NGF-TRKA ENDOSOME DYNAMICS, SIGNALING and FUNCTION in SYMPATHETIC NEURON DENDRITES by Kathryn M. Lehigh a Dissertation Submitted

NGF-TRKA ENDOSOME DYNAMICS, SIGNALING AND FUNCTION IN SYMPATHETIC NEURON DENDRITES

by Kathryn M. Lehigh

A dissertation submitted to Johns Hopkins University in conformity with the requirements of the degree of Doctor of Philosophy

Baltimore, Maryland

May, 2016

Abstract

Nerve growth factor (NGF) is the prototypical neurotrophin, playing key roles in cell growth, survival, and target innervation as well as dendritic growth and the formation and maintenance of synaptic connections. Sympathetic neurons are dependent on target- derived NGF for survival and as such have become an exemplary model for studying

NGF function. NGF signals via retrogradely transported NGF-TrkA endosomes. Recently we have discovered the retrograde transport of TrkA endosomes into the dendritic compartment of sympathetic neurons where they may contribute to the formation and organization of synapses. In this study, we developed a real time imaging paradigm to examine the mobility and transport of TrkA in dendrites, comparing findings to TrkA endosome movement and transport in axons and cell bodies. Using this method we observe that after application of NGF to the distal axon compartment of cultured neurons,

TrkA endosomes move in a saltatory manner retrogradely through the axon, slow down or halt in the soma, and move in a bidirectional manner in dendrites. Although TrkA endosomes in dendrites move at a comparable rate to those in axons, their unique dynamics (i.e. more direction changes) result in a smaller net displacement than endosomes in axons. Further, immunocytochemistry using antibodies specific for a TrkA phosphorylated residue (Y785) that supports downstream signaling cascades of the NGF-

TrkA complex demonstrates that retrogradely trafficked TrkA endosomes within dendrites are signaling competent and that P-TrkA positive endosomes juxtapose postsynaptic density complexes, in vitro and in vivo. These findings suggest that target- derived NGF-TrkA endosomes signal within dendrites to form and maintain synapses.

Functional experiments that combine chemical genetics with drug loaded PLGA

ii microspheres allow for spatially specific inhibition of TrkA kinase activity and have revealed that TrkA activity is necessary in the somatodendritic compartment for both synapse formation (in vitro) and maintenance (in vivo). We have achieved the ability to inhibit TrkA kinase activity in dendrites of cultured neurons, observing that retrogradely transported TrkA endosomes signal within dendrites to maintain PSD clusters. This work reveals a novel mode of NGF-dependent synapse formation and maintenance, and the mechanism by which target fields control circuit assembly.

Thesis Advisor and Reader #1 David Ginty, Ph.D. Committee Member and Reader #2 Rick Huganir, Ph.D. Committee Member Mollie Meffert, Ph.D. Committee Member Larry Schramm, M.D. Ph.D.

iii

Acknowledgements

The greatest lesson I have learned through the completion of my dissertation is that both science and life are better as collaborative efforts.

First, I wish to thank my advisor and mentor Dr. David Ginty because his enthusiasm for good, interesting science always invigorated me, and consequently, my project. I think that David is a scientist for all the right reasons and that has created an incredible lab environment in which to learn how to think critically and innovate. I also want to thank the members of my thesis committee who were always willing to discuss the thesis and contributed valuable insights, ideas, and suggestions: Dr. Richard Huganir, Dr. Larry Schramm, and Dr. Mollie Meffert. I am grateful to Rick, for his strong support and encouragement and for volunteering to be a careful reader of this thesis. Larry for generously providing me with hard copies of innumerable papers documenting the history of the sympathetic nervous system and nerve growth factor field--from him I learned to appreciate that our work stands on the shoulders of those who came before us. I am eternally grateful to Mollie for welcoming me into her lab to use her spinning disk microscope; it was there that I first saw the trafficking of endosomes in real time and experienced a memorable moment of joyful discovery. I am also thankful to Beth and Rita in the Hopkins Neuroscience department for getting stuff done, being supportive, and always showing compassion during the difficult moments of graduate school.

The long hours and roller coaster emotions that accompany experimental science turn co- workers into friends. Moving from one university to another turns co-workers into family. I’m grateful to all members of my Hopkins and Harvard Ginty lab family for support, advice, reagents, and scientific discussion. A lab of our size doesn’t run on its own; Dori, Sarah, Jessie, and Steve have been invaluable to making the Ginty lab an excellent home for six years. Particular thanks to past members whom I consider mentors—Coryse, Tony, Kevin, and Tracy, and to current members whom I turn to daily—Lauren, Vicky, and Emily. There’s a forever special bond between myself, Emily, and Krissy, who were not only my baymates but also my roommates through our not always smooth transition.

All of my work has been made possible by incredible core staff members at both Hopkins and Harvard. Thank you Michele Pucak, Huy Vo, Daniel Tom, Lai Ding, Michelle Ocana, and Hunter Eliot for being so conscientious with your work and for taking the time to make my life easier and science better.

I’m so grateful for my friendships forged through grad school trials and tribulations; business meetings with Clint and coffee meetings with Alex, Claudia and Erin are amazing memories. I feel so lucky that I have the most wonderful volleyball, book club, roommate, home and college friendships to rejuvenate me outside of the lab.

Of course, the best support system of all has been my family. I could never thank my Mom and Dad enough for everything they have done for me. Nate has made me beautiful neuron drawings and has listened to every struggle whether in person or in email. Fortunately, he also married Justine who always kept me well fed. Nick, Becky, and Danny are amazing siblings, I’m grateful that they think I’m smart enough to do this and (sometimes) find it cool. Finally, I’m so happy I have Ron, who may have come along last but his support of my career has been the most tangible. Simply put, thanks for moving to Boston and for being my life partner.

Last, I have to express gratitude for the opportunity to pursue my scientific interests, and for the incredible mentorship of Dr. Maria Donoghue who jumpstarted my scientific career. As David once said to me, “as scientists we get to discover things no one else knows, and it really doesn’t get any better than that”.

Table of Contents

Title Page…………………………………………………………………………………..i Abstract……………………………………………………………………………………ii Acknowledgements……………………………………………………………………….iv Table of Contents…………………………………………………………………………vi List of Figures……………………………………………………………………………vii Chapter 1. Introduction……………………………………………………………………1 Chapter 2. Trka endosome dynamics, signaling and function in sympathetic neuron dendrites…………………………………………………………………………………19 Chapter 3. Discussion and Future Directions……………………………………………81 Materials and Methods………………………………………………………………….100 References………………………………………………………………………………112 Curriculum Vitae……………………………………………………………………….127

List of Figures

Figure 2.1. Live cell assay to monitor endogenous receptor TrkA trafficking. Figure 2.2. Dynamics of axonal TrkA endosomes. Figure 2.3. The dynamics of TrkA endosomes in cell bodies. Figure 2.4. Dynamics of TrkA endosomes in dendrites. Figure 2.5. Comparison of TrkA endosome dynamics within different cellular compartments. Figure 2.6. Flag-TrkA endosomes from the target are transcytosed to CB/dendrite plasma membrane. Figure 2.7. Specificity of phosphorylated TrkA antibodies in vitro. Figure 2.8. Target-derived TrkA endosomes in dendrites are signaling competent. Figure 2.9. Target-derived Flag-TrkA endosomes are found in close proximity to PSDs. Figure 2.10. Target-derived signaling endosomes are located in close proximity to PSDs. Figure 2.11. Assay for visualizing target-derived vesicles in vivo. Figure 2.12 Target-derived endosomes containing TrkA are transported into dendrites in vivo. Figure 2.13 Specificity of phosphorylated TrkA antibody in vivo. Figure 2.14 TrkA signaling endosomes are found in close proximity to synapses in vivo. Figure 2.15 Ipsilateral injection of PLGA-1NM-PP1 microspheres results in local inhibition of TrkA kinase activity. Figure 2.16 PLGA-1NM-PP1 microspheres, not control PLGA microspheres, specifically F592A inhibit TrkA kinase activity in TrkA mice. Figure 2.17 Local inhibition of TrkA kinase activity in the SCG decreases number of synaptic puncta. Figure2.18 NGF-TrkA signaling is required for synapse formation in cell body/dendrite compartment. Figure 2.19 PLGA microspheres loaded with 1NM-PP1 inhibit TrkA kinase signaling and PSDs. Figure 2.20 In vitro assay for local inhibition of TrkA kinase activity within dendrites. Figure 2.21 Local TrkA kinase activity maintains synapses.

vii

Figure 3.1 Summary: Target-derived NGF-TrkA endosomes signal for synaptic maintenance.

viii

Chapter 1 Introduction

1.1. The sympathetic nervous system is an important and accessible system for the study of system and circuit formation

At the heart of the study of neuroscience is the question of how individual neurons communicate with one another, coordinating the complex functions that are attributed to the central and peripheral nervous systems. The interconnection of neurons that perform a specific task is referred to as a circuit. The formation of proper neuronal circuitry involves precise axonal targeting, the elaboration of neuronal processes (both axons and dendrites), the formation and maintenance of synaptic connections between groups of neurons intended to communicate, as well as the pruning of improper connections.

Developmental disorders such as autism, schizophrenia, and Tourette’s syndrome are examples of circuits that have developed incorrectly underscoring the importance of these developmental processes as well as the significance of understanding how neural circuits are formed.

Within the sympathetic nervous system are important neural circuits that must develop correctly in order to achieve homeostasis in the body. The sympathetic nervous system works in conjunction with the parasympathetic nervous system to maintain homeostasis of autonomic physiological processes, including the regulation of blood flow, heart rate and contractility, bladder function, endocrine and exocrine gland function and secretion, pupil responsiveness to light, and sexual arousal, among others. While the autonomic nervous system sustains homeostasis in normal conditions, when one is faced with

1 external or internal stressors the sympathetic system is the division of the autonomic system that becomes upregulated, causing what is commonly referred to as the “fight or flight” response. For example, in the presence of a dangerous predator, organisms dilate pupils so they can take in as much information as possible about the predator, increase heart rate and blood flow so more oxygen can get to muscles, and suppress digestion to divert more energy into what is needed for responding to the potential threat. Disorders of the sympathetic and autonomic nervous systems include diabetic peripheral neuropathies, orthostatic hypertension, bowel dysfunctions, and sexual dysfunctions such as erectile dysfunction.

The basic anatomy of the sympathetic nervous system is relatively simple, and thus ideal for studying how circuits are formed during development. In fact, the accessibility of these sympathetic nervous system neurons has allowed a detailed analysis of their relationship to both the targets they innervate and of the innervation they receive. The sympathetic nervous system consists of CNS preganglionic neurons whose cell bodies reside in the intero–medial-lateral region of the spinal cord at levels C8-L4 and project fibers to the sympathetic chain, synapsing on the dendrites of peripheral postganglionic neurons. Postganglionic sympathetic cell soma are located in either paravertebral ganglia of the sympathetic chain, which extends along the cervical to sacral levels of the spinal cord, or in prevertebral ganglia, which lie adjacent to origins of abdominal arteries. The postganglionic neurons, in turn, project to the target organs of the sympathetic nervous system. Preganglionic neurons project mostly slow conducting small diameter myelinated fibers that exit the spinal cord ventrally along spinal roots and then separate into the sympathetic chain via the white rami, where they extend both rostrally and caudally along

2 the chain. Each preganglionic fiber forms cholinergic synapses with many postganglionic cells, showing a divergence of about 1:10 (Nja and Purves, 1977b). Some postganglionic neuron targets of individual preganglionic neurons reside in different ganglia, thus allowing for coordination of sympathetic activity in sympathetic neurons at several different spinal levels (Langley, 1889; Langley and Sherrington, 1884; Lichtman et al.,

1980). Postganglionic nerve fibers innervate target tissues diffusely; individual nerve endings exhibit several swellings where vesicles containing the neurotransmitter norepinepherine accumulate (Elenkov et al., 2000; Paton and Vizi, 1969; Smolen, 1988).

Synaptic transmission occurs not at specific sites but rather at multiple locations along the highly branched axonal terminals of the postganglionic neurons. Thus, a relatively small number of highly branched fibers can regulate the function of large masses of target tissue.

We can study aspects of sympathetic nervous system circuitry by focusing on one specific and accessible ganglion of the sympathetic chain, the superior cervical ganglion

(SCG). The rostral-most ganglion of the sympathetic chain, the SCG is situated where the carotid artery divides into its internal and external branches. The SCG receives approximately 90% of its preganglionic fiber innervation from spinal cord levels T1-T3, with some innervating preganglionic neurons residing in C8, T4, and T5 levels (Rando et al., 1981; Rubin, 1985b). The SCG is the only ganglion that projects to the head and neck, with major targets being the ipsilateral vasculature, iris, pineal gland, and salivary glands. Proper sympathetic control of the head is crucial; Horner’s syndrome is one classic example of how disrupting sympathetic innervation of the head has unfortunate consequences. Horner’s syndrome is clinically defined as having three main features—

3 decreased diameter of the pupil (miosis), droopy lower and/or upper eyelids (ptosis), and a lack of sweating in the affected facial area (anhidrosis) (Martin, 2007). Each of these features presents on the side of the head that has had SCG function compromised. The underlying cause of this disorder can be either interruption of the preganglionic to postganglionic connections or interruption of postganglionic neuron to target connections

(Fields and Barker, 1992).

1.2. NGF as target derived neurotrophic factor

Clearly, proper development of sympathetic nervous system connectivity is critical, and yet, still not fully understood. We can begin to understand sympathetic circuit assembly by looking at the molecular factors that are known to be fundamental players in sympathetic neuron survival. One such molecule is Nerve Growth Factor, or NGF, the prototypical neurotrophin. NGF’s role appears to be not in neurogenesis or in early stages of differentiation (Fagan et al., 1996) but beginning during later stages, when postganglionic neurons innervate their target field (Fagan et al., 1996). NGF is a target derived factor crucial for survival of both sympathetic and sensory neurons. In fact, the dependence of postganglionic sympathetic neurons on NGF is a key finding leading to the neurotrophic factor hypothesis. A classical concept of neurobiology, the neurotrophic factor hypothesis states that neurons are initially overproduced, and it is the competition of neurons for acquisition of limited amounts of target derived trophic factors that refines the number of neurons to correspond to the size of the target (Oppenheim, 1991).

There is an abundance of evidence that NGF is indeed a target derived neurotrophic factor. The seminal finding in the field demonstrated a diffusable nerve growth stimulating factor was necessary for survival of sympathetic neurons (Cohen et al., 1954;

Levi-Montalcini et al., 1954). Over time it became clear that this diffusible factor, referred to as NGF, regulates the number of surviving sympathetic neurons: increasing

NGF results in great numbers of cells in sympathetic ganglia while NGF anti-serum causes cell death in the sympathetic nervous system (Albers et al., 1994; Hoyle et al.,

1993; Levi-Montalcini, 1987; Levi-Montalcini and Cohen, 1960). These findings were followed by studies that placed NGF in the right tissues at the proper time for regulating neurtonal survival. It was discovered that NGF is expressed in sympathetic target tissues at levels corresponding to innervation density (Heumann, 1994), is secreted from sympathetic target tissues (Barth et al., 1984) and is synthesized and expressed at the time of axonal innervation of target tissues, around embryonic day 13 in rats (Korsching and

Thoenen, 1988; Shelton and Reichardt, 1984). The sufficiency of NGF as a survival factor can be illustrated in in vitro studies; NGF is a necessary factor for early postnatal neuron survival in primary superior cervical ganglion (SCG) cultures (Chun and

Patterson, 1977; Green, 1977), and acts as a survival factor when exclusively applied to the distal axons of neurons grown in compartmentalized cultures, an in vitro situation analogous to postganglionic axons obtaining NGF from target tissues (Campenot, 1977).

In vivo, the absence of NGF, or its receptor TrkA, results in neuronal cell loss (Francis et al., 1999; Smeyne et al., 1994), with a decrease in SCG volume of 90% by postnatal day

3 in mice lacking NGF (Crowley et al., 1994). Taken together, NGF has a great impact on sympathetic circuit development in axonal innervation and systems matching of the sympathetic ganglia to the target end organs.

1.3. NGF is an important factor in many steps of SCG circuit development

As noted above, the development of a circuit requires many intricate steps. For the sympathetic nervous system these steps include the proper axonal connectivity of ganglia to target organs, a period of cell death or survival (determined by NGF), the innervation of preganglionic neuron to postganglionic neuron, the maturation of the postganglionic neuron’s dendritic arbor, and the refinement of synaptic connections. In SCG development many of these steps happen at least partially simultaneously (Glebova and

Ginty, 2005). Already discussed is the observation that sympathetic circuit development relies on NGF as a neurotrophic factor, which signals for systems matching survival of postganglionic neurons, but what is fascinating about this circuit is that NGF seems to play an important role in many other developmental steps as well, particularly in final target innervation, dendritic development and synaptogenesis.

Target Innervation

Before the competition between cells for trophic support from the target can occur to achieve proper neuronal numbers the postganglionic axons must extend and reach their final targets. This consists of an initial axon extension stage and a more final target innervation phase. Analysis of NGF−/−; Bax−/− mice indicates that NGF is required for final sympathetic target innervation in vivo but not for proximal axon projection from sympathetic ganglia (Glebova and Ginty, 2005).

Dendritic development

The elaboration of postganglionic dendrites that will come to receive preganglionic input is a critical event in the sympathetic circuit as it affects the range of inputs the neuron

6 will process and propagate. Neurite outgrowth occurs within the ganglia before axons have even reached their final target(Rubin, 1985a), so dendrite initiation is likely not regulated by target-derived NGF. Rather, it is thought that the bone morphogenetic protein (BMP) family may have more to do with this beginning phase of dendrite development. Multiple BMP family members (1, 4, 5, 6, 7) are capable of stimulating dendritogenesis in cultured sympathetic neurons at earlier time-points than seen from cultured cells given only NGF (Beck et al., 2001; Lein et al., 1995; Lein et al., 2002;

Majdazari et al., 2013). Further, BMPs are expressed in the SCG in a spatiotemporal pattern consistent with a role in dendritogenesis. Another probable facet of dendrite initiation is preganglionic activity, as innervating pre-ganglionic axons, when electrically stimulated, can elicit post-synaptic potentials from postganglionic neurons before dendrites have formed(Rubin, 1985c), also prior to final innervation of target organs by the sympathetic neuron. Additionally, neuronal activity can initiate dendritic growth in vitro (Vaillant et al., 2002).

While BMP signaling and neuronal activity may be catalysts for the initiation of dendrites, they may not be as critical for dendritic maturation and arborization, a developmental process that extends into postnatal ages in the SCG. This process was morphologically studied using retrograde tracing which allowed for the visualization of the full dendritic arbor at different stages of development. Dendrites mature considerably from birth (P1) to adulthood (P90), in both number of primary processes (2.4 to 5.2) as well as in elaboration; there is an increase in length of dendrites and in number of secondary and tertiary dendrites, with there being no tertiary dendrites at birth (Smolen and Beaston-Wimmer, 1986). The greatest period of elaboration is within the first month

7 with a four-fold increase in dendritic length (Voyvodic, 1987). Interestingly, postganglionic dendrites will develop postnatally even without preganglionic input, indicating that neither neuronal activity nor preganglionic innervation dictates the maturation of dendrites (Smolen and Beaston-Wimmer, 1986; Voyvodic, 1987). What seems to have quite an influential role, however, are signals derived from the target tissue. The complexity of dendritic arbors appears to correspond to the size of the target, as increasing or decreasing target field size leads to an expansion or contraction of the dendritic field (Voyvodic, 1989b). Further, eliminating signals from the target through postganglionic axotomy results in dendrite retraction (Purves, 1975; Yawo, 1987). There is some evidence that members of the BMP family are an essential factor for postnatal dendritic maturation, as conditional knock-out of Bmpr1a/1b in immature sympathetic neurons results in reduced dendritic length and complexity (Majdazari et al., 2013), but this study may not account for the necessity of the target, as BMPs are found not only in target tissues (Ducy and Karsenty, 2000) but also within sympathetic ganglia (Beck et al.,

2001; Lein et al., 2002). Alternatively, there is robust evidence that NGF is a key regulator of the elaboration of sympathetic dendrites. Systemic treatment of NGF promotes dendrite growth in neonatal (Snider, 1988) and adult (Ruit et al., 1990; Ruit and

Snider, 1991) mice. Remarkably, systemic treatment with NGF anti-serum causes a reduction in the length, number, and complexity of dendrites (Ruit et al., 1990; Ruit and

Snider, 1991). This effect was shown even in mature animals (Ruit et al., 1990), indicating that NGF has an important role not only in developing dendrites but also in maintaining complex dendritic arbors throughout the life of the animal (Ruit and Snider,

1991).

