Construction and Characterization of a Recombinant Adenoviral Vector Expressing Human Interleukin-12

Construction and characterization of a recombinant adenoviral vector expressing human interleukin-12

Jian Qiao, Shu-Hsia Chen, Khiem B. Pham-Nguyen, John Mandeli, and Savio L. C. Woo Institute for Gene Therapy and Molecular Medicine, Mount Sinai School of Medicine, New York, New York 10029.

Interleukin-12 (IL-12) is a 70-kDa heterodimeric cytokine composed of a 35-kDa subunit (p35) and a 40-kDa subunit (p40). We have demonstrated previously that intratumoral delivery of a recombinant adenoviral vector expressing the mouse IL-12 gene signiﬁcantly prolongs the survival time of mice with metastatic colon carcinoma in the liver. We now report the molecular cloning of cDNA for both subunits of human IL-12 (hIL-12) in a recombinant adenoviral vector in which the p40 and p35 subunits are linked and coexpressed using the encephalomyocarditis virus internal ribosome entry site. The recombinant adenoviral vector was used to transduce human tumor cell lines, and the presence of hIL-12 in the conditioned media was illustrated by enzyme-linked immunosorbent assay. The biological activity of hIL-12 in the conditioned media was also demonstrated in vitro through its ability to induce interferon-␥ production from peripheral blood mononuclear cells (PBMCs), to stimulate PBMC proliferation, and to enhance natural killer activity from normal human PBMCs to lyse natural killer-sensitive K562 target cells. The results of these studies support the application of this recombinant adenoviral vector construct as an efﬁcient gene delivery vehicle in phase I/II clinical studies of hIL-12 gene therapy for cancer.

Key words: Human interleukin-12; recombinant adenoviral vector; gene therapy; antitumor immunity.

nterleukin-12 (IL-12) is a heterodimeric cytokine Adenoviral vectors are capable of achieving high levels Icomposed of two disulfide-linked subunits of 35 and of gene transfer to various target cells in vivo. This 40 kDa.1–3 This protein, previously called cytotoxic capacity has made adenoviral vectors excellent vehicles lymphocyte maturation factor2 or natural killer (NK) for gene therapy in various tumor models in laboratory cell stimulatory factor,1 is predominantly secreted by animals and in clinical applications. Previous results peripheral blood antigen-presenting cells such as mac- have suggested that replication-deficient adenovirus rophages and dendritic cells. It has multiple biological (Ad) vectors expressing mouse IL-12 are effective in the effects on T cells and NK cells, including the stimulation treatment of cancer.19–22 Here, we report the construc- of cytotoxic activity, proliferation, promotion of T helper tion and characterization of a recombinant adenoviral 1 cell development, and interferon-␥ (IFN-␥) produc- vector expressing the functional heterodimeric human tion, leading to cellular-mediated immunity.4–9 Systemic IL-12 (hIL-12) cytokine. The vector can be used to administration of recombinant IL-12 (rIL-12) in animals transduce human tumor cells to secret immunoreactive has shown that this cytokine can inhibit tumor growth hIL-12 into the conditioned media. The virally derived and reduce metastases that result in prolonged surviv- hIL-12 protein also has the same biological activities as al.10,11 However, its clinical applications were limited by rhIL-12 in vitro. systemic toxicity at the effective doses.12 Local delivery of IL-12 to the tumor site could potentially reduce the MATERIALS AND METHODS adverse effects associated with systemic delivery. The cDNAs encoding the p35 and p40 subunits of IL-12 for Cell lines and reagents 13–15 both mice and humans have been cloned. Several The NC-37 cell line (human lymphoblastoid cells, CCL-214; studies have shown that local delivery of IL-12-express- American Type Culture Collection (ATCC), Manassas, Va) ing fibroblasts inhibits tumor growth and leads to the and the HeLa cell line (human cervix cell line, CCL-2; ATCC) development of an antitumor immune response.16–18 were grown in RPMI 1640 with 10% fetal bovine sera (FBS). The 293 cell line23 (adenoviral E1-transformed human embry- onic kidney cells) was maintained in Dulbecco’s modified Eagle’s medium plus 10% FBS. Lovo cells, derived from Received January 21, 1998; accepted October 18, 1998. human colon adenocarcinoma, were grown in Ham’s F-12 Address correspondence and reprint requests to Dr. Savio L. C. Woo, medium with 20% FBS. All culture medium was supplemented Institute for Gene Therapy and Molecular Medicine, Mount Sinai School with 2 mM glutamine, 100 U/mL streptomycin, and 100 ␮g/mL of Medicine, New York, NY 10029. penicillin. © 1999 Stockton Press 0929-1903/99/$12.00/ϩ0 Peripheral blood was obtained from healthy donors. Fresh

