Thesis, University of Amsterdam, the Netherlands

UvA-DARE (Digital Academic Repository)

Bio-systematics of predatory mites used for control of the coconut mite

Famah Sourassou, N.

Publication date 2012 Document Version Final published version

Link to publication

Citation for published version (APA): Famah Sourassou, N. (2012). Bio-systematics of predatory mites used for control of the coconut mite.

General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).

Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible.

UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl)

Download date:30 Sep 2021 Bio-systematics of predatory mites used for control of the coconut mite

Bio-systematics of predatory mites used for control of the coconut mite Nazer Famah Sourassou Nazer

Nazer Famah Sourassou Nazer-voorwerk.qxd 14-9-2012 10:34 Page 1

Bio-systematics of predatory mites used for control of the coconut mite Nazer-voorwerk.qxd 14-9-2012 10:34 Page 2

Famah Sourassou, N 2012. Bio-systematics of predatory mites used for control of the coconut mite

PhD thesis, University of Amsterdam, The Netherlands

The work presented in this thesis was funded by a grant from the Netherlands Organ- isation for Scientific Research (NWO; WOTRO project ‘Molecular and morphometric characterization of geographic populations of two species of predatory mites associated with the coconut mite in Brazil, Benin and Sri Lanka’). Research was conducted partly at the Institute for Biodiversity and Ecosystem Dynamics (IBED), University of Amsterdam.

Publication of this thesis was financially supported by Koppert Biological Systems (www.koppert.nl)

ISBN: 978 94 91407 07 9

Cover design: Jan van Arkel (IBED) Lay-out: Jan Bruin (www.bred.nl) Nazer-voorwerk.qxd 14-9-2012 10:34 Page 3

Bio-systematics of predatory mites used for control of the coconut mite

ACADEMISCH PROEFSCHRIFT

ter verkrijging van de graad van doctor aan de Universiteit van Amsterdam op gezag van de Rector Magnificus prof. dr. D.C. van den Boom ten overstaan van een door het college voor promoties ingestelde commissie, in het openbaar te verdedigen in de Agnietenkapel

op vrijdag 26 oktober 2012, te 10:00 uur

door

Nazer Famah Sourassou

geboren te Paratao, Togo Nazer-voorwerk.qxd 14-9-2012 10:34 Page 4

Promotiecommissie

Promotor: Prof. dr. M.W. Sabelis

Co-promotor: Dr. J.A.J. Breeuwer

Overige leden: Prof. dr. J.J.M. van Alphen Dr. R. Hanna Dr. A.RM. Janssen Prof. dr. S.B.J. Menken Dr. M. Navajas Prof. dr. M.E. Schranz Prof. dr. P.H. van Tienderen

Faculteit der Natuurwetenschappen, Wiskunde en Informatica Nazer-voorwerk.qxd 14-9-2012 10:34 Page 5

Contents

6 Author addresses

7 1 – General introduction

15 2 – Morphological variation and reproductive incompatibility of three coconut- mite-associated populations of predatory mites identified as Neoseiulus paspalivorus (Acari: Phytoseiidae) N. Famah Sourassou, R. Hanna, I. Zannou, G.J. de Moraes, K. Negloh & M.W. Sabelis 31 3 – Endosymbiont Wolbachia and Cardinium bacteria in the predatory mite Neoseiulus paspalivorus N. Famah Sourassou, R. Hanna, J.A.J. Breeuwer, K. Negloh, G.J. de Moreas & M.W. Sabelis 47 4 – Morphological, molecular and cross-breeding analysis of geographic populations of coconut-mite associated predatory mites identified as Neoseiulus baraki: evidence for cryptic species? N. Famah Sourassou, R. Hanna, I. Zannou, J.A.J. Breeuwer, G.J. de Moraes & M.W. Sabelis 67 5 – Females as intraguild predators of males in cross-pairing experiments with phytoseiid mites N. Famah Sourassou, K. Negloh, R. Hanna, J.A.J. Breeuwer & M.W. Sabelis 77 6 – Predatory mites found under the bracts of coconuts and their potential for controlling Aceria guerreronis: review and hypotheses N. Famah Sourassou, R. Hanna, I. Zannou, G.J. de Moraes, F.R. da Silva, K. Negloh, J.A.J. Breeuwer & M.W. Sabelis 93 7 – General discussion 97 Summary 101 Samenvatting 105 Curriculum vitae 106 Acknowledgements Nazer-voorwerk.qxd 14-9-2012 10:34 Page 6

Author addresses

Institute for Biodiversity and Ecosystem Dynamics, University of Amsterdam, Science Park 904, 1098 XH Amsterdam, The Netherlands Johannes A.J. Breeuwer Nazer Famah Sourassou Koffi Negloh Maurice W. Sabelis Fernando R. da Silva Ignace Zannou

International Institute of Tropical Agriculture (IITA), 08 BP 0932 Cotonou, Benin, West Africa Nazer Famah Sourassou Rachid Hanna Koffi Negloh Ignace Zannou

Depto Entomologia e Acarologia, Escola Superior de Agricultura. 'Luiz de Queiroz', Universidade de Sao Paulo, Piracicaba-SP, 13418-900, Brazil Gilberto J. de Moraes Fernando R. da Silva

International Institute of Tropical Agriculture (IITA), BP 2008 (Messa), Yaoundé, Cameroon Rachid Hanna

6 Nazer-chap1.qxd 14-9-2012 10:35 Page 7 1 General introduction

ver the past 50 years there has been considerable progress in the use of phytosei- Oid predators for control of mite pests in agricultural crops (Helle and Sabelis 1985; Lindquist et al. 1996; Gerson et al. 2003). Essential to the development of these biocontrol methods is to provide a reliable description of the control agent (Moraes 1987; McMurtry 2010). A description can be obtained from taxonomic studies that are based on morphological criteria for species identification. However, taxonomic identification of species alone does not always suffice because populations of the same predator species may largely differ in their capacity to control the pest. A recent example is the finding that the predatory mite Phytoseiulus longipes from Brazil and Argentina can control Tetranychus evansi on tomato, but P. longipes from Chili and South-Africa cannot (Tixier et al. 2010). These between-population differences in control capacity appear to have a genetic basis. Another example, is the presence of five cryptic species from different hosts and geographic localities (Euseius tularensis from citrus, E. hibisci from avocado, E. quetzali from deciduous fruits and nuts, E. obispensis from avocado in San Luis Obispo county, E. stipulatus introduced from the Mediterranean region) in what was once assumed to be a single species (E. stipulatus) (McMurtry and Badii 1985; McMurtry 2010). However, there may also be within-population genetic variation with respect to genetic traits relevant to biological control. For example, it is shown that at a scale of 0.25 m2 soil a population sample of the predatory mite Hypoaspis aculeifer exhibits a genetic polymorphism in preference for two species of astigmatic mites, Tyrophagus putrescentiae and Rhizoglyphus robini, that are pests in crops of lily bulbs (Lesna and Sabelis 1999, 2002). Thus, there is a need to identify and characterize the genetic entities (strain, population, biotype, ecotype, host race, geographic race, subspecies, cryptic species, species) that are relevant for assessing traits relevant to biological control (McMurtry 2010). Before deciding on relevant genetic entities it is useful to briefly introduce and define some terms because there is still room for confusion in the general literature. First and foremost, is the biological species concept (Mayer 1940; Mallet 1995), which defines a species as a group of organisms capable of interbreeding and producing fertile offspring of both sexes and separated from other such groups with which interbreeding does not normally happen. With respect to the Phytoseiidae most species have been described solely based on morphological criteria (Chant and McMurtry 2007) and only some species have been studied for their reproductive isolation. However, not all isolating mechanisms are immediately apparent. For example, the presence of endosymbionts and their role in incompatibility between populations has long gone unnoticed, but now we know that this mechanism can isolate populations even when geographical-

7 Nazer-chap1.qxd 14-9-2012 10:35 Page 8

CHAPTER 1

ly very close to each other (see Hoy and Cave 1988 for an example in phytoseiid mites). Such isolating mechanisms cause reduced gene flow between populations and may give rise to genetic differences and incipient speciation (Telschow et al. 2005). This has led to the notion of cryptic species (complex of species), which are defined by Stebbins (1950) as ‘population systems which were believed to belong to the same species until genetic evidence showed the existence of isolating mechanisms separating them’. Grant (1981) defined cryptic species as ‘good biological species that are virtually indistinguish- able morphologically. Cryptic species have been found in the Phytoseiidae based on morphological studies combined with crossbreeding studies (Muma and Denmark 1976; Mahr and McMurtry 1979; McMurtry et al. 1985; Congdon and McMurtry 1985), with behavioural studies (Beard 1999) and with molecular-genetic studies (Tixier et al. 2003, 2004, 2006, 2008). Whether these cryptic species are also sibling species, requires in depth phylogenetic analysis using a variety of morphological, behavioural and genetic traits. Such an analysis is still lacking with respect to the Phytoseiidae. Instead, classifi- cations in the Phytoseiidae are purely based on morphological traits (Chant and McMurtry 2005). Geographically isolated populations may or may not be reproductively isolated. They are often referred to as geographic races, subspecies or semispecies, but their status as a species is unclear until it is known whether they are reproductively isolated when the races become sympatric (Diehl and Bush 1984). The same applies to terms like host races, ecotypes, biotypes and strains. These terms are used to indicate that populations differ conspicuously in some genetically determined traits. Such differences are thought to result from reduced gene flow between populations and thus at least partial genetic isolation. However, the extent to which the partial isolation operates is not always known. Because gene flow is hard to assess and there is a practical need to distinguish populations with different traits (Clark and Walter 1995), the terms referred to above will persist, but it should be clear that the categories blend into one another (Diehl and Busch 1984). For the purpose of biological control it is surely interesting to know whether populations differ in a genetic trait relevant to this objective. However, releasing such a strain, ecotype, biotype or geographic race in another area with a morphologically similar population is problematic if reproductive isolation is not ensured. This is why I focus on reproductive incompatibility between geographic populations and assess their traits as far as I think they are relevant to biological control. Hybridization studies have been conducted between populations or strains of phytoseiid species to test for reproductive compatibility. Such studies challenge taxonomists to examine specimens more critically for morphological characters. This is illustrated by a case study on Typhlodromus exhilaratus (Ragusa), which appeared to harbour two cryptic species, T. exhilaratus and T. phialatus (Athias-Henriot) (Tixier et al. 2006a). In other stud-

8 Nazer-chap1.qxd 14-9-2012 10:35 Page 9

General introduction

ies, synonymy was considered between phytoseiid mites previously identified as different species but showing full reproductive compatibility, for instance synonymy between Amblyseius swirskii (Athias-Henriot) and A. rykei (Pritchard & Baker) (Zannou et al. 2011), or between Cydnodromus idaeus (Denmark & Muma) and C. picanus (Ragusa) (Tixier et al. 2011). Reproductive barriers may arise from prezygotic isolation mechanisms (e.g., mate choice) or or postzygotic mechanisms. Postzygotic incompatibility can result from genetic incompatibility (Navajas et al. 1999; Uesugi et al. 2003; Gotoh et al. 2005b; Pryke and Griffith 2008; Koevoets and Beukeboom 2009) or more specifically from endosymbionts, such as Wolbachia and Cardinium (Laven 1967; O’Neill and Karr 1990; Perrot- Minnot et al. 1996; Breeuwer 1997; Gotoh et al. 2007) as well as their interactions with nuclear genes (Gotoh et al. 1995). Endosymbiont-mediated reproductive incompatibility, so-called ‘cytoplasmic incompatibility’ is a sterility phenomenon that has been first reported between strains of insects (Laven 1959, 1967), and is now known to occur in a wide range of taxa. Two basic forms of cytoplasmic incompatibility are known: unidirectional (nonreciprocal) cytoplasmic incompatibility and bidirectional cytoplasmic incompatibility. Unidirectional (nonreciprocal) cytoplasmic incompatibility occurs in crosses involving infected and uninfected populations and results in normal progeny in one direction but in few viable hybrids or no progeny in the other. Bidirectional cytoplasmic incompatibility is observed in crosses between populations infected with different strains of endosymbionts (Perrot-Minnot et al. 1996). In the Phytoseiidae, unidirectional incompatibilities are the most common, and are associated with shrivelled eggs, a low number of eggs, low survival of immature stages and reduced fecundity in F1 individuals (if present) (Johanowicz and Hoy 1998; Norhona and Moraes 2004). Although compared to insects and isopods little is done to assess the cause of the reproductive incompatibilities in the Phytoseiidae, there is one case study on Metaseiulus occidentalis Nesbitt, demonstrating that Wolbachia mediates unidirectional incompatibility in phytoseiid species (Hess and Hoy 1982; Hoy and Cave 1988; Johanowicz and Hoy 1998). Yet, in the Phytoseiidae, no study has reported Cardinium-mediated cytoplasmic incompatibility, an endosymbiont well known from insects or other mite taxa (spider mites and false spider mites). To discriminate between genetic entities a comprehensive biosystematic approach is required (McMurtry et al. 1976; McMurtry 1980). Over the past decade, molecular methods are being emphasized in systematics as tools to discriminate between populations and/or species. Such techniques are complementary to morphological analysis and crossbreeding studies, and vice versa. DNA-based tools are currently applied to detect genetic variation at any taxonomic level and to measure relat- edness between taxa in mites. Mitochondrial DNA (mtDNA) provides useful markers for the genetic characterization and studies of phylogenetic relationships of

9 Nazer-chap1.qxd 14-9-2012 10:35 Page 10

CHAPTER 1

organisms at different taxonomic levels (Hebert et al. 2003a,b; Tixier al. 2003, 2004, 2006b, 2008a,b; Okassa et al. 2010). DNA barcoding is a method proposed to classi- fy animals to the species level using a fragment of mtDNA, usually the cytochrome oxidase subunit I (COI), well suited for population and species identification (Hebert et al. 2003a,b). The combination of morphological and molecular data has led to separation of species that were hard to distinguish based on morphological criteria only (e.g., Tixier et al. 2006b) In this thesis I will focus on geographic populations as genetic entities and will study whether they are reproductively isolated from other populations, whether they are morphologically and/or genetically different and finally in which biocontrol-relevant traits they differ. Hence, I will perform morphological and molecular analysis, cross- breeding experiments and – in case populations are not compatible – also experiments to assess the causes of incompatibility (especially the role endosymbionts) (CHAPTERS 2- 4). This approach has the practical advantage that genetic integrity of a promising population of biocontrol agents is maintained even after it is introduced in the habitat of another conspecific population. Finally, I will determine differences between populations and species in competitive abilities (CHAPTER 5) and in the traits thought to be relevant for biological control (CHAPTER 6).