The mechanism through which NGF influences dendritic maturation has not been fully elucidated, and while there is evidence indicating that NGF from target is trafficked to the ganglia, it is unknown whether NGF from the target is trafficked into dendrites in vivo to function within that cellular compartment. Another outstanding question is how dendritic remodeling that takes place through adulthood (Voyvodic, 1987), is controlled, though signaling of NGF seems to be a likely candidate (Ruit and Snider, 1991).

Synapse formation and maintenance

The development of sympathetic neuron dendrites is intimately associated with synaptic connectivity between preganglionic and postganglionic neurons. Neurons that have the most complex dendritic arbors are also innervated by the greatest number of axons(Forehand, 1985; Purves and Hume, 1981) and conversely neurons that lack dendrites lose most of their inputs as the animal develops (Purves and Hume, 1981).It appears that the advantage to robust dendritic arborization is that the neuron becomes a greater integrator of signals from the spinal cord, with an increased rate of synaptic activity (Johnson and Purves, 1983). This may again be a consequence of the amount of trophic support each postganglionic neuron receives from its target tissue (Purves et al.,

1988).

Cholinergic preganglionic synapses form early in development, before dendrite formation, at embryonic days 12-13 in rats (Rubin, 1985c). The first contacts are largely axosomatic, but as dendrites begin to appear, at embryonic day 14, synaptogenesis becomes focused on these processes (Rubin, 1985c). Synapses are rapidly formed over the first postnatal week, and reach approximately 80% of adult numbers at the end of the first month (Smolen and Raisman, 1980), coinciding with robust dendritic growth

(Voyvodic, 1987). A well-documented observation is that the somatic membrane becomes a less favorable target of innervation, compared to dendrites, as dendritic complexity increases, but the mechanism behind that observation remains unclear

(Forehand, 1985).

These initial synapses are greatly influenced by retrograde signals they receive from the target, as the absence of target tissues in vivo reveal aberrant and decreased nicotinic acetylcholine receptor (nAChR)expression in postganglionic neurons (Devay et al.,

1999). Indeed, retrograde signals may have greater inductive effects than presynaptic inputs on the formation of these synapses (Rosenberg et al., 2002). Adult maintenance of nAChR expression in the postganglionic neurons depends on presynaptic innervation

(Rosenberg et al., 2002) but possibly to a greater extent target derived signals, as determined through axotomy of postganglionic nerves (Purves, 1975; Zhou et al., 2001) and application of colchicine (Levey and Jacob, 1996). Axotomy of postganglionic nerves (with no manipulation to preganglionic innervation) also results in overall decreased number of synapses, which recovers upon re-innervation of the peripheral targets (Purves, 1975). An important signal from the target for synapse formation again appears to be NGF. As with axotomy or colchicine application, systemic treatment with anti-NGF causes synapse number to decrease (Nja and Purves, 1978), while one can increase the number of synapses in the SCG at early postnatal ages (P10 and younger) with NGF treatment (Schafer et al., 1983). What remains to be investigated is how NGF signaling in the postganglionic neuron results in a trans-synaptic effect and causes an increase in synaptic number. The effect of NGF on synapses in vivo has also been shown using an NGF knockout mouse (NGF-/-;Bax-/- ); at P0, a lack of both postsynaptic

10 density proteins and presynaptic specializations were found in the SCG (Sharma et al.,

2010). Further, an NGF dependent effect of post synaptic density formation in vitro was noted (Sharma et al., 2010). Therefore, it is plausible that NGF from the target is acting in the postganglionic neuron to promote the formation of postsynaptic density areas which in turn affects innervation from preganglionic neurons. More work is required to elucidate this mechanism, as well as to distinguish if NGF’s effects on synapse number are restricted to early developmental ages or if NGF is required for the maintenance of synaptic connections between the preganglionic and postganglionic neurons.

In summary, an abundance of evidence indicates that NGF promotes final target innervation of postganglionic neurons, provides trophic support for survival of postganglionic neurons, elicits and maintains dendritic growth and complexity of postganglionic neurons, and regulates number of synapses between preganglionic and postganglionic neurons. Based on this, one can postulate that trophic support from the target, in the molecular form of NGF, establishes sympathetic nervous system circuits, from cell number to dendritic elaboration to synaptic formation and maintenance.

Questions remain as to how this occurs mechanistically, but one hypothesis is through local signaling of a target derived NGF-TrkA signaling endosome.

1.4. NGF-TrkA signaling endosome hypothesis

In order to study the function of NGF in the sympathetic nervous system, we must understand the mechanism by which NGF, which is produced in target tissues (Heumann,

1994), signals to the postganglionic cells. Thus, questions of how NGF is transported from target fields to ganglia have been asked, and, fortunately, many have been answered. It is believed that NGF secreted from the target organs is taken up by the distal

11 axons of postganglionic neurons and transported retrogradely along the axon to the cell body in the sympathetic ganglia. Direct evidence of this was first shown in an elegant experiment performed by Ian Hendry in the early 1970s. He injected iodinated-NGF into the anterior chamber of the eye, a target that receives axonal innervation from the SCG and looked for radioactivity within the ganglia. Sure enough, 16-20 hours post injection there was a peak level of radioactivity, only in the ipsilateral ganglia, that decreased as expected from a pulse-chase experiment. (Hendry et al., 1974b) Following studies supported the active retrograde transport hypothesis by defining the timing of NGF transport to the cell body at ~0.7 µm/sec (Claude et al., 1982; Hendry et al., 1974a) and by showing that retrograde movement of NGF is abolished by the microtubule depolymerizing agent colchicine (Hendry and Bonyhady, 1980).

NGF-TrkA signaling

Interestingly,NGF directly injected into PC12 cell bodies did not cause a well known effect of NGF activity, induction of choline acetyltransferase (ChAT) expression

(Heumann et al., 1984), indicating that NGF itself was not the signaling molecule.

Indeed, NGF binds to p75NTR low affinity and TrkA with high affinity (Huang and

Reichardt, 2003). Most NGF neurotrophic functions occur through activation of its high affinity receptor, TrkA (Loeb et al., 1991). TrkA is a receptor tyrosine kinase that selectively binds NGF, among all neurotrophins, causing activation of its kinase activity in the form of transphosphorylation of the receptor (Cunningham et al., 1997; Kaplan et al., 1991). TrkA is a plasma membrane spanning receptor with an extracellular domain that binds dimerized NGF and an intracellular domain with several tyrosine residues that become autophosphorylated following NGF binding, activation of TrkA kinase domain,

12 and recruit signaling molecules from multiple signaling pathways. Generally speaking, tyrosine residue 490 (Y490) recruits adaptors Shc or Frs2 upon phosphorylation, resulting in activation of the MAPK and PI3K pathways, while phosphorylated tyrosine residue 785 (Y785) recruits PLC-γ (Obermeier et al., 1993a; Obermeier et al., 1993b).

Each of the downstream signaling pathways has been implicated in different aspects of

NGF-TrkA function. For example, NGF signaling through TrkA activated MAPK signaling in sympathetic neurons upregulates Egr3, a transcriptional regulator that acts cell autonomously in sympathetic neurons to ensure normal development of sympathetic dendrites in vitro and in vivo (Quach et al., 2013). PLC-γ activation by TrkA leads to release of Ca2+ stores through production of IP3 and DAG, resulting in the activation of protein kinase C isoforms (Kaplan and Miller, 2000).

The NGF-TrkA signaling endosome

The exact mechanism of how target-derived neurotrophin NGF is transported through both sensory and sympathetic neuron axons has been investigated in detail, and currently the signaling endosome hypothesis prevails. NGF binds to its receptor TrkA at the distal axon, and remains associated with TrkA in an internalized, endocytosed vesicle that is actively retrogradely transported along microtubules. NGF-TrkA endosomes maintain activation of downstream signaling partners to promote appropriate signaling events for an extended period of time throughout different compartments of the neuron (Howe and

Mobley, 2004). Work in PC12 cells showed NGF rapidly induced internalization of

TrkA receptors into endocytotic vesicles (Grimes et al., 1996), specifically associated with clathrin coated vesicles (Howe et al., 2001), and work in neurons has shown the

NGF-TrkA complex may be internalized via pincher-mediated macroendocytosis

(Philippidou et al., 2011; Valdez et al., 2005). The exact nature of the NGF-TrkA endosome is still debated, with some studies supporting the transport of a Rab5 postive early endosome and others supporting a Rab7 positive late endosome or even a multivesicular body as the major NGF-TrkA endocytotic carrier (Harrington and Ginty,

2013). It may be that the vesicular identity of NGF-TrkA endosomes changes depending on the destiny of the endosome or on cellular context.

There is both in vivo and in vitro evidence supporting the idea that the internalized TrkA endosome is catalytically active as it is carried back to the cell body (Bhattacharyya et al.,

1997; Delcroix et al., 2003; Riccio et al., 1997; Tsui-Pierchala and Ginty, 1999).

Additionally, co-precipitation studies report that NGF is retrogradely transported along with its receptor TrkA (Tsui-Pierchala and Ginty, 1999; Watson et al., 1999), an idea that is also supported by recent real time imaging studies that use biotinylated NGF conjugated to streptavidin quantum dots to monitor retrograde TrkA transport (Cui et al.,

2007; Zhang et al., 2010). It has also been shown that phosphorylated TrkA is necessary within the cell body to activate downstream effectors, as blocking TrkA kinase activity

(using K252a, a pharmacological inhibitor of tyrosine kinases) in cells bodies blocks phosphorylation of downstream molecules such as the transcription factor CREB or Erk5

(MAPK pathway) within the cell body (Riccio et al., 1997; Watson et al., 2001).

Furthermore, blocking TrkA activity at the distal axon inhibits survival and decreases cell body size, a similar effect as seen when blocking NGF-TrkA retrograde transport, indicating that retrogradely transported catalytically active NGF-TrkA signaling endosomes are survival promoting signals (Ye et al., 2003)

NGF-TrkA endosome trafficking

The signaling of NGF-TrkA endosomes is crucial to the function of the neurotrophin, yet in order for NGF signaling to be within the correct cellular compartment in an appropriate amount of time the endosome must be transported there from distal axons.

Understanding the mechanisms through which NGF-TrkA endosome retrograde transport is initiated and carried out is important because various defects in neurotrophin endosomal transport have been illustrated in Charcot-Marie Tooth disorder (Cosker and

Segal, 2014). Fundamental understanding of retrograde neurotrophin endosome transport may also provide insight into neurodengenerative diseases such as Huntington’s disease

(Liot et al., 2013) and Alzheimer’s disease where trafficking defects are seen in degenerating neurons (Millecamps and Julien, 2013; Wang et al., 2013).

In sympathetic neurons, where the axons can extend a great distance, it is important that there is a sufficient mode of transportation which ensures the endosome can propagate the TrkA kinase signal and exert the various physiological functions of NGF in a timely manner (Harrington and Ginty, 2013). This requires active transport, or the ATP-powered movement of cargo by motor proteins along microtubules. There are two major families of active transport, kinesins, which generally move cargo towards the plus ends of microtubules, and cytoplasmic dyneins, which move cargo generally towards the minus ends of microtubules (Maday et al., 2014). In axons, where microtubules are uniformly oriented with plus ends towards axon terminals, retrograde transport is driven by cytoplasmic dyneins (Maday et al., 2014). Indeed, dynein is the motor protein responsible for the retrograde transport of NGF-TrkA target derived signaling endosomes (Heerssen et al., 2004; Wu et al., 2007). The same motor protein (dnhc1) required for axonal

15 retrograde transport is also responsible for dendritic minus-end oriented transport, with cargo specificity provided through the diverse intermediate chain (IC) and light chain gene products that associate with dnch1 (Ha et al., 2008; Vale, 2003). TrkA endosomes are trafficked by dynein complexes containing IC-2C (Cosker and Segal, 2014).

The real time dynamics of retrogradely transported NGF-TrkA endosomes has recently been studied in axons of dorsal root ganglion neurons using QD conjugated NGF (Cui et al., 2007; Zhang et al., 2010). Cui and colleagues were the first to track target-derived individual NGF endosomes in real time, finding that endosomes exhibit stop and go motion, that there is high variability in speed between different axons and that endosomes within the same axon frequently pause at the same apparent axonal location (Cui et al.,

2007). Intriguingly, they found the overall average rate of endosomes in axons to be 1.3

µm/s, which is similar to previous work analyzing the overall transport of NGF endosomes to occur at a rate of ~0.7 µm/sec in vivo (Hendry et al., 1974b) and 0.83

µm/sec in sympathetic neuron cultures (Claude et al., 1982). Despite these various studies analyzing the timing of NGF trafficking from distal axon to cell body, there has been no to date real time analysis of the endogenous NGF receptor, TrkA, to confirm directly that the NGF-TrkA endosome is actively transported retrogradely through sympathetic neurons.

Recently, NGF-TrkA endosomes have been discovered to traffic from distal axon to dendrites of mature sympathetic neurons in culture (Sharma et al., 2010). Analysis of the trafficking dynamics, metabolism, and fate of the NGF-TrkA endosome has not been completed. However, the time of appearance of endogenous retrogradely transported

TrkA endosomes in the dendrites was consistent with the time of appearance of post

16 synaptic density proteins (PSDs), and NGF on the distal axon was found to be necessary for the clustering of PSDs (Sharma et al., 2010). These findings suggest that NGF signals via the TrkA endosome to promote synapse assembly. A major unanswered question in the field is how does NGF from the target influence dendritic growth and synaptogenesis. My hypothesis is that target derived NGF-TrkA signaling endosomes are trafficked from the target through the axon, the cell body and into dendrites, and signal locally, within dendrites, to support synapse formation and maintenance.

During my dissertation I tested this hypothesis by first creating a method to track endogenous TrkA receptors from distal axons to dendrites, comparing the dynamics of the endosome amongst the various cellular compartments. I validate work in the field regarding the dynamics of NGF-TrkA endosome transport within axons, and further our understanding of this process by showing a vastly different manner of movement of TrkA endosomes within dendrites. I evaluated the rate and movement dynamics of TrkA endosomes that enter dendrites in vitro, illustrating that these endosomes are signaling competent endosomes derived from the target region and that are found in close proximity to PSDs. I extended my in vitro observations by showing that signaling competent TrkA endosomes derived from the target are also found in dendrites in vivo, which confirms the retrogradely transported NGF-TrkA signaling endosome hypothesis in vivo and highlights a possible mechanism for how NGF from the target can influence dendritic growth and synaptic maintenance of postganglionic sympathetic neurons. I tested this model and discovered that TrkA kinase activity is necessary within the superior cervical ganglion to maintain synapses between pre-ganglionic and postganglionic sympathetic neurons. Further, I resolved the question of whether synapses are

17 maintained through TrkA kinase activity in cell bodies or more locally within dendrites, showing that inhibition of TrkA kinase activity in dendrites is associated with a local decrease in PSDs. Therefore, we now know that NGF derived from sympathetic targets contributes to the establishment of connectivity of sympathetic nervous system circuits by maintaining synapses through a retrogradely transported NGF-TrkA signaling endosome that requires local NGF/TrkA signaling within dendrites for clustering of postsynaptic density proteins. This work reveals a novel mode of NGF-dependent synapse formation and maintenance, and the mechanism by which target fields control circuit assembly.

Chapter 2 NGF-TrkA endosome Dynamics, Signaling and Function in Dendrites

2.1 Live cell tracking of TrkA endosomes reveals unique dynamics in different cellular compartments.

We recently discovered that target-derived TrkA endosomes are retrogradely transported beyond their previously thought destination, the soma, into the dendrites of cultured sympathetic neurons (Sharma et al., 2010). The identification of TrkA endosomes within dendrites suggested novel functions within that cellular compartment, and provoked us to ask questions about dynamics of transport, metabolism, as well as function of the NGF-

TrkA signaling endosome within dendrites, and how it compares with what is known about TrkA signaling endosomes transported through axons (Harrington and Ginty, 2013;

MacInnis et al., 2003).

To address questions about NGF-TrkA dynamics we developed a real time imaging paradigm that allows us to track and compare the movement of retrogradely trafficked

TrkA endosomes in axons, cell bodies, and dendrites. Several methods were attempted to visualize NGF-TrkA endosomes in real time, including quantum dot conjugated NGF, however in our hands we found that control quantum dots were non-specifically taken up by sympathetic neurons, rendering the method not viable. The live cell paradigm with the most specific results involved culturing dissociated postganglionic sympathetic neurons from a previously described Flag-TrkA knock-in (TrkAFlag) mouse (Sharma et al 2010) in microfluidic chambers (Taylor et al., 2010) and performing an anti-Flag antibody feeding assay that enables visualization of endogenous TrkA endosomal movement in

19 sympathetic neurons as previously described in primary cell culture (Sharma et al., 2010) and for transfected receptors (Chen et al., 2005a; Tanowitz and von Zastrow, 2003;

Vargas and Von Zastrow, 2004). Addition of an anti-Flag+fluorescent-secondary conjugate followed by application of NGF to the distal axon compartment allows for live cell visualization of newly internalized TrkA endosomes as they are retrogradely trafficked into the cell body and dendrite compartment in real time (Figure 2.1).

Importantly, the Flag-fluorescent-secondary conjugated antibody specifically recognizes

Flag-TrkA in TrkAFlag neurons, as performing the assay in wild type neurons does not show fluorescent puncta movement from distal axon compartment or accumulation in cell bodies (Figure 2.1 B-C). This assay allows us to visualize endogenous ligand-dependent

TrkA receptor trafficking in living neurons for the first time (Figure 2.2 A).

Using this assay, imaging neurons on a spinning-disk confocal microscope using a temperature controlled stage set to 36-37⁰C, we found that TrkA endosomes move in a saltatory manner retrogradely through the axon with highly variable rates, resulting in an average rate (across axons) of 0.70 µm/s (Figure 2.5 A), similar to what has been shown previously for movement of NGF (Claude et al., 1982; Cui et al., 2007; Hendry et al.,

1974b). There were several other notable characteristics of endosome movements within axons. First, the TrkA endosomes only moved in a retrograde manner from proximal axons (axons in the cell body and dendrite compartment) to cell body (Figure 2.2 B). This is expected as we know TrkA endosomes are trafficked by the retrograde motor protein dynein in axons (Heerssen et al., 2004) and that microtubules are uniformly oriented within axons with their minus ends directed towards the cell body (Maday et al., 2014).

Small displacements or oscillations in the anterograde direction were occasionally seen,

20 but according to our definition of directionality as movement in one direction for 3 or more sequential frames (images were acquired at 1-4 seconds per frame) there was almost no anterograde movement of endosomes in axons. Second, TrkA endosomes moved in a stop and go manner, with endosomes in the same axon frequently stopping at the same locations. Similar findings were also noted and quantified by Cui and colleagues in a study tracking QD-NGF (Cui et al., 2007). The reason for this is uncertain, but may be attributed to local axonal structure or as seen with mitochondria, local fluctuations in the axonal concentration of Ca2+ (Maday et al., 2014). Third, endosomes (sometimes within the same axon) appeared to move at two different speeds, fast and slow (Figure

2.2 C-D). The fast endosomes, which could move as fast as 3μm/sec, more quickly traversed the distance of the axon while the slow endosomes were more likely to pause frequently or to become stationary. This has also been noted in other endosome trafficking studies, with hypothesized mechanisms being a difference in the motors used, or in the number of motors engaged (Cui et al., 2007). Alternatively, the cytoskeletal structure may be involved, with certain microtubule tracks being more conducive to processive dynein motor movement.