Cancer Gene Therapy, Vol 6, No 4, 1999: pp 373–379 373 374 QIAO, CHEN, PHAM-NGUYEN, ET AL: ADENOVIRAL VECTOR EXPRESSING HUMAN IL-12 peripheral blood mononuclear cells (PBMCs) were separated the ADV.RSV-hIL-12 or DL312 control vectors at a multiplic- by Ficoll-Hypaque density gradient centrifugation (Pharmacia) ity of infection (MOI) of 30. The supernatants were harvested and cultured in Dulbecco’s modified Eagle’s medium, 100 48 hours postinfection. The hIL-12 concentrations in the U/mL streptomycin, 100 ␮g/mL penicillin, and 2 mM glu- supernatants were determined by ELISA for p70 heterodimer tamine, supplemented with 15% FBS. rhIL-12 was obtained (ELISA kit from Endogen). from R&D Systems (Minneapolis, Minn). The enzyme-linked immunosorbent assay (ELISA) kit was purchased from Endo- IFN-␥ induction assay gen (Cambridge, Mass). [3H]thymidine was purchased from DuPont New England Nuclear (Boston, Mass). Human peripheral blood was obtained from healthy donors. PBMCs were separated on a Ficoll-Hypaque density gradient. ϫ 6 Cloning of p40 and p35 cDNAs of hIL-12 A total of 4 10 fresh PBMCs were plated in a 24-well plate at a concentration of 2 ϫ 106 cells/mL. The PBMCs were NC-37 cells was stimulated with 10 ng of phorbol 12-myristate incubated with serial dilutions of culture supernatant from 13-acetate and 20 ng of calcium ionophore A23187 for 48 HeLa cells transduced with ADV.RSV-hIL-12 or with those hours. The total RNA was extracted and was quantitated by supernatants from control vector DL312-transduced or mock- spectrophotometry. Reverse transcriptase-polymerase chain transduced cells. The supernatants from the treated PBMCs reaction (PCR) was performed to amplify the hIL-12 p40 and were harvested after 48 hours and tested for the presence of p35 cDNAs for subsequent cloning purpose. For p40, the sense IFN-␥ in the media by ELISA (Endogen). rhIL-12 (20 ng/mL) primer (GGGGTACCATGTGTCACCAGCAGTTGGT) corre- was used as a positive control. sponded to the N-terminal nucleotides (14–33 base pairs (bp) of p40 cDNA preceded by a KpnI site). The antisense primer PBMC proliferation assay (GGGGTACCATTAATCTAACTGCAGGGCACAGATG) cor- PBMCs were prepared as described above. PBMCs were responded to the C-terminal nucleotides (1000–981 bp of p40 5 24 seeded in a 96-well plate at a density of 1 ϫ 10 cells/well in a cDNA followed by a KpnI site). For p35, the sense primer ␮ (CCCACATGTGGCCCCCTGGGTCAGC) corresponded to the final volume of 100 L and incubated with the 2-fold-diluted N-terminal nucleotides (102–121 bp of p35 cDNA preceded by an supernatants from HeLa cells transduced with ADV.RSV- AflIII site); the antisense primer (AAGGAAAAAAGCGGC- hIL-12 or DL312 or with supernatant from mock-transduced CGCTTAGGAAGCATTCAGATAGC) corresponded to the HeLa cells. PBMCs were incubated with the conditioned C-terminal nucleotides (863–844 bp of p35 cDNA plus a NotI media containing different concentrations of rhIL-12 to estab- 24 lish a positive control. Cells were incubated for 48 hours at site). The PCR product for hIL-12 p40 was subcloned into 37°C and subsequently pulsed for 8 hours with 1 ␮Ci of the KpnI site of the pBluescript plasmid. The p35 cDNA was 3 3 ϩ subcloned into the NcoI and NotI sites of the pCITE-2a [ H]thymidine per well and harvested. [ H]thymidine incorporation was determined using a beta scintillation counter (Wal- plasmid (Novagen, Madison, Wis), where the ATG in the NcoI lac, Gaithersburg, Md). Samples were set up in triplicate. site following the internal ribosome entry site (IRES) sequence from encephalomyocarditis virus was used as the initiation codon of p35. The resulting recombinant pCITE plasmid could NK activity assay be digested by VspI and NotI to generate the IRES-p35 To further characterize the biological activity of the hIL-12 fragment. The cloned DNA sequences of p40 and p35 were produced by ADV.RSV-hIL-12-transduced cells, its ability to determined in their entireties. enhance NK killing activity was determined in vitro. Freshly isolated PBMCs from the human peripheral blood of a normal Construction of a recombinant adenoviral vector volunteer donor were cultured for 1 hour on plastic to deplete expressing hIL-12 monocytes or were used as effector cells without depletion. Next, the PBMCs were incubated in the presence of the test To generate pADV.RSV-p40 DNA, hIL-12 p40 cDNA was supernatants from cells transduced with ADV.RSV-hIL-12. released by KpnI from pBluescript and subcloned into the KpnI The supernatants from DL312-transduced cells and rhIL-12 site of the adenoviral vector pADV.RSV-bpA that had been (1 ng/mL) were used as controls. After a 24-hour incubation, constructed by insertion of a DNA fragment containing Rous the cells were harvested, washed, and used as effector cells. sarcoma virus (RSV) promoter, a polylinker sequence, and the K562 cells, which are sensitive to NK cell lysis, were used as bovine growth hormone (BGH) poly(A) signal into the pX- 51 25 target cells. The effector cells were incubated with Cr-labeled CJL0.1 vector. Plasmid pXCJL0.1 contains adenoviral K562 targets (5 ϫ 103 cells/well) for 4 hours and tested for genomic fragments of 1–455 bp and 3328–5788 bp in 51 26 their lytic activity ( Cr release) in triplicate wells. The ratios of pBR322. The pADV.RSV-hIL-12 plasmid was constructed the effector cells to target cells were 12.5:1, 25:1, 50:1, and by inserting the IRES-p35 fragment into the EcoRV and NotI 100:1. The results were calculated as the percentage of specific sites of the pADV.RSV-p40 DNA. The recombinant Ad lysis of target cells using the following formula: ([experimental ADV.RSV-hIL-12 was produced by cotransfection of the Ϫ Ϫ 27 release spontaneous release]/[maximal release spontane- adenoviral transfer vector pADV.RSV-hIL-12 and pBHG10 ous release]) ϫ 100. into 293 cells using the calcium phosphate precipitation method. Single plaques were picked and purified by double 28 CsCl gradient ultracentrifugation as described previously. RESULTS Virus particle titer was determined by optical absorbance at 260 nm, and infectious unit titer (plaque-forming units/mL) Construction of ADV.RSV-hIL-12 was quantitated by plaque assay using 293 cells. The sequence of full-length p40 and p35 cDNAs of hIL-12 has 24 hIL-12 ELISA been reported previously. Using reverse transcriptase-PCR, we amplified and cloned p40 and p35 cDNAs from phorbol The two human tumor cell lines, HeLa (cervical carcinoma 12-myristate 13-acetate and calcium ionophore-activated hu- cells) and Lovo (colon carcinoma cells), were transduced with man NC-37 B lymphoblastoid cells obtained from ATCC. The

