Mrna for Surface Immunoglobulin Y Chains Encodes a Highly Conserved

Proc. Nati Acad. Sci. USA Vol. 79, pp. 2008-2012, March 1982 Immunology

mRNA for surface immunoglobulin y chains encodes a highly conserved transmembrane sequence and a 28-residue intracellular domain (alternative RNA processing/B-lymphoma cDNA clones/antigen receptor/memory B cells/membrane gene segments) BRETT M. TYLER, ALAN F. COWMAN, STEVEN D. GERONDAKIS, JERRY M. ADAMS, AND ORA BERNARD Molecular Biology Laboratory, The Walter and Eliza Hall Institute of Medical Research, P.O. Royal Melbourne Hospital, Victoria 3050, Australia Communicated by G. J. V. Nossal, December 18, 1981

ABSTRACT To probe the structure of the y heavy chain of (16) that 2PK-3 synthesizes a 1.9-kb y2aS mRNA and a 3.9-kb membrane IgG and the mRNA and gene segments that encode it, y2am mRNA with distinct 3' ends. 2PK-3 also contains a 3.5-kb we have analyzed cDNA clones derived from a yV membrane RNA membrane Vy RNA (16) which is probably analogous to certain of B lymphoma 2PK-3. The nucleotide sequence of the clones in- transcripts of the C, gene that lack V regions but are correctly dicated that membrane yV chains bear a COOH-terminal 71-res- spliced in the C and membrane regions (17). We have now idue segment that is absent from secretory yV chains. This ter- isolated several membrane yV cDNA clones from this RNA. minus includes a 26-residue hydrophobic transmembrane region Their nucleotide sequences indicate that membrane y chains homologous to that ofmembrane ,I chains and, significantly, a 28- have a hydrophobic transmembrane sequence surprisingly ho- residue intracellular domain found only on y chains. The extra mologous to that of, plus a 28-amino acid intracellular domain domain suggests that receptor IgG, on memory B cells, may gen- A, erate adifferent signal on bindingantigen than does receptor IgM, specific to ychains. This extra domain suggests that membrane on virgin B cells. The Vi membrane terminus is encoded by two IgG generates a signal different from that of IgM on binding gene segments 1.5 and 2.4 kilobase pairs downstream from the C,,1 antigen. We also show that membrane gene segments for dif- gene, and -homologous segments occur 3' to the C-,2a and C-A ferent subclasses of y chain are organized similarly and that ym genes. Small amounts of membrane y mRNAs persist in plasma- mRNA occurs even in IgG-secreting plasmacytomas. cytomas secreting IgGI, IgG2a, or IgG2b, suggesting that com- petition between alternative RNA processing pathways governs MATERIALS AND METHODS the synthesis of membrane and secretory y chain mRNAs. Construction of cDNA Clones. Poly(A)+RNA (140 ,ug) isolated (17) from 2PK-3 tissue culture cells was size fractionated Immunoglobulin can either be secreted as antibody or serve on on a 10-40% sucrose gradient. Double-stranded cDNA was the membrane as the antigen receptor of a B lymphocyte (1). constructed (18) from RNA fractions (-10 ,ug) containing mem- The COOH-terminal constant (C) regions of the heavy chain brane y sequences and cloned by dGdC tailing (18) into the Pst determines whether the molecule will be secreted or bound to site of pBR322. Transformants identified by colony hybridiza- the membrane (2). In the best studied case, IgM (2-6), the se- tion (19) with membrane y sequences (see text) were purified cretory heavy chain (ij) has a 20-residue hydrophilic terminus and plasmid DNA was isolated (18). and the membrane ,u chain (Im) has a 41-residue hydrophobic Nucleotide Sequence Determination. Insert sequences from terminus that spans the membrane. The /im and 1,i mRNAs the clone VyML.3 were isolated on 5% acrylamide gels after have correspondingly distinct 3' termini generated by alter- digestion with Rsa I or Hpa II. The fragments were cut further native RNA processing pathways (4-6). The ,us terminus is en- as outlined in Fig. 1B, labeled at their 5' ends by using polynu- coded contiguously to CH4 whereas the two gene segments for cleotide kinase (20) or at their 3' ends by using the large frag- the gum terminus lie 1.85 kilobases (kb) downstream (6). The ment of DNA polymerase I (20), recut with another enzyme, other major membrane immunoglobulin, IgD, also has distinct and purified on 8% acrylamide gels. Sequence determination mRNAs and gene segments for the membrane and secretory by partial chemical degradation was essentially as described chains (7-8). (20). For sequence determination by chain termination (21), the Whereas IgM and IgD occur primarily on virgin B cells (9), large Rsa I fragment was digested with Hae III or Sau3A and the other surface immunoglobulin classes, such as IgG, appear cloned into the HincII or BamHI sites, respectively, of to be associated with memory B cells (10, 11). Little is known M13mp7.1 (a gift from G. Brownlee). Recombinant plaques ofthe structure of membrane IgG or whether the signal that it were analyzed as described (21). The sequencing primer, generates on binding antigen differs from that transmitted by dNTPs, and ddNTPs were from Collaborative Research. membrane IgM (12). The size of the ym polypeptide suggests a specific membrane terminus of at least 7,000 daltons (13, 14) RESULTS and the recently published nucleotide sequences of putative membrane Vy and V2b gene segments suggest that part of this Isolation ofMembrane yV cDNAClones. To clone sequences terminus is similar to the gUim terminus (15). from the membrane Vy or V2& RNAs of 2PK-3 (16), approxi- To define the structure ofmembrane ychains, a prerequisite mately 40,000 cDNA clones were constructed from poly(A)+RNA to understanding howreceptor IgG functions, we have analyzed enriched for membrane species on sucrose gradients. By using mRNA from the B lymphoma 2PK-3, which produces both genomic membrane V2a or y3 probes (b and c in Fig. 2) defined membrane and-secretory IgG2a (13). We have previously shown previously by hybridization to 2PK-3 mRNA (ref. 16; S. Nakai and T. Honjo, personal communication), five membrane y The publication costs ofthis article were defrayed in part by page charge cDNA clones were identified, with inserts of 0.4 to 2.5 kb. payment. This article must therefore be hereby marked "advertise- ment" in accordance with 18 U. S. C. §1734 solely to indicate this fact. Abbreviations: C region, constant region; kb, kilobase(s). 2008 Downloaded by guest on September 24, 2021 Immunology: Tyler et al. Proc. Natl. Acad. Sci. USA 79 (1982) 2009