Thesis outline In this thesis, I focus on mainly two species of predatory mites (Acari: Phytoseiidae) that are found under the perianth of coconuts: Neoseiulus paspalivorus DeLeon and N. baraki Athias-Henriot. There, they feed on coconut mites (Aceria guerreronis Keifer) which in turn are plant parasites in that they consume the contents of meristematic cells in the tissue protected by the coconut perianth. Each of the two predator species has been found in the continents and countries explored for their fauna of predatory mites inhabiting coconuts (Fernando et al. 2003; Lawson-Balagbo et al. 2008; Reis et al. 2008; Fernando and Aratchige 2009; Banerjee and Gupta 2011; Negloh et al. 2011; Zannou et al. unpublished; Fernando et al. unpublished). Thus, they occupy the same niche in that they share coconut mites as prey and they are likely to be each other’s competitor. Based on morphological criteria these species belong to the same genus and they are closely related systematically (Zannou et al. 2006; De Moraes et al. 2004). These two predator species are considered to be candidates for the biological control of coconut mites. To provide a sound basis for identification and characterization of these natural enemies for utilization in biological control programs (Moraes et al. 1987; McMurtry 2010), I investigated several geographic populations of each of the two species. I assessed the degree of reproductive compatibility and examined the extent of morphological and genetic variation between these populations of predatory mites. For each of these populations, I studied some traits thought to be relevant for biological control.

10 Nazer-chap1.qxd 14-9-2012 10:35 Page 11

General introduction

In CHAPTER 2 three populations of predatory mites identified as N. paspalivorus – from Benin, Ghana and Brazil – were subject to a test on reproductive compatibility and multivariate analysis on 32 morphological characters. Multivariate morphometry is the most suitable approach for analyzing morphological variation on a wide set of morphometric and meristic traits. These methods are currently used to provide information on character variability within and between phytoseiid mite populations and to contribute to the taxonomy knowledge of the studied group (i.e., Tixier al. 2003, 2004, 2006b, 2008a,b; Okassa et al. 2010). In CHAPTER 3 I investigate the genetic variation in the three populations identified as N. paspalivorus as well as the cause of their reproductive isolation. First, I used the mitochondrial cytochrome oxidase subunit I (COI) primers to assess the genetic variation between populations. Then, I used 16S rDNA primers to check for the presence of endosymbiotic bacteria Wolbachia and Cardinium in those populations, and to analyze the phylogenetic relationships of each endosymbiont from each host population and from other mite and insect populations of which the endosymbiont sequences are known from GenBank. In addition, an antibiotic test was also conducted to determine whether each symbiont can cause cytoplasmic incompatibility in its host. In CHAPTER 4 I applied an integrative approach combining multivariate morphometry, crossbreeding and molecular analysis to four populations previously identified as N. baraki, one from Benin, two from Tanzania and one from Brazil. In CHAPTER 5 I report on intraguild interactions observed in cross-pairing experiments conducted with the aim to assess reproductive barriers between N. baraki, N. paspalivorus and N. neobaraki. These intraguild interactions may play a role in niche competition between different species, but they are possibly also relevant in creating prezygotic barriers between populations of the same species. In CHAPTER 6, I review the literature on predatory mites found under the perianth of coconuts and focus on the traits that are thought to be vital for their impact on coconut mite control. First, I assess the features of numerical abundance of the predator species. Then, I focus on interspecific and inter-population differences in size, life history on a diet of coconut mites or alternative food (pollen), as well as predation. Finally, I present a phylogenetic analysis for all populations of the three predator species based on COI sequences to test the hypothesis that they represent a complex species. The general discussion (CHAPTER 7) of this Thesis is devoted to the question which of the geographic populations may have the best combination of the traits for biological control of coconut mites. Moreover, I try to provide different alternative scenarios for the worldwide invasion of the three species of predatory mites studied in this Thesis. Finally, I scrutinize the critical assumption underlying this Thesis that reproductive isolation is a fixed trait, rather than a context-dependent plastic phenomenon.

11 Nazer-chap1.qxd 14-9-2012 10:35 Page 12

CHAPTER 1

Acknowledgements I am very greatful to Maurice W. Sabelis for his valuable comments on earlier versions of this chapter. References Banerjee D, Gupta SK (2011) Incidence and seasonal occurrence of mites (Acari) on coconut in West Bengal, India. Zoosymposia 6:82–85. Breeuwer JAJ (1997) Wolbachia and cytoplasmic incompatibility in the spider mite Tetranychus urticae and T. turkestani. Heredity 79:41–47. Chant DA, McMurtry JA (2007) Illustrated Keys and Diagnoses for the Genera and Subgenera of the Phytoseiidae of the World (Acari: Mesostigmata). Indira Publishing House, West Bloomfield, USA. Clark AR, Walter GH (1995) Strains and the classical biological control of insect pests. Can J Zool 73:1777-1790 Diehl SR, Bush GL (1984) An evolutionary and applied perspective of insect biotypes. Ann Rev Entomol 29:471–504. Fernando LCP, Aratchige NS (2009) Status of coconut mite Aceria guerreronis and biological control research in Sri Lanka. In: M.W. Sabelis and J. Bruin (eds.) Trends in Acarology. Proceedings of the 12th International Congress. Springer, The Netherlands, pp. 419–423. Fernando LCP, Aratchige NS, Peiris TSG (2003) Distribution pattern of coconut mite Aceria guerreronis and its predator Neoseiulus aff. paspalivorus on coconut palms. Exp Appl Acarol 31:71–78. Gerson U, Smiley RL, Ochoa R (2003) Mites (Acari) for Pest Control. 539p., Blackwell Science, UK. Giordano R, O’Neill LS, Robertson HM (1995) Wolbachia infections and the expression of cytoplasmic incompatibility in Drosophila sechellia and D. mauritiana. Genetics 140:1307–1317. Gotoh T, Noda H, Ito S (2007) Cardinium symbionts cause cytoplasmic incompatibility in spider mites. Heredity 98:13–20. Gotoh T, Noda H, Fujita T, Iwadate K, Higo Y, Saito S, Ohtsuka S (2005) Wolbachia and nuclear- nuclear interactions contribute to reproductive incompatibility in the spider mite Panonychus mori (Acari: Tetranychidae). Heredity 94:237–246. Gotoh T, Oku H, Moriya K, Odawara M (1995) Nucleus-cytoplasm interactions causing reproductive incompatibility between two populations of Tetranychus quercivorus Ehara et Gotoh (Acari: Tetranychidae). Heredity 74:105–114. Grant V (1981) Plant Speciation. 2nd ed. New York: Columbia University Press. Hebert PND, Cywinska A, Ball SL, deWaard JR (2003a) Biological identifications through DNA barcodes. Proc R Soc Lond B 270:313–321. Hebert PND, Ratnasingham S, deWaard JR (2003b) Barcoding animal life: cytochrome c oxidase subunit 1 divergence among closely related species. Proc R Soc Lond B 270:S96–S99. Helle W, Sabelis MW (1985) Spider Mites: Their Biology, Natural Enemies and Control. World Crop Pests Vol. 1B, Elsevier Amsterdam, 458 pp Hess RT, Hoy MA (1982) Microorganisms associated with the spider mite predator Metaseiulus (=Typhlodromus) occidentalis. Electron microscopic observations. J Invert Pathol 40:98–106. Hoy MA, Cave FE (1988) Premating and post-mating isolation among populations of Metaseiulus occidentalis (Nesbitt) (Acarina: Phytoseiidae). Hilgardia 56:1-20. Johanowicz DL, Hoy MA (1999) Experimental induction and termination of non-reciprocal reproductive incompatibility in a parahaploid mite. Entomol Exp Appl 87:51–58. Johanowicz DL, Hoy MA (1998) The manipulation of arthropod reproduction by Wolbachia endosymbionts. Florida Entomol 83:310–317. Koevoets T, Niehuis O, Van de Zande L, Beukeboom LW (2011) Hybrid incompatibilities in the parasitic wasp genus Nasonia. Heredity 108, 302–311. Laven H (1959) Speciation by cytoplasmic isolation in Culex strains. Evolution 5:370–375.

12 Nazer-chap1.qxd 14-9-2012 10:35 Page 13

General introduction

Laven H (1967) Evolution and speciation in Culex pipiens. In: Genetics of Insects vectors of disease. Eds JW Wright R Pal, Holland: Elsvier, pp 251-271. Lawson-Balagbo ML, Gondim Jr MGC, Moraes GJ, Hanna R, Schausberger P (2008) Exploration of acarine fauna on coconut palm in Brazil with emphasis on Aceria guerreronis (Acari: Eriophyidae) and its natural enemies. Bull Entomol Res 98:83–96. Lesna I, Sabelis MW (2002) Genetic polymorphism in prey preference at a small spatial scale: a case study of soil predatory mites (Hypoaspis aculeifer) and two species of astigmatic mites as prey. In: Acarid Phylogeny and Evolution: Adaptation in Mites and Ticks - Proceedings of the IV Symposium of the European Association of Acarologists (eds. F Bernini, R Nannelli, G Nuzzaci and E de Lillo), Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 49-64. Lesna I, Sabelis MW (1999) Diet-dependent female choice for males with ‘good genes’ in a soil predatory mite. Nature 401:581-584. Lindquist EE, Sabelis MW, Bruin J (eds.) (1996) Eriophyoid Mites - Their Biology, Natural Enemies and Control. World Crop Pest Series Vol. 6, Elsevier Science Publishers, Amsterdam, The Netherlands, 790 + xxxii pp. Mallet J (1995) A species definition for the Modern Synthesis. TREE 10:294–299. Mayr E (1940) Speciation phenomena in birds. Am Nat 74:249–278. McMurtry JA (2010) Concepts of classification of the Phytoseiidae: Relevance to biological control of mites. In: MW Sabelis and J Bruin (Eds.) Trends in Acarology: Proceedings of the 12th International Congress. Springer, The Netherlands, pp. 393–407. McMurtry JA, Badii MH, Congdon BD (1985) Studies on a Euseius species complex on avocado in Mexico and Central America, with a description of a new species (Acari: Phytoseiidae). Int J Acarol 26:107–116. McMurtry JA (1980) Biosystematics of three taxa in the Amblyseius filandicus group from South Africa with comparative life history (Acari: Phytoseiidae). Int J Acarol 6:147–156. McMurtry JA, Mahr DL, Johson HG (1976) Geographic races in the predaceous mite, Amblyseiulus potentillae (Acari: Phtyoseiidae). Int J Acarol 2:23–28. Moraes GJ, Lopez PC, Fernando CP (2004). Phytoseiid mites (Acari: Phytoseiidae) of coconut growing areas in Sri Lanka, with description of three new species. J Acarol Soc Jpn 13:141-160. Moraes GJ (1987) Importance of taxonomy in biological control. Insect Sci Appl 8:841–844. Navajas M, Gutierrez J, Lagnel L, Fauvel G, Gotoh T (1999) DNA sequences and cross-breeding experiments in the hawthorn spider mite Amphitetranychus viennensis reveal high genetic differentiation between Japanese and French populations. Entomol Exp Appl 90:113–122. Negloh K, Hanna R, Schausberger P (2011) The coconut mite, Aceria guerreronis, in Benin and Tanzania: occurrence, damage and associated acarine fauna. Exp Appl Acarol 55:361-374. Noronha ACS, Moraes GJ (2004) Reproductive compatibility between mite populations previously identified as Euseius concordis (Acari: Phytoseiidae). Exp Appl Acarol 32:271–279. Okassa M, Tixier M-S, Kreiter S (2010) Morphological and molecular diagnostics of Phytoseiulus persimilis and Phytoseiulus macropilis (Acari: Phytoseiidae). Exp Appl Acarol 52:291–303. O’Neill SL, Karr TL (1990) Bidirectional incompatibility between conspecific populations of Drosophila simulans. Nature 348:178-180. Perrot-Minnot M-J, Guo LR, Werren JH (1996) Single and double infection with Wolbachia in the parasitic wasp Nasonia vitripennis: Effects on compatibility. Genetics 143:961–972. Pryke SR, Griffith SC (2008) Postzygotic genetic incompatibility between sympatric color morphs. Evolution 63:793–798. Reis AC, Gondim MGC, Moraes GJ, Hanna R, Schausberger P, Lawson-Balagbo LE, Barros R (2008) Population dynamics of Aceria guerreronis Keifer (Acari: Eriophyidae) and associated predators on coconut fruits in northeastern Brazil. Neotrop Entomol 37:457–462. Telschow A, Hammerstein P, Werren JH (2005) The effect of Wolbachia versus genetic incompatibilities on reinforcement and speciation. Evolution 59:1607–1619.

13 Nazer-chap1.qxd 14-9-2012 10:35 Page 14

CHAPTER 1

Tixier M-S, Tsolakis H, Ragusa S, Poinso A, Ferrero M, Okassa M, Barbar Z, Ragusa S, Cheval B, Kreiter S (2011) Integrative taxonomy demonstrates the unexpected between two predatory mite species Cydnodromus idaeus and C. picanus (Acari: Phytoseiidae). Invert Syst 25:273–281. Tixier M-S, Ferrero M, Okassa M, Guichou S, Kreiter S (2010) On the specific identity of specimens of Phytoseiulus longipes Evans (Mesostigmata: Phytoseiidae) showing different feeding behaviours: morphological and molecular analysis. Bull Entomol Res 17:1–11. Tixier M-S, Guichou S, Kreiter S (2008a) Morphological variation of the species Neoseiulus californicus (McGregor) (Acari: Phytoseiidae): importance for diagnostic reliability and synonymies. Invert Syst 22:453–469. Tixier M-S, Kreiter S, Croft BA, Cheval B (2008b) Kampimodromus aberrans (Acari: Phytoseiidae) from the USA: morphological and molecular assessment of its density. Bull Entomol Res 98:125–134. Tixier M-S, Kreiter S, Barbar Z, Ragusa S, Cheval B (2006a) The status of two cryptic species: Typhlodromus exhilaratus Ragusa and Typhlodromus phialatus Athias-Henriot (Acari: Phytoseiidae): consequences for taxonomy. Zoologica Scripta 35:115–122. Tixier M-S, Kreiter S, Ferragut F, Cheval B (2006b) The suspected synonymy of Kampimodromus hmiminai and Kampimodromus adrianae (Acari: Phytoseiidae): morphological and molecular investigations. Can J Zool 84:1216–1222. Tixier M-S, Kreiter S, Croft BA, Cheval B (2004) Morphological and molecular differences in the genus Kampimodromus Nesbitt. Implications for taxonomy. Phytophaga 14:361–375. Tixier M-S, Kreiter S, Cheval B, Auger P (2003) Morphometric variation between populations of Kampimodromus aberrans Oudemans (Acari: Phytoseiidae). Implications for the taxonomy of the genus. Invert Syst 17:349–358. Uesugi R, Goka K, Osakabe M (2003) Development of genetic differentiation and postzygotic isolation in experimental metapopulations of spider mites. Exp Appl Acarol 31:161–176. Zannou ID, Hanna R (2011) Clarifying the identity of Amblyseius swirskii and Amblyseius rykei: are they two distinct species or two populations of one species? Exp Appl Acarol 53:339–347. Zannou ID, Moraes GJ, Ueckermann EA, Olivera AR, Yaninek JS, Hanna R (2006) Phytoseiid mites of the genus Neoseiulus Hughes (Acari: Phytoseiidae) from Sub-Saharan Africa. Int J Acarol 32:241–276.

