DOCSLIB.ORG

ADAMTS12 Depletion by Insulin in OUMS-27 Human Chondrosarcoma Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
ADAMTS12 Depletion by Insulin in OUMS-27 Human Chondrosarcoma Cells Arch Rheumatol 2015;30(2):96-103 doi: 10.5606/ArchRheumatol.2015.5249 ORIGINAL ARTICLE ADAMTS12 Depletion by Insulin in OUMS-27 Human Chondrosarcoma Cells Aynur ALTUNTAŞ,1 Sümeyya AKYOL,2 Bahattin ADAM,3 Özlem ÇAKMAK,4 Veli UĞURCU, 5 Gönül ERDEN,6 Yunus YÜKSELTEN,7 Kadir DEMİRCAN2 1Department of Chemistry, Ankara Regional Office of Council of Forensic Medicine, Ankara, Turkey 2Department of Medical Biology, Medical Faculty of Turgut Özal University, Ankara, Turkey 3Department of Medical Biochemistry, Mevlana University Medical School, Konya, Turkey; San Jose State University, San Jose, California, USA 4Department of Biology Education, Gazi University, Faculty of Education, Ankara, Turkey 5Department of Medical Biochemistry, Dumlupinar University Medical Faculty, Kutahya, Turkey 6Department of Medical Biochemistry, Hacettepe University Medical School, Ankara, Turkey 7Department of Medical Biology, Medical Faculty of Ankara University, Ankara, Turkey ABSTRACT Objectives: In this study, we aim to investigate the association between articular damage in diabetes and a disintegrin-like and metalloproteinase with thrombospondin motifs 12 (ADAMTS12) at gene expression and protein levels. Materials and methods: OUMS-27 human chondrosarcoma cells were used to investigate how ADAMTS12 levels changed in vitro condition in presence and absence of insulin. The study included three groups of cells treated with 10 μg/mL of insulin, and a control group. Cells were incubated with insulin in medium for one day, three days, and seven days. The effects of insulin on ADAMTS12 were investigated at both gene expression and protein levels. The relationships between the variables were tested by Mann-Whitney U test. Results: ADAMTS12 expression was significantly lower in the groups treated with insulin medium for one day and seven day periods (p=0.008 and p=0.008, respectively) compared to the control group. No significant difference was detected in the expression level between the groups kept in insulin medium for three days and the control group (p=0.55). In addition, protein amounts of the groups exposed to insulin medium for one, three, and seven day periods were lower. Conclusion: Insulin reduces the amount of ADAMTS12 which causes delayed recovery of cartilage tissue in the OUMS-27 cell lines utilized in our study for their chondrocytic properties. This reduction due to insulin treatment may contribute to recovery of cartilage tissue. Keywords: ADAMTS12; cartilage tissue; insulin; OUMS-27. Progressive joint destruction is an important metalloproteinase with thrombospondin motifs criterion in predicting long-term progression of (ADAMTS) play role in cartilage breakdown.4 rheumatoid arthritis and osteoarthritis. Despite ADAMTSs belong to metzincin superfamily of improved treatment and care options, prevention metalloendopeptidases, and involve more than of joint destruction may be quite difficult.1 The 19 distinct genes.5 ADAMTS gene products pathophysiology of arthritic joint destruction have protease activity. ADAMTS1, -4, -5, -8, involves proteolytic breakdown of cartilage -9 and -15 have aggrecanase activity whereas tissue. Particularly, aggrecan breakdown in other members do not.2 The cartilage tissue of extracellular matrix results in joint destruction.2,3 the patients with osteoarthritis and rheumatoid Matrix metalloproteinases and a disintegrin and arthritis include biglycan fragments obtained due Received: July 27, 2014 Accepted: August 18, 2014 Published online: October 30, 2014 Correspondence: Aynur Altuntaş, MD. Department of Chemistry, Ankara Regional Office of Council of Forensic Medicine, 06300 Ankara, Turkey. Tel: +90 312 - 340 7324 e-mail: [email protected] ©2015 Turkish