A 1 200bp 1

ao "s 0 cf 0y X a. i: >- 0 6)~~~~V I~ I I II I £I I,r,I T xM1.1 I CH II CH2 I CH3 I M I 3'UT H I XM1.2 I I XM1.3

B 100 bp

CH3 M 3'UT Avall AvaI Ava \ m Haem Sau3A m Sau3A Hinf H aem Sau3A Rsa Sau3A Hif K I l l 1 1- 1 r a I I

--_, ------I I---. FIG. 1. Membrane yj cDNA clones from 2PK-3. (A) Restriction maps of three clones. Only one of the three Hinf sites in yM1.1 is shown. The unmarked horizontal line indicates a probe fragment. (B) Sequence determination strategy for yM1.3. Solid and broken lines indicate fragments analyzed by chemical degradation from the 5' and 3' ends, respectively; wavy lines indicate those analyzed in M13.

Although the yj and Y2a RNAs were ofcomparable abundance, membrane Yi sequences, the 3' half of yM1.1 (Fig. 1A) was it happened that all five clones derived from the ==3.5-kb mem- hybridized to mRNA from 2PK-3 and from plasmacytoma brane yj RNA. Restriction maps of three ofthem are shown in MOPC 21, which produces both membrane and secretory IgGC Fig. 1A. All restriction sites in CH1 to CH3 fit the C.Y sequence (23). The cDNA clone hybridized strongly to the 3.5-kb mem- (22). The two longest clones, yM1. 1 and 'yMl.2, contained 1.5 brane )yi RNA of2PK-3 (arrow, Fig. 3, lane a). Moreover, lane kb 3' to CH3 not present in secretory Yi mRNA (22) and hence b shows that the probe hybridized strongly to the 3.9-kb pre- included the 5' 70% of the "2-kb 3' untranslated region (16). sumptive membrane Yi mRNA in MOPC 21. (The hybridization yM1.3 contained only the 5' 0.8-kb of this region. to the 1,000-fold more abundant yls mRNA presumably reflects To confirm that the 3' region of the clones corresponded to trace CY,1 contamination of the probe.) 5- Aval Sma 3' CXWI| td[amRa Sma Hha Kpn Hha Hha EcoRi Aval Hha Aval Kpn B912 CH1 ^ H| CH2 CH3_ 3S ~~~~~~~1.50kb 0.81kb Cv lM2 o2a Barnan PtPst Sn~Sma Hhah 1 638Bgl12 Hha BgI2 Hind Xba Barn I ~~~~~~1.38kb m0-47kb ~ii.- -