14 Nazer-chap2.qxd 14-9-2012 10:35 Page 15 2 Morphological variation and reproductive incompatibility of three coconut-mite-associated populations of predatory mites identified as Neoseiulus paspalivorus (Acari: Phytoseiidae)

ABSTRACT – Predatory mites identified as Neoseiulus paspalivorus DeLeon (Phytoseiidae) have been considered as agents for classical biological control of the coconut mite, Aceria guerreronis Keifer (Eriophyidae), in Africa and elsewhere. Preliminary identification of geographically distinct populations as belonging to the same species (N. paspalivorus) was based on their morphological similarity. However, laboratory studies recently conducted have shown large differences in feeding behaviors and biological characteristics among individuals collected from three geographic origins: Brazil (South America), Benin and Ghana (West Africa). As morphologically similar specimens do not necessary belong to the same species, we evaluated under laboratory conditions, reproductive compatibility between the specimens from three geographic locations to ascertain their con- specificity. Morphological measurements were also made to determine if there is a means of discriminating between them. Inter-population crosses showed complete reproductive isolation between the three geographic populations, but inter- population discontinuities in morphometric characters were absent. These results indicate that the tested specimens are distinct biological entities despite morphological similarity. Further molecular genetic studies are therefore proposed, including screening for endosymbionts and assessment of genetic differentiation, to determine the cause of reproductive incompatibility and to clarify the taxonomic relationship between those populations.

Experimental and Applied Acarology (2011) 53: 323–238

oconut, Cocos nucifera L., is one of the main crops in the Tropics. The coconut mite, CAceria guerreronis Keifer, has become one of the most important arthropod pests of this crop around the world. It causes severe damage to the crop by attacking the meristematic tissues underneath the bracts. According to recent assessments the abundance of the coconut mite and its damage to the crop may be lower, and the predator fauna associated with coconut mite may be richer in certain areas of Brazil than in Africa (Benin, Ghana and Tanzania) and Sri Lanka (Fernando et al. 2003; Lawson-Balagbo et al. 2008; Reis et al. 2008; Negloh et al. 2010; Fernando et al. unpublished). Over the past two decades, attempts were made to control the pest through the use of chemicals and

15 Nazer-chap2.qxd 14-9-2012 10:35 Page 16

CHAPTER 2

biopesticides. These control measures, however, have proven to be costly, often ineffective and ecologically undesirable (Moore and Alexander 1987; Moore et al. 1989). Because of the exotic nature of the coconut mite in Africa (originated from South America) (Navia et al. 2005), classical biological control, i.e., is the intentional importa- tion and release of natural enemies in the native range of the target pest, where the pest and its natural enemies co-evolved, for permanent establishment and self-sustained control of the target pest, is thought to be a reasonable approach to combat the coconut mites. Mites in the family Phytoseiidae are mostly predators that are well-known to play a significant role in the biological control of arthropod pests such as mites and small insects (McMurtry et al. 1970; Helle and Sabelis 1985; Lindquist et al. 1996; Sabelis and Van Rijn 1997; Gerson et al. 2003). The predatory mite Neoseiulus paspalivorus (DeLeon) (Acari: Phytoseiidae) is the most common natural enemy associated with the coconut mite in Brazil (Lawson-Balagbo et al. 2008; Reis et al. 2008). In Benin and Ghana, West Africa, N. paspalivorus was also frequently reported on infested coconuts (Negloh et al. 2010). However, recent laboratory experiments by Famah Sourassou et al. (in prep.) showed large differences in feeding behaviours and biological characteristics among specimens from the three geographic locations: Benin, Ghana (West Africa) and Brazil (Itamaraca, State of Pernambuco). All three geographic populations developed and reproduced on coconut mite prey, but their biological parameters differed. Furthermore, the specimens from Beninese and Brazilian populations were able to develop and reproduce on Tetranychus urticae Koch (Acari: Tetranychidae), whereas the Ghanaian ones were able to develop on this prey, yet unable to convert the food obtained from this prey into eggs. Moreover, the specimens from Brazilian and Ghanaian populations were able to develop on coconut pollen, whereas those from Beninese populations were not. All three geographic populations of N. paspalivorus did not produce any eggs on coconut pollen. Contrasting results with our data were previously reported by Lawson-Balagbo et al. (2007), showing that N. paspalivorus specimens collected in Acarau (State Cesara, Brazil) could not feed and develop on T. urticae, whereas they were able to develop and reproduce on coconut pollen. Taken together, there are clear indications that the three N. paspalivorus geographic populations are biologically different despite their morphological similarity. Such biological differences between morphologically similar populations may indicate cryptic species (Muma and Denmark 1969; Monetti and Croft 1997; Tixier et al. 2003, 2004, 2006a, 2008). To test whether the three allopatric populations are ‘potentially able to interbreed and produce viable progeny’ (biological species sensu Mayr 1940) is necessary to understand the evident biological differences between the three geographic populations. The study reported in this article aimed to evaluate reproductive compatibility among three geographic populations of predatory mites (Brazil, Benin, and Ghana) that

16 Nazer-chap2.qxd 14-9-2012 10:35 Page 17

Morphological variation and reproductive incompatibility

have been identified as N. paspalivorus based morphological similarity only. We also conducted morphological comparison to determine if there are morphological traits other than those used for their identification that may serve to distinguish these populations. Material and methods Source populations and rearing techniques Specimens of N. paspalivorus were collected from coconuts in October 2005 in Ouidah (06°21’N; 02°097’E), Southern Benin, in September 2006 in Itamaraca (07°46’S; 34°52’W), State of Pernambuco, Northeastern Brazil and in December 2008 near Winneba (05°22’907’’N, 00°38’685’’W), Southern Ghana. These three samples were used for propagation in a rearing unit consisting of a black PVC tile (4 × 4 × 0.1 cm) placed on top of a foam pad (4 × 4 × 1 cm) resting in a Petri dish (14.5 cm in diameter and 1 cm in height). The edges of the tile were covered with a band of tissue paper that also contacted the foam pad. To prevent mites from escaping, distilled water was supplied to the Petri dish on a daily basis to keep wet the foam pad and the tissue paper. A tuft of hydrophobic cotton wool covered by a piece of transparent plastic was placed in the center of each rearing unit to serve as an oviposition site for the predators. Colonies of all populations were maintained in a climate-controlled room at 25-27 °C, 70-90% relative humidity and L12:D12 photoperiod. The colonies were provided with a new supply of immature stages of T. urticae at three day intervals.

Crossing experiments Each experiment started with a cohort of 1-day-old eggs obtained from gravid females of each of the three populations. To obtain them, one hundred females were confined to rearing units similar to that described above and offered eggs of T. urticae as prey. After 24 h, each egg laid by the predator was transferred to a new unit, again similar to that previously described above, except that the PVC was 2.5 cm diameter black PVC disk and had a hole of 2 mm diameter in the center to serve as an oviposition site. The nymphal stages of the three populations were reared on all stages of A. guerreronis supplied ad libitum. When reaching adulthood, predators were sexed and females and males of each population were kept apart for the subsequent crosses. Mating of all possible combinations of recently moulted females and males of the three populations were considered to determine reproductive compatibilities. All crosses were set up as a single pair mating between virgin females and males. Additionally, 10 virgin females of each population were kept in isolation, to ascertain that mating is necessary for oviposition to take place. Each pair was observed daily and the number of eggs laid was recorded for a period of 10 days. Eggs found in the arenas of a given malefemale combination of geographic strains were pooled in a unit similar to that previous-

17 Nazer-chap2.qxd 14-9-2012 10:35 Page 18

CHAPTER 2

ly described (8.5 cm in diameter and 1.5 cm in height), and reared to adulthood to determine egg viability, post-embryonic survivorship and sex-ratio. Offsprings of each cross were backcrossed to assess hybrid fertility. All crossing experiments were carried out simultaneously under the same environmental conditions as described previously (25-27 °C, 70-90% relative humidity and L12:D12 photoperiod). At the end of the observation period, females and males of each population were preserved in 70% alcohol for morphological analysis.

Morphological analysis Twenty adult females and ten adult males of each population were slide-mounted in Hoyer’s medium for examination under a phase-contrast microscope. Measurements were done with an ocular micrometer, at 400× magnification to measure body size and shield dimensions and at 1000× magnification to measure the length of setae, spermathecal calyx (spermatodactyl for male) and cheliceral digits. Females and males were char- acterized based on 32 morphological traits (Tables 2.2 and 2.3) that are used commonly for the identification of phytoseiid mites (i.e., Chant and McMurtry 1994, 1995; Moraes et al. 2004; Zannou et al. 2007). Setal nomenclature follows that of Lindquist and Evans (1965), as applied to the phytoseiids by Rowell et al. (1978) and Chant and Yoshida-Shaul (1991). For measurement of cheliceral digits and spermatodactyl, another set of at least 20 females and 20 males of each population were slide-mounted separately. The gnathosoma was cut from the rest of the body and a slight pressure was applied to the mount by touching the slide coverslip with the rear end of a small brush to help in distinguishing the two cheliceral digits. Holotype measurements, taken from the original description (De Leon 1957), were also included in the results for comparison.

Data analysis Crossing data A single-factor ANOVA was used to test the effects of crossing types on fecundity and duration of the pre-oviposition period. Data of the latter were log-transformed [ln(x+1)] for ANOVA. Means were compared using the Student-Newman-Keuls multiple range test (SNK) at P<0.05.

Morphological data Morphological characters of females and males were analyzed separately with SAS software (SAS Institute 2003). For each population and each character examined, descrip- tive statistics (mean, standard error, maximum, minimum) were calculated using the MEANS procedure (Proc MEANS). Differences among geographic populations were tested by one-way analysis of variance (Proc ANOVA) followed by a Newman-Keuls

18 Nazer-chap2.qxd 14-9-2012 10:35 Page 19

Morphological variation and reproductive incompatibility

multiple comparison test at P<0.05. Next, a multifactorial analysis (Principal Component Analysis) and a Canonical Discriminant Analysis were performed to assess patterns of morphological variation and to identify morphological characters that contribute most to morphological differentiation among the three geographic populations. Prior to multifactorial analysis, a discriminant analysis was carried out to examine how many specimens were correctly classified into their original populations.

Results

Cross-breeding experiments All mated females of intra-population crosses laid eggs, but the proportion of ovipositing females from inter-population crosses ranged between 80 and 100%. Unmated females did not oviposit (Table 2.1). The pre-oviposition period of offspring from each of the inter-population crosses (ranging between 2.9 and 5.4 days) was longer than that of offspring from the intra-population crosses (<2.0 days) (P<0.001; Table 2.1). Average fecundity was about two- to three-fold higher in intra-population than in inter-population crosses (P<0.001; Table 2.1). All eggs obtained from intra-population crosses were viable, with 71% producing females. All eggs produced by inter-population crosses were malformed and non-viable, similar to crosses between females from the Beninese population and males from the Brazilian population. In the crossings between females from Brazil and males from Benin, for which nearly 14% of the eggs produced (13 out of 92 eggs) had a normal shape, only 7.6% of the eggs (7 eggs) hatched giving rise to male progeny only. Eggs were not produced by females of any of the backcrosses involving hybrid males from Brazilian females and Beninese males or Beninese males and Brazilian females (n = 3 for each combination), although mating was observed. In the control backcrosses (n = 3 for each combination), averages of 11.3 and 11.0 eggs per female were recorded for Brazilian and Beninese populations, respectively.

Morphological analysis Mean, standard errors and range of the 32 characters are shown in the Tables 2.2 and 2.3 for female and male populations, respectively. Significant differences were observed for 22 and 15 out of the 32 characters measured, respectively among female and male populations. However, these differences were very small, except for the width of the ventrianal shield at anus level (POST-WVS), which was smaller for the Ghanaian females and the length of seta S5, which was slightly shorter for Beninese females. The standard errors within populations were low and the differences between the minimal and the maximal values for each of the measured morphological variables (except for POST-WVS of the Ghanaian females) were very small.