League Against Rheumatism. All rights reserved. The Effect of Insulin on ADAMTS12 97 to breakdown of proteoglycans by ADAMTSs.6 On difficulties in obtaining chondrocytes. OUMS-27 the other hand, distinct ADAMTS genes play role cell line secretes cartilage-specific proteoglycans, in etiopathology of different disorders. ADAMTS and type-2 and -9 collagens.27 We used OUMS-27 genes are upregulated in some disorders while cell line in our study as well. they are downregulated in others. A disintegrin-like and metalloproteinase with thrombospondin motifs 12 has been first MATERIALS AND METHODS 7 reported by Cal et al. in 2001. ADAMTS12 OUMS-27 human chondrosarcoma cells were gene is found in skeletal muscles, cartilage, kindly provided by Dr. T. Kunisada from Okayama 7-9 tendons and fetal lung. ADAMTS12 was shown University Graduate School of Medicine and 10 to be associated with arthritis, intervertebral Dentistry, Okayama, Japan. Cells were cultured 11,12 13,14 disc degeneration, inflammation, tumor in Dulbecco’s modified Eagle’s medium containing 15-17 invasion, and metastasis. Also, high levels of 10% fetal bovine serum and penicillin/streptomycin ADAMTS12 messenger ribonucleic acid (mRNA) at 37 °C in a humidified atmosphere of 5% CO2 in were detected in osteoarthritis and rheumatoid air. The cells were subcultured at split ratios of 1:2- 18,19 arthritis. On the other hand, role of 1:4 using trypsin plus ethylenediaminetetraacetic ADAMTS12 in articular cartilage, and regulation acid every 7-10 days. Cells were used at passages and biochemistry of ADAMTS12 at gene level 7-14 for all experiments. The medium was have not been clearly demonstrated. changed every other day with either control media Insulin increases synthesis of or control media supplemented with 10 µg/mL of mucopolysaccharides in the chondrocytes whereas insulin for a total of seven days. it elevates synthesis of proteoglycans in the tumor Insulin powder was dissolved in 0.01N HCl cells obtained from the chondrosarcoma cells. In solution. The stock solution had 2 mg/mL other respects, insulin causes a positive nitrogen concentration in 0.01N HCl, and working solution balance by elevating amino acid uptake.20,21 Insulin had 10 µg/mL in medium. Three groups of cells binds to receptors of insulin-like growth factor 1 were subjected to insulin: For one day experiment, (IGF-1) at high concentrations such as 10 µg/mL, 2x105 cells; for three days experiment, 1x105 and imitates its effect in cartilage tissue.22 When cells; and for seven days experiment 5x104 cells used at dosages below 10 nmol/L, it causes an were plated in 20 mm dishes and exposed to increased matrix synthesis while preventing matrix the different regimens of insulin. Briefly, cells breakdown by inhibiting aggrecanase activity and were incubated with insulin in medium for one harmful effects of nitric oxide and interleukin-1 day, three days, and seven days. Cells were (IL-1) on cartilage tissue.23 Exact opposite events plated in five dishes for each condition. After the occur in diabetes due to insulin deficiency and experiment, cells were harvested, and total RNA hyperglycemia. Degraded structural integrity of plus protein isolations were performed. the articular cartilage and proteoglycan changes Total RNA was extracted with TRIzol in the intervertebral discs are common in diabetic (Invitrogen, Carlsbad, CA, USA, Cat#15596-018) patients. Elevated cartilage loss and delayed bone according to the manufacturer’s instructions. Two fracture healing may also occur.24-26 Despite micrograms of RNA were reverse transcribed with investigations, the degradation mechanism of the RevertAid M-MuLV Reverse Transcriptase (Thermo articular cartilage has not been clearly shown. Scientific, Waltham, MA, USA, Cat# EP0441) and In this study, we aimed to investigate the random hexamers (Thermo Scientific, Waltham, association between articular damage in