resistance observed in these cultivars is probably monogenic, as most reported cases of resistance to long-distance movement have been reported as monogenic. For instance, the resistance genes RTM1 and RTM2 have been reported as responsible for movement restriction of Tobacco etch virus in
19 Arabidopsis thaliana (Mahajan et al., 1998). The gene Rsv4 has been shown to restrict cell-to-cell and long distance movement of Soybean mosaic virus in soybean (Gunduz et al., 2004). Monogenic resistance can be easily transferred to susceptible cultivars and fixed into the hosta progeny by vegetative propagation. Third, H. sieboldiana ‘Elegans’ is a favorite cultivar for hybridization (Zilis, 2009), thus it can be crossed with susceptible species and cultivars for further studies on the mode of resistance inheritance.
Analysis of the many named cultivars resulting from crosses with H. sieboldiana
‘Elegans’ may help to elucidate whether this is a dominant trait. Furthermore, screening of other H. sieboldiana cultivars for Type 3 HVX infection phenotype is also warranted to determine if this is a trait present in this hosta species. Because most cultivars present plant to plant variability, it is recommended that future studies include more than three plants per cultivar. Further studies including the use of advanced tools such as an HVX infectious clone tagged with GFP may help to conduct a more in-depth study of the resistance mechanism in the Type 3 cultivars.
20
2007 2008 Cultivar or species Totala Ib Ub Totalc Ub Type 1 H. ‘Dorset Blue’ 4 3 2 4 1 H. ‘Hidden Cove’ 5 5 3 1 1 H. ‘Jaz’ 3 2 1 2 2 H. ‘None Lovelier’ 4 3 2 2 2 H. ‘Patriot’ 3 3 3 3 3 H. ‘Pineapple Upside Down Cake’ 5 3 3 3 1 H. ‘Spartan Glory’ 3 2 1 2 2 H. ‘Sugar and Spice’ 2 2 1 2 2 H. ‘Sum and Substance’ 3 2 1 2 1 H. ‘Twilight Time’ 4 2 3 4 4 Type 2 H. ‘Baby Bunting’ 3 3 0 3 1 H. ‘Halcyon’ 6 2 0 6 1 H. ‘Kufikurin Hyuga’ 5 3 0 3 3 H. ‘Midnight Ride’ 3 3 0 2 2 H. montana ‘Fujibotan’ 3 1 0 3 3 H. ‘Serendipity’ 3 2 0 2 2 H. ‘Whiskey Sour’ 3 2 0 3 2 a Number of plants tested b Number of HVX positive plants based on DAS-ELISA c Number of surviving plants I: inoculated leaves U: upper non-inoculated leaves or new season leaves
Table 2.1. Infectivity and accumulation of HVX in inoculated and upper non-inoculated leaves of 24 different hosta cultivars and species. Type 1 – Systemic infection both years; Type 2 – Systemic infection second year only; Type 3 – Localized infection year one and no systemic infection either year; Type 4 – Systemic infection year one; no detectable infection year two; Type 5 – No detectable infection year one; systemic infection year two.
Continued on next page
21
Table 2.1 continued
2007 2008
Cultivar or species Totala Ib Ub Totalc Ub Type 3
H. ‘Nightlife’ 7 2 0 7 0 H. ‘Olive Bailey Langdon’ 4 1 0 3 0
H. sieboldiana ‘Elegans’ 3 2 0 3 0
H. sieboldiana ‘Northern 3 1 0 2 0 Exposure’ Type 4
H. montana ‘Chodai Ginyo’ 3 0 1 3 0
H. ‘Wily Willy’ 3 0 2 3 0 Type 5
H. plantaginea 3 0 0 3 1
22
2007 2008 Cultivar or species I U U H. 'Dorset Blue' 0.962a 0.026 -b H. 'Dorset Blue' 0.576 0.522 1.396 H. 'Dorset Blue' 0.086 - - H. 'Dorset Blue' - - - H. 'Hidden Cove' 1.237 0.802 2.454 H. 'Hidden Cove' 1.212 0.692 ntc H. 'Hidden Cove' 1.344 - nt H. 'Hidden Cove' 1.277 0.912 nt H. 'Hidden Cove' 0.111 - nt H. 'Jaz' - - nt H. 'Jaz' 2.031 - 2.301 H. 'Jaz' 1.244 2.135 2.346 H. 'None Lovelier' 2.026 - 2.457 H. 'None Lovelier' 1.152 0.051 2.056 H. 'None Lovelier' - - nt H. 'None Lovelier' 1.166 0.662 nt H. 'Patriot' 2.117 2.251 2.473 H. 'Patriot' 1.908 1.95 2.117 H. 'Patriot' 0.104 1.865 2.055 a DAS-ELISA OD405 values have been corrected by subtracting twice the average of OD405 background value b HVX negative test, DAS-ELISA OD405 < 0 after substracting twice OD405 background value (healthy plant control). OD405 average background values were: 0.069 (for inoculated leaves in 2007); 0.066 (for upper non-inoculated leaves in 2007) and 0.079 in 2008 c not tested I: inoculated leaves U: upper non-inoculated leaves or new season leaves
Table 2.2. Detection of HVX by DAS-ELISA of inoculated and upper non-inoculated leaves of individual hosta plants from cultivars classified as Type 1.
Continued on next page
23 Table 2.2 continued
2007 2008 Cultivar or species I U U H. 'Pineapple Upside Down Cake' 1.24 0.051 - H. ‘Pineapple Upside Down Cake' 1.294 0.078 nt H. 'Pineapple Upside Down Cake' 1.019 0.672 1.644 H. 'Pineapple Upside Down Cake' - - - H. 'Pineapple Upside Down Cake' - - nt H. 'Spartan Glory' - - nt H. 'Spartan Glory' 0.066 - 0.244 H. 'Spartan Glory' 0.094 0.03 1.508 H. 'Sugar and Spice' 0.673 0.301 1.632 H. 'Sugar and Spice' 0.81 - 0.048 H. 'Sum and Substance' 0.139 - nt H. 'Sum and Substance' 0.126 0.273 2.499 H. 'Sum and Substance' - - - H. 'Twilight Time' 1.038 0.708 1.482 H. 'Twilight Time' - - 0.705 H. 'Twilight Time' 1.319 0.397 1.552 H. 'Twilight Time' - 0.006 1.74
24
2007 2008 Cultivar or species I U U H. 'Baby Bunting' 0.843a -b 2.313 H. 'Baby Bunting' 0.018 - - H. 'Baby Bunting' 0.461 - - H. 'Halcyon' - - - H. 'Halcyon' 0.062 - 1.581 H. 'Halcyon' - - - H. 'Halcyon' - - - H. 'Halcyon' - - - H. 'Halcyon' 1.077 - - H. 'Kifukurin Hyuga' 1.177 - 2.123 H. 'Kifukurin Hyuga' 0.368 - 1.589 H. 'Kifukurin Hyuga' - - ntc H. 'Kifukurin Hyuga' - - nt H. 'Kifukurin Hyuga' 0.096 - 1.975 H. 'Midnight Ride' 0.009 - nt H. 'Midnight Ride' 0.155 - 1.682 H. 'Midnight Ride' 0.245 - 1.889 H. 'Serendepity' - - nt H. 'Serendepity' 0.862 - 2.211 H. 'Serendepity' 0.865 - 0.168 a DAS-ELISA OD405 values have been corrected by subtracting twice the average of OD405 background value; b HVX negative test, DAS-ELISA OD405 < 0 after substracting twice OD405 background value (healthy plant control). OD405 average background values were: 0.069 (for inoculated leaves in 2007); 0.066 (for upper non-inoculated leaves in 2007) and 0.079 in 2008 c not tested I: inoculated leaves U: upper non-inoculated leaves or new season leaves
Table 2.3 Detection of HVX by DAS-ELISA of inoculated and upper non-inoculated leaves of individual hosta plants from cultivars classified as Type 2.
Continued on next page
25 Table 2.3 continued
2007 2008
Cultivar or species I U U
H. montana 'Fujibotan' 0.277 - 2.103 H. montana 'Fujibotan' - - 2.325 H. montana 'Fujibotan' - - 2.151
H. 'Whiskey Sour' 0.299 - 2.441 H. 'Whiskey Sour' - - - H. 'Whiskey Sour' 0.075 - 2.152
26
2007 2008 Cultivar or species I U U H. 'Nightlife' - a - - H. 'Nightlife' 0.146 b - - H. 'Nightlife' - - - H. 'Nightlife' - - - H. 'Nightlife' - - - H. 'Nightlife' - - - H. 'Nightlife' 0.108 - - H. 'Olive Bailey Langdon' 0.063 - - H. 'Olive Bailey Langdon' - - ntc H. 'Olive Bailey Langdon' - - - H. 'Olive Bailey Langdon' - - - H. sieboldiana 'Elegans' 0.391 - - H. sieboldiana 'Elegans' - - - H. sieboldiana 'Elegans' 0.032 - - H. sieboldiana 'Northern Exposure' - - - H. sieboldiana 'Northern Exposure' 0.03 - - H. sieboldiana 'Northern Exposure' - - - a HVX negative test, DAS-ELISA OD405 < 0 after substracting twice OD405 background value (healthy plant control). OD405 average background values were: 0.069 (for inoculated leaves in 2007); 0.066 (for upper non-inoculated leaves in 2007) and 0.079 in 2008 b DAS-ELISA OD405 values have been corrected by subtracting twice the average of OD405 background value c not tested I: inoculated leaves U: upper non-inoculated leaves or new season leaves
Table 2.4 Detection of HVX by DAS-ELISA of inoculated and upper non-inoculated leaves of individual hosta plants from cultivars classified as Type 3.
27
2007 2008 Cultivar or species I U U
a H. 'Willy Willy' - - - H. 'Willy Willy' - 0.156 b -
H. 'Willy Willy' - 1.719 -
H. montana 'Chodai Ginyo' - - - H. montana 'Chodai Ginyo' - 0.066 - H. montana 'Chodai Ginyo' - - - a HVX negative test, DAS-ELISA OD405 < 0 after substracting twice OD405 background value (healthy plant control). OD405 average background values were: 0.069 (for inoculated leaves in 2007); 0.066 (for upper non-inoculated leaves in 2007) and 0.079 in 2008 b DAS-ELISA OD405 values have been corrected by subtracting twice the average of OD405 background value I: inoculated leaves U: upper non-inoculated leaves or new season leaves
Table 2.5. Detection of HVX by DAS-ELISA of inoculated and upper non-inoculated leaves of individual hosta plants from cultivars classified as Type 4.
28
2007 2008 Species I U U H. plantaginea - a - -
H. plantaginea - - 0.457 b
H. plantaginea - - - a HVX negative test, DAS-ELISA OD405 < 0 after substracting twice OD405 background value (healthy plant control). OD405 average background values were: 0.069 (for inoculated leaves in 2007); 0.066 (for upper non-inoculated leaves in 2007) and 0.079 in 2008 b DAS-ELISA OD405 values have been corrected by subtracting twice the average of OD405 background value I: inoculated leaves U: upper non-inoculated leaves or new season leaves
Table 2.6. Detection of HVX by DAS-ELISA of inoculated and upper non-inoculated leaves of individual hosta plants from cultivars classified as Type 5.
29
DAS-ELISA IC-RT-PCR
2007 2008 2009 2009
Cultivar or species I U U U Roots U
TIPa UPPERb H. ’Nightlife’ -c ------
H. ’Nightlife’ 0.146d ------H. ’Nightlife’ ------H. ’Nightlife’ ------H. ’Nightlife’ ------H. ’Nightlife’ ------H. ’Nightlife’ 0.108 ------H. ‘Olive Bailey Langdon’ ------H. ‘Olive Bailey Langdon’ ------H. sieboldiana 'Elegans' 0.391 ------H.sieboldiana 'Elegans' 0.032 ------H. sieboldiana 'Northern Exposure’ ------H. sieboldiana 'Northern Exposure' 0.03 ------H. ‘Wily Willy’ - 0.156 - - - - - H. ‘Wily Willy’ - 1.719 - - - - - H. ‘Wily Willy’ ------a Root tip (2 cm from the tip) b Root proximal part (approximately 7 cm in length) c HVX negative test, DAS-ELISA OD405 < 0 after substracting twice OD405 background value (healthy plant control). OD405 average background values were: 0.069 (for inoculated leaves in 2007) 0.066 (for upper non-inoculated leaves in 2007); 0.079 in 2008; and 0.1085 in 2009 d DAS-ELISA OD405 values represent original values have been corrected by subtracting twice the average of OD405 background value I: inoculated leaves U: upper non-inoculated leaves or new season leaves
Table 2.7. Detection of HVX by DAS-ELISA and IC-RT-PCR of individual hosta plants from Type 3, 4 and 5 cultivars.