C b ' 1 "63 Barn Kpn Pst Hha Rsa Xba Hind3 I ~~~~~~1-42kb m0-50kb a c 0X2b Bam I >- Kpn Kpn Hha Bam EcoRl - * _- l Ia I _I .I - - - 1-36kb - 0 57ko --

COu I lkb -aZ..-E .fX- 1f .164 :.::.::.:.:.:.:3 1-85kb - - CH1 CH2 CH3 CH4 S Ml M2 FIG. 2. Gene segments for membrane immunoglobulin heavy chains. CH1, H, CH2, and CH3 encode the C region domains, S encodes the secretory mRNA 3' terminus, and Ml and M2 encode the membrane mRNA 3' terminus (see text). The CH3-M1 and M1-M2 distances shown derive from measurements of >20 heteroduplex molecules each, the standard errorbeing always less than ± 0.05 kb. In the M2 segments, solidbars indicate coding sequences, stippled bars are 3' untranslated regions, and open bars are stretches of low homology (<50%) to the y1 cDNA clones. The segment of M2,2a mapped by nuclease S1 digestions (see Fig. 4D) is shown by the broad arrow. Probes are shown by lettered horizontal lines. Restriction sites underlined in the y1 M1 and M2 segments are shared with the yi cDNA clones. In the y2a and y3 clones only Pst, Sma, and Rsa sites defining probes are shown, marked with asterisks. Downloaded by guest on September 24, 2021 2010 Immunology: Tyler et aL Proc. Natd Acad. Sci. USA 79 (1982) a b c d e f g h mRNA. Lane h in Fig. 3 shows that the probe hybridized with comparable efficiency to y2a, and 'y2am mRNA. More defini- tively, the nucleotide sequence (not shown) across the hinge 3.9 region ofthe membrane yi clone yM1. 1, determined from the __ 3.5 Hinfsite in Fig. 1A, was identical to that ofsecretory yV mRNA (22). is Similar Organization for Membrane and V3 Gene .Aa i q - 1.9 yl, V2., I, 1.E Segments. To map the gene segments for the different subclasses of membrane y chains, we formed heteroduplexes between yML. 1 or yM1.2 and cloned genomic fragments containing the C1, CG*, or CG gene. Examples are shown in Fig. 4 A, B, and C, respectively. Fig. 2 shows the deduced positions of the membrane Vyi, A&, and y3 gene segments plus, for com- FIG. 3. Identification of cDNA clones and detection of yA RNA in parison, the recently proposed membrane V2b gene segments plasmacytomas. Poly(A)+RNA (1 Zg per lane in a-e and h; 3 uig in f (15) and the jLlm gene segments (6). In each case studied here, and g) was fractionated on 5 mM MeHgOH/1.5% agarose gels (24), a transferred to modified paper (24), and hybridized overnight at 420 C short (==0.15 kb) segment (Ml), contiguous to CH3 in the with probe (2-5 x 10' cpm/ml) in a hybridization solution (24) con- cDNA clone, hybridized about 1.4 kb 3' to the genomic CH3 taining 50% formamide and 1 M Na'. Probe fragmentspurified by segment. For li, the remainder of the cDNA clone hybridized, polyacrylamide gel electrophoresis were labeled with 32p by nick- apparently continuously, to a second genomic region (M2) lying translation (25). RNA was isolated (17) from: lanes a, c, andh, cultured 0.81 kb 3' to Ml. No other intervening sequences were ob- 2PK-3 cells; lane b, MOPC 21 tumors; lane d, MOPC 173 tumors; lane served, although any less than 100 bp may have been missed. e, HOPC 1 tumors; lane f, cultured MPC 11.45.6.2.4 cells; lane