Infection Defense Against Bacterial Urinary Tract Pathways and Rapid Synthesis of IL-10 for Drive Diverse Biological Escherichia

Home , ADAMTS8, BZW1, CIZ1, EFCBP2, GRLF1, HAS3

Innate Transcriptional Networks Activated in Bladder in Response to Uropathogenic Escherichia coli Drive Diverse Biological Pathways and Rapid Synthesis of IL-10 for This information is current as Defense against Bacterial Urinary Tract of October 1, 2021. Infection Benjamin L. Duell, Alison J. Carey, Chee K. Tan, Xiangqin Cui, Richard I. Webb, Makrina Totsika, Mark A. Schembri, Petra Derrington, Helen Irving-Rodgers, Andrew J. Brooks, Allan W. Cripps, Michael Crowley and Glen C. Ulett Downloaded from J Immunol 2012; 188:781-792; Prepublished online 19 December 2011; doi: 10.4049/jimmunol.1101231 http://www.jimmunol.org/content/188/2/781 http://www.jimmunol.org/

Supplementary http://www.jimmunol.org/content/suppl/2011/12/19/jimmunol.110123 Material 1.DC1 References This article cites 82 articles, 27 of which you can access for free at: http://www.jimmunol.org/content/188/2/781.full#ref-list-1 by guest on October 1, 2021

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Innate Transcriptional Networks Activated in Bladder in Response to Uropathogenic Escherichia coli Drive Diverse Biological Pathways and Rapid Synthesis of IL-10 for Defense against Bacterial Urinary Tract Infection

Benjamin L. Duell,*,1 Alison J. Carey,*,1 Chee K. Tan,* Xiangqin Cui,†,‡ Richard I. Webb,x Makrina Totsika,{ Mark A. Schembri,{ Petra Derrington,‖ Helen Irving-Rodgers,# Andrew J. Brooks,** Allan W. Cripps,* Michael Crowley,†† and Glen C. Ulett*

Early transcriptional activation events that occur in bladder immediately following bacterial urinary tract infection (UTI) are not well defined. In this study, we describe the whole bladder transcriptome of uropathogenic Escherichia coli (UPEC) cystitis in mice using genome-wide expression profiling to define the transcriptome of innate immune activation stemming from UPEC coloni- Downloaded from zation of the bladder. Bladder RNA from female C57BL/6 mice, analyzed using 1.0 ST-Affymetrix microarrays, revealed extensive activation of diverse sets of innate immune response genes, including those that encode multiple IL-family members, receptors, metabolic regulators, MAPK activators, and lymphocyte signaling molecules. These were among 1564 genes differentially regulated at 2 h postinfection, highlighting a rapid and broad innate immune response to bladder colonization. Integrative systems- level analyses using InnateDB (http://www.innatedb.com) bioinformatics and ingenuity pathway analysis identified multiple http://www.jimmunol.org/ distinct biological pathways in the bladder transcriptome with extensive involvement of lymphocyte signaling, cell cycle alter- ations, cytoskeletal, and metabolic changes. A key regulator of IL activity identified in the transcriptome was IL-10, which was analyzed functionally to reveal marked exacerbation of cystitis in IL-10–deficient mice. Studies of clinical UTI revealed significantly elevated urinary IL-10 in patients with UPEC cystitis, indicating a role for IL-10 in the innate response to human UTI. The whole bladder transcriptome presented in this work provides new insight into the diversity of innate factors that determine UTI on a genome-wide scale and will be valuable for further data mining. Identification of protective roles for other elements in the transcriptome will provide critical new insight into the complex cascade of events that underpin UTI. The Journal of Immu- nology, 2012, 188: 781–792. by guest on October 1, 2021 rinary tract infections (UTI) are among the most common not well defined. Studies have shown that UPEC triggers inflam- infectious diseases of humans. Up to 40% of healthy mation that consists of immune mediators, including ILs (9–12), U adult women experience at least one UTI episode in their although some of these responses, including, for example, IL-1a, lifetime (1). Escherichia coli is the most common cause of UTI, occur in a pathogen-specific manner (13). Roles for TNF, NO (14), and the spectrum of UTI caused by uropathogenic E. coli (UPEC) CXCR 2 (15), Tamm-Horsfall protein (16, 17), and CD44 (18) includes asymptomatic bacteriuria, cystitis, pyelonephritis, and have been shown in models of human UPEC UTI, although, in urosepsis. UPEC expresses multiple adhesins and virulence fac- most cases, the functions of these host factors at the cellular and tors that provoke inflammation and enable bacterial colonization molecular levels remain unclear. UPEC induces host cell apoptosis of the bladder as the first step in UTI pathogenesis (2–5). UPEC in cystitis patients (19–21) and macrophage inflammatory peptide may also suppress innate immune responses (6–8). 2 that is induced in response to neutrophils attracted to the bladder The immediate steps that form the host response to UPEC in the to counteract colonization by the bacterium (6). Specific UPEC bladder and mediate the pathogenesis of UPEC UTI in patients are adhesins, including type 1 and P fimbriae, trigger some of these

*School of Medical Sciences, Centre for Medicine and Oral Health, Griffith Univer- The sequences presented in this article have been submitted to the Gene Expression sity Gold Coast Campus, Queensland 4222, Australia; †Department of Biostatistics, Omnibus (http://www.ncbi.nlm.nih.gov/geo/) under accession numbers GSE26509 University of Alabama at Birmingham, Birmingham, AL 35294; ‡Department of and GSE33210. Genetics, University of Alabama at Birmingham, Birmingham, AL 35294; xCentre Address correspondence and reprint requests to Dr. Glen C. Ulett, School of Medical for Microscopy and Microanalysis, University of Queensland, Brisbane, Queensland { Sciences, Centre for Medicine and Oral Health, Griffith University, Gold Coast 4072, Australia; School of Chemistry and Molecular Biosciences, University of ‖ Campus, QLD 4222, Australia. E-mail address: g.ulett@griffith.edu.au Queensland, Brisbane, Queensland 4072, Australia; Pathology Queensland, Gold Coast Hospital, Southport, Queensland 4215, Australia; #School of Obstetrics and The online version of this article contains supplemental material. Gynaecology, University of Adelaide, Adelaide, South Australia 5055, Australia; Abbreviations used in this article: CT, cycle threshold; GO, gene ontology; IHC, **Institute for Molecular Biosciences, University of Queensland, Brisbane, Queens- immunohistochemistry; IPA, ingenuity pathway analysis; KEGG, Kyoto Encyclope- land 4072, Australia; and ††Heflin Center for Human Genetics, University of Ala- dia of Genes and Genomes; qRT-PCR, quantitative RT-PCR; RT, room temperature; bama at Birmingham, Birmingham, AL 35294 SEM, scanning electron microscope; UPEC, uropathogenic Escherichia coli; UTI, 1B.L.D. and A.J.C. contributed equally to this work. urinary tract infection; WT, wild-type. Received for publication May 2, 2011. Accepted for publication November 15, 2011. Copyright Ó 2012 by The American Association of Immunologists, Inc. 0022-1767/12/$16.00 This work was supported by National Health and Medical Research Council Project Grant 569674, a Griffith University Research Infrastructure Fund grant, and a Gold Coast Hospital Collaborative grant. www.jimmunol.org/cgi/doi/10.4049/jimmunol.1101231 782 EARLY BLADDER TRANSCRIPTOME OF UPEC UTI AND IL-10 processes (22, 23). Host responses that arbitrate these very early a T7 promoter sequence. Gene 1.0 ST Mouse Microarrays (Affymetrix) steps in the pathogenesis of UPEC UTI are largely unknown, and were performed, according to the manufacturer’s instructions, in quintu- the overall contributions of innate immune elements beyond pre- plicate for each treatment group using one microarray per bladder. viously identified mechanisms of attachment are not well defined. Quantitative RT-PCR To better understand the nature of innate immunity to UPEC in Quantitative RT-PCR (qRT-PCR) was carried out for groups of genes the bladder, we performed detailed genome-wide gene expression identified as differentially regulated by microarray analysis. Amplification microarray profiling using the murine model of UPEC UTI to of cDNA was performed using a GeneAmp 7700 System (Applied Bio- establish the global host transcriptome of mouse bladder to UPEC systems). Target genes were amplified using thermal cycling conditions cystitis. The overall results of the transcriptome were interrogated previously described (13, 31). Primer sequences are listed in Supplemental Table I. GAPDH and b-actin were used as reference genes. Separate using several cutting-edge bioinformatics platforms and reveal reactions were carried out to ensure that the efficiency of amplification of collections of innate transcriptional networks not previously rec- the reference gene was approximately equal to that of the target gene. ognized in bacterial UTI. Systems-level bioinformatic analyses of Relative expression levels of target genes were determined by normalizing the transcriptional networks show that the early response to in- reaction cycle thresholds (CTs) to the housekeeper genes, GAPDH and b D 2[DCt] fection in the bladder is broad based and rapid and incorporates -actin. CT values were used in the Equation 2.0 for calculation of the relative mRNA expression levels of target genes, as previously de- diverse biological pathways. Functional analysis of a prominent scribed using PCR efficiencies and mean crossing point deviations between IL identified within the transcriptome, IL-10, which was shared samples and controls (13, 31). among multiple biological networks as well as the most highly ELISA and IL-10 IHC activated canonical pathway, unveiled a new appreciation of function for this cytokine in the early control of acute bacterial UTI. The Whole bladders from infected and control (PBS-challenged) mice at 2 h innate transcriptome of UPEC cystitis defined in this work will were collected and analyzed for total levels of IL-10 in the tissues by ELISA Downloaded from m prompt renewed examination of early host determinants of acute and assessed by IHC. For ELISA, tissues were immersed in 70 l protease inhibitor mixture, homogenized, and clarified at 12,000 3 g for 20 min at UTI aimed at uncovering novel control and preventative strategies 4˚C. Supernatants were stored at 280˚C until assay, which was performed for bacterial UTI. using quintuplicate samples in a commercial IL-10 ELISA (Pierce Endo- gen, Scoresby, VIC, Australia). For IHC, bladders were fixed in 10% Materials and Methods buffered formalin, and sections (4 mm) cut from paraffin blocks were Murine model of UPEC cystitis affixed to slides and air dried overnight at 37˚C. Sections were dewaxed http://www.jimmunol.org/ and rehydrated, underwent heat retrieval using Antigen Retrieval solution The murine model of UTI utilizing female C57BL/6 mice (8–10 wk; The (pH 9.0; Dako, Campbellfield, VIC, Australia), and transferred to TBS. Jackson Laboratory [Bar Harbor, ME], Animal Resources Centre [Canning Background Sniper (Biocare Medical, Concord, CA) was applied and then m Vale, WA]) based on transurethral inoculation is described elsewhere (24– rat IgG1 anti-mouse IL-10 Ab (JES5-2A5, 200 g/ml, Santa Cruz Bio- 27). IL-10–deficient B6.129P2-Il10tm1Cgn/J mice (002251) were purchased technology, Santa Cruz, CA; confirmation assays used ab33471, Sapphire with appropriate control mice (000664, C57BL/6J) from The Jackson Bioscience, Waterloo, NSW, Australia). Following immersion in 1% H2O2/ Laboratory. In addition to C57BL/6 mice, CBA mice are also used for UTI TBS, an anti-rat probe (Biocare Medical) was used, and sections were studies (28, 29), and we performed microarray assays to compare strains. developed using 3,39-diaminbenzidine (Pierce/Progen, Richlands, NSW, For infection, mice were anesthetized by brief inhalation exposure to Australia). Sections were counterstained in Mayer’s hematoxylin, dehy- isoflurane, and the periurethral area was sterilized by swabbing with 10% drated, cleared in xylene, and mounted. Controls included Ab isotypes and povidone-iodine, which was subsequently removed with PBS. Mice were staining of bladders from control (PBS-treated) mice. Serial sections were by guest on October 1, 2021 catheterized using a sterile Teflon catheter (0.28 mm internal diameter, stained with H&E. For fluorescent imaging, sections were mounted in 0.61 mm outer diameter, and 25 mm length; Terumo, Somerset, NJ) by fluorescence medium (Dako). Images were acquired using an Olympus inserting the device directly into the bladder, and 40 ml challenge inoculum BX50 microscope, and, for whole bladder, an Olympus SZX16 fitted with was instilled transurethrally. The catheter was removed, and mice were a DP71 CCD camera, and CellF acquisition software. returned to their cages for recovery. Generally, the inoculum was retained within the bladder for ,2 h, which was monitored by inclusion of 0.1% Histotypic human cell coculture model 9 india ink in the bacterial suspension. Mice were infected with 10 CFU We established a histotypic human cell coculture model of whole bladder UPEC CFT073, and urine was collected at 2 h, 24 h, and 5 d postchallenge in vitro that would facilitate study of intercellular interactions (32). Human for colony counts on lysogeny broth agar (30). Bladders and kidneys 5637 bladder urothelial cells (ATCC HTB-9), U937 monocyte-derived collected from euthanized mice at these time points were homogenized for macrophages (ATCC CRL-1593.2), MC116 B cells (ATCC CRL-1649), colony counts or processed for RNA collection, immunohistochemistry and Jurkat T cells (ATCC TIB-152; clone E6-1) were grown in RPMI 1640 (IHC), or microscopy. For Ab depletion studies, female C57BL/6 mice m supplemented with 10% FCS and HEPES, as previously described (33– were administered 300 g rat anti-mouse IL-10-LE/AF–neutralizing Ab 35). A total of 150,000 5637 cells, 15,000 U937 cells, and 1,500 MC116 (JES5-2A5; Southern Biotechnology, Birmingham, AL) i.v. at 18 and 2 h and Jurkat cells each was seeded into wells of a 96-well cell culture plate prior to challenge. for infection. Equivalent cultures were seeded into wells of tissue culture- Fluorescence and electron microscopy treated multiwell chamber slides (Lab-Tek II 155409; Nalge Nunc Inter- national, Rochester, NY) for confocal microscopy. UPEC (multiplicity of 2 mCherry fluorescent protein-tagged UPEC CFT073 was analyzed in tissues infection 10 and 100 CFU cell 1) was added to cocultures and incubated at using an Olympus SZX16 stereo microscope fitted with a DP71 CCD 37˚C. At 2 and 5 h postinfection, supernatants were collected by centri- camera. Bladders were infected for 2 or 24 h, and UPEC was visualized in fuging 96-well plates at 500 3 g and frozen at 280˚C for subsequent situ, which enabled resection of infected areas for subsequent processing for IL-10 ELISA (88-7106-88; eBiosciences, San Diego, CA). For confocal scanning electron microscope (SEM). Resected tissues were prepared by microscopy, chamber slides were centrifuged (500 3 g for 10 min) at fixation in 3% glutaraldehyde in 0.1 M cacodylate buffer (pH 7.4) and stored 2 h, rinsed with PBS, and fixed using 4% paraformaldehyde for 45 min at at 4˚C. After washing with fresh buffer, tissues were postfixed in 1% os- room temperature (RT). Cells were stained with Alexa Fluor 594-phalloidin mium tetroxide, dehydrated through a graded ethanol series, and critical and Hoechst 33258 (Molecular Probes, Mulgrave, VIC, Australia), and point dried. Samples were mounted on SEM stubs and sputter coated with mounted in 0.2 n-propyl gallate. Slides were viewed using an Olympus platinum. Images were acquired with a JSM-6300F high resolution field Fluoview FV1000-IX81 confocal microscope using version 1 application emission SEM (JEOL, Tokyo, Japan) operated at 8 kV. acquisition software. RNA isolation and microarrays mCherry-tagged UPEC strains Total RNA was isolated from whole bladders of mice at 2 h postinfection Cherry-tagged UPEC CFT073 was used to visualize the interactions be- using TRIzol (Life Technologies, Mulgrave, VIC, Australia), according tween UPEC and human cells in the histotypic coculture model. The to the manufacturer’s instructions. RNase-free DNase-treated RNA that plasmid pmCherry (Clontech) was modified by introducing a tetracycline passed Bioanalyzer 2100 (Agilent) analysis was quantified, and 100 ng was resistance cassette into the EcoRI restriction site and then used to transform amplified into double-stranded cDNA with random hexamers tagged with CFT073 and CFT073fimA. The fimA mutation in CFT073 was constructed The Journal of Immunology 783 using l-Red–mediated homologous recombination, as previously de- (42) of 0.05 was used to control the multiple testing issue and generate the scribed (36). The mCherry-tagged strains were then applied to the histo- significant gene lists. We also generated heat maps of differential genes typic coculture model of human bladder cells, as described above, for using hiarchical-clustering algorithms implemented in the R package measurement of IL-10 by ELISA. Experiments using the bacteria in gplots. Gene class testing was performed using the safe package (43) in multiwell chamber slides were performed for confocal microscopy to study Bioconductor using default settings. Both Kyoto Encyclopedia of Genes type 1 fimbriae-mediated adherence in relation to UPEC-triggered IL-10 and Genomes (KEGG) pathway and gene ontology (GO) used as gene synthesis in bladder. classes were analyzed. False discovery rate of 0.1 (44) was used as a cut- off. GoMiner and InnateDB were also used to analyze functional groups of Flow cytometry for identification of IL-10–secreting cells genes activated in biological pathways, and overrepresentation analysis Mixed human cell cocultures incorporating 5637 bladder urothelial cells using Over Representation Analysis was based on fold-change and p value and U937 monocytes were infected with UPEC, as above, and separated into cutoffs of 2.0 and 0.01, respectively. nonadherent (monocyte-enriched) and adherent populations (urothelial ELISA data enriched) after 5 h. Nonadherent cells, inclusive of several PBS rinses, were collected by centrifugation (500 3 g for 5 min); adherent cells were Unpaired Student t test was used with significance level set as a p value subsequently collected by trypsinization. Cells were adjusted to 106 cells ,0.05. per sample and used in FACS analysis using CD45 as a U937 monocyte Tissue bacterial load data. Mann–Whitney U test was used to compare marker, or RNA isolation and subsequent qRT-PCR for human IL-10 using mean values of bacterial CFU/ml that were not normally distributed, with specific primers (Supplemental Table I). For FACS analysis, cells were significance level set as a p value ,0.05. resuspended in wash buffer (1% FBS in PBS), blocked (2% BSA for 1 h, 2 Patient data. Pearson’s x test was used to compare the frequency of el- RT), and centrifuged, and FcRs were blocked with 1% normal human evated urinary IL-10 among patients and controls. Unpaired Student t test serum in wash buffer for 1 h at RT. Cells were centrifuged and resuspended was used to compare plasma levels of IL-10 among patients and controls, in wash buffer with mouse anti-human CD45 IgG conjugated to R-PE with significance level set as a p value ,0.05. (NBP1-28512 [F10-89-4]; Novus Biologicals) at the concentration rec- Downloaded from ommended by the manufacturer and incubated for 30 min in the dark at Ethics statement RT. Cells were washed twice in wash buffer, fixed in 4% paraformaldehyde Animals. overnight at 4˚C, and stored at 4˚C in the dark until analysis, which was This study was carried out in strict accordance with the national guidelines of the Australian National Health and Medical Research Coun- performed using a LSRII Fortessa flow cytometer (BD Biosciences, North cil. The Institutional Animal Care and Use Committee of the University Ryde, NSW, Australia) the following day. Data were analyzed using the FACSDiva version 6 software package. of Alabama at Birmingham and the Animal Ethics Committee of Griffith University reviewed and approved all animal experimentation protocols used in this study (permits: University of Alabama at Birmingham Animal Generation of IL-10–targeting knockdown cells in U937 http://www.jimmunol.org/ monocytes Project 080708186 and Griffith Approval MSC/14/08AEC). The University of Alabama at Birmingham institution has an Animal Welfare Assurance on We made several stable U937 cell lines containing chromosomally inte- file with the Office of Laboratory Animal Welfare (Assurance A3255-01) grated constructs from lentiviral vectors to knock down UPEC-induced and is registered as a Research Facility with the United States Department of IL-10 respones and complement qRT-PCR analysis of CD45-positive Agriculture. The animal care and use program is accredited by the Asso- cells. Lentiviruses were produced using Human Expression Arrest GIPZ ciation for Assessment and Accreditation of Laboratory Animal Care lentiviral short hairpin (sh)-microRNA vectors targeting IL-10 (cloneIDs (American Association for the Accreditation of Laboratory Animal Care V2LHS_111493, V2LHS_111488, V2LHS_226698) and a nontargeting International). Transurethral infections were performed under temporary clone (RHS4346) in conjunction with the TransLenti Viral GIPZ Packaging isoflurane inhalation anesthesia. System (Thermo Scientific Open Biosystems), according to the manu- Human subjects. This study was performed in accordance with the ethical facturer’s protocol. Normal U937 cells harvested between passages 5 and 8 standards of the Gold Coast Hospital, Queensland Health, Griffith Uni- by guest on October 1, 2021 were transduced in the presence of 8 mg/ml polybrene. Transduced cells versity, University of Queensland, Princess Alexandra Hospital, and Hel- were selected with 0.35 mg/ml puromycin, and expression of TurboGFP sinki Declaration. The study was approved, and the need for informed was confirmed by fluorescence microscopy. The newly contructed U937 consent was waived by the institutional review boards of Queensland Health cell lines were designated U937-IL10-KD1, -KD3, and -KD4, and the and Griffith University (MSC/18/10/HREC) and the board of the Princess nontargeting control line U937-IL10-NTC, and were used in culture com- Alexandra Hospital (research protocol 2008/264). bination, as described above. Measurement of IL-10 in patients with UPEC UTI Results Whole bladder transcriptome of UPEC cystitis Analysis of IL-10 in urine of human UTI was performed with adult patient study subjects (.18 y) encountered at the Gold Coast Hospital between Microarray analysis of early global gene expression in bladder August and October 2010. Patients underwent assessment for UTI because triggered by UPEC after transurethral challenge of C57BL/6 mice of symptoms indicating infection or as part of routine patient screening. All patients presenting with cystitis (dysuria, frequency, and/or urgency identified 1,564 genes with significantly altered expression, as with a concentration of a uropathogen in urine .1 3 105 CFU/l) were follows: 914 (58.44%) were upregulated and 650 (41.56%) down- recruited into the study. Urine samples were obtained as clean-catch regulated. These 1,564 genes represent 3.8 and 2.7% of the entire voided or catheterized samples and were frozen at 280˚C until assay. 24,000 gene set significantly upregulated and downregulated, Control subjects were selected on the basis of not having a current UTI respectively. The complete significant gene list is shown as a heat (i.e., no bacteriuria or symptoms indicating UTI). Urinary IL-10 was measured using ELISA. IL-10 was also measured in plasma collected from map and volcano plot in Supplemental Fig. 1 and listed according 57 patients diagnosed as having urosepsis due to UPEC, and these were to statistical significance values in Supplemental Table II. Raw data compared with IL-10 levels in plasma of 60 healthy control subjects. are deposited under accession number GSE26509 in the Gene Ex- Statistical analysis pression Omnibus (http://www.ncbi.nlm.nih.gov/geo/). The list of genes encompassed a diverse set of regulators of metabolism, cell Most of the analysis of the microarray data was in R.2.11 using Bio- cycle, growth and survival, adaptive and innate immune responses, conductor packages (http://www.bioconductor.org). and genes central to immune regulation, such as NF-kB and ILs. Data preprocessing During our analysis of transcriptional activation due to UPEC in The raw microarray data were normalized using quantile normalization (37) the bladder, we noted 78 significant genes that encode IL family and summarized using Robust Multi-array Average (38) as implemented in members and their receptors, including (fold change) the follow- the affy package in Bioconductor. Differentially expressed genes were ing: IL-1b (46.9), IL-6 (46.2), IL-1a (13.9), IL-1r2 (10.28), IL- identified by analyzing the data using the MAANOVA package (39) (http:// 10ra (3.00), IL-10 (5.05), IL-18rap (3.68), and IL-23 (2.2). Other www.bioconductor.org/packages/bioc/1.8/html/maanova.html). To identify significant changes in gene expression induced by UPEC, we used a highly expressed genes were the chemokines Cxcl-10 (38.26), shrinkage-based t test (40) together with permutation (41) to compare the Cxcl-1 (22.15), Cxcl-2 (66.72), Cxcl-16 (3.19), Cxcl-3 (9.07), treatment group and the control group in each strain. A false discovery rate Cxcl-5 (3.46), and Cxcl-9 (2.67). 784 EARLY BLADDER TRANSCRIPTOME OF UPEC UTI AND IL-10

We next measured the expression of several IL and chemokine Table II. Innate transcriptional networks triggered in the bladder by target genes using qRT-PCR to validate array datasets. This showed UPEC at 2 h postinfection as identified using KEGG levels of gene expression of specific target genes that were highly consistent with microarray data. For example, IL-1b (195.49-fold KEGG No. Pathway Name p Value increase), IL-1a (134.57-fold increase), IL-10 (23.67-fold in- 00670 Metabolism of cofactors and vitamins 0.012 crease), IL-6 (132.87-fold increase), and TNF-a (11.23-fold in- 04070 Phosphatidylinositol signaling system 0.012 crease) were highly expressed according to qRT-PCR (Table I), 04620 TLR signaling 0.012 04660 TCR signaling 0.012 validating array analysis. For the majority of the genes tested by 04710 Circadian rhythm 0.012 qRT-PCR, including IL-1b, IL-1a, IL-10, IL-6, TNF-a, CCL2, 05210 Colorectal cancer 0.012 and Cxcl-9, the responses peaked at 2 h (Table I). Various genes 05212 Pancreatic cancer 0.012 that were identified in microarray assays as unchanged in ex- 04630 JAK–STAT signaling 0.017 pression at 2 h, including Msr-1, IL-10rb, and the housekeeper 05217 Basal cell carcinoma 0.019 b 04060 Cytokine–cytokine receptor interaction 0.024 genes -actin and GAPDH, also showed no change at this time 03450 Nonhomologous end joining 0.027 point according to qRT-PCR. Some of these, however, including 05340 Primary immunodeficiency 0.027 Msr-1 and IL-10rb, showed significantly increased expression af- 04210 Apoptosis 0.028 ter 24 h, indicating a slower response to infection. 00760 Nicotinate and nicotinamide metabolism 0.033 04662 BCR signaling 0.033 Transcriptional networks in UPEC cystitis 00510 N-glycan biosynthesis 0.035 00532 Chondroitin sulfate biosynthesis 0.035 Gene class testing using KEGG identified 20 significant biologi- 04320 Dorso-ventral axis formation 0.037 cally relevant pathway interactions in C57BL/6 mice (Table II). 04520 Adherens junction 0.038 Downloaded from These included several with significant associations with infec- 05220 Chronic myeloid leukemia 0.039 tion, including metabolism of cofactors (00670), phosphatidylinositol signaling (04070), TLR (04620), and TCR signaling (04660). Next, we analyzed expression data using GO, which pathways for immune defense against bacteria, cytokine inter- identified 223 biologically relevant pathways triggered by UPEC actions, and B lymphocyte activation (Fig. 1B).

UTI (Supplemental Table III). Among the most significant were We next sought to examine the microarray dataset derived from http://www.jimmunol.org/ those for MAPK activation (187), the response to bacteria- C57BL/6 mice using an integrative approach that incorporates associated molecules (2237), adaptive immune responses (2250), known biological interactions from prior studies. InnateDB bio- regulation of B cell-mediated immunity (2712), chemotaxis informatics (45) revealed a suite of 771 additional unique and (6935), and leukocyte adhesion (7159). A summary of gene class significant biological pathways from REACTOME and Integrating testing results using KEGG and GO is illustrated in Fig. 1A. Network Objects with Hierarchies databases (data not shown). GoMiner analysis also identified extensive gene activation among Among these there were 68 that were overrepresented according to Over Representation Analysis. These included the TLR4 cascade (477830), biological oxidations (477446), and hemostasis

Table I. qRT-PCR of select gene targets identified by microarrays as (477598) (Supplemental Table III). Many of these were confirmed by guest on October 1, 2021 significant in the bladder transcriptome triggered by UPEC at 2 h following infection

Gene Infection Period (h) ΔFold UPEC p Value

Identified by Arrays as Significant IL-1a 2 134.57 0.001 24 6.03 0.001 IL-1b 2 195.49 0.001 24 36.92 0.001 IL-6 2 132.87 0.0001 24 10.56 0.001 IL-10 2 23.67 0.001 24 2.97 0.001 IL-10ra 2 1.74 0.0015 24 3.26 0.001 TNF-a 2 11.23 0.001 24 4.90 0.001 CCL2 2 27.89 0.001 24 4.01 0.001 CXCL5 2 2.32 0.0025 24 5.37 0.001 CXCL9 2 5.08 0.001 24 4.57 0.027 Identified by Arrays as Insignificant Msr-1 2 1.24 0.33 24 3.3 0.001 INFgr1 2 1.033 0.92 24 1.96 0.0075 IL-10rb 2 0.941 0.5 FIGURE 1. Transcriptional networks of gene activation in UPEC- 24 1.33 0.029 infected bladder. Diverse gene networks activated in bladder were identi- b-actin 2 0.815 0.114 fied using KEGG and GO (A), with Venn diagrams summarizing numbers 24 0.937 0.128 of pathways altered by infection according to each tool. GoMiner was used 2 GAPDH 2 1.18 0.5 to identify groups of infection/immune-related genes in pathways in which 24 1.13 0.66 IL-10 (*) was identified as a central component to several networks (B). The Journal of Immunology 785 using ingenuity pathway analysis (IPA), the overall results of Early IL-10 synthesis correlates with UPEC load which are shown in Supplemental Table III. To investigate the relationship between IL-10 and bacterial burden, CBA mice are occasionally used as an alternate strain to C57BL/ we analyzed the distribution of UPEC on bladder uroepithelium 6 mice, and we analyzed gene expression in these mice to delineate using mCherry-tagged UPEC. Binding of UPEC occurred in focal conserved responses, the results of which are shown as a complete areas (Fig. 5A,5B, arrows), and early IL-10 expression correlated list of significant genes in Supplemental Table II. Raw data for CBA with the highest numbers of bacteria at 2 h (Fig. 5C,5D). Lower mice are deposited under accession number GSE33210 on GEO. expression of IL-10 at 24 h (qRT-PCR data, Table I) correlated Overall, many transcriptional network responses observed in with fewer UPEC at this time point, as well as urothelial cell C57BL/6 and CBA mice were shared between the mouse strains. invasion and destruction as observed by SEM (Fig. 5E,5F). Lower For example, signaling pathways representing JAK–STAT (04630), bacterial burdens were observed at 5 d (Fig. 5C). Extrusions from T (04660) and B (04662) cell receptors, TLRs (04620), phos- urothelial cells at 2 h (Fig. 5D) resembled intracellular bacterial phatidylinositol (04070), and apoptosis (04210), identified using communities (51), and elongated UPEC cells at 24 h (Fig. 5E, KEGG, were common, with highly significant p values of acti- 5F) mirrored unique filamentous UPEC, as noted elsewhere (52). vation (Supplemental Table III). Collections of distinct responses Thus, IL-10 synthesis in bladder peaks early with high UPEC were also noted, and CBA mice exhibited a larger number of loads, which are subsequently reduced, and correlate with lower activated genes. Direct comparisons illustrating the overall re- IL-10 expression and urothelial cell destruction. sponse of CBA mice and conserved, CBA-unique, and C57BL/6- unique gene responses are shown in Supplemental Fig. 1. Early IL-10 contributes to control of UPEC UTI In the course of our bioinformatics analysis, we noted many IL We next analyzed whether early IL-10 in bladder has any functional Downloaded from responses that were overrepresented in activated biological path- role in UTI by comparing disease in immunodeficient gene- ways in response to UPEC. This included, for example, pathways knockout mice and wild-type (WT) mice, as previously re- for immune defense against bacteria, cytokine activity, and B cell ported, for other host factors (53). Infection of IL-102/2 mice and signaling, as identified using GoMiner (Fig. 1B). Unlike IL-1b and assessment of the impact of a lack of IL-10 on disease compared IL-6 (46–50), many of the ILs and IL receptors in these responses with WT mice at 24 h postinfection showed that IL-102/2 mice (IL-2ra/b, -8ra, -10, -11, -15ra, -17c, -18rap, and -23a) have not had significantly more UPEC in the bladders, urine, and kidneys previously been associated with UTI. Of note was IL-10, which compared with WT mice (Fig. 6A–C; p = 0.013; p = 0.001; p = http://www.jimmunol.org/ was present in all three GoMiner pathways related to infection 0.007). Bacterial loads in IL-102/2 mice were 10-fold greater in (Fig. 1B) and was shared in the activated T lymphocyte activation bladder and 30-fold greater in urine and kidneys at this time point pathway, as well as eight KEGG (8107, 2794, 2791, 692, 2816, compared with WT mice. Ab depletion studies using an anti– 651, 2813, 604) and eight Integrating Network Objects with Hi- IL-10–neutralizing Ab in WT C57BL/6 mice also demonstrated erarchies (187, 195, 11, 51, 185, 393, 63, 121) pathways (all p = higher bacterial burdens in urine and bladders of mice following 0.005). IPA also revealed IL-10 signaling as the top hit in ca- pretreatment with Ab and subsequent infection with UPEC (Fig. nonical pathway recognition and revealed the multiple genes re- 6D,6E). Mice that received anti–IL-10 Ab prior to UPEC chal- lated to IL-10 activation present within the C57BL/6 trans- 6 lenge had 4.50 0.20 CFU/ml in urine 24 h postchallenge by guest on October 1, 2021 criptome (Supplemental Table III). As a result of these findings, compared with 3.89 6 0.19 CFU/ml in controls, a statistically we chose to study the IL-10 response further. significant difference. Bladder bacterial counts in anti–IL-10 Ab- treated WT mice were also higher than controls (5.14 6 0.26 Induction of bladder IL-10 in response to UPEC CFU/ml versus 4.84 6 0.24 CFU/ml), but these differences were IL-10 was upregulated 5.051-fold in C57BL/6 mice at 2 h not statistically significant based on group sizes of 12 mice. To- (p = 0.005), according to microarrays, and 23.67- and 2.97-fold gether, these data show that early bladder IL-10 is protective in the (p = 0.001) at 2 and 24 h, respectively, according to qRT-PCR. response to UPEC and contributes to bacterial control in UTI, The cognate receptor, IL-10ra, was also upregulated and was particularly in terms of bacteriuria. present in several biological pathways identified by InnateDB, including the cytokine–cytokine receptor pathway (Fig. 2). Both IL-10 is produced in a coculture model of human bladder IL-10ra and IL-10rb were also significantly upregulated in CBA We next sought to investigate whether IL-10 is produced by human mice according to microarrays (Supplemental Table II). To better cells in response to UPEC using a novel histotypic four-cell co- understand this response, we measured total IL-10 protein in culture model of bladder. In cocultures of urothelial cells, bladders of C57BL/6 mice. Compared with mice that received monocytes, T cells, and B cells (ratio 88:10:1:1), there was no only PBS, there was a significant increase in IL-10 protein in detectable increase in IL-10 in response to UPEC after 2 h (data not bladders of infected mice (492 6 33 versus 152 6 25 pg/ml, p , shown). However, IL-10 was produced in UPEC-infected cultures 0.0001) and a parallel increase in kidneys (Fig. 3). Urinary IL-10 after 5 h, with 3-fold more IL-10 secreted by infected cells was also measured, but the data were not significant (data not compared with controls (p , 0.001; Fig. 7A). We also analyzed the shown). effect of the number of T cells on IL-10 production because IHC was then performed on UPEC-colonized uroepithelium T cells often amplify IL-10 production (54). In cocultures that (Fig. 4A–C) and showed IL-10–secreting cells lining the luminal contained more T cells (79:10:10:1), the IL-10 response at 5 h was surface of the bladder in situ (Fig. 4D). IL-10 was not detected in slightly higher compared with cultures containing fewer T cells, sections stained with an isotype-matched control Ab (Fig. 4E)or but these differences were not significant (data not shown). Type 1 in PBS-treated noninfected mice (data not shown). The presence fimbriae are the major adhesin of UPEC responsible for binding to of UPEC within these tissues expressing IL-10 was studied using urothelial cells, and we hypothesized that type 1 fimbriae adher- mCherry-tagged CFT073. IL-10 expression in colonized uroepi- ence might trigger IL-10 production. When we tested a mCherry- thelia was not consistently associated with the presence of UPEC tagged type 1 fimbriae-deficient mutant of UPEC, CFT073fimA, (Fig. 4F–H). Thus, IL-10 expression forms part of the innate re- the mutant stimulated levels of IL-10 slightly higher than the WT sponse to UPEC bladder colonization, but is not consistently UPEC (Fig. 7B). Confocal microscopy confirmed less binding of colocalized within areas of infection. the mutant to bladder cells compared with the WT bacteria (Fig. 786 EARLY BLADDER TRANSCRIPTOME OF UPEC UTI AND IL-10 Downloaded from http://www.jimmunol.org/ by guest on October 1, 2021

FIGURE 2. Cytokine signaling pathways in UPEC UTI. InnateDB analysis of gene expression networks triggered by UPEC in bladder identiﬁed the cytokine–cytokine receptor pathway as highly signiﬁcant and uncovered broad activation of genes encoding various ILs and their receptors (red circles, inset). Included among the the most activated cytokine genes were IL-10 and its receptor IL-10ra (boxed).