Continued on next page
30 Table 2.7 continued
DAS-ELISA IC-RT- PCR
2007 2008 2009 2009 Cultivar or species I U U U Roots U TIP UPPER
H. montana ‘Chodai Ginyo’ ------H. montana ‘Chodai Ginyo’ - 0.066 - - - - - H. montana ‘Chodai Ginyo’ ------H. ‘Midnight Ride’ 0.245 - 1.7415 1.2915 >3.5 >3.5 + H. plantaginea ------H. plantaginea - - 0.457 >3.5 2.7165 >3.5 + H. plantaginea ------
31
Chapter 3
Sequence analysis of Hosta virus X isolates
Introduction
The genus Potexvirus, within the family Flexiviridae, is comprised of 28 recognized species (Fauquet et al., 2005) that mainly infect herbaceous plants and can cause serious economic losses (Martelli et al., 2007). All potexviruses are mechanically transmitted and none have a known vector. Long-distance dissemination is through movement of infected bulbs, tubers, and vegetative cuttings (Martelli et al., 2007). Seed transmission has been reported for several potexviruses species including Hosta virus X (HVX) (Ryu et al.,
2006; Martelli et al., 2007).
Potexviruses have flexuous virions between 470-580 nm long and 13 nm in diameter (Hull, 2002). The genome is one positive-sense, single-stranded RNA molecule with a well conserved genome organization that contains five open reading frames (ORF) that encode the replicase, triple gene block proteins (TGBp1, TGBp2 and TGBp3), and the coat protein (CP) (Komatsu et al., 2008).
The replicase protein contains three highly conserved functional domains: methyltransferase, helicase and RNA-dependent RNA polymerase (RdRp) (Rozanov et al., 1992; Longstaff et al, 1993; Koonin and Dolja, 1993; Davenport and Baulcombe,
32 1997; Verchot-Lubicz et al., 2007). The Bamboo mosaic virus (BaMV) methyltransferase
domain is located near the 5’ end of the ORF and has methyltransferase and
guanylyltransferase activities (Huang et al, 2005; Li et al, 2001). Helicases can be
classified in three super families: SF1, SF2 and SF3 based upon the presence of
conserved motifs. SF1 and SF2 helicases contains seven conserved motifs I, Ia, II to VI and SF3 helicases contain three motifs designated A, B and C (Gorbalenya and Koonin,
1993; Hall and Matson, 1999). The helicase domain in the potexvirus replicase, which is
located between the methyltransferase and the RdRp domains, belong to SF1(Koonin et al., 1993). Motifs I and II are known as the Walker site A and B respectively, which are shown to bind ATP or GTP (Carauthers and Makay, 2002). Helicase proteins carrying
NTP binding motifs have been shown to unwind nucleic acid strands for RNA replication
(Bird et al, 1998). The C-terminal RdRp domain initiates negative strand RNA synthesis
(Cheng et al., 2002), is required for replication of the viral RNA and subgenomic RNA synthesis (Draghici et al., 2009).
The next three overlapping ORFs encode the TGB proteins p1-p3 that are involved in virus movement. PVX TGBp1 has a role as a silencing suppressor (Verchot-
Lubicz et al., 2007). The CP is between 22 and 27 kDa (Adams et al., 2004) and is encoded by the 3’-proximal ORF. The CP is involved in nucleic acid protection and cell-
to-cell movement (Forster, 1992; Verchot-Lubicz, 2005, Tremblay et al, 2006). In the
case of PVX, CP has been reported to act as an elicitor of the potato resistance gene Nx
(Bedahmane, 1995).
The four criteria that have been recognized by the International Committee on
Taxonomy of Viruses for demarcation of potexvirus species are 1) specific natural host
33 range, 2) inability to cross protect another species, 3) specific reactions with monoclonal
antibodies, and 4) different species should have less than ca. 72% nt and 80% aa
sequence identity between the entire replicase or coat protein genes (Fauquet et al, 2005).
Whereas, species from different genera in the family Flexiviridae have less than 40% aa and 45% nt sequence identity in these genes (Adams et al., 2004).
HVX is the most important virus infecting hostas. First described in the U.S.,
HVX-infected cultivars were found in Minnesota, Indiana, Illinois, Iowa and Michigan
(Currier and Lockhart, 1996). In Korea in 2001, one native cultivar and three plants
imported from The Netherlands were confirmed to be infected with HVX (Ryu et al,
2002). In 2006, HVX was found in Poland in hosta plants imported from The Netherlands
(Cajza and Zielinska, 2007). Recently, HVX-infected hostas have been found in nurseries
in Tennessee (Adedire et al., 2009).
The 3’-terminal 2,711 nts and deduced proteins of a HVX isolate collected in
Korea from a Hosta sieboldii ‘Ginko Craig’ plant imported from The Netherlands (HVX-
Kr, GenBank Accession No. AY181252) have been compared to other potexviruses (Park
and Ryu, 2003). Subsequently, HVX-Kr has been completely sequenced (Accession No.
AJ620114). The HVX-Kr genome encodes a replicase, 26-kDa TGBp1, 13-kDa TGBp2,
8-kDa TGBp3 and 23-kDa CP. The HVX-Kr genome is 6,528 nt excluding the poly(A)
tail. The CP sequences of five HVX isolates (HVX-U, 210F, 210H, 210G, 210H2) have
been deposited in GenBank (Table 3.1). HVX-U was collected in Minnesota (Park and
Ryu, 2003) and the other four isolates were collected in Poland.
HVX induces a wide variety of symptoms in hostas. When this project began, it
was unknown whether the different symptoms were due to diversity of the host or virus,
34 or a combination of both. The first objective was to look at diversity of HVX by comparing the CP sequence of HVX isolates collected from different cultivars in Ohio.
The second objective was to select one isolate for additional sequence comparisons to the only available full-length HVX sequence.
Materials and methods
Ohio HVX isolates
Beginning in 2006, symptomatic hostas collected from local nurseries and garden centers or submitted to the C. Wayne Ellett Plant and Pest Diagnostic Clinic at The Ohio State
University were tested for infection by HVX by double antibody sandwich enzyme- linked immunosorbent assay (DAS-ELISA) using commercially available antiserum
(Agdia, Inc). HVX-infected plants were maintained in a greenhouse in Columbus, OH.
Ten HVX isolates from several hosta cultivars were chosen for sequence analysis of the
CP gene (Table 3.1).
CP cDNA synthesis and RT-PCR amplification
Total RNA was isolated from HVX-infected hosta leaves using the RNeasy Plant Mini
Kit (Qiagen, Inc.). To amplify the CP ORF, 7-10 μg of total RNA were mixed with 1 μl
(10 pmol) of PHVXCP3 (5’-TCGGTGGAGCCTTGTTTATTG) which is complementary to sequences within 3’-UTR of HVX-Kr (Park and Ryu, 2003), 1 μl of 10 mM dNTPs and 6 μl nuclease free water, heated at 65°C for 5 min and put on ice for 1 min. First strand cDNA was synthesized in a 20 μl reaction containing 4 µl of 5X first strand buffer,
1 µl of 0.1M DTT and 40 U of RNAsin Recombinant RNAse Inhibitor (Promega Corp.)
35 and 200 U of Superscript III Reverse Transcriptase (Invitrogen Corp.). First strand cDNA
reactions were incubated at 50°C for 60 min, followed by 70°C for 15 min. Two µl of cDNA were amplified by PCR using primers PHVXCP5 (5’-
AGTCTCGAACTAACTAACAGG) and PHVXCP3 (Park and Ryu, 2003) in a 50 μl
reaction containing 5 µl of 10X PCR buffer, 2 µl of 25 mM MgCl2, 10 mM dNTPs, 2 U
of Taq DNA Polymerase (Promega Corp.). Samples were denatured for 2 min at 95°C and subjected to 35 cycles (95°C, 30 sec; 50°C, 30 sec; 72°C, 1 min) followed by a final
5 min extension at 72°C in a model PTC-200 thermocycler (MJ Research).
Sequencing and assembly of CP consensus
PCR products of the CP ORFs were purified with the QIAquick PCR purification kit
(Qiagen, Inc.) and sequenced in both directions using a 3730 DNA analyzer (Applied
Biosystems Inc.) at The Ohio State University Plant-Microbe Genomics Facility (OSU-
PMGF). Chromatogram sequencing files were inspected with Chromas 1.45
(Technelysium Pty Ltd, Helensvale, Australia). A consensus CP sequence was generated using Seqman 5.0 (DNASTAR, Inc., Madison, WI). Sequences flanking the CP ORF were removed prior to sequence alignments.
Multiple alignments of CP sequences
Multiple alignments of CP nt and aa sequences from HVX isolates obtained in this study and six HVX isolates deposited in GenBank (Table 3.1) were done using the Clustal W algorithm of MegAlign 5.0 (DNASTAR, Inc., Madison, WI).
36 RT-PCR amplification of overlapping 5’ and 3’ terminal fragments of HVX-37
One isolate (HVX-37) was chosen for more extensive sequence analysis to determine whether other genes were as similar to each other as the CP. Twenty primers were designed using Primer 3 software (Rozen and Skaletsky, 2000) based upon the HVX-Kr
(Accession No. AJ620114) and tested on HVX-37. Four primers were used for RT-PCR and 10 primers were used for sequencing the HVX-37 genome (Table 3.2). The entire
HVX-37 genome except the poly(A) tail was amplified by RT-PCR in a series of four overlapping PCR products (Fig. 3.1).
Total RNA was isolated from an HVX-infected Hosta ‘Sum and Substance’ collected in Ohio in 2006 (HVX-37) using the RNeasy Plant Mini Kit (Qiagen, Inc.).
First strand cDNA was independently synthesized from 10 μg of total RNA as described above using primers H3, H-5 and H-15, complementary to HVX-Kr nts 6406-6429,
4706-4725, and 2771-2794, respectively (Table 3.2). The 3’-proximal ca. 3.7 kb was amplified with 100 U Pfu DNA Polymerase (Promega Corp.) by amplifying 1 μl cDNA primed with H-3 primers using primers H-3 and H-7 at 95°C for 2 min, followed by 30 cycles (95°C, 30 s; 50°C, 30 s; 72°C, 5 m) followed by a 5 min extension at 72°C. A ca.
2 kb internal fragment was amplified from first strand cDNA primed with H-5 using primers H-5 and H-7 under identical conditions. A 3’-proximal 2.1 kb product was amplified from first strand cDNA primed with H-3 using primers H-3 and H-6, except that the extension time was decreased to 3 min. A ca. 2.7 kb product comprising the 5’- terminus was amplified from first strand cDNA primed with H-15 using primers H-15 and H-8 with a 5 min extension time, except that the annealing temperature was reduced to 47°C.
37 Sequencing, assembly and annotation of the HVX-37 genome
RT-PCR products were directly sequenced at the OSU-PMGF. The chromatogram of
each sequence was analyzed to check for DNA sequence quality. Sequences were
trimmed to remove low quality sequence. Assembly of the 10 sequences was conducted
using Seqman 5.0 (DNAstar, Inc.). To annotate the HVX-37 genome, ORFs were
predicted using EditSeq (DNAstar, Inc.), which searched for ORFs in the three forward reading frames of the HVX-37 contig. An ORF was defined as part of the DNA sequence
of a minimum length of 60 codons that could be translated into a polypeptide. The
deduced protein sequence of each of the putative ORFs was then used to search for
sequence similarity using BLAST (Altschul et al., 1990). ORFs that encoded a protein with sequence homology to other potexvirus proteins were selected for further analysis.
The largest predicted 3’-coterminal ORFs and the deduced protein products were aligned and compared with the proposed ORFs for HVX-Kr (Park and Ryu, 2003) using
Geneious Pro 4.7.6 (Biomatters, Ltd.). The HVX-37 and HVX-Kr replicase protein sequences were aligned with the replicase protein sequences of 23 recognized and eight tentative potexvirus species using MUSCLE alignment of Geneious Pro 4.7.6
(Biomatters, Ltd.). Phylogeny based on replicase sequences were inferred by the neighbor-joining method using the JTT matrix (Jones et al., 1992) with 1000 bootstrap replicates using Mega 4.0 (Tamura et al., 2007).
A neighbor-joining tree was constructed based on an alignment of all available
HVX CP sequences using the neighbor-joining method and 1000 bootstrap replicates
using Genious Pro 4.7.6 (Biomatters, Ltd.).