diabetes MA, USA) with random primers according to and ADAMTS12 at gene expression and protein the manufacturer’s instruction (Table 1). Human levels. We investigated how ADAMTS12 levels glyceraldehyde 3-phosphate dehydrogenase changed in vitro in presence and absence of (GAPDH) was amplified as a control for the insulin. OUMS-27 cell lines that have been polymerase chain reaction (PCR). Samples lacking established from chondrosarcoma cells and express reverse transcriptase were amplified as a control chondrocytic properties are used in investigating for genomic DNA contamination. RNase-free pathophysiology of cartilage disorders due to the water (Qiagen GmbH, Germany) was used to elute 98 Arch Rheumatol Table 1. Forward and reverse primers used in the qRT-PCR analyses for ADAMTS12 and GAPDH. ADAMTS12 Forward AGTGGGCAACTGGAGTGAGT 67 bp product Reverse ACATGTGACACTGCGAATCC GAPDH Forward CCTGCACCACCAACTGCTTA 108 bp product Reverse TCTTCTGGGTGGCAGTGATG ADAMTS: A disintegrin-like and metalloproteinase with thrombospondin motifs; GAPDH: Glyceraldehyde 3-phosphate dehydrogenase. total RNA from each sample. Ultraviolet-visible 1:100 dilution. Cross-reactivity was confirmed spectrophotometry was used to quantify and before the study to agree with that described on determine the purity of each sample. Quantitative the manufacturer’s data sheet. After experiment, reverse transcriptase (qRT)-PCR was performed the cells were washed once with phosphate- on cDNA samples obtained (Qiagen Rotor-Gene buffered saline and then scraped from the plates. Q RT-PCR, Limburg, Netherlands) as described Cells were solubilized in 300 µL of CelLytic M in a previous report.2 Total RNA RT-PCR section (SigmaAldrich, St. Louis, MO, USA, Cat# C2978) uses the intercalating dye SYBR® green (Thermo with a protease inhibitor mixture. After incubation Scientific Maxima SYBR® Green/ROX qPCR in a rotator at 4 °C for 15 minutes, the samples Master
Load more

Recommended publications
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Genetic Polymorphism of Manganese Superoxide Dismutase in Behçet's Disease
    Arch Rheumatol 2016;31(1):48-54 doi: 10.5606/ArchRheumatol.2016.5645 ORIGINAL ARTICLE Genetic Polymorphism of Manganese Superoxide Dismutase in Behçet’s Disease Efkan UZ,1 H. Ramazan YILMAZ,2 Ramazan YAĞCI,3 İsmail AKYOL,4 Tuğba ERSOY, 5 Gülten SUNGUR,5 Ayşe YİĞİT,1 Sunay DUMAN,5 Ömer AKYOL6 1Department of Medical Genetics, Medical Faculty of Süleyman Demirel University, Isparta, Turkey 2Department of Medical Genetics, Medical Faculty of Mevlana University, Konya, Turkey 3Department of Ophthalmology, Medical Faculty of Pamukkale University, Denizli, Turkey 4Animal Science Genetics Unit, Kahramanmaraş Sütçü İmam University Faculty of Agriculture, Kahramanmaraş, Turkey 5Department of Ophthalmology, Ankara Training and Research Hospital, Ankara, Turkey 6Department of Medical Biochemistry, Medical Faculty of Hacettepe University, Ankara, Turkey ABSTRACT Objectives: This study aims to investigate the genetic association between single nucleotide mutation in mitochondrial manganese superoxide dismutase and a Behçet’s disease (BD) population by using molecular techniques. Patients and methods: Ninety-three BD patients (45 males, 48 females; mean age 33.15±8.99 years; range 17 to 65 years) and 125 controls (58 males, 67 females; mean age 28.33±7.31 years; range 18 to 62 years) were genotyped by polymerase chain reaction-restriction fragment length polymorphism method. The genotypic distributions in BD patients and controls were consistent with the Hardy-Weinberg equilibrium. Results: Significant differences were observed between BD patients and controls in terms of genotypic distribution. Frequencies of alanine (Ala)/Ala, Ala/valine (Val), and Val/Val were 14.0% (n=13), 45.2% (n=42), and 40.9% (n=38) in BD patients and 21.6% (n=27), 53.6% (n=67), and 24.8% (n=31) in controls, respectively (p=0.033).