Endosomes first arrived in cell bodies approximately 30 minutes after NGF application and accumulation of endosomes in the soma increased over time. After photobleaching the cell body to track newly transported endosomes from the axons we found that TrkA endosomes in cell bodies slow down or halt in the soma with an average rate of 0.11µm/s

(Figures 2.3 B-C; 2.5 A). Many of the endosomes within the soma appear to be located in a perinuclear compartment where they do not show any movement (Figure 2.3 A).

Anecdotally, it appears that endosomes that remain more peripheral within the cell body remain more mobile and may be more favorably transported into dendrites.

Sympathetic neurons in culture mature and grow dendrites which can be specifically immunostained with MAP2 antibody at DIV 14-16. The live cell assay enables us to track individual TrkA endosome movement through proximal axons,then through the cell body, and out into dendrites. Remarkably, we observed that TrkA endosomes move in a bidirectional manner in dendrites (Figures 2.4 B; 2.5 B, Supplemental_1) with an average rate of 0.40µm/s (Figure 2.5 A). This bidirectionality may mechanistically be explained through the mixed polarity of microtubules found in dendrites, contrary to the uniform polarity of microtubules found in axons (Rolls et al., 2007; Yau et al., 2016). Although

TrkA endosomes in dendrites move at a comparable rate to those in axons, their unique dynamics (i.e. direction changes) result in a smaller net displacement than endosomes in axons, which can be immediately appreciated from watching (in real time) endosomes within dendrites hovering around a small area of the dendrite (Figure 2.5 C,

Supplemental_2). Some TrkA endosomes in dendrites remain stationary, which may be a result of TrkA being transcytosed to the plasma membrane. However, not all TrkA endosomes are transcytosed to the dendritic membrane because some do return to the soma.

In characterizing the general time course of TrkA endosomes trafficked from distal axons, using our fixed Flag-TrkA assay I observed that after a single application of NGF to the distal axon, Flag-TrkA endosomes are present in dendrites as early as 30 minutes post treatment. Flag-TrkA endosome number in dendrites peaks at 3 hours, remaining

22 relatively constant until a slight decrease in endosome number at 6-8 hours following

NGF treatment. (Figure 2.8 B)

This time course, along with the live cell imaging results, illustrates that TrkA endosomes in dendrites are not immediately trafficked back to the cell body, and therefore we questioned the fate of the dendritic TrkA endosome. We proposed three different possibilities. One is that after some time the endosome is transported back into the cell body, where it may be degraded by lysosomes. The live cell imaging data shows that a subset but not predominant number of endosomes return to the cell body, at any given time within 2-5 hours of imaging. A second possibility is that the endosome is targeted to the lysosomal pathway and degraded within dendrites; however using a lysosome associated protein 1 (LAMP1) antibody I do not find lysosomes in dendrites, and I see minimal colocalization between lysotracker and TrkA in cell bodies up to a 4 hour time point (data not shown). A third possibilty, which was hypothesized after noting the number of dendritic TrkA endosomes that have a stationary nature, is that TrkA is transcytosed to the plasma membrane of dendrites. Preliminary experiments I’ve conducted (performing the Flag-TrkA assay in conditions where only recycled TrkA endosomes can be detected) have illustrated this is a definite potential fate for retrogradely trafficked TrkA endosomes (Figure 2.6).

The bidirectional, small displacement movements we observe for TrkA endosomes in dendrites along with the idea that a subset of target derived endosomes are transcytosed, which may allow for renewal of TrkA signaling within dendrites, suggests that NGF-

TrkA signaling plays an important role within dendrites. Real time dynamics of endosomes in dendrites combined with previous work describing NGF dependence of

23 postsynaptic density proteins motivated my hypothesis that NGF-TrkA endosomes from the distal axon are signaling to maintain synapses.

Figure 2.1. Live cell assay to monitor endogenous receptor TrkA trafficking. A.

Schematic of the live cell Flag-TrkA endosome visualization assay. By culturing sympathetic neurons from a mouse where the Flag epitope has been knocked into the

TrkA locus in microfluidic chambers, distal axons can be fluidically isolated from cell bodies and dendrites and TrkA can be detected by a Flag antibody. After applying Flag antibody only to the distal axon compartment at 4⁰C for specific binding and prevention of receptor internalization, washing off any unbound antibody, then applying NGF only to the distal axon compartment at 37⁰C to facilitate activation and internalization of TrkA we can use a fluorescent secondary to visualize TrkA receptors that have traveled retrogradely to the cell body and dendrite compartment. To visualize Flag-TrkA receptors in live cells we incubate Flag primary with fluorescent secondary for an hour before applying this conjugate to the distal axon compartment of cultured Flag-TrkA neurons. B.

Flag Performing this live cell assay on TrkA neurons (left) and wild type neurons (right) shows that the fluorescent puncta within the cell body compartment and the microfluidic chamber grooves are specifically Flag tagged TrkA receptors. C. Representative

Flag kymographs of axons in TrkA neurons (top) and wild type neurons (bottom).

Flag Endosomes in TrkA neurons move retrogradely over time while the rare fluorescent puncta that does appear in wild type axons does not show any movement.

Figure 2.1

Figure 2.2. Dynamics of axonal TrkA endosomes. A. Individual TrkA endosomes in axons can be tracked in real time moving retrogradely down the axon towards the cell body with each image representing a frame of a video taken using a spinning disk confocal microscope that acquired each frame every 4.3 seconds. B.TrkA endosomes in axons move predominantly in the retrograde direction, with 38 endosomes being tracked in the retrograde direction and 2 endosomes moving anterogradely. C. Example of a fast moving endosome that exhibits few pauses, a mean rate of 0.99 um/s, maximum rate of

1.4 um/s and a minimum rate: 0.35 um/s. D. Example of a slow moving endosome that pauses frequently, exhibiting a mean rate of 0.27 um/s, a maximum rate of 1.35 um/s, and a minimum rate of 0.0 um/s.

Figure 2.2

Figure 2.3. The dynamics of TrkA endosomes in cell bodies. A. A montage using every tenth frame of a video taken of a photobleached cell body on a spinning disk confocal microscope as endosomes move from axon into the cell body. In a period of almost 6 minutes the number of endosomes within the cell body increases but the position of each endosome does not change remarkably. B. Example of the rate of movement of one endosome in the cell body that exhibits movement until it becomes static with each point representing a frame taken every 3.11 seconds. C. An example of an endosome entering a cell body exhibiting that very little movement occurs once it arrives at the cell body. Each timepoint represents a frame taken every 3.11 seconds.

Figure 2.3

Figure2.4. Dynamics of TrkA endosomes in dendrites. A. One time-frame from a live cell video visualizing Flag-TrkA endosomes is used to demonstrate how these cells match with post hoc immunohistochemistry for MAP2, a dendritic marker. B. Individual TrkA endosomes in dendrites can be tracked in real time moving anterogradely away from the cell body, then switching directions and returning towards the cell body with each image representing a frame that was acquired on a spinning disk microscope every 3.0 seconds.

This bidirectional movement is a hallmark feature of movement of NGF-TrkA endosomes in dendrites.

Figure 2.4

Figure 2.5. Comparison of TrkA endosome dynamics within different cellular compartments. A. The rates of endosomes tracked in axons (average rate 0.70 µm/s), cell bodies (average rate 0.13 µm/s), and dendrites (average rate 0.25 µm/s). (One way

ANOVA F(2, 70)=13.33 P<0.0001 post hoc. Tukey’s multiple comparison’s test p<.0.0001 (Axon vs cell body) and p<.0.001 (axon vs dendrite); Axon n=29 endosomes,

Dendrite n=20 endosomes CB n=24 endosomes) B. A bar graph denoting the number of times an individual endosome changes its direction (defined as 3 or more movements in a consistent direction); remarkably, endosomes in axons move in one direction while endosomes in dendrites can switch their direction of movement multiple times. C. Graph of relative distance traveled by endosomes in each cellular compartment when displacement is divided by total net movement. This illustrates that endosomes in axons cover a greater distance than endosomes in dendrites, likely due to the directional switches endosomes in dendrites make. (One way ANOVA F(2, 43)=78.91 P<0.0001 post hoc. Tukey’s multiple comparison’s test p<.0001; Axon n=20 endosomes, Dendrite n=19 endosomes CB n=7 endosomes).

Figure 2.5

Figure 2.6. Flag-TrkA endosomes from the target are transcytosed to CB/dendrite plasma membrane. A. The Flag-TrkA assay was performed followed by immunostaining in non-permeabilizing conditions to assess membrane inserted TrkA,

TrkA labeling (left panel) is found on MAP2 stained dendrite and cell body membranes

(right panel). B. Flag antibody was added to the CB/dendrite compartment in non- permeabilizing conditions to show plasma membrane TrkA that is not necessarily from the distal axon compartment. C. Control for transcytosed TrkA endosomes. Flag-TrkA assay was performed followed by immunostaining in non-permeabilizing conditions, followed by acetic acid stripping buffer to remove any membrane Flag-TrkA. D.

Retrogradely trafficked TrkA endosomes not inserted into the plasma membrane. Flag-

TrkA assay was performed followed by immunostaining in permeabilizing conditions, with acetic acid stripping buffer applied between primary and secondary antibodies.

Figure 2.6

2.2 Target-derived TrkA endosomes in dendrites are signaling competent and located near PSDs.

A current model in the field is that target derived NGF exerts its effects on a neuron via a

TrkA signaling endosome (Campenot and MacInnis, 2004; Moises et al., 2007; Zweifel et al., 2005), which supports my hypothesis that the NGF-TrkA endosomes in dendrites are signaling to maintain synapses. Thus, we asked if the TrkA endosomes found in dendrites are signaling competent. TrkA kinase activity is mediated through phosphorylation of the specific tyrosine residues, Y490 and Y785. Once activated, these phosphotyrosines support downstream signaling cascades of the NGF-TrkA complex, namely the Ras/MAPK, PI3 kinase, and PLCγ pathways (Segal, 2003). We confirmed antibodies to Y490 and Y785 to be specific to TrkA phosphorylated residues by employing a chemical genetic strategy on compartmentalized cultures of postganglionic sympathetic neurons from TrkAF592A mice. TrkAF592A mice have a single phenylalanine-to- alanine amino acid substitution in the protein kinase domain of TrkA that renders the catalytic activity of TrkA sensitive to inhibition by the membrane permeable small molecule 1NM-PP1 (Chen et al., 2005a). Thus, treatment of TrkAF592A neurons with

1NM-PP1 blocks TrkA kinase activity whereas treatment of wild-type neurons results in no change in TrkA kinase activity (Chen et al., 2005a). Indeed, we saw almost complete inhibition of P-TrkA (Y490) and P-TrkA (Y785) in TrkAF592A neurons treated with

1NM-PP1 (200 nM) but no change in P-TrkA puncta in 1NM-PP1 treated wild-type neurons. (Figure 2.7) Immunocytochemistry of sympathetic neurons with mature dendrites using these specific P-TrkA antibodies shows distinct P-TrkA puncta along the dendritic shaft, as well as in secondary and tertiary dendrites (Figure 2.8 A). To ask if the

P-TrkA puncta seen were target-derived TrkA-containing endosomes we performed P-

TrkA staining on compartmentalized TrkAFlag neurons where NGF was applied only to the distal axons. After a 2-4 hour incubation period that allowed for Flag-TrkA trafficking from distal axon into distal dendrite we observed that approximately 34% of retrogradely trafficked TrkA endosomes in dendrites were P-TrkA positive as well, indicating signaling competent TrkA endosomes derived from the target exist in sympathetic neuron dendrites (Figure 2.8 A, C). Flag-TrkA endosomes that are not P-

TrkA positive may be NGF-TrkA endosomes on the path to lysosomal degradation or transcytosis (Hu et al., 2015).

The presence of signaling-competent TrkA endosomes in dendrites supports the idea that

TrkA endosomes trafficked to dendrites perform some function. Our lab has demonstrated that the presence of post synaptic density (PSD) proteins in dendrites is dependent upon NGF that is applied to the distal axons (Sharma et al., 2010), so hypothesizing that TrkA endosomes signal locally to cluster PSD proteins, we next asked if TrkA endosomes are found in close proximity to PSDs. When NGF is applied solely to distal axons of sympathetic neurons grown in microfluidic chambers, we find Flag-TrkA endosomes adjacent to MAGUK positive PSDs throughout the dendritic arbor (Figure 2.9

B). This finding was corroborated by performing complementary immunostaining experiments that assessed localization of Flag-TrkA in relation to post-synaptic density protein Homer1 (Figure 2.9 A) In the same experimental paradigm, P-TrkA (Y785) and

MAGUK antibody staining illustrate a close spatial relationship, with some co- localization, between PSDs and TrkA signaling-competent endosomes (Figure 2.10 A-B).

Analysis of the spatial relationship between P-TrkA and MAGUK was conducted using a

MATLAB script written by Harvard’s Image Data Analysis Core. Briefly, a nearest neighbor calculation was made between all P-TrkA puncta and all MAGUK puncta within a specific dendrite area both for actual data as well as for 500 trials of randomized distribution data with the same number of points within the same dendrite area.

Significance was determined first at a dendrite level and secondly at a population level by comparing the frequency of distances of the actual distribution to the 99th percentile of randomized distributions. The spatial relationship between P-TrkA and MAGUK puncta was found to be closer what would be expected by chance, suggesting a functional role of

TrkA signaling endosomes in clustering or maintaining PSDs (Figure 2.10 C-D). In multiple scenarios, TrkA endosomes and PSDs are found to be in close proximity to one another within dendrites of postganglionic sympathetic neurons which suggests that target derived TrkA signaling endosomes within dendrites may function to promote or maintain post synaptic density clustering.

Figure 2.7. Specificity of phosphorylated TrkA antibodies in vitro. A. DIV 10 neurons are stained for MAP2 and P-TrkA (Y490) (top) and P-TrkA (Y785) (bottom) with P-

TrkA in a punctate pattern in the presence of vehicle. B. P-TrkA puncta are decreased in

TrkAF592A neurons in the presence of small molecule drug 1NM-PP1. C. Quantification of decreased P-TrkA puncta in the presence of 1NM-PP1(n=3, 54 cells in the drug condition and 26 cells in the vehicle condition, unpaired two-tailed t-test p<0.05, t=3.721 df=4). D.

Quantification of P-TrkA puncta in wild type neurons in the presence of vehicle or 1NM-

PP1 (n=2, 20 cells from each condition, unpaired two tailed t-test p<0.05, t=0.3384, df=2).

Figure 2.7

Figure 2.8. Target-derived TrkA endosomes in dendrites are signaling competent. A.

Flag-TrkA endosomes traffic from distal axon to dendrite in DIV 14 neurons (left). P-

TrkA puncta are located in dendrites (middle). Flag-TrkA and P-TrkA puncta co-localize within dendrites (right). Colocalization of P-TrkA and Flag-TrkA at 3-6 hours is 40.37%

± 8.75% (n=3, standard error of the mean) (C). B. Time course of arrival of Flag-TrkA endosomes into dendrites from the distal axon. n= 1-3 experiments depending on the time point. C. Time course of arrival of P-TrkA endosomes into dendrites from the distal axon. n= 1-3 experiments depending on the time point, 15-20 dendrites.

Figure 2.8

Figure 2.9 Target-derived signaling endosomes are located in close proximity to

PSDs. A. Representative image of target-derived Flag-TrkA endosomes in close proximity to post synaptic density protein Homer1 in dendrites of sympathetic neurons

DIV 27. White arrows denote examples of close proximity between the puncta. B.

Representative image of target-derived Flag-TrkA endosomes in close proximity to post synaptic density protein MAGUK in dendrites of sympathetic neurons. Antibody host species had previously rendered this experiment impossible but using a Flag antibody generated in Rabbit enabled the execution of this experiment. Blue arrows denote examples of close proximity between the puncta.

Figure 2.9

Figure 2.10. Flag-TrkA endosomes are found in close proximity to PSDs. A.

Representative image of P-TrkA puncta within dendrites in close proximity to MAGUK puncta 3 hours after application of NGF only to the distal axon compartment. Zoomed in image of the dendrite is the right panel. B. A second representative image of a dendrite at higher magnification with white arrows highlighting the close proximity of P-TrkA puncta and MAGUK puncta 3 hours after application of NGF only to the distal axon compartment. C. Histogram of nearest neighbor analysis in nanometers of nearest

MAGUK puncta to P-TrkA puncta (left) and the reverse (right) conducted with

MATLAB script from IDAC (see methods). D. Population level analysis (n=22 dendrites,

4 cultures, 2 independent experiments) comparing the distance between actual P-TrkA and MAGUK puncta to randomized distributions of MAGUK puncta (left) to chance, represented on the y axis as 1, and the reverse (right). Normalized single dendrite data was averaged and a 99% confidence interval was then calculated at each distance

(nanometers) by 5000 bootstrap repetitions sampling from the individual dendrite data.

Significance data was determined by comparing these confidence intervals to 1, the normalized frequency at any given distance, which would be expected by chance (y=1).

Analysis conducted with MATLAB script from IDAC.

Figure 2.10

2.3 Target-derived endosomes are signaling competent in dendrites of postganglionic neurons in sympathetic ganglia in vivo.

To address the possibility that TrkA endosomes play a physiologically relevant functional role in sympathetic neuron dendrites we investigated whether or not target-derived TrkA endosomes are trafficked into dendrites in vivo. To do so we analyzed vesicles derived from a target of the superior cervical ganglion (SCG). Injection of fluorescently- conjugated Wheat Germ Agglutinin (WGA) into the anterior chamber of the eye, a target of SCG axons, resulted in vesicular uptake of WGA protein and retrograde transport of these vesicles into postganglionic neuron cell bodies and further transport from cell bodies into dendrites (Figure 2.11). As expected, based on the anatomy of the sympathetic nervous system, we find WGA vesicles only in the ipsilateral ganglion to the injected anterior chamber, not in the contralateral ganglion (Figure 2.11 B). This appearance of WGA vesicles occurs within 16 hours, which is consistent with the timing of retrograde transport of NGF from target innervating axons to SCG cell bodies (Hendry et al., 1974b). Performing this assay using TrkAFlag mice shows colocalization of retrogradely-transported WGA protein and Flag-TrkA endosomes in dendrites

(45.8±5.8%, n=3 animals), providing evidence for the existence of target-derived TrkA endosomes within dendrites in vivo (Figure 2.12 A, C). We next asked if these target- derived TrkA endosomes are signaling competent, as our in vitro results would suggest.

We performed experiments using the same retrograde tracing assay combined with P-

TrkA (785) immunohistochemistry. Indeed, we found colocalization between WGA protein and P-TrkA positive puncta (11.7±3.5%, n=3 animals) (Figure 2.12 B, C). We verified specificity of the P-TrkA antibody using a chemical genetic assay (Chen et al.,

2005a) in which we can inhibit TrkA kinase activity within the SCG of TrkAF592A mice by intraperitoneal injection of 100 uL of 1 uL 200 mM 1NM-PP1 every hour for four hours

(Figure 2.13). We conclude from these findings that approximately 25% of TrkA endosomes in dendrites of sympathetic neurons that have been transported from the axon terminal are signaling competent, a similar number to that which we observed in vitro.

Figure 2.11. Assay for visualizing target-derived vesicles in vivo. A. Schematic of the assay used to track retrograde vesicle transport from the ipsilateral sympathetic target to postganglionic neuron cell bodies and dendrites. WGA-555 injected into the anterior chamber of the eye is endocytosed by sympathetic neuron distal axons and transported retrogradely to the cell bodies and dendrites of sympathetic neurons. B. The assay specifically labels neurons in the ipsilateral ganglion of the injected target eye, with no non-specific labeling in the contralateral ganglion.