38 Results
CP sequence comparisons of Ohio HVX isolates
An amplicon of predicted size (ca. 700 bp) was produced from RT-PCR amplification of
total RNA isolated from all ten HVX-infected hostas (Fig. 3.2; Table 3.1). The CP
sequence of ten HVX isolates from five named hosta cultivars and one unknown cultivar
were obtained. Comparison of the CP sequences showed 98.9 to 100% and 99.1 to 100%
sequence identities at the nt and aa level, respectively (Table 3.3). The CP sequence of
the four isolates from H. ‘Sum and Substance’ showed higher homology to each other than to CP sequences from isolates from other cultivars; the CP sequences of HVX-37 and HVX-38 were identical. In addition to lacking the two HVX-37 and HVX-38 nt changes, the CP sequences of HVX-35 and HVX-36 differed from one another in one silent change. HVX-36 and HVX-39 share a single nt difference in common with HVX-1 and HVX-2. HVX-36 has one nt difference, A468→G, that is not present in any other
HVX isolate analyzed in this study. The CP sequences of the two isolates from H. ‘Gold
Standard’ (HVX-1 and HVX-2) had a single nt difference. Among all ten isolates, there were only three single nt changes that resulted in aa changes: Ala 29→Val (HVX-11),
Gln72→His (HVX-25) and Ser625→Pro (HVX-35). HVX-35, which has four single nt differences and one aa change, was the most divergent of the Ohio isolates. Overall, one to four nt differences were observed in each HVX CP sequence relative to the consensus
CP sequence.
39 CP sequence comparisons of all available HVX isolates
A high level of sequence identity was also found between the Ohio isolates and the CP sequences of all isolates available in GenBank (Table 3.3). Ten isolates (HVX-1, HVX-2,
HVX-20, HVX-36, HVX-37, HVX-38, HVX-39, 210H, HVX-U and HVX-Kr) have identical coat proteins. Six total aa changes were observed among all HVX isolates. Thus,
210H2 and 210F2 share a single aa change (Ala10→Ser) and have the substitutions
Pro216→Arg and Ile116→Phe, respectively. The other three aa changes are in Ohio isolates HVX-11, HVX-25 and HVX-35. The CP ORFs of HVX-1 and HVX-39, and
HVX-37 and HVX-38 are identical. A phylogenetic analysis of the CP of all isolates shows that most isolates, independent of the place of collection or cultivar, were placed in the same group (Fig. 3.3).
HVX- 37 genome sequence analysis
Overlapping sequence data were generated with ten HVX-specific primers allowing the assembly of a 6429 nt contig. The HVX-37 genome has a 102 nt 5’-UTR and a 108 nt 3’-
UTR minus the poly(A) tail and contains five ORFs with a high degree of sequence homology to HVX-Kr (Table 3.4). A third UTR of 44 nts exists between the TGBp3 and the CP ORFs of HVX-37. The 5’-proximal HVX-37 ORF (nts 103-4524) encodes a 1473 aa protein that has sequence homology with replicase protein of other potexviruses.
This protein contains methyltransferase, helicase and RdRp domains characteristic of potexviruses. The N-terminal domain contains methyltransferase motifs I, II, III and IV
(Fig. 3.4). The helicase contains motifs: I (also called Walker A site) (Han et al., 2007),
II, V and VI, which place HVX within SF1 (Kadare and Haenni, 1997) (Fig. 3.4). The
40 RdRp domain contains the GDD motif which is a highly conserved motif among
potexviruses (Li et al., 1998) and other positive-strand RNA viruses (Fig. 3.4).
A potential non-AUG start codon (UUG) was observed in the proximity of the
TGBp3 ORF. To determine if UUG was conserved across multiple HVX isolates, four
TGBp3 sequences from four HVX isolates were compared to HVX-37. All four isolates
also had an identical UUG start codon for TGBp3 as was present in the original HVX 3’
sequence deposited in GenBank (data not shown; Accession No. AY181252).
Sequence comparison between HVX-37 and HVX-Kr
Percent sequence identities between the HVX-7 and HVX-Kr ORFs, UTRs and the deduced aa sequences are shown in Tables 3.4 and 3.5, respectively. There were eight single nt differences in TGBp1, two of which resulted in aa differences. Alignment of the
TGBp1 ORF also introduced gaps of two nts and one nt in the HVX-Kr TGBp1 ORF that created a frameshift that resulted in a three aa mismatch relative to the four aa in the
HVX-37 sequence. Thus, the TGBp1 of HVX-Kr is one residue shorter than that of
HVX-37. There was only one nt difference in TGBp2, which resulted in a single aa change at residue 80. There were three single silent nt differences in TGBp3. The CP had
six single nt differences that are translationally silent. The 5’- and 3’-UTRs were identical. The 44 nt internal UTR region between the TGBp3 and CP ORFs had a single nt difference between HVX-37 and HVX-Kr.
The replicase ORF was the most divergent region of the HVX genome. Four types of sequence differences were found between the HVX-37 and HVX-Kr replicase ORF:
single nt differences, multiple consecutive nt differences, frameshifts and duplications.
41 There are fifty-two single nt differences between HVX-37 and HVX-Kr replicase ORFs.
Thirty out of the 52 were translationally silent, 12 resulted in aa differences and ten were after a frameshift. Two dinucleotide changes also resulted in a set of three aa differences.
Multiple gaps in both HVX-37 and HVX-Kr replicase ORFs introduced by sequence alignment predicted 18 frameshift mutations that result in multiple aa differences between the replicase proteins. Alignment of the two replicase ORFs also introduced gaps of one, four and ten nts into the HVX-37 replicase ORF and 15 gaps of one or two nts into the HVX-Kr replicase ORF. Most gaps, and hence frameshifts, were located in the variable region between the methyltransferase and helicase motifs (Fig. 3.5).
The HVX-Kr replicase ORF contains a near perfect direct repeat of 105 nts encoding 35 amino acids (HVX-Kr 284 ANHLFIIQRADLKTPKYRTFVPRRKWV
TNIFLP) that is not present in HVX-37 (Fig. 3.6).
Both replicase sequences contain typical methyltransferase, helicase and RdRp motifs characteristic of potexviruses. However, the motif I of the helicase domain is missing in the deduced HVX-Kr replicase due to a frameshift in the ORF.
HVX replicase protein sequence comparison with other potexviruses
Multiple sequence alignment of the HVX replicase protein with all available potexvirus replicase sequences introduced gaps within the alignment not present in the original
HVX-37/HVX-Kr alignment. Thus, pairwise sequence identities based upon this multiple alignment resulted in a slightly lower aa identity (83.6%) than from the original pairwise alignment of HVX replicases (86.7%). The HVX-37 replicase is more similar than the
HVX-Kr replicase to most potexvirus replicases (Table 3.6). Alignment of potexvirus
42 replicase sequences showed the highest level of homology within the methyltransferase,
helicase and RdRp domains. A large variable region also existed between the
methyltransferase and the helicase domains. The region of maximum variability between
HVX-37 and HVX-Kr replicases overlapped this internal variable region.
A neighbor-joining tree was constructed based upon the multiple alignment of the potexvirus replicase protein sequences (Fig. 3.7) showing that the HVX replicase is most
closely related to Nandina mosaic virus (NaMV), Plantago asiatica mosaic virus
(PlAMV), Tulip virus X (TVX), Cassava common mosaic virus (CsCMV) and
Hydrangea rinspot virus (HdRSV), although these sister clades were weakly supported.
This result was similar to that reported by Park and Ryu (2003) based upon an analysis of
TGB proteins and CP. However, it differs from the combined analysis of TGBp1 and CP,
which placed HVX on a sister clade containing of Papaya mosaic virus (PapMV),
Alternanthera mosaic virus (AlMV), Cactus virus X (CVX), PlAMV and TVX (Fajolu et
al., 2009).
Discussion
The present study was begun by examining the CP sequence variation among HVX
isolates. Comparison of coat protein sequences from 10 HVX isolates collected in Ohio
showed high levels of nt and aa sequence identity regardless of the type of symptoms
produced or cultivar. To determine if variability existed among isolates collected from
plants in geographically distant locations, Ohio isolates were compared to isolates from
Minnesota, Poland and Korea. High levels of sequence identity were found among all
isolates, suggesting that the CP is highly conserved. One possible explanation for these
43 findings is that there is selection pressure to maintain functions related to movement
and/or virion stability. However, we cannot rule out that more divergent HVX isolates
exist because all isolates collected in this study were detected using the same HVX antiserum. It is possible that HVX isolates with a more divergent CP may not react with the antiserum used here.
HVX has been previously classified in the genus Potexvirus based on sequence comparisons of the 3’ terminal 2711 nts of isolate HVX-Kr (Park and Ryu, 2003). In this study, the genome of the Ohio isolate HVX-37 was fully sequenced. Analysis of the
HVX-37 genome revealed a typical potexvirus sequence organization: 5’-UTR, five conserved ORFs and 3’-UTR supporting the classification proposed by Park and Ryu
(2003).
Characterization of the deduced protein product of the 5’-proximal ORF revealed highly conserved replicase domains: methyltransferase, helicase and RdRp indicating that the 5’-proximal ORF encodes the replicase protein. A UUG start codon has been identified for the putative TGBp3. Non-AUG start codons (AUU, CUG, UUG) have been previously reported for plant cells (Gordon et al., 1992; Jelkmann et al., 1992; Petty and
Jackson, 1990). The chloroplast inf A gene has been found to be accurately translated from a UUG in tobacco chloroplasts (Hirose et al., 1999). Furthermore, UUG has been assigned as a possible start codon for a putative 7-kDA polypeptide between the ORFs encoding TGBp2 and the CP of Garlic virus X, genus Alexivirus, family Flexiviridae
(Song et al., 1998). AUU has been assigned as a possible initiation codon for ORF 2 in the potexvirus Strawberry mild yellow edge virus (Jelkmann et al., 1992). Mutation from
AUG to UUG in Cauliflower mosaic virus have shown a delay in symptom development
44 in turnip (Pooggin et al., 2001). Whether the UUG start codon of HVX TGBp3 is functional or not in vivo remains undetermined. However, existence of an alternate start
codon in multiple HVX isolates and potential alternate start codons in other members of
the Flexiviridae suggest a function. Perhaps these alternate codons serve a regulatory role
to modulate gene expression from a multi-cistronic subgenomic mRNA.
The HVX-37 genome sequence was compared with the only HVX genome
available, HVX-Kr, with the aim to determine how divergent the two isolates were. The
results showed a high level of sequence homology in each of the ORFs (Table 3.4).
However, each gene product except the replicase had a similarly high level of aa sequence identity. The low replicase protein sequence homology between the two isolates, despite the high percent of nt sequence homology, was due primarily to frameshifts present in the HVX-Kr replicase ORF.
Comparison between the HVX-37 and HVX-Kr replicase proteins found differences in two highly conserved areas. The first is the presence of a duplicated region within the methyltransferase domain of HVX-Kr replicase. A similar duplicated motif was not found in replicase proteins of HVX-37 or any of the potexvirus species analyzed.
However, a BLAST query with the 32 aa replicase motif present in both HVX isolates found homology >62% with some potexvirus replicases (data not shown). The second difference is the absence of the GKS motif in the RdRp of HVX-Kr. The GKS motif is present in HVX-37 and all potexvirus species. Replacement of GKS with GAA abolishes
NTPase and RNA 5’-triphosphatase activities of BaMV (Han, 2007). Because an infectious clone of HVX-Kr has not been reported, it is not possible to know if either of these differences have biological significance.
45 The most divergent region between the HVX-37 and HVX-Kr replicase proteins
was after the duplication in the HVX-Kr and between the methyltransferase and helicase domains. This region is highly variable in all potexvirus species (data not shown). In
addition, this region is involved in PVX homologous RNA recombination (Draghici et
al., 2009). To determine whether there was a similar localized region of reduced sequence
homology within the replicase protein of other potexvirus species, the replicase protein
sequences of 15 PVX strains were aligned. Similar to HVX, a region of reduced sequence
identity was found between the methyltransferase and the helicase domains of different
PVX strains (data not shown). A subsequent alignment of the replicase protein of these
15 PVX strains and HVX-37 and HVX-Kr showed that the region of low sequence
similarity after the duplication found in HVX-Kr overlaps the region of lowest sequence
homology among PVX strains (data not shown).