    [Show full text]
  • Gene Symbol Category ACAN ECM ADAM10 ECM Remodeling-Related ADAM11 ECM Remodeling-Related ADAM12 ECM Remodeling-Related ADAM15 E
    Supplementary Material (ESI) for Integrative Biology This journal is (c) The Royal Society of Chemistry 2010 Gene symbol Category ACAN ECM ADAM10 ECM remodeling-related ADAM11 ECM remodeling-related ADAM12 ECM remodeling-related ADAM15 ECM remodeling-related ADAM17 ECM remodeling-related ADAM18 ECM remodeling-related ADAM19 ECM remodeling-related ADAM2 ECM remodeling-related ADAM20 ECM remodeling-related ADAM21 ECM remodeling-related ADAM22 ECM remodeling-related ADAM23 ECM remodeling-related ADAM28 ECM remodeling-related ADAM29 ECM remodeling-related ADAM3 ECM remodeling-related ADAM30 ECM remodeling-related ADAM5 ECM remodeling-related ADAM7 ECM remodeling-related ADAM8 ECM remodeling-related ADAM9 ECM remodeling-related ADAMTS1 ECM remodeling-related ADAMTS10 ECM remodeling-related ADAMTS12 ECM remodeling-related ADAMTS13 ECM remodeling-related ADAMTS14 ECM remodeling-related ADAMTS15 ECM remodeling-related ADAMTS16 ECM remodeling-related ADAMTS17 ECM remodeling-related ADAMTS18 ECM remodeling-related ADAMTS19 ECM remodeling-related ADAMTS2 ECM remodeling-related ADAMTS20 ECM remodeling-related ADAMTS3 ECM remodeling-related ADAMTS4 ECM remodeling-related ADAMTS5 ECM remodeling-related ADAMTS6 ECM remodeling-related ADAMTS7 ECM remodeling-related ADAMTS8 ECM remodeling-related ADAMTS9 ECM remodeling-related ADAMTSL1 ECM remodeling-related ADAMTSL2 ECM remodeling-related ADAMTSL3 ECM remodeling-related ADAMTSL4 ECM remodeling-related ADAMTSL5 ECM remodeling-related AGRIN ECM ALCAM Cell-cell adhesion ANGPT1 Soluble factors and receptors
    [Show full text]
  • An Analysis of the Effects of Communication Skills Training Provided to the Mothers of Six-Year-Old Children on the Social Skills of Children
    US-China Education Review, ISSN 1548-6613 March 2011, Vol. 8, No. 3, 384-392 An Analysis of the Effects of Communication Skills Training Provided to the Mothers of Six-Year-Old Children on the Social Skills of Children Filiz Erbay Emel Arslan, Aysel Çağdaş Mevlana University, Konya, Turkey Selcuk University, Konya, Turkey This study aims to analyze the effects of communication skills training program provided to the mothers on the social skills of their children. The study uses pre- and post- tests control group design. Experiment and control groups consisted of a total of 30 six-year-old children who were enrolled in nursery school. Experiment group consisted of 15 children; control group consisted of 15 children. The mothers of the children in experiment group were provided communication skills training for 13 weeks. SSES (social skills evaluation scale) was administered to the children before and after the training. The results of pre- and post- tests were compared and the effects of mothers’ training program on the social skills of the children were investigated. Keywords: social skill, communication skill, children, pre-school, mother Introduction As a social being, humans need to live in interaction with other humans. The greatest need of the individuals as social beings is to be accepted by the social environment. Social development period, which is termed as social interaction period, has a vital role in adaptation of humans to their environment. This period begins from childhood and if it starts and continues successfully, it helps people to pursue healthy and harmonious relationships. Social skills are one of those skills which help adaptation to many social conditions (Özabacı, 2004; Steedly, Schwartz, Levin, & Stephen, 2008).