Figure 2.11

Figure 2.12. Target-derived endosomes containing TrkA are transported into dendrites in vivo. A. Retrogradely trafficked WGA vesicles are co-localized with immunohistochemically defined TrkA puncta in dendrites. B. Retrogradely trafficked

WGA vesicles are transported into dendrites where they co-localize with immunohistochemically defined P-TrkA puncta. C. Quantification of C and D: 16 hours after eye injection, 45.8% ± 5.8% (SEM) of WGA puncta transported from distal axon to dendrite co-localize with TrkA, while 11.7% ± 3.5% (SEM) of WGA puncta transported from distal axon to dendrite co-localize with P-TrkA (n=3 animals). Thus, 24% of TrkA endosomes in dendrites transported from the distal axons are signaling competent.

Figure 2.12

Figure 2.13 Specificity of phosphorylated TrkA antibody in vivo. A. Illustrated specificity of the P-TrkA antibody in vivo by injecting 400 μM 1NM-PP1 saline solution once an hour for four hours into the intraperitoneal region of P10-12 TrkAF592A mice and showing reduction of P-TrkA staining in the SCG. Images are of slices through the SCG showing cell bodies and dendrites. Performing the same assay in wild type mice showed no change of P-TrkA staining in the SCG. B. Quantification of reduction of average number of P-TrkA puncta per μm2 in 1NM-PP1 condition compared to vehicle. (n= 5 animals vehicle condition and n=5 animals in 1NM-PP1 condition, unpaired two-tailed t-test *p<0.01, t=3.423 df=8) C. Quantification of comparison of average number of P-

TrkA puncta per μm2 between 1NM-PP1 condition compared to vehicle in wild type animals. (n= 3 animals in vehicle condition and 4 animals 1NM-PP1 condition, unpaired two-tailed t-test *p<0.01, t=1.297 df=5)

Figure 2.13

2.4 Signaling competent endosomes are found at SCG synapses throughout development.

An interesting aspect of sympathetic nervous system development is that as postganglionic dendrites grow there is a switch in the location of synapses from cell body to dendrite (Diaz and Diana, 1992). The mechanism through which innervating preganglionic neurons transfer synapses from cell bodies to dendrites of postganglionic neurons is unknown. It is possible that the trafficking of TrkA endosomes into dendrites is important for this process by signaling to cluster post synaptic density proteins, promoting the formation of synapses, as seen in vitro (Sharma et al., 2010). To address this, we sought to confirm whether target-derived, signaling competent TrkA endosomes are located near dendritic synapses within the ganglion, as we see they are located near

PSDs in vitro. I first attempted to answer this question by using immuno-EM methods to gain nanometer resolution of P-TrkA puncta and PSDs, but was unable to achieve a system that was compatible with the glutaraldehyde sensitive antigen specificity of the P-

TrkA antibody while still maintaining the structural integrity of the PSD within SCG tissue sections.

As an alternate approach to the same end we utilized TH2A-CreER; R26-LSL-YFP mice to achieve sparse labeling of postganglionic neurons in the SCG, enabling us to isolate and analyze dendrites (Figure 2.14). To capture the period in which dendritic growth is most robust (Voyvodic, 1987) and during the switch of synapses from cell body to dendrite we analyzed ages P7, P14, P21, and P42. Analysis of P-TrkA (785) puncta within postganglionic neuron dendrites in relation to pre-synaptic terminals of preganglionic neurons (VAChT+ terminals) demonstrated that signaling competent TrkA endosomes

55 are apposed to pre-synaptic compartments throughout development (Figure 2.14 A). To validate that apposition to VAChT is indicative of a synaptic area we also stained for the post synaptic protein Homer1. We measured the co-localization of Homer1 and VACht at

P7, P14, P21, and P42 over dendritic length and compared those numbers to the co- localization values of P-TrkA and VACht at the same ages, finding the values to similarly increase at each age (Figure 2.14 D-E), corroborating prior work in the SCG demonstrating an increase of synapses over development (Smolen and Raisman, 1980).

These findings strongly suggest that P-TrkA puncta in dendrites that co-localize with

VAChT puncta are located at synapses.

Figure 2.14 TrkA signaling endosomes are found in close proximity to synapses in vivo. A. Representative images at each developmental age (P7, P14, P21, P42) showing that P-TrkA puncta are found in TH2A-CreER;R26LSL-EYFP sparsely labeled dendrites closely apposed by VAChT puncta. B. Representative zoomed in dendrite from animal at postnatal age 21 illustrating P-TrkA puncta co-labeling with VAChT antibody. C.

Representative zoomed in dendrite from animal at postnatal 21 illustrating Homer1 puncta co-labeling with VAChT antibody. D. Quantification of co-localized P-TrkA and

VAChT puncta in dendrites of animals at each developmental age. (P7 0.08 ± 0.04 n=3,

P14 0.24 ± 0.10 n=3, P21 0.44 n=1, P42 0.72±.32, n=2) E. Quantification of co-localized

Homer1and VAChT puncta in dendrites of animals at each developmental age. (P7 0.58

±0.16 n=3, P14 0.82±.08 n=3, P21 1.04 n=1, P42 2.29±1.1 n=2; n reflects number of animals)

Figure 2.14

2.5 Inhibition of TrkA kinase activity in the SCG decreases synaptic puncta.

Our descriptive analysis of target derived TrkA endosomes has shown that NGF-TrkA endosomes are trafficked into dendrites both in vitro and in vivo, where they are signaling competent (Figures 2.4, 2.8, 2.12). TrkA endosomes in dendrites move dynamically in a bidirectional manner within a short distance (Figure 2.5). Signaling competent TrkA endosomes in dendrites in vitro and in vivo are located in close proximity to synaptic proteins through a robust period of dendritic and synaptic development (Figures 2.10,

2.14). These data and former observations showing the dependence of PSDs on target- derived NGF in vitro (Sharma et al., 2010) imply a functional role for dendritic TrkA endosomes in synapse formation as well as maintenance throughout development.

To address this idea we next asked whether inhibiting TrkA kinase activity in the ganglion would disrupt the number of synapses found there at postnatal day 21. By inhibiting TrkA kinase activity locally within the ganglion we are gaining insight into the role TrkA signaling plays within cell bodies and dendrites. At P21 dendrites are elaborate and synapses have already formed onto postganglionic dendrites, thus allowing us to question if TrkA signaling is necessary for maintenance of synapses. Again using a chemical-genetic approach to inhibit TrkA kinase activity in the presence of 1NM-PP1, we restricted the drug to one superior cervical ganglion through use of 1NM-PP1 incorporated Poly-Lactic-co-Glycolic-Acid (PLGA) microspheres (Phosphorex Inc.).

These microspheres provide a biodegradable drug delivery system that releases incorporated molecules as they undergo hydrolysis in aqueous environments (Makadia and Siegel, 2011; Wischke and Schwendeman, 2008) and as such are ideal for sustained local drug release. We generated 1NM-PP1 loaded PLGA microspheres and showed that

60 they deliver bioactive 1NM-PP1 and effectively inhibit TrkA signaling in cultured sympathetic neurons obtained from TrkAF592A mice but not wild-type mice (data not shown). I developed a survival surgery method in which I can inject directly into one superior cervical ganglia, without rupturing the carotoid artery or causing any overt changes in behavior of the mice. Injection of 1NM-PP1 loaded PLGA microspheres into

F592A one SCG of TrkA mice resulted in predominant inhibition of TrkA kinase activity in cells of the injected ganglion compared to the contralateral ganglion, indicating a spatial confinement of drug action (Figure 2.15).

Importantly, we find no inhibition of P-TrkA signaling in wild-type mice injected with

1NM-PP1 loaded PLGA microspheres or control PLGA microspheres, indicating

F592A specificity of the assay, nor in TrkA mice injected with control microspheres, indicating no effect on TrkA signaling from the PLGA microspheres or the survival surgeries (Figure 2.16).

To elucidate the role of TrkA signaling in cell bodies and dendrites in synaptic maintenance we performed immunohistochemical analysis on sections of the SCG of injected animals, staining for pre-synaptic protein VAChT and post synaptic marker

Homer1. Inhibiting TrkA kinase activity for 6-8 hours resulted in an approximately 65% reduction of both VAChT and Homer1 puncta in injected ganglia as compared to the number of synaptic puncta in contralateral ganglia, illustrating a requirement for somatodendritic TrkA signaling in maintaining [immunohistochemically defined] synapses (Figure 2.17 A-B). To ask if the decrease of pre and post synaptic puncta corresponded to a functional deficit we assessed an output of sympathetic system activity on the eye. We assessed ptosis, or eyelid droop, as this is one of the three main deficits of

Horner’s syndrome, a disorder resulting from a lesion to the sympathetic pathway supplying the head and neck (Martin, 2007). Ptosis was seen in ipsilateral eyes but not in contralateral eyes (Figure 2.17 C). Therefore, NGF-TrkA endosome signaling within ganglia is necessary for the maintenance of postsynaptic density proteins, as well as for the maintenance of synapses and function of the SCG.

Figure 2.15 Ipsilateral injection of PLGA-1NM-PP1 microspheres results in local inhibition of TrkA kinase activity. A. Graphic representation of the assay used to inhibit TrkA signaling in the somatodendritic compartment of postganglionic neurons in

F592A vivo. Injection of 1NM-PP1 loaded PLGA micropsheres into one SCG of TrkA mice results in inhibition of TrkA kinase activity in only the cells of that ganglion. B. SCG injection of 1NM-PP1 loaded PLGA micropsheres results in decreased TrkA signaling (P-

TrkA) in the ipsilateral ganglion compared to the contralateral ganglion. C.

Quantification of B. showing significant difference in number of P-TrkA puncta in the ipsilateral ganglion (0.005 ± 0.002 (SEM)) compared to contralateral ganglion (0.014 ±

0.004 (SEM)) (p=0.04) (one-tailed unpaired t-test, * p<0.05, t=1.933 df=10).

Figure 2.15

Figure 2.16 PLGA-1NM-PP1 microspheres, not control PLGA microspheres,

F592A specifically inhibit TrkA kinase activity in TrkA mice. A. Representative images of injected ganglia show that P-TrkA puncta are decreased only when PLGA microspheres

F592A loaded with 1NM-PP1 are injected into TrkA mice. B. Quantification of A. WT animals injected with PLGA-1NMPP1microspheres have significantly (p=0.03) more P-

F592A TrkA puncta per um2 (0.043±0.019 (SEM) n=3) than TrkA animals injected with

F592A PLGA-1NM-PP1 microspheres (0.004±0.002 (SEM) n=6). TrkA animals injected with control PLGA microspheres trend towards significant difference (p=0.101) in number of P-TrkA puncta per um2 (0.035±.008 (SEM) n=3). (one-way ANOVA F(2,

9)=5.698 P<0.05, post hoc Tukey’s multiple comparison’s test * p<0.05)

Figure 2.16

Figure 2.17 Local inhibition of TrkA kinase activity in the SCG decreases the number of synaptic puncta. A. Representative image illustrating that SCG injection of

F592A PLGA-1NM-PP1 microspheres into TrkA animals results in decreased postsynaptic puncta, Homer1, and presynaptic puncta, VAChT, in the ipsilateral ganglion compared to the contralateral ganglion. B. Quantification of ipsilateral P-TrkA (0.38±0.08 (SEM)),

Homer1 (0.36±0.07 (SEM)), and VAChT (0.40±0.09 (SEM)) puncta number normalized to the number of puncta in the contralateral ganglion after 6-8 hours of PLGA-1NM-PP1 microsphere ipsilateral SCG injection. (n=6 animals, column statistics two tailed t test, P-

TrkA t=7.474 df=5 p=0.0007, Homer1 t=9.733, df=5, p=0.0002, VAChT, t=6.891, df=5,

F592A p=0.0010). C. TrkA mice injected with PLGA-1NM-PP1 microspheres into one SCG exhibit eyelid ptosis in the ipsilateral eye.

Figure 2.17

2.6 Local TrkA kinase activity within dendrites is required for PSD maintenance.

Our in vivo findings and prior in vitro findings (Sharma et al., 2010) indicating that TrkA signaling is necessary in the SCG for maintaining synaptic proteins on dendrites and for normal sympathetic output support the idea that TrkA signaling in the somatodendritic compartment is necessary for synaptic maintenance. Since TrkA endosomes that move into dendrites both in vitro and in vivo are signaling competent and are located near synapses, it remained unclear if these endosomes functioned within dendrites or the soma, or both, for synaptic maintenance.

To address this question, I attempted several different methods. The first method involved designing a three compartment microfluidic chamber, envisioning that cells plated in the middle compartment would extend axons through microfluidic grooves in one direction, just as in our two compartment microfluidic devices, and extend dendrites through shorter 50μm grooves in another direction. The existence of a distinct “dendrite compartment” would have allowed for specific inhibition of TrkA kinase activity in dendrites. While three compartment chambers have been used successfully (Taylor and

Jeon, 2011), this method failed to work in my hands because the dendrites of the sympathetic neurons failed to grow through the microfluidic grooves into a separate compartment.

A second method I developed for use within the lab to determine if TrkA endosomes signaled for synaptic maintenance within dendrites or the soma was the stripe assay.

Traditionally used as an assay to determine the effect of axon guidance cues as attractive or repulsive (Krull and Eisen, 2010), this assay has been adapted by Mu Ming Poo’s group to assess the roles of small molecules in the development of neuronal neurites

(Shelly et al., 2010). Our experimental plan to adapt the assay to our specific question was to alternate stripes of TrkA kinase inhibitor with neutral stripes, then plate sympathetic neurons onto the striped coverslips. Next, after waiting 14DIV for the growth of mature dendrites I would perform immunocytochemistry for P-TrkA and

MAGUK puncta to assess 1) if inhibition of TrkA kinase activity was achieved within dendrites grown onto “inhibitory stripes” and 2) ask if TrkA kinase activity was necessary within dendrites to form or maintain clusters of PSDs or if TrkA signaling in the soma was sufficient. Preliminary evidence from this assay suggested that TrkA signaling in dendrites was necessary for the presence of PSDs. However, there were caveats with this system, namely, 1) we could not be certain that the TrkA kinase activity inhibitors were remaining on the coverslip in specific stripes and not diffusing throughout the entire cell body/dendrite compartment over the two weeks of neuronal growth, and 2) we were unable to parse out if the inhibition of PSDs was due to a lack of forming or an inability to be maintained, which would leave the precise role of local dendritic TrkA signaling somewhat elusive.

Having successfully achieved local inhibition of TrkA kinase activity in vivo through the use of PLGA microspheres loaded with 1NM-PP1 I decided to try to adapt the method beyond its current scope for use in our in vitro compartmentalized chamber culture system. First, I replicated our prior in vitro findings that somatodenditic TrkA signaling is required for retrograde control of synapse maintenance. In these experiments, we added

1NM-PP1-PLGA microspheres to the somatodendritic compartment of cultured sympathetic neurons, attaining sustained TrkA kinase inhibition within this compartment while simultaneously applying NGF only to the distal axon compartment to ensure

70 analysis of retrogradely trafficked TrkA endosomes (Figure 2.18). We found a dose- dependent effect of 1NM-PP1-PLGA microspheres, but not control PLGA microspheres, on P-TrkA and MAGUK puncta in cell bodies and dendrites (Figure 2.19). Thus, it appeared that I had developed a method that would work to help us isolate TrkA kinase activity within dendrites from activity within cell soma to determine the functional role of target-derived TrkA signaling endosomes in dendrites.

To achieve specific inhibition within dendritic locales, I applied a low density of biotinylated 1NM-PP1-PLGA microspheres to the somatodendritic compartment of neurons cultured on streptavidin-coated coverslips to anchor the microspheres, resulting in a slow release of 1NM-PP1 in the same locations for the duration of the experiment, a crucial facet of an experiment constructed to analyze local inhibition (Figure 2.20). We verified that the biotinylation process did not obscure the effectiveness of the microspheres. After 6-8 hours of incubation, we observed a trend (p=0.07) of an almost two-fold increase in the distance between the locations of PLGA-1NM-PP1 microspheres and P-TrkA puncta within dendrites but not between control PLGA microspheres and P-

TrkA puncta by using an ImageJ macro that measures the distance between the center of a manually identified microsphere and fluorescent puncta within a masked dendrite

(Figure 2.21 A). The difference observed between control and 1NM-PP1 loaded microspheres indicated local inhibition of TrkA kinase activities within dendrites.

Importantly, the amount of P-TrkA puncta within the soma of neurons in control or drug chambers was not significantly different, which allowed me to ask if TrkA kinase signaling in dendrites or in the soma functions to maintain post-synaptic density clusters

(Figure 2.21 C). Using the same macro, I quantified the distance between both drug

71 loaded microspheres and control microspheres and MAGUK puncta, observing a significant increase in the distance between 1NM-PP1-PLGA microspheres and PSDs as compared to control microspheres (Figure 2.21 A). As the placement of microspheres in proximity to dendrites is a random process, we ensured that the results were not skewed by a significant difference in the distance of microspheres to dendrites between the control and drug conditions (Figure 2.21 B). These analyses taken together show that I have developed a chemical-genetic assay that utilizes PLGA microspheres as a platform of sustained focal drug release, enabling us to create small pockets of TrkA kinase inhibition and show that target-derived TrkA endosomes function in dendrites to maintain post-synaptic density clusters.

Figure 2.18 NGF-TrkA signaling is required for synapse formation in cell body/dendrite compartment. A. NGF applied only to the distal axon compartment in

F592A microfluidic cultures of TrkA sympathetic neurons 14 DIV does not support PSD formation, shown by MAGUK antibody staining, when the small molecule 1NM-PP1 is added to the CB/dendrite compartment, inhibiting TrkA kinase activity, illustrated by P-

TrkA antibody staining. 1NM-PP1 in wild type cultures has no effect. B. Quantification of decreased P-TrkA puncta per μm dendrite in a dose (of 1NM-PP1) dependent manner.

C. Quantification of decreased MAGUK puncta per μm dendrite at various doses of

1NM-PP1. (n=10-15 dendrites per condition)

Figure 2.18

Figure 2.19 PLGA microspheres loaded with 1NM-PP1 inhibit TrkA kinase activity and PSDs. A.B. PLGA-1NM-PP1 microspheres added to mass cultures of

F592A TrkA sympathetic neurons 14 DIV have decreased numbers of P-TrkA puncta (A.) and PSD93-GFP puncta (B.) within cell bodies compared to mass cultures of

F592A TrkA sympathetic neurons 14 DIV that received control PLGA microspheres. (n=7

PLGA control neurons, n=6 PLGA-1NM-PP1 1:100 neurons, n=6 PLGA-1NM-PP1 1:0 neurons) C. Biotinylated PLGA control or PLGA-1NM-PP1 microspheres were added to

F592A TrkA sympathetic neuron DIV 14 mass cultures at concentrations 1:100, 1:50, and

1:25, illustrating that at these concentrations numbers of P-TrkA, MAGUK, and PSD93-

GFP puncta are relatively maintained within cell bodies. (Control n=7 neurons, 1:100 n=5 neurons, 1:50 n=7 neurons, 1:25 n=5 neurons) D. Biotinylated PLGA control or

F592A PLGA-1NM-PP1 microspheres were added to TrkA sympathetic neuron DIV 14 mass cultures at concentrations 1:100, 1:50, and 1:25, illustrating that at these concentrations numbers of P-TrkA, MAGUK, and PSD93- GFP puncta are decreased within dendrites.

(control n=19 dendrites, 1:100 n=13 dendrites, 1:50 n=18 dendrites, 1:25 n=11 dendrites)

Figure 2.19

Figure 2.20 In vitro assay for local inhibition of TrkA kinase activity within dendrites. A. PLGA-1NM-PP1 microspheres are applied to the somatodendritic

F592A compartment of DIV 14 compartmentalized TrkA sympathetic neurons while NGF is applied to the distal axon to achieve localized TrkA kinase inhibition pockets adjacent to dendrites. B. Bright field image of SCG neurons with arrows pointing to PLGA-1NM-

PP1 microspheres. C. Representative images showing P-TrkA and MAGUK immunohistochemistry of neurons that were treated with PLGA-Control or PLGA-1NM-

PP1 microspheres, respectively.