Although the existence of an alternate start codon for HVX TGBp1 is not novel in
the Flexiviridae, its biological significance remains to be determined. The HVX-37 and
HVX-Kr TGB proteins shared a high level of sequence identity. Fajolu et al. (2009)
suggest that HVX is a highly homogenous species based upon comparisons of the CP and
TGBp1 sequences of 30 isolates collected in Tennessee. Conclusions based upon only these
two ORFs may be premature as the biological significance of the replicase variability
remains to be determined. Whether similar duplications and/or frameshifts exist in the
replicase ORFs of other HVX isolates remains to be determined. Thus, we recommend that
further studies should examine this region to look for variability in other HVX isolates.
46
Isolate Location Cultivar Symptoms Access No. Reference
HVX-1 Ohio H. ‘Gold Standard’ Yellowing, green spots FJ403380 This study
HVX-2 Ohio H. ‘Gold Standard’ Yellowing, green spots FJ403381 This study
HVX-11 Ohio H. ‘Fortunei Antioch’ Mosaic FJ403382 This study
HVX-20 Ohio unknown Mosaic FJ403383 This study
HVX-25 Ohio H. ‘Sugar and Cream’ Crinkling, green spots FJ403384 This study
HVX-35 Ohio H. ‘Striptease’ Mosaic FJ403385 This study
HVX-36 Ohio H. ‘Sum and Substance’ Mosaic FJ403386 This study
HVX-37 Ohio H. ‘Sum and Substance’ Mosaic FJ403387 This study
HVX-38 Ohio H. ‘Sum and Substance’ Mosaic FJ403388 This study
HVX-39 Ohio H. ‘Sum and Substance’ Mosaic FJ403389 This study
HVX-U Minnesota unknown unknown AJ517352 Park and Ryu, 2003 210F Poland H. ‘Sum and Substance’ unknown FJ821702 unpublished
210H Poland H. ‘Sum it Up’ unknown FJ821703 unpublished
210G Poland H. ‘Vim and Vigor’ unknown FJ821704 unpublished
210H2 Poland H. ‘Sum and Substance’ unknown FJ821705 unpublished
HVX-Kr Korea H. sieboldii ‘Ginko Systemic mosaic and AJ620114 Park and mottle leaf symptoms Ryu, 2003 Craig’
Table 3.1. HVX isolates used for CP sequence comparisons, location where plant was collected, cultivar name as indicated by the grower or researcher, symptoms of source plant and GenBank Accesion numbers.
47 Name Sequence Position Direction
H-3 1,2 5’GACATATGGAAATTTTCTGTTAAACCAAAC 6406-6429 Reverse
H-5 1,2 5’GAGATTTGCAACTGGTCCTG 4706-4725 Reverse
H-6 1,2 5’GGTGCTGGCAACCAAACTTG 4283-4302 Forward
H-7 1,2 5’CAGCCTTCGAGTTCTCCAAG 2663-2682 Forward
H-8 1,2 5’GAAAACAAAACCAATTTTAACCAACTTCAA 1-30 Forward
H-13 2 5’CCCACGTTGGAGACAACATT 5268-5287 Forward
H-15 1,2 5’AGGTGATTGGTGAAAGTAACTTTC 2771-2794 Reverse
H-182 5’GGGAATAAACACAAACCCACA 266-286 Forward
H-192 5’CCATGATGCAACTCTTCCTG 982-1001 Forward
H-202 5’GACAGCCAGCAGTCCAAGA 1811-1829 Forward 1 Primers used in RT-PCR 2 Primers used in HVX-37 sequencing
Table 3.2. Sequences of primers used for RT-PCR and HVX-37 sequencing.
48
Fig. 3.1. Schematic diagram of amplicons used for sequencing of HVX-37. Black solid bars represent PCR products. Arrows indicate position of primers used for amplification.
49 M 1 2 3 4 5 6 7 8 9 10
1.0 Kb
0.5 Kb
Fig. 3.2. RT-PCR amplification of the coat protein ORF of 10 HVX isolates collected in Ohio. M: 1 Kb marker, 1: HVX-1, 2: HVX-2, 3: HVX-11, 4: HVX-20, 5: HVX-25, 6: HVX-35. 7: HVX-36, 8: HVX-37, 9: HVX-38, 10: HVX-39.
50
Isolates Nucleotide % Identity Amino acid % Identity
OH-OH1 98.9-100 99.1-100
OH-MN2 99.1-99.5 99.5-100
OH-Kr3 98.6-99.1 99.5-100
OH-Po4 98.6-99.8 98.6-100
Po-Po 98.8-99.7 99.1-100
Po-Mn 98.9-99.4 99.1-100 Po-Kr 98.5-99.4 99.1-100 Mn-Kr 98.9 100
Table 3.3. Percentage identities of the coat protein gene of HVX isolates collected from different locations. Multiple alignments were conducted using the Clustal W algorithm with an identity protein weight matrix. HVX isolates from: 1 Ohio (FJ403380-FJ403389); 2 Minnesota (AY181252); 3 Korea (AJ620114); 4 Poland (FJ821702, FJ821703, FJ821704, FJ821705).
51
Fig. 3.3. Cladogram of CP nt sequence of HVX isolates built by Neighbor-joining method, Jukes –Cantor genetic distance model, 1000 bootstrap replicates with Plantago asiatica mosaic virus (PlAMV) as outgroup. Values on branches show consensus support percentage.
52
ORF HVX-37 HVX-Kr % Identity
5’-UTR 1-102 1-102 98.1
Replicase 103-4524 103-4626 95.4 TGBp1 4490-5185 4592-5284 98.1 TGBp2 5151-5501 5250-5600 99.7 TGBp3 5389-5613 5488-5712 98.2 Coat protein 5658-6320 5757-6419 98.9 3’-UTR 6321-6429 6420-6528 100
Table 3.4. Nucleotide sequence comparison between HVX-37 and HVX-Kr
53
thyltransferase (MT), helicase (HEL) and RNA (HEL) and (MT), helicase thyltransferase . HVX-37 replicase protein sequence showing me dependant RNA Polymerase (RdRp) motifs. dependant RNA Fig. 3.4
54
HVX-37 HVX-Kr % ORF Identity MWa Residues MW Residues
Replicase 167.19 1473 172.65 1507 86.7
TGBp1 26 231 26 230 97.4
TGBp2 13 116 13 116 99.1
TGBp3 8 74 8 74 98.6
CP 23 220 23 220 100
a Molecular weight was calculated using the Protein Molecular Weight software of the Sequence Manipulation Suite (SMS) (Stothard, P. 2000).
Table 3.5. Comparison between HVX-37 and HVX-Kr deduced protein products.
55 variable region between both k line = mismatches; - = gaps. - = k line = mismatches; and HVX-Kr replicase showing the een bar = conserved sequences; Blac sequences; een bar = conserved Pairwise alignment between HVX-37 Fig. 3.5. sequences (orange arrow). Solid gr
56
ation within the = mismatches; - gaps. ect repeat duplic erved sequences; Black line Kr replicase showing the near dir . Pairwise alignment of HVX-37 and HVX- HVX-Kr genome (Orange arrow). Solid green bar = cons Fig. 3.6
57 Potexvirus HVX-37 HVX-Kr Hosta virus X isolate Kr 83.6 - Tulip virus X 48.0 44.9 Nandina mosaic virus 46.9 44.4 Plantago asiatica mosaic virus 46.8 44.6 Cassava common mosaic virus 45.7 41.9 Alternanthera mosaic virus 45.4 42.0 Hydrangea ringspot virus 45.3 42.0 Papaya mosaic virus 43.7 42.0 Potato virus X 42.1 42.0 Allium virus X 42.0 42.0 Clover yellow mosaic virus 42.0 42.0 Cactus virus X 42.0 42.0 Pepino mosaic virus 41.9 40.1 Zygocactus virus X 41.8 39.4 Schlumbergera virus X 41.4 39.0 White clover mosaic virus 41.4 39.0 Cymbidium mosaic virus 41.2 38.7 Strawberry mild yellow edge virus 40.9 38.5 Nerine virus X 40.5 38.9 Phaius virus X 40.5 37.8 Opuntia virus X 40.3 38.1 Lillium virus X 40.0 38.0 Mint virus X 40.0 37.8 Foxtail mosaic virus 39.8 37.2 Bamboo mosaic virus 39.7 37.3 Alstroemeria virus X 38.2 36.7 Narcissus mosaic virus 38.1 35.9 Chenopodium mosaic virus X 37.6 35.3 Asparagus virus 3 37.5 35.8 Scallium virus X 37.3 35.5 Potato aucuba mosaic virus 36.8 34.5 Lettuce virus X 36.3 34.9
Table 3.6. Replicase aa sequence comparison among HVX- 37, HVX-Kr and 32 other potexvirus species
58
59 Fig. 3.7. Phylogenetic tree of the replicase aminoacid sequence of 32 potexvirus species construced by Neighbor-joining method, 1000 bootstrap replicates, 93776 seed, complete deletion of gaps, p-distance model. Hosta virus X isolate HVX-37, Hosta virus X isolate HVX-Kr, YP_002308464; Bamboo mosaic virus (BaMV), NP_042582; Potato virus X (PVX) CAA80774; Alstroemeria virus X (AlsVX), YP_319827; Foxtail mosaic virus (FoMV), NP_040988; Opuntia virus X (OVX), YP_054407; Schlumbergera virus X (SchVX),YP_002341559; Cactus virus X (CVX), NP_148778; Zygocactus virus X (ZyVX), YP_054402: Allium virus X (AVX), YP_002647027; Clover yellow mosaic virus (ClYMV), NP_077079; Alternanthera mosaic virus (AltMV), ACS28233; Papaya mosaic virus (PapMV), NP_044330; Hydrangea ringspot virus (HdRSV), YP_224084; Cassava common mosaic virus (CsCMV), NP_042695; Tulip virus X (TVX), NP_702988; Nandina mosaic virus (NaMV), AAX19931; Plantago asiatica mosaic virus (PlAMV), NP_620836; Strawberry mild yellow edge virus (SMYEV), NP_620642; Potato aucuba mosaic virus (PAMV), NP_619745; Cymbidium mosaic virus (CymMV), NP_054025; Pepino mosaic virus (PepMV), ACJ74161; Lettuce virus X (LeVX), YP_001960940; Narcissus mosaic virus (NMV), AAP51012; Chenopodium mosaic virus X (CMVX), YP_667844; Scallium virus X (ScaVX), NP_570726; Asparagus virus 3 (AV-3), YP_001715612; Mint virus X (MVX), YP_224134; Phaius virus X (PhaVX), YP_001655010; Lillium virus X (LVX), YP_263303; White clover mosaic virus (WClMV), NP_620715; Nerine virus X (NVX), YP_446992; Shallot virus X (ShVX), NP_620648 (outgroup).
60
Chapter 4
In-vitro transcripts of full-length cDNA clones of Hosta virus X are infectious to hosta and Nicotiana benthamiana plants
Introduction
The development of infectious cDNA clones of RNA viruses has contributed greatly to the understanding of virus biology and host-virus interactions. The first successful construction of an infectious cDNA clone of a plant virus was described by Alquist et al.
(1984). In that study, in vitro transcripts from cDNA clones of the three genomic RNAs of Brome mosaic virus under the transcriptional control of a modified lambda Pr promoter were produced using E. coli RNA polymerase. Subsequently, infectious clones for Tobacco mosaic virus and Tomato mosaic virus were built using the same methodology (Dawson et al., 1986; Meshi et al., 1986). Eventually, the bacterial lambda promoter was replaced with a shorter bacteriophage T7 or SP6 promoter, increasing yield and infectivity of transcripts. An alternative method to in vitro transcription is the manual inoculation of cDNA clones under control of Cauliflower mosaic virus 35S promoter to produce viral transcripts in vivo (Mori et al., 1991), but this method failed to produce cDNA clones that were as infectious as T7 in vitro transcripts. Agroinfiltration (Turpen et al., 1993) and particle bombardment inoculation (Dagless et al., 1997) methods greatly improved the infectivity from 35S-based cDNA clones; infectivity requires the use of a
61
self-cleaving ribozyme that removes unwanted non-viral nts from the 3’-end and high
quantities of Agrobacterium (>108 cells) as inoculum for agroinfiltration. Furthermore,
symptoms are often delayed in comparison to an RNA control (Chapman et al., 2008).