7C,7D). Thus, type 1 fimbriae-mediated attachment to human these data confirm that the IL-10 produced in the coculture model bladder cells is not required for UPEC-triggered IL-10 production. of human bladder in response to UPEC is derived mostly from U937 monocytes in this model. Identification of the IL-10–producing cells IL-10 is produced in human UTI To determine the cell type that produces IL-10 in response to UPEC in the coculture model of human bladder, we used CD45 Measurement of IL-10 in patients with UPEC cystitis by ELISA staining as a marker of monocytes and analyzed cocultures after showed significantly higher urinary IL-10 levels (.10 pg/ml) 5 h of infection (Fig. 8A) or separated populations of nonadherent among patients compared with control individuals without UTI (enriched for U937 monocytes) and adherent cells (enriched for (Fig. 10A). Low baseline levels of urinary IL-10 (3–5 pg/ml) were urothelial cells). Utilizing qRT-PCR, we observed a 4.1-fold in- more common among controls compared with UTI patients, but crease in IL-10 mRNA in monocyte-enriched (CD45-positive) cell significantly more patients exhibited high levels of urinary IL-10 populations compared with controls (Fig. 8B). In contrast, IL-10 (.40 pg/ml) compared with controls (Fig. 10A). We also mea- mRNA levels in urothelial-enriched (CD45-negative) cells re- sured IL-10 in plasma of 57 patients with UPEC urosepsis and 61 mained unchanged after 5 h of infection (Fig. 8C). healthy subjects without UTI to determine whether the urinary We then measured IL-10 protein in cocultures that used various tract might be influenced by systemic IL-10 in urosepsis. Patients IL-10–targeting knockdown versions of U937 cells to confirm data with urosepsis had significantly higher levels of IL-10 in plasma from the qRT-PCR assays above. In infected cocultures that used compared with controls (Fig. 10B). any of three IL-10 knockdown U937 cells (targeting exons 1, 3, and 4), the IL-10 response was abolished compared with control Discussion cocultures that used either normal U937 cells, or a nontargeting The very early inflammatory signaling events triggered in the control U937 line that was transduced with a nontargeting control bladder immediately following colonization with UPEC define the vector (Fig. 9). In a fourth IL-10–targeting U937 cell line, how- cascade of events that culminate in UTI disease or resolution of ever, the response was not changed (data not shown). Together, infection. Recently, innate resistance to UPEC UTI was demon- The Journal of Immunology 787

innate defense to bacterial UTI. Several genes identified in this study are consistent with prior reports that profiled mouse bladder previously and mapped responses in foci of uroepithelium infected with intracellular UPEC pods, which displayed localized responses (50, 57). The whole tissue approach we have used gives broader definition to the total bladder transcriptome of UTI. This provides crucial new insight into the dynamic interactions of infected cells as well as adjacent bystander cells, the inflammatory infiltrate associated with UTI (46), and the local vasculature that contributes to inflammation in the bladder after bacterial colonization (20, 47, 58). Notably, many of the responses identified in the whole bladder transcriptome presented in this work are consistent with those observed in localized responses to intracellular bacterial communities in bladder urothelial cells, as previously re- ported (57). Of particular note were localized urothelial responses to intracellular bacterial communities such as those directed at opposing UPEC salvage of host cell iron and facilitation of glu- FIGURE 3. Protein levels of IL-10 in response to UPEC. Concentrations cose import and epithelial structural integrity (57). Many of these of IL-10 were measured by ELISA in bladder (A) and kidney (B) homo- responses are consistent with the genes, such as lipocalin 2 (Lcn2) Downloaded from genates (n = 9 per group, combined from two separate experiments) 2 h and hexokinase 2 (Hk2), identified as highly upregulated in the after challenge and demonstrate rapid production of IL-10 protein in whole bladder transcriptome of UPEC cystitis in this study. To- bladder in response to UPEC infection. gether, these findings emphasize the importance of iron scaveng- ing in the lifestyle of E. coli in the bladder, as recently described strated in the context of pathogen-specific signaling in murine (59–61), and, from the hosts’ perspective, the key role of iron se- pyelonephritis (55), and the danger-associated molecular pattern questration, sugar metabolism, and cell integrity in the urinary http://www.jimmunol.org/ S100A8/A9 was shown to be unnecessary for effective host de- tract in response to bacterial uropathogens. fense against UTI (56). The overall innate response of bladder in The whole bladder transcriptome of UPEC cystitis reveals UPEC cystitis in the murine UTI model, however, remains largely a complex network of interactions that encompass a broad func- uncharacterized. In this study, we provide a detailed genome-wide tional variety of genes involved in metabolism, cell cycle, growth, microarray analysis of whole bladder to UPEC UTI in mice using adaptive and innate immune responses, cofactors, and signaling. large group sizes and a nonpooled sampling approach for in- Many of the identified biological pathways have not previously creased statistical power to offer a revealing new perspective on been associated with UTI. Leukocyte signaling triggered in the the innate response to infection. Our approach has uncovered a bladder appears to reflect a collection of pathways linking TLR, broad range of host factors not previously known to regulate TCR, cytokines, JAK–STAT signaling, and BCR signaling. That by guest on October 1, 2021

FIGURE 4. In situ detection of IL-10 in bladder. UPEC colonization of uroepithelium was assessed by H&E (A, B; boxed areas show the same region in one section at different magnifications) to demonstrate UPEC binding (inset), and fluorescence microscopy was used to visualize mCherry-tagged UPEC bound to tissue (C), with IHC used to detect IL-10 expression. C, Different regions of the same section are shown. The boxed sections indicate equivalent regions within serial sections of the same tissue. IL-10–secreting cells are shown in D on the luminal surface of colonized uroepithelium (arrowheads), but not in controls (E). Significant staining was absent in sections stained with an isotype-matched control Ab. Colocalization of UPEC and IL-10 was detected in some areas (G, H), but not in others that were not colonized (H, upper arrows). Boxed areas of F and G show same region in different serial sections. Scale bars, 750 mm(A); 20–55 mm(B–F); 185 mM(G, panel width); 130 mm(H, panel width). Boxed areas, 160 mm(A); 19 mm(B). 788 EARLY BLADDER TRANSCRIPTOME OF UPEC UTI AND IL-10

FIGURE 5. IL-10 expression correlates with bladder UPEC load. Synthesis of early IL-10 correlates with focal UPEC adhesion to bladder uroepithelium at 2 h, as shown in whole tissue using mCherry-tagged UPEC (A, B) and higher bacterial loads at 2 h compared with later time points (C; n = 14–18 per time point, combined from three separate experiments). Early colonization reﬂects UPEC bound in focal areas of adhesion around bulbous extrusions (D), which is followed by decreasing bacterial loads over time and urothelial cell destruction (E, F). Scale bars, 800 mm(A); 160 mm (B); 10 mm(F). Downloaded from http://www.jimmunol.org/ many of these signaling pathways were activated by UPEC not only networks related to leukocyte activation and lymphocyte signaling in the universal C57BL/6 mouse strain, but also the alternate CBA during acute UTI. These observations underscore the prominence strain, demonstrates a high degree of conservation in many of the of these signaling mechanisms in the innate response to UPEC in by guest on October 1, 2021

FIGURE 6. Early IL-10 protects against UPEC UTI. Bladders, urine, and kidneys of C57BL/6 mice and age-matched IL-10–deficient mice (B6.129P2- Il10tm1Cgn/J) challenged with UPEC were cultured after 1 d of infection (n = 12 per group, combined from two separate experiments) to compare tissue bacterial loads. Higher UPEC numbers detected in IL-10–deficient mice compared with control mice demonstrate a protective role of early bladder IL-10 expression in cystitis (A), bacteriuria (B), and pyelonephritis (C). C57BL/6 mice treated with anti–IL-10–neutralizing Ab also exhibited higher mean UPEC burdens in bladders (D) and urine (E) compared with controls, although differences in bladders were not statistically significant. Mann–Whitney U test was used for comparisons, with significance set at p , 0.05. The Journal of Immunology 789

UPEC described in this work, including MIP-2, IL-1b, IL-6 (4, 13, 46, 50), and CXCR1 (58). Interestingly, our data reveal that the induction of these mediators, which occurs amid extensive inflammatory responses, takes place with concomitant UPEC-triggered transcriptomic activation of key immunosuppressive genes. These include a suppressor of cytokine signaling socs3 and rapid induction of the gene for the master regulator of innate immunity, IL-10. We suggest that this induction of suppression-related responses may represent a proactive attempt by the host to moderate exces- sive inflammation, which could damage tissue locally and cause immunopathology in the bladder. Thus, the early bladder transcriptome mounted in response to UPEC appears to reflect a bal- ance of host defense strategies designed to drive rapid and robust immune activation, but also moderate inflammatory responses by stimulating the actions of immune modulators. A notable element within the UPEC cystitis transcriptome was broad involvement of multiple IL family members and their re- FIGURE 7. UPEC-triggered IL-10 synthesis in an in vitro model of ceptors, including IL-1, IL-2, IL-6, IL-8ra, IL-10, IL-11, IL-17c/ra, human bladder. UPEC triggers IL-10 synthesis in a histotypic coculture IL-18rap, and IL-23a. Considering the role of IL-10 as a master Downloaded from model of human bladder (5637 urothelial cells, monocytes, T cells, and B regulator of innate immunity, we focused on IL-10 in functional cells [ratio 88:10:1:1]) (A). UPEC-induced IL-10 occurs independently of and clinical studies in patients with UPEC cystitis. IL-10 works at type 1 fimbriae attachment because levels of IL-10 triggered by infection the crossroads of Th1-centric inflammation (54) and immuno- (B) were similar in cocultures infected with either mCherry-tagged WT suppression (64). Smith et al. (65) described urinary IL-10 in renal UPEC (C) or CFT073fimA despite impaired binding of the mutant (D). transplant patients with transplant rejection; however, the func- Data represent mean 6 SD of quadruplicate samples from three separate , tion of IL-10 in the infected human urinary tract is hitherto un- experiments. Unpaired Student t test was used with significance at p http://www.jimmunol.org/ known. In our study, patients with UPEC cystitis secreted signif- 0.05. Red, mCherry-tagged UPEC; green, Alexa Fluor 488 phalloidin for F-actin; blue, Hoechst 33258 for nuclei. Scale bars, 10 mm. icant urinary IL-10 and produced high levels of IL-10 systemically during UPEC urosepsis. Whether the systemic IL-10 present in patients with UPEC urosepsis has coordinated effects in immune the bladder. The short infection window used in our study high- regulation, as described in other clinical conditions, is unknown lights the integral role for early lymphocyte signaling immediately (66). However, our studies in mice point to the fact that IL-10 following UPEC infection. Prior studies with urothelial cells (58, produced in the bladder plays a functional role early in UTI dis- 62, 63) and animals (50) uncovered several genes triggered by 2 2 ease pathogenesis. Infection of IL-10 / mice showed an un- expected protective role for early IL-10 in UPEC UTI because these by guest on October 1, 2021 mice had more UPEC and more severe bacteriuria. Bacteriuria was also more severe in mice undergoing Ab depletion using an anti–IL-10–neutralizing Ab. These findings highlight a functional impact of early IL-10 in UPEC UTI and suggest that future investigation of novel anti-inflammatory treatments in the mouse UTI model may be worth investigating as a means of understanding the inflammation-immunosuppression nexus in acute bacterial UTI. In addition, several IL-102/2 mice also progressed to pyelonephritis, which failed to develop in control mice, sug- gesting additional unknown effects in the upper urinary tract. The apparent protective role for early IL-10 in UPEC UTI in mice may reflect a moderation of pathological inflammatory responses shown to be central in many of the active biological pathways in the whole bladder transcriptome. As a comparison, for example, in protozoan and helminthic infections, IL-10 aids in disease control by reducing pathological sequelae and development of lesions in acute infections (67). It is noteworthy that IL-10 also has well-defined roles in mediating pathogenesis in other bacterial infections due to broad immunosuppressive effects; IL-10 is known to contribute to persistent infections such as tuberculosis (67, 68). These contradictory effects of IL-10 in different disease states are explained by the well-known pluripotent nature of IL-10 FIGURE 8. UPEC-triggered IL-10 in a mixed coculture model of human and the host requirement for tightly controlled inflammatory bladder is monocyte derived. In cocultures of U937 monocytes and 5637 responses to defend against a diversity of microbial pathogens urothelial cells infected with UPEC for 5 h, then analyzed for CD45 by while concurrently minimizing host damage. FACS (A) (percentage of CD45-positive cells in inset), isolated cell populations enriched for nonadherent monocytes (B) exhibited a 4.1-fold in- Our in vitro analysis of the human IL-10 response to UPEC using crease in IL-10 mRNA according to qRT-PCR (normalized to noninfected a novel coculture model of bladder incorporating urothelial cells, control cocultures). IL-10 mRNA in adherent cell populations, composed monocytes, and lymphocytes, which comprise a major element of predominantly of urothelial cells, was unchanged after 5 h (C). GAPDH the inflammatory infiltrate in the bladder response to E. coli (69), served as a reference gene. identified the source of the IL-10 as monocytes. The urothelial cell 790 EARLY BLADDER TRANSCRIPTOME OF UPEC UTI AND IL-10

FIGURE 9. Knockdown of UPEC-induced IL-10 in U937 monocytes in a dual coculture model of human bladder. sh-microRNA–based targeting of IL-10 for knockdown in U937 monocytes conﬁrmed that UPEC-induced IL-10 in cocultures was derived from monocytes. The IL-10 response in UPEC- infected (UPEC multiplicity of infection 10) cocultures of 5637 urothelial cells in combination with various stable U937 monocyte cell lines harboring contructs targeting exons 1, 3, and 4 of IL-10 or a nontargeting control (NTC) is shown and compared with the response of cocultures that incorporated Downloaded from normal U937 cells. IL-10 responses in U937 IL-10KD cocultures were not signiﬁcantly different in any of three KD cell lines compared with noninfected control cultures containing normal U937 cells. An independent-samples t test was used to compare replicates (n = 12) of 5637–U937 control cocultures (containing normal U937 cells) against infected cocultures with U937 shRNA KD cell lines. coculture system used in this work has inherent limitations, such previously (70, 71) and have proven useful for assessing IL-10 as the exclusion of polymorphonuclear leukocytes, but epithelial effects (72). The advantages of coculture models incorporating http://www.jimmunol.org/ cell types have been cocultured with lymphocytes and monocytes epithelial cells for the study of host–pathogen interactions are reviewed elsewhere (32). Epithelial cells in mucosal tissues are anatomically positioned in close proximity to various subepithe- lial cell types, including lymphocytes (73), which can contribute to cell signaling function via paracrine pathways (74). Signaling between cells may aid these responses because lymphocytes pro- duce IL-10 in response to various bacteria such as Mycobacteria spp. (75, 76) and Helicobacter spp. (77), and intercellular inter-

actions can be essential to drive antibacterial responses (78). a-b by guest on October 1, 2021 T cell activation, mononuclear cell and lymphocyte proliferation, and receptor signaling, as well as leukocyte cell-cell adhesion and JAK–STAT signaling for cytokine metabolic processes, were identified as major conserved mechanisms within the bladder transcriptome of UPEC UTI underscoring extensive cellular interactions. The precise mechanisms of UPEC-induced IL-10 in this human cell coculture model, however, and the identity of the IL-10–producing cells in situ in the murine model of UPEC UTI will require further study. Type 1 fimbriae of UPEC induce secretion of various cytokines in the mouse UTI model (48). Surprisingly, IL-10 synthesis in human cell in vitro occurred independently of fimbriae-mediated binding in this study. This indicates that the presence of neither type 1 fimbriae nor bacterial attachment is required for IL-10 production in the mixed cell coculture model of human bladder. Other components of bacteria that may trigger IL-10 include LPS (79) and species-specific molecules such as M protein of Strep- tococcus pyogenes, which induces IL-10 via Tr1 cells (80). LPS triggers the production of IL-10 in noninfectious experimental models that incorporate dendritic cells and macrophage stimula- tion, for example (81, 82). LPS also activates key innate immune mechanisms, including TLR-4, CD14, and NF-kB (83), which were shown to be activated by UPEC within the KEGG TLR FIGURE 10. IL-10 forms part of the human immune response to UPEC. signaling pathway and the strongly induced IPA network for IL-10 In patients with UPEC UTI elevated urinary IL-10 (.10 pg/ml) was more signaling. In addition to UPEC-triggered synthesis of IL-10, the common in individuals with UTI compared with controls (A)(n = 10/154; 6.5% versus n = 3/263; 1.1%; p = 0.006, Pearson’s x2 test). Plasma IL-10 ligand-binding chain of the IL-10R, IL-10ra, was also triggered at was also elevated in patients with UPEC urosepsis (n = 57) compared with the transcriptional level. Bladder cells are not known to express controls (n = 60) (B)(p = 0.001, unpaired Student t test, independent IL-10R, and, to our knowledge, this is the first report of IL-10ra samples) illustrating IL-10 in the human immune response to UPEC. responses in bladder tissue. Thus, this may represent an additional The Journal of Immunology 791 mechanism of immune regulation at the bladder-bacterial interface involves binding of GBS to bladder uroepithelium and potent but GBS-specific given the key role of IL-10R–dependent signaling in innate im- induction of interleukin 1alpha. J. Infect. Dis. 201: 866–870. 14. Engel, D., U. Dobrindt, A. Tittel, P. Peters, J. Maurer, I. Gu¨tgemann, munity (84). IL-10R is present on the surface of a variety of other B. Kaissling, W. Kuziel, S. Jung, and C. Kurts. 2006. Tumor necrosis factor human lymphoid and myeloid cells (85) and is upregulated during alpha- and inducible nitric oxide synthase-producing dendritic cells are rapidly recruited to the bladder in urinary tract infection but are dispensable for bacterial infection-induced inflammatory conditions such as sepsis (86). clearance. Infect. Immun. 74: 6100–6107. Moreover, human epithelial cells lining the colonic mucosa ex- 15. Olszyna, D. P., S. Florquin, M. Sewnath, J. Branger, P. Speelman, S. J. van press IL-10 to control inflammation and maintain mucosal ho- Deventer, R. M. Strieter, and T. van der Poll. 2001. CXC chemokine receptor 2 contributes to host defense in murine urinary tract infection. J. Infect. Dis. 184: meostasis (66). It is important to note, however, that our findings 301–307. on IL-10R transcripts were not extended to detection of the re- 16. Saëmann, M. D., T. Weichhart, W. H. Ho¨rl, and G. J. Zlabinger. 2005. Tamm- ceptor protein, which is a limitation of the current work. The role Horsfall protein: a multilayered defence molecule against urinary tract infection. Eur. J. Clin. Invest. 35: 227–235. for IL-10R in addition to IL-10 in maintaining urothelial integrity 17. Saëmann, M. D., T. Weichhart, M. Zeyda, G. Staffler, M. Schunn, K. M. Stuhlmeier, is an appealing area for further investigation. Y. Sobanov, T. M. Stulnig, S. Akira, A. von Gabain, et al. 2005. Tamm-Horsfall The UPEC UTI whole bladder transcriptome described in this glycoprotein links innate immune cell activation with adaptive immunity via a Toll-like receptor-4-dependent mechanism. J. Clin. Invest. 115: 468–475. study provides a wealth of new information for detailed study and 18. Rouschop, K. M., M. Sylva, G. J. Teske, I. Hoedemaeker, S. T. Pals, will be an invaluable tool for further data mining and biological J. J. Weening, T. van der Poll, and S. Florquin. 2006. Urothelial CD44 facilitates Escherichia coli infection of the murine urinary tract. J. Immunol. 177: 7225– pathway exploration. Further molecular analysis of the role of 7232. IL-10 in the early transcriptome of UPEC UTI and investigation of 19. Klumpp, D. J., M. T. Rycyk, M. C. Chen, P. Thumbikat, S. Sengupta, and the multitude of other signaling events defined to our knowledge for A. J. Schaeffer. 2006. Uropathogenic Escherichia coli induces extrinsic and intrinsic cascades to initiate urothelial apoptosis. Infect. Immun. 74: 5106–5113. the first time in this study will provide opportunity for improved 20. Mulvey, M. A., J. D. Schilling, J. J. Martinez, and S. J. Hultgren. 2000. Bad bugs Downloaded from understanding of the innate host responses to E. coli in the context and beleaguered bladders: interplay between uropathogenic Escherichia coli and of these important human infections. innate host defenses. Proc. Natl. Acad. Sci. USA 97: 8829–8835. 21. Ha¨cker, H., C. Fu¨rmann, H. Wagner, and G. Ha¨cker. 2002. Caspase-9/-3 activation and apoptosis are induced in mouse macrophages upon ingestion and Acknowledgments digestion of Escherichia coli bacteria. J. Immunol. 169: 3172–3179. 22. Bergsten, G., B. Wullt, M. A. Schembri, I. Leijonhufvud, and C. Svanborg. 2007. We thank Prof. John Gerrard for facilitation of clinical aspects of this Do type 1 fimbriae promote inflammation in the human urinary tract? Cell. study, Janice King and Yvette Hale for excellent technical assistance, and Microbiol. 9: 1766–1781. Dr. Michael Hanzal-Bayer at the Facility for Life Science Automation at In- 23. Wullt, B., G. Bergsten, H. Connell, P. Ro¨llano, N. Gebratsedik, L. Hang, and http://www.jimmunol.org/ stitute for Molecular Biosciences, University of Queensland, for performing C. Svanborg. 2001. P-fimbriae trigger mucosal responses to Escherichia coli in the human urinary tract. Cell. Microbiol. 3: 255–264. the lentivirus transductions. We thank Dr. Joan Faoagali and other members 24. Allsopp, L. P., M. Totsika, J. J. Tree, G. C. Ulett, A. N. Mabbett, T. J. Wells, of the microbiology laboratory at the Princess Alexandra Hospital for help B. Kobe, S. A. Beatson, and M. A. Schembri. 2010. UpaH is a newly identified with the collection of patient plasma samples. We also thank Flora Gathof autotransporter protein that contributes to biofilm formation and bladder colo- for administrative assistance and Prof. David Briles for helpful discussions. nization by uropathogenic Escherichia coli CFT073. Infect. Immun. 78: 1659– 1669. 25. Valle, J., A. N. Mabbett, G. C. Ulett, A. Toledo-Arana, K. Wecker, M. Totsika, Disclosures M. A. Schembri, J. M. Ghigo, and C. Beloin. 2008. UpaG, a new member of the trimeric autotransporter family of adhesins in uropathogenic Escherichia coli. J. The authors have no financial conflicts of interest. Bacteriol. 190: 4147–4161. 26. Tree, J. J., G. C. Ulett, C. L. Ong, D. J. Trott, A. G. McEwan, and M. A. Schembri. by guest on October 1, 2021 2008. Trade-off between iron uptake and protection against oxidative stress: References deletion of cueO promotes uropathogenic Escherichia coli virulence in a mouse model of urinary tract infection. J. Bacteriol. 190: 6909–6912. 1. Foxman, B. 2002. Epidemiology of urinary tract infections: incidence, mor- 27. Roos, V., G. C. Ulett, M. A. Schembri, and P. Klemm. 2006. The asymptomatic bidity, and economic costs. Am. J. Med. 113(Suppl. 1A): 5S–13S. bacteriuria Escherichia coli strain 83972 outcompetes uropathogenic E. coli 2. Oelschlaeger, T. A., U. Dobrindt, and J. Hacker. 2002. Virulence factors of strains in human urine. Infect. Immun. 74: 615–624. uropathogens. Curr. Opin. Urol. 12: 33–38. 28. Buckles, E. L., X. Wang, M. C. Lane, C. V. Lockatell, D. E. Johnson, 3. Wright, K. J., and S. J. Hultgren. 2006. Sticky fibers and uropathogenesis: D. A. Rasko, H. L. Mobley, and M. S. Donnenberg. 2009. Role of the K2 capsule bacterial adhesins in the urinary tract. Future Microbiol. 1: 75–87. in Escherichia coli urinary tract infection and serum resistance. J. Infect. Dis. 4. Sivick, K. E., and H. L. Mobley. 2010. Waging war against uropathogenic 199: 1689–1697. Escherichia coli: winning back the urinary tract. Infect. Immun. 78: 568–585. 29. Bahrani-Mougeot, F. K., E. L. Buckles, C. V. Lockatell, J. R. Hebel, D. E. Johnson, 5. Klemm, P., and M. A. Schembri. 2000. Bacterial adhesins: function and struc- C. M. Tang, and M. S. Donnenberg. 2002. Type 1 fimbriae and extracellular ture. Int. J. Med. Microbiol. 290: 27–35. polysaccharides are preeminent uropathogenic Escherichia coli virulence 6. Billips, B. K., S. G. Forrestal, M. T. Rycyk, J. R. Johnson, D. J. Klumpp, and determinants in the murine urinary tract. Mol. Microbiol. 45: 1079–1093. A. J. Schaeffer. 2007. Modulation of host innate immune response in the bladder 30. Bertani, G. 2004. Lysogeny at mid-twentieth century: P1, P2, and other exper- by uropathogenic Escherichia coli. Infect. Immun. 75: 5353–5360. imental systems. J. Bacteriol. 186: 595–600. 7. Svanborg, C., G. Bergsten, H. Fischer, G. Godaly, M. Gustafsson, D. Karpman, 31. Pfaffl, M. W., G. W. Horgan, and L. Dempfle. 2002. Relative expression software A. C. Lundstedt, B. Ragnarsdottir, M. Svensson, and B. Wullt. 2006. Uropa- tool (REST) for group-wise comparison and statistical analysis of relative ex- thogenic Escherichia coli as a model of host-parasite interaction. Curr. Opin. pression results in real-time PCR. Nucleic Acids Res. 30: e36. Microbiol. 9: 33–39. 32. Duell, B. L., A. W. Cripps, M. A. Schembri, and G. C. Ulett. 2011. Epithelial cell 8. Mabbett, A. N., G. C. Ulett, R. E. Watts, J. J. Tree, M. Totsika, C. L. Ong, coculture models for studying infectious diseases: benefits and limitations. J. J. M. Wood, W. Monaghan, D. F. Looke, G. R. Nimmo, et al. 2009. Virulence Biomed. Biotechnol. 2011: 852419. properties of asymptomatic bacteriuria Escherichia coli. Int. J. Med. Microbiol. 33. Ulett, G. C., K. H. Maclean, S. Nekkalapu, J. L. Cleveland, and E. E. Adderson. 299: 53–63. 2005. Mechanisms of group B streptococcal-induced apoptosis of murine mac- 9. Sheu, J. N., M. C. Chen, K. H. Lue, S. L. Cheng, I. C. Lee, S. M. Chen, and rophages. J. Immunol. 175: 2555–2562. G. J. Tsay. 2006. Serum and urine levels of interleukin-6 and interleukin-8 in 34. Ulett, G. C., and E. E. Adderson. 2005. Nitric oxide is a key determinant of group B streptococcus-induced murine macrophage apoptosis. J. Infect. Dis. children with acute pyelonephritis. Cytokine 36: 276–282. 191: 1761–1770. 10. Oregioni, O., P. Delaunay, P. Bruna, A. Gaudart, E. Lemichez, P. Boquet, and 35. Ulett, G. C., J. F. Bohnsack, J. Armstrong, and E. E. Adderson. 2003. Beta- L. Landraud. 2005. Urinary interleukin-8 is elevated in urinary tract infections hemolysin-independent induction of apoptosis of macrophages infected with independently of the causative germs. Cytokine 31: 415–418. serotype III group B streptococcus. J. Infect. Dis. 188: 1049–1053. 11. Otto, G., J. Braconier, A. Andreasson, and C. Svanborg. 1999. Interleukin-6 and 36. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal disease severity in patients with bacteremic and nonbacteremic febrile urinary genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA tract infection. J. Infect. Dis. 179: 172–179. 97: 6640–6645. 12. Candela, J. V., E. Park, J. M. Gerspach, R. Davidoff, L. Stout, S. M. Levy, 37. Bolstad, B. M., R. A. Irizarry, M. Astrand, and T. P. Speed. 2003. A comparison G. E. Leach, G. C. Bellman, and P. M. Lad. 1998. Evaluation of urinary IL- of normalization methods for high density oligonucleotide array data based on 1alpha and IL-1beta in gravid females and patients with bacterial cystitis and variance and bias. Bioinformatics 19: 185–193. microscopic hematuria. Urol. Res. 26: 175–180. 38. Irizarry, R. A., B. Hobbs, F. Collin, Y. D. Beazer-Barclay, K. J. Antonellis, 13. Ulett, G. C., R. I. Webb, K. B. Ulett, X. Cui, W. H. Benjamin, M. Crowley, and U. Scherf, and T. P. Speed. 2003. Exploration, normalization, and summaries of M. A. Schembri. 2010. Group B Streptococcus (GBS) urinary tract infection high density oligonucleotide array probe level data. Biostatistics 4: 249–264. 792 EARLY BLADDER TRANSCRIPTOME OF UPEC UTI AND IL-10

39. Wu, W., G. Churchill, M. K. Kerr, and X. Cui. 2003. Analysis of N-dye induced by uropathogenic E. coli between two kinds of urinary tract epithelial microarray experiments using mixed model effects containing analysis of vari- cells. J. Biomed. Sci. 16: 91. ance, permutation and bootstrap, cluster and consensus tree. Available at: http:// 64. O’Garra, A., P. L. Vieira, P. Vieira, and A. E. Goldfeld. 2004. IL-10-producing www.bioconductor.org/packages/bioc/1.8/html/maanova.html. Accessed: and naturally occurring CD4+ Tregs: limiting collateral damage. J. Clin. Invest. 40. Cui, X., J. T. Hwang, J. Qiu, N. J. Blades, and G. A. Churchill. 2005. Improved 114: 1372–1378. statistical tests for differential gene expression by shrinking variance compo- 65. Smith, S. D., M. A. Wheeler, M. I. Lorber, and R. M. Weiss. 2000. Temporal nents estimates. Biostatistics 6: 59–75. changes of cytokines and nitric oxide products in urine from renal transplant 41. Yang, H., and G. Churchill. 2007. Estimating p-values in small microarray patients. Kidney Int. 58: 829–837. experiments. Bioinformatics 23: 38–43. 66. Jarry, A., C. Bossard, C. Bou-Hanna, D. Masson, E. Espaze, M. G. Denis, and 42. Benjamini, Y., and Y. Hochberg. 1995. Controlling the false discovery rate: C. L. Laboisse. 2008. Mucosal IL-10 and TGF-beta play crucial roles in pre- a practical and powerful approach to multiple testing. J. Roy. Statist. Soc. Ser. B venting LPS-driven, IFN-gamma-mediated epithelial damage in human colon 57: 289–300. explants. J. Clin. Invest. 118: 1132–1142. 43. Barry, W. T., A. B. Nobel, and F. A. Wright. 2005. Significance analysis of 67. Mege, J. L., S. Meghari, A. Honstettre, C. Capo, and D. Raoult. 2006. The two functional categories in gene expression studies: a structured permutation ap- faces of interleukin 10 in human infectious diseases. Lancet Infect. Dis. 6: 557– proach. Bioinformatics 21: 1943–1949. 569. 44. Yekutieli, D., and Y. Benjamini. 1999. Resampling-based false discovery rate 68. Turner, J., M. Gonzalez-Juarrero, D. L. Ellis, R. J. Basaraba, A. Kipnis, controlling multiple test procedures for correlated test statistics. J. Statist. Plann. I. M. Orme, and A. M. Cooper. 2002. In vivo IL-10 production reactivates Inference 82: 171–196. chronic pulmonary tuberculosis in C57BL/6 mice. J. Immunol. 169: 6343–6351. 45. Lynn, D. J., G. L. Winsor, C. Chan, N. Richard, M. R. Laird, A. Barsky, 69. Sivan, Y., B. Griffel, O. Medalia, and M. Aronson. 1982. Comparative histology J. L. Gardy, F. M. Roche, T. H. Chan, N. Shah, et al. 2008. InnateDB: facilitating of the mouse bladder following initial infection and re-infection with Escher- systems-level analyses of the mammalian innate immune response. Mol. Syst. ichia coli. J. Pathol. 138: 353–364. Biol. 4: 218. 70. Kaoutzani, P., S. P. Colgan, K. L. Cepek, P. G. Burkard, S. Carlson, C. Delp- 46. Ingersoll, M. A., K. A. Kline, H. V. Nielsen, and S. J. Hultgren. 2008. G-CSF induction early in uropathogenic Escherichia coli infection of the urinary tract Archer, M. B. Brenner, and J. L. Madara. 1994. Reconstitution of cultured in- modulates host immunity. Cell. Microbiol. 10: 2568–2578. testinal epithelial monolayers with a mucosal-derived T lymphocyte cell line: 47. Sivick, K. E., M. A. Schaller, S. N. Smith, and H. L. Mobley. 2010. The innate modulation of epithelial phenotype dependent on lymphocyte-basolateral mem- immune response to uropathogenic Escherichia coli involves IL-17A in a murine brane apposition. J. Clin. Invest. 94: 788–796. Downloaded from model of urinary tract infection. J. Immunol. 184: 2065–2075. 71. McKay, D. M., K. Croitoru, and M. H. Perdue. 1996. T cell-monocyte inter- 48. Carbone, M., D. L. Hasty, K. C. Yi, J. Rue, M. T. Fera, F. La Torre, M. Giannone, actions regulate epithelial physiology in a coculture model of inflammation. Am. and E. Losi. 2002. Cytokine induction in murine bladder tissue by type 1 fim- J. Physiol. 270: C418–C428. briated Escherichia coli. Ann. N. Y. Acad. Sci. 963: 332–335. 72. Tuettenberg, A., S. Fondel, K. Steinbrink, A. H. Enk, and H. Jonuleit. 2010. 49. Hannan, T. J., I. U. Mysorekar, C. S. Hung, M. L. Isaacson-Schmid, and CD40 signalling induces IL-10-producing, tolerogenic dendritic cells. Exp. Der- S. J. Hultgren. 2010. Early severe inflammatory responses to uropathogenic E. matol. 19: 44–53. coli predispose to chronic and recurrent urinary tract infection. PLoS Pathogens 73. Louis, N. A., D. Daniels, and S. P. Colgan. 2006. Cell-cell interactions on solid

DOI:10.1371/journal.ppat.1001042. matrices. Methods Mol. Biol. 341: 51–59. http://www.jimmunol.org/ 50. Mysorekar, I. U., M. A. Mulvey, S. J. Hultgren, and J. I. Gordon. 2002. Mo- 74. Blume, E. D., C. T. Taylor, P. F. Lennon, G. L. Stahl, and S. P. Colgan. 1998. lecular regulation of urothelial renewal and host defenses during infection with Activated endothelial cells elicit paracrine induction of epithelial chloride se- uropathogenic Escherichia coli. J. Biol. Chem. 277: 7412–7419. cretion: 6-Keto-PGF1alpha is an epithelial secretagogue. J. Clin. Invest. 102: 51. Anderson, G. G., J. J. Palermo, J. D. Schilling, R. Roth, J. Heuser, and 1161–1172. S. J. Hultgren. 2003. Intracellular bacterial bioﬁlm-like pods in urinary tract 75. Roncarolo, M. G., S. Gregori, M. Battaglia, R. Bacchetta, K. Fleischhauer, and infections. Science 301: 105–107. M. K. Levings. 2006. Interleukin-10-secreting type 1 regulatory T cells in ro- 52. Justice, S. S., D. A. Hunstad, P. C. Seed, and S. J. Hultgren. 2006. Filamentation dents and humans. Immunol. Rev. 212: 28–50. by Escherichia coli subverts innate defenses during urinary tract infection. Proc. 76. Madura Larsen, J., C. S. Benn, Y. Fillie, D. van der Kleij, P. Aaby, and Natl. Acad. Sci. USA 103: 19884–19889. M. Yazdanbakhsh. 2007. BCG stimulated dendritic cells induce an interleukin- 53. Jones-Carson, J., E. Balish, and D. T. Uehling. 1999. Susceptibility of immu- 10 producing T-cell population with no T helper 1 or T helper 2 bias in vitro. nodeﬁcient gene-knockout mice to urinary tract infection. J. Urol. 161: 338–341. Immunology 121: 276–282.

54. Couper, K. N., D. G. Blount, and E. M. Riley. 2008. IL-10: the master regulator 77. Kullberg, M. C., D. Jankovic, P. L. Gorelick, P. Caspar, J. J. Letterio, by guest on October 1, 2021 of immunity to infection. J. Immunol. 180: 5771–5777. A. W. Cheever, and A. Sher. 2002. Bacteria-triggered CD4(+) T regulatory cells 55. Fischer, H., N. Lutay, B. Ragnarsdo´ttir, M. Yadav, K. Jo¨nsson, A. Urbano, A. Al suppress Helicobacter hepaticus-induced colitis. J. Exp. Med. 196: 505–515. Hadad, S. Ra¨misch, P. Storm, U. Dobrindt, et al. 2010. Pathogen specific, IRF3- 78. Ulett, G. C., N. Ketheesan, and R. G. Hirst. 1998. Macrophage-lymphocyte dependent signaling and innate resistance to human kidney infection. PLoS interactions mediate anti-Burkholderia pseudomallei activity. FEMS Immunol. Pathogens DOI:10.1371/journal.ppat.1001109. Med. Microbiol. 21: 283–286. 56. Dessing, M. C., L. M. Butter, G. J. Teske, N. Claessen, C. M. van der Loos, 79. Chanteux, H., A. C. Guisset, C. Pilette, and Y. Sibille. 2007. LPS induces T. Vogl, J. Roth, T. van der Poll, S. Florquin, and J. C. Leemans. 2010. S100A8/ IL-10 production by human alveolar macrophages via MAPKinases- and Sp1- PLoS A9 is not involved in host defense against murine urinary tract infection. dependent mechanisms. Respir. Res. 8: 71. One 5: e13394. 80. Price, J. D., J. Schaumburg, C. Sandin, J. P. Atkinson, G. Lindahl, and C. Kemper. 57. Reigstad, C. S., S. J. Hultgren, and J. I. Gordon. 2007. Functional genomic 2005. Induction of a regulatory phenotype in human CD4+ T cells by strepto- studies of uropathogenic Escherichia coli and host urothelial cells when intra- coccal M protein. J. Immunol. 175: 677–684. cellular bacterial communities are assembled. J. Biol. Chem. 282: 21259–21267. 81. Pengal, R. A., L. P. Ganesan, G. Wei, H. Fang, M. C. Ostrowski, and 58. Godaly, G., G. Bergsten, L. Hang, H. Fischer, B. Frendeús, A. C. Lundstedt, S. Tridandapani. 2006. Lipopolysaccharide-induced production of interleukin-10 M. Samuelsson, P. Samuelsson, and C. Svanborg. 2001. Neutrophil recruitment, chemokine receptors, and resistance to mucosal infection. J. Leukoc. Biol. 69: is promoted by the serine/threonine kinase Akt. Mol. Immunol. 43: 1557–1564. 899–906. 82. Fujita, S., K. Seino, K. Sato, Y. Sato, K. Eizumi, N. Yamashita, M. Taniguchi, 59. Garcia, E. C., A. R. Brumbaugh, and H. L. Mobley. 2011. Redundancy and and K. Sato. 2006. Regulatory dendritic cells act as regulators of acute lethal specificity of Escherichia coli iron acquisition systems during urinary tract in- systemic inflammatory response. Blood 107: 3656–3664. fection. Infect. Immun. 79: 1225–1235. 83. Akira, S., S. Uematsu, and O. Takeuchi. 2006. Pathogen recognition and innate 60. Hagan, E. C., and H. L. Mobley. 2009. Haem acquisition is facilitated by a novel immunity. Cell 124: 783–801. receptor Hma and required by uropathogenic Escherichia coli for kidney in- 84. Pils, M. C., F. Pisano, N. Fasnacht, J. M. Heinrich, L. Groebe, A. Schippers, fection. Mol. Microbiol. 71: 79–91. B. Rozell, R. S. Jack, and W. Mu¨ller. 2010. Monocytes/macrophages and/or 61. Watts, R. E., M. Totsika, V. L. Challinor, A. N. Mabbett, G. C. Ulett, J. J. De neutrophils are the target of IL-10 in the LPS endotoxemia model. Eur. J. Voss, and M. A. Schembri. 2011. Contribution of siderophore systems to growth Immunol. 40: 443–448. and urinary tract colonization of asymptomatic bacteriuria Escherichia coli. 85. Elbim, C., H. Reglier, M. Fay, C. Delarche, V. Andrieu, J. El Benna, and Infect. Immun. In press. M. A. Gougerot-Pocidalo. 2001. Intracellular pool of IL-10 receptors in specific 62. Godaly, G., G. Otto, M. D. Burdick, R. M. Strieter, and C. Svanborg. 2007. granules of human neutrophils: differential mobilization by proinflammatory Fimbrial lectins influence the chemokine repertoire in the urinary tract mucosa. mediators. J. Immunol. 166: 5201–5207. Kidney Int. 71: 778–786. 86. Tamassia, N., F. Calzetti, N. Menestrina, M. Rossato, F. Bazzoni, L. Gottin, and 63. Tsai, K. W., H. T. Lai, T. C. Tsai, Y. C. Wu, Y. T. Yang, K. Y. Chen, C. M. Chen, M. A. Cassatella. 2008. Circulating neutrophils of septic patients constitutively Y. S. Li, and C. N. Chen. 2009. Difference in the regulation of IL-8 expression express IL-10R1 and are promptly responsive to IL-10. Int. Immunol. 20: 535–541. Supplemental Legend

Supplemental Figure S1: Early gene expression profiles in bladder of C57BL/6 mice triggered by UPEC and comparative analysis with CBA mice. The transcriptome of early UPEC UTI in C57BL/6 mice comprises 1564 genes from diverse functional groups including IL-family members and receptors, cytokines, and regulators of innate immunity. Expression changes are illustrated by a heat map of signal intensities in infected (UPEC- 2) and control (CRL-2) groups (n=5) in (A). Volcano plots in (B) illustrate significant genes identified by shrinkage t-test [-log10(Pvalue)] (y-axis) and expression ratio (Log2 Fold Change infected / control) (x-axis) where red stars represent genes at FDR<0.05 and vertical lines denote a 2-fold difference in expression between groups. The equivalent transcriptome in CBA mice is represented in the volcano plot in (C). Comparison of the top 284 differentially-expressed genes in C57BL/6 mice with the same genes in CBA mice in heat maps in (D) shows groups of genes with similar expression patterns and areas of uniqueness. A scatterplot in (E) illustrates the large number of conserved gene responses between the two mouse strains overall, where individual genes that displayed highly regulated activities in response to UPEC exhibited comparable responses between the two mouse strains (red dots). Gene responses unique to CBA mice (white dots) or C57BL/6 mice (black dots) are also shown.