g, 2PK- The 3 tumors. Probes: for lanes a and b, the yM1.1 3' probe in Fig. 1A; for V2a and Vy M2 segments were located about 0.5 kb 3' to c-g, y2am probe (b in Fig. 2); for h, hinge (a in Fig. 2). Ml but were only partially homologous to the Vy cDNA se- y2. quence because, even at the low stringency used (tm - 350C; ref. 26), there were always regions of nonhybridization (Fig. 4 Membrane mRNA for Three Subclasses ofyChains in Plas- B and C). macytomas. To look for mRNA for other subclasses ofVm chains To confirm the position of the A& M2 segment using y2am and to determinewhether, like MOPC 21, other plasmacytomas mRNA, a genomic fragment spanning the 5' end of M2 (b in produced Vm mRNA, we hybridized a genomic membrane y2a Figs. 2 and 4D) was labeled at the Bgl II site within M2 and probe (b in Fig. 2) to poly(A)+RNA from several plasmacytomas. hybridized to 2PK-3 poly(A)'RNA. The distance between the In Fig. 3, lanes c and g show the expected strong hybridization 5' end of M2 and the Bgl II site was then determined by di- ofthis probe to 2PK-3 3.9-kb y2an mRNA. The probe also de- gesting the RNADNA hybrids with Si nuclease (29). Fig. 4D tected small amounts of 3.9-kb Vm RNA (-0.2 molecules per shows that a 390-bp sequence 5' to the Bgl II site was protected cell) in the IgG2a-secreting plasmacytomas MOPC 173 (lane d) by the y2am mRNA, placing the 5' end of M2 within 40 bp of and HOPC 1 (lane e). MPC11.45.6.2.4 tissue culture cells (lane the position indicated by the heteroduplexes to the Vi cDNA f), which secrete IgG2b, contained larger amounts (=5 mole- clone. cules per cell) of a 3.9-kb Vm RNA which also proved to carry Nucleotide Sequence of the Membrane yV COOH Termi- the MPC11 VH region (E. Webb, personal communication). nus. The sequence of the membrane-specific region of yMl.3 Lane g shows hybridization to the same amount of 2PK-3 was determined by the strategy in Fig. 1B. The sequence (Fig. mRNA. Hence, a 3.9-kb membrane mRNA appears to be com- 5) encodes a 71-amino acid membrane COOH terminus plus mon to at least three of the four subclasses of V chains. 523 nucleotides of the 3' untranslated region. The splice be- Hinge Regions of Membrane and Secretory y Chains Are tween the Vy membrane sequence and CH3 falls within the Identical. Membrane V2 chains of2PK-3 were reported to lack codon for the penultimate residue (glycine) of the secretory a serological determinant that appeared to map in the hinge chain (22), as predicted (4, 16). The first 131 nuceotides ofthe region ofsecretory Y2a chains, and it was suggested that Vm and membrane sequence match the proposed genomic Vi Ml seg- V chains might have different hinges (13). To test this, we hy- ment (15). Thus, no membrane encoding segments lie between bridized a secretory V2a hinge probe (a in Fig. 2) to 2PK-3 CH3 and Ml. The remainder of the membrane Vy translated

A. B C D 1 1100rlt 3POr1t M2- -mRNA ml -M2 I MI, + mRNA ml 4 kb 1kb I';1I2ml CX2a M2 I 2 1kb 5' Li 117 I 3' .-A 1 100rnt I pGI 3 2 pG2l pG3 I. ig !E3 1 . I5 SI SZziI X'2 - =/- F4 H \ -: I 2-1--! s 390i 1 2 1a ig rIiC22 U3:1rf1lP1s +3 XM1 1 .3 VMI2 -FiRN:~'