Many more infectious cDNA clones or RNA plant viruses have been constructed using the simpler in vitro RNA transcript–based methods that avoid complicated cloning
strategies and the purchase of expensive equipment. During the last two decades,
infectious cDNA clones of species in the family Flexiviridae have been built following this methodology. Examples include potexviruses: Potato virus X (Chapman et al, 1992),
Papaya mosaic virus (Sit and AbouHaidar, 1993), Clover yellow mosaic virus (Holy and
AbouHaidar, 1993), Cymbidium mosaic virus (Yu and Wong, 1998), and more recently,
Pepino mosaic virus (Hasiow-Jaroszewska et al., 2009). Infectious clones have also been produced for the vitiviruses Grapevine virus A (Galiakparov et al., 1999) and Grapevine virus B (Moskovitz et al., 2007), the carlavirus Blueberry scorch virus (Lawrence and
Hillman, 1994), and the allexivirus Shallot virus X (Vishnichenko and Zavriev, 2001).
Hosta virus X (HVX) is a recently discovered potexvirus that causes economic losses to hosta growers and producers. It is transmitted by contaminated cutting tools, vegetative propagation (Currier and Lockhart, 1996) and is seed transmitted (Ryu et al.,
2006). The natural host range of HVX is restricted to hostas, but N. benthamiana Domin. has been experimentally infected (Currier and Lockhart, 1996). HVX causes different symptoms in hosta leaves such as mosaic, stunting, leaf twisting and death (Currier and
Lockhart, 1996; Ryu et al., 2002; Lewandowski, 2008) that vary depending on the hosta cultivar. No source of resistance against HVX has been reported.
62
One HVX isolate, HVX-Kr, has been fully sequenced (Accession No. AJ620114).
HVX-Kr has a single-positive-stranded RNA genome 6528 nts in length, excluding the poly(A) tail, which contains a 102 nt 5’-UTR, five ORFs and a 109 nt 3’-UTR (Park and
Ryu, 2003). The 5’-proximal ORF encodes a putative 1508 amino acid protein. The next three ORFs encode 26-kDa, 13-kDa and 8-kDa proteins that have sequence homology with the triple gene block proteins (TGB) p1-p3 of other potexviruses. The 3’-proximal
ORF encodes the 23-kDa CP (Park and Ryu, 2003).
We have completely sequenced one HVX isolate from a Hosta ‘Sum and
Substance’ plant collected in Ohio. The main objective of this phase of the project was building an infectious HVX cDNA clone. This clone is an important milestone toward developing a reverse genetics system for elucidating the mechanisms of resistance to
HVX, determining viral factors causing symptoms in HVX infected hostas, and making a comparative analysis between HVX movement in monocots and dicots.
Materials and methods
RNA extraction
Total RNA was isolated from an HVX-infected Hosta ‘Sum and Substance’ plant collected in Ohio in 2006 (HVX-37) using the RNeasy Plant Mini Kit (Qiagen, Inc.).
cDNA synthesis
Two approaches were attempted to generate a full-length cDNA copy of the HVX
genome. The first approach consisted of first strand cDNA synthesis primed with H-3
(sequences of all primers are listed in Table 4.1) complementary to sequences within the
63
3’-UTR immediately upstream of the poly(A) tail, and subsequent PCR amplification with H-3 and H-8, which corresponds to 5’-proximal 30 nts. The second approach consisted on an initial PCR amplification of overlapping 5’ and 3’ cDNAs that collectively represent the entire HVX genome, followed by the assembly of the fragments by long fusion PCR (Fig. 4.1). For that purpose, first strand cDNA was independently primed with primers complementary to the 3’-UTR (H-3) and replicase sequences (H-
15). Subsequently, a 2.7 kb 5’-proximal fragment was amplified from cDNA primed with
H-15 using primers H-8 and H-15. Reaction conditions were 95°C for 2 min followed by
30 cycles (95°C, 30 s; 47°C, 30 s; 72°C, 4 min) followed by a 5 min extension at 72°C.
Sequences corresponding to the T7 promoter were fused to the 5’-end by amplification using primers H-8like and H-15. Reactions conditions were 95°C for 1 min followed by
30 cycles (95°C, 20 s; 47°C, 20 s; 72°C, 2 min) followed by a 3 min extension at 72°C. A
3.7 kb 3’-proximal fragment was amplified by PCR from cDNA primed with H-3 using primers H-7 and H-3. Reaction conditions were 95°C for 2 min followed by 30 cycles
(95°C, 30 s; 50°C, 30 s; 72°C, 5 min) followed by a 5 min extension at 72°C. A poly(A25)
tail and 3’-proximal restriction sites were introduced by amplification with H-7 and hvx-
poly(A). Reaction conditions were similar to the ones reported for H-8like and H-15,
except the annealing temperature was increased to 50°C. All PCR amplifications were conducted in 50 µl reactions containing 0.5 mM dNTPs, 10 pmol of each primer, 5 µl of
10X Pfu buffer and 1 µl of Pfu DNA Polymerase (Promega Corp.) in a model PTC-200 thermocycler (MJ Research).
64
Long fusion PCR
Overlapping 5’- and 3’-proximal amplicons were purified using the Qiaquick PCR
Purification Kit (Qiagen, Inc.). The purified products were then analyzed in a 1% agarose in 1X TAE (40 mM Tris/Acetate, 1 mM EDTA, pH 8.0) gel and compared to a 1 to 10 kb
DNA marker (Promega Corp.). DNA concentration was estimated from absorbance at
260 nm using a Nanodrop 2000 (Thermo Fisher Scientific, Inc.). Equimolar quantities of each product were mixed in a 50 μl PCR reaction containing 0.5 mM dNTPs, 5 µl of 10X
Pfu buffer and 1 µl of Pfu DNA Polymerase (Promega Corp.). PCR conditions were 95°C for 2 min followed by 12 cycles (95°C, 20s; 68°C, 20s; 72°C, 2 min) and a 3 min extension at 72°C. Subsequently, 3 µl of the previous reaction were added to a 50 µl PCR reaction containing 0.5 mM dNTPs, 5 µl of 10X Pfu buffer, 10 pmol of primers H8like and hvx-poly(A), and 1 µl of Pfu DNA Polymerase (Promega Corp.). PCR conditions were 95°C for 1 min followed by 30 cycles (95°C, 20s; 59°C, 20s; 72°C, 3.5 min) and a 3 min extension at 72°C. A PCR product of the expected size (6.5 kb) was excised from the gel using a sterile scalpel and purified using a QIAquick gel extraction kit (Qiagen, Inc.).
Construction of pHVX
To build pHVX, the gel purified 6.5 kb PCR product was digested with KpnI and BamHI, purifed using Qiaquick PCR purification kit (Qiagen, Inc.) and ligated into similarly digested pNEB193 at a 1:1 molar ratio. Competent Escherichia coli JM109 cells were transformed with the products of the ligation using a heat shock method as previously described (Sambrook and Russell, 2001). Cells were grown for an hour in SOC medium and then plated on LB agar containing 100 μg/ml of ampicillin. Plates were coated with
65
X-gal and IPTG for white/blue screening. Transformants were grown overnight at 37°C.
Small-scale plasmid preparations were conducted essentially as described by Zhou et al.
(1990). Putative clones were evaluated for the presence of the correct insert by restriction mapping. Expected digestion products were calculated based on the HVX-37 sequence using NEB Cutter 2.0 (http://tools.neb.com/NEBcutter2/). Products of the initial HindIII
digestion were analyzed on a 1% agarose TAE gel. After that, presumptive positive
clones were double digested with the enzymes KpnI plus SpfI or BamHI. Clones that gave
the expected pattern for all three digestions were chosen for a large scale plasmid
preparation (Krieg and Melton, 1984). Briefly, positive clones were grown in 40 ml of
LB medium containing 100 μg/ml of ampicillin for 16 hours at 225 rpm. Cells were
collected by centrifugation at 4,000 rpm and suspended in 3 ml of cold SET buffer (25
mM Tris-HCl, pH 8.0, 10 mM EDTA, 15% Sucrose) containing 2 mg/ml of freshly added
lysozyme. Six ml of 0.2 M NaOH, 1% SDS was carefully added to each tube and
incubated 10 min on ice. Following the addition of 3.75 ml of 3 M NaOAC, pH 5.2, tubes
were incubated on ice for 20 min, and then centrifuged at 12,000 rpm at 4°C for 10 min.
After the addition of 20 µl of RNAse A (10 mg/ml) to the supernatant, tubes were
incubated at 37°C for 45 min. DNA was extracted twice with 50 mM Tris-saturated
phenol-chloroform-isoamyl alcohol (25:24:1) and ethanol precipitated. DNA was pelleted
by centrifugation at 10,000 rpm at 4°C for 10 min. The pellet was rinsed with 70%
ethanol, dried under vacuum, and suspended in 200 μl of nuclease free water. An aliquot
of 1 µl was run on a 1% agarose gel. The OD260 was measured with a Nanodrop 2000
spectrophotometer to estimate DNA concentration. Clones were re-evaluated for
presence of the correct insert by restriction mapping. The products of three restriction
66
enzyme digestions with the enzymes KpnI plus HindIII, KpnI plus BamHI, and SpeI plus
BamHI were analyzed. Clones that gave the expected pattern for all three digestions were
selected for production of in vitro transcripts.
In vitro transcription and plant inoculation
In vitro RNA transcripts were produced with T7 RNA polymerase from 1.2 μg of
BamHI-linearized pHVX as previously described (Lewandowski and Dawson, 1998),
except reaction volumes were increased to 30 µl. RNA transcripts were directly rub- inoculated onto the youngest expanded N. benthamiana and hosta leaves previously dusted with silicon carbide.
Transcripts derived from each of the seven clones were independently inoculated to four leaves of N. benthamiana and H. ‘None Lovelier’ plants. A total of twenty-one N.
benthamiana and nine H. ‘None Lovelier’ plants were inoculated in three independent experiments. Clones that yielded transcripts infectious to N. benthamiana were subsequently inoculated in four independent experiments to an additional 42 hostas.
Each experiment consisted of inoculation of up to five different susceptible hosta cultivars (Sum and Substance, Sugar and Spice, Midnight Ride, and June) with RNA transcripts independently derived from pHVX-4, pHVX-5 and pHVX-7. Positive (HVX-
37 sap) and negative (healthy) controls were included in each experiment. Plants were maintained in a growth chamber at 25°C with a 14 h photoperiod.
67
DAS-ELISA
Inoculated leaves of N. benthamiana and hosta plants were sampled at 10 and 30 days
post-inoculation (dpi), respectively. Upper non-inoculated leaves of H. ‘None Lovelier’
were also sampled at 56 dpi. Leaves were ground in 5 volumes of cold extraction buffer
[1.3 g sodium sulfite anhydrous, 20.0 g polyvinylpropilidone, 0.2 g sodium azide, 2.0 g
powdered egg (chicken) albumin, 20.0 g Tween-20, per liter of distilled water, pH 7.4]
and analyzed by double antibody sandwich enzyme-linked immunosorbent assay (DAS-
ELISA) using commercially available HVX antiserum using the manufacturer’s protocols
(Agdia, Inc).
IC-RT-PCR
Samples were also tested by immunocapture reverse-transcription polymerase chain reaction (IC-RT-PCR). One ml of sap was incubated with 20 µl of magnetic beads (sheep anti rabbit anti-Hosta virus X antibodies). Magnetic bead-conjugated anti-HVX antiserum
was kindly provided by Dr. J. Rob Fisher (Ohio Department of Agriculture). Tubes were
incubated at room temperature for 2 hours with gentle agitation and then were placed on
a magnetic rack. Beads were washed three times with 1 ml of PBS-S after transferring the
sap to another tube. After the final wash, beads were suspended in 500 μl of PBS-S. A
reverse transcription cocktail containing 4 μl Moloney Murine Leukemia Virus- Reverse
Transcriptase (MMLV-RT) buffer,, 2 μl 5 mM dNTPs, 0.5 μl random hexamers
(Promega, Corp.), 1 μl BSA (1 mg/ml), 1 μl DTT (0.1mM), 0.5 μl RNAsin, and 1 μl
MMLV-RT in a 20 μl reaction, was added to each tube containing the beads. Tubes were
incubated for 1 hour at 42°C and subsequently placed on a magnetic rack. cDNA was
68
transfer to a new 1.5 ml microcentrifuge tube. Two µl of cDNA were amplified by PCR
using primers within the replicase ORF H-16 and H-17 (Table 4.1) in a 50 μl reaction
containing 5 µl of 10X PCR buffer, 1 mM MgCl2, 0.5 mM dNTPs, and 2 U of Taq DNA
Polymerase (Promega Corp.). Samples were denatured for 2 min at 95°C and subjected to
30 cycles (95°C, 30 sec; 50°C, 30 sec; 72°C, 1 min) followed by a 5 min extension at
72°C. PCR products were analyzed in a 1% agarose 1X TAE (40 mM Tris/Acetate, 1
mM EDTA, pH 8.0) gel and compared to a 1 to 10 kb DNA marker (Promega Corp).