Figure 2.20

Figure 2.21 Local TrkA kinase activity maintains synapses. A. Quantification of the distance between PLGA-Control or PLGA-1NM-PP1 microspheres and the nearest P-

TrkA or MAGUK puncta (t-test *p<0.05, #p<0.1, n=5 experiments). B. Quantification of the average distance between each quantified PLGA microsphere and dendrite mask per experiment (one-way ANOVA, *p<0.05 n=5 experiments). A and B quantification obtained using novel ImageJ macro by Daniel Tom at the Harvard NeuroDiscovery

Center. C. Analysis of the number of P-TrkA puncta in cell bodies in neurons treated with either PLGA-Control or PLGA-1NM-PP1 microspheres (t-test *p<0.05, n=4 experiments).

Figure 2.21

Chapter 3

Discussion and Future Directions

3.1 Conclusions

It has been well established over decades of neuroscience research that nerve growth factor is a major molecular player in the development of the sympathetic nervous system.

Its roles in final target innervation, survival, dendritic elaboration and synapse formation have all been investigated. However, a major question that remained unanswered was elucidating the mechanism through which NGF promotes formation and maintenance of synapses on sympathetic neuron dendrites. My dissertation work adds to our understanding of neurotrophin-dependent neural development, as I report that NGF from the target is necessary for synaptic maintenance through local dendritic signaling of

NGF-TrkA endosomes. Target-derived NGF-TrkA endosomes are trafficked retrogradely from axons, then through cell bodies, and into dendrites where they move in a bidirectional manner that is suggestive of clustering post-synaptic density proteins.

Through a novel series of in vitro and in vivo techniques, we have demonstrated that target-derived signaling competent endosomes move into dendrites and are located in close proximity to synapses. We next assessed the necessity of TrkA kinase activity in cell bodies and dendrites for synapse formation; in the absence of TrkA signaling within the sympathetic ganglia, synaptic protein levels are decreased, indicating a requirement of TrkA signaling for synapse maintenance in dendrites. Deficits in dendritic TrkA signaling are also correlated with ptosis, a sympathetic signaling deficit phenotype which leads to reduced tone in the superior tarsal muscle and drooping eyelid. To determine whether the maintenance of PSDs in dendrites is due to TrkA signaling within the cell

81 body or more locally, at synapses within dendrites, we locally inhibited TrkA signaling in dendrites, but not in cell bodies, in vitro. These experiments revealed that decreased dendritic TrkA signaling leads to an inhibition of PSD clustering within that same dendritic area, but not in areas of dendrites where TrkA signaling has not been blocked.

Taken together, our results indicate that NGF trafficked from sympathetic targets is necessary not only to promote systems matching survival of sympathetic neurons but also to shape the connectivity of these circuits by regulating the number of preganglionic- postganglionic synapses, through local TrkA signaling (Figure 3.1).

Figure 3.1 Target-derived NGF-TrkA endosomes signal for synaptic maintenance.

A. NGF binds to and activates its receptor TrkA at the distal axon promoting the internalization and retrograde transport of a NGF-TrtkA signaling endosome. NGF-TrkA endosomes move retrogradely through axons in a saltatory manner, slow down or halt in cell bodies, and a subset are transported into dendrites where they move in a bidirectional manner adjacent to PSDs (in vitro) and presynaptic terminals (in vivo). B. TrkA kinase activity within dendrites promotes the maintenance of synapses.

Figure 3.1

3.2 A mechanism through which NGF-TrkA signaling regulates dendritic synaptogenesis

I have shown that target-derived TrkA endosomes are transported into dendrites, where they are signaling competent, and signal locally to maintain postsynaptic density proteins.

These observations provoke new questions. With our current knowledge and tools we could further elucidate the mechanism through which TrkA signals in dendrites to regulate synaptogenesis. Specifically, we can assess which TrkA signaling pathway is necessary for synaptic maintenance, whether or not TrkA kinase activity is necessary for endosome movement into dendrites, and how the TrkA signaling endosomes moves in relation to PSD clusters.

TrkA signaling pathway for maintenance of PSDs

We found that local signaling of NGF’s receptor TrkA is necessary in dendrites for the maintenance of synapses, both in vitro and in vivo. Future studies will be needed to determine the identity of TrkA signaling pathway through which this NGF function is executed. NGF-TrkA signaling functions are carried out through three main effector pathways: the MAPK pathway, PI3K pathway and the PLC-γ pathway (Kaplan and

Miller, 2000). Previous studies have indicated that PI3K/AKT signaling is the main effector of NGF mediated survival of sympathetic neurons (Crowder and Freeman,

1998), showing that this effector pathway is necessary for the initiation of retrograde transport from the target as well as necessary within cell bodies (Kuruvilla et al., 2000).

With regards to NGF signaling in support of PSD function, however, work in compartmentalized cultures of sympathetic neurons demonstrated that PI3K signaling is not necessary within the cell body and dendrite compartment for the formation of PSD

85 clusters (Sharma et al., 2010). Conversely, inhibition of the MAPK/MEK signaling pathway within both the cell body and dendrite compartment did prevent the formation of

PSD clusters (Sharma et al., 2010), indicating that this may be the pathway through which local TrkA signaling mediates synapse formation and maintenance. Another clue to the signaling pathway utilized for the maintenance of synapses can be found in the P-

TrkA antibodies used for this study. We found that antibodies specific to two TrkA autophosphorylated tyrosine residues 490 (P-TrkA (Y490)) and (P-TrkA (Y785)) puncta were located in dendrites of sympathetic neurons after application of NGF to distal axons, with more robust expression of P-TrkA (Y785) (Figures 2.7, 2.8). The TrkA receptor phosphorylated tyrosine residue 490 is commonly associated with docking proteins Shc and FRS2 (Kaplan and Miller, 2000) which are required for activation of the Ras-MAPK pathway as well as the PI3K pathway (York et al., 2000). Phosphorylation of tyrosine

785 is more commonly associated with recruitment of the enzyme PLC-γ, whose activation causes release of internal Ca2+ and activation of protein kinase C (Reichardt,

2006). Interestingly, when the analogous PLC-γ recruiting tyrosine residue in TrkB receptors is mutated in a loss of function manner (trkBPLC/PLC mice), BDNF-TrkB stimulated LTP in hippocampal neurons is inhibited (Minichiello et al., 2002). Other work has shown that activation of TrkB signaling through PLC-γ is necessary for the proper localization of PSD-95 in hippocampal neuron dendrites, while inhibition of the

MAPK pathway decreased expression of PSD-95 both in the soma and in dendrites

(Yoshii and Constantine-Paton, 2014). This suggests that there may be different roles for different TrkA effector pathways in the process of clustering and maintaining PSDs in dendrites. Therefore, I hypothesize that local TrkA signaling within dendrites clusters

PSD proteins and maintains PSD localization to synapses mainly through activation of the PLC-γ pathway, while signaling through TrkA (Y490) and the MAPK pathway may support PSD formation and maintenance through signals that emanate from within the soma. The in vitro microsphere assay that I have presented in this work would be ideal for addressing this question, as microspheres loaded with pharmacological inhibitors of

PLC-γ and MAPK/MEK pathways could be used to specifically inhibit these pathways within dendrites of cultured sympathetic neurons and ask if PSD clusters remain or dissipate.

Is TrkA kinase activity necessary for movement of endosomes into dendrites?

A question that directly stems from this work is whether TrkA kinase activity is necessary for the movement of NGF-TrkA endosomes into dendrites, and complementary to that, if TrkA kinase activity is necessary for movement of endosomes within dendrites.

My data show that both in vitro and in vivo there are a fraction of TrkA endosomes within dendrites that are not signaling competent (Figures 2.8, 2.12), making it a distinct possibility that NGF-TrkA endosomes can move from soma to dendrite without TrkA kinase activity. There is also evidence from prior studies that TrkA kinase activity is not required for the transport of retrogradely trafficked endosomes within proximal axons

(Ye et al., 2003), therefore it may be that the actual transport of TrkA endosomes amongst various cellular compartments is regulated by other endosome associated proteins such as cofilin (Harrington et al., 2011).

However, as only a subset of the endosomes that are transported from distal axon to soma are also transported into dendrites and TrkA signaling within dendrites is necessary for synapse maintenance, future directions should include addressing the role TrkA kinase

87 activity plays in the transport of endosomes from soma to dendrites. To address this question one would want to locally inhibit TrkA kinase activity within the soma and ask if target-derived endosomes move into dendrites. Several novel tools are now available which makes answering this question possible. The first is the PLGA microspheres loaded with 1NM-PP1, which allow for local inhibition of cellular compartments even within the same physical compartment. The second tool is a Flag-TrkB/AF592A chimera of the TrkB extracellular domain and TrkA intracellular domain in which BDNF activates the intracellular signaling of TrkA (Ye et al., unpublished). This tool also allows for the visualization of trafficking endosomes through the Flag epitope tag as well as the 1NM-

PP1 induced inhibition of TrkA kinase activity through the F-592-A point mutation within the TrkA catalytic domain. This construct can be expressed in sympathetic neurons through lentiviral delivery which allows us to combine the live cell Flag-TrkA assay with the chemical genetic inhibition of TrkA kinase activity. The combination of these techniques will enable us to 1) ask if specific inhibition of TrkA kinase activity in cell bodies affects the trafficking of endosomes into dendrites 2) if local inhibition of

TrkA kinase activity within dendrites affects the characteristic live cell dynamics of TrkA endosomes within dendrites and 3) if inhibiting TrkA kinase activity in dendrites causes

NGF-TrkA endosomes to leave the dendrite and return to the soma.

The Flag-TrkB/AF592A chimera would allow us to answer another pressing question brought up by this work: how labile is the NGF-TrkA signaling endosome within dendrites? Specifically, if the TrkA endosome is no longer signaling competent, is it trafficked back to the soma, does it undergo maturation towards lysosome degradation, or does it remain in dendrites, poised to signal for PSD clustering again? A previous study

88 demonstrated that TrkA endosomes can be newly phosphorylated following dephosphorylation (Ye et al., 2003). In addition, my own results indicate that non- phosphorylated NGF-TrkA endosomes are found in dendrites. I would therefore propose that NGF-TrkA endosomes in dendrites can be re-phosphorylated and competent to mediate synaptic maintenance. This hypothesis could be tested by performing a live cell

Flag-TrkB/AF592A assay to visualize the movement of TrkA endosomes. During the experiment, soluble 1NM-PP1 could be applied to the cell body/dendrite compartment to inhibit TrkA kinase activity. This approach will disrupt TrkA signaling and cause

MAGUK clusters to decrease. Wash out of 1NM-PP1 would then enable one to ask if

PSD clusters re-form around the same TrkA endosomes. Simultaneously blocking retrograde transport with application of colchicine in the distal axon compartment endosomes would ensure that re-clustering of PSDs is not due to newly retrogradely trafficked endosomes.

Are TrkA signaling endosomes localized near PSDs?

My results using the live cell Flag-TrkA assay demonstrate that the movement of TrkA endosomes in dendrites is bidirectional. One possible explanation of this observed trajectory of NGF-TrkA endosomes is that these endosomes move back and forth within a small segment of dendrite to aggregate postsynaptic density proteins into a larger postsynaptic structure. The nature of the bidirectional movement as well as my results showing the very close proximity of the target-derived signaling endosomes and

MAGUK puncta strongly suggest this is the case, however, direct evidence is lacking.

This question could be answered using the live cell Flag-TrkA assay along with a fluorescently tagged PSD protein, but current methods have been unable to give

89 satisfactory results in my hands. I found that a transgenic PSD95-GFP mouse expressed puncta in sympathetic dendrites that co-localized with MAGUK antibody, but these overexpressed proteins were not dependent on NGF signaling and therefore using neurons from these mice would likely have yielded ambiguous results. Infection of sympathetic neurons with a lentiviral PSD95-GFP vector, while expressed in cell bodies, did not express within dendrites (at levels detectable by spinning disk confocal microscopy), possibly because the major postsynaptic scaffolding protein in sympathetic neurons is PSD93 (Parker et al., 2004). Despite these technical difficulties, this is a question worth pursuing. Potential ways to address the question in the future include novel knock-in fluorescently tagged PSD93 mice, or to clone a lentiviral fluorescently tagged PSD93 vector.

3.3 Broader Application to Circuit Development

A major question stemming from our work is: why is the NGF-TrkA endosome required to move into dendrites and signal for the formation and maintenance of synapses? We observe that signaling competent TrkA endosomes are found in dendrites throughout the period of development P7-P42 in mice. We also find that the inhibition of TrkA signaling in the SCG results in a decrease of not only post-synaptic proteins but also pre-synaptic vesicles within these ganglia. The findings of this work prompt us to hypothesize about why regulation of postsynaptic apparatus by the postganglionic neuron may be important, which can be framed in a larger discussion of synaptic formation and maintenance. I propose that TrkA signaling within the superior cervical ganglion plays a role in the shift of synaptic innervation from cell bodies to dendrites, either through intracellular or intercellular NGF signaling.

Localization of innervating axons

The question of how synaptic inputs are properly integrated into the SCG and other neuronal circuits is a major question in neuroscience. In early SCG development, synapses are concentrated on cell bodies of postganglionic neurons. In later development, however, synapses from preganglionic neurons are predominantly found in opposition of dendrites of postganglionic neurons (Diaz and Diana, 1992).It is important to note that, the time course during which this synaptic localization shifts is correlated with a period of robust dendritic elaboration within the sympathetic ganglia (Voyvodic, 1987).

The shift in localization of synapses from cell body to dendrite that occurs in the sympathetic circuit is also seen in a central nervous system circuit; the innervation of excitatory input climbing fibers from inferior olivary neurons onto Purkinje cells. Similar to what is seen in the sympathetic ganglia, climbing fibers first innervate the soma of

Purkinje cells, then during the second and third postnatal weeks synapses become concentrated on dendrites (Hashimoto and Kano, 2013).This process follows the development of Purkinje cell dendrite elaboration with a slight time lag (Hashimoto and

Kano, 2013). A recent study shed light on the regulation of development of this circuit by showing that the same transcription factor, RORα, is necessary at various stages of

Purkinje cell dendritic arborization and maintenance (Takeo et al., 2015). Micro-RNA knock-down of RORα at stages beyond the dendritic translocation phase caused a decrease in dendritic spines, and remarkably, resulted in an increased number of spines on somata, illustrating that factors intrinsic to the Purkinje cell determine postsynaptic areas, which may in turn regulate the dendritic translocation of synapses (Takeo et al.,

2015). The parallels of this cerebellar circuit development to the sympathetic circuit may

91 provide insight into the mechanism behind preganglionic fiber dendritic translocation of synapses, and vice versa. NGF-TrkA signaling, similar to RORα, is necessary at various stages of dendrite and synapse development and maintenance in the sympathetic circuit, and therefore is a good candidate for an intrinsic factor regulating the localization of synapses. As dendrites lengthen and elaborate, and NGF-TrkA endosomes move into primary, secondary and tertiary dendrites to form and maintain postsynaptic density structures, these signaling endosomes may promote the process of preganglionic innervation onto dendrites. This issue could be more directly addressed by locally inhibiting TrkA signaling within the ganglia at various stages of development (i.e., P0 compared to P14) and assessing the pattern of VAChT innervation on cell bodies versus dendrites.

An interesting observation from our work is that TrkA transported from the distal axon is transcytosed to the dendritic plasma membrane (Figure 2.6). This transcytosis event may result in the release of NGF into the extracellular space proximal to ganglia, which could act to promote the proper integration of presynaptic terminals with postsynaptic dendrites. One may speculate that NGF release could act as an autocrine and/or paracrine factor onto sympathetic neurons, resulting in the strengthening of synapses in dendrites that receive adequate amounts of neurotrophins from the target or even in a complex dendro-dendritic signaling mechanism (Kawai et al., 1993). It is also possible that NGF secreted from the postganglionic target leads to a response in preganglionic neurons, acting as a cue for these neurons to form synapses at specific locations on dendrites.

Preganglionic neurons do not express TrkA, but perhaps NGF mediated preganglionic to postganglionic communication is achieved through NGF signaling via its low affinity

92 receptor p75NTR, or through a signaling cascade initiated by NGF. Indeed, there is evidence for a postganglionic to preganglionic signaling mechanism during synapse formation, as evidenced by a study illustrating specific re-innervation of preganglionic neurons after axotomy (Nja and Purves, 1977a, b). It is possible that NGF acting on postganglionic dendrites can cause the local release of BDNF from the postganglionic neuron, guiding TrkB-expressing preganglionic innervating terminals to areas of dendrites that have already formed postsynaptic densities. Evidence for this “cascade of trophic factors” has come from work demonstrating the role of BDNF in regulating innervation density of preganglionic fibers onto postganglionic neurons (Causing et al.,

1997). Interestingly, the molecular mechanism by which climbing fibers change their localization of innervation from Purkinje cell body to dendrite remains unknown, but is thought to be a limiting molecule emitted from the Purkinje cells(Hashimoto and Kano,

2013).This theory could be tested by using PLGA microspheres for local delivery of chelating antibodies against NGF or BDNF.

A second possibility, however, is that an alternative signal from the target is also regulating the development of this circuit. My experiments analyzing the transport of

TrkA/WGA vesicles from the target into dendrites (Figure 2.12) suggest that this process may not be specific to TrkA, but may be a more fundamental feedback mechanism of circuit development and maintenance whereby the target end organ is influencing the properties of the innervating neurons.

Refinement of circuit through localization of synapses onto dendrites

The purpose of climbing fibers synapsing onto Purkinje cell dendrites is thought to be an activity-dependent refinement of inputs to achieve a one-to-one inferior olive neuron to

Purkinje cell circuit (Hashimoto et al., 2009; Nishiyama, 2014). The idea that dendritic translocation occurs as a circuit refining mechanism is certainly intriguing. In the sympathetic system, it may be that this process helps to decrease redundant input onto postganglionic neurons (Lichtman and Purves, 1980). We know that the sympathetic circuit is a divergent circuit, where one preganglionic neuron will innervate approximately 10 postganglionic neurons (Nja and Purves, 1977b), but perhaps innervation density is different during late embryonic and early postnatal stages, before elaboration of dendrites. The elaboration and arborization of dendrites from postganglionic neurons may enhance the divergence of the circuit simply by increasing the number of postganglionic neurons within one area of physical space. This idea is supported by the observation that preganglionic neurons from one spinal cord segment appear to innervate neurons within the same area of a ganglia (Lichtman et al., 1980).

Elaboration of dendrites

The process of synapse formation during development is tightly coupled with the elaboration of dendrites in these circuits. It is known that NGF regulates the complexity of dendritic arbors, but it remains to be determined whether local NGF signaling within dendrites is necessary for this process. We now have tools with which to parse out the role of local TrkA signaling in dendritic growth and elaboration. Injection of PLGA-

1NM-PP1 microspheres at various stages of development in a triple transgenic animal

(THCreER; R26-LSL-YFP; TrkAf592A) to analyze the growth and complexity of dendrites as compared to the control ganglia may reveal if local TrkA signaling regulates the growth of dendrites during development.

Postsynaptic cell regulation of synapses

Synapse formation is traditionally thought to be driven by presynaptic innervation of a postsynaptic cell, perhaps modulated by the postsynaptic neuron or local environmental cues. However, our work, building on prior work in the field, argues that signals from the postganglionic neuron are not modulatory but rather a necessary component of the mechanism for the maintenance of axo-dendritic synapses within the sympathetic nervous system. Early sympathetic system studies noted that physical or chemical interruption of communication between postganglionic axons and their target fields in adult animals resulted in a decreased number of postsynaptic densities as well as inhibited postsynaptic potentials (Purves, 1975; Purves and Nja, 1976). Recovery of synaptic transmission was only seen in animals in which peripheral synaptic connections were reestablished

(Purves, 1975). These studies were highly suggestive of a target derived factor acting as a synaptic maintenance cue, likely NGF (Purves and Nja, 1976). Further support of this idea is work performed in vitro demonstrating that target-derived NGF is necessary for the formation of postsynaptic density clusters (Sharma et al., 2010). My work adds support for the model that NGF-TrkA signaling is necessary for the maintenance of synapses, by showing that inhibiting TrkA signaling leads to a decrease in synaptic proteins in the SCG. My work further extends this model by illustrating that the regulation of synapse maintenance is executed through a local dendritic signaling mechanism. In order to determine whether postganglionic neurons also regulate presynaptic innervation of axons one could inject PLGA-1NM-PP1 microspheres into the ganglia and show that on some time-scale there is a decrease in postsynaptic proteins prior to the decrease of presynaptic proteins.