Cancer Gene Therapy, Vol 6, No 4, 1999 QIAO, CHEN, PHAM-NGUYEN, ET AL: ADENOVIRAL VECTOR EXPRESSING HUMAN IL-12 375

Figure 1. Map of the recombinant adenoviral vector ADV.RSV-hIL-12. The plasmid pADV.RSV-hIL-12 contains the left end of the Ad5 genome (1–5788 bp) with a deletion in the E1 region from 456-3327 bp. The adenoviral sequences flank the expression cassette of hIL-12, which is composed of the RSV long-terminal repeat promoter, p40 cDNA, IRES, p35 cDNA, and the polyadenylation signal of the BGH gene. After cotransfection into 293 cells, recombination between pADV.RSV-hIL-12 and pBHG10 produced recombinant Ads containing the hIL-12 gene expression cassette in the E1 region. See Materials and Methods for details regarding vector construction. cDNAs were sequenced in their entireties, and the respective DL312. The effect of the hIL-12 produced from ADV.RSV- cDNAs with correct sequences were linked with the IRES hIL-12 on the proliferation of PBMCs was evaluated. As ϩ sequence obtained from the pCITE-2a vector. The bicistronic shown in Figure 4, [3H]thymidine incorporation was signifi- pADV.RSV-hIL-12 plasmid DNA was constructed by insert- cantly increased in the PBMCs stimulated with the superna- ing the p40-IRES-p35 fragment into the KpnI and NotI sites of tants from the ADV.RSV-hIL-12-transduced cells at the con- pADV.RSV-bpA, a plasmid containing part of the adenoviral centrations tested; nevertheless, the supernatants from the genome, the RSV long-terminal repeat promoter, and the DL312- or mock-transduced cells had a less significant effect BGH poly(A) tail. Cells transfected with this plasmid ex- on enhancing the proliferation of PBMCs (Fig 4). The group pressed a high level of hIL-12 in the culture media (data not differences between ADV.hIL-12 and DL312 were examined shown). Recombinant Ad (ADV.RSV-hIL-12) was produced by repeated measures analysis of variance (ANOVA), P ϭ by cotransfecting pADV.RSV-hIL-12 with pBHG10 into trans- .006. The data were transformed using the logarithm (base e) formed kidney cells (293) using the calcium phosphate transformation before proceeding with the analysis. The func- method. The replication-defective Ad produced by homolo- tionality of the virally produced hIL-12 was further character- gous recombination was isolated from a single plaque and expanded in 293 cells. The expression cassette of hIL-12 inserted into the E1 region of the recombinant adenoviral vector is shown in Figure 1. The vector was prepared in large scale and purified using double CsCl gradient ultracentrifugation.

Expression of hIL-12 in ADV.RSV-hIL-12- transduced cells To assess the expression of hIL-12, two human tumor cell lines were transduced with ADV.RSV-hIL-12 or control vector ADV-DL312 at an MOI of 30. The hIL-12 levels from the supernatants of the transduced cells were measured using an ELISA kit speciﬁc for the heterodimer p70. At 48 hours posttransduction, hIL-12 production was 32 ng/106 cells in a transduced human colon carcinoma cell line (Lovo) and 80 ng/106 cells in a transduced human cervical carcinoma cell line (HeLa). There was negligible hIL-12 in the supernatants from control vector-transduced cells or mock-transduced tumor cells (Fig 2). The P value is .001 for ADV.RSV-hIL-12- versus DL312-transduced Lovo cells by Student’s t test.

Functional characterization of hIL-12 produced from ADV.RSV-hIL-12-transduced cells The biological activities of the hIL-12 protein expressed by the transduced cells were measured by induction of IFN-␥, stimulation of PBMC proliferation, and enhancement of NK activity in normal human PBMCs. Significant biological activity was detected in the supernatants of the ADV.RSV-hIL-12-trans- Figure 2. Production of hIL-12 from two human tumor cell lines after duced cells. There was a dose-dependent induction of IFN-␥; vector transduction. Lovo cells and HeLa cells were transduced with at an hIL-12 concentration of 8 ng/mL, the IFN-␥ induction ADV.RSV-hIL-12 or DL312 at an MOI of 30. The supernatants from activity approached that of the purified rIL-12 protein at 20 the transduced cells were collected after 48 hours and tested by ng/mL. The IFN-␥ production from the mock-transduced cells ELISA for production of the heterodimer p70 protein. Lovo cells are as well as control vector-transduced cells was markedly re- human colon carcinoma cells; HeLa cells are human cervical duced (Fig 3). The data using the logarithm (base e) transfor- carcinoma cells. The data were analyzed by Student’s t test (group mation were examined by Student’s t test. The result is ADV.RSV-hIL-12 versus ADV-DL312, P ϭ .0006 in HeLa cells and significant, P ϭ .023, between ADV.RSV-hIL-12 versus P ϭ .001 in Lovo cells).

Cancer Gene Therapy, Vol 6, No 4, 1999 376 QIAO, CHEN, PHAM-NGUYEN, ET AL: ADENOVIRAL VECTOR EXPRESSING HUMAN IL-12