19 Nazer-chap2.qxd 14-9-2012 10:35 Page 20

CHAPTER 2 Neoseiulus paspalivorus. females period female eggs/female hatchability (% females) n % Pre- No. % Immature Sex Outcome of three geographic crosses (means ± SE) involving populations identified as POPULATION CROSSES POPULATION CROSSES - - ROSS NTRA NTER Female × MaleFemale I ovipositing oviposition eggs/ deformed egg survivorship ratio Table 2.1 Table C Brazil × Benin × Ghana × I 20Brazil × Benin 20 15Benin × Brazil 100Brazil × Ghana 100 100Ghana × Brazil 30Benin × Ghana 30Ghana × Benin 15 1.6 ± 0.19c 83.3 the same letter in a column are not significantly different (SNK; by Means followed 15 1.8 ± 0.26c P>0.05) 1.9 ± 0.19c 93.3n: 10 100 of number 12.8 ± 0.64a pair crosses *: 10 all progeny are males 12.2 ± 0.48a 93.3 10.1 ± 0.55b 3.8 ± 0.31b 100 2.9 ± 0.25b 0 80 5.4 ± 0.13a 0 0 5.2 ± 0.33c 5.2 ± 0.22a 5.7 ± 0.55c 3.1 ± 0.10b 3.8 ± 0.29c 86 100 5.1 ± 0.54a 4.2 ± 0.41c 100 100 100 5.8 ± 0.66c 100 100 3.9 ± 0.84c 100 7.6 100 99.0 ± 0.65 0.0 100 99.4 ± 0.51 0.0 71.9±3.92 0.0 71.8±1.11 0.0 100 0.0 - 74.1±4.01 - - - 0.0* ------

20 Nazer-chap2.qxd 14-9-2012 10:35 Page 21

Morphological variation and reproductive incompatibility OLOTYPE H RAZIL B HANA G ENIN B All measurements are in micrometers. Mean, standard error and range of measured on adult females of 32 morphometric variables three geographic populations identified Neoseiulus paspalivorus. Table 2.2 Table as Morphological characters Length of dorsal shield Mean ± SEWidth of dorsal shieldj1 Min–Max 343.1 ± 0.99 aj3 336–352j4 137.9 ± 0.96 a Mean ± SEj5 130–146j6 338.2 ± 0.73 c Min–MaxJ2 333–342 138.8 ± 0.78 aJ5 Mean ± SE 130–146z2 340.6 ± 0.74 bz4 Min–Max 336–349 138.3 ± 0.98 az5 127–143Z1 (De Leon 1957) 11.4 ± 0.13 aZ4 340 10.5 ± 0.14 bZ5 10–12 140 9.3 ± 0.16 a 10–12s4 9.0 ± 0.13 aS2 9.8 ± 0.12 b 8–10S4 11.5 ± 0.15 a 10.9 ± 0.17 a 8–10 11.4 ± 0.18 aS5 10–12 9.0 ± 0.12 b 9–11r3 9–12 10–12 9.3 ± 0.19 bR 10.3 ± 0.17 b 9.4 ± 0.23 a 8–10St IV 9.5 ± 0.24 a 10.3 ± 0.12 b 8–10 9.2 ± 0.13 b 10.4 ± 0.18 a ST1-ST3 11.1 ± 0.20 a 9–11 8–11 11.1 ± 0.16 a 10.1 ± 0.22 bST2-ST2 17.0 ± 0.21 a 10–11 8–11 9–11 9–10 10–14 10–12ST5-ST5 54.6 ± 0.36 a 9.9 ± 0.23 a 8–11 10.7 ± 0.19 a 15–18VSW-ANT 11.0 ± 0.17 a 12.5 ± 0.15 a 51–56 9.0 ± 0.17 aVSW-POST 8–11 13.6 ± 0.16 a 10.0 ± 0.12 a 9–12 11 11.4 ± 0.20 a 10.4 ± 0.13 b 9.2 ± 0.16 a 11–14 9.6 ± 0.17 bLength of 9–12 14.5 ± 0.19 b 10–12 shield ventrianal 17.0 ± 0.19 a 12–15 11 Length of 10–11 15.8 ± 0.18 b digit fixed 103.6 ± 0.56 a 9–11 50.2 ± 0.40 a 9–12 8–10 14–16 8–10Length of 15–19 digit 11.7 ± 0.22 b movable 9.3 ± 0.14 b 15–18 12.4 ± 0.16 a 80.8 ± 0.43 a 9.6 ± 0.13 bLength of 98–108 10.8 ± 0.14 b 17.6 ± 0.20 b 48–52 calyx 11.0 ± 0.23 a 13.9 ± 0.20 a 10–14 51.9 ± 0.42 abDiameter of 9 calyx 9–10 11–15 76–82 10.1 ± 0.21 a 10–11 15.3 ± 0.15 a 11 16–19 23.7 ± 0.19 a 9–10 59.6 ± 0.37 a 8.8 ± 0.17 bVSW-ANT, 17.8 ± 0.19 a 81.4 ± 0.33 a Width of 47–54 16.0 ± 0.17 b 107.8 ± 0.57 a 10 11 12–15 of shield at level ventrianal 9–12 18.7 ± 0.16 a 73.5 ± 0.49 a ZV2; are not significantly different (SNK;Means with same letter in a row VSW-POST, Width of 52.5 ± 0.27 b P<0.05). 14–16 101–111 23–25 shield at anus ventrianal 57–63 9–12 17–19 79–82 15–17 13.8 ± 0.14 a 7–10 17–20 70–76 11.8 ± 0.19 b 80.5 ± 0.42 a 18.4 ± 0.22 a 51–55 50.8 ± 0.48 b 11 12.8 ± 0.17 b 9 12–15 11 11.4 ± 0.16 a 102.2 ± 0.75 b 10–12 79–86 14.6 ± 0.18 b 16–20 7.8 ± 0.18 a 23.1 ± 0.38 a 6.8 ± 0.14 a 58.3 ± 0.35 b 47–54 18.0 ± 0.27 a 81.1 ± 0.48 a 11–14 95–108 10–12 11 17 19.0 ± 0.17 a 60.8 ± 1.11 b 14–16 9 22–25 57–60 52 16–19 79–85 6–9 11.8 ± 0.19 b 6–7 54–73 18–20 80.7 ± 0.36 a 17.5 ± 0.19 b 12 52.6 ± 0.42 a 11–14 10.1 ± 0.12 b 14 - 79–82 16–19 23.3 ± 0.27 a 57.4 ± 0.39 b 51–57 18.3 ± 0.19 a 82.0 ± 0.47 a 15 73.8 ± 0.40 a 9–11 8.2 ± 0.17 a 6.6 ± 0.18 a 19 54–60 21–25 17–19 79–86 11 70–76 6–9 5–7 - - - 10 - - - - - 8.0 ± 0.16 a 6.3 ± 0.10 a 6–9 6–7 - -

21 Nazer-chap2.qxd 14-9-2012 10:35 Page 22

CHAPTER 2 OLOTYPE H RAZIL B HANA G ENIN B All measurements are in micrometers. Mean, standard error and range of measured on adult males of 32 morphometric variables three geographic populations identified as Table 2.3 Table Neoseiulus paspalivorus. Morphological characters Length of dorsal shield Mean ± SEWidth of dorsal shieldj1 Min–Max 257.1 ± 1.73 aj3 250–269 j4 124.5 ± 0.67 a Mean ± SEj5 120–127 257.7 ± 1.16 aj6 Min–MaxJ2 253–263 117.6 ± 0.87 b 114 –120J5 Mean ± SEz2 256.8 ± 2.11 az4 124.0 ± 0.56 a Min–Max 241–263z5 120–127Z1 (De Leon 1957) 9.6 ± 0.19 aZ4 260 10.0 ± 0.26 a 120 Z5 7.8 ± 0.25 b 8–10s4 8–11 7.8 ± 0.26 aS2 6–9 8.6 ± 0.22 aS4 9.2 ± 0.33 a 6–9S5 9.8 ± 0.25 a 10.2 ± 0.12 a 7.0 ± 0.20 b 7–10r3 8.2 ± 0.27 b 8–11R 9–11 9–11 7.6 ± 0.22 b 9.1 ± 0.26 b 6–8St IV 6–9 7.3 ± 0.22 a 8.1 ± 0.21 aST1-ST3 9.4 ± 0.27 a 9.6 ± 0.19 a 6–9 8–10 8- 11ST2-ST2 14.4 ± 0.27 ab 9.6 ± 0.19 a 10.0 ± 0.12 a 10.3 ± 0.16 a 6–9 7–9ST5-ST5 40.4 ± 0.64 a 12–15 8–10 6.6 ± 0.19 bVSW-ANT 8–10 9–10 10.5 ± 0.27 a 9.4 ± 0.20 a 9–11 10.0 ± 0.18 a 36–44VSW-POST 11.2 ± 0.18 b 8.5 ± 0.16 a 6–8Length of 14.0 ± 0.36 b 12.2 ± 0.31 b 9–11 shield ventrianal 8–10 8.0 ± 0.20 a 8.4 ± 0.19 a 9–11 9.0 ± 0.36 a 10–12 9.2 ± 0.42 aLength of 10.0 ± 0.26 a 12.7 ± 0.29 b digit 7–9 fixed 41.1 ± 0.65 a 92.5 ± 0.92 a 13–16 11–14Length of digit movable - - 7–9 7–9 7–10 11–14 9.6 ± 0.19 b 7–11 67.2 ± 0.63 aLength of 9–11 15.0 ± 0.18 b 38–44 7.6 ± 0.29 a 89–98 11.2 ± 0.18 a spermatod. shaft 12.1 ± 0.19 a 8.6 ± 0.22 b 9.1 ± 0.32 b 40.2 ± 0.48 ab 9.8 ± 0.22 aLength of spermatod. 63–70 15.2 ± 0.31 a foot 118.0 ± 1.62 a 13.1 ± 0.33 a 9–10 14–16 17.6 ± 0.30 a 10–12 33.6 ± 0.51 a 11.7 ± 0.20 aSpermatod, 12.0 ± 0.20 b 38–41 6–9 Spermatodactyl 11–13 14.8 ± 0.34 a 76.7 ± 1.55 a 7–10 111–127 8–10 - are not significantly different (SNK;Means with same letter in a row 9–11 40.0 ± 0.69 a 94.4 ± 0.63 a P<0.05). 14–16 11–15 9.5 ± 0.33 a 7.8 ± 0.19 a 16–19 32–35 11–12 11–12 4.6 ± 0.32 a - - - 13–16 70–82 66.2 ± 0.56 a 37–45 10.2 ± 0.25 ab 16.1 ± 0.22 a 92–98 10.8 ± 0.19 a 117.0 ± 1.31 a 40.0 ± 0.51 b 11.4 ± 0.22 b 9–10 7–9 4–6 63–70 111–123 9–11 9.5 ± 0.20 ab 11.8 ± 0.20 a 15–17 17.2 ± 0.25 a 10–11 30.7 ± 0.67 b 12.8 ± 0.26 a 12.0 ± 0.20 a 38–41 10–12 - - - 15.0 ± 0.32 a 75.1 ± 1.06 a - 92.0 ± 1.05 a 8–10 11–13 16–19 28–35 11–14 11–12 116.6 ± 1.31 a - 13–16 70–79 65.9 ± 0.42 a 10.8 ± 0.26 a 15.3 ± 0.25 b 85–95 - 108–120 4.8 ± 0.25 a 41.5 ± 0.31 a - - 63–66 14–16 10.2 ± 0.25 a 10–12 - 17.7 ± 0.22 a 33.0 ± 0.51 a 12.3 ± 0.25 ab 11.8 ± 0.21 a 41–44 4–6 78.6 ± 0.92 a - 11–14 16–19 31–35 11–12 9–11 - - - 73–82 - - - - 4.5 ± 0.27 a - - - - - 4–6 - -

22 Nazer-chap2.qxd 14-9-2012 10:35 Page 23

Morphological variation and reproductive incompatibility

Table 2.4 Classification based on discriminant analysis of 32 morphological characters of three geographic populations of Neoseiulus paspalivorus females and males. FEMALE MALE % well- Benin Ghana Brazil % well- Benin Ghana Brazil classified* classified* Benin 90 18 0 2 60 6 2 2 Ghana 85 0 17 3 80 0 8 2 Brazil 85 2 1 17 50 0 5 5 Total 86.7 20 18 22 63.33 6 15 9 *Percentage of well-classified individuals in their original populations

Predicted classification of specimens based on discriminant analysis is shown in Table 2.4. Overall, 86.7% of female specimens and 63.3% of male specimens were classified in the population of origin. The majority of misclassifications for males concerned the Ghanaian and Brazilian specimens (7 of 11, or 63.6%), whereas for females 50% of the misclassifications concerned the Beninese and Brazilian populations, and the Ghanaian and the Brazilian populations. The results of discriminant analysis were corroborated by the principal component analysis (Figure 2.1); substantial overlaps of measurements of females occurred between the Brazilian and Beninese specimens, and between the Brazilian and the Ghanaian specimens. Overlaps were observed between the Ghanaian and Beninese female specimens (Figure 2.1a). In relation to male specimens, considerable level of overlap was found between the measurements on the Brazilian and Beninese specimens (Figure 2.1b). The canonical discrimination analysis allowed a clear distinction between the females of the three populations (Figure 2.2a). The Brazilian and Beninese specimens are the most distant, while the Ghanaian specimens were intermediate between latter two. However, in males, only the Ghanaian specimens could be clearly distinguished from the two others (Figure 2.2b). The posterior width of the ventrianal shield (VSW_POST) and the lengths of j1, Z5, S5 and r3 contributed the most to the morphological differentiation between females of the three geographic populations, whereas the width of the dorsal and genital shields and length of seta S5 contributed the most to the morphological differentiation of males from the three geographic populations. Neoseiulus paspalivorus females from Ghana had a slightly narrower dorsal shield and relatively longer ventrianal shield with a reduced width at the level of the anal shield (posterior width of ventrianal shield) and slightly shorter seta Z5, while males of the same population had slightly narrower dorsal and genital shields. The two sexes of Beninese specimens differed from those of Brazil and Ghana by having slightly shorter seta S5. Specimens from Brazil appeared to be intermediate, but much closer to Beninese specimens by having a similar size of ventrianal shield (for female) and genital shield (for male) with the Beninese specimens and similar length of setae S5 with the Ghanaian specimens.

23 Nazer-chap2.qxd 14-9-2012 10:35 Page 24

CHAPTER 2

Discussion The results of univariate and multivariate analyses are consistent with the previous identification of all three populations– from Benin, Ghana and Brazil– as belonging to the same species. Overlapping morphometric values indicate great morphological similarity among the geographic populations tested. The measurements of the specimens examined were similar to the holotype measurements of N. paspalivorus (De Leon 1957) and measurements of females for the same species from Sri Lanka (Moraes et al. 2004). Differences in setal measurements were small, and the discrimination between the geo-

Figure 2.1 Principal component analysis based on 32 morphometric characters measured on adult females (a) and (b) males from three geographic specimens identified as Neoseiulus paspalivorus: Polygons formed based on the projection of the individuals of each population onto the principal components 1and 2.

24 Nazer-chap2.qxd 14-9-2012 10:35 Page 25

Morphological variation and reproductive incompatibility

graphic populations by multifactorial analyses was based on only some characters that have low weight in species differentiation. McMurtry (1980) indicated that caution should be exercised in using relatively small differences in setal length to differentiate species. Tixier et al. (2006b) reported large differences in setal lengths between Kampimodromus hmiminai (McMurtry and Bounfour) from France and Morocco and K. adrianae (Ferragut and Pena-Estévez) from the Canary Islands, but molecular analysis indicated that they are synonyms. However, the results of cross-breeding indicate reproductive isolation between the populations investigated, which, should therefore be considered as separate species (Mayr 1940). The absence of oviposition in unmated N. pas-

Figure 2.2 Canonical discrimination analysis of 32 morphometric characters measured on adult females (a) and (b) males from three geographic populations of Neoseiulus paspalivorus: Polygons formed based on the projection of the individuals of each population onto the canonical vari- able 1 and 2.