The idea that signals from the target end organ signal within postganglionic neurons to regulate numbers of synapses between that neuron and the preganglionic neuron that innervates it certainly presents a post-synaptic-cell-centric view of synaptic formation and maintenance. However, postsynaptic cells’ regulating their own innervation has been described in other systems, including in another cholinergic system, the neuromuscular junction. Formation of the NMJ postsynaptic apparatus requires MuSK and rapsyn, with motor innervation of the muscle only required for later stages of synaptic growth and maintenance (Lin et al., 2001). Similar to the idea that TrkA signaling within dendrites may help to guide preganglionic terminals to appropriate dendrites through PSD formation and maintenance, the muscle of the NMJ demonstrates “prepatterned” postsynaptic structures prior to neuronal terminal innervation (Kim and Burden, 2008). Even more generally, the idea of a postganglionic neuron acting to become “receptive” to synaptic innervation, through circuit derived cues, is also seen in the visual system, where retinal ganglion cells receive signals from astrocytes that induce the ability of RGC dendrites to receive synaptic input (Barker et al., 2008).

3.4 Regulation of synapses from the target may be a fundamental mechanism of circuit development.

Our results demonstrate that NGF internalized from the sympathetic target regulates the connectivity of the sympathetic circuit by regulating the number of preganglionic- postganglionic synapses, which is achieved through local TrkA signaling in dendrites. I propose a model in which a novel “feedback” mechanism from the target regulates circuit and synapse development: circuits are formed in a “systems matching” manner, meaning that the target influences the amount of innervation it receives. Prior work has

96 demonstrated that elaboration and complexity of neuronal processes is largely influenced by innervation of the target field; increasing or decreasing target field size leads to an expansion or contraction of the dendritic field (Voyvodic, 1989a). In addition to this, I propose that the number and size of the synapses on dendrites is proportional to the target field size and that signaling from the target regulates the number of synapses within the circuit. Our findings may indeed represent a fundamental mechanism underlying circuit development.

To test this idea, one could employ similar strategies to those presented in this dissertation to investigate if neurotrophins, or any target derived signals, influence connectivity within the somatosensory system, for instance. It is known that NGF is retrogradely transported from the peripheral branches of dorsal root ganglion nociceptive neurons to their cell bodies. Due to the unique pseudo-unipolar morphology of these neurons, culture conditions have not been sufficient for determining whether NGF-TrkA endosomes are anterogradely transported from cell body to distal axons of their central nervous system processes. It would be interesting to inject PLGA-1NM-PP1 microspheres into the DRG and ask if TrkA kinase activity influences the connectivity of nociceptors within the dorsal horn of the spinal cord. This line of investigation could be medically relevant, as a substantial number of studies implicate NGF in inflammatory hyperalgesia (Mizumura and Murase, 2015). It may be that dysregulation of NGF-TrkA signaling results in increased numbers of nociceptive synapses and increased pain sensitivity during neuropathic pain states.

Another circuit in which to study the fundamental role of NGF as a circuit forming and maintenance molecule would be the central nervous system population of TrkA

97 expressing neurons, the basal forebrain cholinergic neurons (Friedman et al., 1993). My preliminary evidence suggests that NGF-TrkA endosomes are retrogradely transported from the distal axons of these neurons into dendrites, yet the role that TrkA signaling plays in these neurons and within this circuit remains to be elucidated. It is an important circuit to study, however, because adult rats lacking TrkA in the forebrain show deficits in attentional performance (Parikh et al., 2013). Furthermore, basal forebrain cholinergic neurons are a particularly vulnerable population in both Alzheimer’s disease and Down’s syndrome (Iulita and Cuello, 2014).

3.5 Translational Implications

As a branch of the autonomic nervous system, the sympathetic nervous system plays a major role in homeostatic functions of the body and influences many physiological functions. Therefore, the proper development of this circuit is essential, and thus the study of how this circuit develops is imperative. Here we show that NGF regulates proper circuitry of the sympathetic system through local TrkA signaling, functioning for the maintenance of synapses. The role of NGF as an important maintenance factor of this system has been noted in various sympathetic target circuits, for example, abnormal NGF levels have been associated with heart failure and sudden cardiac death (Fukuda et al.,

2015), as well as overactive bladder syndrome (Seth et al., 2013). Thus, the work presented here may have therapeutic implications for many sympathetic nervous system- associated disorders.

Loss of ganglionic NGF-TrkA function in post-weaning (P21) mice results in a decrease of synapses, as well as a hallmark phenotype of Horner’s syndrome, ptosis (Martin,

2007). The ptosis phenotype may be a result of impaired sympathetic innervation of the

98 tarsal musculature of the eyelid, presenting as droopy upper or lower eyelids (Eldredge et al., 2008). Thus, in disrupting the circuitry of the SCG by inhibiting TrkA kinase activity, we have identified a potential molecular mechanism underlying Horner’s syndrome. To test this, an assessment of the other main features of Horner’s syndrome, miosis and anhidrosis (Martin, 2007), should be completed by examining the pupillary light reflex in the ipsilateral pupil of mice that were locally injected with PLGA-1NMPP1 microspheres. Future experiments elucidating the role of soma and dendritic NGF-TrkA signaling in this disorder, which is frequently associated with cluster headaches (Martin,

2007), may prove valuable to the medical community.

Materials and Methods

Mouse Husbandry and Genotyping

TrkAF592A/F592A mice (Chen et al., 2005a) were maintained homozygous on a C57BL/6 background. TrkAFlag/Flag mice (Sharma et al., 2010) were maintained homozygous on a mixed background. TH-2A-CreER mice were generated in the Ginty laboratory by knocking in a T2A-CreERT2 peptide, inserted after the TH endogenous sequence and before the 3'UTR of the TH locus (unpublished). Heterozygous males were crossed to homozygous Rosa-CAG-LSL-EYFP-WPRE (Madisen et al., 2010) reporter mice and were genotyped for TH-2A-CreER using the following primer set which detect both mutant and wild type alleles; TH-2A-CreER-1: CATGCCCATATCCAATCTCC, TH-2A-CreER-2:

CTGGAGCGCATGCAGTAGTA, and TH-2A-CreER-3:

ATGTTTAGCTGGCCCAAATG. Analyses of wild type neurons or tissue were performed on C57BL/6 or CD1 background mice. Mice were handled and housed in accordance with the Harvard Medical School and Johns Hopkins University IACUC guidelines.

Neuronal Culture

SCG neurons were cultured as previously described (Wickramasinghe et al., 2008; Ye et al., 2003). In brief, neurons were obtained by enzymatic dissociation of P0–P4 mouse

SCG. These neurons were plated in DMEM supplemented with 10% fetal bovine serum

(FBS), penicillin/streptomycin (1 U/ml), and 50 ng/ml NGF purified from mouse salivary glands or purchased (NGF 2.5S) from Harlan laboratories. After 24–48 hrs, 5 μM Ara-C was added to the culture media for 48–96 hrs to eliminate glial contamination. This

100 resulted in long-term neuronal cultures that remained essentially glia-free for the duration of all experiments. Media was changed every 48 hrs and all experiments commenced 14–

16 DIV for mass cultures and microfluidic chambers (unless otherwise noted). SCG neurons were cultured in microfluidic chambers as previously described (Harrington et al., 2011; Sharma et al., 2010). In experiments with biotinylated PLGA microspheres, coverslips were coated with 5 μg/mL Streptavidin for 1 hour and rinsed twice with ddH2O prior to plating of neurons.

Immunocytochemistry

Neurons were fixed in 4% PFA/1xPBS for 15 minutes at room temperature. After fixation, they were thoroughly washed in 1xPBS, blocked for 30–60 min in 5% Normal

Goat Serum with 0.05% Triton-X in 1xPBS at room temperature, and incubated overnight at 4°C in 1% Normal Goat Serum block solution containing primary antibodies. Neurons were then rinsed in PBS, incubated with appropriate Alexa Flour fluorescent secondary antibodies in 5% Normal Goat Serum block solution for 60 min at room temperature, rinsed again in PBS, and subsequently mounted for confocal microscopy. Primary antibodies include pan-MAGUK K28/86 (1:500,

Neuromab/Antibodies Inc.), MAP-2 (1:5000, Millipore 06-574), P-TrkA (Y785) (1:1000,

Cell Signaling 4168S), P-TrkA (Y490) (1:1500, Cell Signaling 4691S), Flag-M1 (1:1000,

Sigma F7425), Homer1 (1:1000 Synaptic Systems 160003).

Microfluidic Chambers

Microfluidic chambers were generated as previously described (Park et al., 2006). Masks were designed in AutoCad and made by Photo Sciences Inc. Molds were generated in

101

Johns Hopkins Whitaker Institute Lithography and Fabrication Facility by Katie Lehigh,

David Ye, or Huy Vo.

Flag-TrkA Assay

Assay was performed as described previously (Sharma et al., 2010). Cells were NGF starved overnight at 37C in DMEM. The following day, cells were habituated to 4°C for

10-15 minutes, then Flag antibody, either M1 (1 µg/mL) or FlagM1-FAB (6 μg/mL) diluted in DMEM was applied to only the distal axon compartment at 4°C for 45 min-1 hour. Cells were washed in DMEM to remove any unbound antibody, then NGF (50-100

µg/mL) diluted in DMEM was applied only to the distal axon compartment. Complete compartmentalization of both antibody and ligand to the distal axons was achieved using microfluidic chambers, with a volume of 80 μL added to distal axon compartment and a volume of 120 μL added to cell body/dendrite compartment. After NGF application cells were incubated in a humidified 10% CO2 incubator at 37°C for 1-6 hours depending on the purpose of the experiment. Cells were then immunostained according to in vitro immunostaining protocol above.

Live Cell Imaging Flag-TrkA Assay

The live cell Flag-TrkA assay was completed the same as the fixed Flag-TrkA assay with one exception; Flag antibody, either M1 (1 µg/mL) or FlagM1-FAB (6 μg/mL) was incubated with 2 µg/mL Alexa Fluor secondary antibody, diluted in DMEM, for 1 hour at room temperature on a shaker. This conjugated primary-secondary antibody was then applied only to the distal axon compartment at 4°C for 45 min-1 hour. Cells were washed in DMEM to remove any unbound antibody, then NGF (50-100 μg/mL) diluted in

102

DMEM was applied only to the distal axon compartment. Complete compartmentalization of both antibody and ligand to the distal axons was achieved using microfluidic chambers, with a volume of 80 µL added to distal axon compartment and a volume of 120 μL added to cell body/dendrite compartment. After NGF application, cells were incubated in a humidified 10% CO2 incubator at 37°C for 1-6 hours depending on the purpose of the experiment. To image tagged endogenous TrkA endosomes’ dynamics in real time without harming neuronal health, three conditions must be met: there must be proper CO2 buffering, the temperature must remain consistently 36-37°C, and the chambers must stay hydrated. The first was achieved either through using a HEPES based

ACSF medium (120mM NaCl, 5mM KCl, 5mM CaCl2, 2mM MgCl2, 25mM HEPES (pH

7.4), 30mM glucose) or a CO2 buffered chamber on the spinning disk microscope.

Temperature was maintained through feedback monitors linked to the microscope stage.

Hydration was maintained either through adding new ACSF media or via humidified stages on the microscope. Actual imaging was achieved in the following manner: the glass coverslip, with microfluidic chamber attached, was removed from the petri dish and placed onto the microscope stage, where it could be imaged using either 40x or 63x magnification objectives. It is also possible to use glass bottomed petri dishes as long as the diameter of the glass will fit the microfluidic chamber. Imaging was completed on a

Yokogawa spinning disk microscope (Zeiss) in the laboratory of Mollie Meffert for the first three years, and subsequently in the Harvard Neurodiscovery Center Enhanced

Neuroimaging Core on an Andor Revolution Spinning Disk Microscope, using fast piezo

Z sectioning (Prior Piezo Stage with 250um travel - Z250).The latter of these microscopes achieved temperature, CO2, and humidity maintenance by both a whole

103 scope incubator and small stage top incubator. Videos were taken with maximum speed acquisition allowed by the number of 1 um Z slices necessary to capture the depth of the dendrite and cell body of interest. Photobleaching was achieved by applying maximum laser intensity to the cell of interest for 5 minutes. At the end of the live cell experiments, cells were fixed and immunostained according to in vitro immunostaining protocol above and mounted for confocal microscopy.

Transcytosis Experiments

Protocol for transcytosis experiments was based on a previously described recycling assay protocol (Chen et al., 2005b). The Flag-TrkA assay was performed as usual;after the desired period of TrkA trafficking (3-6 hrs), appropriate secondary antibodies were added to the non-permeabilized cultures at 4°C for 1-2 hours. Secondary antibody was washed off cells with 1xPBS, and cells were fixed, blocked, then stained for P-TrkA or

MAP2. Stripping buffer (either 1mM EDTA or 0.5M NaCl/0.2M Acetic acid) was applied before and after application of secondary antibody in additional chambers as distinct negative controls.

Tissue Immunohistochemistry

SCG sections were produced by dissecting the ganglia from mice euthanized via CO2 and fixing the ganglia in 4% PFA/1xPBS at room temperature for one hour. Fixed and washed tissue was cryoprotected in 30% sucrose, embedded in OCT, and cryosectioned at a thickness of 20 μm. For WGA-555 eye injection experiments, sections were rehydrated in 1xPBS, blocked for 30-60 min (5% Normal Goat Serum, 0.05% Triton-X in

1xPBS), and incubated in primary antibody diluted in block overnight at 4°C. They were

104 subsequently washed in 1xPBS, incubated with appropriate Alexa Fluor fluorescent secondary antibodies for 60 min at room temperature, washed in PBS, and then mounted for confocal microscopy. For all other experiments, an alternative, high salt protocol was used. For this, cryosections were rehydrated in 1xPBS, incubated in 50% EtOH for 30 min, then washed in high salt PBS (0.3M NaCl) and incubated in appropriate primary antibodies diluted in high salt PBST (0.3M NaCl, 0.03% Triton-X) for 48-72 hours at

4°C. They were subsequently washed in high salt PBS, incubated with appropriate Alexa

Fluor fluorescent secondary antibodies for 60 min at room temperature, washed in high salt PBS, and then mounted for confocal microscopy. Primary antibodies include TrkA

(1:1000, Millipore 06-574), P-TrkA (Y785) (1:1000, Cell Signaling 4168S), Flag-M1

(1:1000, Sigma F7425), Homer1 (1:1000, Synaptic Systems 160003), MAP2 (1:2500,

Millipore AB5543), GFP (1:1000, Aves GFP 1020), and vAChT (1:200, Enzo Life

Sciences BML-SA684-0100).

Intraperitoneal injections for P-TrkA antibody specificity To address the specificity of P-TrkA antibodies in vivo, the inhibitor 1NM-PP1 was dissolved in DMSO to make a 200mM stock, and 2.5 µL of the 1NM-PP1 solution or

DMSO was diluted into 100 μL of injection solution (0.9% NaCL, 2.5% Tween-20) for intraperitoneal injections. Treatments were given every hour for a total of four times, in

P10-P12 aged TrkAF592A/F592A mice. The inhibitor was synthesized by Aurora Analytics

LLC.

Retrograde eye injection

10 µL WGA-555 was injected into the anterior chamber of the eye of anesthetized P21-

P30 male mice using a Hamilton syringe as previously described (Hendry et al., 1974b).

105

Mice were euthanized 16-20 hours later via CO2. SCGs were dissected out and standard immunohistochemical tissue processing procedures (above) were followed.

Tamoxifen treatment

One week before sacrifice and dissection of superior cervical ganglia, tamoxifen injections were administered to the mice at a dose that would achieve sparse labeling of neurons. (0.005 mg for P7, 0.01mg P14 and P21, and 0.1mg postnatal 6-8 wks)

Tamoxifen was dissolved in ethanol (20 mg/ml), mixed with equal volume of sun flower seed oil (Sigma), vortexed for 5-10 mins and centrifuged under vacuum for 20-30 mins to remove all ethanol. The solution was kept at -20°C and delivered via IP injection. SCGs were dissected at P7, P14, P21, and postnatal 6-8 weeks.

SCG microsphere injections

Male mice (P21) were anesthetized via continuous inhalation of isoflurane (1-3%) from a precision vaporizer for the 20 minute duration of the surgery. Breathing rate of each animal was monitored throughout the procedure, with adjustments to anesthetic dose made as necessary. Puralube, a protective eye ointment, was applied to the eyes while they were in the nose cone. To inject SCGs with microspheres, the area of the ipsilateral

SCG was treated with depilatory cream (NAIR, Church and Dwight Co.), for 1 min, washed with water, and then swabbed with 70% Ethanol and Betadine before incision.

An incision was made to the front of the neck, lateral to the midline. Fat, muscle, and glands were cut or moved aside to expose the SCG, residing at the juncture of the internal and external carotoid arteries. Next, a Hamilton syringe was used to puncture the membrane of the SCG and inject 1-5uL of 0.5 mg microspheres diluted in 10 mLs of

0.9% saline: either control (Phosphorex; PLGA 50:50, 5μm diameter) or 1NM-PP1

106 loaded PLGA microspheres (Phosphorex; PLGA 50:50, 11.5% 1NM-PP1 loading, 3μm diameter) were used. Skin was sutured using sterile vicryl sutures, then swabbed with

NewSkin adhesive (Fisher). Carprofen (4 mg/kg) was applied subcutaneously for analgesia immediately following the procedure, and animals recovered in isolation on a heating pad for 30 minutes. Six-eight hours following surgery animals were euthanized, their SCGs were dissected out and standard immunohistochemical tissue processing procedures (above) were followed.

In vitro PLGA microsphere assay PLGA microspheres were biotinylated to anchor them to streptavidin coated coverslips for in vitro local TrkA kinase inhibition experiments. Both control (Phosphorex; PLGA

50:50, 5μm diameter) and 1NM-PP1 loaded microspheres (Phosphorex; PLGA 50:50,

11.5% 1NM-PP1 loading, 3μm diameter) were biotinylated according to the following protocol. 0.5 mg microspheres were diluted in 1 mL of MES buffer (0.1mM MES pH5.5) then incubated with 140 μL of 50mM Amine-PEG-Biotin (Thermo-Scientific Pierce) in

MES buffer solution and 60 µL 100 mM EDC (Thermo-Scientific Pierce) in MES buffer solution for 1 hour on a shaker at room temperature. Solution was dialyzed using Pierce

Slide-A-Lyzer 20,000 MWCO dialysis cassettes in MES buffer at 4°C for 30 minutes.

Dialyzed microsphere solution was added to DMEM to bring to 10 mL solution and pH was brought to 7.4. This solution was further diluted 1:50 unless otherwise specified into

DMEM and applied to the cell body and dendrite compartment of sympathetic neurons grown on coverslips plated with streptavidin. After 1 hour for biotin-streptavidin binding cultures were washed with DMEM to remove any unbound microspheres. NGF was

107 applied to the distal axon and cultures were incubated at 37°C for the duration of the experiment, 6-8 hours. Cultures were then fixed and immunostained as described above.

Image Analysis

Endosome tracking Image analysis was completed through manual tracking of individual endosomes either using IMARIS spot tracking or the ImageJ MTrackJ plugin written by Erik Meijering

(Meijering et al., 2012). Directionality was defined as moving in a direction for 3 or more sequential image frames. Post-hoc MAP2 staining or DIC imaging was used to verify dendrites.