metastatic melanoma.29 Tumor regression and/or prolonged survival of treated animals has been documented in murine models using systemic or peritumoral administration of IL-12.10,13 Studies in mice have also suggested that the local delivery of IL-12 to tumors is more efficient than systemic administration.10 In addition to its ability to enhance an immune response, Voest et al30 reported that IL-12 contributed to the suppression of angiogenesis in mice, which may have antitumoral activity by itself. All of these biological properties make IL-12 a particularly valuable cytokine for cancer therapy. These beneficial effects of IL-12 notwithstanding, a high dose IL-12 administrated systemically is associated with severe toxicity in preclinical studies,31–33 and two patients died in clinical trials.12 The systemic toxicity of IL-12 can potentially be avoided if the powerful cytokine is produced locally in situ. This can be achieved by either cell-based or gene-based strategies for IL-12 gene transfer and expression in vivo. The implantation of engineered tumor cells or fibroblasts expressing mouse IL-12 into murine tumors can cause a rejection of established tumors and can elicit a systemic antitumor immune ␥ Figure 3. Induction of IFN- in human PBMCs by virally produced reaction specific for the tumor type at a distant site.16–18 hIL-12. Human PBMCs were incubated in the presence of either Lotze et al34 have already initiated a phase I/II clinical culture medium from HeLa cells or conditioned media from HeLa cells transduced with ADV.RSV-hIL-12 or DL312 at an MOI of 30 or trial of hIL-12 gene therapy of several different tumors from mock-transduced HeLa cells. After 48 hours, culture superna- by direct injection of tumors with genetically engineered tants were collected and used for IFN-␥ measurement by ELISA. autologous fibroblasts. The results showed evidence of a The hIL-12 concentrations in the supernatants from the ADV.RSV- tumor response in patients with advanced cancer. In hIL-12-transduced HeLa cells used in the assay as determined by addition, Sun et al35 reported in another recent clinical ELISA were 0.0128 ng/mL (a), 0.064 ng/mL (b), 0.32 ng/mL (c), 1.6 phase I study that the patients with metastatic melanoma ng/mL (d), and 8 ng/mL (e). The rhIL-12 (20 ng/mL) was used as a in an advanced stage could achieve a modulation of the positive control. The P value was calculated by Student’s t test. immune response after vaccination with hIL-12 gene- ϭ (group ADV.RSV-hIL-12 (e) versus DL312, P .023). modified autologous melanoma cells. Alternatively, the IL-12 gene can be directly delivered into the tumor through adenoviral-mediated gene transfer. In an ortho- ized by its NK enhancement activity. After the human PBMCs topic model of hepatic metastasis of colon carcinoma with or without depletion of adherent monocytes were stimu- and a subcutaneous model of metastatic breast carci- lated with the supernatant from the ADV.RSV-hIL-12-transduced cells, the cytolytic activity against K562, an NK-sensitive noma, we and others have demonstrated that the intra- cell line, was significantly enhanced compared with the super- tumoral administration of recombinant adenoviral vec- natant from DL312-transduced cells (P ϭ .0002 by repeated tors expressing mouse IL-12 was efficacious in causing measures ANOVA) (Fig 5). These activities were comparable tumor destruction and in significantly prolonging the with the stimulatory effects of rhL-12. survival of the tumor-bearing animals.20,21 Considering these preclinical results, intratumoral delivery of recombinant adenoviral vectors expressing hIL-12 may be an DISCUSSION excellent strategy to achieve its therapeutic potential while avoiding the toxicity associated with systemic IL-12, a cytokine produced by activated monocyte- delivery of rIL-12. macrophages and dendritic cells, has multiple immuno- In this study, we reported the cloning of the p40 and logical activities. It induces IFN-␥ production by both p35 cDNAs of hIL-12 from human NC-37 B lympho- ϩ ϩ resting and activated NK cells, CD4 T cells, and CD8 blastoid cells. These cDNAs contain the complete and T cells. It also enhances the lytic activities of NK cells, correct coding sequences for the two subunits of hIL-12, stimulates the differentiation of T helper 1 cells, and as determined by DNA sequencing (data not shown). elevates specific cytotoxic T-lymphocyte responses. Re- Because IL-12 is a heterodimeric cytokine and the cent studies have demonstrated the antitumor effects of synthesis of bioactive IL-12 requires the coexpression of IL-12 against a variety of tumor models in mice, includ- both subunits, we used the IRES sequence from en- ing B16 melanoma, M5076 reticulum cell sarcoma, cephalomyocarditis virus to link the two cDNAs to Lewis lung carcinoma, Renca renal cell adenocarci- produce a bicistronic gene in the pADV.RSV-hIL-12 noma, and MCA26 colon carcinoma; specifically, it was plasmid. Our results demonstrate that the hIL-12 pro- reported that the treatment of IL-12 by itself was also duced by cells transduced with the ADV.RSV-hIL-12 is effective on a major histocompatibility complex-negative functional, including its ability to induce IFN-␥ produc-

Cancer Gene Therapy, Vol 6, No 4, 1999 QIAO, CHEN, PHAM-NGUYEN, ET AL: ADENOVIRAL VECTOR EXPRESSING HUMAN IL-12 377