FIG. 4. Identification of genomic membrane sequences. (A-C) Heteroduplexes between cDNA and yi, Vy2a, or y3 genomic sequence, respectively, constructed and spread at low stringency (26). Each is representative of at least 20 similar molecules. In the diagrams, broken lines indicate vector and solid lines indicate inserts. (A) yM1.1 and pG1.3B2 DNAs, both digested with BamHI; (B) yM1.1 DNA digested with Bgl plus Sal, and Sal- digested pG2.1B10 DNA; and (C) 'yM1.2 and pG3.1B/H DNAs (27) both digested with BamHI. pG1.3B2 and pG2.1B1O are BamHI subelones of the CY, and Ca2 clones G1.3 and G2.1, respectively, which were constructed fromBamHI fragments of T lymphoma ST4 DNA by using the vector A1059 (28). The inserts commence atBamHl sites in CH1 and extend 12.3 kb (G1.3) or5.4kb (G2.1) downstream. (D) Nuclease digests of RNA-DNA hybrids to y2a mRNA. Fragment b (Fig. 2) was labeled at its 5' ends with 32P and hybridized to 2 lag of 2PK-3 poly(A)+RNA as described (16). RNA-DNA hybrids plus 1 Zgof carrier DNA were digested with 1.5 unit of S1 nuclease (29) for30 min at450C andthen fractionated ona 7 M urea/5% acrylamide gel. The band at 1,100 nucleotides (nt) is due to rehybridized DNA. In the diagram, the asterisk denotes the label. Downloaded by guest on September 24, 2021 Immunology: Tyler et al. Proc. Natl. Acad. Sci. USA 79 (1982) 2011

CH3 -H3 1 10 20 30 ProGlyLeuGlnLeuAspGluThrCysAlaGluAlaGlnAspGlyGluLeuAspIlyLeuTrpThrThrI leThrI lePheIleSerLeuPheLeuLeuSerValCysTyrSerAlaAla CCTGGGCTGCAACTGGACGAGACCTGTGCTGAGGCCCAGGACGGGGAGCTGGACGGGCTCTGGACGACCATCACCATCTTCATCAGC:CTCTTCCTGCTCAGCGTGTGCTACAGCGCTGCT 40 MsoI^.M2 50 60 70 ValThrLeuPhfLysValLysTrpIlePheSerSerValValGluLeuLysGlnThrLeuValProGluTyrLysAsnMetIleGlyGlnAlaPro GTCACACTCTTCAGGTAAAGTGGATCTTCTCCTCGGTGGTGGAGCTG-GCAGACACTGGTTCCTGATACAAGACATGATTGGGCAGCGCCCTAGGCCACCTCTTGTAATGGCAGG