    [Show full text]
  • Ultra-Processed Food Targets Bone Quality Via Endochondral Ossification
    Bone Research www.nature.com/boneres ARTICLE OPEN Ultra-processed food targets bone quality via endochondral ossification Janna Zaretsky1, Shelley Griess-Fishheimer1, Adi Carmi1, Tamara Travinsky Shmul1, Lior Ofer2, Tali Sinai1, Svetlana Penn1, Ron Shahar2 and Efrat Monsonego-Ornan 1 Ultra-processed foods have known negative implications for health; however, their effect on skeletal development has never been explored. Here, we show that young rats fed ultra-processed food rich in fat and sugar suffer from growth retardation due to lesions in their tibial growth plates. The bone mineral density decreases significantly, and the structural parameters of the bone deteriorate, presenting a sieve-like appearance in the cortices and poor trabecular parameters in long bones and vertebrae. This results in inferior mechanical performance of the entire bone with a high fracture risk. RNA sequence analysis of the growth plates demonstrated an imbalance in extracellular matrix formation and degradation and impairment of proliferation, differentiation and mineralization processes. Our findings highlight, for the first time, the severe impact of consuming ultra-processed foods on the growing skeleton. This pathology extends far beyond that explained by the known metabolic effects, highlighting bone as a new target for studies of modern diets. Bone Research (2021) ;9:14 https://doi.org/10.1038/s41413-020-00127-9 1234567890();,: INTRODUCTION penetration of blood vessels and bone tissue formation by The vertebrate skeleton has evolved as a dynamic system that osteoblasts.1,2,4,6 The EO process is tightly orchestrated by various serves numerous functions, such as protecting internal organs, signaling molecules and transcription factors, including transform- creating attachment sites for muscles to produce locomotion, ing growth factor β/bone morphogenetic protein (BMP), fibroblast providing a reservoir for minerals, and serving as a hematopoietic growth factor (FGF), Wnt, hedgehog, and the transcription factor niche.
    [Show full text]
  • Full PF for Volume 1, Issue 1
    Participatory Educational Research (PER) ISSN: 2148-6123 Volume 1, Issure 1 June 2014 Participatory Educational Research (PER) EDITOR IN CHIEF Assoc. Prof. Dr. Özgen KORKMAZ (Mevlana University, Turkey) EDITORS Prof. Dr. Norma NEL (University of South Africa, South Africa) ASSISTANT EDITORS Prof. Dr. Norma ROMM (University of South Africa, South Africa) EDITORIAL BOARD Prof. Dr. Ahmet MAHİROĞLU (Gazi University, Turkey) Prof. Dr. Fok PING-KWAN (The Chinese University of Hong Kong, Honkong) Dr. Gary (LINPU Wang) (Zhejiang International Studies University, China) Prof. Dr. Hafize KESER (Ankara University, Turkey) Prof. Dr. Hannu SAVOLAINEN (University of Jyväskylä, Finland) sildik Prof. Dr. Helen R. ABADIANO (Central Connecticut State University, USA) Prof. Dr. Jeffrey L. DEREVENSKY (McGill University, Canada) Prof. Dr. Jeonghee NAM (Pusan National University, Kore) Prof. Dr. LDM LEBELOANE (University of South Africa, South Africa) Prof. Dr. Mary C. HERRING (University of Northern Iowa, USA) Prof. Dr. Mitchell BECK (Central Connecticut State University, USA) Prof. Dr. Petra ENGELBRECHT (Canterbury Christ Church University, UK). Prof. Dr. Raymond LEBLANC (University of Ottawa, Canada) Prof. Dr. Steve SHARRA (Michigan State University, USA) Prof. Dr. Uğur DEMİRAY (Anadolu University, Turkey) Assoc. Prof. Dr. Chi-Jen HUANG (National Chiayi University, Taiwan) Assoc. Prof. Dr. Ertuğrul USTA (Mevlana University, Turkey) Assoc. Prof. Dr. Hsueh-hua CHUANG (National Sun Yat-sen University, Tayvan) Assoc. Prof. Dr. İsmail ŞAHİN (Necmettin Erbakan University, Turkey) Assoc. Prof. Dr. Janet MCINTYRE(Flinders University Adelaide Area, Australia) Assoc. Prof. Dr. José GIJON PUERTA (Universidad de Granada, Spain) Assoc. Prof. Dr. Oktay AKBAŞ (Kırıkkale University, Turkey) Assoc. Prof. Dr. Sofia D. Anastasiadou (University of West Macedonia, Greece) Assoc.