Figure 4. Stimulation of PBMC proliferation. Human PBMCs were incubated in the presence of serial 2-fold-diluted supernatants from HeLa cells transduced with ADV.RSV-hIL-12 or DL312 or from mock-transduced HeLa cells. The starting dose of rhIL-12 or virally produced hIL-12 (tested by ELISA) was 20 ng/mL in the assay. [3H]thymidine incorporation was measured after a 48-hour culture. The P values of the CPM data were calculated with repeated measures analysis (group ADV.RSV-hIL-12 versus DL312, P ϭ .006). tion, to stimulate proliferation, and to enhance the NK step before cellular transduction. Alternatively, the re- activity from normal human PBMCs. The specific activ- combinant adenoviral vectors can be readily produced at ity of this hIL-12 is comparable with that of purified high titer and high yield by viral passaging in comple- rhIL-12. Use of the IRES sequence to link and coexpress menting cells. The recombinant adenoviral vectors can the two subunits has also been achieved in a retroviral efficiently transduce both dividing and nondividing cells vector, and it expressed similar levels of both hIL-12 in vitro and in vivo. Although it is known to result in only 36 subunits (p35 and p40) as evidenced by ELISA. The short-term transgene expression in immunocompetent recombinant retroviral vectors are limited by their ability animals due to immunological rejection of the trans- to transduce only dividing cells and by relatively low viral duced cells after 1–2 weeks, this limitation does not titers. Thus, retroviral vectors have been used mostly in apply to cancer gene therapy if the goal is to destroy the ex vivo cell-based gene therapy for cancer. Recently, 37 tumor cells within that time frame. Zhang et al used a Semliki Forest virus (SFV) vector to Combining the properties of recombinant adenoviral express hIL-12. Recombinant SFV vectors are produced vectors with the therapeutic potential of IL-12, the by the cotransfection of vector RNA and nonpackage- adenoviral vector expressing hIL-12 will be readily ap- able SFV-help2 RNA molecules into cultured cells and plicable in future phase I/II clinical trials of gene therapy are limited by a relatively low viral titer and yield. This for cancer. In addition, it can potentially be used in recombinant SFV vector also requires a preactivation

Figure 5. Enhancement of NK activity by virally produced hIL-12. Human PBMCs (106 cells/mL) were cultured in the presence of supernatants from HeLa cells transduced by DL312 or ADV.RSV-hIL-12 (hIL-12 present at a concentration of 1.6 ng/mL as determined by ELISA). After 24 hours, the human PB- MCs were harvested and used as effector cells in a 51Cr release cytolytic assay. For the ADV.RSV-hIL-12 group, PBMCs with or without the depletion of monocytes (MonϪ) were used as effector cells. K562 cells, which are sensitive to NK-mediated lysis, were used as target cells. The results shown are for effector to target ratios of 12.5:1, 25:1, 50:1, and 100:1. rhIL-12 (1 ng/mL) was used as a positive control. Group differences and the interaction between groups and concentrations were examined by repeated measures ANOVA (group ADV.RSV-hIL-12 versus DL312, P ϭ 0.0002).