Supplemental Table I: Primer sequences used in qRT-PCR.

Supplemental Table II: Global gene expression triggered by UPEC in the bladder of C57BL/6 (B6) (upper) and CBA mice (lower) at 2h after transurethral challenge illustrating diverse changes in gene expression in the whole bladder transcriptome of UPEC cystitis. Raw data are deposited in MIAME format under record GSE26509 (C57BL/6) and GSE33210 (CBA) on the Gene Expression Omnibus.

Supplemental Table III: Innate transcriptional networks and biological pathways triggered by UPEC in bladder as identified using Genes Ontology (GO; A), innateDB systems-level analysis (B), and Ingenuity Pathway Analysis (C) showing the top hits in highly relevant responses in C57BL/6 mice. Conserved pathways between C57BL/6 and CBA mice as identified by GO and Kyoto Encyclopedia of Genes and Genomes are highlighted in (D). Figure 1S

A CRL C57BL/6 (B6)CBA expression inB6(FDR<0.001) Top 284geneswithaltered D UPEC-2 CRL CRL UPEC-2 CRL UPEC-2 CRL UPEC-2 UPEC UPEC UPEC-2

UPEC CRL-2 UPEC UPEC CRL-2 10408379 10407985 10571865 10497356 10600698 10601456 10589884 10442098 10342108 10381695 10343655 10525553 10361265 10385912 10349603 10435497 10563712 10451646 10351667 10566350 10372094 10390075 10450069 10548375 10373358 10500656 10537787 10437243 10445977 10445767 10533213 10563715 10523120 10424683 10599008 10548385 10429856 10437224 10598004 10445753 10534927 10373912 10579636 10534395 10398665 10449284 10340721 10369615 10427035 10400405 10449741 10443527 10561453 10350516 10583519 10550906 10458340 10364950 10458382 10379518 10376060 10597758 10439936 10384458 10384725 10361091 10379630 10444890 10588577 10536794 10429491 10561204 10545921 10516266 10492997 10353899 10566132 10452633 10383152 10509965 10443463 10351182 10357875 10342554 10501608 10586240 10503334 10463599 10450325 10387372 10520452 10493831 10523156 10499861 10541614 10416837 10347291 10436100 10462623 10538791 10379636 10563597 10508074 10373918 10487597 10389231 10368144 10531415 10523151 10365286 10498024 10345752 10487238 10492448 10432236 10481627 10472050 10351206 10379511 10448117 10487588 10583100 10469786 10445746 10547664 10376513 10448124 10399710 10396840 10523138 10533720 10446229 10392845 10379633 10569877 10551891 10379721 10349968 10433101 10545930 10404152 10345824 10435704 10521667 10573790 10362129 10472538 10584841 10498367 10425053 10402800 10385518 10582322 10557591 10376324 10500710 10456904 10567580 10489463 10347888 10368970 10380999 10450501 10569020 10598093 10353844 10562720 10429128 10583669 10593050 10475782 10512354 10412123 10459288 10474181 10569011 10559467 10477250 10405216 10573939 10512030 10349744 10531994 10462390 10375145 10508734 10576115 10482802 10508772 10524631 10595633 10338068 10338361 10434224 10341378 10537911 10411508 10345404 10343543 10338160 10341646 10344218 10338223 10476668 10391221 10472916 10512847 10428857 10438313 10404612 10470283 10588454 10394534 10434925 10588731 10562260 10476301 10406817 10364262 10512352 10587792 10383502 10372781 10586242 10586227 10556297 10515399 10561516 10383196 10478633 10580183 10481634 10397346 10387890 10450374 10385941 10560575 10580139 10357472 10434778 10389207 10532744 10430372 10397351 10529732 10490632 10577025 10509218 10393544 10543524 10581151 10516966 10534202 10542981 10357604 10396831 10400844 10371846 10351197 10586248 10496539 10539739 10550509 10481164 10504203 10547641 10445412 10461558 10562709 10597279 10498992 10590801 10398121 10563338 10448034 10516064 10367919 10360406 10457225 10586244 10586246 10495967 10469816 10356082 CRL-2 CRL-2 CRL2 CRL-2 CRL2 CRL2

CRL2 B CRL2 UPEC2 UPEC2 UPEC2 UPEC2 UPEC2 10588454 10357875 10340721 10492997 10444890 10372781 10376060 10503334 10396831 10515399 10342554 10512847 10586240 10387372 10343543 10385518 10531994 10567580 10439936 10477250 10406817 10385941 10367919 10529732 10476301 10345752 10556297 10597758 10508734 10532744 10490632 10577025 10559467 10364262 10429491 10397346 10438313 10537911 10588731 10586246 10586242 10397351 10573939 10411508 10509218 10400844 10428857 10393544 10470283 10353899 10472916 10391221 10516064 10364950 10387890 10463599 10450325 10389207 10509965 10478633 10383502 10476668 10586227 10404612 10383152 10588577 10545921 10458340 10550906 10443527 10430372 10562260 10542981 10562709 10384725 10351182 10408379 10407985 10342108 10385912 10571865 10349603 10497356 10600698 10351667 10601456 10442098 10548385 10566350 10583100 10563712 10437224 10589884 10435497 10376513 10424683 10451646 10500656 10512354 10450069 10373358 10537787 10504203 10365286 10545930 10392845 10584841 10533213 10437243 10372094 10429856 10598004 10492448 10445753 10523138 10448124 10390075 10379721 10345824 10579636 10569877 10520452 10493831 10563715 10379633 10541614 10599008 10523120 10445746 10487588 10469786 10547664 10347291 10523156 10563597 10538791 10508074 10347888 10499861 10436100 10416837 10379636 10338223 10381695 10525553 10341378 10338068 10475782 10573790 10461558 10569020 10450501 10508772 10404152 10576115 10445977 10521667 10500710 10593050 10548375 10373912 10349968 10433101 10373918 10446229 10445767 10380999 10362129 10551891 10482802 10557591 10396840 10361265 10345404 10343655 10434224 10561204 10586248 10580139 10534202 10472050 10448117 10487238 10524631 10376324 10597279 10498024 10536794 10448034 10462390 10456904 10560575 10563338 10586244 10383196 10429128 10412123 10353844 10598093 10432236 10539739 10595633 10562720 10445412 10582322 10435704 10583669 10425053 10581151 10512030 10371846 10498367 10357472 10459288 10580183 10543524 10405216 10349744 10474181 10472538 10368970 10495967 10547641 10481634 10489463 10569011 10512352 10402800 10534395 10369615 10566132 10452633 10344218 10341646 10449741 10394534 10443463 10398665 10360406 10449284 10487597 10389231 10462623 10531415 10379511 10379518 10384458 10587792 10481627 10583519 10458382 10351206 10434778 10469816 10356082 10450374 10379630 10590801 10516266 10399710 10498992 10357604 10457225 10516966 10534927 10375145 10523151 10368144 10351197 10398121 10496539 10533720 10550509 10481164 10361091 10427035 10501608 10350516 10400405 10561516 10561453 10338361 10338160 10434925 E C Table Is - Primer sequences used in qRT-PCR.

Target Gene Sequence 5' >>> 3' Direction

Mouse: IL-1 GAAGAGACCATCCAACCCAGAT Sense CTGCCTGACGAGCTTCATCA Antisense IL-1 CCAAAAGATGAAGGGCTGCTT Sense TGCTGCTGCGAGATTTGAAG Antisense IL-6 TGGGACTGATGCTGGTGACA Sense TGGGAGTGGTATCCTCTGTGAA Antisense IL-10 GGGTTGCCAAGCCTTATCG Sense ATTTCTGGGCCATGCTTCTCT Antisense IL-10ra CTTCAGTTCTCAGGACGCCGC Sense TGGGAGCAAACGCGACAACA Antisense IL-10rb GGGTGGCTTCCTTCTGGTGC Sense GGAAAGCAGGTACCTCCCACTGTAG Antisense TNF- CAGCCGATGGGTTGTACCTT Sense TGTGGGTGAGGAGCACGTAGT Antisense CCL2 GCAGAGAGCCAGACGGGAGG Sense GGGACCTGCATGGTGGTGGA Antisense CXCL5 TCCTGCCTGAAGGAAGAGAGAGAAC Sense GATATGCTGGAGGAGGTGTGGAGA Antisense CXCL9 GACATTCTCGGACTTCACTCCAACA Sense CACTGCTCCAGGAAGATGATGCC Antisense MSR1 AGGCTCTGCCCTCATGAACAAGA Sense GCCATTTTTAGTGCTGTGAGGAAGG Antisense IFNGr1 GCTTGCGGACTTGGCGACTAG Sense CGCGAGGGACACCTCTGACA Antisense -actin AGGCCCAGAGCAAGAGAGGTA Sense TCTCCATGTCGTCCCAGTTG Antisense GAPDH TGTGTCCGTCGTGGATCTGA Sense GATGCCTGCTTCACCACCTT Antisense Human: IL-10 CCTGGAGGAGGTGATGCCCCAA Sense ATCGATGACAGCGCCGTAGCCTC Antisense GAPDH GTCGCCAGCCGAGCCACATC Sense CCAGGCGCCCAATACGACCA Antisense

Table IIs - Global gene expression triggered by UPEC in the bladder of C57BL/6 (B6)

(upper) and CBA mice (lower) at 2h after transurethral challenge illustrating diverse changes in gene expression in the whole bladder transcriptome of UPEC cystitis. Raw data are deposited in MIAME format under record GSE26509 (C57BL/6) and

GSE33210 (CBA) on the Gene Expression Omnibus.

ΔFold B6 Gene Assignmenta Gene Nameb FDRc UPEC 1 NM_021274 Cxcl10 38.262 0.000 2 AK040949 Lincr 3.978 0.002 3 NM_009397 Tnfaip3 25.061 0.002 4 NM_145827 Nlrp3 13.485 0.002 5 NM_181596 Retnlg 19.356 0.002 6 NM_013693 Tnf 6.229 0.002 7 NM_153511 Il1f9 39.447 0.002 8 NM_013650 S100a8 50.439 0.002 9 NM_009114 S100a9 49.710 0.002 10 NM_008176 Cxcl1 22.151 0.002 11 NM_009140 Cxcl2 66.722 0.002 12 NM_030720 Gpr84 6.997 0.004 13 NM_008611 Mmp8 22.401 0.004 14 NM_010907 Nfkbia 6.986 0.005 15 NM_030612 Nfkbiz 8.284 0.005 16 NM_007782 Csf3r 12.282 0.005 17 N.C.A. - 26.882 0.005 18 NM_017466 Ccrl2 9.595 0.005 19 NM_021406 Trem1 20.980 0.005 20 NM_153159 Zc3h12a 5.676 0.005 21 NM_010555 Il1r2 10.283 0.005 22 GENSCAN0360855 Unknown 14.348 0.005 23 NM_016960 Ccl20 4.133 0.005 24 NM_011346 Sell 5.386 0.005 25 NM_007570 Btg2 4.904 0.005 26 NM_007548 Prdm1 4.694 0.005 27 NM_001013365 Osm 4.407 0.005 28 NM_008501 Lif 8.435 0.005 29 NM_008390 Irf1 5.907 0.005 30 NM_011333 Ccl2 15.844 0.005 31 NM_011407 Slfn1 4.958 0.005 32 NM_011410 Slfn4 11.149 0.005 33 NM_013652 Ccl4 5.890 0.005

34 NM_009971 Csf3 5.047 0.005 35 NM_021327 Tnip1 3.761 0.005 36 NM_001017426 Jmjd3 3.880 0.005 37 NM_023158 Cxcl16 3.186 0.005 38 NM_011337 Ccl3 27.900 0.005 39 ENSMUST051264 Cd300lf 5.666 0.005 40 NM_009705 Arg2 3.224 0.005 41 NM_010234 Fos 4.893 0.005 42 NM_009396 Tnfaip2 2.894 0.005 43 NM_029679 6330500D04Rik 3.291 0.005 44 L38281 Irg1 19.196 0.005 45 NM_010444 Nr4a1 4.787 0.005 46 NM_001029841 Sla 2.858 0.005 47 ENSMUSG075583 Gm10872 4.681 0.005 48 NM_009008 Rac2 2.630 0.005 49 NM_172612 Rnd1 12.869 0.005 50 NM_001082545 Stfa2 5.445 0.005 51 NR_003508 Mx2 6.259 0.005 52 NM_008690 Nfkbie 4.916 0.005 53 NM_021407 Trem3 2.901 0.005 54 NM_015766 Ebi3 2.138 0.005 55 NM_009404 Tnfsf9 5.556 0.005 56 NM_007865 Dll1 4.874 0.005 57 NM_008215 Has1 15.067 0.005 58 NM_013521 Fpr1 14.954 0.005 59 NM_013642 Dusp1 4.349 0.005 60 NM_008198 Cfb 3.909 0.005 61 NM_009841 Cd14 9.660 0.005 62 NM_023044 Slc15a3 4.812 0.005 63 NM_019408 Nfkb2 3.626 0.005 64 NM_031167 Il1rn 4.595 0.005 65 NM_010090 Dusp2 3.380 0.005 66 NM_013599 Mmp9 3.370 0.005 67 NM_172659 Slc2a6 4.047 0.005 68 NM_008491 Lcn2 13.460 0.005 69 NM_146118 Slc25a25 3.511 0.005 70 NM_008230 Hdc 10.938 0.005 71 NM_010554 Il1a 13.940 0.005 72 NM_008361 Il1b 46.888 0.005 73 NM_011414 Slpi 3.132 0.005 74 NM_183162 BC006779 2.790 0.005 75 NM_153564 Gbp5 6.675 0.005 76 NM_011905 Tlr2 6.911 0.005 77 BC037703 BC037703 3.079 0.005 78 NM_013807 Plk3 3.179 0.005 79 NM_029662 Mfsd2 4.877 0.005

80 NM_001033308 BC013712 2.692 0.005 81 NM_031168 Il6 46.199 0.005 82 NM_203320 Cxcl3 9.068 0.005 83 NM_010474 Hs3st1 3.726 0.005 84 NM_030701 Gpr109a 7.740 0.005 85 AK149668 Ncf1 3.038 0.005 86 NM_153510 Pilra 3.267 0.005 87 NM_001001495 Tnip3 11.029 0.005 88 NM_026414 Asprv1 4.135 0.005 89 NM_010819 Clec4d 14.114 0.005 90 NM_010751 Mxd1 4.354 0.005 91 AK157959 Unknown 3.381 0.005 92 NM_011401 Slc2a3 3.286 0.005 93 NM_009402 Pglyrp1 5.095 0.005 94 NM_172142 AY078069 4.410 0.005 95 NM_009627 Adm 3.778 0.005 96 NM_011756 Zfp36 4.712 0.005 97 NM_010908 Nfkbib 2.992 0.005 98 ENSMUST039861 Cd33 7.291 0.005 99 NM_031181 Siglece 3.466 0.005 100 NM_008654 Myd116 5.018 0.005 101 NM_011315 Saa3 8.541 0.005 102 NM_026985 1810033B17Rik 7.341 0.005 103 NM_024444 Cyp4f18 3.647 0.005 104 NM_013914 Snai3 3.331 0.005 105 NM_010493 Icam1 5.348 0.005 106 ENSMUSG053641 Unknown 3.194 0.005 107 NM_007464 Birc3 5.788 0.005 108 NM_153287 Axud1 6.511 0.005 109 NM_177363 Tarm1 3.447 0.005 110 NM_145977 Slc45a3 2.219 0.005 111 NM_007695 Chi3l1 4.388 0.005 112 NM_011198 Ptgs2 9.243 0.005 113 NM_011345 Sele 6.144 0.005 114 NM_011347 Selp 8.797 0.005 115 NM_011636 Plscr1 3.702 0.005 116 NM_019777 Ikbke 2.814 0.005 117 NM_007498 Atf3 4.673 0.005 118 NM_008655 Gadd45b 6.960 0.005 119 NM_029075.1 Stx11 4.363 0.005 120 NM_010999 Olfr56 2.048 0.005 121 NM_011408 Slfn2 4.172 0.005 122 NM_009044 Rel 5.791 0.005 123 NM_013653 Ccl5 3.436 0.005 124 NM_021384 Rsad2 6.398 0.005 125 NM_008039 Fpr-rs2 2.698 0.005

126 NM_010831 Snf1lk 2.373 0.005 127 NM_007913 Egr1 4.146 0.005 128 NM_010415 Hbegf 7.134 0.005 129 NM_008987 Ptx3 10.788 0.005 130 NM_001083318 Etv3 2.668 0.005 131 NM_145133 T2bp 4.195 0.005 132 NM_198405 Sirpb1 3.738 0.005 133 NM_028808 P2ry13 2.586 0.005 134 XM_001479346 Igsf2 2.846 0.005 135 NM_010208 Fgr 3.128 0.005 136 NM_019998 Alg2 0.547 0.005 137 NM_009903 Cldn4 2.057 0.005 138 NM_023516 2310016C08Rik 4.820 0.005 139 ENSMUST057218 Gmfg 2.835 0.005 140 XM_001480292 LOC100048461 2.915 0.005 141 NM_011113 Plaur 6.213 0.005 142 NM_008400 Itgal 2.869 0.005 143 NM_009046 Relb 3.281 0.005 144 NM_181593 Itpkc 4.769 0.005 145 NM_027898 Gramd1a 2.288 0.005 146 NM_145834 Il17c 3.807 0.005 147 NM_011227 Rab20 2.689 0.005 148 ENSMUST076326 AB124611 2.505 0.005 149 NM_008348 Il10ra 2.996 0.005 150 NM_007536 Bcl2a1d 4.124 0.005 151 NM_013730 Slamf1 4.000 0.005 152 NM_011859 Osr1 0.465 0.005 153 NM_030017 Rdh12 5.459 0.005 154 NM_023386 Rtp4 2.828 0.005 155 ENSMUST099816 Cd80 3.117 0.005 156 NM_010407 Hck 2.296 0.005 157 NM_009151 Selplg 3.110 0.005 158 NM_172503 Zswim4 3.205 0.005 159 X70920 Ly-6G.1 4.454 0.005 160 NM_011636 Plscr1 2.773 0.005 161 NM_018790 Arc 4.728 0.005 162 NM_007669 Cdkn1a 2.895 0.005 163 NM_008842 Pim1 3.559 0.005 164 NM_133662 Ier3 5.486 0.005 165 NM_007420 Adrb2 2.097 0.005 166 NM_021893 Cd274 3.667 0.005 167 NM_010553 Il18rap 3.682 0.005 168 NM_009911 Cxcr4 3.742 0.005 169 MI0000248 Unknown 0.311 0.005 170 NM_138301 Trpm2 2.283 0.005 171 NM_001042558 Apaf1 2.267 0.005

172 N.C.A. - 2.099 0.005 173 NM_010696 Lcp2 3.104 0.005 174 NM_013654 Ccl7 8.476 0.005 175 XM_001477846 LOC672511 2.572 0.005 176 NM_001038010 Gcn5l2 0.640 0.005 177 NM_011518 Syk 2.216 0.005 178 NM_181754 Gpr141 1.735 0.005 179 NM_181860 Gt4-1 0.658 0.005 180 NM_145389 BC016579 2.825 0.005 181 NM_009372 Tgif1 2.056 0.005 182 ENSMUST091817 Pstpip2 2.768 0.005 183 NM_007746 Map3k8 3.852 0.005 184 NM_008331 Ifit1 9.876 0.005 185 NM_198724 Egfl7 0.588 0.005 186 NM_177139 Lypd6 0.557 0.005 187 ENSMUST065927 Tnfaip6 9.021 0.005 188 NM_009740 Bcl10 2.081 0.005 189 NM_011693 Vcam1 3.714 0.005 190 NM_001081211 Ptafr 2.867 0.005 191 NM_001081343 3110043O21Rik 2.329 0.005 192 ENSMUSG073880 4930466F19Rik 2.745 0.005 193 NM_010591 Jun 2.180 0.005 194 NM_145209 Oasl1 3.499 0.005 195 NM_008886 Pms2 0.639 0.005 196 NM_028900 Gcc1 2.065 0.005 197 NM_138648 Olr1 5.168 0.005 198 NM_008848 Pira6 2.573 0.005 199 NM_032541 Hamp1 2.939 0.005 200 NM_153101 Mrgpra2 4.703 0.005 201 NM_053088 Ifitm5 2.241 0.005 202 NM_173014 Aytl1 1.943 0.005 203 NM_010499 Ier2 3.700 0.005 204 NM_019662 Rrad 2.752 0.005 205 XM_001476259 Dennd4a 3.240 0.005 206 XM_001476259 Dennd4a 2.843 0.005 207 ENSMUSG049742 C330006D17Rik 1.921 0.005 208 NM_010548 Il10 5.051 0.005 209 NM_008404 Itgb2 2.105 0.005 210 NM_009344 Phlda1 2.415 0.005 211 NM_001038653 Slc16a3 2.340 0.005 212 NM_019549 Plek 5.663 0.005 213 NM_016767 Batf 1.953 0.005 214 NM_019453 Mefv 2.464 0.005 215 NM_01085390 Dusp5 2.864 0.005 216 NM_175512 Dhrs9 3.308 0.005 217 AB112025 Sirpb1 2.963 0.005

218 NM_011990 Slc7a11 11.439 0.005 219 NM_010276 Gem 4.341 0.005 220 NM_009763 Bst1 2.054 0.005 221 NM_009141 Cxcl5 5.570 0.005 222 NM_199159 Tas2r135 2.717 0.005 223 XM_001476227 LOC100046632 3.794 0.005 224 NM_030691 Igsf6 3.461 0.005 225 NM_001033632 Ifitm6 3.793 0.005 226 XM_001476259 Dennd4a 3.234 0.005 227 XM_001480590 Dennd4a 3.735 0.005 228 NM_001081188 Exosc7 0.629 0.005 229 NM_173437 Nav1 0.621 0.005 230 NM_011157 Srgn 3.904 0.005 231 NM_011579 Tgtp 3.029 0.005 232 NM_145437 4732429D16Rik 3.039 0.005 233 NM_001013392 Rreb1 0.620 0.005 234 NM_008677 Ncf4 1.954 0.005 235 NM_207648 H2-Q6 1.929 0.005 236 N.C.A. - 3.393 0.005 237 NM_007987 Fas 3.374 0.005 238 NM_031376 Pik3ap1 1.829 0.005 239 NM_181417 Csrp2bp 0.558 0.005 240 NM_009883 Cebpb 2.983 0.005 241 NM_009421 Traf1 2.061 0.005 242 NM_010139 Epha2 2.743 0.005 243 NM_145226 Oas3 2.095 0.005 244 NM_011090 Pira3 2.990 0.005 245 AK156116 Mrgpra2 4.640 0.005 246 NM_175136 Rnf122 3.031 0.005 247 NM_145857 Nod2 1.939 0.005 248 NM_001005421 Amica1 2.441 0.005 249 XM_001480590 Dennd4a 3.282 0.005 250 NM_009895 Cish 3.640 0.005 251 NM_008694 Ngp 2.326 0.005 252 NM_001163539 5430427O19Rik 2.508 0.005 253 GENSCAN0411269 Unknown 2.243 0.005 254 NM_172572 Rhbdf2 2.114 0.005 255 AK011044 Zfp192 0.508 0.005 256 NM_031997 Tmem2 1.811 0.005 257 NM_177320 Pik3r5 2.154 0.005 258 NM_144559 Fcgr4 2.732 0.006 259 NM_172845 Adamts4 9.631 0.006 260 NM_018750 Rassf5 1.527 0.006 261 NM_025499 Eid3 7.232 0.006 262 NM_019679 Fmnl1 1.948 0.006 263 GENSCAN0411269 Unknown 2.291 0.006

264 NM_008326 Irgm 2.478 0.006 265 NM_009969 Csf2 3.369 0.006 266 NM_019925 Gpr132 1.849 0.006 267 NM_008235 Hes1 0.574 0.006 268 NM_207301 Wrb 0.550 0.006 269 NM_053214 Myo1f 2.150 0.006 270 NM_001143689 H2-gs10 1.887 0.006 271 NM_010391 H2-Q10 1.754 0.006 272 NM_001033339 Mmp25 1.889 0.006 273 ENSMUST087244 EG630499 2.542 0.006 274 NM_178890 Abtb2 2.084 0.006 275 NM_139200 Pscdbp 3.088 0.006 276 AK006581 4930578G10Rik 4.357 0.006 277 NM_019840 Pde4b 3.317 0.006 278 NM_138952 Ripk2 2.630 0.006 279 NM_008037 Fosl2 2.166 0.006 280 N.C.A. - 0.446 0.006 281 NM_029415 Slc10a6 2.925 0.006 282 NM_008416 Junb 3.766 0.006 283 ENSMUST098569 EG639396 0.394 0.006 284 NM_007535 Bcl2a1c 2.775 0.006 285 NM_172476 Tmc7 1.809 0.006 286 NM_008057 Fzd7 0.518 0.006 287 NM_011488 Stat5a 1.568 0.006 288 NM_201531 Kcnf1 0.558 0.006 289 NM_017464 Nedd9 1.810 0.006 290 ENSMUST022663 Tnfrsf10b 2.431 0.006 291 NM_001081066 Dennd3 1.883 0.006 292 NM_008225 Hcls1 2.087 0.006 293 NM_023380 Samsn1 3.187 0.006 294 GENSCAN0356606 Unknown 3.810 0.006 295 NM_172442 Dtx4 0.545 0.006 296 NM_011095 Lilrb3 2.105 0.006 297 NM_009136 Scrg1 2.173 0.006 298 NM_029639 1600029D21Rik 2.190 0.006 299 NM_028679 Irak3 2.421 0.006 300 AF167317 Zfp114 0.633 0.006 301 NM_009074 Mst1r 1.493 0.006 302 XM_905096 Irgb10 2.820 0.006 303 N.C.A. - 0.481 0.006 304 NM_009912 Ccr1 3.786 0.006 305 AK173247 Sema4c 2.207 0.006 306 NM_001145660 Rfx8 2.992 0.006 307 AK220339 A130090K04Rik 2.017 0.006 308 NM_008147 Gp49a 6.804 0.006 309 NM_026268 Dusp6 2.756 0.006

310 NM_031252 Il23a 2.208 0.006 311 NM_001081957 OTTMUSG0971 2.621 0.006 312 NM_183249 1100001G20Rik 1.801 0.006 313 NM_001040005 Rnf213 2.198 0.006 314 NM_001029988 Fat2 0.500 0.006 315 NM_001007465 Rffl 1.585 0.006 316 NM_033373 Krt23 4.969 0.006 317 NM_030887 Jundm2 2.248 0.006 318 NM_007539 Bdkrb1 4.837 0.006 319 NM_007930 Enc1 2.155 0.006 320 NM_152804 Plk2 2.629 0.006 321 NM_013660 Sema4d 1.571 0.006 322 N.C.A. - 2.241 0.006 323 NM_008879 Lcp1 2.009 0.006 324 NM_008102 Gch1 3.693 0.006 325 ENSMUSG072496 N.C.A. 2.022 0.006 326 NM_011809 Ets2 1.976 0.006 327 NM_013790 Abcc5 0.587 0.006 328 NM_010846 Mx1 2.975 0.006 329 AK012942 2810051F02Rik 0.615 0.006 330 NM_023124 H2-Q8 1.729 0.006 331 NM_080636 Hars2 0.601 0.006 332 BC086486 Wdr85 0.604 0.006 333 NM_009058 Ralgds 2.211 0.006 334 NM_170701 Cd40 1.916 0.006 335 NM_001005846 Mcoln2 4.155 0.006 336 NM_008689 Nfkb1 3.026 0.006 337 NM_172468 Snx30 0.533 0.006 338 BC117807 Ibrdc3 2.756 0.006 339 ENSMUSG073868 Gm10590 2.069 0.006 340 NM_028209 Ttc4 0.652 0.006 341 NM_175437 A530088I07Rik 2.838 0.006 342 NM_010757 Mafk 2.026 0.006 343 N.C.A. - 1.806 0.006 344 NM_177876 Vps37b 2.030 0.006 345 NM_001171003 Mgam 1.931 0.006 346 NM_027477 Zfp398 0.512 0.006 347 NM_172161 Irak2 1.843 0.006 348 NM_001033122 Cd69 2.069 0.006 349 NM_016850 Irf7 2.178 0.006 350 XM_001480590 Dennd4a 3.179 0.006 351 NM_008317 Hyal1 0.466 0.006 352 NM_133974 Cdcp1 2.058 0.006 353 NM_020049 Slc6a14 5.395 0.006 354 NM_011180 Pscd1 1.547 0.006 355 NM_008091 Gata3 0.374 0.006

356 MI0000243 Unknown 0.505 0.006 357 NM_176993 Mpzl3 1.444 0.006 358 ENSMUST038176 Pira3 1.595 0.006 359 NM_145533 Smox 2.223 0.006 360 NM_011111 Serpinb2 2.469 0.006 361 NM_010500 Ier5 2.320 0.006 362 AK090249 LOC238771 0.548 0.006 363 NM_028728 Nfam1 1.799 0.006 364 NM_007520 Bach1 2.809 0.006 365 NM_013671 Sod2 1.886 0.006 366 NM_010235 Fosl1 5.002 0.006 367 XR_035270 4632415L05Rik 0.619 0.006 368 NM_028712 Rap2b 2.490 0.006 369 NM_011819 Gdf15 2.005 0.006 370 XM_001480590 Dennd4a 3.256 0.006 371 ENSMUST060013 EG622976 2.904 0.006 372 NM_028182 Sh2d4a 0.596 0.006 373 NM_177475 Suhw2 0.645 0.006 374 AK085490 Tnfrsf1b 2.110 0.006 375 DQ341272 Treml2 1.759 0.006 376 NM_007921 Elf3 3.246 0.006 377 GENSCAN0411269 Unknown 1.827 0.006 378 NM_007780 Csf2rb 2.062 0.006 379 AK082264 C230030N03Rik 0.538 0.006 380 NM_013508 Elk3 0.648 0.006 381 NM_172562 Tada2l 0.566 0.006 382 NM_054051 Pip5k2b 0.596 0.006 383 NM_013683 Tap1 1.837 0.006 384 NM_013609 Ngfb 3.095 0.006 385 NM_001081687 Gm5150 2.759 0.006 386 NM_013820 Hk2 4.384 0.006 387 NM_011662 Tyrobp 2.275 0.006 388 NM_001081212 Irs2 1.735 0.006 389 NM_009954 Bcar1 1.832 0.006 390 NM_009341 Tcp10c 1.636 0.006 391 NM_009546 Trim25 1.678 0.006 392 NM_177115 March3 1.894 0.006 393 NM_011854 Oasl2 1.951 0.006 394 NM_011852 Oas1g 1.838 0.006 395 NM_011267 Rgs16 3.118 0.006 396 GENSCAN0411269 Unknown 1.777 0.006 397 NM_007950 Ereg 5.762 0.006 398 XR_032778 LOC668181 2.034 0.006 399 NM_022415 Ptges 2.311 0.006 400 BC059914 5830417I10Rik 0.602 0.006 401 NM_145509 5430435G22Rik 0.439 0.006

402 AK051037 Wdr76 0.485 0.006 403 NM_015818 Hs6st1 1.833 0.006 404 NM_001033435 Gm885 2.226 0.006 405 BC029862 Gnb1l 0.502 0.006 406 NM_001033135 Rnf149 2.040 0.006 407 NM_013532 Lilrb4 4.112 0.006 408 NM_153588 Mkl2 0.651 0.006 409 NM_178751 Tmem142b 1.807 0.006 410 NM_009251 Serpina3g 2.441 0.006 411 GENSCAN0411269 Unknown 2.136 0.007 412 NM_033324 Dgcr8 0.665 0.007 413 NM_177561 Usp46 0.463 0.007 414 NM_008871 Serpine1 5.711 0.007 415 NM_027347 Med23 0.667 0.007 416 NM_026450 Zfp169 0.583 0.007 417 ENSMUSG072633 Unknown 0.582 0.007 418 NM_144800 Mtss1 0.601 0.007 419 NM_009663 Alox5ap 2.180 0.007 420 NM_153778 Atoh8 0.583 0.007 421 XM_994514 LOC434156 0.604 0.007 422 NM_009898 Coro1a 2.245 0.007 423 NM_145996 Arid5a 2.824 0.007 424 NM_172517 Rbbp5 0.701 0.007 425 NM_001029878 Lonrf2 0.504 0.007 426 NM_001081307 Ppp1r12b 0.774 0.007 427 AK089525 Slamf7 1.769 0.007 428 NM_199322 Dot1l 1.846 0.007 429 NM_010153 Erbb3 0.623 0.007 430 NM_009288 Stk10 1.555 0.007 431 NM_008425 Kcnj2 2.593 0.007 432 GENSCAN0411269 Unknown 2.130 0.007 433 GENSCAN0411269 Unknown 2.078 0.007 434 NM_018861 Slc1a4 2.079 0.007 435 BC034256 Tgtp 2.349 0.007 436 NM_183137 2410002I01Rik 0.579 0.007 437 NM_020557 Tyki 2.403 0.007 438 NM_013464 Ahr 0.614 0.007 439 NM_008957 Ptch1 0.374 0.007 440 NM_026873 Ptcd2 0.591 0.007 441 NM_001123371 Pnp2 1.765 0.007 442 NM_180588 Reep4 0.664 0.007 443 NM_028064 Slc39a4 1.518 0.007 444 NM_007679 Cebpd 3.613 0.007 445 NM_031182 Tcfap4 0.570 0.007 446 NM_011145 Ppard 1.782 0.007 447 DQ087180 B430306N03Rik 1.721 0.007

448 NM_010734 Lst1 1.604 0.007 449 NM_011898 Spry4 1.973 0.007 450 MI0000169 Unknown 0.430 0.007 451 AY044451 Alpk2 1.911 0.007 452 NM_198429 Nfatc1 1.738 0.007 453 NM_009045 Rela 1.919 0.007 454 NM_019935 Ovol1 3.202 0.007 455 NM_028306 Hspa12b 0.489 0.007 456 NM_175181 2600010E01Rik 1.844 0.007 457 NM_010516 Cyr61 2.588 0.007 458 NM_010945 Nsmaf 0.615 0.007 459 NM_001081205 Npal1 2.190 0.007 460 NM_011535 Tbx3 0.583 0.007 461 NM_011027 P2rx7 0.682 0.007 462 GENSCAN0412029 Unknown 0.574 0.007 463 BC112328 LOC626578 3.193 0.007 464 NM_022017 Trpv4 1.466 0.007 465 NM_175092 Rhof 2.076 0.007 466 NM_026849 Mtmr14 1.636 0.007 467 AK035685 Unknown 0.637 0.007 468 NM_001082960 Itgam 1.790 0.007 469 NM_008036 Fosb 4.150 0.007 470 NM_018808 Dnajb1 1.770 0.007 471 NM_013906 Adamts8 1.575 0.007 472 NM_175535 Arhgap20 0.463 0.007 473 N.C.A. - 0.612 0.007 474 AK220476 Dennd4a 2.843 0.007 475 NM_026658 Mto1 0.762 0.007 476 NM_001012236 Trex1 2.167 0.007 477 ENSMUST047498 AA467197 1.925 0.007 478 NM_001033237 Yeats2 0.617 0.007 479 BC027413 Tprkb 0.573 0.007 480 NM_001038604 Clec5a 2.882 0.007 481 GENSCAN0424096 Unknown 2.799 0.007 482 NM_008478 L1cam 0.713 0.007 483 ENSMUST026564 Ifitm1 1.579 0.007 484 GENSCAN0411269 Unknown 2.144 0.007 485 NM_207680 Bcl2l11 1.714 0.007 486 NM_028258 Dzip1l 0.574 0.007 487 NM_013612 Slc11a1 1.748 0.007 488 NM_172545 Ehmt1 0.632 0.007 489 NM_009805 Cflar 1.768 0.007 490 GENSCAN0411269 Unknown 1.699 0.007 491 NM_008394 Irf9 1.672 0.007 492 XM_985543 EG666707 2.331 0.007 493 NM_001002786 Rab44 1.637 0.007

494 NM_025861 Pqlc1 2.542 0.007 495 NM_023336 Brd3 0.658 0.007 496 NM_001134300 8430427H17Rik 0.635 0.007 497 GENSCAN0402007 Unknown 2.640 0.007 498 NM_026153 Ankrd33b 1.927 0.007 499 NM_010330 Emb 2.438 0.007 500 NM_007658 Cdc25a 0.639 0.007 501 NM_008599 Cxcl9 2.987 0.007 502 NM_007875 Dpagt1 0.683 0.007 503 XR_032218 LOC435208 1.566 0.007 504 ENSMUSG072793 Unknown 1.990 0.007 505 NM_172260 Cep68 0.642 0.007 506 NM_009026 Rasd1 2.595 0.007 507 NM_008152 Gpr65 2.674 0.007 508 NM_028356 Zbtb25 0.640 0.007 509 NM_027496 Ankrd33b 2.061 0.007 510 NM_008216 Has2 4.746 0.007 511 NM_013490 Chka 1.896 0.007 512 NR_028427 5830416P10Rik 1.713 0.007 513 NM_133232 Pfkfb3 3.134 0.007 514 NM_177244 Fastkd1 0.577 0.007 515 NM_011521 Sdc4 1.996 0.007 516 NM_053084 Trim32 0.589 0.007 517 NM_011400 Slc2a1 2.203 0.007 518 NM_008154 Gpr3 1.661 0.007 519 NM_029850 Bcl7a 0.589 0.007 520 NM_022657 Fgf23 2.340 0.007 521 GENSCAN0376706 Unknown 1.465 0.007 522 NM_144921 Atp1a3 1.722 0.007 523 AK085367 4933407C03Rik 1.341 0.007 524 NM_010456 Hoxa9 0.574 0.007 525 NM_029896 Wdr82 0.714 0.007 526 NM_153074 Lrrc25 1.969 0.007 527 NM_030198 Gins3 0.620 0.007 528 NM_030113 Arhgap10 0.785 0.007 529 NM_153406 Specc1l 0.771 0.007 530 N.C.A. - 1.824 0.007 531 NM_026496 Grhl2 0.558 0.007 532 NM_133731 Prss22 4.052 0.007 533 NM_133209 Pilrb1 1.940 0.007 534 NM_145149 Rasgrp4 1.694 0.007 535 ENSMUST0101358 Gm614 1.397 0.007 536 NM_027881 Osbpl3 0.649 0.007 537 GENSCAN0411269 Unknown 1.924 0.007 538 AAI50856 EG240055 0.606 0.007 539 NM_007836 Gadd45a 2.203 0.007