    [Show full text]
  • Turkey Territory Update February 2017 1 © 2017 ACCUCOMS International BV
    Turkey Territory Update February 2017 1 © 2017 ACCUCOMS International BV Turkey Territory Update February 2017 ACCUCOMS Team Eyad Mohammad - Commercial Manager, MENA & Turkey With a Bachelor’s degree in Engineering from University of Jordan, and a CMA certificate, Eyad has over 15 years of sales, marketing and management experience in publishing, logistics and telecommunications. Having lived and worked in several countries of the MENA region, Eyad has deep understanding to diversified cultures and business environments of the region. He speaks Arabic, English and French and he is located in Amman, Jordan. Contact Eyad via [email protected] Baris Oguz Yilmaz - Regional Manager, Turkey Holds a degree in Nuclear Engineering from Hacettepe University. Baris is Turkish, and his undergraduate education provided him with excellent use of English. His skills in social communication and interaction, made him a new member of our team in March 2013. Baris is located at ACCUCOMS’ Ankara office in Turkey. Contact Baris via [email protected] Pinar Teke - Regional Manager, Turkey Has a bachelor’s degree in Information Management from Hacettepe University and Public Relations from Anadolu University. Pinar has more than five years of experience within the Turkish library market. She is now responsible for growing our publisher sales in Turkey. She is Turkish and speaks English fluently. Pinar is located in Istanbul, Turkey. Contact Pinar via [email protected] Turkey Territory Update February 2017 2 © 2017 ACCUCOMS International BV ACCUCOMS represents in Turkey: Recent Events On July 15th 2016, a coup d'état was attempted against state institutions and President Recep Erdoğan. The coup failed, but the aftermath of the coup attempt and current engagement in military operations in Syria made Turkish economy face geopolitical headwinds and unsettled political conditions.
    [Show full text]
  • Bilateral Trade: Between India and Turkey
    Research Article Journal of Business and Trade (JOINBAT) 1(1), 53-60, 2020 Recieved: 28-Nov-2020 Accepted: 11-Dec-2020 Bilateral Trade: Between India and Turkey Rashmi GUJRATI1 , Hayri UYGUN2 1 Tecnia Institute of Advanced Studies, India 2 Recep Tayyip Erdoğan University, Turkey ABSTRACT Bilateral trade between Turkey and India in import Turkey was the 44th largest worldwide cause and India was 47th major basis from Turkey. And in export Turkey was 16th largest and India was 9th largest global sources of export destination. In 2014 the amount US$6.9 billion India exported to Turkey, and Turkey globally importers 2.8%. In 2014 India exported mineral fuels and goods dominate to Turkey. India was 7th main provider of petroleum lubricant crystal to Turkey. For Turkey India is a major world-wide basis of import. India imports from turkey, Organic chemicals are in the 8th major universal basis, manmade staple fibres in the 3rd major world- wide source; and an automobile is in 11th major basis. From 2005 to 2014 India's imports has risen from US$219.9 million. In 2019 at the G-20 summit, India representative Sanjay Bhattacharyya said in Ankara that recently Turkey and India trade and two-way investment were in much higher potential. He spoke on the title of invest in India that with the commitment of India economic Turkey growth has been increased and it has been reached from 22% to $8.6 billion in 2018. By 2020 the goal was to reached $ 10 billion trade and till 2025 to be more resolute aim.