Plant-to-plant passage of in vitro RNA transcript-derived progeny
Twenty-two hosta cultivars (Table 4.2) were inoculated with sap from a systemically
infected H. ‘None Lovelier’ plant previously inoculated with RNA transcripts derived
from pHVX-7. Inoculated and upper non-inoculated leaves of each cultivar were tested
by DAS-ELISA at 30 dpi. Leaf samples from single N. benthamiana plants previously
inoculated with RNA transcripts derived from either pHVX-4 or pHVX-5 were ground in
phosphate buffer and used to inoculate one H. ‘Twilight Time’ plant per clone.
Inoculated leaves were tested by DAS-ELISA at 30 dpi.
Sequencing of pHVX
Thirty-two primers were designed based upon the HVX-37 genome (Tables 4.3 and 4.4).
In order to obtain high quality DNA sequence data, the gap between sequential primer
binding sites was no longer than 500 nts and most of the contig is based upon five overlapping sequences. pHVX-7 was sequenced using a 3730 DNA analyzer (Applied
Biosystems Inc.) at The Ohio State University Plant-Microbe Genomics Facility (OSU-
69
PMGF). A consensus sequence of the contig produced was generated using Seqman 5.0
(DNASTAR, Inc., Madison, WI). The complete pHVX-7 sequence was compared to the
HVX-37 genome sequence described in Chapter 3 by pairwise sequence alignment using
Geneious Pro 4.7.6 (Biomatters, Ltd.).
Sequencing of progeny derived from pHVX-7
Total RNA was extracted from two systemically infected H. ‘None Lovelier’ plants, one inoculated with transcripts derived from pHVX-7, the other with sap from the original source plant HVX-37. The CP ORF was amplified by RT-PCR using PHVXCP5 and
PHVXCP3 (Park and Ryu, 2003; Chapter 3). RT-PCR products were purified and sequenced as described above at the OSU-PMGF. Percent identity between both CP sequences was calculated by pairwise alignment using the CLUSTAL W algorithm of
MegAlign 5.0 (DNASTAR, Inc., Madison, WI).
Transmission electron microscopy
Fresh, symptomatic leaves of a pHVX-7 transcript infected H. ‘None Lovelier’ were dissected with a sterile scalpel. A carbon coated copper grid was float on a drop of leaf extract for 1 min and then dried. Next, the grid was wash with drops of water (four drops,
30 sec per drop), placed on a drop of 1% phosphotungstic acid stain for 30 s, and blot dried for 30 min. Finally, grids containing the sample were observed in a transmission electron microscope at the Mollecular and Cellular Imaging Center, OARDC, Wooster,
OH.
70
Results
Construction of a full-length cDNA clone of HVX
The strategy to amplify the entire HVX genome by RT-PCR using primers corresponding to the 3’- and 5’-termini failed to produce a product. However, the second strategy that separately amplified overlapping 5’- and 3’-proximal fragments was successful. Using long fusion PCR, a full-length cDNA copy of the HVX genome was successfully amplified. A total of thirty-three putative clones were screened for the presence of a full- length HVX-37 cDNA by restriction mapping. Seven out of 33 clones showed the expected restriction fragment pattern. These clones were designated pHVX-1, pHVX-2, pHVX-3, pHVX-4, pHVX-5, pHVX-6 and pHVX-7.
Infectivity of transcripts derived from pHVX in hosta and N. benthamiana plants
Five of the seven full-length clones yielded HVX transcripts that were infectious to N. benthamiana as determined by DAS-ELISA (Table 4.5) and IC-RT-PCR (Fig. 4.2). No symptoms were observed in the N. benthamiana plants inoculated with transcripts or sap from a HVX-37 infected hosta. RNA transcripts of the three clones that were infectious in at least two N. benthamiana plants (pHVX-4, -5 and -7) were inoculated directly to hostas. Of these three clones, RNA transcripts of only pHVX-4 and pHVX-7 were infectious to hostas when mechanically inoculated (Table 4.5). HVX was detected by IC-
RT-PCR at 30 dpi in one out of four inoculated leaves of H. ‘June’ and ‘Sugar and Spice’ with transcripts derived from pHVX-4 and pHVX-7, respectively. HVX was detected by
DAS-ELISA and IC-RT-PCR in one of the two H. ‘None Lovelier’ inoculated leaves at
30 dpi with transcripts derived from pHVX-7. HVX was also detected by DAS-ELISA in
71
one upper non-inoculated young leaf of the same H. ‘None Lovelier’ plant at 56 dpi (this leaf was not tested by IC-RT-PCR). Inoculated and upper non-inoculated leaves of the
HVX-7-inoculated H. ‘None Lovelier’ plant also tested positive by HVX ImmunoStrips
(kindly provided by Agdia, Inc.).
Long flexuous virions (length of ca. 540 nm and a width of ca. 13 nm) were observed in leaf dips of upper leaves of transcript inoculated H. ‘None Lovelier’ (Fig.
4.3). Mild mosaic symptoms were observed in systemically infected leaves of H. ‘None
Lovelier’ inoculated with transcripts from pHVX-7 (Fig. 4.4) ten months after inoculation. To determine the infectivity of HVX-7 progeny, 22 hosta cultivars were inoculated with a homogenate prepared by grinding upper non-inoculated leaf tissue from a systemically infected H. ‘None Lovelier’ inoculated with pHVX-7 transcripts in 5 volumes of cold phosphate buffer. Fourteen cultivars were infected as determined by
DAS-ELISA 30 dpi (Table 4.2). Of the 14 infected plants, one cultivar, H. ‘Paul’s Glory’ had previously not been tested for susceptibility to HVX (Chapter 2).
Sequence comparisons between pHVX and HVX-37
A pairwise sequence alignment between the contig assembled from the direct sequencing of HVX-37 amplicons and pHVX showed a 99.8% identity at the nt level. Seventeen unresolved nts observed in the HVX-37 contig sequence accounted for 91% of the differences and were resolved by sequencing pHVX-7.
72
Sequence comparisons between progeny derived from pHVX and HVX-37
Total RNA was extracted from the systemically infected pHVX-7 transcript inoculated H.
‘None Lovelier’ and the CP ORF was amplified and sequenced. Sequence of the CP ORF
of progeny from the HVX-7 infected hosta was identical to the original pHVX-7 clone
and HVX-37 RT-PCR products.
Discussion
This chapter describes the construction of full-length HVX cDNA clones, from which in
vitro RNA transcripts infectious to hosta and N. benthamiana plants were produced. To
produce a full-genomic HVX cDNA, long fusion PCR was used (Shevshuk et al., 2004),
which enabled the fusion of overlapping HVX amplicons. This method was a suitable
alternative to amplification of the complete genome with 5’- and 3’-specific primers,
which was unsuccessful with total RNA extracted from HVX-infected hosta leaves.
HVX was detected by DAS-ELISA and IC-RT-PCR in inoculated and upper non-
inoculated leaves of hosta, indicating that progeny virus derived from pHVX was able to
move systemically. Sap from an RNA transcript-infected hosta also infected fourteen
hosta cultivars, showing that progeny virus is highly infectious and easily mechanically
transmissible, despite the fact that many of the RNA transcript-inoculated plants were not
detectably infected. Typical potexvirus particles were observed in the upper leaves of
transcript-inoculated plants showing that virions were produced. The low transcript
infectivity may be due several factors including reduced infectivity of RNA, cloning artifacts, and/or a sub-optimal length poly(A) tail. Although the length of the HVX poly(A) tail has not been experimentally determined, we chose A25 based upon findings
73
by Tsai et al. (1999) who showed that A25 was effective for infectious clones of Bamboo mosaic virus. However, other studies have shown that increasing the length of the poly(A) tail can increase transcript infectivity. Increasing the poly(A) tail of Papaya mosaic virus from 24 to 71 residues increased transcript infectivity 43% (Sit and
AbouHaidar, 1993). An increase in infectivity was also found for Clover yellow mosaic virus, potexvirus, transcripts after lengthening the poly(A) tail from 23 to 135 residues
(Holy and AbouHaidar, 1993)
pHVX-7 was completely sequenced and compared to the contig assembled from the direct sequencing of HVX-37 RT-PCR products (see Chapter 3 for more information on how HVX-37 was sequenced). The sequences were nearly identical (99.8%) suggesting that we have cloned a representative sequence of the HVX-37 population.
In vitro transcripts derived from five pHVX clones were able to infect N. benthamiana, but only three directly infected hostas. Because clones pHVX-1 and pHVX-2 were not infectious in N. benthamiana, efforts to infect hostas were focused on the five clones that infected N. benthamiana. Compared to hostas, a greater percentage of
N. benthamiana plants were infected by mechanical inoculation with RNA transcripts,
possibly due to a thinner cuticle than hostas. Differences in infectivity were also observed
in hosta, where only two of the five clones tested detectably infected hosta. However,
because of the low number of plants tested, we cannot rule out that by testing a larger
number of plants may have identified additional clones that could infect hosta. RNA
inoculation difficulties have been documented for other crops with a thick cuticle such as
citrus; transcripts of Citrus leaf blotch virus yielded zero infected citrus plants (Vives et
al., 2008). Because a greater percentage of N. benthamiana plants were infected after
74 inoculation with in vitro transcripts, attempts were made to passage virions to hosta.
However, this approach did not result in any infected hostas.
This is the first report of the construction of an infectious cDNA clone of HVX.
Many existing infectious clones of the family Flexiviridae are viral pathogens of dicots and have been only tested in dicot plants. Two monocot-infecting potexviruses, Bamboo mosaic virus and Cymbidium mosaic virus, are generally studied in the experimental dicot host N. benthamiana rather than their natural monocot hosts (Chen et al., 2005; Hsu et al., 2008; Huang et al., 2008). The construction of HVX clones infectious to both monocot (hosta) and dicot (N. benthamiana) hosts creates seldom-seized opportunities to do a comparative study of potexvirus movement in monocots and dicots with a focus on the natural monocot host. These studies will be informed by the breadth of potexvirus research on virus movement already completed in N. benthamiana (reviewed by Verchot-
Lubicz et al., 2007) and the planned HVX cDNA clones tagged with a reporter gene such as GFP to allow non-destructive monitoring in planta.
75
Name Sequence (5’ – 3’) Position Direction H-3a GACATATGGAAATTTTCTGTTAAACCAAAC 6406-6429 Reverse H-7a CAGCCTTCGAGTTCTCCAAG 2663-2682 Forward H-8a GAAAACAAAACCAATTTTAACCAACTTCAA 1-30 Forward H-15a AGGTGATTGGTGAAAGTAACTTTC 2771-2794 Reverse H-8 likea AATTGGTACCTAATACGACTCACTATAGAAA KpnI-T7-1-30 Forward ACAAAACCAATTTTAACCAACTTCAA a H-poly(A) tail AATTCCTGCAGGGGATCCT(25)TGGAAATTTT 6406-6429- Reverse CTGTTAAACCAAAC BamHI-SpbfI H-16b AACGCAATCATGCTCTTCCT 3573-3592 Forward H-17b AAGTCCCACTGAGCTTTGACA 3791-3811 Reverse a Primers used for in vitro synthesis of HVX-37 cDNA. Restriction sites are underlined and the T7 promoter sequence is shaded. b Primers used for IC-RT-PCR.
Table 4.1. Sequences of primers used for in vitro synthesis of HVX-37 cDNA and IC- RT-PCR.
76
Fig. 4.1. Schematic diagram of amplicons used for construction a full-length cDNA clone. Black solid bars represent PCR products. Arrows indicate position of primers used for amplification.