540 NM_029057 Tbc1d30 0.594 0.007 541 NM_023438 Tmem132e 1.555 0.007 542 NM_173033 BC057893 0.712 0.007 543 NM_178639 Sfxn5 1.497 0.007 544 GENSCAN0355664 Unknown 0.625 0.007 545 NM_001033311 BC023744 0.671 0.007 546 NM_001080949 Ttc5 0.624 0.007 547 NM_008268 Hoxb5 0.528 0.008 548 NM_019388 Cd86 2.030 0.008 549 NM_011472 Sprr2f 3.136 0.008 550 NM_001013577 1110054O05Rik 0.654 0.008 551 NM_029264 Ttll10 0.662 0.008 552 N.C.A. - 0.575 0.008 553 NM_138656 Mvd 1.662 0.008 554 NM_027106 Avpi1 2.239 0.008 555 NM_172648 Ifi205 4.808 0.008 556 N.C.A. - 3.606 0.008 557 NM_033374 Dock2 1.542 0.008 558 ENSMUST026564 Ifitm1 1.678 0.008 559 NM_010118 Egr2 2.722 0.008 560 NM_001037713 Fbxo39 1.810 0.008 561 NM_011018 Sqstm1 1.555 0.008 562 ENSMUST025568 Tmem138 0.625 0.008 563 NM_011260 Reg3g 5.840 0.008 564 GENSCAN0414808 Unknown 1.826 0.008 565 MI0000257 Unknown 0.523 0.008 566 NM_029466 Arl5b 2.508 0.008 567 NM_030209 Crispld2 1.505 0.008 568 XM_001480753 LOC100043691 0.574 0.008 569 NM_178788 Dctd 0.670 0.008 570 NM_028658 Ccdc128 0.638 0.008 571 NM_010119 Ehd1 2.122 0.008 572 BC059269 4933427D14Rik 0.624 0.008 573 NM_028792 Josd1 0.704 0.008 574 NM_028943 Sgms2 2.228 0.008 575 NM_010346 Grb7 0.481 0.008 576 N.C.A. - 0.294 0.008 577 NM_008607 Mmp13 1.809 0.008 578 NM_001105561 Gm11545 1.751 0.008 579 NM_009856 Cd83 2.406 0.008 580 NM_028789 Unkl 0.714 0.008 581 NM_133947 Numa1 0.705 0.008 582 NM_199080 Ddx17 0.709 0.008 583 NM_011065 Per1 1.760 0.008 584 NM_029998 6030458C11Rik 0.706 0.008 585 NM_001080944 Atp8b4 1.819 0.008

586 NM_009805 Cflar 1.599 0.008 587 NM_008207 H2-T24 1.702 0.008 588 NM_011386 Skil 2.318 0.008 589 NM_026862 Cd177 1.909 0.008 590 NM_178027 Vps26b 0.584 0.008 591 GENSCAN0411269 Unknown 1.847 0.008 592 NM_027309 Lysmd2 0.641 0.008 593 NM_001039115 OTTMUSG0421 0.720 0.008 594 NM_194346 Rnf31 1.437 0.008 595 NM_011893 Sh3bp2 1.817 0.008 596 NM_009311 Tac1 2.847 0.008 597 NM_001039530 Parp14 2.456 0.008 598 NR_003548 Sprr2g 2.835 0.008 599 NM_009517 Zmat3 0.709 0.008 600 NM_153820 Arhgap15 2.035 0.008 601 NM_033622 Tnfsf13b 0.729 0.008 602 AK169251 Zfp422 0.670 0.008 603 NM_207255 Zfp532 0.679 0.008 604 NM_172765 Zbtb44 0.578 0.008 605 NM_019721 Mettl3 0.740 0.008 606 NM_009890 Ch25h 4.013 0.008 607 NM_212444 Gyk 2.721 0.008 608 NM_009557 Zfp46 1.451 0.009 609 XM_355823 Apold1 2.470 0.009 610 XM_001476596 LOC100041569 0.675 0.009 611 NM_178802 Trim65 0.652 0.009 612 BC055351 Hn1l 0.775 0.009 613 ENSMUSG069074 Gm10258 0.560 0.009 614 NM_011948 Map3k4 0.569 0.009 615 NM_010258 Gata6 0.677 0.009 616 NM_001001452 Tas2r143 2.085 0.009 617 NM_172339 Snapc4 0.742 0.009 618 NM_008748 Dusp8 1.970 0.009 619 NM_011171 Procr 3.281 0.009 620 NM_026454 Ube2f 1.416 0.009 621 NM_007707 Socs3 5.393 0.009 622 NM_011470 Sprr2d 1.815 0.009 623 NM_013706 Cd52 2.475 0.009 624 NM_172528 Lrrc1 0.685 0.009 625 NM_001004363 Nuak1 0.596 0.009 626 NM_001037955 Dusp22 0.697 0.009 627 NM_021542 Kcnk5 1.782 0.009 628 NM_022314 Tpm3 1.455 0.009 629 NM_028544 Rasip1 1.809 0.009 630 NM_011951 Mapk14 0.717 0.009 631 NM_153421 Phc3 0.673 0.009

632 NM_027840 9130017C17Rik 1.695 0.009 633 BC051512 2310026E23Rik 0.624 0.009 634 NM_019747 Zfp113 0.521 0.009 635 NM_013542 Gzmb 1.636 0.009 636 NM_013594 Mbd1 1.416 0.009 637 AK129390 D630045J12Rik 0.649 0.009 638 NM_001009935 Txnip 0.482 0.009 639 NM_177171 Heatr5a 0.785 0.009 640 NM_026623 Nudt21 0.569 0.009 641 NM_025964 Fam119a 0.669 0.009 642 NM_025629 Adamtsl5 0.658 0.009 643 NM_001042523 Txnrd1 2.362 0.009 644 NM_144933 Med17 0.719 0.009 645 XM_001473233 C130039O16Rik 1.479 0.009 646 NM_021448 Elp2 0.721 0.009 647 NM_007778 Csf1 1.909 0.009 648 NM_130879 Usp48 0.635 0.009 649 NM_028457 Dem1 0.720 0.009 650 NM_009704 Areg 3.868 0.009 651 NM_181444 Gprc5a 3.277 0.009 652 NM_011332 Ccl17 2.763 0.009 653 NM_146201 Zfp553 0.600 0.009 654 XR_002221 EG624251 1.310 0.009 655 N.C.A. - 0.612 0.009 656 XR_033405 LOC546714 2.478 0.009 657 NM_013562 Ifrd1 2.779 0.009 658 NM_198652 Hjurp 0.662 0.009 659 NM_007575 Ciita 0.716 0.009 660 NM_172565 Klhl11 0.770 0.009 661 NM_027117 Klhdc2 0.755 0.009 662 NM_177775 D9Ertd280e 0.626 0.009 663 NM_172689 Ddx58 1.769 0.009 664 NM_172051 Tmcc3 1.840 0.009 665 NM_011604 Tlr6 1.696 0.009 666 NM_011235 Rad51l3 0.649 0.009 667 NM_010723 Lmo4 0.747 0.009 668 M84563 Pnp 1.749 0.009 669 NM_011629 Nr2c1 0.638 0.009 670 AJ278965 Cd80 2.432 0.009 671 NM_030240 2900092E17Rik 0.627 0.009 672 NM_001002842 Pram1 1.583 0.009 673 NM_018877 Setdb1 0.651 0.009 674 NM_001025156 Ccdc93 0.800 0.009 675 NM_010837 Mtap6 0.691 0.009 676 MI0000170 Unknown 1.679 0.010 677 NM_019980 Litaf 2.125 0.010

678 NM_011523 Synj2 0.750 0.010 679 NM_030185 Zcchc4 0.648 0.010 680 N.C.A. - 1.476 0.010 681 NM_001081128 Mtr 0.767 0.010 682 NM_001017966 Ddi2 0.699 0.010 683 NM_177878 Mblac1 0.648 0.010 684 NM_022026 Aqp9 1.719 0.010 685 NM_031869 Prkab1 1.397 0.010 686 NM_010171 F3 1.550 0.010 687 NM_001045514 Akna 1.605 0.010 688 N.C.A. - 0.461 0.010 689 NM_026876 1190005F20Rik 0.564 0.010 690 NM_001029990 Mett11d1 0.612 0.010 691 NM_009892 Chi3l3 2.177 0.010 692 NM_011808 Ets1 1.818 0.010 693 NM_080445 B3galt6 0.644 0.010 694 NM_001082547 Gm5483 2.166 0.010 695 NM_007670 Cdkn2b 1.473 0.010 696 NM_008827 Pgf 1.602 0.010 697 NR_003517 LOC236604 0.511 0.010 698 NM_177824 9830107B12Rik 1.551 0.010 699 NM_001122667 Mkl2 0.615 0.010 700 NM_178682 4933426M11Rik 1.696 0.010 701 NM_153788 Centb1 1.490 0.010 702 NM_001033245 Hk3 1.584 0.010 703 NM_007554 Bmp4 0.464 0.010 704 NM_172628 Sh3tc2 0.591 0.010 705 XR_035143 A730049H05Rik 1.762 0.010 706 NM_001029929 Zmynd15 1.469 0.010 707 NM_013529 Gfpt2 3.095 0.010 708 NM_024171 Sec61b 0.494 0.010 709 NM_021409 Pard6b 1.528 0.010 710 NM_019566 Rhog 1.908 0.010 711 NM_172766 Nfrkb 0.756 0.010 712 NM_144549 Trib1 2.676 0.010 713 NM_153551 Dennd1c 1.429 0.010 714 MI0000554 Unknown 0.702 0.010 715 NM_145742 Dhx35 0.756 0.010 716 NM_001081237 Klhdc5 0.605 0.010 717 XR_035361 9130230L23Rik 1.648 0.010 718 NM_008217 Has3 2.854 0.010 719 NM_024261 1700052N19Rik 0.684 0.010 720 NM_019750 Nat6 0.665 0.010 721 NM_010185 Fcer1g 1.609 0.010 722 NM_177815 Rft1 0.762 0.010 723 NM_178615 Rgmb 0.779 0.010

724 NM_010454 Hoxa6 0.713 0.010 725 NM_023892 Icam4 1.712 0.010 726 NM_145943 Sec61b 1.702 0.010 727 NM_008462 Klra2 1.919 0.010 728 NM_025777 Duoxa2 1.775 0.010 729 NM_053109 Clec2d 1.990 0.010 730 NM_001163567 Fam102b 0.732 0.010 731 NM_025378 Ifitm3 1.328 0.010 732 NM_134046 Cenpo 0.643 0.010 733 NM_001033780 I830077J02Rik 1.624 0.010 734 NM_177767 Ogfod1 0.706 0.010 735 NM_145426 Mfap3 0.743 0.010 736 NM_053083 Loxl4 2.120 0.010 737 NM_001080819 Arid1a 0.781 0.010 738 ENSMUST019439 Tmem129 0.626 0.010 739 BC077714 Taok2 0.712 0.010 740 NM_020028 Edg4 1.431 0.010 741 NM_017370 Hp 4.379 0.010 742 NM_172755 Sfrs14 0.733 0.011 743 NM_009229 Sntb2 1.477 0.011 744 NM_029821 1190003J15Rik 2.331 0.011 745 AK161750 1500002C15Rik 0.719 0.011 746 NM_028864 Zc3hav1 1.543 0.011 747 NM_028800 Stk40 1.786 0.011 748 NM_001013026 Ttf2 0.709 0.011 749 NM_009324 Tbx2 0.532 0.011 750 NM_023668 Ndel1 1.435 0.011 751 NM_010755 Maff 3.032 0.011 752 NM_016695 Mpp2 1.553 0.011 753 NM_009524 Wnt5a 0.457 0.011 754 MI0000768 Unknown 0.650 0.011 755 NM_001033444 Capn13 0.563 0.011 756 NM_027835 Ifih1 2.469 0.011 757 NM_012039 Zw10 0.709 0.011 758 NM_009137 Ccl22 1.714 0.011 759 XR_033297 LOC668321 1.549 0.011 760 NM_008275 Hoxd13 0.666 0.011 761 BC042569 Zfp167 0.558 0.011 762 NM_030150 Dhx58 1.372 0.011 763 NM_011487 Stat4 1.748 0.011 764 ENSMUST099405 Unknown 3.483 0.011 765 ENSMUST052138 Terf2ip 0.732 0.011 766 NM_007450 Slc25a4 0.791 0.011 767 NM_007465 Birc2 2.163 0.011 768 NM_010117 Rhbdf1 1.386 0.011 769 N.C.A. - 0.651 0.011

770 NM_026891 Cdan1 0.644 0.011 771 NM_008126 Gjb3 0.421 0.011 772 NM_001048219 Nlrp9a 1.402 0.011 773 NM_008732 Slc11a2 1.481 0.011 774 NM_009547 Zfp161 0.564 0.011 775 NM_019426 Atf7ip 0.614 0.011 776 ENSMUST0342 Ccl11 3.065 0.012 777 NM_008681 Ndrg1 1.642 0.012 778 AK170206 F630028O10Rik 2.210 0.012 779 NM_011210 Ptprc 2.838 0.012 780 NM_021439 Chst11 1.441 0.012 781 NM_198019 Cep78 0.654 0.012 782 AK018133 6330407A03Rik 2.111 0.012 783 NM_011471 Sprr2e 1.987 0.012 784 NM_011791 Ash2l 0.749 0.012 785 NM_138953 Ell2 2.784 0.012 786 NM_011508 Eif1 1.403 0.012 787 NM_175283 Srd5a1 0.638 0.012 788 NM_009523 Wnt4 0.597 0.012 789 NM_013781 Sh2d3c 1.560 0.012 790 NM_207669 Gabpb1 1.588 0.012 791 NM_021457 Fzd1 0.788 0.012 792 NM_030121 Asb8 0.674 0.012 793 NM_010394 H2-Q7 1.346 0.012 794 NM_022032 Perp 0.726 0.012 795 NM_145520 Trub2 0.695 0.012 796 NM_010260 Gbp2 1.946 0.012 797 NM_173765 A230062G08Rik 0.636 0.012 798 NM_012017 Zfp346 0.701 0.012 799 NM_008685 Nfe2 1.438 0.012 800 NM_172824 Ccdc14 0.718 0.012 801 NM_001081417 Chd7 1.584 0.012 802 NM_133907 Ube3c 0.781 0.012 803 NM_008012 Akr1b8 1.799 0.013 804 NM_001024703 Mctp2 1.979 0.013 805 NM_153796 Peo1 0.705 0.013 806 NM_177268 Ankrd16 0.654 0.013 807 NM_009662 Alox5 1.755 0.013 808 NM_028170 1700030K09Rik 0.744 0.013 809 NM_027521 Hmha1 1.600 0.013 810 NM_007395 Acvr1b 1.533 0.013 811 NM_144895 Spg20 0.699 0.013 812 NM_016693 Map3k6 2.006 0.013 813 NM_178732 Zfp324 0.668 0.013 814 AK148655 Zfp319 0.710 0.013 815 ENSMUST036407 AI450540 0.679 0.013

816 N.C.A. - 1.395 0.013 817 NM_027418 Mapk6 2.224 0.013 818 NM_021367 Tslp 1.838 0.013 819 EF660528 AW112010 2.492 0.013 820 AK032580 ENSMUSG060719 0.597 0.013 821 NM_028890 4931414P19Rik 0.569 0.013 822 NM_028150 Supt7l 0.749 0.013 823 AK082857 9030420J04Rik 0.676 0.013 824 NM_008847 Pip5k1a 1.408 0.013 825 NM_001033336 Abcc4 1.325 0.014 826 NM_175134 Ankrd46 0.589 0.014 827 NM_175934 Ppp1r10 1.402 0.014 828 NM_207028 Tas2r126 1.584 0.014 829 NM_001033669 Fbxw10 1.858 0.014 830 NM_018738 Igtp 1.911 0.014 831 NM_001081217 Zfp174 0.646 0.014 832 NM_011237 Rad9 0.668 0.014 833 NM_001033392 3222401L13Rik 0.632 0.014 834 AK166222 A730017L22Rik 0.521 0.014 835 NM_007415 Parp1 0.750 0.014 836 NM_207231 Arl5c 1.366 0.014 837 NM_026611 Rnaset2b 0.584 0.014 838 NM_008321 Id3 1.938 0.014 839 NM_028035 Snx10 1.945 0.014 840 NM_026942 Stoml1 0.723 0.014 841 NM_010716 Lig3 0.784 0.014 842 NM_011979 Vnn3 2.627 0.014 843 NM_008255 Hmgcr 1.510 0.014 844 NM_001163513 Dlg5 0.753 0.014 845 NM_009295 Stxbp1 1.307 0.014 846 NM_013867 Bcar3 1.756 0.014 847 NM_172505 A730008H23Rik 0.656 0.014 848 NM_025866 Cdca7 0.652 0.014 849 NM_010851 Myd88 1.984 0.014 850 GENSCAN0380192 Unknown 1.738 0.014 851 NM_029985 Lrrc42 0.663 0.014 852 NM_007609 Casp4 3.110 0.014 853 NM_008679 Ncoa3 0.756 0.014 854 NM_022420 Gprc5b 1.702 0.014 855 NM_178641 Inpp5f 0.686 0.014 856 N.C.A. - 1.562 0.014 857 NM_029756 Sdccag8 0.711 0.014 858 NM_011498 Bhlhb2 2.220 0.014 859 NM_183426 Sbno2 2.939 0.014 860 NM_015769 Ercc4 0.736 0.014 861 XM_001481048 Alpk1 1.400 0.014

862 NM_001033225 Pnrc1 1.410 0.014 863 NM_153505 Nckap1l 1.477 0.014 864 ENSMUST046955 Wdr92 0.663 0.014 865 NM_029796 Lrg1 2.098 0.014 866 NM_009099 Trim30 2.334 0.014 867 NM_027949 Phf7 0.685 0.014 868 NM_029922 Parp6 0.687 0.014 869 NM_173048 Gga3 0.769 0.014 870 GENSCAN0424492 Unknown 0.585 0.014 871 NM_008316 Hus1 0.728 0.015 872 NM_021356 Gab1 0.624 0.015 873 NM_019418 Tnfsf14 1.637 0.015 874 AC163651.2 Odc1 (+3 Gm) 1.559 0.015 875 NM_027405 1700020O03Rik 1.290 0.015 876 NM_177798 Frs2 0.689 0.015 877 AK049951 ENSMUSG052691 0.646 0.015 878 NM_009834 Ccrn4l 2.349 0.015 879 NM_133806 Uap1 1.940 0.015 880 NM_011772 Ikzf4 1.842 0.015 881 NM_001040005 Rnf213 1.638 0.015 882 NM_134133 2010002N04Rik 2.187 0.015 883 NM_001024699 ZBTB45 0.602 0.015 884 NM_001033239 Csta 1.286 0.015 885 NM_018889 Pigb 0.687 0.015 886 NM_013626 Pam 0.785 0.015 887 NM_145376 Aytl2 0.680 0.015 888 NM_026127 4833420G17Rik 0.517 0.015 889 NM_007829 Daxx 1.484 0.015 890 NM_024435 Nts 2.058 0.015 891 NM_007483 Rhob 1.434 0.015 892 AK035282 D17Ertd663e 0.712 0.015 893 AK160455 1810036N14Rik 0.704 0.015 894 NM_146101 Habp2 1.305 0.015 895 NM_027290 Mcm10 1.675 0.015 896 NM_019427 Epb4.1l4b 0.758 0.015 897 NM_021513 Thap11 0.607 0.015 898 NM_008338 Ifngr2 1.381 0.015 899 NM_153566 Yrdc 1.485 0.015 900 NM_010807 Marcksl1 1.625 0.015 901 NM_001025427 Hmga1 1.630 0.015 902 NM_020596 Egr4 1.454 0.015 903 NM_001033253 Plekhg1 0.575 0.015 904 NM_001081549 Rcan1 2.660 0.015 905 XM_619521 EG545242 0.708 0.015 906 NM_013563 Il2rg 1.702 0.015 907 NM_205820 Tlr13 1.889 0.015

908 NM_030067 Gpr115 0.546 0.015 909 NM_027450 Glipr2 1.859 0.015 910 NM_175268 A930008G19Rik 0.607 0.016 911 XR_034822 LOC668786 1.932 0.016 912 NM_153507 Cpne2 1.342 0.016 913 BC052187 2700094F01Rik 0.617 0.016 914 NM_008569 Anapc1 0.744 0.016 915 ENSMUST041588 AA881470 0.734 0.016 916 NM_198005 Dcaf17 0.572 0.016 917 NM_030697 Ankrd47 0.691 0.016 918 NM_026405 Rab32 1.416 0.016 919 NM_020517 Lenep 0.738 0.016 920 NM_177152 Lrig3 0.685 0.016 921 XM_001478111 LOC100042023 0.693 0.016 922 NM_001081057 Tecpr2 0.704 0.016 923 NM_138671 Nadk 1.325 0.016 924 ENSMUSG071420 Unknown 2.098 0.016 925 NM_016752 Slc35b1 0.804 0.016 926 NM_010849 Myc 2.138 0.016 927 NM_175449 Fam26f 1.669 0.016 928 NM_031999 Gpr137b 0.694 0.016 929 NM_172966 Sh3rf2 0.603 0.016 930 NM_146474 Olfr1261 1.457 0.016 931 NM_011577 Tgfb1 1.600 0.016 932 BC051078 5730409G15Rik 0.754 0.016 933 NM_018831 Dclre1a 0.623 0.016 934 NM_008452 Klf2 1.569 0.016 935 NM_138672 Stab1 0.561 0.016 936 NM_146253 Zbtb6 1.871 0.016 937 NM_178347 Cdc23 0.710 0.017 938 NM_009132 Scin 1.598 0.017 939 BC058212 Nat11 0.777 0.017 940 NM_080554 Psmd5 0.671 0.017 941 BC060223 Nup205 0.782 0.017 942 NM_027134 Mtfmt 0.680 0.017 943 NM_011545 Tcf21 0.500 0.017 944 NM_199322 Dot1l 1.586 0.017 945 NM_026086 Nanp 0.613 0.017 946 NM_133345 Ing4 0.661 0.017 947 NM_019574 Patz1 0.625 0.017 948 NM_201373 Trim56 1.341 0.017 949 AK173043 Dmxl2 1.663 0.017 950 NM_153119 Plekho1 1.599 0.017 951 GENSCAN0416105 Unknown 0.423 0.017 952 NM_146176 Cnot3 0.720 0.017 953 NM_008359 Il17ra 1.883 0.017

954 NM_144558 Bivm 0.573 0.017 955 NM_008928 Map2k3 1.823 0.018 956 NM_016874 Deaf1 0.701 0.018 957 AK046107 Glb1 0.712 0.018 958 NM_007807 Cybb 2.206 0.018 959 NR_002841.1 Rn4.5s 1.755 0.018 960 NM_001080129 Tmpo 0.645 0.018 961 NM_013739 Dok3 1.464 0.018 962 NM_016683 Zkscan5 0.612 0.018 963 N.C.A. - 2.543 0.018 964 NM_008364 Il1rap 1.656 0.018 965 NM_020583 Isg20 1.477 0.018 966 NM_028152 Mms19l 0.689 0.018 967 NM_008624 Mras 0.644 0.018 968 NM_028115 Trub1 0.766 0.018 969 NM_011909 Usp18 1.745 0.018 970 NM_001001882 Rtel1 0.762 0.018 971 AF357363 Snord16a 1.662 0.018 972 NM_011355 Sfpi1 1.804 0.018 973 GENSCAN0370682 Unknown 1.756 0.018 974 GENSCAN0390926 Unknown 0.705 0.018 975 NM_183319 Xkrx 0.581 0.019 976 NM_025831 1300014I06Rik 1.816 0.019 977 NM_013723 Podxl 0.704 0.019 978 NM_010747 Lyn 1.546 0.019 979 NM_001081192 Hcn4 1.623 0.019 980 NM_001002004 2610507B11Rik 0.760 0.019 981 NM_008640 Laptm4a 0.863 0.019 982 NM_009177 St3gal1 1.753 0.019 983 NM_007577 C5ar1 1.787 0.019 984 NM_173390 Nhsl1 0.699 0.019 985 NM_181545 Slfn8 2.093 0.019 986 NM_026960 Gsdmdc1 1.414 0.019 987 NM_033476 Tcfcp2 0.656 0.019 988 NM_133349 Zfand2a 1.535 0.019 989 NM_133922 Krba1 0.687 0.019 990 NM_198101 Gmip 1.295 0.019 991 NM_178227 Scn3b 1.531 0.019 992 NR_028263 B130006D01Rik 0.738 0.019 993 NM_001085502 Nt5c1a 1.733 0.019 994 NM_001039710 Coq10b 1.716 0.019 995 NM_021897 Trp53inp1 2.470 0.019 996 ENSMUSG074629 4930518I15Rik 0.553 0.019 997 NM_011281 Rorc 0.651 0.019 998 NM_008263 Hoxa10 0.653 0.019 999 ENSMUST064254 Atf7 0.772 0.019

1000 NM_146673 Olfr823 1.859 0.019 1001 NM_017373 Nfil3 2.875 0.019 1002 NM_018781 Egr3 1.499 0.019 1003 NM_010046 Dgat1 1.978 0.019 1004 BC046433 Prdm15 0.749 0.019 1005 NM_007675 Ceacam10 1.684 0.019 1006 N.C.A. - 1.242 0.019 1007 NM_178364 Zfp369 0.638 0.019 1008 NM_016674 Cldn1 0.498 0.019 1009 XM_001471580 LOC667597 1.427 0.019 1010 NM_147153 Vps39 0.722 0.019 1011 NM_183025 A430033K04Rik 0.634 0.019 1012 NM_173022 BC048403 0.710 0.019 1013 NM_025609 Map3k7ip1 0.609 0.019 1014 NM_010045 Darc 1.688 0.019 1015 NM_146042 Ibrdc2 0.671 0.019 1016 NM_008720 Npc1 0.739 0.019 1017 NM_011223 Pxn 1.517 0.019 1018 NM_008872 Plat 2.755 0.019 1019 GENSCAN0373676 Unknown 0.730 0.019 1020 NM_029357 Pcdh1 1.669 0.019 1021 NM_001033311 BC023744 0.757 0.019 1022 NM_023233 Trim13 1.958 0.019 1023 NM_001081368 Tbccd1 0.697 0.019 1024 NM_001002846 Fbxl12 0.721 0.019 1025 NM_001080814 Fat3 0.788 0.019 1026 NM_019505 Dgke 0.713 0.019 1027 NM_172049 Tmem18 0.736 0.019 1028 BC031537 Gtlf3a 1.626 0.019 1029 NM_175270 Ankrd56 1.558 0.019 1030 NM_145926 Mgat4b 1.429 0.019 1031 NM_172804 Syt16 0.754 0.019 1032 NM_015828 Gne 0.703 0.020 1033 GENSCAN0374171 Unknown 1.456 0.020 1034 NM_001039482 Klhl20 0.665 0.020 1035 NM_026642 Trmt12 0.684 0.020 1036 XM_001481240 LOC100043921 1.513 0.020 1037 NM_001101433 Zcchc24 0.706 0.020 1038 NM_019952 Clcf1 1.892 0.020 1039 NM_027995 Paqr7 0.600 0.020 1040 NM_011914 Whsc2 0.737 0.020 1041 NM_001081107 Hel308 0.776 0.020 1042 AC150277.2 Epb4.1l4a or GM32361.546 0.020 1043 NM_001002898 Sirpb1 1.589 0.020 1044 NM_008396 Itga2 2.375 0.020 1045 NM_001081417 Chd7 1.592 0.020

1046 NM_010442 Hmox1 2.277 0.020 1047 NM_009082 Rpl29 1.328 0.020 1048 BC025573 2310014H01Rik 1.724 0.020 1049 NM_145478 Pim3 1.636 0.020 1050 NM_010148 Epn2 0.807 0.020 1051 NM_178241 Il8ra 1.299 0.020 1052 MI0000167 Unknown 1.821 0.020 1053 XR_033730 EG668553 0.796 0.021 1054 NM_010242 Fut4 0.668 0.021 1055 NM_001039646 Gbp10 1.535 0.021 1056 NM_001024932 Pilrb2 1.798 0.021 1057 AK170322 ENSMUSG073567 1.649 0.021 1058 NM_138630 Arhgap4 1.389 0.021 1059 NM_011945 Map3k1 0.643 0.021 1060 NM_001010833 Mdc1 0.626 0.021 1061 NM_023580 Epha1 0.602 0.021 1062 NM_172749 Zfp646 0.722 0.021 1063 NM_011066 Per2 0.706 0.021 1064 NM_001025597 Ikzf1 1.257 0.021 1065 NM_010459 Hoxb4 0.704 0.021 1066 NM_144797 Metrnl 1.689 0.021 1067 NM_175360 Obfc1 1.370 0.021 1068 NM_001082476 Ndor1 0.775 0.021 1069 NM_010225 Foxf2 0.705 0.021 1070 NM_001081393 Armc4 1.189 0.021 1071 NM_001126490 Ism1 0.590 0.021 1072 AK041042 B130055M24Rik 0.718 0.021 1073 NM_033601 Bcl3 2.862 0.021 1074 NM_019572 Hdac7a 0.725 0.021 1075 NM_053069 Atg5 0.687 0.022 1076 NM_001081417 Chd7 1.977 0.022 1077 NM_001081029 4930420K17Rik 1.372 0.022 1078 NM_001025067 Lrig2 0.677 0.022 1079 NM_153562 BC023814 0.680 0.022 1080 NM_008840 Pik3cd 1.406 0.022 1081 NM_019788 Pldn 0.717 0.022 1082 NM_011593 Timp1 3.876 0.022 1083 NM_029035 Spsb1 1.870 0.022 1084 NM_028730 Pex26 0.765 0.022 1085 N.C.A. - 0.693 0.022 1086 XM_909906 I830127L07Rik 1.917 0.022 1087 XM_144292 Tmem156 1.666 0.022 1088 NM_133738 Antxr2 1.600 0.022 1089 ENSMUST068975 Zfp180 0.777 0.022 1090 NM_013659 Sema4b 1.515 0.022 1091 NM_145940 Wipi1 0.619 0.023

1092 NM_183208 Zmiz1 0.768 0.023 1093 NM_172599 D14Ertd436e 0.623 0.023 1094 NM_178411 Zfp334 0.782 0.023 1095 NM_172751 Arhgef10 0.651 0.023 1096 NM_145513 Tiprl 0.715 0.023 1097 NM_177632 Fam43a 2.446 0.023 1098 NM_177294 Rpap1 0.721 0.023 1099 ENSMUSG073541 Unknown 2.024 0.023 1100 NR_002851 Snord82 1.921 0.023 1101 NM_008874 Plcb3 0.777 0.023 1102 NM_007562 Bnc1 0.678 0.023 1103 NM_007719 Ccr7 1.641 0.023 1104 NM_018825 Sh2b2 1.652 0.023 1105 NM_023258 Pycard 0.574 0.023 1106 NM_199146 AI451617 2.092 0.023 1107 MI0000579 Unknown 1.709 0.024 1108 NM_028874 Snx19 0.746 0.024 1109 NM_001033164 2510002D24Rik 0.750 0.024 1110 NM_019941 Zfp235 0.629 0.024 1111 NM_028778 Nuak2 1.599 0.024 1112 NM_175384 Cdca2 0.550 0.024 1113 NM_007484 Rhoc 1.601 0.024 1114 NM_007610 Casp2 0.681 0.024 1115 NM_009697 Nr2f2 0.506 0.024 1116 AK170409 Gm14636 1.900 0.024 1117 NM_001002764 Smg6 0.731 0.024 1118 NM_001033156 Fbxo33 1.863 0.024 1119 N.C.A. - 0.718 0.024 1120 NM_028608 Glipr1 1.559 0.024 1121 GENSCAN0385395 Unknown 0.655 0.024 1122 NM_053207 Egln1 0.731 0.025 1123 AK220405 4930506M07Rik 0.636 0.025 1124 NM_011103 Prkcd 1.268 0.025 1125 NM_001081417 Chd7 1.667 0.025 1126 AY703837 Cd200r3 0.595 0.025 1127 NM_001081144 Zfp518b 0.749 0.025 1128 MI0000138 Unknown 1.553 0.025 1129 NM_001008233 Plekhn1 0.624 0.025 1130 NM_133203 Klra17 1.426 0.025 1131 NM_011331 Ccl12 2.530 0.025 1132 AK040631 A430110L20Rik 0.649 0.025 1133 NM_133215 Mtmr4 0.658 0.025 1134 BC016608 Unknown 1.962 0.025 1135 NM_172683 Pogz 0.759 0.025 1136 NM_008992 Abcd4 0.718 0.026 1137 GENSCAN0358514 Unknown 0.619 0.026

1138 NM_025833 Baiap2l1 1.404 0.026 1139 NM_001007568 Zfp251 0.721 0.026 1140 NM_025862 Acad8 0.690 0.026 1141 NM_001081117 Mki67 1.350 0.026 1142 NM_134023 Tbc1d10a 1.536 0.026 1143 NM_027113 Wdr5b 0.677 0.026 1144 NM_011098 Pitx2 0.573 0.026 1145 MI0000153 Unknown 0.677 0.026 1146 NM_010570 Irs1 0.522 0.026 1147 NM_019988 Gbl 0.670 0.026 1148 NM_011849 Nek4 0.752 0.026 1149 NM_028404 Top1mt 0.671 0.026 1150 NM_133871 Ifi44 1.643 0.026 1151 NM_013510 Epb4.1l1 0.732 0.026 1152 NM_174852 Phf12 0.700 0.026 1153 NM_008350 Il11 1.841 0.026 1154 NM_027460 Slc25a33 1.538 0.026 1155 NM_016887 Cldn7 1.674 0.026 1156 NM_009564 Zfp64 0.772 0.026 1157 NM_001025296 Dffa 0.754 0.026 1158 NM_001081347 Rhobtb1 0.687 0.026 1159 NM_021440 Ddc8 0.647 0.026 1160 NM_009364 Tfpi2 2.021 0.026 1161 NM_133753 Errfi1 2.319 0.027 1162 NM_145211 Oas1a 1.580 0.027 1163 NM_026696 0610030E20Rik 0.664 0.027 1164 NM_009531 Xpc 0.814 0.027 1165 XM_001003599 LOC677440 1.482 0.027 1166 GENSCAN0360722 Unknown 0.691 0.027 1167 NM_001081417 Chd7 1.975 0.027 1168 NM_008332 Ifit2 1.899 0.027 1169 NM_023538 Agk 0.768 0.027 1170 NM_025857 Aagab 0.718 0.027 1171 NM_172516 Ripk5 0.677 0.027 1172 NM_177381 Cog3 0.752 0.027 1173 NM_008368 Il2rb 1.465 0.027 1174 NM_001079686 Syne1 0.749 0.027 1175 NM_146588 Olfr1030 1.337 0.027 1176 ENSMUSG075275 Unknown 1.395 0.027 1177 ENSMUSG073863 Unknown 0.725 0.027 1178 NM_023230 Ube2v1 1.504 0.027 1179 XR_005074 LOC677168 1.568 0.028 1180 NM_201637 Chd8 0.724 0.028 1181 NM_029083 Ddit4 1.590 0.028 1182 NM_013489 Cd84 1.823 0.028 1183 NM_153139 Slc36a1 0.673 0.028

1184 NM_028193 Brf1 0.814 0.028 1185 NM_008851 Pitpnm1 1.297 0.028 1186 NM_138592 Usp39 0.801 0.028 1187 NM_021565 Midn 1.818 0.028 1188 NM_010927 Nos2 1.417 0.028 1189 NM_172731 Fgd5 0.799 0.028 1190 NM_001024504 Dcun1d2 0.704 0.028 1191 NM_144529 Arhgap17 0.813 0.028 1192 NM_013602 Mt1 2.188 0.028 1193 BC145673 D14Ertd668e 1.607 0.028 1194 BC094608 Arhgef4 0.665 0.028 1195 NM_001001806 Zfp36l2 0.647 0.028 1196 BC024452 Afmid 1.269 0.028 1197 NM_133986 Tcta 0.615 0.028 1198 NM_133687 Cxxc5 0.704 0.028 1199 NM_025778 Bcl2l14 0.766 0.028 1200 NM_001033257 Phactr2 0.685 0.028 1201 NM_015732 Axin2 0.653 0.028 1202 NM_009523 Wnt4 0.715 0.028 1203 NM_019494 Cxcl11 1.585 0.028 1204 NM_001081113 Ipo8 0.686 0.028 1205 NM_001081317 Anubl1 1.473 0.028 1206 NM_133238 Cd209a 1.681 0.028 1207 NM_153177 Eif2c4 0.638 0.029 1208 NM_172506 Boc 0.714 0.029 1209 NM_009621 Adamts1 2.162 0.029 1210 NM_053180 Ccrk 0.736 0.029 1211 NM_023740 Zdhhc16 0.762 0.029 1212 NM_011561 Tdg 1.331 0.029 1213 NM_027351 Ppil3 0.687 0.029 1214 NM_008756 Ocln 1.466 0.029 1215 NM_172615 1700021K19Rik 0.704 0.029 1216 NM_028833 Iqce 0.687 0.029 1217 NM_016858 Rab33b 0.834 0.029 1218 NM_153780 2610044O15Rik 0.629 0.029 GA_x5J8B7TT63N- 1219 AY096337 0.653 0.029 1148-873 1220 NM_138310 Apob48r 1.468 0.029 1221 NM_130877 Peg10 1.936 0.029 1222 NM_025873 Trit1 0.695 0.029 1223 NM_022983 Edg7 1.325 0.029 1224 NM_028028 Zswim1 0.611 0.029 1225 NM_001081962 Sap25 0.616 0.029 1226 NM_028362 2410018L13Rik 0.345 0.029 1227 NM_008630 Mt2 2.841 0.029 1228 NM_146012 Ctdsp2 0.667 0.030

1229 ENSMUST095760 Gm889 1.357 0.030 1230 NM_010612 Kdr 0.672 0.030 1231 NM_144877 Mettl13 0.699 0.030 1232 NM_028666 5430432M24Rik 1.677 0.030 1233 NM_153108 Defb8 1.467 0.030 1234 NM_010143 Ephb3 0.602 0.030 1235 NM_011848 Nek3 0.633 0.030 1236 NM_001081307 Ppp1r12b 0.769 0.030 1237 NM_153572 Katnal1 0.715 0.030 1238 NM_019651 Ptpn9 0.788 0.030 1239 NM_001080925 Rapgefl1 0.512 0.030 1240 BC094925 Slc22a15 1.415 0.030 1241 NM_001081417 Chd7 1.715 0.030 1242 NM_033134 Inpp5e 0.711 0.030 1243 NM_172514 Tmem71 1.565 0.030 1244 NM_027590 Ints10 0.762 0.030 1245 NM_026187 Ankzf1 0.684 0.030 1246 NM_027982 Ppm1j 1.588 0.030 1247 NM_175152 Thap3 0.744 0.031 1248 NM_172474 Tyw3 0.744 0.031 1249 NM_174850 Micall2 1.465 0.031 1250 NR_030675 D730005E14Rik 1.627 0.031 1251 N.C.A. - 1.428 0.031 1252 NM_007970 Ezh1 0.734 0.031 1253 BC052508 9030025P20Rik 0.692 0.031 1254 NM_181414 Pik3c3 0.666 0.031 1255 NM_001001983 Pi4ka 0.784 0.031 1256 NM_027558 Pgrmc2 0.719 0.031 1257 NM_026950 Ociad2 0.691 0.031 1258 NM_008620 Gbp4 1.804 0.031 1259 N.C.A. - 0.697 0.031 1260 NM_026521 Zfp706 0.736 0.031 1261 NM_016962 Spast 0.678 0.031 1262 AK007436 Adamts9 2.115 0.031 1263 NM_001081977 Rnf144 1.503 0.031 1264 NM_011691 Vav1 1.503 0.031 1265 NM_133746 Calhm2 0.640 0.031 1266 BC048850 Shb 1.625 0.031 1267 NM_019643 Tera 0.648 0.031 1268 NM_009850 Cd3g 1.346 0.032 1269 NM_001081417 Chd7 1.669 0.032 1270 NM_011770 Ikzf2 0.630 0.032 1271 NM_001037717 Slc38a6 0.615 0.032 1272 NM_023646 Dnaja3 0.755 0.032 1273 NM_144815 Cecr5 0.719 0.032 1274 NM_183296 Krtap16-10 1.262 0.032

