ADAMTS12 Depletion by Insulin in OUMS-27 Human Chondrosarcoma Cells

ADAMTS12 Depletion by Insulin in OUMS-27 Human Chondrosarcoma Cells

Arch Rheumatol 2015;30(2):96-103 doi: 10.5606/ArchRheumatol.2015.5249 ORIGINAL ARTICLE ADAMTS12 Depletion by Insulin in OUMS-27 Human Chondrosarcoma Cells Aynur ALTUNTAŞ,1 Sümeyya AKYOL,2 Bahattin ADAM,3 Özlem ÇAKMAK,4 Veli UĞURCU, 5 Gönül ERDEN,6 Yunus YÜKSELTEN,7 Kadir DEMİRCAN2 1Department of Chemistry, Ankara Regional Office of Council of Forensic Medicine, Ankara, Turkey 2Department of Medical Biology, Medical Faculty of Turgut Özal University, Ankara, Turkey 3Department of Medical Biochemistry, Mevlana University Medical School, Konya, Turkey; San Jose State University, San Jose, California, USA 4Department of Biology Education, Gazi University, Faculty of Education, Ankara, Turkey 5Department of Medical Biochemistry, Dumlupinar University Medical Faculty, Kutahya, Turkey 6Department of Medical Biochemistry, Hacettepe University Medical School, Ankara, Turkey 7Department of Medical Biology, Medical Faculty of Ankara University, Ankara, Turkey ABSTRACT Objectives: In this study, we aim to investigate the association between articular damage in diabetes and a disintegrin-like and metalloproteinase with thrombospondin motifs 12 (ADAMTS12) at gene expression and protein levels. Materials and methods: OUMS-27 human chondrosarcoma cells were used to investigate how ADAMTS12 levels changed in vitro condition in presence and absence of insulin. The study included three groups of cells treated with 10 μg/mL of insulin, and a control group. Cells were incubated with insulin in medium for one day, three days, and seven days. The effects of insulin on ADAMTS12 were investigated at both gene expression and protein levels. The relationships between the variables were tested by Mann-Whitney U test. Results: ADAMTS12 expression was significantly lower in the groups treated with insulin medium for one day and seven day periods (p=0.008 and p=0.008, respectively) compared to the control group. No significant difference was detected in the expression level between the groups kept in insulin medium for three days and the control group (p=0.55). In addition, protein amounts of the groups exposed to insulin medium for one, three, and seven day periods were lower. Conclusion: Insulin reduces the amount of ADAMTS12 which causes delayed recovery of cartilage tissue in the OUMS-27 cell lines utilized in our study for their chondrocytic properties. This reduction due to insulin treatment may contribute to recovery of cartilage tissue. Keywords: ADAMTS12; cartilage tissue; insulin; OUMS-27. Progressive joint destruction is an important metalloproteinase with thrombospondin motifs criterion in predicting long-term progression of (ADAMTS) play role in cartilage breakdown.4 rheumatoid arthritis and osteoarthritis. Despite ADAMTSs belong to metzincin superfamily of improved treatment and care options, prevention metalloendopeptidases, and involve more than of joint destruction may be quite difficult.1 The 19 distinct genes.5 ADAMTS gene products pathophysiology of arthritic joint destruction have protease activity. ADAMTS1, -4, -5, -8, involves proteolytic breakdown of cartilage -9 and -15 have aggrecanase activity whereas tissue. Particularly, aggrecan breakdown in other members do not.2 The cartilage tissue of extracellular matrix results in joint destruction.2,3 the patients with osteoarthritis and rheumatoid Matrix metalloproteinases and a disintegrin and arthritis include biglycan fragments obtained due Received: July 27, 2014 Accepted: August 18, 2014 Published online: October 30, 2014 Correspondence: Aynur Altuntaş, MD. Department of Chemistry, Ankara Regional Office of Council of Forensic Medicine, 06300 Ankara, Turkey. Tel: +90 312 - 340 7324 e-mail: [email protected] ©2015 Turkish League Against Rheumatism. All rights reserved. The Effect of Insulin on ADAMTS12 97 to breakdown of proteoglycans by ADAMTSs.6 On difficulties in obtaining chondrocytes. OUMS-27 the other hand, distinct ADAMTS genes play role cell line secretes cartilage-specific proteoglycans, in etiopathology of different disorders. ADAMTS and type-2 and -9 collagens.27 We used OUMS-27 genes are upregulated in some disorders while cell line in our study as well. they are downregulated in others. A disintegrin-like and metalloproteinase with thrombospondin motifs 12 has been first MATERIALS AND METHODS 7 reported by Cal et al. in 2001. ADAMTS12 OUMS-27 human chondrosarcoma cells were gene is found in skeletal muscles, cartilage, kindly provided by Dr. T. Kunisada from Okayama 7-9 tendons and fetal lung. ADAMTS12 was shown University Graduate School of Medicine and 10 to be associated with arthritis, intervertebral Dentistry, Okayama, Japan. Cells were cultured 11,12 13,14 disc degeneration, inflammation, tumor in Dulbecco’s modified Eagle’s medium containing 