25 Nazer-chap2.qxd 14-9-2012 10:35 Page 26

CHAPTER 2

palivorus females observed in this study was in agreement with what is known to date for the majority of phytoseiids (Croft 1970; McMurtry et al. 1976; McMurtry 1980; Moraes and McMurtry 1981; Noronha and Moraes 2002, 2004). Thus, the high proportion of ovipositing females observed in inter-population crosses imply that mating had occurred, therefore indicating the absence of pre-mating reproductive barriers between the populations under test. The complete bidirectional post-mating reproductive incompatibility observed between the geographic populations was expressed in the form of reduced fecundity, zygotic mortality and a male-biased sex ratio among the few sterile offspring. Bidirectional incompatibility is a rare phenomenon, as unidirectional incompatibilities are the most common in phytoseiid and tetranychid mite populations (Hoy and Cave 1988; Gotoh and Noguchi 1989; Gotoh et al. 1995; Breeuwer 1997; Johanowicz and Hoy 1998; Vala et al. 2000, 2002; Noronha and Moraes 2002, 2004). Our results of bidirectional incompatibility among geographic populations of N. paspalivorus are therefore quiet exceptional, but are similar to those reported by Monetti and Croft (1996) with respect to crosses between the morphologically similar phytoseiid species Neoseiulus californicus (McGregor) and N. fallacis (Garman). Moreover, Klimov et al. (2004) observed postzygotic reproductive isolation between two cryptic species of Sancassania mites, Sancassania salasi and S. ochoai (Klimov, Lekveishvili & OConnor), and molecular analysis of these populations showed that they represent distinct species. The causes of reproductive incompatibility are poorly studied in mites, particularly in phytoseiids. Only in the phytoseiid Galendromus occidentalis (Nesbitt) and in some spider mites, the endosymbionts Wolbachia and more recently Cardinium have been demonstrated to mediate unidirectional reproductive incompatibility (Hess and Hoy 1982; Gotoh et al. 1995; Johanowicz and Hoy 1996; Breeuwer 1997; Vala et al. 2000, 2002, 2003; Gotoh et al. 2006; Ros and Breeuwer 2009). Bidirectional incompatibility is assumed to be caused by either negative nuclear-nuclear genes interactions, as has been reported in the spider mite Panonychus mori Yokoyama (Gotoh et al. 2005), or infection by different strains of Wolbachia, as is well documented for insects (Laven 1959, 1967; Mercot et al. 1995; O’Neill and Karr 1990; Clancy and Hoffmann 1996). Although males and females from different geographic origins were able to mate, we did not obtain F1 hybrids (except in the cross involving Beninese females and Brazilian males where very few sterile males were produced). This apparent lack of gene exchange among the three geographically isolated populations revealed a pattern of reproductive isolation among them. Moreover, the crossing data appeared to corroborate the previously known biological differences observed among these three geographic populations (Famah Sourassou et al. in prep). Taken together, we expect the reproductive incompatibility observed in this study to be the result of genetic divergence due to allopatric differentiation among the popula-

26 Nazer-chap2.qxd 14-9-2012 10:35 Page 27

Morphological variation and reproductive incompatibility

tions investigated (Hurt and Hedrick 2003; Dettman et al. 2008) rather than to be caused by Wolbachia. Even if endosymbionts would be present, there is no guarantee that they were the cause of reproductive isolation because some Wolbachia strains are incapable of inducing reproductive incompatibility in their host (Giordano et al. 1995; Turrelli and Hoffmann 1995; Gotoh et al. 2005). For example, Gotoh et al. (2005) observed bidirectional reproductive incompatibility between two Japanese populations of P. mori (from Hanayama and Toyama) although harbouring the same Wolbachia strain. In this case, the procedure suggested by Breeuwer (1997), i.e., crossing experiments in combination with antibiotic treatment should be used to demonstrate whether they are involved in the reproductive incompatibility. Reproductive isolation is generally thought to develop by the gradual accumulation of genetic differences between populations as a by-product of other adaptive or neutral genetic changes that take place in allopatry (Mayr 1963; Charlesworth et al. 1987; Coyne 1992, 1993; Wu and Davis 1993; Drès and Mallet 2002; Gavrilets 2003; Coyne and Orr 2005; Dettman et al. 2008). Moreover, reproductive isolation has been shown to represent an initial step in the speciation process by preventing or greatly reducing gene flow between populations (Laven 1959, 1967; Conner and Saul 1986; Thompson 1987; 1995; Dettman et al. 2008), and our data are therefore consistent with incipient allopatric speciation (Drès and Mallet 2002; Gavrilets 2003; Coyne and Orr 2005) among these three geographically isolated specimens identified as N. paspalivorus. In conclusion, we found that three geographically isolated populations of predatory mites preliminarily identified as N. paspalivorus, show reproductive isolation indicating that they are distinct biological species despite morphological similarity. Based on the crossing data reported in this study, we propose that there is every reason to screen for the presence of endosymbionts and to perform molecular characterization in order to test the hypothesis on allopatric speciation. It would be also informative to use molecular methods for determining the origin and invasion route of these predatory mites in comparison with what is already known for A. guerreronis (Navia et al. 2005), i.e the prey of these predatory mites and the pest of coconut palms. By including more geographic populations, our work may provide a basis for inferring the intercontinental and between-country invasion of these predatory mites and creates a solid basis for finding the best strains for developing biological control of coconut mites.

Acknowledgements We thank R. Houndafoche, P. Sovimi, C. Kededji and B. Bovis for their assistance in maintaining the predator colonies and conducting experiments. We also thank A. Onzo, D. Gnanvossou and M. Toko for their encouragements and advices. Many thanks go to Sam Korie for providing assistance on the statistical analysis of the data, and to Fabien Hountondji for his comments on the manuscript. The authors also thank M.G.C. Gondim Jr, for helping to locate and for supplying the specimens of N. paspalivorus from Brazil. This research was supported by the International Institute of Tropical Agriculture (IITA) and the University of Amsterdam, the Netherlands,

27 Nazer-chap2.qxd 14-9-2012 10:35 Page 28

CHAPTER 2

through a grant from the Board of the Netherlands Foundation for the advancement of Tropical Research (WOTRO). This study is part of a PhD thesis of the senior author.

References Breeuwer JAJ (1997) Wolbachia and cytoplasmic incompatibility in the spider mites Tetranychus urticae and T. turkestani. Heredity 79:41–47. Chant DA, McMurtry JA (1994) A review of the subfamilies Phytoseiinae and Typhlodrominae (Acari: Phytoseiidae. Int J Acarol 20(4): 223–310. Chant DA, McMurtry JA (2005) Review of the subfamily Amblyseiinae Muma (Acari: Phytoseiidae) Part IV. The tribe Euseiini N. tribe, subtribes Typhlodromalina, N. subtribe, Euseiina N. subtribe and Ricoseiina N. subtribe. Int J Acarol 31:187–222. Chant DA, Yoshida-Shaul E (1991) Adult ventral setal patterns in the family Phytoseiidae (Acari: Gamasina). Int J Acarol 17(3):187–199. Charlesworth B, Coyne JA, Barton NH (1987) The relative rates of evolution of sex chromosomes and autosomes. Am Nat 130:113–146. Clancy DJ, Hoffmann AA (1996) Cytoplasmic incompatibility in Drosophila simulans: evolving com- plexity. Trends Ecol Evol 11:145–146. Conner GW, Saul GB (1986) Acquisition of incompatibility by inbred wild-type stocks of Mormoniella. J Heredity 77:211–213. Coyne JA (1992) Genetics and speciation. Nature 355: 511–515. Coyne JA (1993) The genetics of an isolating mechanism between two sibling species of Drosophila. Evolution 47: 778–788. Coyne JA, Orr AH (2005) Speciation in the 21st century. Heredity 95:105–109. Croft BA (1970) Comparative study on four strains of Typhlodromus occidentalis (Acarina: Phytosei- idae). I. Hybridization and reproductive isolation studies. Ann Entomol Soc Am 63:1559–1563. De Leon D (1957) Three new Typhlodromus from southern Florida (Acarina: Phtyoseiidae). Florida Entomol 40:141–144. Dettman J, Aderson J, Kohn L (2008) Divergent adaptation promotes reproductive isolation among experimental populations of the filamentous fungus Neurospora. BMC Evol Biol 1:35. Drès M, Mallet J (2002) Host races in plant-feeding insects and their importance in sympatric speciation. Phil Trans R Soc Lond B 357:471–492. Fernando LCP, Aratchige NS, Peiris TSG (2003) Distribution pattern of coconut mite Aceria guerreronis and its predator Neoseiulus aff. paspalivorus on coconut palms. Exp Appl Acarol 31:71–78. Gavrilets S (2003) Models of speciation. What have we learned in 40 years? Evolution 57:2197–2215. Giodarno R, O’Neill SO, Robertson HM (1995) Wolbachia infection and the expression of cytoplasmic incompatibility in Drosophila sechellia and Drosophila mauritiana. Genetics 140:1307–1317. Gerson U, Smile RL, Ochoa R (2003) Mites (Acari) for Pest Control. 539p., Blackwell Science, UK Gotoh T, Noda H, Ito S (2006) Cardinium symbionts cause cytoplasmic incompatibility in spider mites. Heredity 98:13-20. Gotoh T, H Noda, T Fujita, K Iwadate, Y Higo, S Saito, S Ohtsuka (2005) Wolbachia and nuclear- nuclear interactions contribute to reproductive incompatibility in the spider mite Panonychus mori (Acari: Tetranychidae). Heredity 94:237–246. Gotoh T, Nugochi O (1989) Developmental success and reproductive incompatibility among populations of the European red mite Panonychus ulmi (Acari: Tetranychidae). Exp Appl Acarol 10:157–165. Gotoh T, Oku H, Moriya K, Odawara M (1995) Nucleus-cytoplasm interactions causing reproductive incompatibility between two populations of Tetranychus quercivorus Ehara et Gotoh (Acari: Tetranychidae). Heredity 74:105–114. Helle W, Sabelis MW (1985) Spider Mites: Their Biology, Natural Enemies and Control. World Crop Pests Vol. 1B, Elsevier Amsterdam, 458 pp.

28 Nazer-chap2.qxd 14-9-2012 10:35 Page 29

Morphological variation and reproductive incompatibility

Hess RT, Hoy MA (1982) Microorganisms associated with the spider mite predator Metaseiulus (=Typhlodromus) occidentalis. Electron microscopic observations. J Invert Pathol 40:98–106. Hoy MA, Cave FE (1988) Premating and post-mating isolation among populations of Metaseiulus occidentalis (Nesbitt) (Acarina: Phytoseiidae). Hilgardia 56:1–20. Hurt CR, Hedrick PW (2003) Initiation stages of reproductive isolation in two species of the endangered sonorant topminnow. Evolution 57(12): 2835-2841. Johanowicz DL, Hoy MA (1998) Experimental induction and termination of non-reciprocal reproductive incompatibility in a parahaploid mite. Entomol Exp Appl 87(1):51–58. Klimov PB, Lekveishvili M, Dowling APG, OConnor BM (2004) Multivariate analysis of morphological variation in two cryptic species of Sancassania (Acari: Acaridae) from Costa Rica. Ann Entomol Soc Am 97(2):322–345. Laven H (1959) Speciation by cytoplasmic isolation in Culex strains. Evolution 5:370–375. Laven H (1967) Evolution and speciation in Culex pipiens. In Genetics of Insects Vectors of Disease. Eds JW Wright, R Pal, pp. 251–271. Holland: Elsevier. Lawson-Balagbo ML, Gondim Jr MGC, Moraes GJ, Hanna R, Schausberger P (2007) Life history of the predatory mites Neoseiulus paspalivorus and Proctolaelaps bickleyi, candidates for biological control of Aceria guerreronis. Exp Appl Acarol 34:49–61. Lawson-Balagbo ML, Gondim Jr MGC, Moraes GJ, Hanna R, Schausberger P (2008) Exploration of acarine fauna on coconut palm in Brazil with emphasis on Aceria guerreronis (Acari: Eriophyidae) and its natural enemies. Bull Entomol Res 98:83–96. Lindquist EE, Evans GO (1965) Taxonomic concept in the Ascidae, with a modified setal nomenclature for the idiosoma of the Gamasina (Acari: Mesostigmata). Mem Entomol Soc Can 47:1–64. Lindquist EE, Sabelis MW, Bruin J (eds.) (1996) Eriophyoid Mites - Their Biology, Natural Enemies and Control. World Crop Pest Series Vol. 6, Elsevier Science Publishers, Amsterdam, The Netherlands, 790 + xxxii pp. Mayr E (1940) Speciation phenomena in birds. Am Nat 74:249–278. Mayr E (1963) Animal Species and Evolution. Harvard University Press, Gambridge, MA. McMurtry JA (1980) Biosystematics of three taxa in the Amblyseius finlandicus group from South Africa, with comparative life history studies (Acari: Phytoseiidae). Int J Acarol 6:147–156. McMurtry JA, Huffaker CB, Van de Vrie M (1970) Ecology of tetranychid mites and their natural enemies: A review: I. Tetranychidae enemies: their biological characters and the impact of spray practices. Hilgardia 40:331–390. McMurtry JA, Mahr DL, Johnson HG (1976) Geographic races in the predaceous mite, Amblyseius potentillae (Acari: Phytoseiidae). Int J Acarol 2:23–28. Mercot H, Llorente B, Jacques M, Atlas A, Montchamp-Moreau C (1995) Variability within the Seychelles cytoplasmic incompatibility system in Drosophila simulans. Genetics 141:1015–1023. Monetti LN, Croft BA (1997) Mating cross-mating and related behaviors of Neoseiulus californicus and Neoseiulus fallacies (Acari: Phytoseiidae). Exp Appl Acarol 21: 67–74. Moore D, Alexander L (1987) Stem injection of vamidothion for control of coconut mite, Eriophyes guerreronis Keifer in St Lucia. Crop Protection 6:329–333. Moore D, Alexander L, Hall RA (1989) The coconut mite, Eriophyes guerreronis Keifer in St. Lucia: yield losses and attempts to control it with acaricide, polybutene and Hirsutella fungus. Trop Pest Manag 35:83–98. Moraes GJ, Lopes PC, Fernando LCP (2004) Phytoseiid mites (Acari: Phytoseiidae) of coconut growing areas in Sri Lanka, with description of 3 new species. J Acarol Soc Jpn 13(2):141–160. Moraes GJ, McMurtry JA (1981) Biology of Amblyseius citrifolius (Denmark and Muma) (Acarina – Phytoseiidae). Hilgardia 49:1–29. Muma MH, Denmark HA (1969) Sibling species of Phytoseiidae (Acari: Mesostigmata). Fla Entomol 52:67–72.