1275 NM_012030 Slc9a3r1 1.465 0.032 1276 NM_010579 Eif6 1.506 0.032 1277 NC_000073 Gm10046 0.674 0.032 1278 NM_145468 Skp2 0.710 0.032 1279 NM_175518 D730040F13Rik 0.703 0.032 1280 NM_152808 Slc44a2 0.683 0.032 1281 NM_178618 2310040C09Rik 1.542 0.033 1282 BC048376 2310003H01Rik 1.411 0.033 1283 NM_001098636 Pwwp2 0.581 0.033 1284 NM_009022 Aldh1a2 0.743 0.033 1285 XM_907863 4933426I21Rik 0.575 0.033 1286 BC034069 BC034069 0.670 0.033 1287 NM_029888 Zfp142 0.679 0.033 1288 NM_177758 Zscan20 0.746 0.033 1289 NM_024248 Cars2 0.726 0.033 1290 NM_007757 Cpox 0.623 0.033 1291 XM_913399 Arl14 1.601 0.033 1292 NM_198103 Exoc8 0.707 0.033 1293 NM_001081746 EG665378 1.865 0.033 1294 NM_152895 Jarid1b 0.763 0.033 1295 NM_023136 Dtymk 0.752 0.033 1296 NM_134015 Fbxw11 1.276 0.033 1297 NM_178620 Mfsd11 0.610 0.033 1298 AK029314 Tes3-ps 1.401 0.033 1299 AK129042 Ppp2r5c 0.672 0.034 1300 NM_133735 Ptcd1 0.739 0.034 1301 NM_021433 Stx6 1.316 0.034 1302 NM_177725 Lrrc8a 1.445 0.034 1303 NM_008990 Pvrl2 1.559 0.034 1304 NM_029721 Snx27 0.671 0.034 1305 NM_029077 Trim14 0.710 0.034 1306 NM_173019 Pfkfb4 1.293 0.034 1307 NM_001005508 Arhgap30 1.289 0.034 1308 AK047224 Mafg 1.414 0.034 1309 NM_008367 Il2ra 1.569 0.034 1310 NM_183285 Kctd2 0.651 0.034 1311 NM_026576 Etaa1 0.550 0.034 1312 NM_009069 Rit1 0.686 0.034 1313 N.C.A. - 1.683 0.034 1314 ENSMUST022696 Xpo7 0.705 0.034 1315 NM_172288 Nup133 0.726 0.034 1316 GENSCAN0378867 - 0.794 0.034 1317 NM_175645 Xylt1 1.482 0.034 1318 NM_145382 Fam193b 0.667 0.035 1319 NM_029580 Trmt5 0.683 0.035 1320 NM_011777 Zyx 1.424 0.035

1321 NM_030116 Mrpl9 0.806 0.035 1322 NM_023684 Lime1 0.762 0.035 1323 NM_028235 Ttc30b 0.552 0.035 1324 NM_001033291 Usp40 0.657 0.035 1325 NM_146010 Tspan8 1.597 0.035 1326 GENSCAN0359831 Unknown 0.652 0.035 1327 NM_028784 F13a1 0.704 0.035 1328 XR_034641 LOC100048603 0.720 0.035 1329 NM_011580 Thbs1 2.403 0.035 1330 NM_001081417 Chd7 1.867 0.035 1331 NM_007651 Cd53 1.898 0.035 1332 NM_025806 Plbd1 1.540 0.035 1333 NM_011193 Pstpip1 1.398 0.035 1334 NM_010345 Grb10 0.800 0.035 1335 NM_001081417 Chd7 1.499 0.035 1336 NM_028043 D1Bwg0212e 0.794 0.035 1337 NM_146078 Ubr2 0.742 0.035 1338 NM_175507 Tmem20 0.661 0.035 1339 NM_029810 Nt5c2 1.188 0.035 1340 NM_001008502 Bbs12 0.729 0.035 1341 NM_178892 Tiparp 2.317 0.035 1342 NM_001081417 Chd7 1.856 0.035 1343 ENSMUSG070035 Unknown 0.816 0.035 1344 NM_153592 Erlin2 0.771 0.035 1345 NM_146089 Ccdc5 0.737 0.035 1346 NM_001033922 Treml4 1.565 0.035 1347 NM_001163314 Pgap1 0.596 0.035 1348 NM_029545 6530401N04Rik 0.738 0.035 1349 NM_007403 Adam8 2.082 0.035 1350 BC094315 D230010M03Rik 0.720 0.035 1351 BC040791 B230208H17Rik 0.792 0.035 1352 NM_013673 Sp100 1.766 0.035 1353 NM_001001738 BC063749 1.391 0.036 1354 NM_175179 2810002O09Rik 0.735 0.036 1355 BC058418 2310061I04Rik 0.761 0.036 1356 NM_201258 Oog3 1.182 0.036 1357 NM_011599 Tle1 0.758 0.036 1358 NM_001080813 Rab11fip1 1.545 0.036 1359 NM_011612 Tnfrsf9 1.469 0.036 1360 NM_177359 6030490I01Rik 0.587 0.036 1361 NM_027425 Rufy2 0.654 0.037 1362 AK220421 1200015N20Rik 0.696 0.037 1363 BC038064 5830404H04Rik 0.810 0.037 1364 NM_177573 9930104L06Rik 0.687 0.037 1365 NM_001080929 Cdr2l 1.700 0.037 1366 BC107378 Pyhin1 1.773 0.037

1367 NM_010226 Fkhl18 1.703 0.037 1368 ENSMUSG059332 Unknown 0.750 0.037 1369 NM_207671 Zfp318 0.579 0.037 1370 NM_172557 Rufy1 0.754 0.037 1371 NM_026552 Arpc4 1.311 0.037 1372 N.C.A. - 1.438 0.037 1373 NM_007832 Dck 1.447 0.037 1374 NM_029509 5830443L24Rik 1.472 0.037 1375 NM_146261 BC031748 0.703 0.037 1376 NM_173390 Nhsl1 0.606 0.037 1377 NM_145934 AW049765 1.424 0.037 1378 U29511 Zfp78 0.813 0.037 1379 ENSMUSG073645 Unknown 0.673 0.038 1380 NM_175284 Fzd10 0.673 0.038 1381 NM_177226 Zfp629 0.705 0.038 1382 NM_019992 AI586015 1.489 0.038 1383 NM_146175 Zfp282 0.721 0.038 1384 NM_130447 Dusp16 1.738 0.038 1385 NM_030750 Sgpp1 0.639 0.038 1386 AK149456 C730015B19 1.485 0.038 1387 BC052902 Gdap10 1.757 0.038 1388 N.C.A. - 2.216 0.038 1389 ENSMUST031549 EG240327 2.016 0.038 1390 NM_028967 Batf2 1.475 0.038 1391 NM_022882 Lpin2 1.311 0.038 1392 NM_199068 Foxk1 0.755 0.038 1393 AK122307 Gpatch8 0.691 0.038 1394 NM_015792 Fbxo18 0.687 0.038 1395 XM_001472441 LOC100039226 1.815 0.038 1396 NM_010720 Lipg 1.747 0.038 1397 AK220341 4921513D23Rik 0.739 0.038

1398 AK081107 Gm9983 0.674 0.038 1399 NM_145510 Rabif 0.809 0.038 1400 NM_027698 Exod1 0.591 0.038 1401 BC103777 Zscan29 0.695 0.039 1402 NM_023168 Grina 1.468 0.039 1403 NM_175440 Prss27 1.604 0.039 1404 NM_001081014 Dennd4c 0.691 0.039 1405 NM_177409 Tram2 0.693 0.039 1406 NM_182990 Ssrp1 0.845 0.039 1407 NM_178729 Fbxl5 1.484 0.039 1408 NM_008358 Il15ra 1.575 0.039 1409 NM_008739 Nsd1 0.669 0.039 1410 XM_001477444 1700066J24Rik 1.247 0.039 1411 NM_007596 Caml 0.809 0.040 1412 NM_030166 Galntl2 0.589 0.040

1413 NM_199033 Tsen2 0.678 0.040 1414 NM_173738 BC027344 0.799 0.040 1415 NM_029937 Nup210l 1.473 0.040 1416 NM_178110 Trim62 0.650 0.040 1417 NM_175256 Heg1 0.718 0.040 1418 NM_013705 Zfp30 0.781 0.040 1419 NM_177684 Zfp637 0.574 0.040 1420 NM_172513 Fam126b 0.616 0.040 1421 AC087117.9 Unknown 1.607 0.040 1422 NM_008577 Slc3a2 1.401 0.040 1423 AK083217 Iqcc 0.713 0.040 1424 NM_001083882 1600012H06Rik 0.747 0.040 1425 XR_033605 LOC432565 1.324 0.040 1426 NM_016684 Zscan12 0.720 0.040 1427 AK048760 C230049M14 1.583 0.040 1428 BC112902 BC013481 1.427 0.040 1429 NM_139144 Ogt 0.678 0.040 1430 NM_008059 G0s2 1.629 0.040 1431 NM_027008 Kctd5 1.346 0.040 1432 XR_033749 LOC677259 1.851 0.040 1433 NM_001081043 Ptpn23 1.455 0.040 1434 NR_030694 1110002L01Rik 0.596 0.040 1435 NM_198160 Smarcc2 0.755 0.040 1436 NM_027880 Telo2 0.715 0.041 1437 NM_010469 Hoxd4 0.657 0.041 1438 NM_010721 Lmnb1 1.475 0.041 1439 NM_027905 1300018J18Rik 0.719 0.041 1440 NM_023317 Nde1 0.786 0.041 1441 NM_028261 Tmem173 1.876 0.041 1442 NM_133879 Zbtb48 0.831 0.041 1443 GENSCAN0420962 Unknown 0.699 0.041 1444 NM_011014 Oprs1 0.688 0.041 1445 NM_027346 Ccdc44 0.709 0.041 1446 NM_009149 Glg1 0.717 0.041 1447 NM_018802 Syt8 0.789 0.041 1448 NM_198942 Dhx57 0.703 0.041 1449 NM_013613 Nr4a2 2.137 0.041 1450 NM_183000 Accn3 1.345 0.041 1451 NM_010700 Ldlr 1.721 0.041 1452 NM_026878 Rasl11b 0.725 0.041 1453 NM_025610 Asrgl1 0.799 0.042 1454 NM_134158 Cd300d 1.471 0.042 1455 NM_010789 Meis1 0.635 0.042 1456 NM_153168 Lars2 0.729 0.042 1457 NM_145432 Heatr6 0.807 0.042 1458 NM_010066 Dnmt1 0.811 0.042

1459 XM_885087 LOC620695 1.762 0.042 1460 NM_178394 Jakmip1 0.774 0.042 1461 NM_028301 Anks3 0.809 0.042 1462 NM_030236 Fbxo34 1.293 0.042 1463 NM_011451 Sphk1 2.402 0.042 1464 NM_026936 Oxa1l 0.710 0.042 1465 NM_177698 Psd3 0.707 0.042 1466 NM_027534 Fvt1 0.708 0.042 1467 GENSCAN0424223 Unknown 0.603 0.042 1468 ENSMUSG075019 Unknown 0.780 0.042 1469 NM_176999 Atp10b 0.711 0.043 1470 NM_016851 Irf6 1.432 0.043 1471 NM_023173 Dusp12 0.714 0.043 1472 NM_027163 Il1f8 1.260 0.043 1473 NM_019937 Ccnl1 2.230 0.043 1474 NM_175091 Tnks 0.789 0.043 1475 NM_010743 Il1rl1 1.322 0.043 1476 NM_178070 Vps33b 0.707 0.043 1477 AF357372 Snord49a 1.715 0.044 1478 NM_199018 Stard8 0.540 0.044 1479 NM_183275 1110002N22Rik 0.746 0.044 1480 NM_172979 Muc15 1.179 0.044 1481 ENSMUSG073751 Unknown 1.279 0.044 1482 NM_029162 Zfp509 0.801 0.044 1483 AK017419 5530400B01Rik 1.731 0.044 1484 XR_001627 EG668139 1.900 0.044 1485 NM_175528 E330009J07Rik 0.772 0.044 1486 NM_023397 1810034K20Rik 0.677 0.045 1487 NM_177545 Vangl1 0.780 0.045 1488 NM_009568 Zfp94 0.703 0.045 1489 NM_028948 Ccdc11 1.249 0.045 1490 NM_001042671 Prei4 2.010 0.045 1491 NM_183138 Tet3 0.772 0.045 1492 ENSMUST043914 Ints9 0.714 0.045 1493 NM_029464 4930588N13Rik 1.230 0.046 1494 NM_001098237 Zbtb3 0.776 0.046 1495 NM_009477 Upp1 1.606 0.046 1496 MI0000696 Unknown 1.355 0.046 1497 NM_172371 Slc16a13 0.729 0.046 1498 NM_029654 Atg2b 0.781 0.046 1499 NM_017476 Akap8l 0.695 0.046 1500 NM_007626 Cbx5 0.699 0.046 1501 NM_133982 Rpp25 0.656 0.046 1502 NM_008250 Hlx 1.399 0.046 1503 NM_001033540 EG330503 0.742 0.046 1504 NM_201518 Flrt2 0.674 0.046

1505 NM_001008425 Thoc6 1.375 0.046 1506 NM_013498 Crem 1.783 0.046 1507 NM_001085495 Arfgef2 0.774 0.046 1508 NM_001146704 Mamstr 1.383 0.046 1509 NM_013673 Sp100 1.563 0.046 1510 NM_178664 B3gntl1 0.705 0.046 1511 NM_001011736 Olfr205 1.276 0.046 1512 NM_177816 Sh2d4b 1.317 0.046 1513 NM_027764 Rcbtb1 0.676 0.046 1514 NM_177388 Slc41a2 1.560 0.046 1515 NM_153194 Zfp740 0.754 0.046 1516 NM_032544 Gtpbp3 0.755 0.046 1517 NM_001040106 Aak1 0.795 0.047 1518 NM_021792 Iigp1 2.643 0.047 1519 NM_144874 Cox15 0.702 0.047 1520 GENSCAN0373676 Unknown 0.770 0.047 1521 NM_001163015 Gprasp2 0.721 0.047 1522 NM_011792 Bace1 0.827 0.047 1523 NM_013614 Odc1 1.841 0.047 1524 NM_001115076 Camsap1 0.761 0.047 1525 NM_001081419 Dip2a 0.761 0.047 1526 NM_008977 Ptpn2 2.210 0.047 1527 NM_026929 Chac1 1.340 0.047 1528 BC025846 Prr12 0.633 0.047 1529 NM_145633 Ankrd27 0.777 0.047 1530 XM_001477842 LOC100041932 1.288 0.047 1531 NM_027184 Ipmk 1.320 0.047 1532 NM_001004164 Gnptab 0.705 0.048 1533 N.C.A. 1.447 0.048 1534 NM_021396 Pdcd1lg2 1.532 0.048 1535 ENSMUST096607 EG665378 1.527 0.048 1536 ENSMUST097776 Cnnm3 0.697 0.048 1537 NM_001033534 Layn 1.517 0.048 1538 NM_011663 Zrsr1 0.673 0.048 1539 NM_178873 Adck2 0.672 0.048 1540 NM_173757 Mrps27 0.743 0.048 1541 NM_010479 Hspa1a 1.463 0.048 1542 NM_026858 Xrcc6bp1 0.777 0.049 1543 NM_177782 BC067047 1.364 0.049 1544 NM_197944 Hsh2d 1.389 0.049 1545 NM_172456 Endogl1 0.742 0.049 1546 NM_001080814 Fat3 0.724 0.049 1547 ENSMUSG042579 4632404H12Rik 0.771 0.049 1548 MI0000555 Unknown 1.202 0.049 1549 NM_007645 Cd37 1.470 0.049 1550 NM_008873 Plau 1.469 0.049

1551 NM_054098 Steap4 2.602 0.049 1552 NM_028428 Fut11 0.756 0.049 1553 NM_008269 Hoxb6 0.702 0.049 1554 ENSMUST086876 Pot1b 0.632 0.049 1555 BC058649 Slc39a9 0.804 0.049 1556 NM_183321 BC053749 0.603 0.049 1557 NM_198405 Sirpb1 1.998 0.049 1558 NM_183155 BC002230 0.712 0.049 1559 AC122390.4 Unknown (2 gene) 0.802 0.049 1560 NM_175476 Arhgap25 1.440 0.049 1561 NM_013919 Usp21 0.687 0.049 1562 NM_011972 Poli 0.709 0.050 1563 XR_034598 LOC633030 1.300 0.050 1564 NM_138686 Cys1 0.682 0.050

CBA 1 GENSCAN0360855 Unknown 12.995 0.000 2 NM_016960 Ccl20 4.910 0.000 3 NM_011407 Slfn1 4.008 0.000 4 NM_008361 Il1b 15.401 0.000 5 NM_009140 Cxcl2 15.858 0.000 6 NM_021274 Cxcl10 11.651 0.000 7 NM_001001495 Tnip3 5.713 0.000 8 NM_011346 Sell 3.926 0.001 9 NM_011347 Selp 4.983 0.001 10 NM_010696 Lcp2 2.341 0.001 11 NM_011337 Ccl3 13.056 0.001 12 NM_021406 Trem1 6.460 0.001 13 NM_008331 Ifit1 7.815 0.001 14 NM_009114 S100a9 8.071 0.001 15 NM_007782 Csf3r 4.209 0.001 16 NM_009141 Cxcl5 6.161 0.001 17 NM_153510 Pilra 2.008 0.001 18 NM_010819 Clec4d 5.201 0.001 19 N.C.A. - 8.264 0.001 20 XM_001480292 LOC100048461 2.606 0.001 21 NM_011090 Pira3 1.924 0.001 22 NM_011332 Ccl17 3.472 0.001 23 NM_194446 Cdk10 0.792 0.001 24 NM_020049 Slc6a14 7.504 0.001 25 NM_008147 Gp49a 4.484 0.001 26 NM_011333 Ccl2 5.955 0.001 27 NM_011331 Ccl12 3.933 0.001 28 NM_181596 Retnlg 8.221 0.001 29 NM_031167 Il1rn 3.322 0.001

30 NM_010554 Il1a 6.900 0.001 31 NM_013650 S100a8 7.644 0.001 32 NM_001081687 LOC381484 2.774 0.001 33 NM_011260 Reg3g 9.087 0.001 34 NM_009402 Pglyrp1 2.612 0.001 35 NM_133809 Kmo 1.573 0.001 36 NM_008328 Ifi203 2.643 0.001 37 NM_013532 Lilrb4 3.292 0.001 38 NM_009397 Tnfaip3 3.251 0.001 39 NM_013654 Ccl7 5.123 0.001 40 NM_011408 Slfn2 2.468 0.001 41 NM_021384 Rsad2 5.276 0.001 42 NM_010907 Nfkbia 2.492 0.001 43 NM_139227 Atxn7 0.793 0.001 44 L38281 Irg1 5.827 0.001 45 NM_021407 Trem3 3.099 0.001 46 NM_153511 Il1f9 8.057 0.001 47 NM_025777 Duoxa2 3.070 0.001 48 NM_172659 Slc2a6 2.584 0.001 49 NM_013613 Nr4a2 0.329 0.001 50 NM_001010834 Slc10a5 0.610 0.001 51 NM_198405 Sirpb1 2.469 0.001 52 NM_198405 Sirpb1 3.425 0.001 53 AB112025 Sirpb1 2.232 0.001 54 NM_001085419 OTTMUSG010432 1.652 0.001 55 NM_172689 Ddx58 1.449 0.001 56 NM_153159 Zc3h12a 2.848 0.001 57 NM_144907 Sesn2 0.701 0.001 58 NM_177162 9930032O22Rik 4.351 0.001 59 NM_008036 Fosb 0.242 0.001 60 NM_053080 Aldh1a3 2.002 0.001 61 NM_009277 Trim21 1.526 0.001 62 NM_172476 Tmc7 0.612 0.001 63 NM_008872 Plat 2.795 0.001 64 NM_010493 Icam1 3.267 0.001 65 NM_007535 Bcl2a1c 2.183 0.001 66 NM_008348 Il10ra 1.569 0.001 67 NM_007536 Bcl2a1d 2.150 0.001 68 NM_009912 Ccr1 3.021 0.001 69 ENSMUST067529 Sytl5 0.753 0.001 70 NM_022415 Ptges 1.714 0.001 71 NM_181071 Tanc2 0.702 0.002 72 NM_007780 Csf2rb 2.199 0.002 73 NM_023386 Rtp4 2.766 0.002 74 N.C.A. - 2.778 0.002 75 NM_009841 Cd14 3.456 0.002

76 NM_025717 Rbm4b 0.781 0.002 77 NM_019983 Rabgef1 0.845 0.002 78 NM_015801 Pnpla6 0.842 0.002 79 NM_011410 Slfn4 5.171 0.002 80 NM_013693 Tnf 2.277 0.002 81 NM_008332 Ifit2 2.195 0.002 82 NM_031168 Il6 6.288 0.002 83 XR_032098 LOC545747 1.165 0.002 84 NM_011926 Ceacam1 2.166 0.002 85 NM_011636 Plscr1 2.622 0.002 86 ENSMUST020321 Unknown 2.766 0.002 87 NM_010330 Emb 1.913 0.002 88 NM_007781 Csf2rb2 1.883 0.002 89 NM_018778 Cldn8 0.627 0.002 90 ENSMUST087884 Unknown 1.726 0.002 91 NM_011693 Vcam1 2.200 0.002 92 GENSCAN0402007 Unknown 2.284 0.002 93 NM_007403 Adam8 2.428 0.002 94 NM_008611 Mmp8 6.562 0.002 95 mmu-mir-223 MI0000703 2.028 0.002 96 NM_177320 Pik3r5 1.565 0.002 97 ENSMUST0100512 Unknown 3.162 0.002 98 NM_030720 Gpr84 2.444 0.002 99 NM_001082546 BC100530 2.104 0.002 100 NM_011355 Sfpi1 1.771 0.002 101 NM_145532 Mall 2.045 0.002 102 NM_153564 Gbp5 3.299 0.002 103 BC037703 BC037703 1.656 0.002 104 NM_007651 Cd53 1.924 0.002 105 NM_008176 Cxcl1 3.508 0.002 106 NM_008400 Itgal 1.558 0.002 107 NM_030691 Igsf6 1.975 0.002 108 NM_013721 Rpl7a 2.226 0.002 109 NM_007464 Birc3 2.329 0.002 110 NM_153420 Acpl2 0.789 0.002 111 NM_010908 Nfkbib 1.593 0.002 112 GENSCAN0409278 Unknown 1.442 0.002 113 NM_011267 Rgs16 2.529 0.002 114 NM_011210 Ptprc 1.798 0.002 115 N.C.A. - 2.374 0.002 116 ENSMUST020855 Unknown 0.768 0.002 117 NM_009396 Tnfaip2 2.292 0.002 118 NM_030677 Gpx2 2.257 0.002 119 ENSMUST096063 Gm608 0.772 0.002 120 NR_003508 Mx2 2.860 0.002 121 ENSMUST031549 EG240327 2.129 0.002

122 ENSMUST025207 Unknown 2.442 0.002 123 NM_023044 Slc15a3 2.242 0.002 124 ENSMUST0100422 Unknown 0.605 0.002 125 NM_008489 Lbp 1.645 0.002 126 ENSMUST099660 Unknown 0.753 0.002 127 NM_178047 Prom2 0.821 0.002 128 NM_011470 Sprr2d 1.687 0.002 129 NM_198412 Dnajc6 0.839 0.002 130 NM_001081211 Ptafr 1.515 0.002 131 NM_010208 Fgr 1.951 0.002 132 NM_011315 Saa3 4.840 0.002 133 NM_007609 Casp4 2.568 0.002 134 ENSMUST076326 AB124611 1.437 0.002 135 NM_008522 Ltf 2.173 0.002 136 NM_011593 Timp1 3.822 0.002 137 NM_030719 Gats 0.720 0.003 138 NM_001082543 Stfa1 2.022 0.003 139 NM_010266 Gda 1.754 0.003 140 NM_001005421 Amica1 1.429 0.003 141 NM_030694 Ifitm2 1.302 0.003 142 NM_011980 Zfp146 0.909 0.003 143 NM_001081035 Nav3 1.725 0.003 144 NM_023380 Samsn1 2.790 0.003 145 BC046418 Cdc42bpg 0.807 0.003 146 NM_008491 Lcn2 4.110 0.003 147 NM_026414 Asprv1 2.033 0.003 148 NM_001039530 Parp14 1.790 0.004 149 NM_001082545 Stfa2 2.663 0.004 150 NR_002896 Snord22 1.248 0.004 151 NM_001005858 LOC667370 2.394 0.004 152 NM_133832 Rdh10 2.252 0.005 153 NM_018775 Tbc1d8 0.673 0.005 154 NM_013499 Crry 1.108 0.005 155 NM_008476 Krt6a 2.574 0.005 156 NM_010501 Ifit3 2.805 0.005 157 NM_011976 Sema4g 0.637 0.005 158 NM_019408 Nfkb2 1.815 0.005 159 NM_019835 B4galt5 2.039 0.005 160 NM_001033308 BC013712 1.685 0.005 161 NM_053109 Clec2d 1.759 0.005 162 NM_031198 Tcfec 2.293 0.005 163 ENSMUST026564 Ifitm1 1.586 0.005 164 NM_026235 Larp6 1.317 0.005 165 NM_011636 Plscr1 2.553 0.005 166 NM_175027 Fancb 0.691 0.005 167 NM_021550 C1galt1c1 0.815 0.005

168 NM_008329 Ifi204 2.583 0.005 169 NM_001081150 Lonrf1 0.639 0.005 170 XM_905096 Irgb10 2.526 0.005 171 NM_011157 Srgn 1.663 0.005 172 NM_170701 Cd40 1.680 0.005 173 NM_009873 Cdk6 1.471 0.005 174 NM_177610 Duox2 1.380 0.005 175 NM_138648 Olr1 1.681 0.005 176 NM_001037712 Kcnh6 1.309 0.005 177 ENSMUST044324 5730557B15Rik 1.302 0.005 178 NM_009851 Cd44 1.723 0.005 179 NM_019494 Cxcl11 2.364 0.005 180 NM_007843 Defb1 0.542 0.005 181 NM_001005846 Mcoln2 2.788 0.005 182 NM_026405 Rab32 1.488 0.005 183 BC027208 Rps25 1.798 0.005 184 NM_145545 Gbp6 1.638 0.005 185 XR_032826 LOC631400 1.386 0.005 186 NM_030682 Tlr1 1.671 0.005 187 NM_010111 Efnb2 0.815 0.005 188 NM_133990 Il13ra1 1.703 0.005 189 XM_912534 EG333830 1.148 0.005 190 DQ341272 Treml2 1.499 0.005 191 NM_001081957 OTTMUSG000971 2.064 0.006 192 NM_011471 Sprr2e 2.156 0.006 193 NM_024444 Cyp4f18 1.753 0.006 194 NM_019770 Tmed2 1.635 0.006 195 NM_008690 Nfkbie 1.693 0.006 196 NM_028060 Slc35f2 1.634 0.006 197 ENSMUST099956 LOC383735 1.341 0.006 198 NM_023158 Cxcl16 1.619 0.006 199 NM_145437 4732429D16Rik 1.712 0.006 200 NM_009251 Serpina3g 2.833 0.006 201 NM_021551 Slc22a17 0.787 0.006 202 NM_011019 Osmr 1.962 0.006 203 NM_021359 Itgb6 1.603 0.006 204 NM_008230 Hdc 2.438 0.006 205 NM_010809 Mmp3 1.351 0.006 206 NM_001034859.1 EG225594 2.442 0.006 207 ENSMUST096010 Unknown 0.773 0.006 208 NM_031181 Siglece 1.759 0.006 209 NM_031376 Pik3ap1 1.631 0.006 210 NM_011604 Tlr6 1.326 0.006 211 NM_009137 Ccl22 1.895 0.006 212 ENSMUST061047 Unknown 0.721 0.006 213 NM_172785 Zc3h12d 1.485 0.006

214 NM_010999 Olfr56 2.237 0.006 215 NM_013652 Ccl4 1.830 0.006 216 ENSMUST042416 Unknown 1.829 0.006 217 NM_010663 Krt17 1.459 0.006 218 NM_134131 Tnfaip8 1.213 0.006 219 ENSMUST031639 Unknown 1.188 0.006 220 XM_895013 1700055N04Rik 1.270 0.006 221 NM_172404 Ccbl1 0.789 0.006 222 NM_145209 Oasl1 2.266 0.006 223 NM_139294 Braf 0.868 0.006 224 NM_001013365 Osm 2.252 0.006 225 NM_007539 Bdkrb1 2.577 0.006 226 NM_028785 Dock8 0.765 0.006 227 NM_130452 Bbox1 0.620 0.006 228 NM_139309 Fcmd 0.804 0.006 229 NM_013706 Cd52 1.517 0.006 230 NM_007577 C5ar1 1.502 0.006 231 NM_153101 Mrgpra2 4.201 0.006 232 NM_173445 Rccd1 0.814 0.006 233 NM_031195 Msr1 2.425 0.006 234 ENSMUST098782 Unknown 1.478 0.006 235 GENSCAN0415289 Unknown 1.254 0.006 236 ENSMUST020017 Unknown 0.865 0.006 237 NM_008501 Lif 2.078 0.006 238 NM_008070 Gabrb2 0.642 0.006 239 NM_020557 Tyki 2.547 0.006 240 NM_001034870 Serpina3h 2.016 0.006 241 NM_009252 Serpina3n 2.378 0.006 242 ENSMUST082745 Unknown 0.607 0.006 243 NM_011161 Mapk11 1.706 0.006 244 BC141885 Unknown 1.397 0.006 245 NM_133731 Prss22 2.487 0.006 246 ENSMUST071855 Unknown 1.332 0.006 247 ENSMUST058632 Unknown 0.812 0.006 248 NM_026720 Ankrd13d 0.836 0.006 249 XM_975226 EG635702 0.744 0.006 250 NM_008689 Nfkb1 1.648 0.006 251 AK137636 9930005F22Rik 0.810 0.006 252 NM_177861 Tmem67 0.812 0.006 253 NM_133203 Klra17 1.870 0.006 254 NM_175089 Nek1 0.778 0.006 255 NM_008317 Hyal1 0.720 0.006 256 NM_198105 ORF34 0.852 0.006 257 NM_008677 Ncf4 1.445 0.006 258 NM_012013 Figla 1.144 0.007 259 NM_008518 Ltb 1.380 0.007

260 NM_001081411 Sclt1 0.696 0.007 261 ENSMUST026564 Ifitm1 1.470 0.007 262 XR_032778 LOC668181 1.436 0.007 263 NM_205820 Tlr13 1.733 0.007 264 XR_033047 LOC668034 1.340 0.007 265 NM_019963 Stat2 1.701 0.007 266 NM_011640 Trp53 1.328 0.007 267 NM_029005 Mlkl 1.802 0.007 268 ENSMUST080220 Unknown 1.486 0.007 269 NM_008773 P2ry2 1.936 0.007 270 N.C.A. - 0.823 0.007 271 ENSMUST074994 Unknown 1.467 0.007 272 NM_019980 Litaf 1.473 0.007 273 NM_145619 Parp3 1.241 0.007 274 NM_018738 Igtp 2.081 0.007 275 NM_016767 Batf 1.528 0.007 276 NM_025950 Cdc37l1 0.855 0.007 277 EF660528 AW112010 2.118 0.007 278 NM_008091 Gata3 0.717 0.007 279 NM_030701 Gpr109a 2.468 0.007 280 BC100510 EG434181 1.226 0.007 281 NM_001033632 Ifitm6 1.979 0.007 282 NM_013653 Ccl5 1.678 0.008 283 NM_009008 Rac2 1.411 0.008 284 NM_172964 Arhgap28 0.733 0.008 285 NM_021606 Nek6 1.884 0.008 286 NM_027998 Cldn23 0.788 0.008 287 NM_053073 Lrp8 1.547 0.008 288 BC107378 Pyhin1 2.103 0.008 289 GENSCAN0406949 Unknown 1.850 0.008 290 NM_146030 Plekhh3 0.759 0.008 291 NM_144559 Fcgr4 1.480 0.008 292 NM_146010 Tspan8 1.406 0.008 293 AF357355 Rian 0.591 0.008 294 DQ087180 B430306N03Rik 1.788 0.008 295 ENSMUST095859 Unknown 0.678 0.008 296 NM_010243 Fut9 0.669 0.008 297 ENSMUST001113 Unknown 1.520 0.008 298 ENSMUST098351 Unknown 1.272 0.008 299 ENSMUST049461 Unknown 0.800 0.008 300 NM_008988 Punc 0.859 0.008 301 N.C.A. - 0.831 0.008 302 NM_010851 Myd88 1.602 0.008 303 NM_009477 Upp1 1.741 0.008 304 ENSMUST088473 Unknown 1.421 0.008 305 NM_009720 Atox1 0.873 0.008

306 NM_130877 Peg10 2.169 0.008 307 NM_133798 Exdl2 0.844 0.009 308 NM_025394 Tomm7 0.828 0.009 309 NM_144925 Tnrc6a 0.754 0.009 310 NM_033601 Bcl3 2.734 0.009 311 N.C.A. - 1.337 0.009 312 NM_025860 Ddx18 1.273 0.009 313 NM_027773 2310047D13Rik 1.475 0.009 314 NM_011292 Rpl9 1.410 0.009 315 ENSMUST099405 Unknown 2.918 0.009 316 ENSMUST0102996 4930452B06Rik 0.755 0.009 317 NM_007826 Dach1 0.661 0.009 318 NM_173769 Zfp641 0.822 0.009 319 ENSMUST099532 Unknown 1.315 0.009 320 XR_033414 LOC664953 1.320 0.009 321 NM_001038499 Arsi 1.198 0.009 322 ENSMUST084161 similartoSWI 1.368 0.009 323 NM_010727 Lnx1 0.816 0.009 324 NM_008012 Akr1b8 2.240 0.009 325 NM_019691 Gria4 0.831 0.009 326 NM_172536 Zfp609 0.739 0.009 327 NM_026496 Grhl2 0.803 0.009 328 NM_010444 Nr4a1 0.364 0.009 329 NM_028064 Slc39a4 1.649 0.009 330 ENSMUST080677 Unknown 1.332 0.009 331 NM_008904 Ppargc1a 0.458 0.009 332 NM_013563 Il2rg 1.652 0.009 333 NM_008327 Ifi202b 2.284 0.009 334 NM_025447 Dimt1 1.374 0.009 335 NM_029850 Bcl7a 0.800 0.009 336 NM_172960 Adck5 0.774 0.009 337 ENSMUST064200 Tmem106c 0.798 0.009 338 NM_020566 Dnajc4 0.824 0.009 339 NM_178778 A930041I02Rik 0.779 0.009 340 NM_009763 Bst1 1.485 0.009 341 NM_019935 Ovol1 0.674 0.010 342 NM_009779 C3ar1 1.458 0.010 343 NM_001077189 Fcgr2b 1.492 0.010 344 N.C.A. - 0.780 0.010 345 NM_181545 Slfn8 1.602 0.010 346 NM_026556 Dynll2 0.845 0.010 347 XM_204772 EG277089 1.519 0.010 348 NM_207708 Syngr1 0.855 0.010 349 N.C.A. - 0.683 0.010 350 NM_009177 St3gal1 1.674 0.010 351 NM_008338 Ifngr2 1.508 0.010

352 NM_145125 Brwd1 0.829 0.010 353 ENSMUST023655 Unknown 1.926 0.010 354 NM_001033922 Treml4 1.718 0.010 355 NM_001081223 Rbbp8 0.768 0.010 356 NM_009890 Ch25h 2.702 0.010 357 NM_011905 Tlr2 2.167 0.010 358 NM_011673 Ugcg 1.833 0.010 359 NM_175437 A530088I07Rik 1.584 0.010 360 ENSMUST058258 Unknown 0.771 0.010 361 NM_177561 Usp46 0.768 0.010 362 NM_175092 Rhof 1.503 0.010 363 AK143453 ENSMUSG072690 0.632 0.010 364 XM_994291 Prkcz2 0.768 0.010 365 NM_001024673 EG330496 1.256 0.010 366 NM_029767 Rps9 0.878 0.010 367 ENSMUST026573 1600016N20Rik 0.775 0.010 368 NM_028175 Lrrc8e 0.760 0.010 369 XR_033709 LOC100042289 1.401 0.010 370 NM_173413 Rab8b 1.355 0.010 371 ENSMUST065703 9930022N03Rik 1.819 0.010 372 NM_011458.1 Serpina3K 1.851 0.010 373 NM_145827 Nlrp3 2.167 0.010 374 N.C.A. - 1.174 0.010 375 ENSMUST091817 Pstpip2 1.692 0.010 376 XM_001474881 LOC100040538 0.736 0.010 377 NM_010655 Kpna2 1.458 0.010 378 NM_008778 Pak3 0.742 0.010 379 NM_010170 F2rl2 1.359 0.010 380 NM_008402 Itgav 1.213 0.010 381 NM_022320 Gpr35 1.354 0.010 382 ENSMUST091374 Unknown 1.352 0.010 383 XM_001476014 EG632013 0.886 0.010 384 mmu-mir-219-1 MI0000702 1.333 0.010 385 NM_139198 Plac8 2.021 0.010 386 NM_153585 Cnot10 0.827 0.010 387 NM_031881 Nedd4l 1.382 0.010 388 NM_010553 Il18rap 1.777 0.011 389 NM_023735 Actr3 1.208 0.011 390 NM_001037713 Fbxo39 1.481 0.011 391 NM_033374 Dock2 1.211 0.011 392 NM_010431 Hif1a 1.532 0.011 393 NM_007987 Fas 1.903 0.011 394 NM_030612 Nfkbiz 1.786 0.011 395 NM_009812 Casp8 1.486 0.011 396 NM_001080933 Ankfn1 0.641 0.011 397 BC028900 Plekhh1 0.767 0.011