    [Show full text]
  • The Transformation of Higher Education in Turkey Between 2002-2018: an Analysis of Politics and Policies of Higher Education
    THE TRANSFORMATION OF HIGHER EDUCATION IN TURKEY BETWEEN 2002-2018: AN ANALYSIS OF POLITICS AND POLICIES OF HIGHER EDUCATION A THESIS SUBMITTED TO THE GRADUATE SCHOOL OF SOCIAL SCIENCES OF MIDDLE EAST TECHNICAL UNIVERSITY BY ONUR KALKAN IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE IN THE DEPARTMENT OF SOCIOLOGY SEPTEMBER 2019 Approval of the Graduate School of Social Sciences Prof. Dr. Yaşar Kondakçı Director I certify that this thesis satisfies all the requirements as a thesis for the degree of Master of Science. Prof. Dr. Ayşe Saktanber Head of Department This is to certify that we have read this thesis and that in our opinion it is fully adequate, in scope and quality, as a thesis for the degree of Master of Science. Assoc. Prof. Dr. Erdoğan Yıldırım Supervisor Examining Committee Members Assist. Prof. Dr. Barış Mücen (METU, SOC) Assoc. Prof. Dr. Erdoğan Yıldırım (METU, SOC) Assoc. Prof. Dr. İlker Aytürk (Bilkent Üni., ADM) I hereby declare that all information in this document has been obtained and presented in accordance with academic rules and ethical conduct. I also declare that, as required by these rules and conduct, I have fully cited and referenced all material and results that are not original to this work. Name, Last name : ONUR KALKAN Signature : iii ABSTRACT THE TRANSFORMATION OF HIGHER EDUCATION IN TURKEY BETWEEN 2002-2018: AN ANALYSIS OF POLICIES AND POLITICS OF HIGHER EDUCATION KALKAN, Onur M.S., Department of Sociology Supervisor : Assoc. Prof. Dr. Erdoğan Yıldırım September 2019, 191 pages This thesis studies the concept of “transformation of higher education” and tries to assess the changes taking place in Turkey’s higher education in the period of 2002-2018 with respect to politics and policies using such concept.
    [Show full text]
  • Fibroblasts from the Human Skin Dermo-Hypodermal Junction Are
    cells Article Fibroblasts from the Human Skin Dermo-Hypodermal Junction are Distinct from Dermal Papillary and Reticular Fibroblasts and from Mesenchymal Stem Cells and Exhibit a Specific Molecular Profile Related to Extracellular Matrix Organization and Modeling Valérie Haydont 1,*, Véronique Neiveyans 1, Philippe Perez 1, Élodie Busson 2, 2 1, 3,4,5,6, , Jean-Jacques Lataillade , Daniel Asselineau y and Nicolas O. Fortunel y * 1 Advanced Research, L’Oréal Research and Innovation, 93600 Aulnay-sous-Bois, France; [email protected] (V.N.); [email protected] (P.P.); [email protected] (D.A.) 2 Department of Medical and Surgical Assistance to the Armed Forces, French Forces Biomedical Research Institute (IRBA), 91223 CEDEX Brétigny sur Orge, France; [email protected] (É.B.); [email protected] (J.-J.L.) 3 Laboratoire de Génomique et Radiobiologie de la Kératinopoïèse, Institut de Biologie François Jacob, CEA/DRF/IRCM, 91000 Evry, France 4 INSERM U967, 92260 Fontenay-aux-Roses, France 5 Université Paris-Diderot, 75013 Paris 7, France 6 Université Paris-Saclay, 78140 Paris 11, France * Correspondence: [email protected] (V.H.); [email protected] (N.O.F.); Tel.: +33-1-48-68-96-00 (V.H.); +33-1-60-87-34-92 or +33-1-60-87-34-98 (N.O.F.) These authors contributed equally to the work. y Received: 15 December 2019; Accepted: 24 January 2020; Published: 5 February 2020 Abstract: Human skin dermis contains fibroblast subpopulations in which characterization is crucial due to their roles in extracellular matrix (ECM) biology.