29 Nazer-chap2.qxd 14-9-2012 10:35 Page 30

CHAPTER 2

Navia D, de Moraes GJ, Roderick G, Navajas M (2005) The invasive coconut mite Aceria guerreronis (Acari: Eriophyidae): origin and invasion sources inferred from mitochondrial (16S) and nuclear sequence. Bull Entomol Res 95:105–116. Negloh K, Hanna R, Schausberger P (2010) Season- and fruit age-dependent population dynamics of Aceria guerreronis and its associated predatory mite Neoseiulus paspalivorus on coconut in Benin. Biol Contr 54: 349–358. Noronha ACS, Moraes GJ (2002) Variaçãoes morfológicas intra e interpopulacionaes de Euseius citrifolius Danmark & Muma e Euseius concordis Chant (Acari, Phytoseiidae). Revta Bras Zool 19(4):1111–1122. Noronha ACS, Moraes, GJ (2004) Reproductive compatibility between mite populations previously identified as Euseius concordis (Acari: Phytoseiidae). Exp Appl Acarol 32:271–279. O’Neill SL, Karr TL (1990) Bidirectional incompatibility between conspecific populations of Drosophila simulans. Nature 348:178–180. Reis AC, Gondim MGC, Moraes GJ, Hanna R, Schausberger P, Lawson-Balago LE, Barros R (2008) Population dynamics of Aceria guerreronis Keifer (Acari: Eriophyidae) and associated predators on coconut fruits in Northeastern Brazil. Neotrop Entomol 37(4):457–462. Ros VID, Breeuwer JAJ (2009) The effects of, and interactions between, Cardinium and Wolbachia in the doubly infected spider mite Bryobia sarothamni. Heredity 102:413–422. Rowell HJ, Chant DA, Hansel RIC (1978) The discrimination of setal homologies and setal patterns on the dorsal shield in the family Phytoseiidae (Acarina: Mesostigmata). Can Entomol 110:859-876. Sabelis MW, Van Rijn PCJ (1997) Predation by insects and mites. In: T. Lewis (Ed.) Thrips as Crop Pests. CAB-International, pp. 259–354. SAS (2003) SAS Institute version 9.1 Inc., Cary, NC, USA. Thompson JN (1987) Symbiont-induced speciation. Biol J Linn Soc 32:385–393. Tixier M-S, Guichou S, Kreiter S (2008) Morphological variation of the species Neoseiulus californicus (McGregor) (Acari: Phytoseiidae): importance for diagnostic reliability and synonymies. Invert Syst 22:453–469. Tixier M-S, Kreiter S, Barbar Z, Ragusa S, Cheval B (2006a) The status of two cryptic species: Typhlodromus exhilaratus Ragusa and Typhlodromus phialatus Athias-Henriot (Acari: Phytosei- idae): consequences for taxonomy. Zool Scripta 35:115–122. Tixier M-S, Kreiter S, Ferragut F, Cheval B (2006b) The suspected synonymy Kampimodromus hmiminai and Kampimodromus adrianae (Acari: Phytoseiidae): morphological and molecular investigations. Can J Zool 84:1216–1222. Tixier M-S, Kreiter S, Cheval B, Auger P (2003) Morphometric variation between populations of Kampimodromus aberrans Oudemans (Acari: Phytoseiidae). Implications for the taxonomy of the genus. Invert Syst 17(2):349–358. Tixier M-S, Kreiter S, Croft B A, Cheval B (2004) Morphological and molecular differences in the genus Kampimodromus Nesbitt. Implications for taxonomy. Phytophaga 14:361–375. Turelli M, HofFmann AA (1995) Cytoplasmic incompatibility in Drosophila simulans: dynamics and parameters estimates from natural populations. Genetics 140:1319–1338. Vala F, Breeuwer JAJ, Sabelis MW (2003) No variation for Wolbachia-induced hybrid breakdown in two populations of spider mite. Exp Appl Acarol 29:1–12. Vala F, Weeks A, Claessen D, Breeuwer JAJ, Sabelis MW (2002) Within- and between-population variation in Wolbachia-induced reproductive incompatibility. Evolution 56:1331–1339. Vala F, Breeuwer JAJ, Sabelis MW (2000) Wolbachia-induced ‘hybrid breakdown’ in the two-spotted spider mite Tetranychus urticae Koch. Proc R Soc Lond B 267:1931–1937. Wu CI, Davis AW (1993) Evolution of postmating reproductive isolation: the composite nature of Haldane’s rule and its genetic bases. Am Nat 142:187–212. Zannou ID, Moraes GJ, Ueckermann EA, Olivera AR, Yanineck JS, Hanna R (2006) Phytoseiids mites of the genus Neoseiulus Hughes (Acari: Phytoseiidae) from Sub-Saharan Africa. Int J Acarol 32: 241–276.

30 Nazer-chap3.qxd 14-9-2012 10:36 Page 31 3 Endosymbiont Wolbachia and Cardinium bacteria in the predatory mite Neoseiulus paspalivorus

ABSTRACT – Whereas endosymbiont-induced incompatibility is known to occur in various arthropod taxa, such as spider mites, insects and isopods, it has been rarely reported in plant-inhabiting predatory mites (Acari: Phytoseiidae). Recent cross- breeding studies with the phytoseiid mite Neoseiulus paspalivorus DeLeon revealed a complete post-mating reproductive isolation between specimens collected from three geographic origins – Northeast Brazil (South America), Benin and Ghana (West Africa) – even though they are morphologically very similar. Here, we carried out a study to assess to what extent these populations exhibit genetic differences and whether endosymbionts are involved in the incompatibility. First, we used the mitochondrial cytochrome oxidase I (COI) gene to assess genetic diversity among geographic populations. Second, we used a PCR-based method to check for the presence of Wolbachia and/or Cardinium in these mites, and we determined their phylogenetic relationships using specific primers for Wolbachia and Cardinium 16S rDNA genes. Third, we conducted a test using an antibiotic (Tetracycline) in an attempt to eliminate the symbionts and to evaluate their effects on the reproductive compatibility of their host. Based on the DNA sequences of their COI genes, specimens of the three populations appear to be genetically virtually identical. However, the 16S rDNA genes sequences of their associated endosymbionts differed between the populations: the Benin and Brazil populations harbour different strains of Wolbachia symbionts, while the Ghana population harbours Cardinium symbionts. In response to antibiotic treatment females of each of the three populations became incompatible with untreated males of their own population, similar to that observed in crossings between females from one geographic population and males from another. We conclude that the three geographic populations of N. paspalivorus used in our study represent a single species composed of genetically isolated populations, and that their associated bacterial symbionts are likely to be the cause of the post-mating reproductive isolation previously observed among the three geographic populations. This insight is relevant to biological control of coconut mites for which N. paspalivorus is an effective predator, because introducing one geographic strain into the population of another (e.g., in field releases or mass cultures) may cause population growth depression.

Unpublished manuscript

n the two past decades, our knowledge of the endosymbiotic bacteria – Wolbachia and ICardinium – has considerably increased, as well as our understanding of reproductive abnormalities they cause in their hosts, thus opening avenues for new research (Duron

31 Nazer-chap3.qxd 14-9-2012 10:36 Page 32

CHAPTER 3

et al. 2008). Yet, little attention has been paid to the occurrence of these endosymbiotic bacteria in natural enemies widely used as biological control agents and the consequence this may have on the outcome of classical biological control operations. For example, releasing an incompatible strain in the habitat of another may have consequences for the outcome of the biological control (Stouthamer et al. 2000; Zindel et al. 2011). Predatory mites (Acari: Phytoseiidae) are widely used for biological control of plant-feeding mites. While there is a plethora of publications on the role of endosymbionts in plant-feeding mites (i.e., Breeuwer 1997; Vala et al. 2000; Gotoh et al. 2003, 2005a,b, 2007), very little is known about the presence and the role of endosymbionts in plant-inhabiting phytoseiid mites that represent their most important natural enemies (Enigl and Schausberger 2007; Wu and Hoy 2012). In this article, we focus on the predatory mite Neoseiulus paspalivorus DeLeon, a candidate enemy for biocontrol of the coconut mite, Aceria guerreronis Keifer, a key pest of coconut palms (Moraes et al. 2004; Lawson-Balagbo et al. 2008; Reis et al. 2008; Negloh et al. 2011). To better exploit the use of this phytoseiid mite as biological control agent studies were conducted to determine genetic diversity (cryptic species, biotypes and genotypes) among different populations (McMurtry 2010). Crossing experiments between populations from three geographic regions – Northeast Brazil (South America), Benin and Ghana (West Africa) – yielded no F1 offspring or of only a few sterile males and thus revealed a complete post- mating and bidirectional incompatibility (Famah Sourassou et al. 2011). It is well known that post-zygotic incompatibility can result from genetic incompatibility (Navajas et al. 1999; Uesugi et al. 2003; Gotoh et al. 2005b; Pryke and Griffith 2008; Koevoets and Beukeboom 2009), or from cytoplasmic incompatibilities due to intracellular bacteria such as Wolbachia and Cardinium (O’Neill and Karr 1990; Breeuwer 1997; Gotoh et al. 2007). These two bacterial symbionts infect a wide range of arthropods and are known to cause reproductive abnormalities in their host, including cytoplasmic incompatibility, feminization, parthenogenesis, hybrid breakdown and male killing (Rigaud et al. 1997; Hoffmann and Turelli 1997; Hurst et al. 1999; Vala et al. 2000; Charlat et al. 2001). Cytoplasmic incompatibility, the most common effect of Wolbachia and Cardinium infections, is a sterility phenomenon that has been described first in insects and mites (Wade and Stevens 1985; Hoffmann et al. 1997; Hoffmann and Turelli 1988; O’Neill 1989; Breeuwer and Werren 1990). Cytoplasmic incompatibility can be either unidirectional or bidirectional. In the former, crosses between populations are incompatible in one direction, but in the reciprocal cross mating is fully compatible, as are matings between infected (by the same strain) individuals. In contrast, bidirectional incompatibility usually occurs when the male and female carry different strains of Wolbachia (Laven 1959, 1967; Breeuwer and Werren 1990; Bordenstein et al. 2001, 2003; Telschow et al. 2005, 2007). Incompatibilities have been reported in crosses between populations of some phytoseiid species, but with unidirectional incompatibilities being

32 Nazer-chap3.qxd 14-9-2012 10:36 Page 33

Endosymbiont bacteria in Neoseiulus paspalivorus

most commonly observed (Hoy and Cave 1988; Johanowicz and Hoy 1998; Noronha and Moraes 2002, 2004; Wu and Hoy 2012). However, the role of endosymbionts in causing these incompatibilities is still unclear, except in one case (Metaseiulus occidentalis; Hoy and Cave 1988; Wu and Hoy 2012). In this article, our aim is to determine to what extent these populations exhibit genetic differences and whether endosymbionts are involved in the reproductive isolation between three geographic populations morphologically identified as N. paspalivorus (Famah Sourassou et al. 2011). First, we assessed genetic diversity between the three populations based on the variability in the mitochondrial cytochrome oxidase I (COI) gene. Second, we used the 16S ribosomal DNA primers to detect the presence of the endosymbiotic bacteria, Wolbachia and Cardinium, in the three populations and to analyse the phylogenetic relationships of these bacteria. Third, we performed an antibiotic test to determine whether each of these bacteria is associated with cytoplasmic incompatibility in the host.

Material and methods

Populations studied and laboratory rearing The three laboratory-reared populations – from Benin, Ghana and Brazil – used in the present study were the same as those used by Famah Sourassou et al. (2011). In addition, specimens collected from weeds in Benin were included in genetic analyses for comparative reasons. Details on the locality and date of collection, host plant and the number of colonizing females are listed in Table 3.1. The various populations were maintained in rearing units consisting of a black PVC tile (4 × 4 × 0.1 cm) placed on top of a foam pad (4 × 4 × 1 cm) resting in a Petri dish (14.5 cm diameter and 1 cm high). The edges of the tile (and part of the foam pad) were covered with a band of tissue paper. To prevent mites from escaping, distilled water was supplied to the Petri dish on a daily basis to keep the foam pad and the tissue paper wet. A small tuft of hydrophobic cotton wool covered by a piece of transparent plastic was placed in the center of each rearing unit to serve as a resting place and as an oviposition substrate for

Table 3.1 Collection localities, host plant and date of collection of four geographic populations of Neoseiulus paspalivorus. No. Country Locality Host plant Latitude Longitude Collection date colonizing females Benin Ouidah Cocos nucifera 06°21’66N 02°09’76E October 2005 52 Benin Ouidah Cyperus esculentus 06°21’66N 02°09’76E October 2010 - Ghana Winneba Cocos nucifera 05°22’90N 00°38’68W December 2008 11 Brazil Itamaraca Cocos nucifera 07°46’05N 34°52’08W September 2006 5

33 Nazer-chap3.qxd 14-9-2012 10:36 Page 34

CHAPTER 3

the predators. All colonies were maintained in a room at 25-27 ºC, 70-90% relative humidity and L12:D12 photoperiod. At three-day intervals the colonies were provided with a fresh supply of prey consisting of eggs of Tetranychus urticae Koch and inevitably also the immatures that emerge from them.