Cancer Gene Therapy, Vol 6, No 4, 1999 378 QIAO, CHEN, PHAM-NGUYEN, ET AL: ADENOVIRAL VECTOR EXPRESSING HUMAN IL-12 combination with other genes and reagents such as other 16. Tahara H, Zeh HJR, Storkus WJ, et al. Fibroblasts cytokines to achieve maximal therapeutic effects.38–41 genetically engineered to secrete interleukin 12 can sup- press tumor growth and induce antitumor immunity to a murine melanoma in vivo. Cancer Res. 1994;54:182–189. ACKNOWLEDGMENTS 17. Zitvogel L, Tahara H, Robbins PD, et al. Cancer immunotherapy of established tumors with IL-12: effective de- We thank Drs. Manuel Carusol and Jia Li for helpful discus- livery by genetically engineered fibroblasts. J Immunol. sions. This research was supported in part by National Insti- 1995;155:1393–1403. tutes of Health Grants CA-70337 and CA-75175 (to S.-H.C.). 18. Tahara H, Lotze MT, Robbins PD, Storkus WJ, Zitvogel L. IL-12 gene therapy using direct injection of tumors with genetically engineered autologous fibroblasts. Hum Gene REFERENCES Ther. 1995;6:1607–1624. 19. Bramson J, Hitt M, Gallichan WS, Rosenthal KL, Gauldie 1. Kobayashi M, Fitz L, Ryan M, et al. Identification and J, Graham FL. Construction of a double recombinant purification of natural killer cell stimulatory factor adenovirus vector expressing a heterodimeric cytokine: in (NKSF), a cytokine with multiple biologic effects on vitro and in vivo production of biologically active interleu- human lymphocytes. J Exp Med. 1989;170:827–845. kin-12. Hum Gene Ther. 1996;7:333–342. 2. Stern AS, Podlaski FJ, Hulmes JD, et al. Purification to 20. Bramson JL, Hitt M, Addison CL, Muller WJ, Gauldie J, homogeneity and partial characterization of cytotoxic lym- Graham FL. Direct intratumoral injection of an adenovi- phocyte maturation factor from human B-lymphoblastoid rus expressing interleukin-12 induces regression and long- cells. Proc Natl Acad Sci USA. 1990;87:6808–6812. lasting immunity that is associated with highly localized 3. Gubler U, Chua AO, Schoenhaut DS, et al. Coexpression expression of interleukin-12. Hum Gene Ther. 1996;7: of two distinct genes is required to generate secreted 1995–2002. bioactive cytotoxic lymphocyte maturation factor. Proc 21. Caruso M, Pham-Nguyen K, Kwong YL, et al. Adenovirus- Natl Acad Sci USA. 1991;88:4143–4147. mediated interleukin-12 gene therapy for metastatic colon 4. Chehimi J, Starr SE, Frank I, et al. Natural killer (NK) cell carcinoma. Proc Natl Acad Sci USA. 1996;93:11302–11306. stimulatory factor increases the cytotoxic activity of NK 22. Chen L, Chen D, Block E, O’Donnell M, Kufe DW, cells from both healthy donors and human immunodeficiency Clinton SK. Eradication of murine bladder carcinoma by virus-infected patients. J Exp Med. 1992;175:789–796. intratumor injection of a bicistronic adenoviral vector 5. Chehimi J, Valiante NM, D’Andrea A, et al. Enhancing carrying cDNAs for the IL-12 heterodimer and its inhibi- effect of natural killer cell stimulatory factor (NKSF/ tion by the IL-12 p40 subunit homodimer. J Immunol. interleukin-12) on cell-mediated cytotoxicity against tu- 1997;159:351–359. mor-derived and virus-infected cells. Eur J Immunol. 