In vitro co-localization of P-TrkA and MAGUK Dendrites stained for P-TrkA, MAGUK, and MAP2 were imaged on an LSM700 Zeiss

Confocal Microscope using a 63x objective acquiring images that had 0.05µm sized pixels. Proximity was analyzed using a MATLAB script written by the Harvard Image

Data Analysis Core. Specifically, manual thresholding of MAP2 stained dendrites was performed to identify areas of interest. Robust point source detection and Gaussian PSF- model fitting were then performed within each dendrite area to identify both MAGUK and P-TrkA puncta with a precision ranging from approximately 15-70 nm (Aguet et al.,

2013). A distance-based co-localization measure was then calculated as previously described (Lachmanovich et al., 2003; Mendoza et al., 2011). Briefly, closest distances between points in the two image channels (MAGUK and P-TrkA) were calculated, and a frequency vs. search radius curve generated. This curve was then normalized to the mean frequency of interpoint distances observed in 500 rounds of randomly generated point positions with the same number of points and within the same dendrite area. These 500

108

rounds of randomization were conducted in two ways: once holding points from image

channel one (P-TrkA) fixed while randomizing channel two (MAGUK), and a second

time holding points from image channel two while randomizing channel one. Performing

randomizations in both channels controls for the fact that spatial patterns in the points in

one channel can potentially induce unauthentic indications of co-localization in the other

channel. In our data, no difference was seen between these alternate randomizations.

Significance of co-localization within each dendrite was determined by comparing the

measured density vs. distance to the 99th percentile of the density seen in the 500

randomizations in that cell. For analysis combining multiple dendrites from multiple

experiments, the normalized density curves for each cell were averaged and a 99%

confidence interval was then calculated at each distance by 5000 bootstrap repetitions, by

sampling from the individual dendrite curves with replacement. Significance was

determined by comparing these confidence intervals to what would be expected purely by

chance, represented as 1, which is the normalized frequency at any given distance.

Nearest-neighbor distances were also calculated between points to determine the fraction

of points within the 100 nm cutoff from one another.

The co-localization code is available upon request from the Image and Data Analysis

Core at Harvard Medical School (http://idac.hms.harvard.edu/).

Puncta analysis

In experiments where numbers of puncta (P-TrkA, VACHT, Homer) were quantified,

analysis was performed using ImageJ. Each channel of each image was thresholded, and

the particle analysis function was used to summarize the number and size of puncta

within the channel, which was analyzed relative to area, number of cell bodies, or

109 dendrite length (μm). Co-localization analysis was completed also using ImageJ. Channel one and channel two were individually thresholded to binary images and the number of puncta within each channel was quantified using the Analyze Particles function. Next, the binary images were processed using the Image Calculator function to identify pixels/puncta that were fluorescent (1 in binary terms) in both channels, and the number and size of these “co-localized” puncta were quantified. For developmental analysis of P-

TrkA in dendrites a comparison was done between the number of PTrkA puncta and

Homer puncta within the ganglia at each age. The amount of co-localization between

Homer and VACHT and PTrkA and VACHT puncta within TH labeled dendrites (using

ImageJ to mask regions of interest) of each animal at each age was analyzed.

Measurement of microsphere to fluorescent puncta

Data was analyzed using an ImageJ macro written by Daniel Tom at Harvard

Neurodiscovery Imaging Core. After microspheres within each image were manually selected as regions of interest (ROIs) each image was processed through the program as follows: 1) cell bodies were chosen as ROIs to be eliminated from the analysis 2) each channel (P-TrkA, MAGUK, MAP2) was manually thresholded to identify objects of each channel and the image was binarized 3) using the Image Calculator ‘AND’ function,

MAP2 and both puncta channels were combined to identify puncta within dendrites 4) center of microsphere ROIs was identified 5) the program used an algorithm to measure the distance between identified puncta and each microsphere and created a spreadsheet with the results of the nearest distance, in μm as well as the size of the nearest identified puncta and the distance of microsphere ROI to dendrite.

110

Data Analysis Statistical tests were performed using GraphPad Prism 6 software. Comparisons between two groups were done by Student's t test. Comparisons between more than one group were done using an ANOVA test followed by Tukey's post hoc test. Error bars in all figures represent SEM and quantifications are presented as mean±SEM.

111

References

Aguet, F., Antonescu, C.N., Mettlen, M., Schmid, S.L., and Danuser, G. (2013). Advances in analysis of low signal-to-noise images link dynamin and AP2 to the functions of an endocytic checkpoint. Dev Cell 26, 279-291.

Albers, K.M., Wright, D.E., and Davis, B.M. (1994). Overexpression of nerve growth factor in epidermis of transgenic mice causes hypertrophy of the peripheral nervous system. J Neurosci 14, 1422-1432.

Barker, A.J., Koch, S.M., Reed, J., Barres, B.A., and Ullian, E.M. (2008). Developmental control of synaptic receptivity. J Neurosci 28, 8150-8160.

Barth, E.M., Korsching, S., and Thoenen, H. (1984). Regulation of nerve growth factor synthesis and release in organ cultures of rat iris. J Cell Biol 99, 839-843.

Beck, H.N., Drahushuk, K., Jacoby, D.B., Higgins, D., and Lein, P.J. (2001). Bone morphogenetic protein-5 (BMP-5) promotes dendritic growth in cultured sympathetic neurons. BMC Neurosci 2, 12.

Bhattacharyya, A., Watson, F.L., Bradlee, T.A., Pomeroy, S.L., Stiles, C.D., and Segal, R.A. (1997). Trk receptors function as rapid retrograde signal carriers in the adult nervous system. J Neurosci 17, 7007-7016.

Campenot, R.B. (1977). Local control of neurite development by nerve growth factor. Proceedings of the National Academy of Sciences of the United States of America 74, 4516-4519.

Campenot, R.B., and MacInnis, B.L. (2004). Retrograde transport of neurotrophins: fact and function. Journal of neurobiology 58, 217-229.

Causing, C.G., Gloster, A., Aloyz, R., Bamji, S.X., Chang, E., Fawcett, J., Kuchel, G., and Miller, F.D. (1997). Synaptic innervation density is regulated by neuron-derived BDNF. Neuron 18, 257-267.

112

Chen, X., Ye, H., Kuruvilla, R., Ramanan, N., Scangos, K.W., Zhang, C., Johnson, N.M., England, P.M., Shokat, K.M., and Ginty, D.D. (2005a). A chemical-genetic approach to studying neurotrophin signaling. Neuron 46, 13-21.

Chen, Z.Y., Ieraci, A., Tanowitz, M., and Lee, F.S. (2005b). A novel endocytic recycling signal distinguishes biological responses of Trk neurotrophin receptors. Molecular biology of the cell 16, 5761-5772.

Chun, L.L., and Patterson, P.H. (1977). Role of nerve growth factor in the development of rat sympathetic neurons in vitro. I. Survival, growth, and differentiation of catecholamine production. J Cell Biol 75, 694-704.

Claude, P., Hawrot, E., Dunis, D.A., and Campenot, R.B. (1982). Binding, internalization, and retrograde transport of 125I-nerve growth factor in cultured rat sympathetic neurons. J Neurosci 2, 431-442.

Cohen, S., Levi-Montalcini, R., and Hamburger, V. (1954). A Nerve Growth-Stimulating Factor Isolated from Sarcom as 37 and 180. Proceedings of the National Academy of Sciences of the United States of America 40, 1014-1018.

Cosker, K.E., and Segal, R.A. (2014). Neuronal signaling through endocytosis. Cold Spring Harb Perspect Biol 6.

Crowder, R.J., and Freeman, R.S. (1998). Phosphatidylinositol 3-kinase and Akt protein kinase are necessary and sufficient for the survival of nerve growth factor-dependent sympathetic neurons. J Neurosci 18, 2933-2943.

Crowley, C., Spencer, S.D., Nishimura, M.C., Chen, K.S., Pitts-Meek, S., Armanini, M.P., Ling, L.H., McMahon, S.B., Shelton, D.L., Levinson, A.D., et al. (1994). Mice lacking nerve growth factor display perinatal loss of sensory and sympathetic neurons yet develop basal forebrain cholinergic neurons. Cell 76, 1001-1011.

Cui, B., Wu, C., Chen, L., Ramirez, A., Bearer, E.L., Li, W.P., Mobley, W.C., and Chu, S. (2007). One at a time, live tracking of NGF axonal transport using quantum dots. Proceedings of the National Academy of Sciences of the United States of America 104, 13666-13671.

Cunningham, M.E., Stephens, R.M., Kaplan, D.R., and Greene, L.A. (1997). Autophosphorylation of activation loop tyrosines regulates signaling by the TRK nerve growth factor receptor. The Journal of biological chemistry 272, 10957-10967.

113

Delcroix, J.D., Valletta, J.S., Wu, C., Hunt, S.J., Kowal, A.S., and Mobley, W.C. (2003). NGF signaling in sensory neurons: evidence that early endosomes carry NGF retrograde signals. Neuron 39, 69-84.

Devay, P., McGehee, D.S., Yu, C.R., and Role, L.W. (1999). Target-specific control of nicotinic receptor expression at developing interneuronal synapses in chick. Nat Neurosci 2, 528-534.

Diaz, G., and Diana, A. (1992). Immunohistochemical study of synaptophysin distribution in the superior cervical ganglion of newborn and adult rats. J Auton Nerv Syst 37, 121-124.

Ducy, P., and Karsenty, G. (2000). The family of bone morphogenetic proteins. Kidney Int 57, 2207-2214.

Eldredge, L.C., Gao, X.M., Quach, D.H., Li, L., Han, X., Lomasney, J., and Tourtellotte, W.G. (2008). Abnormal sympathetic nervous system development and physiological dysautonomia in Egr3-deficient mice. Development 135, 2949-2957.

Elenkov, I.J., Wilder, R.L., Chrousos, G.P., and Vizi, E.S. (2000). The sympathetic nerve--an integrative interface between two supersystems: the brain and the immune system. Pharmacol Rev 52, 595-638.

Fagan, A.M., Zhang, H., Landis, S., Smeyne, R.J., Silos-Santiago, I., and Barbacid, M. (1996). TrkA, but not TrkC, receptors are essential for survival of sympathetic neurons in vivo. J Neurosci 16, 6208-6218.

Fields, C.R., and Barker, F.M., 2nd (1992). Review of Horner's syndrome and a case report. Optom Vis Sci 69, 481-485.

Forehand, C.J. (1985). Density of somatic innervation on mammalian autonomic ganglion cells is inversely related to dendritic complexity and preganglionic convergence. J Neurosci 5, 3403-3408.

Francis, N., Farinas, I., Brennan, C., Rivas-Plata, K., Backus, C., Reichardt, L., and Landis, S. (1999). NT-3, like NGF, is required for survival of sympathetic neurons, but not their precursors. Dev Biol 210, 411-427.

114

Friedman, W.J., Ibanez, C.F., Hallbook, F., Persson, H., Cain, L.D., Dreyfus, C.F., and Black, I.B. (1993). Differential actions of neurotrophins in the locus coeruleus and basal forebrain. Exp Neurol 119, 72-78.

Fukuda, K., Kanazawa, H., Aizawa, Y., Ardell, J.L., and Shivkumar, K. (2015). Cardiac innervation and sudden cardiac death. Circ Res 116, 2005-2019.

Glebova, N.O., and Ginty, D.D. (2005). Growth and survival signals controlling sympathetic nervous system development. Annual review of neuroscience 28, 191-222.

Green, L.A. (1977). A quantitative bioassay for nerve growth factor (NGF) activity employing a clonal pheochromocytoma cell line. Brain research 133, 350-353.

Grimes, M.L., Zhou, J., Beattie, E.C., Yuen, E.C., Hall, D.E., Valletta, J.S., Topp, K.S., LaVail, J.H., Bunnett, N.W., and Mobley, W.C. (1996). Endocytosis of activated TrkA: evidence that nerve growth factor induces formation of signaling endosomes. J Neurosci 16, 7950-7964.

Ha, J., Lo, K.W., Myers, K.R., Carr, T.M., Humsi, M.K., Rasoul, B.A., Segal, R.A., and Pfister, K.K. (2008). A neuron-specific cytoplasmic dynein isoform preferentially transports TrkB signaling endosomes. J Cell Biol 181, 1027-1039.

Harrington, A.W., and Ginty, D.D. (2013). Long-distance retrograde neurotrophic factor signalling in neurons. Nature reviews Neuroscience 14, 177-187.

Harrington, A.W., St Hillaire, C., Zweifel, L.S., Glebova, N.O., Philippidou, P., Halegoua, S., and Ginty, D.D. (2011). Recruitment of actin modifiers to TrkA endosomes governs retrograde NGF signaling and survival. Cell 146, 421-434.

Hashimoto, K., Ichikawa, R., Kitamura, K., Watanabe, M., and Kano, M. (2009). Translocation of a "winner" climbing fiber to the Purkinje cell dendrite and subsequent elimination of "losers" from the soma in developing cerebellum. Neuron 63, 106-118.

Hashimoto, K., and Kano, M. (2013). Synapse elimination in the developing cerebellum. Cell Mol Life Sci 70, 4667-4680.

Heerssen, H.M., Pazyra, M.F., and Segal, R.A. (2004). Dynein motors transport activated Trks to promote survival of target-dependent neurons. Nat Neurosci 7, 596-604.

115

Hendry, I.A., and Bonyhady, R. (1980). Retrogradely transported nerve growth factor increases ornithine decarboxylase activity in rat superior cervical ganglia. Brain research 200, 39-45.

Hendry, I.A., Stach, R., and Herrup, K. (1974a). Characteristics of the retrograde axonal transport system for nerve growth factor in the sympathetic nervous system. Brain research 82, 117-128.

Hendry, I.A., Stockel, K., Thoenen, H., and Iversen, L.L. (1974b). The retrograde axonal transport of nerve growth factor. Brain research 68, 103-121.

Heumann, R. (1994). Neurotrophin signalling. Current opinion in neurobiology 4, 668- 679.

Heumann, R., Korsching, S., Scott, J., and Thoenen, H. (1984). Relationship between levels of nerve growth factor (NGF) and its messenger RNA in sympathetic ganglia and peripheral target tissues. EMBO J 3, 3183-3189.

Howe, C.L., and Mobley, W.C. (2004). Signaling endosome hypothesis: A cellular mechanism for long distance communication. Journal of neurobiology 58, 207-216.

Howe, C.L., Valletta, J.S., Rusnak, A.S., and Mobley, W.C. (2001). NGF signaling from clathrin-coated vesicles: evidence that signaling endosomes serve as a platform for the Ras-MAPK pathway. Neuron 32, 801-814.

Hoyle, G.W., Mercer, E.H., Palmiter, R.D., and Brinster, R.L. (1993). Expression of NGF in sympathetic neurons leads to excessive axon outgrowth from ganglia but decreased terminal innervation within tissues. Neuron 10, 1019-1034.

Hu, Y.B., Dammer, E.B., Ren, R.J., and Wang, G. (2015). The endosomal-lysosomal system: from acidification and cargo sorting to neurodegeneration. Translational neurodegeneration 4, 18.

Huang, E.J., and Reichardt, L.F. (2003). Trk receptors: roles in neuronal signal transduction. Annu Rev Biochem 72, 609-642.

Iulita, M.F., and Cuello, A.C. (2014). Nerve growth factor metabolic dysfunction in Alzheimer's disease and Down syndrome. Trends Pharmacol Sci 35, 338-348.

116

Johnson, D.A., and Purves, D. (1983). Tonic and reflex synaptic activity recorded in ciliary ganglion cells of anaesthetized rabbits. J Physiol 339, 599-613.

Kaplan, D.R., Martin-Zanca, D., and Parada, L.F. (1991). Tyrosine phosphorylation and tyrosine kinase activity of the trk proto-oncogene product induced by NGF. Nature 350, 158-160.

Kaplan, D.R., and Miller, F.D. (2000). Neurotrophin signal transduction in the nervous system. Current opinion in neurobiology 10, 381-391.

Kawai, Y., Tamai, Y., and Senba, E. (1993). Principal neurons as local circuit neurons in the rat superior cervical ganglion: the synaptology of the neuronal processes revealed by intracellular injection of biocytin. J Comp Neurol 328, 562-574.

Kim, N., and Burden, S.J. (2008). MuSK controls where motor axons grow and form synapses. Nat Neurosci 11, 19-27.

Korsching, S., and Thoenen, H. (1988). Developmental changes of nerve growth factor levels in sympathetic ganglia and their target organs. Dev Biol 126, 40-46.

Krull, C.E., and Eisen, J.S. (2010). Mechanisms of growth cone repulsion. F1000 Biol Rep 2, 6.

Kuruvilla, R., Ye, H., and Ginty, D.D. (2000). Spatially and functionally distinct roles of the PI3-K effector pathway during NGF signaling in sympathetic neurons. Neuron 27, 499-512.

Lachmanovich, E., Shvartsman, D.E., Malka, Y., Botvin, C., Henis, Y.I., and Weiss, A.M. (2003). Co-localization analysis of complex formation among membrane proteins by computerized fluorescence microscopy: application to immunofluorescence co- patching studies. J Microsc 212, 122-131.

Langley, J.N. (1889). On the Physiology of the Salivary Secretion: Part V. The effect of stimulating the cerebral secretory nerves upon the amount of saliva obtained by stimulating the sympathetic nerve. J Physiol 10, 291-328.

Langley, J.N., and Sherrington, C.S. (1884). Secondary Degeneration of Nerve Tracts following removal of the Cortex of the Cerebrum in the Dog. J Physiol 5, 49-126 125.

117

Lein, P., Johnson, M., Guo, X., Rueger, D., and Higgins, D. (1995). Osteogenic protein-1 induces dendritic growth in rat sympathetic neurons. Neuron 15, 597-605.

Lein, P.J., Beck, H.N., Chandrasekaran, V., Gallagher, P.J., Chen, H.L., Lin, Y., Guo, X., Kaplan, P.L., Tiedge, H., and Higgins, D. (2002). Glia induce dendritic growth in cultured sympathetic neurons by modulating the balance between bone morphogenetic proteins (BMPs) and BMP antagonists. J Neurosci 22, 10377-10387.

Levey, M.S., and Jacob, M.H. (1996). Changes in the regulatory effects of cell-cell interactions on neuronal AChR subunit transcript levels after synapse formation. J Neurosci 16, 6878-6885.

Levi-Montalcini, R. (1987). The nerve growth factor 35 years later. Science 237, 1154- 1162.

Levi-Montalcini, R., and Cohen, S. (1960). Effects of the extract of the mouse submaxillary salivary glands on the sympathetic system of mammals. Ann N Y Acad Sci 85, 324-341.

Levi-Montalcini, R., Meyer, H., and Hamburger, V. (1954). In vitro experiments on the effects of mouse sarcomas 180 and 37 on the spinal and sympathetic ganglia of the chick embryo. Cancer Res 14, 49-57.

Lichtman, J.W., and Purves, D. (1980). The elimination of redundant preganglionic innervation to hamster sympathetic ganglion cells in early post-natal life. J Physiol 301, 213-228.

Lichtman, J.W., Purves, D., and Yip, J.W. (1980). Innervation of sympathetic neurones in the guinea-pig thoracic chain. J Physiol 298, 285-299.

Lin, W., Burgess, R.W., Dominguez, B., Pfaff, S.L., Sanes, J.R., and Lee, K.F. (2001). Distinct roles of nerve and muscle in postsynaptic differentiation of the neuromuscular synapse. Nature 410, 1057-1064.

Liot, G., Zala, D., Pla, P., Mottet, G., Piel, M., and Saudou, F. (2013). Mutant Huntingtin alters retrograde transport of TrkB receptors in striatal dendrites. J Neurosci 33, 6298- 6309.

118

Loeb, D.M., Maragos, J., Martin-Zanca, D., Chao, M.V., Parada, L.F., and Greene, L.A. (1991). The trk proto-oncogene rescues NGF responsiveness in mutant NGF- nonresponsive PC12 cell lines. Cell 66, 961-966.

MacInnis, B.L., Senger, D.L., and Campenot, R.B. (2003). Spatial requirements for TrkA kinase activity in the support of neuronal survival and axon growth in rat sympathetic neurons. Neuropharmacology 45, 995-1010.