CATTGCCATGACCTGCCAT (C) 36

FIG. 5. Nucleotide sequence of the membrane Yi mRNA 3' terminus. The boundaries of CH3, Ml, and M2 were determined by reference to published C-Y (22) and membrane Yi and Y2b (15) genomic sequences. Stars separate functional segments of the amino acid sequence (see text), triangles indicate splice points (see text), and the heavily underlined TGG codon reads TGA in the gm sequence (see text). region is 80% homologous to the T2b M2 sequence tentatively ing plasmacytomas (Fig. 3; ref. 15) parallels the occurrence of identifed by Rogers et aL (15), confirming their identification small amounts of tkm mRNA in IgM-secreting plasmacytomas and indicating that no genomic coding regions lie between Ml and hybridomas (4). It suggests that processing of primary im- and M2. munoglobulin gene transcripts into membrane or secretory Significantly, the Tm COOH terminus is larger than that of mRNAs is determined by competing membrane- or secretory- ALm. Whereas the /Lm coding sequence terminates with TGA four specific enzymes (6). The y, gene segment, which encodes only codons beyond the transmembrane region (see Discussion), in one residue, lies contiguous to y CH3 (22). Hence, there may Tym this codon (heavily underlined in Fig. 5) is TGG (trypto- be specific termination ofa secretory precursor RNA upstream phan) and a further 25 amino acids are encoded. The TGG did of Ml, analogous to the regulated termination of transcription not arise in yMl.3 from a termination codon (TAG or TGA) by in A phage (30). Alternatively, there could be a "splice versus a cloning artefact because an independent clone, yMl. 1, had slice" mechanism: acommon precursor spanning the membrane the same sequence. Because the T2b M2 sequence also reads gene segments could be spliced from y CH3 to Ml to yield the TGG at this position (15), it is unlikely that the TGG in the membrane mRNA or could be cleaved (sliced) at the secretory cDNA clones arose by mutation of the 2PK-3 Cyl gene and it poly(A) addition site to yield secretory mRNA (31). is probable that the additional coding region is common to the four C.Y genes. CH31 Hinge' Transmembrane DISCUSSION yi HSP GLDLDE'FCAEAQDGELD GLWTTITIFISLFLLSV Y2b RSP GLDLDDICAEAKDGELD GLWTTITIFISLFLLSV Conserved Arrangement for Membrane Heavy Chain Gene , KSI EGEVNAEEEGFE NLWTTASTFIVLFLLSL Segments. We have used heteroduplexes with membrane Ty CH4II 10 17 20 30 cDNA clones and nuclease digestion experiments with mem- Intracellular brane y& mRNA to identify the two coding regions (Ml and M2) CYSAAVTLF KVKWIFSSWRLKQTLVPEYKNMIGQAP for the 3' termini of z2bCYSASVTLF KVKWIFSSVVELKQKILPDYGNMIGQGA membrane Y1, T2a) and y3 mRNAs (Fig. 2). p FYS]ITVLF KVK Our positioning ofthe yi and y& Ml segments matches that of 40 43 50 60 70 the Ml segment recently proposed from genomic nucleotide MIM2 sequences (ref. 15; Y. Yamawaki-Kataoka and T. Honjo, personal communication). Our cDNA sequence also confirms by C homology the proposed Ml and M2 gene segments of T2b (15) and for yi, y2a, and T2b (Y. Yamawaki-Kataoka and T. Honjo, personal communication). (This accord also removes any doubt that the 2PK-3 Ty RNA is properly spliced in its 3' region.) As F-L-G shown in the Fig. 2, arrangement of the membrane gene seg- L-L ments is virtually identical for the four y subclasses. Ml, which _S-- encodes the first 44 amino acids, is located about 1.4 kb downstream from CH3. M2, which encodes the last 27 amino acids plus at least 1.3 kb ofthe =2-kb 3' untranslated region (ref. 15; _-WI TV- this paper), is located ==0.5 kb 3' to Ml (0.8 kb for Ty). The F nearly identical sizes of the ym mRNAs for the different sub- Side I Si)u classes (Fig. 3; ref. 15) suggests that the length of M2 has also FIG. 6. Comparisonof yl, Y2b, and ,umembrane COOHtermini and been conserved. The um gene segments (6) are arranged sim- structure of membrane IgG. (A) COOH-terminal sequences of mem- ilarly to y (Fig. 2) and, in particular, the location of the Ml/ brane yj (this paper), Y2b (15), and IL (4) chains. Homologous residues M2 intervening sequence, between the codons for the first two are shaded. The one-letter