398 NM_172592 Sfrs12 0.840 0.011 399 NM_011246 Rasgrp1 1.316 0.011 400 NM_009861 Cdc42 1.102 0.011 401 NM_009898 Coro1a 1.439 0.011 402 NM_133238 Cd209a 2.116 0.011 403 NM_028679 Irak3 1.618 0.011 404 NM_153179 Pkhd1 0.805 0.011 405 NM_008198 Cfb 1.716 0.011 406 NM_008714 Notch1 0.778 0.011 407 NM_009143 Sdf2 0.821 0.011 408 GENSCAN0380192 Unknown 1.876 0.011 409 GENSCAN0411269 Unknown 1.688 0.012 410 NM_026835 Ms4a6d 2.081 0.012 411 NM_001013785 Akr1c19 0.827 0.012 412 XR_001887 EG625969 1.320 0.012 413 NM_001081069 Rgs11 0.787 0.012 414 NM_013861 Tpk1 0.783 0.012 415 ENSMUST0100556 Unknown 1.861 0.012 416 NM_001013371 Dtx3l 1.596 0.012 417 NM_026616 Rnaseh2c 0.900 0.012 418 BC028561 Gm568 1.407 0.012 419 NM_172142 AY078069 1.625 0.012 420 NM_029821 1190003J15Rik 2.053 0.012 421 NM_178256 Reps2 0.797 0.012 422 NM_198092 Usp2 0.610 0.012 423 NM_021327 Tnip1 1.487 0.012 424 NM_019588 Plce1 0.837 0.013 425 NM_001017427 Rasef 0.870 0.013 426 M31319.1 N.C.A. 1.305 0.013 427 NM_001079824 Hnrph3 0.808 0.013 428 NM_007714 Clk4 0.740 0.013 429 NM_010669 Krt6b 1.823 0.013 430 NM_026985 1810033B17Rik 1.635 0.013 431 NM_177130 Glt28d2 0.810 0.013 432 NM_008390 Irf1 1.671 0.013 433 ENSMUST042610 Unknown 1.800 0.013 434 NM_001081168 Sap30l 0.796 0.013 435 NM_008326 Irgm 1.958 0.013 436 NM_025815 Cpne8 1.556 0.013 437 NM_011472 Sprr2f 2.318 0.013 438 NM_007544 Bid 1.289 0.013 439 NM_001080925 Rapgefl1 0.648 0.013 440 NM_027986 Cdadc1 0.806 0.013 441 NM_199223 Rtn4rl2 1.398 0.013 442 N.C.A. - 0.780 0.013 443 ENSMUST085250 Unknown 1.192 0.013

444 NM_007914 Ehf 1.282 0.013 445 BC048787 2310057J16Rik 0.817 0.013 446 ENSMUST062784 A630077B13Rik 1.364 0.013 447 NM_011201 Ptpn1 1.515 0.013 448 XM_001002717 LOC668629 1.231 0.014 449 NM_009253 Serpina3m 2.615 0.014 450 NM_001082547.1 EG433016 1.936 0.014 451 XR_034597 LOC668529 1.803 0.014 452 NM_172385 Zfp536 0.754 0.014 453 XR_030603 LOC664936 1.217 0.014 454 NM_029499 Ms4a4c 2.034 0.014 455 NM_008987 Ptx3 2.231 0.014 456 NM_023142 Arpc1b 1.177 0.014 457 XR_032431 LOC245676 1.416 0.014 458 NM_175440 Prss27 1.760 0.014 459 NM_001081020 Adamts6 0.727 0.014 460 NM_139148 Clca4 1.327 0.014 461 NM_153505 Nckap1l 1.341 0.014 462 NM_011662 Tyrobp 1.373 0.014 463 NM_181542 Slfn10 1.607 0.014 464 NM_024457 Rap1b 1.196 0.014 465 NM_010655 Kpna2 1.381 0.014 466 XM_001480612 LOC100043546 1.810 0.014 467 NM_028775 Cyp2s1 0.671 0.014 468 NM_030261 Sesn3 0.626 0.014 469 NM_145400 Ube4a 0.858 0.014 470 NM_011882 Rnasel 1.247 0.014 471 NM_001029841 Sla 1.456 0.014 472 NM_197943 Rutbc1 0.825 0.014 473 NM_018866 Cxcl13 1.544 0.014 474 NM_009099 Trim30 1.950 0.014 475 ENSMUST053488 Unknown 0.510 0.014 476 ENSMUST048660 4732466D17Rik 0.704 0.014 477 NM_175493 Gpr68 1.424 0.014 478 NM_011945 Map3k1 0.793 0.014 479 NM_025910 Mina 1.191 0.014 480 NM_019664 Kcnj15 0.765 0.014 481 NM_007746 Map3k8 1.765 0.014 482 ENSMUST081649 Ifitm2 1.257 0.014 483 XR_032386 LOC633944 1.334 0.014 484 BC002073 Ccl6 1.786 0.014 485 NM_030180 Usp54 0.793 0.014 486 NM_008225 Hcls1 1.306 0.014 487 NM_018734 Gbp3 1.600 0.014 488 NM_010508 Ifnar1 1.205 0.014 489 NM_008753 Oaz1 0.919 0.014

490 NM_173368 Chd6 0.752 0.014 491 NM_027571 P2ry12 0.798 0.014 492 NM_019535 Sh3gl2 0.755 0.014 493 NM_023143 C1r 1.168 0.014 494 NM_001083318 Etv3 1.364 0.014 495 NM_175472 Zcchc11 0.852 0.014 496 NM_012048 Polk 0.827 0.015 497 XM_001477842 LOC100041932 1.600 0.015 498 NM_008342 Igfbp2 0.820 0.015 499 NM_001042523 Txnrd1 1.564 0.015 500 NM_009044 Rel 1.610 0.015 501 NM_011877 Ptpn21 0.816 0.015 502 NM_178920 Mal2 1.458 0.015 503 NM_134251 Slc12a8 0.829 0.015 504 NM_021792 Iigp1 1.999 0.015 505 AK050521 Scrn3 0.756 0.015 506 NM_009098 Rps8 1.278 0.015 507 NM_181391 Chchd7 0.835 0.015 508 ENSMUST095525 Unknown 0.705 0.015 509 NM_032541 Hamp1 1.834 0.015 510 XM_905139 EG631359 1.364 0.015 511 ENSMUST082107 Unknown 1.590 0.015 512 NM_173417 Kcns3 1.140 0.015 513 NM_030253 Parp9 1.425 0.015 514 NM_080455 Tshz2 0.820 0.015 515 NM_008033 Fnta 0.891 0.015 516 ENSMUST092627 Unknown 0.730 0.015 517 ENSMUST058809 Unknown 0.630 0.015 518 NM_018814 Pcnx 0.821 0.015 519 NM_007679 Cebpd 2.174 0.015 520 NM_207220 Gpr137 0.834 0.015 521 ENSMUST094029 Unknown 1.223 0.015 522 XR_033213 LOC433716 1.339 0.015 523 NM_008359 Il17ra 1.667 0.015 524 NM_057173 Lmo1 0.753 0.015 525 NM_175098 Ccdc126 0.808 0.015 526 NM_010581 Cd47 1.207 0.015 527 NM_027166 Ypel5 0.791 0.015 528 NM_001008232 Ddefl1 1.219 0.015 529 NM_021897 Trp53inp1 0.656 0.015 530 NM_010924 Nnmt 1.498 0.015 531 NM_015737 Galnt4 1.452 0.015 532 XM_001471580 LOC667597 2.239 0.015 533 ENSMUST082910 ENSEMBLncRNA 1.222 0.015 534 NM_027830 Mcm9 0.849 0.015 535 NM_181754 Gpr141 1.307 0.015

536 ENSMUST099184 Unknown 0.772 0.015 537 NM_011612 Tnfrsf9 1.283 0.015 538 GENSCAN0354318 Unknown 1.245 0.015 539 NM_021315 Noc3l 1.353 0.015 540 NM_194462 Akap9 0.850 0.015 541 NM_001048175 Adam28 0.755 0.015 542 NM_010329 Pdpn 1.551 0.015 543 NM_025292 Synj2bp 0.803 0.015 544 GENSCAN0356606 Unknown 2.071 0.015 545 NM_008168 Grik5 0.829 0.015 546 N.C.A. - 0.719 0.015 547 XR_031410 LOC620283 1.236 0.015 548 NM_026213 Ttc33 0.841 0.015 549 NM_023516 2310016C08Rik 1.846 0.015 550 AK020810 A930005F02Rik 0.725 0.015 551 NM_027893 Pvrl4 0.784 0.015 552 NM_007921 Elf3 1.569 0.015 553 XR_034431 LOC100048255 0.774 0.015 554 NM_019777 Ikbke 1.975 0.015 555 NM_010751 Mxd1 1.780 0.015 556 NM_010347 Aes 0.838 0.015 557 NM_027184 Ipmk 0.877 0.016 558 NM_001081344 Stxbp5 0.842 0.016 559 NM_011691 Vav1 1.366 0.016 560 NM_008313 Htr4 0.705 0.016 561 XM_981629 EG666103 1.395 0.016 562 NM_009753 Bicd1 0.770 0.016 563 GENSCAN0407254 Unknown 1.374 0.016 564 NM_010143 Ephb3 0.809 0.016 565 NM_025641 Uqcrh 0.834 0.016 566 NM_001033122 Cd69 1.662 0.016 567 N.C.A. - 1.525 0.016 568 NM_008193 Guk1 0.869 0.016 569 NM_133209 Pilrb1 1.391 0.016 570 NM_146336 Olfr893 0.723 0.016 571 NM_001008700 Il4ra 1.838 0.016 572 NM_181071 Tanc2 0.850 0.016 573 NM_145999 Rhot2 0.840 0.016 574 XM_143595 EG229879 1.206 0.016 575 NM_021297 Tlr4 1.281 0.016 576 NM_008217 Has3 1.624 0.016 577 NM_010738 Ly6a 1.344 0.016 578 NR_002851 Snord82 1.300 0.016 579 NM_011192 Psme3 1.231 0.016 580 ENSMUST050983 4932411E22Rik 0.693 0.016 581 NM_178382 Flrt3 0.745 0.016

582 NM_130447 Dusp16 0.813 0.016 583 NM_023884 Ralgps2 0.792 0.016 584 XM_986941 Ms4a4a 1.657 0.016 585 NM_029631 Abhd14b 0.819 0.016 586 ENSMUST080633 Unknown 0.707 0.017 587 ENSMUST062708 BC053749 0.755 0.017 588 NM_026149 Nudcd1 1.331 0.017 589 NM_029634 Ihpk2 0.812 0.017 590 NM_021458 Fzd3 0.791 0.017 591 NM_016740 S100a11 1.159 0.017 592 NM_130905 Cd209e 2.007 0.017 593 ENSMUST053993 Unknown 1.431 0.017 594 NM_011198 Ptgs2 1.953 0.017 595 NM_198012 Trim68 0.706 0.017 596 NM_029571 Kti12 1.280 0.017 597 AF357333 MBII-276C 1.232 0.017 598 NM_001045520 Clint1 1.213 0.017 599 NM_016958 Krt14 1.643 0.017 600 NM_001081068 Zfp294 1.284 0.017 601 GENSCAN0414808 Unknown 1.646 0.017 602 DQ832275 Sh2d5 1.359 0.017 603 NM_010741 Ly6c1 1.228 0.017 604 NM_008039 Fpr-rs2 1.400 0.017 605 AK079848 ENSMUSG052368 0.847 0.017 606 NM_009963 Cry2 0.732 0.017 607 GENSCAN0411269 Unknown 1.599 0.017 608 XM_917864 Ankdd1a 0.741 0.017 609 XM_001478412 LOC676923 1.229 0.017 610 NM_029924 Mbd5 0.757 0.017 611 NM_001013373 Tmprss13 0.766 0.017 612 NM_144861 BC021395 0.807 0.017 613 NM_009516 Wee1 0.717 0.017 614 ENSMUST047498 AA467197 1.454 0.018 615 NM_015736 Galnt3 1.680 0.018 616 ENSMUST026038 Unknown 1.523 0.018 617 NM_133775 Il33 2.536 0.018 618 NM_019418 Tnfsf14 1.474 0.018 619 N.C.A. - 0.766 0.019 620 NM_008879 Lcp1 1.299 0.019 621 GENSCAN0411269 Unknown 1.482 0.019 622 XR_030943 LOC382722 1.231 0.019 623 NM_144550 Ccdc52 0.785 0.019 624 NM_009364 Tfpi2 1.451 0.019 625 BC055685 Letm2 0.770 0.019 626 NM_194341 Ap1gbp1 0.885 0.019 627 XM_905894 RP23-54E4.8 1.261 0.019

628 NM_013901 Slc39a1 1.377 0.019 629 NM_008848 Pira6 1.347 0.019 630 NM_080638 Mvp 1.305 0.019 631 NM_134448 Dst 0.790 0.019 632 NM_011665 Ube2i 0.751 0.019 633 AF357342 MBII-119C 0.846 0.019 634 NM_172673 Frmd5 0.770 0.019 635 NM_174870 Slc26a1 1.204 0.019 636 NM_172736 Leng8 0.783 0.019 637 NM_001042760 Slc22a18 0.851 0.019 638 NM_001024703 Mctp2 1.462 0.019 639 NM_173378 Trp53bp2 0.810 0.019 640 GENSCAN0424492 Unknown 0.807 0.019 641 NM_199025 Zbtb26 0.828 0.019 642 ENSMUST074590 Unknown 1.172 0.019 643 NM_001079932 Trim72 1.153 0.019 644 NM_011305 Rxra 0.813 0.020 645 NM_139150 Carf 0.788 0.020 646 N.C.A. - 0.702 0.020 647 NM_019679 Fmnl1 1.271 0.020 648 NM_011190 Psme2 1.365 0.020 649 NM_029679 6330500D04Rik 1.613 0.020 650 NM_010560 Il6st 1.165 0.020 651 NM_028833 Iqce 0.848 0.020 652 ENSMUST056162 Unknown 1.330 0.020 653 NM_001008233.1 Plekhn1 0.813 0.020 654 NM_027432 Wdr77 1.241 0.020 655 NM_175937 Cpeb2 0.818 0.020 656 NM_013601 Msx2 0.795 0.020 657 NM_145984 Prepl 0.845 0.020 658 NM_177388 Slc41a2 1.381 0.020 659 NM_008020 Fkbp2 0.815 0.020 660 ENSMUST082686 Unknown 0.773 0.020 661 NM_203320 Cxcl3 2.200 0.020 662 BC031202 Plxnb2 1.254 0.020 663 AF357374 MBII-422C 1.419 0.020 664 NM_011366 Sorbs3 0.778 0.020 665 XR_032183 LOC665262 1.186 0.020 666 ENSMUST088318 Unknown 1.266 0.020 667 NM_001081746 EG665378 1.337 0.020 668 NM_173424 Zbtb37 0.796 0.020 669 ENSMUST042861 Unknown 1.426 0.020 670 NM_178773 Tmem16d 0.715 0.020 671 AK148532 OTTMUSG005767 0.728 0.020 672 NM_018854 Ift20 0.880 0.020 673 GENSCAN0411269 Unknown 1.489 0.020

674 NM_025443 Pno1 1.280 0.020 675 ENSMUST076540 LOC382486 1.372 0.020 676 NM_001026214 Entpd5 0.743 0.020 677 NM_016959 Rps3a 0.840 0.020 678 ENSMUST022953 1700010C24Rik 1.179 0.020 679 ENSMUST099484 Unknown 1.305 0.020 680 NM_013543 H2-Ke6 0.770 0.020 681 NM_013721 Rpl7a 1.486 0.020 682 NM_178890 Abtb2 1.200 0.020 683 ENSMUST079535 Unknown 1.237 0.020 684 NM_027371 Bxdc5 1.130 0.020 685 NM_028226 Rbm12b 0.887 0.020 686 NM_026871 Hint2 0.774 0.020 687 NM_153177 Eif2c4 0.768 0.020 688 NM_009093 Rps29 0.858 0.020 689 AY039837 Ube2n 1.238 0.020 690 NM_054084 Calcb 1.480 0.020 691 ENSMUST038277 2210412D01Rik 1.172 0.020 692 XR_034272 LOC100043330 1.206 0.020 693 NM_199446 Phkb 0.854 0.020 694 NM_022419 Abhd8 0.772 0.020 695 NM_009178 St3gal4 1.296 0.020 696 NM_019689 Arid3b 0.875 0.020 697 NM_148925 Fyco1 0.763 0.020 698 ENSMUST039323 AA986860 0.722 0.020 699 GENSCAN0411269 Unknown 1.559 0.020 700 NM_026191 Dhx40 0.821 0.020 701 NM_001081421 Galntl1 0.763 0.020 702 NM_177338 Hmbox1 0.826 0.020 703 NM_027212 Med30 0.830 0.020 704 NM_008367 Il2ra 1.334 0.020 705 ENSMUST050982 LOC675534 1.509 0.020 706 NM_009093 Rps29 0.879 0.020 707 NM_010260 Gbp2 1.613 0.020 708 NM_130879 Usp48 0.886 0.020 709 NM_009478 Urod 0.828 0.020 710 XM_001477657 BC059842 0.838 0.020 711 NM_172126 Adam1a 0.785 0.020 712 NM_009046 Relb 1.519 0.020 713 ENSMUST098718 Unknown 0.538 0.020 714 ENSMUST034632 1810021J13Rik 0.733 0.020 715 NM_176846 Exph5 0.751 0.020 716 NM_025714 Odf2l 0.772 0.020 717 BC029862 Gnb1l 0.810 0.020 718 NM_020574 Kcne3 2.069 0.021 719 NM_026446 Rgs19 1.310 0.021

720 NM_007778 Csf1 1.497 0.021 721 AK156116 Mrgpra2 3.307 0.021 722 XM_894481 EG629581 1.131 0.021 723 NM_026493 Cspp1 0.776 0.021 724 XM_001477846 LOC672511 1.608 0.021 725 XM_980525 EG633752 1.304 0.021 726 XR_030618 LOC100044414 1.206 0.021 727 NM_026611 Rnaset2b 0.804 0.021 728 NM_021893 Cd274 1.843 0.021 729 NM_026578 Nola1 1.321 0.021 730 AK137596 9830163L10 1.221 0.021 731 BC051177 5830411G16Rik 0.846 0.021 732 NM_175529 Leng9 0.849 0.021 733 NM_011193 Pstpip1 1.234 0.021 734 NM_009575 Zic3 1.152 0.021 735 NM_172854 Olfml2a 0.737 0.021 736 ENSMUST076071 Unknown 0.672 0.021 737 NM_019652 Asna1 0.862 0.021 738 DQ112091 B230118H07Rik 0.801 0.021 739 BC145673 D14Ertd668e 1.816 0.021 740 NM_028392 Ppp2r2b 0.780 0.021 741 NM_019578 Extl1 0.822 0.021 742 NM_144849 Ankrd54 0.857 0.021 743 NM_011909 Usp18 1.688 0.021 744 NM_133218 Zfp704 0.811 0.021 745 NM_001081105 Rhoh 1.318 0.021 746 NM_183426 Sbno2 2.092 0.021 747 NM_010188 Fcgr3 1.425 0.021 748 NM_013614 Odc1 1.429 0.021 749 NM_008046 Fst 1.490 0.021 750 ENSMUST089885 Unknown 1.529 0.021 751 NM_001085410 1110020G09Rik 0.739 0.021 752 ENSMUST057405 BC027072 1.246 0.021 753 NM_016850 Irf7 1.772 0.021 754 AK048560 Stox2 0.777 0.021 755 NM_025978 Ttc14 0.827 0.021 756 NM_198422 Paqr3 0.659 0.021 757 NM_028362 2410018L13Rik 0.739 0.021 758 ENSMUST0101193 Unknown 1.175 0.022 759 NM_009100 Rptn 1.134 0.022 760 NM_152134 Homer1 0.687 0.022 761 NM_009917 Ccr5 1.707 0.022 762 XM_001003685 Gm1752 0.787 0.022 763 NM_139200 Pscdbp 1.466 0.022 764 NM_010112 Efs 0.760 0.022 765 NM_153391 Wdr19 0.725 0.022

766 NM_146177 Suv420h2 0.848 0.022 767 ENSMUST093504 Unknown 0.814 0.022 768 ENSMUST09940 Unknown 1.513 0.022 769 ENSMUST049171 LOC383474 1.152 0.022 770 GENSCAN0390373 Unknown 1.226 0.022 771 NM_134080 Flnb 1.742 0.022 772 NM_025378 Ifitm3 1.240 0.022 773 NM_001081037 Srgap1 1.254 0.022 774 ENSMUST035569 Unknown 0.816 0.022 775 NM_008404 Itgb2 1.299 0.022 776 NM_144915 Daglb 0.797 0.022 777 ENSMUST040368 AW061290 0.828 0.022 778 XM_884529 EG620143 0.811 0.023 779 NM_020052 Scube2 0.740 0.023 780 ENSMUST041252 Unknown 0.721 0.023 781 NM_016865 Htatip2 0.827 0.023 782 NM_001081433 Ankrd44 0.807 0.023 783 NM_023230 Ube2v1 1.335 0.023 784 ENSMUST051264 Cd300lf 1.432 0.023 785 ENSMUST096320 Unknown 0.738 0.023 786 XR_033405 LOC546714 1.491 0.023 787 NM_026937 Ascc1 0.749 0.023 788 BC012016 Prdm9 0.781 0.023 789 NM_145934 AW049765 1.265 0.023 790 NM_146191 Lrrk1 0.909 0.023 791 NM_001037725 Als2cr13 0.790 0.023 792 NM_028234 Prr8 0.855 0.023 793 NM_027328 Prpf31 1.152 0.023 794 ENSMUST083801 Unknown 1.343 0.023 795 NM_153507 Cpne2 1.159 0.023 796 NM_011568 Thoc4 1.244 0.023 797 NM_020005 Pcaf 0.792 0.023 798 NM_010250 Gabra1 0.812 0.023 799 mmu-mir-10b MI0000221 0.676 0.023 800 NM_008519 Ltb4r1 1.251 0.023 801 NM_178802 Trim65 0.878 0.023 802 NM_010474 Hs3st1 1.574 0.023 803 AK040949 Lincr 1.850 0.024 804 GENSCAN0412502 Unknown 1.616 0.024 805 NM_007440 Alox12 0.727 0.024 806 NM_013790 Abcc5 0.791 0.024 807 NM_134127 Cyp4f15 0.711 0.024 808 NM_001039692 Arhgap12 0.758 0.024 809 NM_028029 Dnmbp 0.781 0.024 810 NM_177960 Idi1 1.300 0.024 811 NM_011599 Tle1 0.839 0.024

812 NM_016748 Ctps 1.708 0.024 813 GENSCAN0421426 Unknown 1.341 0.024 814 NM_001038604 Clec5a 1.464 0.024 815 NM_019566 Rhog 1.193 0.024 816 NM_133206 Znrf1 1.351 0.024 817 NM_025858 Scotin 1.117 0.024 818 NM_001077364 Tsc22d3 0.685 0.024 819 NM_007835 Dctn1 0.873 0.024 820 NM_173431 Rpgrip1l 0.809 0.024 821 NM_027947 Zbtb43 0.787 0.024 822 NM_011638 Tfrc 1.408 0.024 823 NM_172743 Plekha7 1.256 0.024 824 NM_011589 Timeless 1.288 0.024 825 XR_034437 EG639787 1.386 0.024 826 XR_032609 4930401B11Rik 1.312 0.024 827 N.C.A. - 1.204 0.024 828 NM_181577 Ccdc85a 0.755 0.024 829 NM_008073 Gabrg2 1.187 0.024 830 NM_008049 Ftl2 1.274 0.024 831 NM_013521 Fpr1 2.236 0.024 832 XR_005074 LOC677168 1.647 0.024 833 AK170695 Zmym6 0.810 0.024 834 ENSMUST031499 Unknown 0.779 0.024 835 NM_012057 Irf5 1.313 0.024 836 XR_004872 LOC384358 1.220 0.024 837 XR_033791 LOC100042107 1.290 0.024 838 NM_021394 Zbp1 1.576 0.024 839 ENSMUST064814 Unknown 0.836 0.024 840 NM_018876 Fut2 2.011 0.024 841 NM_139140 Spats2 0.799 0.024 842 NM_018729 Cd244 1.215 0.024 843 NM_145960 Mtrf1 0.827 0.024 844 N.C.A. - 0.724 0.024 845 XR_031878 LOC624863 1.325 0.024 846 ENSMUST039861 Cd33 1.713 0.024 847 NM_019807 Acpp 0.803 0.024 848 AK160455 1810036N14Rik 0.843 0.024 849 NM_007719 Ccr7 1.342 0.024 850 ENSMUST040330 BC088983 0.748 0.024 851 NM_177658 B230339M05Rik 0.905 0.024 852 mmu-mir-205 MI0000248 0.692 0.024 853 NM_011663 Zrsr1 0.783 0.024 854 NM_010818 Cd200 1.237 0.024 855 NM_001082553 Rab27b 0.862 0.024 856 mmu-mir-146b MI0004665 1.395 0.024 857 NM_010637 Klf4 0.694 0.024

858 AB055406 6330406I15Rik 1.518 0.024 859 XR_001547 EG433273 1.270 0.024 860 NM_023536 Mrto4 1.293 0.024 861 NM_001081068 Zfp294 1.211 0.024 862 NM_175300 Anapc2 0.863 0.024 863 NM_012055 Asns 1.223 0.024 864 NM_008554 Ascl2 0.826 0.024 865 NM_133971 Ankrd10 0.831 0.024 866 NM_033322 Lztfl1 0.864 0.024 867 NM_024264 Cyp27a1 0.735 0.024 868 NM_019456 Apbb1ip 1.391 0.024 869 ENSMUST093823 AA407270 0.726 0.024 870 NM_011579 Tgtp 1.731 0.024 871 mmu-mir-351 MI0000643 1.277 0.024 872 XR_035265 D930048N14Rik 0.843 0.025 873 XR_032827 LOC230765 1.239 0.025 874 XR_035709 LOC668366 1.507 0.025 875 NM_021442 Mds1 0.785 0.025 876 NM_026975 Bola1 0.808 0.025 877 ENSMUST031817 Unknown 1.466 0.025 878 XR_034287 LOC665926 1.271 0.025 879 NM_020051 Ascl3 1.197 0.025 880 NM_145620 Rrp9 1.310 0.025 881 NM_001013828.1 LOC435565 1.670 0.025 882 NM_026470 Spata6 0.834 0.025 883 BC016598 2210010L05Rik 0.889 0.025 884 NM_001033711 Evi2a 1.404 0.025 885 ENSMUST081828 2900006K08Rik 0.753 0.025 886 NM_009425 Tnfsf10 1.470 0.025 887 BC060215 BC031353 0.730 0.025 888 BC066100 6720401G13Rik 0.768 0.025 889 NM_010426 Foxf1a 1.284 0.025 890 NM_144796 Susd4 0.781 0.025 891 NM_146016 C230094A16Rik 0.828 0.025 892 GENSCAN0411269 Unknown 1.510 0.025 893 NM_175136 Rnf122 1.495 0.025 894 NM_001013814 Amt 0.794 0.025 895 NM_010045 Darc 1.435 0.025 896 NM_009969 Csf2 1.475 0.025 897 ENSMUST054693 Unknown 1.460 0.025 898 NM_080857 Asb13 0.791 0.025 899 NM_001033380 E030018N11Rik 1.238 0.025 900 NM_007695 Chi3l1 1.956 0.025 901 GENSCAN0387256 Unknown 1.425 0.025 902 NM_194346 Rnf31 1.249 0.025 903 NM_009274 Srpk2 0.873 0.025

904 N.C.A. - 0.802 0.025 905 ENSMUST043011 Unknown 0.704 0.025 906 NM_017479 Myst4 0.757 0.025 907 ENSMUST085048 Unknown 1.152 0.025 908 NM_001039373 Mtcp1 0.755 0.025 909 NM_001040130 Tmem141 0.830 0.025 910 AF357371 MBII-96C 1.289 0.025 911 NM_026505 Bambi 0.789 0.025 912 NM_011204 Ptpn13 0.788 0.025 913 NM_133917 Mlxip 0.880 0.025 914 NM_030255 Apobec3 1.134 0.025 915 NM_133993 Pwp1 1.208 0.026 916 ENSMUST000342 Ccl11 1.601 0.026 917 NM_177379 Grit 0.829 0.026 918 NM_138756 Slc25a36 0.798 0.026 919 NM_001080934 Slc16a5 1.250 0.026 920 NM_008396 Itga2 1.502 0.026 921 NR_002896 Snord22 1.497 0.026 922 NM_027835 Ifih1 1.506 0.026 923 NM_010945 Nsmaf 0.864 0.026 924 NM_029662 Mfsd2 1.661 0.026 925 N.C.A. - 0.720 0.026 926 BC024868 BC024868 0.885 0.026 927 N.C.A. - 2.384 0.026 928 NM_016923 Ly96 1.301 0.026 929 NM_015804 Atp11a 0.862 0.026 930 NM_026876 1190005F20Rik 0.875 0.026 931 NM_023141 Tor3a 1.243 0.026 932 GENSCAN0418409 Unknown 1.149 0.026 933 ENSMUST064107 Unknown 0.780 0.026 934 mmu-mir-27b MI0000142 0.823 0.026 935 NM_146066 Gspt1 1.152 0.026 936 NM_198034 Sidt1 0.806 0.026 937 NM_019924 Rps6ka4 1.133 0.026 938 NM_207206 Agpat7 1.274 0.026 939 NM_022811 Polr1e 1.304 0.026 940 NM_013762 Rpl3 1.206 0.026 941 NM_133900 Psph 0.815 0.026 942 NM_181579 Pof1b 1.317 0.026 943 ENSMUST069291 Unknown 1.883 0.026 944 NM_019396 Cyhr1 0.785 0.026 945 NM_026472 Mki67ip 1.374 0.026 946 ENSMUST075542 LOC272713 1.200 0.026 947 NM_148948 Dicer1 0.866 0.026 948 NM_030180 Usp54 0.819 0.026 949 NM_138747 Nol1 1.389 0.026

950 NM_008732 Slc11a2 1.324 0.026 951 NM_011345 Sele 1.586 0.026 952 NM_001025381 Gpr17 1.139 0.026 953 NM_009261 Strbp 0.821 0.026 954 ENSMUST0100860 Unknown 0.831 0.026 955 BC077714 Taok2 0.856 0.026 956 ENSMUST048786 1700120B06Rik 1.135 0.026 957 NM_023420 Col4a3bp 0.812 0.026 958 NM_001002004 2610507B11Rik 0.906 0.026 959 NM_021542 Kcnk5 0.792 0.026 960 NM_174850 Micall2 1.380 0.026 961 NM_181470 Ltv1 1.327 0.026 962 ENSMUST087942 9830134C10Rik 1.327 0.026 963 NM_175467 Sptlc3 0.801 0.026 964 NM_172675 Stx16 0.838 0.026 965 NM_026138 6330407J23Rik 1.203 0.026 966 NM_144904 Rod1 1.172 0.026 967 NM_133916 Eif3b 1.183 0.026 968 NM_198305.1 Klhl17 0.843 0.026 969 NM_025936 Rars 1.281 0.026 970 NM_009631 Adora3 1.344 0.026 971 NM_133740 Prmt3 1.232 0.026 972 AK041042 B130055M24Rik 0.848 0.026 973 NM_013884 Cspg5 0.776 0.026 974 NM_145517 Ormdl1 0.817 0.026 975 ENSMUST028017 5630401D24Rik 1.112 0.026 976 NM_145926 Mgat4b 1.282 0.026 977 AK157788 Gm73 1.314 0.026 978 NM_144842 Zmym5 0.805 0.026 979 NM_022816 Acot10 1.393 0.026 980 NM_021396 Pdcd1lg2 1.276 0.026 981 NM_028152 Mms19l 0.842 0.026 982 NM_144897 Apoa1bp 0.892 0.026 983 BC060111 Sfrs18 0.765 0.026 984 X03052 H2-T18 0.733 0.026 985 NM_031159 Apobec1 1.274 0.026 986 ENSMUST091241 Unknown 1.375 0.026 987 ENSMUST0100766 Unknown 1.216 0.026 988 ENSMUST098726 LOC628629 0.835 0.026 989 NM_025534.2 Ccdc82 0.841 0.026 990 ENSMUST0103302 Unknown 1.247 0.026 991 GENSCAN0399405 Unknown 1.271 0.026 992 GENSCAN0355361 Unknown 0.732 0.026 993 NM_001081006 Etl4 0.835 0.026 994 NM_139144 Ogt 0.835 0.026 995 NM_023617 Aox3 0.708 0.027

996 NM_008655 Gadd45b 1.545 0.027 997 NM_007625 Cbx4 0.781 0.027 998 DQ279480 Zp4 1.326 0.027 999 NM_028186 Nkd2 0.777 0.027 1000 ENSMUST0100697 Unknown 1.276 0.027 1001 NM_027905 1300018J18Rik 0.845 0.027 1002 NM_001082545 Stfa2 1.360 0.027 1003 NM_172829 St6gal2 0.813 0.027 1004 ENSMUST087518 LOC672238 1.228 0.027 1005 NM_011414 Slpi 1.277 0.027 1006 NM_001076679 LOC751864 1.917 0.027 1007 ENSMUST072554 9430015G10Rik 0.852 0.027 1008 NM_001013756 Grhl3 0.780 0.027 1009 NM_023785 Ppbp 1.910 0.027 1010 ENSMUST0101522 Unknown 0.850 0.027 1011 NM_144912 Rad9b 0.699 0.027 1012 NM_008437 Napsa 1.370 0.027 1013 AF357327 Rpl13 1.296 0.027 1014 NM_001005863 Mtus1 0.829 0.027 1015 AJ409464 Dazl-binding(ib7) 2.294 0.027 1016 NM_011712 Wbp5 0.804 0.027 1017 NM_028817 Acsl3 0.757 0.027 1018 XM_985771 Ibrdc1 0.812 0.027 1019 NM_207655 Egfr 1.286 0.027 1020 NM_019968 Arl10 0.837 0.027 1021 NM_011281 Rorc 0.753 0.027 1022 NM_145394 Slc44a3 0.771 0.027 1023 AK085490 Tnfrsf1b 1.350 0.027 1024 NM_144938 C1s 1.186 0.027 1025 mmu-mir-532 MI0003206 0.791 0.027 1026 NM_007935 Epc1 0.837 0.027 1027 ENSMUST056756 Unknown 0.743 0.027 1028 NM_001008550 Zfyve26 0.845 0.027 1029 NM_175155 Sash1 0.812 0.027 1030 ENSMUST072592 Unknown 1.135 0.027 1031 NM_009078 Rpl19 1.170 0.027 1032 NM_001029912 Zswim5 0.822 0.027 1033 NM_001015876 Tyw1 0.847 0.027 1034 M83749 Ccnd2 1.222 0.027 1035 NM_007972 F10 1.272 0.027 1036 NM_023631 Aox4 1.182 0.027 1037 NM_020600 Rps14 0.890 0.027 1038 ENSMUST055162 BC060631 0.834 0.027 1039 NM_001040005 Rnf213 1.460 0.027 1040 NM_011613 Tnfsf11 1.189 0.027 1041 NM_053089 Narg1 1.190 0.027

1042 NM_001002898 Sirpb1 1.484 0.027 1043 NM_010747 Lyn 1.324 0.027 1044 N.C.A. - 0.831 0.027 1045 NM_001081235 Mn1 0.768 0.027 1046 AK173166 4921533L14Rik 0.842 0.027 1047 NM_153553 Npas4 0.813 0.027 1048 XR_031023 LOC675593 1.378 0.027 1049 NM_019750 Nat6 0.780 0.027 1050 NM_017466 Ccrl2 1.889 0.027 1051 NM_025824 Bzw1 1.150 0.027 1052 GENSCAN0394124 Unknown 1.223 0.027 1053 NM_001081347 Rhobtb1 0.748 0.027 1054 NM_153597 Trpt1 0.803 0.027 1055 ENSMUST051925 Unknown 1.243 0.027 1056 ENSMUST095151 4833413O15Rik 0.880 0.027 1057 ENSMUST0101090 Unknown 0.672 0.027 1058 NM_001009818 Septin11 1.280 0.027 1059 NM_026106 Dr1 1.167 0.027 1060 NM_053208 Egln2 0.798 0.027 1061 NM_146214 Tat 0.743 0.027 1062 ENSMUST075898 Unknown 1.209 0.027 1063 XR_030785 LOC636070 1.152 0.027 1064 GENSCAN0420962 Unknown 0.831 0.027 1065 NM_133685 Rab31 1.414 0.027 1066 NM_172845 Adamts4 2.278 0.027 1067 NM_146706 Olfr401 1.268 0.027 1068 NM_008403 Itgb1bp1 0.844 0.027 1069 M84563 Pnp 1.485 0.027 1070 ENSMUST048646 Unknown 0.879 0.027 1071 NM_145133 T2bp 1.463 0.027 1072 NM_054098 Steap4 1.675 0.027 1073 NM_011854 Oasl2 1.675 0.027 1074 BC112328 LOC626578 1.718 0.027 1075 NM_025860 Ddx18 1.279 0.027 1076 ENSMUST033786 Unknown 1.234 0.027 1077 NM_001033382 Cacna2d4 1.147 0.027 1078 NM_176831 Ppcdc 0.820 0.027 1079 BC034256 Tgtp 1.790 0.027 1080 ENSMUST031879 BC011487 0.872 0.027 1081 NM_145826 Il17re 0.839 0.027 1082 NM_027872 Slc46a3 0.699 0.027 1083 NM_026850 Pdcl3 0.858 0.028 1084 NM_152895 Jarid1b 0.816 0.028 1085 NM_011119 Pa2g4 1.306 0.028 1086 NM_177267 Wdr22 0.861 0.028 1087 NM_024193 Nol5a 1.375 0.028

1088 NM_011504 Stxbp3a 0.867 0.028 1089 NM_080289 Grhpr 0.802 0.028 1090 NM_001081249 Vcan 1.707 0.028 1091 NM_133734 Wdr23 0.804 0.028 1092 XM_990451 AU042671 0.842 0.028 1093 NM_009151 Selplg 1.373 0.028 1094 XM_001479604 EG232970 0.819 0.028 1095 ENSMUST072222 Zfp329 0.809 0.028 1096 XR_034309 LOC629583 1.173 0.028 1097 NM_008349 Il10rb 1.165 0.028 1098 NM_053166 Trim7 0.888 0.028 1099 NM_011058 Pdgfra 1.316 0.028 1100 ENSMUST032230 Unknown 1.337 0.028 1101 ENSMUST052281 E130012A19Rik 1.269 0.028 1102 NM_001081350 Nol8 1.252 0.028 1103 NM_013660 Sema4d 1.276 0.028 1104 NM_009609 Actg1 1.143 0.028 1105 ENSMUST058187 Unknown 0.840 0.028 1106 ENSMUST097463 Unknown 1.356 0.028 1107 NM_172739 Grlf1 0.873 0.028 1108 ENSMUST099816 Cd80 1.483 0.028 1109 NM_178929 Kazald1 0.712 0.028 1110 GENSCAN0385818 Unknown 1.199 0.028 1111 BC096404 Rpl21 0.906 0.028 1112 ENSMUST095767 Etv1 0.727 0.028 1113 ENSMUST089430 Unknown 1.203 0.028 1114 NM_001045523 Bahd1 0.901 0.028 1115 NM_011510 Abcc8 1.226 0.028 1116 NM_029702 Arfrp1 0.914 0.029 1117 ENSMUST052126 2200001I15Rik 0.849 0.029 1118 AK173339 D130059P03Rik 0.863 0.029 1119 NM_001025597 Ikzf1 1.291 0.029 1120 NM_177684 Zfp637 0.865 0.029 1121 ENSMUST061860 Unknown 0.755 0.029 1122 NM_001029934 Usp32 0.849 0.029 1123 ENSMUST002396 Unknown 1.520 0.029 1124 XM_001479346 Igsf2 1.395 0.029 1125 NM_010093 E2f3 1.237 0.029 1126 XR_031827 LOC100040496 1.191 0.029 1127 ENSMUST064767 Unknown 1.520 0.029 1128 NM_144860 Mib1 0.863 0.029 1129 GENSCAN0405036 Unknown 0.837 0.029 1130 NM_001081326 Agl 0.813 0.029 1131 XM_357820 Cyp2t4 0.873 0.029 1132 ENSMUST097520 EG639653 1.143 0.029 1133 ENSMUST078332 5230400G24Rik 0.860 0.030