    [Show full text]
  • Cypriot Journal of Educational Sciences
    Cypriot Journal of Educational Sciences Volume 7, Issue 3 (2012) 220-228 http://www.awer-center.org/cjes/ Computer, electrical and electronic engineering students' attitude towards cooperative learning Halis Altun a *, Ozgen Korkmaz a a Engineering Faculty Department of Computer Engineering, Mevlana University, Turkey Abstract The aim of this study is to adapt the Cooperative Learning Attitude Scale into Turkish and determine engineering students’ attitudes towards the cooperative learning. The study is based on the descriptive scanning model. The study group consists of 466 engineering students. The validity of the scale is confirmed through exploration factor analysis and item discriminative power methods. On these data descriptive statistics and t, Anova and Scheffe tests have been employed (p<0, 05). The findings show that the adapted scale is valid and reliable in determining the level of cooperative learning attitudes of the engineering students in Turkish cultural environment. Moreover, the level of the attitude towards the cooperative learning for engineering students is found to be high and does not show any meaningful difference across the gender and engineering disciplines. On the other hand, the level of the attitudes shows a meaningful difference across the grade levels in engineering education. Keywords: Cooperative learning, attitude, engineering education, reliability, validity; Selection and/or peer review under responsibility of Assoc. Prof. Dr. Zehra Ozcinar, Assist. Prof. Dr. Çiğdem Hürsen ©2012 Academic World Education & Research Center. All rights reserved. 1. Introduction As in almost all societal spheres, the teaching methods are also exposed to dramatic changes due to the technological developments imposed in the recent decades. The conventional teaching methods are recently witnessed to experience a great change and as a consequence, new paradigms in teaching methods are aroused.
    [Show full text]
  • Identification, by Systematic RNA Sequencing, of Novel Candidate
    Laboratory Investigation (2015) 95, 1077–1088 © 2015 USCAP, Inc All rights reserved 0023-6837/15 Identification, by systematic RNA sequencing, of novel candidate biomarkers and therapeutic targets in human soft tissue tumors Anne E Sarver1, Aaron L Sarver2, Venugopal Thayanithy1 and Subbaya Subramanian1 Human sarcomas comprise a heterogeneous group of more than 50 subtypes broadly classified into two groups: bone and soft tissue sarcomas. Such heterogeneity and their relative rarity have made them challenging targets for classification, biomarker identification, and development of improved treatment strategies. In this study, we used RNA sequencing to analyze 35 primary human tissue samples representing 13 different sarcoma subtypes, along with benign schwannoma, and normal bone and muscle tissues. For each sarcoma subtype, we detected unique messenger RNA (mRNA) expression signatures, which we further subjected to bioinformatic functional analysis, upstream regulatory analysis, and microRNA (miRNA) targeting analysis. We found that, for each sarcoma subtype, significantly upregulated genes and their deduced upstream regulators included not only previously implicated known players but also novel candidates not previously reported to be associated with sarcoma. For example, the schwannoma samples were characterized by high expression of not only the known associated proteins GFAP and GAP43 but also the novel player GJB6. Further, when we integrated our expression profiles with miRNA expression data from each sarcoma subtype, we were able to deduce potential key miRNA–gene regulator relationships for each. In the Ewing’s sarcoma and fibromatosis samples, two sarcomas where miR-182-5p is significantly downregulated, multiple predicted targets were significantly upregulated, including HMCN1, NKX2-2, SCNN1G, and SOX2.
    [Show full text]