Maday, S., Twelvetrees, A.E., Moughamian, A.J., and Holzbaur, E.L. (2014). Axonal transport: cargo-specific mechanisms of motility and regulation. Neuron 84, 292-309.

Madisen, L., Zwingman, T.A., Sunkin, S.M., Oh, S.W., Zariwala, H.A., Gu, H., Ng, L.L., Palmiter, R.D., Hawrylycz, M.J., Jones, A.R., et al. (2010). A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nat Neurosci 13, 133-140.

Majdazari, A., Stubbusch, J., Muller, C.M., Hennchen, M., Weber, M., Deng, C.X., Mishina, Y., Schutz, G., Deller, T., and Rohrer, H. (2013). Dendrite complexity of sympathetic neurons is controlled during postnatal development by BMP signaling. J Neurosci 33, 15132-15144.

Makadia, H.K., and Siegel, S.J. (2011). Poly Lactic-co-Glycolic Acid (PLGA) as Biodegradable Controlled Drug Delivery Carrier. Polymers 3, 1377-1397.

Martin, T.J. (2007). Horner's syndrome, Pseudo-Horner's syndrome, and simple anisocoria. Curr Neurol Neurosci Rep 7, 397-406.

Meijering, E., Dzyubachyk, O., and Smal, I. (2012). Methods for cell and particle tracking. Methods Enzymol 504, 183-200.

Mendoza, M.C., Er, E.E., Zhang, W., Ballif, B.A., Elliott, H.L., Danuser, G., and Blenis, J. (2011). ERK-MAPK drives lamellipodia protrusion by activating the WAVE2 regulatory complex. Mol Cell 41, 661-671.

Millecamps, S., and Julien, J.P. (2013). Axonal transport deficits and neurodegenerative diseases. Nature reviews Neuroscience 14, 161-176.

119

Minichiello, L., Calella, A.M., Medina, D.L., Bonhoeffer, T., Klein, R., and Korte, M. (2002). Mechanism of TrkB-mediated hippocampal long-term potentiation. Neuron 36, 121-137.

Mizumura, K., and Murase, S. (2015). Role of nerve growth factor in pain. Handb Exp Pharmacol 227, 57-77.

Moises, T., Dreier, A., Flohr, S., Esser, M., Brauers, E., Reiss, K., Merken, D., Weis, J., and Kruttgen, A. (2007). Tracking TrkA's trafficking: NGF receptor trafficking controls NGF receptor signaling. Mol Neurobiol 35, 151-159.

Nishiyama, H. (2014). Learning-induced structural plasticity in the cerebellum. Int Rev Neurobiol 117, 1-19.

Nja, A., and Purves, D. (1977a). Re-innervation of guinea-pig superior cervical ganglion cells by preganglionic fibres arising from different levels of the spinal cord. J Physiol 272, 633-651.

Nja, A., and Purves, D. (1977b). Specific innervation of guinea-pig superior cervical ganglion cells by preganglionic fibres arising from different levels of the spinal cord. J Physiol 264, 565-583.

Nja, A., and Purves, D. (1978). The effects of nerve growth factor and its antiserum on synapses in the superior cervical ganglion of the guinea-pig. J Physiol 277, 53-75.

Obermeier, A., Halfter, H., Wiesmuller, K.H., Jung, G., Schlessinger, J., and Ullrich, A. (1993a). Tyrosine 785 is a major determinant of Trk--substrate interaction. EMBO J 12, 933-941.

Obermeier, A., Lammers, R., Wiesmuller, K.H., Jung, G., Schlessinger, J., and Ullrich, A. (1993b). Identification of Trk binding sites for SHC and phosphatidylinositol 3'-kinase and formation of a multimeric signaling complex. The Journal of biological chemistry 268, 22963-22966.

Oppenheim, R.W. (1991). Cell death during development of the nervous system. Annual review of neuroscience 14, 453-501.

120

Parikh, V., Howe, W.M., Welchko, R.M., Naughton, S.X., D'Amore, D.E., Han, D.H., Deo, M., Turner, D.L., and Sarter, M. (2013). Diminished trkA receptor signaling reveals cholinergic-attentional vulnerability of aging. Eur J Neurosci 37, 278-293.

Park, J.W., Vahidi, B., Taylor, A.M., Rhee, S.W., and Jeon, N.L. (2006). Microfluidic culture platform for neuroscience research. Nat Protoc 1, 2128-2136.

Parker, M.J., Zhao, S., Bredt, D.S., Sanes, J.R., and Feng, G. (2004). PSD93 regulates synaptic stability at neuronal cholinergic synapses. J Neurosci 24, 378-388.

Paton, W.D., and Vizi, E.S. (1969). The inhibitory action of noradrenaline and adrenaline on acetylcholine output by guinea-pig ileum longitudinal muscle strip. Br J Pharmacol 35, 10-28.

Philippidou, P., Valdez, G., Akmentin, W., Bowers, W.J., Federoff, H.J., and Halegoua, S. (2011). Trk retrograde signaling requires persistent, Pincher-directed endosomes. Proceedings of the National Academy of Sciences of the United States of America 108, 852-857.

Purves, D. (1975). Functional and structural changes in mammalian sympathetic neurones following interruption of their axons. J Physiol 252, 429-463.

Purves, D., and Hume, R.I. (1981). The relation of postsynaptic geometry to the number of presynaptic axons that innervate autonomic ganglion cells. J Neurosci 1, 441-452.

Purves, D., and Nja, A. (1976). Effect of nerve growth factor on synaptic depression after axotomy. Nature 260, 535-536.

Purves, D., Snider, W.D., and Voyvodic, J.T. (1988). Trophic regulation of nerve cell morphology and innervation in the autonomic nervous system. Nature 336, 123-128.

Quach, D.H., Oliveira-Fernandes, M., Gruner, K.A., and Tourtellotte, W.G. (2013). A sympathetic neuron autonomous role for Egr3-mediated gene regulation in dendrite morphogenesis and target tissue innervation. J Neurosci 33, 4570-4583.

Rando, T.A., Bowers, C.W., and Zigmond, R.E. (1981). Localization of neurons in the rat spinal cord which project to the superior cervical ganglion. J Comp Neurol 196, 73-83.

121

Reichardt, L.F. (2006). Neurotrophin-regulated signalling pathways. Philos Trans R Soc Lond B Biol Sci 361, 1545-1564.

Riccio, A., Pierchala, B.A., Ciarallo, C.L., and Ginty, D.D. (1997). An NGF-TrkA- mediated retrograde signal to transcription factor CREB in sympathetic neurons. Science 277, 1097-1100.

Rolls, M.M., Satoh, D., Clyne, P.J., Henner, A.L., Uemura, T., and Doe, C.Q. (2007). Polarity and intracellular compartmentalization of Drosophila neurons. Neural Dev 2, 7.

Rosenberg, M.M., Blitzblau, R.C., Olsen, D.P., and Jacob, M.H. (2002). Regulatory mechanisms that govern nicotinic synapse formation in neurons. Journal of neurobiology 53, 542-555.

Rubin, E. (1985a). Development of the rat superior cervical ganglion: ganglion cell maturation. J Neurosci 5, 673-684.

Rubin, E. (1985b). Development of the rat superior cervical ganglion: ingrowth of preganglionic axons. J Neurosci 5, 685-696.

Rubin, E. (1985c). Development of the rat superior cervical ganglion: initial stages of synapse formation. J Neurosci 5, 697-704.

Ruit, K.G., Osborne, P.A., Schmidt, R.E., Johnson, E.M., Jr., and Snider, W.D. (1990). Nerve growth factor regulates sympathetic ganglion cell morphology and survival in the adult mouse. J Neurosci 10, 2412-2419.

Ruit, K.G., and Snider, W.D. (1991). Administration or deprivation of nerve growth factor during development permanently alters neuronal geometry. J Comp Neurol 314, 106-113.

Schafer, T., Schwab, M.E., and Thoenen, H. (1983). Increased formation of preganglionic synapses and axons due to a retrograde trans-synaptic action of nerve growth factor in the rat sympathetic nervous system. J Neurosci 3, 1501-1510.

Segal, R.A. (2003). Selectivity in neurotrophin signaling: theme and variations. Annual review of neuroscience 26, 299-330.

122

Seth, J.H., Panicker, J.N., and Fowler, C.J. (2013). The neurological organization of micturition. Handb Clin Neurol 117, 111-117.

Sharma, N., Deppmann, C.D., Harrington, A.W., St Hillaire, C., Chen, Z.Y., Lee, F.S., and Ginty, D.D. (2010). Long-distance control of synapse assembly by target-derived NGF. Neuron 67, 422-434.

Shelly, M., Lim, B.K., Cancedda, L., Heilshorn, S.C., Gao, H., and Poo, M.M. (2010). Local and long-range reciprocal regulation of cAMP and cGMP in axon/dendrite formation. Science 327, 547-552.

Shelton, D.L., and Reichardt, L.F. (1984). Expression of the beta-nerve growth factor gene correlates with the density of sympathetic innervation in effector organs. Proceedings of the National Academy of Sciences of the United States of America 81, 7951-7955.

Smeyne, R.J., Klein, R., Schnapp, A., Long, L.K., Bryant, S., Lewin, A., Lira, S.A., and Barbacid, M. (1994). Severe sensory and sympathetic neuropathies in mice carrying a disrupted Trk/NGF receptor gene. Nature 368, 246-249.

Smolen, A., and Raisman, G. (1980). Synapse formation in the rat superior cervical ganglion during normal development and after neonatal deafferentation. Brain research 181, 315-323.

Smolen, A.J. (1988). Morphology of synapses in the autonomic nervous system. J Electron Microsc Tech 10, 187-204.

Smolen, A.J., and Beaston-Wimmer, P. (1986). Dendritic development in the rat superior cervical ganglion. Brain research 394, 245-252.

Snider, W.D. (1988). Nerve growth factor enhances dendritic arborization of sympathetic ganglion cells in developing mammals. J Neurosci 8, 2628-2634.

Takeo, Y.H., Kakegawa, W., Miura, E., and Yuzaki, M. (2015). RORalpha Regulates Multiple Aspects of Dendrite Development in Cerebellar Purkinje Cells In Vivo. J Neurosci 35, 12518-12534.

123

Tanowitz, M., and von Zastrow, M. (2003). A novel endocytic recycling signal that distinguishes the membrane trafficking of naturally occurring opioid receptors. The Journal of biological chemistry 278, 45978-45986.

Taylor, A.M., Dieterich, D.C., Ito, H.T., Kim, S.A., and Schuman, E.M. (2010). Microfluidic local perfusion chambers for the visualization and manipulation of synapses. Neuron 66, 57-68.

Taylor, A.M., and Jeon, N.L. (2011). Microfluidic and compartmentalized platforms for neurobiological research. Crit Rev Biomed Eng 39, 185-200.

Tsui-Pierchala, B.A., and Ginty, D.D. (1999). Characterization of an NGF-P-TrkA retrograde-signaling complex and age-dependent regulation of TrkA phosphorylation in sympathetic neurons. J Neurosci 19, 8207-8218.

Vaillant, A.R., Zanassi, P., Walsh, G.S., Aumont, A., Alonso, A., and Miller, F.D. (2002). Signaling mechanisms underlying reversible, activity-dependent dendrite formation. Neuron 34, 985-998.

Valdez, G., Akmentin, W., Philippidou, P., Kuruvilla, R., Ginty, D.D., and Halegoua, S. (2005). Pincher-mediated macroendocytosis underlies retrograde signaling by neurotrophin receptors. J Neurosci 25, 5236-5247.

Vale, R.D. (2003). The molecular motor toolbox for intracellular transport. Cell 112, 467- 480.

Vargas, G.A., and Von Zastrow, M. (2004). Identification of a novel endocytic recycling signal in the D1 dopamine receptor. The Journal of biological chemistry 279, 37461- 37469.

Voyvodic, J.T. (1987). Development and regulation of dendrites in the rat superior cervical ganglion. J Neurosci 7, 904-912.

Voyvodic, J.T. (1989a). Peripheral target regulation of dendritic geometry in the rat superior cervical ganglion. J Neurosci 9, 1997-2010.

Voyvodic, J.T. (1989b). Target size regulates calibre and myelination of sympathetic axons. Nature 342, 430-433.

124

Wang, D., Chan, C.C., Cherry, S., and Hiesinger, P.R. (2013). Membrane trafficking in neuronal maintenance and degeneration. Cell Mol Life Sci 70, 2919-2934.

Watson, F.L., Heerssen, H.M., Bhattacharyya, A., Klesse, L., Lin, M.Z., and Segal, R.A. (2001). Neurotrophins use the Erk5 pathway to mediate a retrograde survival response. Nat Neurosci 4, 981-988.

Watson, F.L., Porcionatto, M.A., Bhattacharyya, A., Stiles, C.D., and Segal, R.A. (1999). TrkA glycosylation regulates receptor localization and activity. Journal of neurobiology 39, 323-336.

Wickramasinghe, S.R., Alvania, R.S., Ramanan, N., Wood, J.N., Mandai, K., and Ginty, D.D. (2008). Serum response factor mediates NGF-dependent target innervation by embryonic DRG sensory neurons. Neuron 58, 532-545.

Wischke, C., and Schwendeman, S.P. (2008). Principles of encapsulating hydrophobic drugs in PLA/PLGA microparticles. Int J Pharm 364, 298-327.

Wu, C., Ramirez, A., Cui, B., Ding, J., Delcroix, J.D., Valletta, J.S., Liu, J.J., Yang, Y., Chu, S., and Mobley, W.C. (2007). A functional dynein-microtubule network is required for NGF signaling through the Rap1/MAPK pathway. Traffic 8, 1503-1520.

Yau, K.W., Schatzle, P., Tortosa, E., Pages, S., Holtmaat, A., Kapitein, L.C., and Hoogenraad, C.C. (2016). Dendrites In Vitro and In Vivo Contain Microtubules of Opposite Polarity and Axon Formation Correlates with Uniform Plus-End-Out Microtubule Orientation. J Neurosci 36, 1071-1085.

Yawo, H. (1987). Changes in the dendritic geometry of mouse superior cervical ganglion cells following postganglionic axotomy. J Neurosci 7, 3703-3711.

Ye, H., Kuruvilla, R., Zweifel, L.S., and Ginty, D.D. (2003). Evidence in support of signaling endosome-based retrograde survival of sympathetic neurons. Neuron 39, 57-68.

York, R.D., Molliver, D.C., Grewal, S.S., Stenberg, P.E., McCleskey, E.W., and Stork, P.J. (2000). Role of phosphoinositide 3-kinase and endocytosis in nerve growth factor- induced extracellular signal-regulated kinase activation via Ras and Rap1. Mol Cell Biol 20, 8069-8083.

125

Yoshii, A., and Constantine-Paton, M. (2014). Postsynaptic localization of PSD-95 is regulated by all three pathways downstream of TrkB signaling. Front Synaptic Neurosci 6, 6.

Zhang, K., Osakada, Y., Vrljic, M., Chen, L., Mudrakola, H.V., and Cui, B. (2010). Single-molecule imaging of NGF axonal transport in microfluidic devices. Lab on a chip 10, 2566-2573.

Zhou, Y., Deneris, E., and Zigmond, R.E. (2001). Nicotinic acetylcholine receptor subunit proteins alpha7 and beta4 decrease in the superior cervical ganglion after axotomy. Journal of neurobiology 46, 178-192.

Zweifel, L.S., Kuruvilla, R., and Ginty, D.D. (2005). Functions and mechanisms of retrograde neurotrophin signalling. Nature reviews Neuroscience 6, 615-625.

126

Kathryn Michelle Lehigh Harvard Medical School 200 Longwood Ave, Room 437 Armenise Boston MA 02115 [email protected]

Education Ph.D. expected 2016 Program in Neurobiology Johns Hopkins School of Medicine B.S. 2009 Neurobiology Georgetown University

Professional Experience 2010- Graduate student dissertation (Johns Hopkins School of Medicine), Advisor: Dr. David Ginty The role of target-derived NGF-TrkA signaling endosomes in synapse formation.

2010 Graduate student research rotation (Johns Hopkins School of Medicine), Advisor: Dr.Mary Blue Barrel cortex structure and formation in mouse models of Rhett Syndrome.

2009 Graduate student research rotation (Johns Hopkins School of Medicine), Advisor: Dr. Mollie Meffert Developing tools to understand NF-kappaB function.

2009 Research Assistant (Georgetown University), Advisor: Dr. Maria Donoghue Parcellation of the thalamus into distinct nuclei reflects EphA expression and function.

2007-2008 HHMI Research Scholar (Georgetown University), Advisor: Dr. Maria Donoghue Parcellation of the thalamus into distinct nuclei reflects EphA expression and function. Honors 2009 Graduate cum laude, Georgetown University 2009 Biology Senior Thesis Book Award, Georgetown University 2007-2009 Howard Hughes Medical Institute Research Scholars

Publications Lehigh.K.M., West, K., Ginty, D.D. Target-derived NGF-TrkA endosome signaling is required in dendrites for synapse formation and maintenance. (In preparation).

Ye, D., Lehigh K.M. and Ginty D.D. Multivesicular bodies mediate retrograde NGF/TrkA signaling in sympathetic neurons. (In preparation).

127

Lehigh, K.M., Leonard, C., Baranoski, J., Donoghue, M.J. (2013) Parcellation of the thalamus into distinct nuclei reflects EphA expression and function. Gene Expression Patterns. 8: 454- 463.

Abstracts Lehigh.K.M, Ginty, D.D. (2016) NGF-TrkA endosome dynamics, signaling, and function in dendrites. HHMI Science Meeting. HHMI Headquarters, Chevy Chase, MD, February 3, 2016. (Poster)

Lehigh.K.M, Ginty, D.D. (2014) NGF-TrkA signaling endosome dynamics and signaling in dendrites. Axon Guidance, Synapse Formation, and Regeneration. Cold Spring Harbor Laboratory, NY, September 17, 2014. (Talk)

Lehigh.K.M, Ginty, D.D. (2013) NGF-TrkA signaling endosome dynamics and signaling in dendrites. Gordon Research Conferences: Neurotrophic Factors, Newport, RI, June 2-7, 2013. (Poster)

Lehigh.K.M, Ginty, D.D. (2013) NGF-TrkA signaling endosome dynamics and signaling in dendrites. Johns Hopkins Neuroscience Lab Lunch Seminar. Baltimore, MD. February 5, 2013. (Talk)

Teaching Experience Fall 2015 Neuroscience: HST130/Neuro200 (Harvard Medical School Graduate/Medical student course) Position: Teaching assistant; wrote and graded exams and led discussion sections Course director: Dr. John Assad

Fall 2014 Human Genetics MCB 101 Harvard College Undergraduate Course. Position: Teaching fellow; responsible for all evaluation and development of each student’s scientific writing skills Professor: Dr. Craig Hunter

Spring 2011 Neuroanatomy Section of Nervous system & Special Senses (Medical student course) Position: Teaching assistant; led a small group through wet lab neuroanatomy dissections Class coordinators: Dr. Mary Blue, Dr. Larry Schramm and Dr. Mary Ann Wilson

Fall 2010 Neuroscience and Cognition I (Johns Hopkins University School of Medicine Graduate Course) Position: Teaching assistant; wrote lecture notes and ran review sessions Course Director: Dr. Seth Blackshaw

128

Scientific Outreach and Mentorship

2015-present Contributing author of Harvard Neuroscience Blog

2015-present Nepris: Real world delivered to classrooms. Lecture: Science Writing for 4th Graders. Jan, 1, 2015.

2014-present Mentor for Katherine West; Undergraduate Research Assistant (Ginty Laboratory)

Fall 2014 Science in the News Neuroscience Lecture Coordinator

2014 Mentor for Meghan Parsons; Undergraduate Research Assistant and Undergraduate in Harvard College Neurobiology Research Course (98r) (Ginty Laboratory)

2008-2009 Mentor for Jake Baranoski; Undergraduate Research Assistant (Donoghue Laboratory)

129