amino acid code is: A, Ala; C, Cys; D, Asp; intracellular amino acids (see below), is identical. Presumably E, Glu; F, Phe; G, Gly; H, His; I, Ileu; K, Lys; L, Leu; M, Met; N, Asn; the ancestral CH gene had this arrangement, and so the ar- Q, Gln; R, Arg; S, Ser; T, Thr; V, Val; W, Trp; Y, Tyr. (B) Possible struc- rangement of membrane gene segments for IgD, IgE, and IgA ture for membrane IgG (see text). S-S indicates a disulfide bond. (C) Opposing side views of the putative Yi transmembrane a-helix assum- may be very similar. ing 3.6 residues per turn (see text). Circled residues differ in the ,u se- Control of Membrane y mRNA Synthesis in Plasmacyto- quence, a broken-line circle indicating a conservative change. Bold mas. The persistence of low levels of Tm mRNA in IgG-secret- residues indicate hydrophilic hydroxyamino acids. Downloaded by guest on September 24, 2021 2012 Immunology: Tyler et aL Proc. Natd Acad. Sci. USA 79 (1982) Membrane IgG Contains a Highly Conserved Transmem- municating unpublished results, and Jan Holton and Suzanne Dillon brane Sequence and an Intracellular Domain. The membrane for expert technical assistance. This workwas supported by the National yi COOH terminus contains a 26-residue hydrophobic region Health and Medical Research Council (Canberra), The American Heart (residues 18-43) flanked by two hydrophilic regions (Figs. 5 and Association, the U.S. National Cancer Institute (ROl-CA12421), and 6A). Fig. 6B shows a plausible structure for these regions in the Drakensberg Trust. relation to the membrane. The hydrophobic region presumably crosses the membrane because it resembles other transmembrane sequences in hydrophobicity (32-34) and, as an a-helix, 1. Walters, C. S. & Wigzell, H. (1970)J. Exp. Med. 132, 1233-1279. 2. Parkhouse, R. M. E., Lifter, J. & Choi, Y. S. (1980) Nature (Lon- the most likely structure for a transmembrane sequence (8, 15, don) 284, 280-281. 32), would be long enough (3.8 nm) to readily span the lipid 3. Kehry, M., Ewald, S., Douglas, R., Sibley, C., Raschke, W., bilayer. The 18 amino acids joining CH3 to the transmembrane Fambrough, D. & Hood, L. (1980) Cell 21, 393-406. sequence include 6 acidic residues and therefore probably have 4. Rogers, J., Early, P., Carter, C., Calame, K., Bond, M., Hood, little secondary structure, forming a "membrane hinge." In- L. & Wall, R. (1980) Cell 20, 303-312. deed, Staphylococcus aureus protease, which is specific for 5. Alt, F. W., Bothwell, A. L. M., Knopp, M., Siden, E., Mather, appears to E., Koshland, M. & Baltimore, D. (1980) Cell 20, 293-301. acidic residues, preferentially cleave MOPC 21 6. Early, P. W., Rogers, J., Davis, M. M., Calame, K., Bond, M., membrane y, chains within this region (J. Goding, personal Wall, R. & Hood, L. (1980) Cell 20, 313-319. communication). The cysteines in the membrane hinges of a 7. Liu, C.-P., Tucker, P. W., Mushinski, F. & Blattner, F. R. heavy chain dimer probably form an interchain disulfide bridge (1980) Science 209, 1348-1353. because membrane IgGi molecules containing one ym and one 8. Maid, R., Roeder, W., Traunecker, A., Sidman, C., Wabl, M., chain can form disulfide-linked eight-chain immunoglobulin Raschke, W. & Tonegawa, S. (1981) Cell 24, 353-365. %y 9. Coding, J. W., Scott, D. W. & Layton, J. E. (1977) Immunol dimers (J. Goding, personal communication). It is most unlikely Rev. 37, 152-186. that the 28 COOH-terminal residues are removed during pro- 10. Mason, D. W. (1976)J. Exp. Med. 145, 1122-1130. cessing because membrane y chains appear to be 7,000-10,000 11. Okamura, K., Julius, M. H., Tsu, T. & Herzenberg, L. A. (1976) daltons larger than the secretory chain (13, 14) and, without Eur. J. Immunot 6, 467-472. these residues, the difference could only be 4,500 daltons. 12. Metzger, H. (1978) in Contemporary Topics in Molecular Im- Comparison ofthe yi, Y2b, and 1L membrane sequences (Fig. munology, eds. Reisfeld, R. A. & Inman, F. P. (Plenum, New 6A) indicates that the transmembrane region has York), Vol. 19, pp. 119-152. been the most 13. Oi, V. T., Bryan, V. M., Herzenberg, L. A. & Herzenberg, L. conserved. Overall, the yi and V2b membrane sequences have A. (1980)J. Exp. Med. 151, 1260-1274. 