1993; 23. Graham FL, Smiley J, Russell WC, Nairn R. Characteris- 23:1826–1830. tics of a human cell line transformed by DNA from human 6. Soiffer RJ, Robertson MJ, Murray C, Cochran K, Ritz adenovirus type 5. J Gen Virol. 1997;36:59–74. J. Interleukin-12 augments cytolytic activity of peripheral 24. Tahara H, Lotze MT. Antitumor effects of interleukin-12 blood lymphocytes from patients with hematologic and (IL-12): applications for the immunotherapy and gene solid malignancies. Blood. 1993;82:2790–2796. therapy of cancer. Gene Ther. 1995;2:96–106. 7. Wolf SF, Sieburth D, Sypek J. Interleukin 12: a key 25. Fang B, Eisensmith RC, Li XHC, Shedlovsky A, Dove W, modulator of immune function. Stem Cells. 1994;12:154–168. Woo SLC. Gene therapy for phenylketonuria: phenotypic 8. Heufler C, Koch F, Stanzl U, et al. Interleukin-12 is correction in a genetically deficient mouse model by produced by dendritic cells and mediates T helper 1 adenovirus-mediated hepatic gene transfer. Gene Ther. development as well as interferon-␥ production by T 1994;1:247–254. helper 1 cells. Eur J Immunol. 1996;26:659–668. 26. Graham FL, Prevec L. Manipulation of adenovirus vector. 9. Tsung K, Meko JB, Peplinski GR, Tsung YL, Norton JA. In: Murray EJ, ed. Methods in Molecular Biology: Gene IL-12 induces Th1-directed antitumor response. J Immu- Transfer and Expression Protocols, Volume 7. Clifton, NJ: nol. 1997;158:3359–3365. The Human Press; 1991:109–128. 10. Brunda MJ, Luistro L, Warrier RR, et al. Antitumor and 27. Bett AJ, Haddara W, Prevec L, Graham FL. An efficient antimetastatic activity of interleukin 12 against murine and flexible system for construction of adenovirus vectors tumors. J Exp Med. 1993;178:1223–1230. with insertions or deletions in early regions 1 and 3. Proc 11. Nishimura T, Watanabe K, Yahata T, et al. Application of Natl Acad Sci USA. 1994;91:8802–8806. interleukin 12 to antitumor cytokine and gene therapy. 28. Kay MA, Landen CN, Rothenberg SR, et al. In vivo Cancer Chemother Pharmacol. 1996;38:27–34. hepatic gene therapy: complete albeit transient correction 12. Cohen J. IL-12 deaths: explanation and a puzzle. Science. of factor IX deficiency in hemophilia B dogs. Proc Natl 1995;270:908. Acad Sci USA. 1994;91:2353–2357. 13. Nastala CL, Edington HD, McKinney TG, et al. Recom- 29. Nanni P, Rossi I, De Giovanni C, et al. Interleukin 12 gene binant IL-12 administration induces tumor regression in therapy of MHC-negative murine melanoma metastases. association with IFN-␥ production. J Immunol. 1994;153: Cancer Res. 1998;58:1225–1230. 1697–1706. 30. Voest EE, Kenyon BM, O’Reilly MS, Truitt G, D’Amato 14. Wolf SF, Temple PA, Kobayashi M, et al. Cloning of RJ, Folkman J. Inhibition of angiogenesis in vivo by cDNA for natural killer cell stimulatory factor, a het- interleukin 12. J Natl Cancer Inst. 1995;87:581–586. erodimeric cytokine with multiple biologic effects on T and 31. Sarmiento UM, Riley JH, Knaack PA, et al. Biologic natural killer cells. J Immunol. 1991;146:3074–3081. effects of recombinant human interleukin-12 in squirrel 15. Schoenhaut DS, Chua AO, Wolitzky AG, et al. Cloning monkeys (Sciureus saimiri). Lab Invest. 1994;71:862–873. and expression of murine IL-12. J Immunol. 1992;148: 32. Leonard JP, Sherman ML, Fisher GL, et al. Effects of 3433–3440. single-dose interleukin-12 exposure on interleukin-12-as-