1134 NM_008425 Kcnj2 1.363 0.030 1135 NM_172822 Pigz 0.744 0.030 1136 NM_054040 Tulp4 0.880 0.030 1137 XR_032770 LOC433168 1.291 0.030 1138 NM_178887 Fibcd1 1.153 0.030 1139 ENSMUST097152 Unknown 0.882 0.030 1140 ENSMUST041264 Unknown 0.847 0.030 1141 NM_013926 Cbx8 0.852 0.030 1142 NM_021525 Rcl1 1.363 0.030 1143 mmu-mir-32 MI0000691 0.757 0.030 1144 XR_032776 LOC546090 1.435 0.030 1145 NM_008712 Nos1 1.157 0.030 1146 NM_011354 Serf2 0.873 0.030 1147 NM_001012236 Trex1 1.350 0.030 1148 BC022177 ENSMUSG073540 0.683 0.030 1149 AF357377 MBII-35C 1.235 0.030 1150 NM_009421 Traf1 1.263 0.030 1151 NM_170680 Abcc10 0.909 0.030 1152 GENSCAN0362519 Unknown 0.704 0.030 1153 NM_198298 Helz 0.793 0.030 1154 NM_008840 Pik3cd 1.217 0.030 1155 NM_177355 Plcxd3 0.786 0.030 1156 NM_013842 Xbp1 1.287 0.030 1157 NM_146668 Olfr739 1.206 0.030 1158 ENSMUST099469 Unknown 0.723 0.030 1159 NM_027764 Rcbtb1 0.859 0.030 1160 NM_026641 Ift80 0.836 0.030 1161 NM_172473 Hace1 0.864 0.030 1162 ENSMUST052596 Unknown 1.137 0.030 1163 GENSCAN0411269 Unknown 1.530 0.030 1164 NM_027008 Kctd5 1.262 0.030 1165 NM_053083 Loxl4 1.390 0.030 1166 NM_153598 Ugt2b34 0.732 0.030 1167 NM_009656 Aldh2 0.880 0.030 1168 NM_172867 Zfp462 0.845 0.031 1169 NM_010655 Kpna2 1.437 0.031 1170 NM_030083 Lsmd1 0.872 0.031 1171 NM_011943 Map2k6 0.661 0.031 1172 NM_172639 5330431N19Rik 0.833 0.031 1173 NM_177259 Dab1 0.835 0.031 1174 NM_001024932 Pilrb2 1.284 0.031 1175 XR_034880 LOC100043722 1.175 0.031 1176 NM_026862 Cd177 1.307 0.031 1177 AK087378 E130002D13 0.835 0.031 1178 NM_001037915 Ripply1 1.172 0.031 1179 NM_029781 Rab36 0.801 0.031

1180 NM_011391 Slc16a7 0.831 0.031 1181 NM_011847 Dnajb6 1.138 0.031 1182 NM_023605 Fbxo9 0.817 0.031 1183 N.C.A. - 0.623 0.031 1184 NM_007963 Evi1 0.748 0.031 1185 NM_001081298 Lphn2 1.285 0.031 1186 NR_001460 Rmrp 0.793 0.031 1187 ENSMUST087204 Unknown 0.803 0.031 1188 NM_001080814 Fat3 0.793 0.031 1189 AJ278965 Cd80 1.383 0.031 1190 NM_019405 Cetn2 0.824 0.031 1191 ENSMUST094196 Unknown 1.284 0.031 1192 NM_026812 Hddc3 0.838 0.031 1193 NM_001037719 Btla 1.317 0.031 1194 NM_001081177 Kif13b 0.796 0.031 1195 NM_010885 Ndufa2 0.871 0.031 1196 NM_026343 Stx17 0.813 0.031 1197 NM_028979 Cyp2j9 0.756 0.031 1198 NM_027399 Steap1 1.564 0.031 1199 NM_023118 Dab2 1.236 0.031 1200 NM_008764 Tnfrsf11b 1.415 0.031 1201 NM_028078 Igsf5 0.847 0.031 1202 BC051054 9930023K05Rik 1.611 0.031 1203 BC029225 2700038C09Rik 0.870 0.031 1204 ENSMUST046739 H28 1.413 0.031 1205 NM_026493 Cspp1 0.824 0.032 1206 NM_018817 Smarcal1 0.885 0.032 1207 NR_002840 Gas5 1.336 0.032 1208 NM_013489 Cd84 1.421 0.032 1209 NM_009280 Ss18 0.835 0.032 1210 BC031159 E130014J05Rik 0.862 0.032 1211 NM_172382 Jmjd2a 0.871 0.032 1212 NM_025438 Rsrc2 0.883 0.032 1213 NM_177382 Cyp2r1 0.731 0.032 1214 ENSMUST069775 OTTMUSG004461 0.739 0.032 1215 NM_025374 Glo1 0.783 0.032 1216 GENSCAN0355997 Unknown 1.311 0.032 1217 GENSCAN0404702 Unknown 1.312 0.032 1218 NM_001024134 Trim15 1.300 0.032 1219 ENSMUST082728 Unknown 1.275 0.032 1220 ENSMUST025314 0610009O20Rik 0.876 0.032 1221 ENSMUST036426 Prss35 0.781 0.032 1222 NR_002852 Rnu5g 1.385 0.032 1223 NM_172796 Slfn9 1.511 0.032 1224 AY171969 GenBank 1.328 0.032 1225 NM_007636 Cct2 1.128 0.032

1226 ENSMUST053264 2410089E03Rik 0.772 0.032 1227 BC027679 5730408K05Rik 1.344 0.032 1228 XR_033773 LOC666967 1.288 0.032 1229 NM_023530 Pla2g12b 1.177 0.032 1230 NM_013473 Anxa8 1.554 0.032 1231 NM_026468 Atp5g2 0.769 0.032 1232 NM_001033174 Osbp 0.875 0.032 1233 NM_008389 Ipp 0.769 0.032 1234 NM_178599 Commd8 0.851 0.032 1235 NM_172603 Phf11 1.534 0.032 1236 NM_177128 Iqcb1 0.791 0.032 1237 NM_011647 Tsc2 0.897 0.032 1238 NM_145533 Smox 1.442 0.032 1239 NM_008309 Htr1d 0.820 0.032 1240 NM_146188 Kctd15 0.789 0.032 1241 ENSMUST070621 Unknown 1.245 0.032 1242 NM_026493 Cspp1 0.815 0.032 1243 NM_009171 Shmt1 1.290 0.032 1244 ENSMUST091023 Unknown 1.168 0.032 1245 NM_011482 Nhp2l1 1.610 0.032 1246 ENSMUST050386 Unknown 0.731 0.032 1247 XR_032545 LOC100041268 0.666 0.032 1248 NM_177353 Slc9a7 0.796 0.032 1249 NM_134032 Hoxb2 0.810 0.032 1250 ENSMUST072359 Unknown 1.181 0.032 1251 NM_008418 Kcna3 1.218 0.032 1252 NM_001030274 Ndufs5 0.762 0.032 1253 NM_022022 Ube4b 0.871 0.032 1254 NM_022657 Fgf23 2.250 0.032 1255 ENSMUST028205 BC005624 0.879 0.032 1256 NM_008630 Mt2 1.256 0.032 1257 NM_133957 Nfat5 0.864 0.032 1258 NM_175206 Fbxl22 0.813 0.032 1259 XR_032300 EG624165 1.449 0.032 1260 NM_010847 Mxi1 0.819 0.032 1261 NM_001080746 Gtf2i 0.842 0.032 1262 NM_008857 Prkci 0.832 0.033 1263 NM_009294 Stx4a 0.858 0.033 1264 NM_027338 Vps36 0.850 0.033 1265 XM_141845 EG245472 1.237 0.033 1266 NM_016705 Kif21a 0.865 0.033 1267 GENSCAN0354955 Unknown 1.314 0.033 1268 NM_007680 Ephb6 0.876 0.033 1269 NM_133741 Snrk 0.769 0.033 1270 BC028847 2610110G12Rik 0.805 0.033 1271 NM_009187 Cox7a2l 0.728 0.033

1272 ENSMUST099980 Unknown 1.179 0.033 1273 NM_174875 Atg4a 0.861 0.033 1274 NM_008607 Mmp13 1.369 0.033 1275 NM_007713 Clk3 0.902 0.033 1276 XM_001473789 LOC665565 1.364 0.033 1277 XR_034527 LOC666774 1.370 0.033 1278 NM_001081307 Ppp1r12b 0.830 0.033 1279 BC106181 3010003L21Rik 0.831 0.033 1280 NM_027678 Zranb3 0.845 0.033 1281 mmu-let-7d MI0000405 0.804 0.033 1282 NM_026341 Nudt13 0.754 0.033 1283 NM_025422 Cd302 1.257 0.033 1284 NM_172694 Megf9 0.810 0.033 1285 NM_024451 Unc84a 0.889 0.033 1286 NM_145951 Enox2 0.848 0.033 1287 NM_020493 Srf 0.869 0.033 1288 NM_133716 Smap1l 1.144 0.033 1289 N.C.A. - 0.863 0.033 1290 NM_146045 B4galt7 0.892 0.033 1291 NM_033615 Adam33 0.801 0.033 1292 NM_011990 Slc7a11 1.831 0.033 1293 NM_172280 2210018M11Rik 0.873 0.033 1294 NM_010795 Mgat3 0.842 0.033 1295 NM_007668 Cdk5 0.841 0.033 1296 NA - 0.788 0.033 1297 GENSCAN0413561 Unknown 1.274 0.033 1298 ENSMUST001256 Sema6b 1.209 0.033 1299 GENSCAN0419507 Unknown 1.133 0.033 1300 XR_033747 LOC667819 1.180 0.033 1301 NM_019453 Mefv 1.386 0.033 1302 ENSMUST088972 Unknown 1.199 0.033 1303 BC094908 C330005M16Rik 1.227 0.033 1304 AK045567 F830001A07Rik 0.696 0.033 1305 NM_025709 Gapvd1 0.913 0.034 1306 NM_028868 Cxxc1 0.902 0.034 1307 mmu-mir-103-2 MI0000588 0.761 0.034 1308 NM_029836 Tspyl2 0.844 0.034 1309 ENSMUST074310 LOC435651 1.177 0.034 1310 AF357389 MBI-26H 0.825 0.034 1311 NM_020270 Scamp5 0.819 0.034 1312 NM_007732 Col17a1 1.264 0.034 1313 NM_144863 Wdr36 1.284 0.034 1314 XR_030737 LOC100039375 1.406 0.034 1315 NM_009911 Cxcr4 1.217 0.034 1316 NM_080640 Baalc 1.291 0.034 1317 ENSMUST051591 Unknown 1.235 0.034

1318 NM_023733 Crot 0.865 0.034 1319 N.C.A. - 1.121 0.034 1320 NM_025421 Acyp1 0.804 0.034 1321 NM_134152 Lpxn 1.285 0.034 1322 NM_148922 Mdm1 0.791 0.034 1323 NM_001080941.1 N.C.A. 1.153 0.034 1324 XR_034092 LOC627733 1.187 0.034 1325 NM_138743 1190017O12Rik 0.856 0.034 1326 ENSMUST063530 9930109F21Rik 1.385 0.034 1327 NM_145492 Zfp521 0.679 0.034 1328 XM_146632 9030420J04Rik 0.802 0.034 1329 NM_009068 Ripk1 1.229 0.035 1330 NM_178701 Lrrc8d 1.310 0.035 1331 ENSMUST086091 Unknown 1.202 0.035 1332 XR_001799 EG665900 1.139 0.035 1333 XR_032099 LOC665154 1.320 0.035 1334 ENSMUST059802 EG666992 1.179 0.035 1335 NM_001001333 Hexdc 0.849 0.035 1336 EF529510 1110017I16Rik 1.148 0.035 1337 NM_008722 Npm1 1.196 0.035 1338 BC037112 BC037112 0.899 0.035 1339 ENSMUST055085 Tmem86b 0.843 0.035 1340 NM_015734 Col5a1 1.130 0.035 1341 NM_177319 Zfyve27 0.894 0.035 1342 ENSMUST037403 Unknown 0.836 0.035 1343 XR_032332 LOC269718 1.182 0.035 1344 NM_026716 Sycn 1.166 0.035 1345 ENSMUST094320 Unknown 0.761 0.035 1346 NM_007498 Atf3 0.450 0.035 1347 NM_172577 Slc25a21 0.848 0.035 1348 NM_030153 Mak10 0.881 0.035 1349 XM_001475045 LOC100045861 1.457 0.035 1350 NM_153512 Kcng3 0.825 0.035 1351 ENSMUST088013 Unknown 0.817 0.035 1352 ENSMUST090305 Ifitm7 1.273 0.035 1353 NM_172150 Ift52 0.853 0.035 1354 NM_183172 Ric8b 0.835 0.035 1355 NM_011933 Decr2 0.746 0.035 1356 NM_183221 Fat4 0.808 0.035 1357 NM_016698 Rnf10 0.877 0.035 1358 AK220358 9130404D08Rik 0.848 0.035 1359 ENSMUST030181 LOC622404 0.816 0.035 1360 XR_034027 LOC665570 1.270 0.035 1361 AK129030 4732479N06Rik 0.794 0.035 1362 NM_194262 Arid4b 0.873 0.035 1363 NM_008802 Pde7a 0.847 0.035

1364 NM_019422 Elovl1 1.252 0.035 1365 NM_178854 Cnot6l 0.872 0.035 1366 NM_011291 Rpl7 0.826 0.035 1367 NM_009640 Angpt1 0.734 0.035 1368 BC038887 Tomm40 1.153 0.035 1369 NM_177089 Tacc1 0.857 0.035 1370 NM_011480 Srebf1 0.783 0.035 1371 NM_008841 Pik3r2 0.833 0.035 1372 NM_008102 Gch1 1.532 0.035 1373 NM_008070 Gabrb2 0.704 0.035 1374 ENSMUST059364 Unknown 1.374 0.035 1375 NM_213660 Stat3 1.314 0.035 1376 NM_172571 Fbf1 0.888 0.035 1377 AJ409464 Dazl-binding(ib7) 2.239 0.035 1378 NM_009916 Ccr4 1.318 0.035 1379 NM_027326 Mllt3 0.854 0.035 1380 ENSMUST026987 D13Wsu177e 1.297 0.035 1381 NM_172612 Rnd1 1.858 0.035 1382 NM_010867 Myom1 0.806 0.036 1383 NM_001083119 Ptpru 0.680 0.036 1384 NM_015795 Fbxo16 0.782 0.036 1385 BC010717 Jarid1a 0.875 0.036 1386 NM_007807 Cybb 1.367 0.036 1387 BC042793 4930403C10Rik 1.141 0.036 1388 XM_001474636 LOC100040409 1.216 0.036 1389 NM_001038619 Dnm3 0.834 0.036 1390 AK081583 C130047K18 0.761 0.036 1391 NM_153528 Gramd1c 0.797 0.036 1392 NM_001081300 Tshz1 0.838 0.036 1393 NM_008413 Jak2 1.242 0.036 1394 N.C.A. - 0.813 0.036 1395 BC039996 D330028D13Rik 0.782 0.036 1396 NM_021432 Nap1l5 0.807 0.036 1397 NM_009075 Rpia 0.810 0.036 1398 NM_033620 Pard3 0.816 0.036 1399 ENSMUST098943 Unknown 1.169 0.036 1400 NM_183103 1700112C13Rik 1.116 0.036 1401 NM_028838 Lrrc2 1.278 0.036 1402 NM_025862 Acad8 0.799 0.036 1403 NM_010153 Erbb3 0.776 0.036 1404 NM_134054 1110002B05Rik 0.738 0.036 1405 ENSMUST068792 D730040F13Rik 0.794 0.036 1406 NM_001080819 Arid1a 0.908 0.036 1407 NM_133236 Glcci1 0.837 0.036 1408 NM_008967 Ptgir 1.228 0.036 1409 ENSMUST060013 EG622976 1.632 0.036

1410 ENSMUST083277 Unknown 0.805 0.036 1411 NM_029790 Mett5d1 0.753 0.036 1412 XR_030904 LOC432569 1.408 0.036 1413 ENSMUST082827 Unknown 1.199 0.036 1414 NM_133357 Krt75 1.256 0.036 1415 N.C.A. - 0.805 0.036 1416 XM_001476299 BC030046 0.777 0.036 1417 ENSMUST082713 Unknown 1.280 0.036 1418 NM_024175 Rps23 1.505 0.036 1419 NM_173427 Klhdc7a 0.731 0.036 1420 NM_175325 Bbs4 0.786 0.036 1421 NM_027982 Ppm1j 1.217 0.036 1422 ENSMUST079716 LOC640532 1.533 0.036 1423 ENSMUST094715 AY616753 1.174 0.036 1424 NM_146206 Tpcn2 0.882 0.036 1425 NM_001081426 Dip2c 0.875 0.036 1426 NM_010469 Hoxd4 0.744 0.036 1427 NM_009336 Vps72 0.853 0.036 1428 ENSMUST016530 Unknown 0.743 0.036 1429 NM_011111 Serpinb2 1.662 0.036 1430 NM_146035 Mgat2 1.343 0.036 1431 NM_178253 Klhdc1 0.821 0.036 1432 NM_175337 Mlh3 0.806 0.036 1433 NM_025633 Metapl1 0.806 0.036 1434 NM_031177 Ift122 0.805 0.036 1435 NM_194059 Nanos3 1.161 0.036 1436 NM_011285 Rpgr 0.776 0.037 1437 ENSMUST032517 Unknown 1.240 0.037 1438 NM_011840 Map2k5 0.825 0.037 1439 AF357374 MBII-422C 1.450 0.037 1440 GENSCAN0417544 Unknown 1.140 0.037 1441 NM_198160 Smarcc2 0.855 0.037 1442 XM_975835 LOC665283 1.144 0.037 1443 NM_017476 Akap8l 0.824 0.037 1444 NM_178751 Tmem142b 1.319 0.037 1445 XR_001627 EG668139 1.393 0.037 1446 NM_009846 Cd24a 1.400 0.037 1447 BC040692 Btbd2 0.846 0.037 1448 ENSMUST053175 E130203B14Rik 0.776 0.037 1449 NM_201367 Gpr176 1.213 0.037 1450 NM_001038696 Rnpc3 0.844 0.037 1451 XR_002124 EG668043 1.489 0.037 1452 NM_080461 Zfp358 0.805 0.037 1453 BC030045 Zfp651 0.852 0.037 1454 NM_008739 Nsd1 0.872 0.037 1455 ENSMUST056087 5430420C16Rik 1.356 0.037

1456 NM_172497 Efhb 0.829 0.037 1457 NM_153572 Katnal1 0.851 0.037 1458 NM_011848 Nek3 0.805 0.037 1459 NM_175446 Zmat1 0.737 0.037 1460 NM_010119 Ehd1 1.271 0.037 1461 NM_172653 Slc39a10 0.876 0.037 1462 NM_175029 Atg4c 0.790 0.037 1463 NM_007465 Birc2 1.244 0.037 1464 NM_010261 Rabac1 0.848 0.037 1465 ENSMUST057256 6030458C11Rik 0.846 0.037 1466 NM_138301 Trpm2 1.347 0.037 1467 NM_025399 Nudt14 0.838 0.037 1468 ENSMUST074481 Unknown 1.199 0.037 1469 NM_025310 Ftsj3 1.301 0.037 1470 NM_030246 Wdr21 0.809 0.037 1471 NM_011382 Six4 0.711 0.037 1472 NM_139232 Fgd4 0.788 0.037 1473 NM_016862 Vti1a 0.826 0.037 1474 NM_011265 Rfx3 0.820 0.037 1475 NM_009702 Aqr 1.160 0.037 1476 NM_175556 Plch2 0.894 0.037 1477 NM_001025426 Depdc5 0.878 0.037 1478 XM_914623 Gsg1l 1.155 0.037 1479 NM_025785 Fbxo25 0.840 0.037 1480 ENSMUST066603 Unknown 1.289 0.037 1481 ENSMUST0102329 Unknown 1.313 0.037 1482 XM_001477657 BC059842 0.851 0.037 1483 ENSMUST017316 Unknown 0.901 0.037 1484 XR_033275 LOC667125 1.391 0.037 1485 NM_013481 Bop1 1.271 0.037 1486 NM_001030307 Dkc1 1.250 0.037 1487 NM_173021 Phka1 0.889 0.037 1488 ENSMUST021957 BC021381 0.855 0.037 1489 NM_144835 Heatr1 1.384 0.037 1490 NM_010071 Dok2 1.251 0.038 1491 NM_025994 Efhd2 1.323 0.038 1492 NM_177243 Slc26a9 1.272 0.038 1493 NM_016738 Rpl13 1.391 0.038 1494 NM_144791 Tor1aip1 1.177 0.038 1495 NM_001081378 C330002I19Rik 0.850 0.038 1496 N.C.A. - 0.611 0.038 1497 ENSMUST070085 Unknown 1.307 0.038 1498 NM_018887 Cyp39a1 0.752 0.038 1499 NM_145396 Tbl3 1.250 0.038 1500 mmu-mir-199b MI0000714 0.753 0.038 1501 NM_025817 1200009O22Rik 0.699 0.038

1502 NM_008905 Ppfibp2 0.802 0.038 1503 NM_011503 Stxbp2 0.875 0.038 1504 ENSMUST0103470 Unknown 1.137 0.038 1505 NM_144536 Cdkal1 0.871 0.038 1506 NM_177307 Cyp4f39 0.707 0.038 1507 NM_028162 Tbc1d5 0.883 0.038 1508 NM_001081424 Chrna10 1.191 0.038 1509 NM_009530 Atrx 0.867 0.038 1510 NM_011600 Tle4 0.864 0.038 1511 N.C.A. - 0.785 0.038 1512 NM_010730 Anxa1 1.165 0.038 1513 NM_026538 Ddx56 1.173 0.038 1514 NM_016976 Grm1 1.107 0.038 1515 NM_008575 Mdm4 0.855 0.038 1516 NM_172937 Shprh 0.881 0.038 1517 ENSMUST0102569 0610010K14Rik 0.900 0.038 1518 NM_008156 Gpld1 0.806 0.038 1519 NM_008287 Hrsp12 0.775 0.038 1520 NM_016915 Pla2g6 0.814 0.038 1521 NM_019754 Tagln3 1.141 0.038 1522 NM_146073 Zdhhc14 0.813 0.038 1523 NM_029942 Prelid2 0.756 0.038 1524 NM_016861 Pdlim1 1.197 0.038 1525 ENSMUST053094 C330043M08Rik 0.760 0.038 1526 NM_027756 Mfap3l 0.832 0.038 1527 NM_010442 Hmox1 1.991 0.038 1528 ENSMUST094273 EG545391 0.858 0.038 1529 NM_211358 Slc35c1 1.271 0.038 1530 ENSMUST091002 6330505N24Rik 0.803 0.038 1531 NM_008861 Pkd2 0.882 0.039 1532 NM_028728 Nfam1 1.350 0.039 1533 NM_008576 Abcc1 1.142 0.039 1534 NM_009811 Casp6 0.814 0.039 1535 ENSMUST031040 C130090K23Rik 1.224 0.039 1536 ENSMUST079393 LOC670341 1.207 0.039 1537 AK049951 ENSMUSG052691 0.774 0.039 1538 GENSCAN0411911 Unknown 0.739 0.039 1539 NM_011585 Tia1 0.814 0.039 1540 NM_008273 Hoxd11 0.809 0.039 1541 NM_001099217 Ly6c2 1.193 0.039 1542 NM_007865 Dll1 1.638 0.039 1543 ENSMUST054471 4930430F08Rik 0.849 0.039 1544 NM_145451 Gpx6 1.191 0.039 1545 AF357396 MBI-89H 0.688 0.039 1546 NM_018879 Tusc4 0.796 0.039 1547 NM_173741 Wdr24 0.894 0.039

1548 NM_001033198 Ankrd50 1.230 0.039 1549 NM_001081282 Ibtk 1.181 0.039 1550 NM_028478 Rassf6 1.528 0.039 1551 NM_001033244 Fancd2 0.748 0.039 1552 XM_486078 EG546032 0.793 0.039 1553 NM_033354 Sec16b 0.746 0.039 1554 NM_012026 Rgnef 0.853 0.039 1555 AK154502 Zfp760 0.818 0.039 1556 NM_016854 Ppp1r3c 0.596 0.039 1557 NM_033612 Ela1 0.877 0.039 1558 NM_177192 D030011O10Rik 0.874 0.040 1559 NM_027045 Gcap14 0.863 0.040 1560 GENSCAN0362306 Unknown 1.171 0.040 1561 NM_001025427 Hmga1 1.290 0.040 1562 ENSMUST099641 Unknown 0.778 0.040 1563 BC004722 Malat1 0.797 0.040 1564 ENSMUST097330 Unknown 1.283 0.040 1565 NM_010483 Htr5b 1.113 0.040 1566 NM_026439 Ccdc80 1.174 0.040 1567 ENSMUST064257 Unknown 1.168 0.040 1568 NM_026962 Kbtbd3 0.814 0.040 1569 ENSMUST038090 Unknown 0.793 0.040 1570 AJ306625 Synpo2 0.853 0.040 1571 N.C.A. - 1.179 0.040 1572 XR_034427 LOC432482 1.179 0.040 1573 ENSMUST026827 0610011F06Rik 0.887 0.040 1574 GENSCAN0390445 Unknown 1.293 0.040 1575 NM_010821 Mpeg1 1.411 0.040 1576 ENSMUST028597 Tcp11l1 0.813 0.040 1577 XM_907399 EG628040 1.237 0.040 1578 NM_008145 Gnrh1 0.820 0.040 1579 XM_144292 Tmem156 1.338 0.040 1580 ENSMUST065630 Unknown 1.179 0.040 1581 AK005187 Tra2a 0.801 0.040 1582 ENSMUST095119 Unknown 0.737 0.040 1583 NM_153571 Hscb 0.780 0.040 1584 NM_175124 Lrrc28 0.834 0.040 1585 NM_015818 Hs6st1 1.431 0.040 1586 NM_010472 Hrb 1.191 0.040 1587 N.C.A. - 0.813 0.040 1588 NM_009721 Atp1b1 1.285 0.040 1589 ENSMUST046833 9130017N09Rik 1.151 0.040 1590 ENSMUST070681 4933439F18Rik 0.805 0.040 1591 NM_183201 Slfn5 1.469 0.040 1592 NM_029988 Pigh 0.764 0.040 1593 NM_178364 Zfp369 0.855 0.040

1594 ENSMUST042984 LOC212084 1.188 0.040 1595 ENSMUST023246 Unknown 1.991 0.040 1596 NM_001003669 Krt74 1.144 0.040 1597 N.C.A. - 1.207 0.040 1598 XR_034677 LOC677448 1.250 0.040 1599 NM_030087 1500032D16Rik 0.733 0.040 1600 NM_033444 Clic1 1.242 0.040 1601 NM_001033339 Mmp25 1.270 0.040 1602 NM_027196 Pold4 0.831 0.040 1603 NM_181404 Ankrd15 0.866 0.040 1604 ENSMUST082849 Unknown 1.231 0.040 1605 NM_008315 Htr7 1.193 0.040 1606 NM_019454 Dll4 0.786 0.040 1607 ENSMUST099278 Gm114 0.783 0.040 1608 ENSMUST059573 A930034L06Rik 0.746 0.040 1609 NM_009112 S100a10 1.118 0.040 1610 ENSMUST001456 Tmem79 0.840 0.040 1611 ENSMUST098758 I830077J02Rik 1.271 0.040 1612 NM_018761 Ctnnal1 0.783 0.040 1613 XR_033663 LOC624662 1.156 0.040 1614 NM_007945 Eps8 1.426 0.040 1615 GENSCAN0418691 Unknown 0.785 0.040 1616 NM_009136 Scrg1 1.175 0.040 1617 NM_013602 Mt1 1.355 0.040 1618 NM_153583 Atg4d 0.815 0.040 1619 XM_975751 LOC665268 1.152 0.040 1620 NM_019969 Plag1 0.763 0.040 1621 NM_027878 1200002N14Rik 1.449 0.040 1622 NM_028412 Ciz1 0.852 0.040 1623 NM_001033385 D630037F22Rik 0.807 0.041 1624 BC069874 2810408A11Rik 0.732 0.041 1625 U90514 Tcra-V8 1.190 0.041 1626 NM_175552 Wdr3 1.197 0.041 1627 NM_201355 Nat14 0.833 0.041 1628 NM_175750 Plxna4 0.842 0.041 1629 NM_028782 Lonp1 0.816 0.041 1630 ENSMUST0101634 Unknown 0.772 0.041 1631 GENSCAN0411269 Unknown 1.446 0.041 1632 NM_144923 Blvrb 0.863 0.041 1633 NM_153095 Mrgpra1 1.171 0.041 1634 NM_001033329 Arhgef9 0.820 0.041 1635 NM_175135 Eif2b3 1.221 0.041 1636 NM_031165 Hspa8 1.334 0.041 1637 NM_001085549 OTTMUSG008561 0.728 0.041 1638 NM_007936 Epha4 0.847 0.041 1639 NM_177652 Ryr3 0.891 0.041

1640 NM_027562 Clec2g 1.284 0.041 1641 NM_175130 Trpm4 0.841 0.041 1642 NM_029730 Mospd2 0.894 0.041 1643 NM_029546 Pwp2 1.254 0.041 1644 NM_016858 Rab33b 0.876 0.041 1645 ENSMUST068305 Mapk1ip1 0.794 0.041 1646 NM_175546 Wdfy2 0.837 0.041 1647 NM_024468 Trim39 0.892 0.041 1648 NM_001080815 Gipr 1.132 0.041 1649 NM_177364 Sh3pxd2b 1.331 0.041 1650 NR_000002 Snord32a 1.157 0.041 1651 BC052885 Thada 0.891 0.041 1652 NM_027192 Ttl 0.854 0.041 1653 GENSCAN0359716 Unknown 1.214 0.041 1654 NM_001005510 Syne2 0.868 0.041 1655 BC053913 5730419I09Rik 0.800 0.041 1656 NM_153582 Cmtm4 0.844 0.041 1657 ENSMUST098569 EG639396 0.777 0.041 1658 NM_028711 Slc25a27 0.775 0.042 1659 NM_001025613 Otud7b 0.877 0.042 1660 NM_007961 Etv6 1.214 0.042 1661 ENSMUST081747 0610040J01Rik 1.363 0.042 1662 NM_201609 Zfp652 0.848 0.042 1663 NM_027044 Pfdn5 0.845 0.042 1664 NM_028262 Setd3 0.857 0.042 1665 NM_001085378 Myh7b 1.160 0.042 1666 NM_001025561 Pus1 1.172 0.042 1667 ENSMUST027867 4930455F23Rik 0.863 0.042 1668 NM_013769 Tjp3 1.299 0.042 1669 NM_029239 Prkcn 0.874 0.042 1670 NM_011398 Slc25a14 0.918 0.042 1671 ENSMUST0100426 Unknown 0.803 0.042 1672 NM_020581 Angptl4 1.382 0.042 1673 NM_145138 Nek9 0.872 0.042 1674 XR_033950 EG667078 1.322 0.042 1675 NM_011921 Aldh1a7 0.845 0.042 1676 NM_027261 RefSeq 1.293 0.042 1677 ENSMUST084386 Unknown 1.120 0.042 1678 NM_011929 Clcn6 0.849 0.042 1679 ENSMUST0101013 LOC665521 1.344 0.042 1680 NM_009287 Stim1 0.838 0.042 1681 ENSMUST065820 Unknown 1.108 0.042 1682 ENSMUST036360 BC028528 0.740 0.042 1683 NM_019553 Ddx21 1.299 0.042 1684 BC058794 3110048E14Rik 0.836 0.042 1685 NM_011479 Sptlc2 1.287 0.042

1686 ENSMUST089933 Unknown 1.129 0.042 1687 NM_021496 Pvrl3 0.868 0.042 1688 NM_181400 Wdr47 0.786 0.042 1689 XM_908033 LOC633596 1.229 0.042 1690 NM_010881 Ncoa1 0.839 0.042 1691 NM_009086 Rpo1-2 1.345 0.042 1692 ENSMUST0101167 Unknown 1.566 0.042 1693 NM_172966 Sh3rf2 0.678 0.042 1694 NM_028744 Pi4k2b 0.828 0.042 1695 NM_134157 Atp6v1b1 1.175 0.042 1696 XM_488356 EG436212 1.171 0.042 1697 NM_001003916 AK129302 0.768 0.042 1698 ENSMUST099140 Unknown 1.175 0.042 1699 NM_019806 Vapb 0.898 0.042 1700 NM_029036 S100pbp 0.838 0.042 1701 XR_032208 LOC635039 1.306 0.042 1702 NM_026794 Deb1 0.833 0.042 1703 NM_025546 Rsl1d1 1.221 0.042 1704 U73624 Defcr26 1.274 0.042 1705 NM_145420 Ube2d1 1.156 0.042 1706 NM_146019 Chd3 0.830 0.042 1707 NM_144812 Tnrc6b 0.823 0.042 1708 GENSCAN0363879 Unknown 1.225 0.042 1709 XR_033404 LOC100047486 0.883 0.042 1710 NM_177081 Ptpn7 1.168 0.042 1711 NM_009879 Ift81 0.783 0.042 1712 NM_028651 Tmtc4 0.838 0.042 1713 ENSMUST090172 Unknown 1.187 0.042 1714 GENSCAN0404277 Unknown 0.821 0.042 1715 NM_001033877 Adamts17 0.783 0.042 1716 NM_010880 Ncl 1.258 0.042 1717 BC024460 4930430E16Rik 0.725 0.042 1718 NM_011129 Septin4 0.794 0.042 1719 XR_001553 EG626534 1.261 0.042 1720 AY149175 Mzf6d 1.712 0.042 1721 GENSCAN0408408 Unknown 1.208 0.042 1722 NM_178686 Ccdc100 0.827 0.042 1723 ENSMUST026889 Unknown 0.801 0.042 1724 NM_025845 Prpf38b 0.914 0.042 1725 ENSMUST079223 Unknown 0.825 0.042 1726 NM_008191 Guca2b 1.200 0.042 1727 NM_018830 Asah2 0.795 0.042 1728 AK051129 D130003B22Rik 0.845 0.042 1729 NM_008485 Lamc2 1.272 0.042 1730 AK137734 Crkrs 0.834 0.042 1731 NM_153547 Gnl3 1.329 0.042

1732 NM_172988 Fbxl4 0.829 0.042 1733 NM_032418 Dmpk 0.853 0.042 1734 AK082488 Gtf2ird2 0.901 0.042 1735 NM_178118 Dixdc1 0.867 0.042 1736 XR_033065 LOC667879 1.420 0.043 1737 ENSMUST0102473 Unknown 1.227 0.043 1738 XR_031591 LOC628753 1.178 0.043 1739 ENSMUST098485 Bcl2a1c 1.327 0.043 1740 NM_172132 Jmjd2b 0.870 0.043 1741 NM_020009 Frap1 0.869 0.043 1742 NM_053097 Cml3 0.674 0.043 1743 NM_011488 Stat5a 1.266 0.043 1744 ENSMUST042824 Unknown 0.867 0.043 1745 GENSCAN0411754 Unknown 1.172 0.043 1746 NM_010454 Hoxa6 0.774 0.043 1747 BC025086 2010315L10Rik 0.834 0.043 1748 NM_016658 Galt 0.839 0.043 1749 NM_172648 Ifi205 1.694 0.043 1750 NM_134201 V1rf4 1.130 0.043 1751 NM_022887 Tsc1 0.865 0.043 1752 NM_009098 Rps8 1.241 0.043 1753 XR_034988 LOC665772 1.168 0.043 1754 XM_989063 RP23-269N23.3 1.249 0.043 1755 NM_011824 Grem1 1.361 0.043 1756 BC039761 9830102E05Rik 0.801 0.043 1757 ENSMUST053420 Unknown 0.787 0.043 1758 NM_001033245 Hk3 1.238 0.043 1759 NM_007463 Speg 0.844 0.043 1760 ENSMUST030261 2610528J11Rik 1.365 0.044 1761 GENSCAN0408785 Unknown 1.194 0.044 1762 NM_001029850 Magi1 0.855 0.044 1763 NM_001078649 Tmem134 0.889 0.044 1764 BC048938 2810422J05Rik 0.814 0.044 1765 NM_001080949 Ttc5 0.812 0.044 1766 NM_009404 Tnfsf9 1.526 0.044 1767 NM_001008706 Calm5 1.174 0.044 1768 NM_177721 Ranbp6 0.876 0.044 1769 NM_020024 Taf10 0.843 0.044 1770 ENSMUST053608 Unknown 1.257 0.044 1771 NM_026114 Eif2s1 1.182 0.044 1772 NM_133871 Ifi44 1.572 0.044 1773 N.C.A. - 2.189 0.044 1774 ENSMUST075941 Unknown 0.857 0.044 1775 NM_029352 Dusp9 1.316 0.044 1776 NM_033327 Zfp423 0.858 0.044 1777 NM_009087 Rpo1-3 0.848 0.044

1778 GENSCAN0421713 Unknown 1.127 0.044 1779 BC060141 Nbeal1 0.881 0.044 1780 ENSMUST034049 Slc25a4 1.258 0.044 1781 NM_001039354 Lin7a 0.774 0.044 1782 NM_009839 Cct6b 0.884 0.044 1783 NM_183186 Foxn3 0.815 0.044 1784 NM_033609 Med15 1.159 0.044 1785 NM_008907 Ppia 1.225 0.044 1786 NR_003363 EG625054 1.290 0.044 1787 AK141895 Slc44a1 1.337 0.044 1788 AK163124 A630072M18Rik 0.781 0.044 1789 NM_011577 Tgfb1 1.321 0.044 1790 XR_001564 EG621699 1.248 0.044 1791 NM_001008548 Pde2a 0.879 0.044 1792 NM_019709 Mbtps1 0.870 0.044 1793 ENSMUST034737 2410004A20Rik 1.135 0.044 1794 NM_009703 Araf 0.885 0.044 1795 ENSMUST096268 Unknown 1.231 0.044 1796 NM_080469 Prnpip1 0.855 0.044 1797 AK143696 F430010L17 0.781 0.044 1798 BC050864 Fbxl7 0.785 0.044 1799 BC034114 4933437K13Rik 0.783 0.044 1800 NM_182995 6330503K22Rik 0.858 0.044 1801 XM_001476705 LOC100041484 1.103 0.044 1802 NM_008928 Map2k3 1.277 0.045 1803 N.C.A. - 1.331 0.045 1804 NM_019708 Scoc 1.155 0.045 1805 XM_992807 LOC676779 0.840 0.045 1806 ENSMUST098177 EG625321 1.218 0.045 1807 BC039806 Tmem125 1.477 0.045 1808 NM_133889 Bsdc1 0.837 0.045 1809 ENSMUST077423 Unknown 1.140 0.045 1810 NM_170755 BC038286 0.869 0.045 1811 NM_016926 Sart3 0.916 0.045 1812 XR_034373 LOC219180 1.262 0.045 1813 ENSMUST085217 Gk5 0.778 0.045 1814 N.C.A. - 0.865 0.045 1815 NM_153565 Pcsk9 1.189 0.045 1816 NM_009460 Sumo1 1.186 0.045 1817 NM_009924 Cnr2 1.167 0.045 1818 NM_033571 Fkbp6 1.175 0.045 1819 NM_133225 Acbd3 0.886 0.045 1820 ENSMUST019951 2410017P07Rik 0.822 0.045 1821 NM_001024508 Brd9 0.842 0.045 1822 NM_022311 Tcte2 0.845 0.045 1823 N.C.A. - 1.150 0.045