59 of71 residues in common, in accord with their 68% homology 14. Word, C. J. & Kuehl, W. M. (1981) Mol Immunol 18, 311-322. over CH1 to CH3 (35), but only 1 residue differs between their 15. Rogers, J., Choi, E., Souza, L., Carter, C., Word, C., Kuehl, transmembrane regions. Furthermore, whereas the ,u chain has M., Eisenberg, D. & Wall, R. (1981) Cell 26, 19-27. a membrane hinge that resembles yonly in charge (-6) and has 16. Tyler, B. M., Cowman, A. F., Adams, J. M. & Harris, A. W. (1981) Nature (London) 293, 406-408. only three intracellular residues, the ,u transmembrane se- 17. Kemp, D. J., Harris, A. W. & Adams, J. M. (1980) Proc. Natl. quence displays the strongest homology to y (17 of 26 residues Acad. Sci. USA 77, 2876-2880. in common) of any part of their C regions. This homology is 18. Cough, N. M., Webb, E. A., Cory, S. & Adams, J. M. (1980) particularly striking because, in general, transmembrane se- Biochemistry 19, 2702-2710. quences ofeven related polypeptides are poorly conserved (33, 19. Grunstein, M. & Hogness, D. S. (1975) Proc. Natl Acad. Sci. USA 34). To examine this homology further, we aligned the trans- 70, 3961-3965. 'y, 20. Maxam, A. M. & Gilbert, W. (1980) Methods Enzymol 65, membrane residues as they would appear in an a-helix. Fig. 6C 499-560. shows opposing side views of such a helix. On side I, many res- 21. Sanger, F., Coulson, A. R., Barrell, B. G., Smith, A. J. H. & idues (circled) differ between u and y. In contrast, the residues Roe, B. A. (1980)1. Mol Biol 143, 161-178. on side II are strongly conserved. Moreover, side II bears sev- 22. Rogers, J., Clarke, P. & Salser, W. (1979) Nucleic Acids Res. 6, eral hydrophilic residues (boldface) which, in an apolar mem- 3305-3321. brane environment, should be strongly interactive. Hence, in 23. Princler, G. L. & McIntire, K. R. (1975) CelL Immunol 15, 197-207. membrane immunoglobulin, this side ofthe helix may associate 24. Alwine, J. C., Kemp, D. J. & Stark, G. R. (1977) Proc. Nati Acad. with another integral membrane protein (see ref. 36) or may Sci. USA 74, 5350-5354. enable pairing of the a-helices in a heavy chain dimer (15). 25. Rigby, P. J. W., Dieckmann, M., Rhodes, C. & Berg, P. (1977) How membrane immunoglobulin signals the binding of an- J. Mol Biol 113, 237-251. tigen is poorly understood except that receptor crosslinking may 26. Tyler, B. M. & Adams, J. M. (1980) Nucleic Acids Res. 8, be involved (12). For instance, membrane IgG having at least 5579-5598. 27. Adams, J. M., Webb, E. A., Gerondakis, S. D. & Cory, S. (1980) one and maybe two unstructured hinge regions could not read- Nucleic Acids Res. 8, 6019-6032. ily transmit an allosteric change from its antigen-binding NH2 28. Karn, J., Brenner, S., Barnett, L. & Cesareni, G. (1980) Proc. terminus to its intracellular COOH terminus. The striking con- Natl Acad. Sci. USA 77, 5172-5176. servation of the presumptive transmembrane a-helix suggests 29. Berk, A. J. & Sharp, P. A. (1977) Cell 12, 721-732. that induction of the signal may require the binding of another 30. Greenblatt, J. (1981) Cell 24, 8-9. membrane protein. The specific intracellular domain of 31. Nevins, J. R. & Darnell, J. E., Jr. (1978) Cell 15, 1477-1493. ym 32. Tomita, M. & Marchesi, V. T. (1975) Proc. Natl Acad. Sci. USA chains, however, indicates that membrane IgG and IgM prob- 72, 2964-2968. ably produce different signals, as suggested for membrane IgM 33. Burnstein, Y. & Schecter, I. (1978) Biochemistry 17, 2392-2400. and IgD (9). Distinct signals in membrane IgM- and IgG-bear- 34. Gething, M. J., Bye, J., Skehel, J. & Waterfield, M. (1980) Na- ing cells could reflect a dichotomy between virgin B cells and ture (London) 287, 301-306. memory B cells (9-11). 35. Yamawaki-Kataoka, Y., Kataoka, T., Naoki, T., Obata, M. & Honjo, T. (1980) Nature (London) 283, 786-789. We thank Alan Harris for 2PK-3 and Mll cells, Jim Goding, Alan 36. Sidman, C., Bercovici, T. & Gitler, C. (1980) Mol Immunol 17, Harris, and Suzanne Cory for stimulating discussions, T. Honjo for com- 1575-1583. Downloaded by guest on September 24, 2021