Genetic analysis Two or three adult females of each colony were used for molecular analysis. DNA was extracted using the Chelex method (Walsh et al. 1991). Mites were crushed using Precellys 24 (Brevet Bertin Technology, France) in a sterile tube containing 100 µl of 5% chelex solution and 4-5 sterile beads. Tubes were then vortexed, after which 5 µl of proteinase K (20 mg/ml) was added. Tubes were subsequently incubated at 56 °C for 1 h, heated at 95 °C for 8 min, and then briefly centrifuged and stored at -20 °C until later use. A fragment of the mitochondrial cytochrome oxidase subunit one (COI) was amplified and sequenced using primers specifically designed for tetranychid mites (5’- TGATTTTTTGGTCACCCAGAAG and 5’-TACAGCTCCTATAGATAAAAC; Navajas et al. 1996). The amplification reaction was carried out in a 25 µl reaction mixture containing 11.4 µl of sterile water, 2.5 µl 10X Super Taq Buffer (HT BioTechnology, Cambridge, UK), 5 µl dNTP mix (1 mM), 1.25 µl bovine serum albu-

min (10 mg/ml), 1.25 µl MgCl2 (25 mM), 0.2 µl of each primer (10 µM), 0.2 µl of Super Taq (5U/µL), and 3 µl of DNA template. The PCR amplification (PTC-200 thermal cycler, BioRad), was initiated with a 4-min incubation at 95 °C, followed by 35 cycles, each with 1 min at 94 °C, 1 min at 48 °C and 1 min at 72 °C, and then an extension for 4 min at 72 °C. PCR products were purified using the Invitek DNA extraction kit (Invitek, UK) and the sequence was determined by the ABI Prism Big Dye Terminator Sequencing method (Applied Biosystems, The Netherlands). Quality check of sequence chromatograms and construction of contigs were performed with BioEdit version 5.0.6 (Hall 1999). Sequences were aligned with ClustalW (as implemented in BioEdit), and a construction of the distance matrix and the Neighbour-Joining Tree (with 1000 boot- straps) using the Jukes-Cantor model (Jukes and Cantor 1969) was performed with MEGA® software version 5.

Screening for endosymbionts DNA was extracted from a pool of 8-10 adult females of each population using the same method as described above. A PCR-based approach was used to check for the presence/absence of the two symbionts in each population. For detection of Wolbachia and Cardinium, the 16S Wolbachia rDNA primers (76F–5’-TTGTAGCCTGCTATG- GTATAACT and 1012R– 5’-GAATAGGTATGATTTTCATGA; O’Neil et al. 1992), and the 16S Cardinium rDNA primers (CLO-f1–5’-GGAACCTTACCTGGGCTA- GAATGTATT and CLO-r–5’-GCCACTGTCTTCAAGCTCTACCAAC; Kurtti et al.

34 Nazer-chap3.qxd 14-9-2012 10:36 Page 35

Endosymbiont bacteria in Neoseiulus paspalivorus

1996) were used. Twenty-five µl PCR reactions were set up using 11.4 µl H2O, 1.25 µl MgCl2 (50 mM), 1.25 bovine serum albumin (10 mg/ml), 2.5 µl PCR buffer, 5 µl dNTPs mix (1 mM each), 0.2 µl each primer (20 µM each) (HT Bio Technology), 0.2 µl Taq

polymerase (5U/µL) and 3 µl of DNA extract. For Cardinium, neither MgCl2 nor bovine serum albumin was added. PCR amplification was carried out in a PTC-200 thermal cycler (BioRad). The thermal profile used for 16S Wolbachia was: 1 min at 94 °C, followed by 35 cycles each of 40 s at 94 °C, 30 s at 48 °C and 1 min at 72 °C, and 94 °C. For the Cardinium 16S rDNA (CLO-f/r), the thermal conditions were as follow: 2 min at 94 °C, followed by 34 cycles of 40 s at 94 °C, 30 s at 51 °C and 45 s at 72 °C, 5 min at 72 °C, and a final extension for 10 min at 10 °C. PCR products (2 µl) were visualized on 1% agarose gel stained with ethidium bromide in 0.5X TBE buffer (45 mM Tris base, 45 mM boric acid, and 1 mM EDTA pH 8.0). Eggs and immatures of T. urticae used as prey for rearing these populations in our laboratory, as well as all stages of A. guerreronis, the natural prey of the predatory mite under study, were also tested for the occurrence of endosymbionts. PCR products were purified using the Invitek DNA extraction kit (Invitek, UK) and sequenced along both strands by the ABI Prism Big Dye Terminator Sequencing method (Applied Biosystems, The Netherlands). Sequence alignment and construction of contigs were performed using the software BioEdit 5.0.6 with ClustalW.

Phylogenetic analysis of the 16S rDNA sequences A NCBI BLAST search on January 15, 2012 reported our 16S Wolbachia rDNA sequences to be most similar with the existing 16S Wolbachia rDNA sequences in the NCBI database. A high similarity score (98-100%) was observed with the first fifty displayed 16S Wolbachia rDNA sequences in the NCBI database. Representative Wolbachia 16S rDNA sequences were retrieved from the NCBI database. These sequences, in addition to the ones obtained in this study, were automatically aligned by the aid of ClustalW (Thompson et al. 1994), whereupon short entries were discarded resulting in a global alignment of approximately 695 base-pairs, consisting of 31 sequences retrieved from the GenBank and of the three sequences obtained in this study. This final data set of 34 sequences was used for phylogenetic analysis. A BLAST search for the Cardinium 16S rDNA sequence in the NBCI also showed a similarity score of 95-97% with the existing 16S Cardinium rDNA sequences. For the phylogenetic analysis of the 16S Cardinium rDNA sequence obtained in this study, the same procedure was used, and a global alignment of 395base-pairs was obtained, consisting of 27 sequences retrieved from the NBCI database and of the unique sequence obtained in the present study. Phylogenetic trees based on Maximum Likelihood (ML) method were constructed in MEGA5 using the Juke-Cantor evolution model with 1000 bootstrap replications.

35 Nazer-chap3.qxd 14-9-2012 10:36 Page 36

CHAPTER 3

Antibiotics test Presence of Wolbachia or Cardinium is no guarantee that they are the cause of reproductive isolation because some Wolbachia strains do not induce incompatibility in their host (Giordano et al. 1995; Navajas et al. 1999; Gotoh et al. 2005b). Our objective here was to determine whether the symbionts found are associated with cytoplasmic incompatibility of their host. Based on the common knowledge that incompatibility occurs between uninfected females and infected males, we performed a test in which tetracycline-treated females from each population were mated with untreated males of the same population. To obtain virgin females, gravid females were removed from the colony and confined in a rearing unit as described above. Twenty-four hours later, eggs laid were transferred each to a separate experimental unit and reared to adulthood on a diet consisting of all stages A. guerreronis. To administer tetracycline to females, new experimental units were placed on a cotton bed soaked with tetracycline solution (0.5% w/v in 10% glucose solution) in Petri dishes similar to the ones described above (10 discs per Petri dish). In addition, 3-5 droplets of the tetracycline solution were deposited on the PVC disk representing the experimental unit. The experimental units did not harbour any food source. In this way, each female was maintained on tetracycline for 24 hours, thereafter mated with untreated males taken from the same colony as that of the female. Female F1 progeny from this cross was used directly in crossing experiments of Benin and Ghana population. In case of the Brazilian population F1 females were treated once more with antibiotics and mated with males from the infected base population. Progeny from this cross were then used in the crossing experiments. Tetracycline-treated females were PCR-checked for the efficiency of the antibiotic treatment. To test whether compatibility can be restored in inter-population crosses, both males and females of each population were tetracycline-treated for three successive gen- erations using the same procedure as described above. Individuals that were produced after the last treatment were not treated and kept individually for one week before the crossing experiments. Inter-population crosses were set up as a single pair mating between tetracycline-lines of the Benin and Brazil populations. Each pair was observed daily and the number of eggs laid was recorded for a period of 10 days. Per cross all eggs produced from all mating pairs were pooled in a single arena.

Results

Genetic analysis We amplified approximately 500 base pairs of the COI gene from individuals from each of three N. paspalivorus populations. A 455-bp section was aligned and used for further analyses. Similar nucleotide composition was observed for all populations studied

36 Nazer-chap3.qxd 14-9-2012 10:36 Page 37

Endosymbiont bacteria in Neoseiulus paspalivorus

(30.7% Adenine, 43.5% Thymine, 14.3% Guanine, and 11.4% Cytosine). A BLAST search in the GenBank database showed that the sequences aligned with others COI sequences of Phytoseiidae. The three geographic populations tested varied between 0 and 0.2% nucleotide diversity.

Detection of endosymbionts The Benin and Brazil populations were PCR-positive for the 16S Wolbachia rDNA gene (Figure 3.1a), whereas the Ghana population was positive for the 16S Cardinium rDNA gene (Figure 3.1b). This suggests the presence of Wolbachia symbionts in both Benin and Brazil populations, and the presence of Cardinium symbionts in the Ghana population. However, the bands displayed in those populations were always weak compared with those of positive controls, Bryobia sp. (for Wolbachia) and Brevipalpus sp. (for Cardinium), for each of which a single mite was used to extract DNA. This could be due to low bacterial densities or inefficient PCR. Moreover, neither Wolbachia nor Cardinium was detected in the prey used for rearing those populations in the laboratory (eggs and immatures of T. urticae), as in their natural prey (all stages of A. guerreronis) collected from Ouidah, Benin. This rules out the possibility that positive PCRs in the predatory mites was due the presence of bacteria in their digestive tract.

Phylogenetic relationships of the 16S rDNA genes After alignment and trimming of approximately 1000 base pairs of the 16S Wolbachia rDNA and 500 base pairs of the Cardinium 16S rDNA gene, the final dataset contained 880 bp of the former gene and 450 bp of the latter gene. The nucleotide sequences of the 16S Wolbachia rDNA gene amplified from the two Beninese populations – from weeds and coconut fruits – were 100% identical. However, the nucleotide sequence of the 16S Wolbachia rDNA gene obtained from the Brazil population collected from coconut fruits differed by 4.5% from those nucleotides of the two Benin populations.

(a) Wolbachia 16S rDNA (b) Cardinium 16S rDNA (c)

1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 3 4 8

~1000 ~1000

~500 Figure 3.1 PCR assay for Wolbachia and Cardinium infections based on the sequence of the 16S rDNA. Lane L, ladder (>1000 bp in Figure 3.1a, 1000 bp in Figure 3.1b,c); 1, Benin (from coconut); 2, Benin (from weeds); 3, Ghana; 4, Brazil; 5, T. urticae eggs; 6, T. urticae immature stages; 7, A. guerreronis;8,Bryobia sp. (positive control for Wolbachia); 9, Brevipalpus sp. (positive control for Cardinium); 10, negative control (no DNA); (a) Wolbachia 16S rDNA; (b) Cardinium 16S rDNA; (c) Tetracycline-treated individuals from 1, 3 and 4 (8, positive control)

37 Nazer-chap3.qxd 14-9-2012 10:56 Page 38

CHAPTER 3

The phylogenetic tree based on the 16S Wolbachia sequences indicated that the symbionts identified in the Beninese and Brazil populations formed a monophyletic group with other 16S rDNA Wolbachia present in the GenBank. Moreover, there was a clear differentiation, with 100% bootstrap support, between the 16S Wolbachia rDNA sequences from the two Benin populations together, and that from the Brazil population (Figure 3.2).

Figure 3.2 Phylogenetic tree of 16S rDNA sequences of Wolbachia based on Maximum Likelihood procedure in MEGA5. Numbers on the nods indicate bootstrap values (%, values above 60 are displayed). Wolbachia strains are designated by their host names (in parentheses) and bear GenBank accession number. 1, Benin population collected from coconut; 2, Benin population collected from weeds; 3, Brazil population collected from coconut.

38 Nazer-chap3.qxd 14-9-2012 10:36 Page 39

Endosymbiont bacteria in Neoseiulus paspalivorus

The phylogenetic analysis of the 16S Cardinium rDNA clearly indicated that the symbiont detected in the Ghana population of N. paspalivorus was placed in the same group with other Cardinium symbionts present in the GenBank (Figure 3.3). The Cardinium in the Ghana population of N. paspalivorus seemed to be closely related to the Cardinium symbionts from other phytoseiid mites.

Figure 3.3 Phylogenetic tree of 16S rDNA sequences of Cardinium based on Maximum Likelihood procedure in MEGA5. Numbers on the nods indicate bootstrap values (%, values above 60 are displayed). Cardinium strains are designated by their host names (in parentheses) and bear GenBank accession number. Arrow indicates Cardinium sequence obtained in this study.

39 Nazer-chap3.qxd 14-9-2012 10:36 Page 40

CHAPTER 3

Cytoplasmic incompatibility Both the Benin and Brazil populations showed the typical pattern of unidirectional incompatibility: the cross between uninfected (treated) females and infected males produced no or very few offspring and all other possible cross combinations showed similar egg production, survival and sex ratios (Table 3.2). However, the incompatibility was expressed in different ways. In the Brazil population, incompatibility resulted in very low fecundity. Only one out of the 13 F2 females tested produced eggs; two eggs during the 10 days of observation. In the Benin population, on the other hand, the incompatible cross produced only slightly, but significant, fewer eggs, but none of these eggs hatched. Antibiotic treatment of infected females from the Ghana base population yielded very few offspring. Possibly the Cardinium is essential for host fitness (Bandi et al. 2001; Vavre et al. 2002; Pannebakker et al. 2007). We therefore decided to use all female offspring in the cross with infected males, which is the expected incompatible cross. This cross produced fewer eggs compared to the infected base population and all eggs shrivelled and failed to hatch (Table 3.2). Although not all possible cross combination could be made, it suggests that the infection in the Ghana population can also cause unidirectional incompatibility. In crossing experiments offspring were used from antibiotic treated mothers. It is possible that antibiotics may still have unwanted side effects on the fitness of the offspring. This was not the case since, crosses between uninfected females and males did not differ in egg production and hatchability of the eggs compared to the (IxI) crosses between infected individuals from the base population. A PCR check for Wolbachia and Cardinium confirmed that all uninfected females used in the crosses were symbiont-free. In addition, we carried out crosses between uninfected Brazil and Benin populations. Previous crossing experiments between mites from the Brazil and Benin populations did not produce any offspring (Famah Sourassou et al. 2011). At that time the presence of Wolbachia in these populations was not known. The crossing experiments between uninfected individuals of the two populations revealed a different pattern (Table 3.3). Crosses between uninfected Brazil females and Benin males were fully compatible producing on average 1.3 eggs per day with 96% egg hatching rate. The reciprocal cross between Benin females and Brazil males, however, did not differ from earlier crosses between infected individuals (Famah Sourassou et al. 2011); females produced on average 0.2 eggs per day and all eggs failed to hatch.