1824 NM_175465 Sestd1 0.765 0.045 1825 NM_008090 Gata2 0.795 0.045 1826 NM_010758 Mag 1.164 0.045 1827 NM_011308 Ncor1 0.920 0.045 1828 NM_010891 Septin2 1.099 0.045 1829 NM_008685 Nfe2 1.230 0.045 1830 ENSMUST053683 Zbtb9 0.847 0.045 1831 NM_011581 Thbs2 0.805 0.045 1832 NM_007885 Slc26a2 0.830 0.045 1833 NM_172882 Wdfy3 0.861 0.045 1834 AK132915 Itgad 1.219 0.045 1835 NM_009434 Phlda2 1.436 0.045 1836 NM_033314 Slco2a1 1.304 0.045 1837 GENSCAN0399328 Unknown 1.122 0.045 1838 NM_001033380 E030018N11Rik 1.388 0.045 1839 N.C.A. - 0.704 0.045 1840 ENSMUST063827 Unknown 0.873 0.045 1841 NM_001013380 Dync1li2 0.884 0.045 1842 ENSMUST055625 EG432987 1.322 0.045 1843 NM_008321 Id3 1.237 0.045 1844 NM_025983 Atp5e 0.803 0.046 1845 ENSMUST092997 Unknown 1.261 0.046 1846 NM_001097623 Trerf1 0.847 0.046 1847 NM_020296 Rbms1 1.159 0.046 1848 NM_013761 Srr 0.795 0.046 1849 AJ409464 Dazl-binding(ib7) 1.589 0.046 1850 AK122307 Gpatch8 0.840 0.046 1851 ENSMUST077776 Unknown 1.112 0.046 1852 NM_134207 V1rg6 1.158 0.046 1853 NM_013914 Snai3 1.426 0.046 1854 ENSMUST037763 Unknown 0.832 0.046 1855 NM_145603 Ces2 1.136 0.046 1856 NM_138956 Rassf3 0.799 0.046 1857 XR_033817 LOC667989 1.181 0.046 1858 NM_001029878 Lonrf2 0.734 0.046 1859 AF020338 BC016423 1.235 0.046 1860 NM_013697 Ttr 0.669 0.046 1861 NM_174995 Mgst2 0.816 0.046 1862 ENSMUST015124 5730449L18Rik 1.230 0.046 1863 XR_032084 LOC667348 1.162 0.046 1864 NM_153555 Wdr42a 0.845 0.046 1865 NM_028119 Ddb2 0.852 0.046 1866 NM_001003910 BC030307 0.875 0.046 1867 NM_019986 Habp4 0.861 0.046 1868 NM_021301 Slc15a2 0.734 0.046 1869 NM_010735 Lta 1.223 0.046

1870 NM_027530 Rufy3 0.848 0.046 1871 ENSMUST011407 Unknown 1.171 0.046 1872 ENSMUST092891 Cacng7 0.802 0.046 1873 NM_029536 Gpr165 0.774 0.046 1874 NM_178935 4932441K18Rik 0.832 0.046 1875 NM_009376 Ift88 0.847 0.046 1876 NR_002840 Gas5 1.565 0.046 1877 NM_018750 Rassf5 1.197 0.046 1878 ENSMUST050374 BC030396 1.161 0.046 1879 NM_011521 Sdc4 1.287 0.046 1880 XM_887553 EG623114 1.153 0.046 1881 XM_001474551 RP23-153M14.8 0.832 0.046 1882 NM_001081362 Trrap 0.874 0.046 1883 NM_010753 Mxd4 0.792 0.046 1884 NM_145358 Camkk2 1.243 0.046 1885 NM_001082960 Itgam 1.320 0.046 1886 ENSMUST094309 A830073O21Rik 0.842 0.046 1887 NM_016874 Deaf1 0.817 0.046 1888 NM_001093765 Myadm 1.124 0.046 1889 N.C.A. - 1.186 0.046 1890 GENSCAN0409354 Unknown 1.177 0.046 1891 ENSMUST083179 Unknown 1.304 0.046 1892 XM_001472912 LOC100039478 1.234 0.046 1893 NM_177910 Gmppb 1.238 0.046 1894 BC096691 Eif1 1.088 0.046 1895 NM_008992 Abcd4 0.813 0.047 1896 XR_034838 LOC668275 1.227 0.047 1897 NM_020287 Insm2 1.158 0.047 1898 mmu-mir-30d MI0000549 0.785 0.047 1899 NM_198311 Ttc8 0.835 0.047 1900 NM_009304 Syngr2 1.129 0.047 1901 NM_153788 Centb1 1.290 0.047 1902 NM_054095 Efcbp2 1.169 0.047 1903 BC099522 1190007F08Rik 0.887 0.047 1904 NM_009461 Ubr1 0.903 0.047 1905 NM_001081345 Chd2 0.849 0.047 1906 XR_030780 LOC669207 1.241 0.047 1907 XR_031974 LOC670326 1.300 0.047 1908 NM_144917 Rbed1 0.792 0.047 1909 NM_021516 Mark3 0.914 0.047 1910 NM_026408 Sncaip 0.723 0.047 1911 NM_145067 Gucy2c 1.212 0.047 1912 NM_145580 Tmem149 0.869 0.047 1913 XM_887141 LOC622699 1.236 0.047 1914 NM_018824 Slc23a2 0.831 0.047 1915 NM_001081429 Ccdc15 0.850 0.047

1916 NM_007707 Socs3 1.955 0.047 1917 ENSMUST077235 Dhrsx 1.133 0.047 1918 NM_011586 Myo18a 1.232 0.047 1919 BC048191 Gtl2 0.816 0.047 1920 ENSMUST029915 Unknown 0.773 0.047 1921 NM_175154 Galk2 0.890 0.047 1922 NM_145853 Tpcn1 0.800 0.047 1923 XM_001477326 LOC100043002 1.203 0.047 1924 NM_177325 Tsr1 1.296 0.048 1925 NM_197940 Wipf2 0.873 0.048 1926 NM_130858 Nxph3 1.216 0.048 1927 NM_031878 Smarcd2 0.824 0.048 1928 NM_009351 Tep1 0.902 0.048 1929 XM_904680 C7 0.814 0.048 1930 NM_007405 Adcy6 0.821 0.048 1931 NM_153791 Flywch1 0.906 0.048 1932 NM_001038703 Gpr146 1.362 0.048 1933 NM_007590 Calm3 0.864 0.048 1934 NM_001034907 Zc3h12b 0.814 0.048 1935 NM_016887 Cldn7 1.348 0.048 1936 NM_025385 Prr13 1.295 0.048 1937 NM_013630 Pkd1 0.846 0.048 1938 X15962 Rps12 1.184 0.048 1939 ENSMUST030114 Unknown 0.846 0.048 1940 NM_008638 Mthfd2 1.414 0.048 1941 ENSMUST070150 E130308A19Rik 0.856 0.048 1942 NM_173765 A230062G08Rik 0.863 0.048 1943 NM_027758 Tbc1d9 0.765 0.048 1944 NM_027444 Bbx 0.887 0.048 1945 NM_028762 Rbm19 1.200 0.048 1946 NM_133765 Fbxo31 0.822 0.048 1947 N.C.A. - 0.857 0.048 1948 NM_008911 Ppox 0.801 0.048 1949 ENSMUST017316 Unknown 1.203 0.048 1950 XM_001475442 4930463M05Rik 1.179 0.048 1951 NM_178398 Wipi2 0.885 0.048 1952 NM_024288 Rmnd5a 0.814 0.048 1953 NM_177384 Ttc16 1.180 0.048 1954 NM_145506 Epb4.1l5 0.828 0.048 1955 XM_912125 4930405M20Rik 0.872 0.048 1956 NM_026880 Pink1 0.826 0.048 1957 NM_026298 Ift172 0.818 0.048 1958 NM_009676 Aox1 0.764 0.048 1959 NM_016666 Aip 0.856 0.048 1960 NM_010333 Edg5 1.209 0.048 1961 NM_028599 Wdr75 1.220 0.048

1962 NM_021332 Glp1r 1.214 0.048 1963 NM_133649 Slc12a6 0.734 0.048 1964 NM_173364 Zfp445 0.856 0.048 1965 NM_133857 Usp53 0.835 0.048 1966 NM_144783 Wt1 0.827 0.048 1967 N.C.A. - 1.828 0.048 1968 ENSMUST061202 Unknown 1.090 0.048 1969 NM_080575 Acss1 0.631 0.048 1970 NM_011159 Prkdc 0.850 0.048 1971 NM_008678 Ncoa2 0.853 0.049 1972 NM_026137 Wdr13 0.841 0.049 1973 BC051541 2600009E05Rik 0.887 0.049 1974 GENSCAN0392275 Unknown 1.142 0.049 1975 NM_172713 Sdad1 1.253 0.049 1976 NM_026665 Cep57 0.847 0.049 1977 NM_001033432 Heca 0.825 0.049 1978 NR_002905 EG436583 1.284 0.049 1979 XM_984786 Tns1 0.808 0.049 1980 ENSMUST081227 Unknown 1.206 0.049 1981 NM_181316 Bbs9 0.801 0.049 1982 NM_207671 Zfp318 0.812 0.049 1983 NM_011212 Ptpre 1.188 0.049 1984 NM_009418 Tpp2 1.179 0.049 1985 NM_144958 Eif4a1 1.207 0.049 1986 NM_011817 Gadd45g 1.466 0.049 1987 AK042470 Zfp157 0.861 0.049 1988 NM_010320 Gng8 0.850 0.049 1989 NM_011811 Farsb 1.168 0.049 1990 NM_028608 Glipr1 1.175 0.049 1991 NM_133757 Pgs1 1.316 0.049 1992 NM_019735 Apip 0.812 0.049 1993 AK122339 D2Ertd391e 0.859 0.049 1994 NM_026728 Echdc2 0.825 0.049 1995 NM_018748 Golga4 0.850 0.049 1996 NM_172760 Elmo3 0.914 0.049 1997 NM_021462 Mknk2 0.760 0.049 1998 NM_011852 Oas1g 1.461 0.049 1999 NM_019687 Slc22a4 1.193 0.049 2000 NM_138741 Sdpr 0.738 0.049 2001 NM_138753 Hexim1 0.851 0.049 2002 NM_025617 2210012G02Rik 0.820 0.049 2003 NM_019965 Dnajb12 0.900 0.049 2004 NM_001081417 Chd7 1.245 0.049 2005 NM_024228 Gdpd3 0.823 0.049 2006 NM_009739 Bckdk 0.851 0.049 2007 NM_144808 Slc39a14 1.486 0.049

2008 NM_053111 Ear6 1.154 0.049 2009 BC056472 1500031H01Rik 0.892 0.049 2010 NM_026856 Zfp644 0.911 0.049 2011 NM_017380 Septin9 1.119 0.050 2012 NM_001080924 Znrf3 0.853 0.050 2013 NM_019868 Hnrph2 1.343 0.050 2014 NM_145155 Wasf3 0.860 0.050 2015 BC027208 Rps25 1.186 0.050 2016 ENSMUST067347 Unknown 1.422 0.050 2017 N.C.A. - 1.248 0.050 2018 NM_011289 Rpl27 1.235 0.050 2019 NM_011264 Rev3l 0.762 0.050 2020 ENSMUST071948 Unknown 1.272 0.050 2021 NM_026431 1810043G02Rik 0.800 0.050 2022 NM_011771 Ikzf3 0.815 0.050 2023 ENSMUST014546 Tsg101 1.094 0.050 2024 NM_020622 ORF9 1.536 0.050 2025 NM_028198 Xpo5 1.205 0.050 2026 ENSMUST078796 Unknown 1.344 0.050 2027 NM_201256 Eif4ebp3 0.863 0.050 2028 ENSMUST039319 Unknown 0.838 0.050 2029 NM_175356 Pi4kb 0.904 0.050 2030 NM_028291 Pan3 0.883 0.050 2031 NM_019928 Klk4 1.189 0.050 2032 NM_020599 Rlbp1 1.136 0.050 2033 AK158895 2900092E17Rik 0.780 0.050 2034 NM_027382 Hdac8 0.777 0.050 2035 NM_010422 Hexb 0.810 0.050 2036 NM_144920 Plekha5 0.854 0.050 2037 NM_030150 Dhx58 1.256 0.050 2038 BC085505 1110013L07Rik 0.821 0.050 2039 NM_009283 Stat1 1.208 0.050 2040 NM_011452 Serpinb9b 1.390 0.050 2041 NM_001034900 OTTMUSG015743 1.186 0.050 2042 NM_080793 Setd7 0.819 0.050 2043 NM_173347 Prune 0.816 0.050 2044 NM_010807 Marcksl1 1.217 0.050 2045 MMU-MIR-701 MI0004685 0.827 0.050 2046 NM_011227 Rab20 1.286 0.050

aN.C.A., gene for this NCBI Reference Sequence (RefSeq) is not currently annotated; bGene name, no current gene designation for this RefSeq; cFDA, false discovery rate.

Table IIIs - Innate transcriptional networks and biological pathways triggered by UPEC in bladder as identified using Genes Ontology (GO; A), innateDB systems-level analysis

(B), and Ingenuity Pathway Analysis (C) showing the top hits in highly relevant responses in C57BL/6 mice. Conserved pathways between C57BL/6 and CBA mice as identified by GO and Kyoto Encyclopedia of Genes and Genomes are highlighted in (D).

Pathway Details of Activated Pathway or Gene p value/ Number/ Score or ∆ Category Expression

A. Genes Ontology (GO) – C57BL/6 mice 0000187 MAPK activation 0.01 0001569 Blood vessel morphogenesis 0.01 0001570 Vasculogenesis 0.01 0001763 Branching morphogenesis 0.01 0001933 Negative regulation of protein amino acid phosphorylation 0.01 0001934 Positive regulation of protein amino acid phosphorylation 0.01 0002237 Response to bacteria associated molecule 0.01 0002250 Adaptive immune response 0.01 0002460 Adaptive immune response (recombination of Ig receptors) 0.01 0002712 Regulation of B cell mediated immunity 0.01 0002889 Regulation of Immunoglobulin-mediated immune response 0.01 0006469 Negative regulation of protein kinase activity 0.01 0006752 Group transfer coenzyme metabolism 0.01 0006760 Folate and derivative metabolism 0.01 0006935 Chemotaxis 0.01 0007257 JUN kinase activation 0.01 0007266 Rho-mediated signal transduction 0.01 0009617 Response to bacteria 0.01 0009913 Epidermal cell differentiation 0.01 0010562 Positive regulation of phosphorus metabolism 0.01 0030334 Regulation of cell migration 0.01 0030593 Neutrophil chemtaxis 0.01 0031401 Positive regulation of protein modification 0.01 0031424 Keratinization 0.01 0032496 Response to lipopolysaccharide 0.01 0032615 Interleukin-12 production 0.01 0032943 Mononuclear cell proliferation 0.01 0033673 Negative regulation of kinase activity 0.01 0033674 Positive regulation of kinase activity 0.01 0035023 Regulation of rho protein signal transduction 0.01

0042098 T cell proliferation 0.01 0042327 Positive regulation of phosphorylation 0.01 0042330 Taxis 0.01 0042490 Mechanoreceptor differentiation 0.01 0043405 Regulation of MAPK activity 0.01 0043406 Positive regulation of MAPK activity 0.01 0043488 Regulation of mRNA stability 0.01 0045637 Regulation of myeloid cell differentiation 0.01 0045667 Regulation of osteoblast differentiation 0.01 0045669 Positive regulation of osteoblast differentiation 0.01 0045937 Positive regulation of phosphate metabolism 0.01 0046483 Heterocycle metabolism 0.01 0046631 Alpha-beta T cell activation 0.01 0046651 Lymphocyte proliferation 0.01 0046661 Male sex differentiation 0.01 0046888 Negative regulation of hormone secretion 0.01 0048009 IGF receptor signalling 0.01 0048754 Tubulogenesis 0.01 0050767 Regulation of neurogenesis 0.01 0050769 Positive regulation of neurogenesis 0.01 0050900 Leukocyte migration 0.01 0051048 Negative regulation of secretion 0.01 0051145 Smooth muscle cell differentiation 0.01 0051271 Negative regulation of cell movement 0.01 0043507 Positive regulation of JUNK activity 0.012 0045446 Endothelial cell differentiation 0.012 0002274 Myeloid leukocyte activation 0.013 0007159 Leukocyte adhesion 0.013 0019216 Regulation of lipid metabolism 0.013 0043330 Response to exogenous dsRNA 0.013 0045860 Positive regulation of protein kinase activity 0.013 0051347 Positive regulation of transferase activity 0.013 0000723 Telomere maintenence 0.014 0032200 Telomere organisation 0.014 0046890 Regulation of lipid biosynthesis 0.014 0006399 tRNA metabolism 0.015 0008033 tRNA maturation 0.015 0050679 Positive regulation of epithelial cell proliferation 0.015 0051270 Regulation of cell movement 0.015 0008544 Epidermis development 0.016 0030522 Intracellular receptor-mediated signallling 0.016 0031663 LPS-mediated signalling 0.016 0048557 Embryonic digestive tract morphogenesis 0.016 0048566 Embryonic gut development 0.016 0051091 Positive regulation of transcription factor activity 0.016 0051092 NF-kappaB activation 0.016

0051147 Regulation of muscle cell differentiation 0.016 0007498 Mesoderm development 0.017 0019218 Regulation of steroid metabolism 0.017 0042326 Negative regulation of phosphorylation 0.017 0048729 Tissue morphogenesis 0.017 0001658 Ureteric bud branching 0.018 0001892 Embryonic placenta development 0.018 0008038 Neuron recognition 0.018 0008286 Insulin receptor signalling 0.018 0009451 RNA modification 0.018 0016202 Regulation of striated muscle tissue development 0.018 0030595 Leukocyte chemotaxis 0.018 0040015 Negative regulation of body growth 0.018 0043367 CD4-positive, alpha-beta T cell differentiation 0.018 0043487 Regulation of RNA stability 0.018 0045638 Negative regulation of myeloid cell differentiation 0.018 0048634 Regulation of muscle organ development 0.018 0051348 Negative regulation of transferase activity 0.018 0050768 Negative regulation of neurogenesis 0.019 0007205 PKC activation by G protein-coupled receptor signalling 0.02 0030336 Negative regulation of cell migration 0.02 0045807 Positive regulation of endocytosis 0.02 0048545 Response to steroid hormone stimulus 0.02 0050730 Regulation of peptidyl-tyrosine phosphorylation 0.02 0050731 Positive regulation of peptidyl-tyrosine phosphorylation 0.02 0000077 DNA damage checkpoint 0.021 0008629 Induction of apoptosis by intracellular signals 0.021 0032270 Positive regulation of cellular protein metabolism 0.021 0051247 Positive regulation of protein metabolism 0.021 0060113 Inner ear receptor cell differentiation 0.021 0007439 Ectodermal gut development 0.022 0032944 Regulation of mononuclear cell differentiation 0.022 0046632 Alpha-beta T cell differentiation 0.022 0048567 Ectodermal gut morphogenesis 0.022 0050670 Regulation of lymphocyte proliferation 0.022 0031570 DNA integrity checkpoint 0.023 0048730 Epidermis morphogenesis 0.023 0007623 Circadian rhythm 0.024 0019724 B cell mediated immunity 0.024 0030216 Keratinocyte differentiation 0.024 0040014 Regulation of body growth 0.024 0042476 Odontogenesis 0.025 0043410 Positive regulation of MAPKKK cascade 0.025 0045577 Regulation of B cell differentiation 0.025 0048144 Fibroblast proliferation 0.025 0048145 Regulation of fibroblast proliferation 0.025

0000188 Termination of MAPK activity 0.026 0007346 Mitotic cell cycle regulation 0.026 0009067 Aspartate family amino acid biosynthesis 0.026 0031124 mRNA 3’-end processing 0.026 0031399 Regulation of protein modification 0.026 0042226 Interleukin-6 biosynthesis 0.026 0043407 Negative regulation of MAPK activity 0.026 0050764 Regulation of phagocytosis 0.026 0050766 Positive regulation of phagocytosis 0.026 0002573 Myeloid leukocyte differentiation 0.027 0010563 Negative regulation of phosphorus metabolism 0.027 0045936 Negative regulation of phosphate metabolism 0.027 0051098 Regulation of binding 0.027 0051101 Regulation of DNA binding 0.027 0042088 Th1 type immune response 0.028 0001738 Epithelial polarization 0.029 0019221 Cytokine-mediated signalling 0.029 0051241 Negative regulation of multicellular organizmal process 0.029 0002683 Negative regulation of immune system process 0.03 0032147 Protein kinase activation 0.03 0043331 Response to dsRNA 0.03 0046634 Regulation of alpha-beta T cell activation 0.03 0042475 Odontogenesis of dentine-containing teeth 0.031 0043086 Negative regulation of catalytic activity 0.031 0048066 Developmental pigmentation 0.031 0050907 Sensory transduction of chemical stimulus 0.031 0002762 Negative regulation of myeloid leukocyte differentiation 0.032 0006691 Leukotriene metabolism 0.032 0007260 Negative regulation of myeloid leukocyte differentiation 0.032 0009262 Deoxyribonucleotide metabolism 0.033 0009620 Response to fungus 0.033 0043648 Dicarboxylate metabolism 0.033 0009411 Response to UV light 0.035 0006305 DNA alkylation 0.036 0006306 DNA methylation 0.036 0018108 Peptidyl-tyrosine phosphorylation 0.036 0018212 Peptidyl-tyrosine modification 0.036 0048565 Gut development 0.037 0048675 Axon extension 0.037 0000075 Cell cycle checkpoint 0.038 0001932 Regulation of protein amino acid phosphorylation 0.038 0006730 One-carbon metabolism 0.038 0009725 Response to hormone stimulus 0.038 0030100 Regulation of endocytosis 0.038 0042058 Regulation of EGRF signalling 0.038 0043388 Positive regulation of DNA binding 0.038

0051099 Positive regulation of binding 0.038 0001659 thermoregulation 0.039 0001843 Neural tube closure 0.039 0019220 Regulation of phosphate metabolism 0.039 0042325 Regulation of phosphorylation 0.039 0051174 Regulation of phosphorus metabolism 0.039 0007422 Peripheral nervous system development 0.04 0032640 TNF-alpha production 0.04 0042129 Regulation of T cell proliferation 0.04 0007015 Actin filament organization 0.041 0045576 Mast cell activation 0.041 0051050 Positive regulation of transport 0.041 0006261 DNA-dependent DNA replication 0.042 0009967 Positive regulation of signal transduction 0.042 0042089 Cytokine biosynthesis 0.042 0042107 Cytokine metabolism 0.042 0042491 Auditory receptor cell differentiation 0.042 0046638 Positive regulation of alpha-beta T cell differentiation 0.042 0048547 Gut morphogenesis 0.042 0001825 Blastocyst formation 0.043 0045926 Negative regulation of growth 0.043 0016054 Organic acid catabolism 0.044 0046395 Carboxylic acid catabolism 0.044 0051054 Positive regulation of DNA metabolism 0.044 0051090 Regulation of transcription factor activity 0.044 0007088 Regulation of mitosis 0.045 0007249 NIK-I-kappaB/NF-kappaB cascade 0.045 0033555 Multicellular organizmal response to stress 0.045 0046637 Regulation of alpha-beta T cell differentiation 0.045 0048568 Embryonic organogenesis 0.045 0050673 Epithelial cell proliferation 0.045 0050770 Regulation of axonogenesis 0.045 0001822 Kidney development 0.046 0018105 Peptidyl-serine phosphorylation 0.046 0018209 Peptidyl-serine modification 0.046 0048546 Alimentary canal morphogenesis 0.046 0050678 Regulation of epithelial cell proliferation 0.046 0001838 Embryonic epithelial tube formation 0.047 0009066 Aspartate family amino acid metabolism 0.047 0009719 Response to endogenous stimulus 0.047 0043449 Alkene metabolism 0.047 0050913 Bitter taste perception 0.047 0002474 Peptide antigen processing & presentation via MHC class I 0.048 0042733 Embryonic digit morphogenesis 0.048 0048536 Spleen development 0.048 0051130 Positive regulation of cell organization 0.048

0008217 Blood pressure homeostasis 0.049 0009593 Detection of chemical stimulus 0.049 0009799 Determination of symmetry 0.049 0009855 Determination of bilateral symmetry 0.049 0016569 Covalent chromatin modification 0.049 0030183 B cell differentiation 0.049 0032675 Regulation of Interleukin-6 production 0.049 0043122 Regulation of I-kappaB kinase/NF-kappaB cascade 0.049 0051187 Cofactor catabolism 0.049

B. innateDB (systems-level analysis) – C57BL/6 mice 7247 Signaling in Immune system .000 8111 NOD-like receptor signaling pathway .000 699 Toll-like receptor signaling pathway .000 728 MAPK signaling pathway .000 7285 Class A/1 (Rhodopsin-like receptors) .000 7308 Peptide ligand-binding receptors .000 604 Cytokine-cytokine receptor interaction .001 6920 Chemokine receptors bind chemokines .002 63 Heteromeric GPCR signaling pathway .002 185 Heterotrimeric GPCR signaling pathway .002 195 Heterotrimeric GPCR signaling pathway .002 Heterotrimeric GTP-binding protein coupled receptor 11 signaling pathway .002 Heterotrimeric GTP-binding protein coupled receptor 187 signaling pathway .002 4351 Chemokine signaling pathway .002 8116 Cytosolic DNA-sensing pathway .002 692 T cell receptor signaling pathway .003 7213 Hemostasis .005 6955 Signaling by GPCR .006 51 Heterotrimeric GPCR signaling pathway .006 759 Apoptosis .006 235 Gene expression of IL2 by AP-1 .008 115 TNFR1 signaling pathway .008 7021 Toll Like Receptor 3 (TLR3) Cascade .008 7720 Innate Immunity Signaling .012 7716 TCR signaling .012 7491 Viral dsRNA:TLR3:TRIF Complex Activates RIP1 .014 121 JAK-STAT pathway and regulation pathway .016 666 P53 signaling pathway .018 7907 P75NTR signals via NF-kB .018 TRAF6 Mediated Induction of the antiviral cytokine IFN- 7677 alpha/beta cascade .018 790 B cell receptor signaling pathway .022

7678 Integrin cell surface interactions .022 353 T cell receptor signaling pathway .022 747 Small cell lung cancer .022 7639 Toll Receptor Cascades .022 651 Jak-STAT signaling pathway .028 113 IKK-NFkB cascade .032 4363 Prion diseases .032 7738 Cell surface interactions at the vascular wall .038 Immunoregulatory interactions between a Lymphoid and a 7692 non-Lymphoid cell .038 CD4 T cell receptor signaling (through Vav, Rac and JNK 275 cascade .038 7853 Exocytosis of Alpha granule .038 6904 Platelet degranulation .038 682 Hematopoietic cell lineage .039 720 Neuroactive ligand-receptor interaction .041 639 ECM-receptor interaction .055 7689 Facilitative Na+-independent glucose transporters .055 7351 Glucose and other sugar SLC transporters .055 6967 Phase 1 functionalization .055 7067 Platelet Activation .06 4393 Pathways in cancer .069 7142 Downstream TCR signaling .072 616 Bladder cancer .072 7028 Dissolution of Fibrin Clot .072 85 IKK-NF-kappaB cascade .072 159 NF-kB signaling .072 7674 Regulated proteolysis of p75NTR .072 2813 Systemic lupus erythematosus .072 758 Adipocytokine signaling pathway .076 627 ErbB signaling pathway .076 61 IL-1 signaling .076 59 JNK cascade .078 7660 NF-kB is activated and signals survival .078 7538 Response to elevated platelet cytosolic Ca++ .078 27 Toll-like receptor signaling pathway .078 7575 Formation of Platelet plug .082 755 Leukocyte transendothelial migration .082

C. Ingenuity Pathway Analysis (IPA) – C57BL/6 mice

Networks Genetic Disorder, Hematological Disease, Drug Metabolism 54 Networks Inflammatory Response, Cell-To-Cell Signaling and 39 Interaction, Tissue Development Networks Cellular Movement, Immune Cell Trafficking, Antigen 36 Presentation

Networks Cell Death, Gene Expression, Cellular Growth and 30 Proliferation Networks Inflammatory Response, Cellular Development, 30 Hematopoiesis

Biological -Diseases and Disorders- Function Inflammatory Response (170 molecules) <0.001 Dermatological Disease and Conditions (125 molecules) <0.001 Inflammatory Disease (177 molecules) <0.001 Genetic Disorder (93 molecules) <0.001 Connective Tissue Disorders (121 molecules) <0.001

Biological -Molecular and Cellular Function- Function Cellular Movement (155 molecules) <0.001 Cell-To-Cell Signaling and Interaction (158 molecules) <0.001 Cell Death (151 molecules) <0.001 Antigen Presentation (92 molecules) <0.001 Cellular Growth and Proliferation (186 molecules) <0.001

Biological -Physiological System Development and Function- Function Immune Cell Trafficking (131 molecules) <0.001 Hematological System Development and Function (171 <0.001 molecules) Tissue Development (151 molecules) <0.001 Tissue Morphology (105 molecules) <0.001 Hematopoiesis (96 molecules) <0.001

Canonical Pathways IL-10 Signaling <0.001 Dendritic Cell Maturation <0.001 IL-17A Signaling in Fibroblasts <0.001 TNFR2 Signaling <0.001 Role of Macrophages, Fibroblasts and Endothelial Cells in <0.001 Rheumatoid Arthritis

Molecules CXCL3 45.40 S100A8 45.36 IL-6 41.98 IL36G 36.41 S100A9 36.06 IL-1B 34.74 CXCL10 25.49 CLEC4E 24.99 MMP8 24.68 CCL3L1/CCL3L3 22.44 Mir-205 3.07

GATA3 2.73 PTCH1 2.66 GJB3 2.49 5430435G22Rik 2.34 BMP4 2.33 Zfp640 2.30 Mir-145 2.29 WNT5A 2.20 ARHGAP20 2.12

Toxicity -Mechanisms- Liver Necrosis/Cell Death <0.001 LXR/RXR Activation <0.001 Renal Necrosis/Cell Death <0.001 NF-κB Signaling <0.001 Hepatic Cholestasis <0.001

Toxicity -Clinical Chemistry and Hematology- Increased Levels of AST <0.001 Increased Levels of ALT <0.001 Increased Levels of Alkaline Phophatase <0.001 Decreased Levels of Albumin <0.001 Increased Levels of CRP <0.001

Toxicity -Cardiotoxicity- Cardiac Infarction <0.001 Cardiac Hypertrophy <0.001 Cardiac Stenosis <0.001 Cardiac Necrosis/Cell Death <0.001 Cardiac Fibrosis <0.001

Toxicity -Hepatotoxicity- Liver Damage <0.001 Liver Necrosis/Cell Death <0.001 Liver Inflammation <0.001 Liver Proliferation <0.001 Liver Hepatitis <0.001

Toxicity -Nephrotoxicity- Renal Nephritis <0.001 Renal Damage <0.001 Renal Necrosis/Cell Death <0.001 Renal Proliferation <0.001 Renal Tubule Injury <0.001

D. Conserved Pathways – C57BL/6 and CBA mice

KEGG CBA B6 04520 Adherens junction 0.008 0.038 04630 Jak-STAT signaling pathway 0.018 0.017 04660 T cell receptor signaling pathway 0.018 0.012 04662 B cell receptor signaling pathway 0.022 0.033 04666 Fc gamma R-mediated phagocytosis 0.014 <0.25 05200 Pathways in cancer 0.016 <0.25 05210 Colorectal cancer 0.022 0.012 05212 Pancreatic cancer 0.016 0.012 00760 Nicotinate and nicotinamide metabolism 0.008 0.033 04722 Neurotrophin signaling pathway 0.008 <0.25 04620 Toll-like receptor signaling pathway 0.016 0.012 04640 Hematopoietic cell lineage 0.022 <0.25 04070 Phosphatidylinositol signalling system 0.051 0.012 04623 Cytosolic DNA-sensing pathway 0.032 <0.25 04060 Cytokine-cytokine receptor interaction 0.008 <0.25 04062 Chemokine signaling pathway 0.014 <0.25 04210 Apoptosis 0.016 0.028 04621 NOD-like receptor signaling pathway 0.036 <0.25 04650 Natural killer cell mediated cytotoxicity 0.037 <0.25 04670 Leukocyte transendothelial migration 0.008 <0.25

GO 0000187 MAPK activation <0.25 0.01 0001838 Embryonic epithelial tube formation 0.021 0.047 0002237 Response to molecule of bacterial origin 0.022 0.01 0006909 Phagocytosis 0.030 <0.25 0007159 Leukocyte cell-cell adhesion 0.010 0.013 0007257 JUN kinase activation <0.25 0.01 0007266 Rho protein signal transduction 0.034 0.01 0009913 Epidermal cell differentiation <0.25 0.01 0010741 Negative regulation of intracellular protein kinase cascade 0.025 <0.25 0030593 Neutrophil chemotaxis 0.030 0.01 0030595 Leukocyte chemotaxis 0.030 0.018 0032494 Response to peptidoglycan 0.042 <0.25 0032496 Response to lipopolysaccharide <0.25 0.01 0032615 Interleukin-12 production 0.041 0.01 0032640 TNF-alpha production <0.25 0.04 0032680 Regulation of tumor necrosis factor production 0.044 <0.25 0032755 Positive regulation of interleukin-6 production 0.050 <0.25 0032760 Positive regulation of tumor necrosis factor production 0.028 <0.25

0032946 Positive regulation of mononuclear cell proliferation 0.030 <0.25 0042088 T-helper 1 type immune response 0.020 0.028 0042089 Cytokine biosynthesis <0.25 0.042 0042098 T cell proliferation 0.015 0.01 0042102 Positive regulation of T cell proliferation 0.015 <0.25 0042107 Cytokine metabolic process 0.048 0.042 0043405 Regulation of MAP kinase activity 0.022 0.01 0043406 Positive regulation of MAP kinase activity 0.043 0.01 0043507 Positive regulation of JUN kinase activity 0.040 0.012 0046631 Alpha-beta T cell activation 0.010 0.01 0046632 Alpha-beta T cell differentiation 0.022 <0.25 0046635 Positive regulation of alpha-beta T cell activation 0.022 0.01 0050671 Positive regulation of lymphocyte proliferation 0.030 <0.25 0050900 Leukocyte migration 0.040 0.01 0051090 Regulation of transcription factor activity 0.041 0.044 0051092 NF-kappaB activation <0.25 0.016 0060326 Cell chemotaxis 0.030 <0.25 0070665 Positive regulation of leukocyte proliferation 0.030 <0.25 0071706 Tumor necrosis factor superfamily cytokine production 0.044 <0.25 0072175 Epithelial tube formation 0.021 <0.25 0090046 Regulation of transcription regulator activity 0.041 <0.25 0002819 Regulation of adaptive immune response 0.030 <0.25 0002822 Regulation of adaptive immune response 0.030 <0.25 0000060 Protein import into nucleus, translocation 0.031 <0.25 0045766 Positive regulation of angiogenesis 0.022 <0.25 0051091 Activation of transcription factor activity 0.010 0.016 0051098 Regulation of binding 0.010 0.027 0051101 Regulation of DNA binding 0.029 0.027 0090047 Positive regulation of transcription regulator activity 0.010 <0.25 0001819 Positive regulation of cytokine production 0.046 <0.25 0002274 Myeloid leukocyte activation <0.25 0.013 0046637 Regulation of alpha-beta T cell differentiation <0.25 0.045 0046638 Positive regulation of alpha-beta T cell differentiation 0.022 0.042 0043388 Positive regulation of DNA binding 0.010 0.038 0051099 Positive regulation of binding <0.25 0.038 0007439 Ectodermal gut development <0.25 0.022 0048567 Ectodermal gut morphogenesis <0.25 0.022 0001841 Neural tube formation 0.021 <0.25 0060249 Anatomical structure homeostasis 0.030 <0.25 0007260 Negative regulation of myeloid leukocyte differentiation <0.25 0.032 0016570 Histone modification 0.022 <0.25 0034504 Protein localization to nucleus 0.010 <0.25 0002696 Positive regulation of leukocyte activation 0.022 <0.25 0042475 Odontogenesis of dentine-containing teeth <0.25 0.031 0042476 Odontogenesis 0.019 0.025 0050870 Positive regulation of T cell activation 0.010 <0.25

0051251 Positive regulation of lymphocyte activation 0.022 <0.25 0007440 Foregut morphogenesis 0.021 <0.25 0009991 Response to extracellular stimulus 0.010 <0.25 0019221 Cytokine-mediated signaling pathway 0.037 0.029 0023036 Initiation of signal transduction 0.037 <0.25 0023038 Signal initiation by diffusible mediator 0.037 <0.25 0023049 Signal initiation by protein/peptide mediator 0.037 <0.25 0046634 Regulation of alpha-beta T cell activation 0.046 0.03 0016331 Morphogenesis of embryonic epithelium 0.046 <0.25 0051607 Defense response to virus 0.032 <0.25 0048704 Embryonic skeletal system morphogenesis 0.034 <0.25 0051648 Vesicle localization 0.044 <0.25 0002377 Immunoglobulin production 0.038 <0.25 0043367 CD4-positive, alpha-beta T cell differentiation <0.25 0.018 0016569 Covalent chromatin modification 0.022 0.049 0050764 Regulation of phagocytosis 0.030 0.026 0050766 Positive regulation of phagocytosis 0.030 0.026 0002821 Positive regulation of adaptive immune response 0.020 <0.25 0002824 Positive regulation of adaptive immune response 0.020 <0.25 0006606 Protein import into nucleus 0.010 <0.25 0014013 Regulation of gliogenesis 0.034 <0.25 0030522 Intracellular receptor mediated signaling pathway 0.047 0.016 0032944 Regulation of mononuclear cell proliferation 0.023 0.022 0050670 Regulation of lymphocyte proliferation 0.023 0.022 0034097 Response to cytokine stimulus 0.044 <0.25 0035023 Regulation of rho protein signal transduction <0.25 0.01 0051149 Positive regulation of muscle cell differentiation 0.023 <0.25 0007498 Mesoderm development 0.037 0.017 0030216 Keratinocyte differentiation 0.028 0.024 0007249 I-kappab kinase/NF-kappab cascade 0.041 0.045 0008286 Insulin receptor signalling <0.25 0.018 0007422 Peripheral nervous system development 0.045 0.04 0030100 Regulation of endocytosis 0.030 0.038 0046888 Negative regulation of hormone secretion 0.010 0.01 0001837 Epithelial-mesenchymal transition 0.010 <0.25 0045807 Positive regulation of endocytosis 0.018 0.02 0032602 Chemokine production 0.010 <0.25 0030183 B cell differentiation 0.035 0.049 0051170 Nuclear import 0.010 <0.25 0033138 Positive regulation of peptidyl-serine phosphorylation 0.017 <0.25 0031667 Response to nutrient levels 0.010 <0.25 0000209 Protein polyubiquitinylation 0.010 <0.25 0007163 Establishment or maintenance of cell polarity 0.023 <0.25 0032147 Protein kinase activation <0.25 0.03 0032642 Regulation of chemokine production 0.024 <0.25 0035148 Tube formation 0.021 <0.25

0002065 Columnar/cuboidal epithelial cell differentiation 0.022 <0.25 0021915 Neural tube development 0.044 <0.25 0051650 Establishment of vesicle localization 0.048 <0.25 0002440 Production of molecular mediator of immune response 0.050 <0.25 0007015 Actin filament organization <0.25 0.041 0042733 Embryonic digit morphogenesis <0.25 0.048 0051048 Negative regulation of secretion <0.25 0.01