15-17 invasion, and metastasis. Also, high levels of 10% fetal bovine serum and penicillin/streptomycin ADAMTS12 messenger ribonucleic acid (mRNA) at 37 °C in a humidified atmosphere of 5% CO2 in were detected in osteoarthritis and rheumatoid air. The cells were subcultured at split ratios of 1:2- 18,19 arthritis. On the other hand, role of 1:4 using trypsin plus ethylenediaminetetraacetic ADAMTS12 in articular cartilage, and regulation acid every 7-10 days. Cells were used at passages and biochemistry of ADAMTS12 at gene level 7-14 for all experiments. The medium was have not been clearly demonstrated. changed every other day with either control media Insulin increases synthesis of or control media supplemented with 10 µg/mL of mucopolysaccharides in the chondrocytes whereas insulin for a total of seven days. it elevates synthesis of proteoglycans in the tumor Insulin powder was dissolved in 0.01N HCl cells obtained from the chondrosarcoma cells. In solution. The stock solution had 2 mg/mL other respects, insulin causes a positive nitrogen concentration in 0.01N HCl, and working solution balance by elevating amino acid uptake.20,21 Insulin had 10 µg/mL in medium. Three groups of cells binds to receptors of insulin-like growth factor 1 were subjected to insulin: For one day experiment, (IGF-1) at high concentrations such as 10 µg/mL, 2x105 cells; for three days experiment, 1x105 and imitates its effect in cartilage tissue.22 When cells; and for seven days experiment 5x104 cells used at dosages below 10 nmol/L, it causes an were plated in 20 mm dishes and exposed to increased matrix synthesis while preventing matrix the different regimens of insulin. Briefly, cells breakdown by inhibiting aggrecanase activity and were incubated with insulin in medium for one harmful effects of nitric oxide and interleukin-1 day, three days, and seven days. Cells were (IL-1) on cartilage tissue.23 Exact opposite events plated in five dishes for each condition. After the occur in diabetes due to insulin deficiency and experiment, cells were harvested, and total RNA hyperglycemia. Degraded structural integrity of plus protein isolations were performed. the articular cartilage and proteoglycan changes Total RNA was extracted with TRIzol in the intervertebral discs are common in diabetic (Invitrogen, Carlsbad, CA, USA, Cat#15596-018) patients. Elevated cartilage loss and delayed bone according to the manufacturer’s instructions. Two fracture healing may also occur.24-26 Despite micrograms of RNA were reverse transcribed with investigations, the degradation mechanism of the RevertAid M-MuLV Reverse Transcriptase (Thermo articular cartilage has not been clearly shown. Scientific, Waltham, MA, USA, Cat# EP0441) and In this study, we aimed to investigate the random hexamers (Thermo Scientific, Waltham, association between articular damage in diabetes MA, USA) with random primers according to and ADAMTS12 at gene expression and protein the manufacturer’s instruction (Table 1). Human levels. We investigated how ADAMTS12 levels glyceraldehyde 3-phosphate dehydrogenase changed in vitro in presence and absence of (GAPDH) was amplified as a control for the insulin. OUMS-27 cell lines that have been polymerase chain reaction (PCR). Samples lacking established from chondrosarcoma cells and express reverse transcriptase were amplified as a control chondrocytic properties are used in investigating for genomic DNA contamination. RNase-free pathophysiology of cartilage disorders due to the water (Qiagen GmbH, Germany) was used to elute 98 Arch Rheumatol Table 1. Forward and reverse primers used in the qRT-PCR analyses for ADAMTS12 and GAPDH. ADAMTS12 Forward AGTGGGCAACTGGAGTGAGT 67 bp product Reverse ACATGTGACACTGCGAATCC GAPDH Forward CCTGCACCACCAACTGCTTA 108 bp product Reverse TCTTCTGGGTGGCAGTGATG ADAMTS: A disintegrin-like and metalloproteinase with thrombospondin motifs; GAPDH: Glyceraldehyde 3-phosphate dehydrogenase. total RNA from each sample. Ultraviolet-visible 1:100 dilution. Cross-reactivity was confirmed spectrophotometry was used to quantify and before the study to agree with that described on determine the purity of each sample. Quantitative the manufacturer’s data sheet. After experiment, reverse transcriptase (qRT)-PCR was performed the cells were washed once with phosphate- on cDNA samples obtained (Qiagen Rotor-Gene buffered saline and then scraped from the plates. Q RT-PCR, Limburg, Netherlands) as described Cells were solubilized in 300 µL of CelLytic M in a previous report.2 Total RNA RT-PCR section (SigmaAldrich, St. Louis, MO, USA, Cat# C2978) uses the intercalating dye SYBR® green (Thermo with a protease inhibitor mixture. After incubation Scientific Maxima SYBR® Green/ROX qPCR in a rotator at 4 °C for 15 minutes, the samples Master

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    8 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us