77
OD405 Cultivar or species I U H. ‘Baby Bunting’ >3.5a >3.5 H. ‘Halcyon’ 0.277 0.094 H. ‘Francee’ 1.794 ntb H. ‘Midnight Ride’ 2.645 0.097 H. montana ‘Fujibotan’ 0.103 >3.5 H. ‘None Lovelier’ nt >3.5 H. ‘Northern Exposure’ 0.683 nt H. ‘Patriot’ 0.540 0.669 H. ‘Paul’s Glory’ 0.201 0.101 H. ‘Pineapple Upsidedown Cake’ 0.398 0.093 H. plantaginea >3.5 0.099 H. ‘Spartan Glory’ 1.573 nt H. ‘Whiskey Sour’ 2.809 3.05 H. ‘Blue Angel’ -c - H. ‘Nightlife’ - - H. ‘Jaz’ - - H. ‘Wily Willy’ - - H. ‘Kifukurin Hyuga’ - - H. montana ‘Chodai Ginyo’ - - H. ‘Sum and Substance’ - - H. ‘Sugar and Spice’ nt - H. ‘Twilight Time’ - - a DAS-ELISA values over twofold the average value of mock-inoculated cultivar (OD405 = 0.087) were considered as positive b not tested c OD405 values below 0.087 were considered as negative; I: Inoculated leaf U: Upper non-inoculated leaf
Table 4.2. Infectivity of HVX-7 progeny passage from an RNA transcript- inoculated H. ‘None Lovelier’ to 22 hosta cultivars. 78
Name Sequence (5' - 3') Position H30 AAACTCCAGTTCTTCAAAAG 400-420 H31 AGTTCACGGCTCACCTTCC 800-820 H32 CCCAGACGAGCTGGTAAGGC 1200-1220 H33 GAGCCGCACAGAAGAAAGCTG 1600-1620 H34 CCACCAGAGGAAGAGATCCCG 2000-2020 H35 CATTCTCCGTCATCCATGGCG 2400-2420 H36 TGCCAGCCCAACGTGGAGCTC 2665-2685 H37 CTCAATGCCACACATCGCAAC 2800-2820 H38 AGATCACTCCAGAGGAGCCC 3200-3220 H40 GCAACAAACCTACCTCTCG 3600-3620 H41 AAGTTTCACAACATTCCAGAG 4000-4020 H42 TTGGCACACTGCAACAAATC 4400-4420 H43 CTTTCTCAGGACCAGTTGC 4800-4820 H44 AGACAAGACGGCCCTGTACAG 5200-5220 H45 GCAACAACTGCCTAATCTACG 5600-5620 H46 ATCCCAGGACTCGCGCCAGGC 6000-6020 H39 CAATAAACAAGGCTCCACCG 6428-6448
Table 4.3. Forward primers used for pHVX-7 sequencing
79
Name Sequence (5' to 3') Position H47 CTCTCTCAGTCTGGCCATTGC 100-120 H48 CACACGGAACATGTCCGCAG 500-520 H49 GTGACCCACTTTCTTCTGGGC 900-920 H50 CTTAATTGGGTTGACTAGATC 1300-1320 H51 CTTTCAGGGACTGGCTGAAAC 1700-1720 H52 AATCCGACCGCTTTGAGTTGC 2100-2120 H53 TCTGAGCTCGTTAGTGGGGC 2500-2520 H54 CCAAGATGTGCATTTCTGGG 2900-2920 H55 TTACTCCCTGGCATCCGGCG 2978-2998 H56 TGGCGTGCTTTTCCGGC 3300-3320 H57 CATCTTCTTGACCCACTGAG 3700-3720 H58 CGTCGAAGGTGGGTCCTTCGC 4100-4120 H59 ACTTGGTGGGTTCTGCACTGG 4500-4520 H60 GGGAGCTTTGCCCTCTCGTAG 4900-4920 H61 ACTCCTATCACTACCGCTAGC 5300-5320 H62 TGGCAAACTTAACCGGCGTG 5700-5720 H63 TCGCATAATTCCAGATGATGG 6100-6120 H64 TTCTGTTAAACCAAACCTTAG 6500-6520
Table 4.4. Reverse primers used for pHVX-7 sequencing
80
pHVX clonea Inoculated plant 1 2 3 4 5 6 7 Mockb Sapc
Nicotiana benthamiana 0/5d 0/3 1/5 2/5 3/5 1/5 3/5 0/5 5/5
Hosta ‘June’ nt nt nt 1/4 0/4 nt 0/4 0/4 4/4
H. ‘Midnight Ride’ nt nt nt 0/4 0/4 nt 0/4 0/4 4/4
H. ‘None Lovelier’ nt nt nt 0/3 0/3 nt 1/3 0/3 3/3
H. ‘Sugar and Spice’ nt nt nt 0/4 0/4 nt 1/4 0/4 4/4
H. ‘Sum and Substance’ nt nt nt 0/2 0/2 nt 0/2 0/2 2/2
a pHVX clone used to produce RNA transcripts in vitro b Mock = Buffer inoculated plant c Sap = Plant inoculated with sap from a HVX-37-infected hosta d Number of HVX positive plants out of the total inoculated plants. Each plant for a given clone/host combination represents an independent experiment. Positive plants are based on IC-RT-PCR and DAS-ELISA results. In DAS-ELISA, absorbance values (A405) over twofold the value of mock-inoculated plants were considered as positive. e Not tested. Note: HVX-4, HVX-5 and HVX-6 were positive in N. benthamiana during the first three experiments; hence these clones were selected for inoculation into hosta.
Table 4.5. Infectivity of in vitro transcripts of five full-length HVX cDNA clones.
81
M 1 2 3 4 5 6 m p
Fig. 4.2. Detection of HVX replicase internal region by IC-RT-PCR in pHVX transcript inoculated N. benthamiana plants 10 dpi. M. 1 Kb DNA ladder; HVX-1 (lane 1); HVX-3 (lane 2); HVX-4 (lane 3); HVX-5 (lane 4); HVX-6 (lane 5); HVX-7 (lane 6) ; m. mock; p.HVX-37 infected N. benthamiana
82
A B
Fig. 4.3. Electron micrograph of virions from systemically infected leaves of Hosta ‘None Lovelier’ plants inoculated with the parental isolate HVX-37 (A) or in vitro transcripts of pHVX-7 (B)
83
A B
Fig. 4.4. HVX-7 induced symptoms in Hosta ‘None Lovelier’. A. Leaf from a systemically infected plant inoculated with transcripts from pHVX-7, showing crinkle symptoms. B. Leaf from a mock-inoculated plant. Photo was taken during the second growing season (10 months after inoculation).
84
References
Adams MJ, Antoniw JF, Bar-Joseph M, Brunt AA, Candresse T, Foster GD, Martelli GP, Milne RG, Zavriev SK, Fauquet CM. 2004. The new plant virus family Flexiviridae and assessment of molecular criteria for species demarcation. Archives of Virology 149: 1045-1060.
Adedire OL, Wen RH, Windham A, Windham M, Hajimorad MR. 2009. Hosta virus X in Hosta identified in Tennessee, USA. Plant Pathology 58, 405-405.
Alquist P, French R, Janda M, Loesch-Fries LS. 1984. Multicomponent RNA plant virus infection derived from cloned viral cDNA. Proceeding of the National Academy of Sciences 81: 7066-7070.
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool. Journal of Molecular Biology 215: 403-410.
Angiosperm Phylogeny Group. 2003. An update of the Angiosperm Phylogeny Group classification for the orders and families of flowering plants: APG II. Botanical Journal of the Linnean Society 141: 399-436.
Attathom S, Weathers LG, Gumpf DJ. 1978. Identification and characterization of a potexvirus from California barrel cactus. Phytopathology 68: 1401–1406.
Baker JG. 1870. A revision of the genera and Species of Herbaceous Capsular Camophyllous Liliaeceae. Journal of the Linnaean Society of London II 54: 349-436.
Bendahmane A, Köhm BA, Dedi C, Baulcombe DC. 1995. The coat protein of potato virus X is a strain-specific elicitor of Rx1-mediated virus resistance in potato. Plant Journal 8: 933-941.
Bird LE, Subramanya HS, Wigley DB. 1998. Helicases: a unifying structural theme? Current Opinion in Structural Biology 8: 14–18.
85 Blanchette B, Lockhart BEL. 2003. Hosta virus X: A three-year study. Hosta Journal 35: 19-23.
Brierley P. 1954. Symptoms in the florist’s hydrangea caused by tomato ringspot virus and an unidentified sap-transmissible virus. Phytopathology 44: 696–699.
Brown DJF, Halbrendt JM, Robbins RT, Vrain TC. 1993. Transmission of Nepoviruses by Xiphinema americanum-group Nematodes. Journal of Nematology 25(3): 349–354.
Brunt AA. 1966. Narcissus mosaic virus. Annals of Applied Biology 58: 13-23.
Brunt AA, Crabtree K, Dallwitz MJ, Gibbs AJ, Watson L, Zurcher EJ. 1996. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20th August 1996.' URL http://biology.anu.edu.au/Groups/MES/vide/
Cajza M, Zielinska L. Hosta Virus X- A new pathogen of ornamental plants in Poland. 2007. Progress in Plant Protection 47(2): 69-72.
Caruthers JM, McKay DB. 2002. Helicase structure and mechanism. Current Opinion in Structural Biology 12: 123-133.
Chapman SN, Kavanagh T, Baulcombe DC. 1992. Potato virus X as a vector for gene expression in plants. Plant Journal 2: 549-557.
Chapman S. Construction of infectious clones for RNA viruses: TMV. In Foster GD, Johansen, E, Hong, Y, Nagy, P, Editors. Plant Virology Protocols. 2nd Ed. NJ. USA: Humana Press. p. 477-490.
Chen IH, Chou WJ, Lee PY, Hsu YH, Tsai, CH. 2005. The AAUAAA Motif of Bamboo Mosaic Virus RNA Is Involved in Minus-Strand RNA Synthesis and Plus- Strand RNA Polyadenylation. Journal of Virology 79: 14555-14561.
Cheng JH, Peng CW, Hsu YH, Tsai CH. 2002. The synthesis of minus-strand RNA of bamboo mosaic potexvirus initiates from multiple sites within the poly(A) tail. Journal of Virology: 6114-6120.
85 Chung MG, Jones SB, Hamrick JL, Chung HG. 1991. Morphometric and Isozyme analysis of the genus Hosta in Korea. Plant Species Biology 6: 55-69.
Currier S, Lockhart BEL. 1996. Characterization of a Potexvirus infecting Hosta spp. Plant Disease 80: 1040-1043.
Dagless EM, Shintaku, MH, Nelson, RS, Foster GD. 1997. A CaMV 35S promoter driven cDNA clone of tobacco mosaic virus can infect host plant tissue despite being uninfectious when manually inoculated onto leaves. Archives of Virology 142: 183-191.
Davenport G, Baulcombe D. 1997. Mutation of the GKS motif of the RNA-dependent RNA polymerase from potato virus X disables or eliminates virus replication. Journal of General Virology 78: 1247-1251.
Dawson WO, Beck DL, Knorr DA, Grantham GL. 1986. cDNA cloning of the complete genome of tobacco mosaic virus and production of infectious transcripts. Proceeding of the National Academy of Sciences 83: 1832-1836.
Dawson WO, Hilf ME. 1992. Host-Range Determinants of Plant Viruses. Annual Review of Plant Physiology and Plant Molecular Biology 43: 527-555.
Draghici HK, Pilot R, Thiel H, Varrelmann M. 2009. Functional mapping of PVX RNA-dependent RNA-replicase using pentapeptide scanning mutagenesis-Identification of regions essential for replication and subgenomic RNA amplification. Virus Research 143: 114-124.
Derks AFLM, Lemmers MEC. 1997. Detection of tospoviruses in bulbous crops and their transmissibility by vegetative propagation. Acta Horticulturae 430: 709-710.
Fauquet CM, Mayo MA, Maniloff J, Desselberger U, Ball LA. 2005. Virus Taxonomy : Eighth Report of the International Committee on the Taxonomy of Viruses. London: Elsevier, 1217 pp.
Fajolu OL, Wen RH, Windham AS, Windham MT, Moulton JK, Hajimorad MR. 2009. Genetic variability and phylogenetic analysis of hosta virus X. Archives of Virology 154: 1909-1916.
Fujita N. 1979. The genus Hosta in Japan. The American Hosta Society Bulletin 10: 14- 43.
86 Forster RLS, Beck DL, Guilford PJ, Voot DM, Van Dolleweerd CJ, Andersen MT. 1992. The coat protein of white clover mosaic potexvirus has a role in facilitating cell-to- cell transport in plants. Virology 191: 480-484.
Geering ADW, Thomas JE. 1999. Characterisation of a virus from Australia that is closely related to papaya mosaic potexvirus. Archives of Virology 144: 577-592.
Galiakparov N, Tanne E, Sela I, Gafny R. 1999. Infectious RNA transcripts from grapevine virus A cDNA clone. Virus Genes 19: 235-242.
Gleason ML, Daughtrey ML, Chase AR, Moorman GW, Mueller DS. 2009. Diseases of herbaceous perennials. APS press. 281p.
Gorbalenya A, Koonin E. 1993. Helicases: amino acid sequence comparisons with structure-function relationships. Current Opinion in Structural Biology 3: 419-429.