Cancer Gene Therapy, Vol 6, No 4, 1999 QIAO, CHEN, PHAM-NGUYEN, ET AL: ADENOVIRAL VECTOR EXPRESSING HUMAN IL-12 379

sociated toxicity and interferon-␥ production. Blood. 1997; 38. Zitvogel L, Robbins PD, Storkus WJ, et al. Interleukin-12 90:2541–2548. and B7.1 co-stimulation cooperate in the induction of 33. Ryffel B. Interleukin-12: role of interferon-␥ in IL-12 effective antitumor immunity and therapy of established adverse effects. Clin Immunol Immunopathol. 1997;83:18–20. tumors. Eur J Immunol. 1996;26:1335–1341. 34. Lotze MT, Zitvogel L, Campbell R, et al. Cytokine gene 39. Lasek W, Feleszko W, Golab J, et al. Antitumor effects of therapy of cancer using interleukin-12: murine and clinical the combination immunotherapy with interleukin-12 and trials. Ann N Y Acad Sci. 1996;795:440–454. tumor necrosis factor ␣ in mice. Cancer Immunol Immu- 35. Sun Y, Jurgovsky K, Moller P, et al. Vaccination with nother. 1997;45:100–108. IL-12 gene-modiﬁed autologous melanoma cells: preclini- 40. Zhang T, Kawakami K, Qureshi MH, Okamura H, Kuri- cal results and a ﬁrst clinical phase I study. Gene Ther. moto M, Saito A. Interleukin-12 (IL-12) and IL-18 syner- 1998;5:481–490. gistically induce the fungicidal activity of murine perito- 36. Zitvogel L, Tahara H, Cai Q, et al. Construction and neal exudate cells against Cryptococcus neoformans characterization of retroviral vectors expressing biologi- through production of ␥ interferon by natural killer cells. cally active human interleukin-12. Hum Gene Ther. 1994; Infect Immun. 1997;65:3594–3599. 5:1493–1506. 41. Putzer BM, Hitt M, Muller WJ, Emtage P, Gauldie J, 37. Zhang J, Asselin-Paturel C, Bex F, et al. Cloning of human Graham FL. Interleukin 12 and B7-1 costimulatory mole- IL-12 p40 and p35 DNA into the Semliki Forest virus cule expressed by an adenovirus vector act synergistically vector: expression of IL-12 in human tumor cells. Gene to facilitate tumor regression. Proc Natl Acad Sci USA. Ther. 1997;4:367–374. 1997;94:10889–10894.

Cancer Gene Therapy, Vol 6, No 4, 1999