Gordon K, Fütterer J, Hohn T. 1992. Efficient initiation of translation at non-AUG triplets in plant cells. Plant Journal 2: 809–813.
Grenfell D. 1990. Hosta: The flowering foliage plant. Portland, Oregon: Timber Press. p 188-193.
Gunduz I, Buss GR, Chen P, Tolin SA. 2004. Genetic and Phenotypic Analysis of Soybean mosaic virus Resistance in PI 88788 Soybean. Phytopathology 94: 687-692.
Hall MC, Matson SW. 1999. Helicase motifs: the engine that powers DNA unwinding. Molecular Microbiology 34: 867-877.
Hammond J, Reinsel MD, Maroon-Lango, CJ. 2006. Identification of Potexvirus Isolates from Creeping Phlox and Trailing Portulaca as Strains of Alternanthera Mosaic Virus, and Comparison of the 3-Terminal Portion of the Viral Genomes. Acta Horticulturae 722: 71-77.
Han YT, Tsai CS, Chen YC, Lin MK, Hsu YH, Meng M. 2007. Mutational analysis of a helicase motif-based RNA 5'-triphosphatase/NTPase from bamboo mosaic virus. Virology 367: 41-50.
87 Hasiow-Jaroszewska B, Borodynko N, Pospieszny H. 2009. Infectious RNA transcripts derived from cloned cDNA of a pepino mosaic virus isolate. Archives of Virology 154: 853-856.
Hirose T, Ideue T, Wakasugi T, Sugiura M. 1999. The chloroplast infA gene with a functional UUG initation codon. Federation of the Societies of Biochemistry and Molecular Biology Letters 445:169-172.
Holy S, AbouHaidar MG. 1993. Production of infectious in vitro transcripts from a full- length clover yellow mosaic virus cDNA clone. Journal of General Virology 74 (4): 781- 784.
Huang YL, Hsu YH, Han YT, Meng M. 2005. mRNA guanylation catalyzed by the S- adenosylmethionine-dependent guanylyltransferase of bamboo mosaic virus.Journal of Biological Chemistry 280: 13153–13162.
Huang YW, Hu CC, Lin NS, Tsai CH, Hsu, YH. 2008. In vitro replication of Bamboo mosaic virus satellite RNA. Virus Research 136: 98-106.
Hull R. 2002. Matthews’ Plant Virology. San Diego, CA: Elsevier Academic Press. p. 37.
Hsu HT, Chou YL, Tseng YH, Lin YH, Lin TM, Lin NS, Hsu YH, Chang BY. 2008. Topological properties of the triple gene block protein 2 of Bamboo mosaic virus. Virology 379: 1-9.
Jelkmann W, Maiss E, Martin RR. 1992. The nucleotide sequence and genome organization of strawberry mild yellow edge-associated potexvirus. Journal of General Virology 73: 475-479.
Johnson F. 1942. The complex nature of white clover mosaic. Phytopathology 32: 103- 116.
Jones DT, Taylor WR, Thornton JM. 1992. The rapid generation of mutation data matrices from protein sequences. Computer Applications in the Biosciences 8: 275–282.
Kadare G, Haenni AL. 1997. Virus-encoded RNA helicases. Journal of Virology 71: 2583-2590.
88 Komatsu K, Yamaji Y, Ozeki J, Hashimoto M, Kagiwada S, Takahashi S, Namba S. 2008. Nucleotide sequence analysis of seven Japanese isolates of Plantago asiatica mosaic virus (PlAMV): a unique potexvirus with significantly high genomic and biological variability within the species. Archives of Virology 153: 193-198.
Koonin EV, Dolja VV, Morris TJ. 1993. Evolution and Taxonomy of Positive-Strand RNA Viruses: Implications of Comparative Analysis of Amino Acid Sequences. Critical Reviews in Biochemistry and Molecular Biology 28: 375-430.
Lawrence DM, Hillman BI. 1994. Synthesis of infectious transcripts of blueberry scorch carlavirus in vitro. Journal of General Virology 75 (9): 2509-2512.
Lewandowski DJ, Dawson WO. 1998.Deletion of internal sequences results in tobacco mosaic virus defective RNAs that accumulate to high levels without interfering with replication of the helper virus. Virology 251: 427–437.
Lewandowski DJ. 2008. Hosta virus X. Ohio State University Fact Sheet. HYG 3069-08. http://ohioline.osu.edu/hyg-fact/3000/pdf/3069.pdf.
Li WZ, Qu F, Morris TJ. 1998. Cell-to-cell movement of turnip crinkle virus is controlled by two small open reading frames that function in trans. Virology 244: 405- 416.
Li YI, Chen YJ, Hsu YH, Meng M. 2001. Characterization of the AdoMet-dependent guanylyltransferase activity that is associated with the N terminus of bamboo mosaic virus replicase. Journal of Virology 75:782–788.
Lin MT, Kitajima EW, Cupertino FP, Costa CL. 1977. Partial purification and some properties of bamboo mosaic virus. Phytopathology, 67(12): 1439-1443.
Lockhart BEL. 2006. Occurrence of Arabis mosaic virus in Hostas in the United States. Plant Disease 90: 834.
Lockhart BEL, Daughtrey ML. 2008. First Report of Alternanthera mosaic virus Infection in Angelonia in the United States. Plant disease 92(10): 1473.
Lockhart BEL, Currier S. 1996. Viruses occurring in Hosta spp. in the USA. Acta Horticulturae 432: 62-71.
89 Longstaff M, Brigneti G, Boccard F, Chapman S, Baulcombe D. 1993. Extreme resistance to potato virus X infection in plants expressing modified components of the putative viral replicase. EMBO Journal 12: 379–386.
Maat DZ. 1976. Two potexviruses in Nerine. Acta Horticulturae 59: 81-82.
Maekawa, F. 1940. The genus Hosta. Journal of the Faculty of Science 5: 394-397.
Mahajan SK, Chisholm ST, Whitham SA, Carrington JC. 1998. Identification and characterization of a locus RTM1that restricts long distance movement of tobacco etch virus in Arabidopsis thaliana. The Plant Journal 14: 177-186.
Martelli GP, Adams MJ, Kreuze JF, Dolja VV. 2007. Family Flexiviridae: a case study in virion and genome plasticity. Annual Review of Phytopathology 45: 73-100.
Mathew B. 1988. Hostaceae a new name for the invalid Funkiaceae. Kew Bulletin 43 (2): 302.
Meshi T, Ishikawa M, Motoyoshi F, Semba K, Okada Y. 1986. In vitro transcription of infectious RNAs from full length cDNAs of tobacco mosaic virus. Proceeding of the National Academy of Sciences 83: 5043-5047.
Mowat WP. 1982. Pathology and properties of tulip virus X, a new potexvirus. Annals of Applied Biology 101: 51–63.
Momol MT, Dankers H, Adkins S. 2003. First report of Tomato spotted wilt virus in hosta in Florida. Online. Plant Health Progress doi:10.1094/PHP-2003-1024-01-HN.
Mori M, Mise K, Kobayashi K, Okuno T, Furusawa I. 1991. Infectivity of plasmids containing brome mosaic virus cDNA linked to the cauliflower mosaic virus 35S RNA promoter. Journal of General Virology 72(2): 243-246.
Moskovitz Y, Goszczynski DE, Bir L, Fingstein A, Czosnek H, Mawassi M. 2008. Sequencing and assembly of a full-length infectious cloneof grapevine virus B and its infectivity on herbaceous plants. Archives of Virology 153: 323–328.
90 Mueller D, Gleason M, Lewis D, Jeffers S, Edmunds B, Warfield C, Williams- Woodward J. 2005. Hosta diseases and Pests. http://www.extension.iastate.edu/Publications/SUL14.pdf
Park MH, Ryu KH. 2003. Molecular evidence supporting the classification of Hosta virus X as a distinct species of the genus Potexvirus. Archives of Virology 148: 2039- 2045.
Petty ITD, Jackson AO. 1990. Two forms of the major barley stripe mosaic virus nonstructural protein are synthesized in vivo from alternative initiation codons. Virology 177: 829-832.
Pierce WH. 1935. The identification of certain viruses affecting leguminous plants. Journal of Agricultural Research 51: 1017-1039.
Pooggin MM, Fütterer J, Skryabin KG, Hohn T. 2001. Ribosome shunt is essential for infectivity of cauliflower mosaic virus. Proceedings of the National Academy of Sciences of the United States of America 98: 886-891.
Rozanov MN, Koonin EV, Gorbalenya AE. 1992. Conservation of the putative methyltransferase domain: a hallmark of the 'Sindbis-like' supergroup of positive-strand RNA viruses. Journal of General Virology 73 (8): 2129-2134.
Rozen S, Skaletsky HJ. 2000. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp 365-386.
Ryu KH, Park MH, Lee JS. 2002. Occurrence of mosaic disease of hosta plants caused by Hosta virus X. Plant Pathology Journal 18(6): 313-316.
Ryu KH, Park MH, Lee MY, Lee JS. 2006. Characterization and seed transmission of Hosta virus X isolated from Hosta plants. Acta Horticulturae 722, 91-94.
Rush MC. 1970. Serological Strains of Tobacco Ringspot Virus Transmitted by Xiphinema americanum 1. Journal of Nematology 2(3): 265-269.
Sakurai T .2004. Distinct efficiencies of Impatiens necrotic spot virus transmission by five thrips vector species (Thysanoptera: Thripidae) of tospoviruses in Japan. Applied Entomology and Zoology 39(1): 71-78.
91 Shevchuk NA, Bryksin AV, Nusinovich YA, Cabello FC, Sutherland M, Ladisch S. 2004. Construction of long DNA molecules using long PCR-based fusion of several fragments simultaneously. Nucleic Acids Research 32: e19.
Sit TL, AbouHaidar MG. 1993. Infectious RNA transcripts derived from cloned cDNA of papaya mosaic virus: effect of mutations to the capsid and polymerase proteins. Journal of General Virology 74 (6): 1133-1140.
Song S, Song J, Kim C, Lee J, Choi Y. 1998. Molecular characterization of the garlic virus X genome. Journal of General Virology 79: 155-159.
Stone OM. 1980. Two new potexviruses from monocotyledons. Acta Horticulturae. 110: 59-63.
Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) Software Version 4.0. Molecular Biology Evolution 24: 1596-1599.
Tremblay MH, Majeau N, Gagne ME, Lecours K, Morin H, Duvignaud JB, Bolduc M, Chouinard N, Pare C, Gagne S, Leclerc D. 2006. Effect of mutations K97A and E128A on RNA binding and self assembly of papaya mosaic potexvirus coat protein. Federation of European Biochemical Societies Journal 273: 14–25.
Turpen TH, Turpen AM, Weinzettl, N, Kumagai, MH, Dawson WO. 1993. Transfection of whole plants from wound inoculated with Agrobacterium tumefasciens containing cDNA of tobacco mosaic virus. Journal of Virological Methods 42: 227-240.
USDA Floriculture crops 2008 Summary. 2009. http://www.nass.usda.gov/Publications/Todays_Reports/reports/floran09.pdf
Van de Wetering F, van der Hoek M, Goldbach R, Peters D. 1999. Differences in tomato spotted wilt virus vector competency between males and females of Frankliniella occidentalis. Entomologia Experimentalis et Applicata 93: 105-112.
Verchot-Lubicz J. 2005. A New Cell-to-Cell Transport Model for Potexviruses. Molecular Plant-Microbe Interactions 18: 283-290.
Verchot-lubicz J, Chang-Ming Y, Bamunusinghe D. 2007. Molecular biology of potexviruses: recent advances. Journal of General Virology 88: 1643-1655.
92 Vishnichenko VK, Zavriev SK. 2001. Detection of infectious viral particles in plant protoplasts inoculated with transcripts of full-length shallot virus X cDNA. Archives of Virology 146, 1213-1217.
Vives MC, Martin S, Ambros S, Renovell A, Navarro L, Pina JA, Moreno P, Guerri J. 2008. Development of a full-genome cDNA clone of Citrus leaf blotch virus and infection of citrus plants. Molecular Plant Pathology 9(6): 787-797.
Yu HH, Wong SM. 1998. Synthesis of biologically active cDNA clones of cymbidium mosaic potexvirus using a population cloning strategy. Archives of Virology 143: 1617- 1620.
Zilis, MR. 2009. The Hostapedia. Rochelle, IL: Q & Z Inc. p. 9-13.
Zonneveld BJM, Iren F. 2001. Genome Size and Pollen Viability as Taxonomic Criteria: Application to the Genus Hosta. Plant Biology 3(2): 176-185.
93