Discussion The main question addressed in the present study was whether the three reproductively isolated populations identified as N. paspalivorus – from Benin, Ghana and Brazil – represent a single species (Famah Sourassou et al. 2011). The key results of this study demonstrate that all three geographic populations of N. paspalivorus studied represent a

40 Nazer-chap3.qxd 18-9-2012 2:48 Page 41

Endosymbiont bacteria in Neoseiulus paspalivorus

Table 3.2 Cytoplasmic incompatibility patterns in intra-population crosses between uninfected (U) and infected (I) individuals of Neoseiulus paspalivorus. Note that all eggs per cross were pooled for egg hatch, survival and sex ratio measurements. Percentage survival is individual survival from hatching to adulthood. Sex ratio is the percentage female offspring. Not all cross combinations within the Ghana population were done because tetracycline-treated females produced very few offspring. Means ± SE followed by different letters are significantly different (SNK test, P<0.05). CROSS n % gravid Fecundity % egg % Sex ratio female × male females (eggs/female/day) hatchability survival (% females) BENIN I × I 10 100 1.4 ± 0.02 a 100 100 70 U × I 10 100 1.1 ± 0.08 b 0 0 - U × U 10 100 1.2 ± 0.09 b 100 100 52.4 I × U 8 100 0.9 ± 0.08 c 100 100 69.4 BRAZIL I × I 10 100 1.4 ± 0.09 a 100 100 70.8 U × I 13 95.4 0.2 ± 0.23 b 100 100 54 U × U 10 100 1.7 ± 0.31 a 100 100 58 I × U 10 10 1.6 ± 0.06 a 100 100 60 GHANA I × I 10 100 1.2 ± 0.07 a 100 100 69.1 U × I 10 100 0.7 ± 0.08 b 0 100 -

Table 3.3 Compatibility patterns of crosses between infected (I) and uninfected (U) individuals of the Benin (Be) and Brazil (Br) populations of Neoseiulus paspalivorus. For comparison, crosses between infected individuals from the base populations are shown, but were done in a previous study (Famah Sourassou et al. 2011). Means ± SE followed by different letters within column are significantly different (SNK test, P<0.05). Statistical testing only includes crosses from this study. CROSS n % gravid Fecundity % egg % Sex ratio female × male females (eggs/female/day) hatchability survival (% females) UBr × UBe 15 100 1.3 ± 0.12 a 96 100 78.8 UBe × UBr 16 100 0.2 ± 0.02 b 0 – – IBr × IBe 30 83 0.5 ± 0.03* 7.6 100 0 IBe × IBr 30 93 0.6 ± 0.05* 0 – – *Famah Sourassou et al. (2011)[email protected]

single species composed of at least three isolated populations, and that the post-mating reproductive isolation observed between these populations is most likely due to their associated endosymbiotic bacteria. The three populations are morphologically identical (Famah Sourassou et al. 2011) and the genetic dissimilarity between the three populations of based on the mitochondrial cytochrome oxidase I (COI) gene is low, less than 0.2%, and far less than intra-specific genetic distances reported in other mite species such as Kampimodromus species (1.4%) (Tixier et al. 2008) and Euseius sp. (0-5%) (Okassa et al. 2009). This suggests that

41 Nazer-chap3.qxd 14-9-2012 11:00 Page 42

CHAPTER 3

they belong to the same biological species N. paspalivorus. Nevertheless, crosses between these populations produced no offspring (Table 3.3; Famah Sourassou et al. 2011). Pre-zygotic isolation does not appear to explain the absence of offspring in crosses between these three populations of N. paspalivorus. The proportions of gravid females in inter-population matings were as high as the proportions gravid females in the intra-population matings (Table 3.3; Famah Sourassou et al. 2011). In pseudo- arrhenotokous mites, females only become gravid with eggs after copulation and suc- cessful sperm transfer (see Toyoshima et al. 2000). The presence of gravid females can thus be used as an indication that mating has taken place. Moreover, the two Benin populations of N. paspalivorus from weeds and coconuts had identical Wolbachia 16S rDNA sequences, whereas the Brazil population had a different sequence, as supported by 100% bootstrap value in the phylogenetic analyses (Figure 3.2). Thus the Benin and Brazil mite populations are infected with different Wolbachia strains. Both Wolbachia and Cardinium symbionts can cause unidirectional incompatibility in all three populations of N. paspalivorus (Table 3.2). Interestingly, the timing of incompatibility differs between these populations. In the Wolbachia infected Benin and Cardinium infected Ghana populations, incompatibility was expressed early in offspring development resulting in shrivelling of the eggs, whereas in the Wolbachia infected Brazil population, incompatibility resulted in very low fecundity (Table 3.2). Host-symbiont interactions can vary as a result of genetic differences of both host and symbiont (Bordenstein and Werren 2003). The Wolbachia infections in the Brazil and Benin populations are, at least based on 16S gene, different, but also the two mite populations appear to be genetically different, as reciprocal crosses between uninfected individuals from both populations did not yield offspring (Table 3.3). One possible mechanistic explanation for the difference in timing of the visibility of incompatibility is that Wolbachia concentrations in the Benin population are lower than in the Brazil population. As a result, incompatibility is less severe in incompatible crosses that involve males with the lower bacterial density (Breeuwer and Werren 1993; Engelstaedter et al. 2007). Regardless of whether Wolbachia concentrations actually differ, host-symbiont interactions can vary due to genetic differences between Wolbachia and/or hosts (see Engelstaedter and Hurst 2009). In addition, infected females tend to produce a more female biased sex ratio than uninfected females in compatible crosses. This was most evident in Wolbachia infected females. An increase in the proportion of male offspring was detected in crosses involving treated females. Female bias sex ratio shift is one of the common effects of Wolbachia infection (i.e., Breeuwer 1997; Rigaud et al. 1997; Kajeyama et al. 2002). From an evolutionary point of view, symbionts that are maternally transmitted are expected to bias sex ratios toward the transmitting – female – sex.

42 Nazer-chap3.qxd 14-9-2012 11:00 Page 43

Endosymbiont bacteria in Neoseiulus paspalivorus

Bidirectional incompatibility was observed in reciprocal crosses between mites from the Benin and Brazil populations that are both infected with Wolbachia. Bidi- rectional reproductive incompatibility often occurs in crosses between populations har- boring different Wolbachia strains. Our finding of different bacterial symbionts in the three populations is consistent with this hypothesis. Compatibility was restored in crossings between tetracycline-treated females of the Benin population and tetracycline-treated males of the Brazil population. However, incompatibility could not be restored in the reciprocal cross between tetracycline-treated males from Benin and tetracycline-treated females from Brazil. We have only screened for two symbionts in each population and we cannot rule out the possibility that another bacterium is involved (Duron et al. 2008; Enigl and Schausberger 2007). This needs further investigation. An alternative but not mutually exclusive explanation is that cyto-nuclear incompatibilities may exist between the Benin nuclear genome and the Brazil cytoplasm. Such cyto-nuclear incompatibilities have been reported between closely related species of the parasitoid wasp Nasonia (Breeuwer and Werren 1995; Koevoets et al. 2011), but also between populations of the spider mite Tetranychus quercivorus (Gotoh et al. 2005). We have only looked at three mite populations, and found that they are infected with two types of symbionts that have effects on sex ratio and incompatibility. It would be interesting to determine the infection patterns throughout the distribution range of N. paspalivorus and determine the nature of host-symbiont interactions. Although morphologically and genetically (based on COI) similar, geographic populations of the predatory mite N. paspalivorus have developed reproductive isolation (Famah Sourassou et al. 2011), which is associated with (and perhaps also due to) endosymbiotic bacteria found in them. Evidently, this isolation has not (yet) led to morphological differences (as far as they are used for taxonomic classification) and to genetic differences at the level of the mitochondria. It is yet to be investigated whether these populations differ in other traits that are relevant to biological control of coconut mites on palm trees. Another practical implication could be that introducing an incompatible strain from one geographic area into the habitat of another strain may initially create a depression in population growth due to failures in producing viable offspring. The same may occur when different strains are mixed up to initiate a mass rearing of the predatory mites. These are all good reasons to check for endosymbionts in biocontrol agents and carefully study their role in reproductive isolation between populations, as well as the genetic differentiation that is expected to arise from this.

Acknowledgements Many thanks go to M.G.C. Gondim Jr for supplying the specimens of N. paspalivorus from Brazil, and R. Houndafoche, P. Sovimi, C. Kededji and B. Bovis for their assistance in maintaining the predator colonies and conducting crossing experiments. This research was supported by the International Institute of Tropical Agriculture (IITA) and the University of Amsterdam, The

43 Nazer-chap3.qxd 14-9-2012 11:00 Page 44

CHAPTER 3

Netherlands, through a grant from the Board of the Netherlands Foundation for the Advancement of Tropical Research (WOTRO).

References Bandi C, Dunn AM, Hurst GD, Rigaud T (2001) Inherited microorganisms, sex-specific virulence and reproductive parasitism. Trends in Parasitology 17:88–94. Bordenstein SR (2003) Symbiosis and the origin of the species. In: Bourtzis K, Miller T, eds. Insect Symbiosis. CRC Press, Boca Raton, pp. 283–304. Bordenstein SR, O’Hara FP, Werren JH (2001) Wolbachia-induced bidirectional incompatibility precedes other hybrid incompatibility in Nasonia. Nature 409:707–710. Breeuwer JAJ, Werren JH (1993) Cytoplasmic incompatibility and bacterial density in Nasonia vitripennis. Genetics 135:565-574. Breeuwer JAJ, Werren JH (1995) Hybrid breakdown between two haplodiploid species: the role of nuclear and cytoplasmic genes. Evolution 49:705–717. Breeuwer JAJ (1997) Wolbachia and cytoplasmic incompatibility in the spider mite Tetranychus urticae and T. turkestani. Heredity 79:41–47. Breeuwer JAJ, Werren JH (1990) Microorganisms associated with chromosome destruction and reproductive isolation between two insect species. Nature 346:558–560. Charlat S, Bourtzis K, Mercot H (2001) Wolbachia-Induced cytoplasmic incompatibility. In Seckbach J (ed) Symbiosis: Mechanism and Model Systems. KAP, The Netherlands, pp. 621–644. Duron O, Bouchon D, Boutin S, Bellamy L, Zhou L, Engelstädter J, Hurst GD (2008) The diversity of reproductive parasites among arthropods: Wolbachia do not walk alone. BMC Biol 6: 27. Enigl M, Schausberger P (2007) Incidence of the endosymbionts, Wolbachia, Cardinium and Spiroplasma in phytoseiid mites and associated preys. Exp Appl Acarol 42:75–85. Engelstaedter J, Hurst GDD (2009) The ecology and evolution of microbes that manipulate host reproduction. Ann Rev Ecol Evol Syst 40:127-149. Engelstaedter J, Hammerstein P, Hurst GDD (2007) The evolution of endosymbiont density in doubly infected host species. J Evol Biol 20:685-695. Famah Sourassou N, Hanna R, Zannou I, Moraes GJ, Negloh K, Sabelis MW (2011) Morphological variation and reproductive incompatibility of three coconut-mite-associated populations of predatory mites identified as Neoseiulus paspalivorus (Acari: Phytoseiidae). Exp Appl Acarol 53:323–338. Giordano R, O’Neill LS, Robertson HM (1995) Wolbachia infections and the expression of cytoplasmic incompatibility in Drosophila sechellia and D. mauritiana. Genetics 140:1307–1317. Giordano R, Jackson JJ, Robertson HM (1997) The role of Wolbachia bacteria in reproductive incompatibilities and hybrid zones of Diabrotica beetles and Gryllus crickets. PNAS 94:11439–11444. Gotoh T, Noda H, Ito S (2007) Cardinium symbionts cause cytoplasmic incompatibility in spider mites. Heredity 98:13–20. Gotoh T, Noda H, Fujita T, Iwadate K, Higo Y, Saito S, Ohtsuka S (2005a) Wolbachia and nuclear- nuclear interactions contribute to reproductive incompatibility in the spider mite Panonychus mori (Acari: Tetranychidae). Heredity 94:237–246 Gotoh T, Oku H, Moriya K, Odawara M (2005b) Nucleus-cytoplasm interactions causing reproductive incompatibility between two populations of Tetranychus quercivorus Ehara & Gotoh (Acari: Tetranychidae). Heredity 74:105–114. Gotoh T, Noda H, Hong XY (2003) Wolbachia distribution and cytoplasmic incompatibility based on a survey of 42 spider mite species (Acari: Tetranychidae) in Japan. Heredity 91:208–216. Hall TA (1999) BioEdit. A user-friendly biological sequence editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41:95-98. Hoffmann AA, Turelli M (1997) Cytoplasmic incompatibility in insects. In: O’Neil SL, Hoffmann AA, Werren JH (eds) Influential Passengers: Inherited Microorganisms and Arthropod Reproduction. Oxford University Press, Oxford, pp 42–80.

44 Nazer-chap3.qxd 14-9-2012 11:00 Page 45

Endosymbiont bacteria in Neoseiulus paspalivorus

Hoffmann AA, Turelli M (1988) Unidirectional incompatibility in Drosophila simulans: inheritance, geographic variation and fitness effects. Genetics 119:435–444. Hoy MA, Cave FE (1988) Premating and post-mating isolation among populations of Metaseiulus occidentalis (Nesbitt) (Acarina: Phytoseiidae). Hilgardia 56:1–20. Hurst JDD, Jiggins FM, Schulenburg JH, Bertrand D, West SA, Goriceheva II, Zakharov IA, Werren JH, Stouthamer R, Majerus MEN (1999) Male killing Wolbachia in two species of insects. Proc R Soc Lond B 266:735–740. Johanowicz DL, Hoy MA (1998) Experimental induction and termination of non-reciprocal reproductive incompatibility in a parahaploid mite. Entomol Exp Appl 87:51–58. Jukes TH, Cantor CR (1969) Evolution of protein molecules. Pp. 21–132 In: Munro HN (Ed.) Mammalian Protein Metabolism. Academic Press, NY, USA. Kajeyama D, Nishimura G, Hoshizaki S, Ishikawa Y (2002) Feminizing Wolbachia in an insect, Ostrinia furnacalis (Lepidoptera: Crambidae). Heredity 88:444–449. Koevoets T, Niehuis O, van de Zande L, Beukeboom LW (2011) Hybrid incompatibilities in the parasitic wasp genus Nasonia. Heredity 108:302–311. Koevoets T, Beukeboom LW (2009) Genetics of postzygotic isolation and Haldane’s rule in haplodiploid. Heredity 102:16–23. Kurtti TJ, Munderloh UG, Andreadis TG, Magnarelli LA (1996) Tick cell culture isolation of an intracellular prokaryote from the tick Isodes scapularis. J Invert Path 6:7318–312. Laven H (1959) Speciation by cytoplasmic isolation in Culex strains. Evolution 5:370–375 Laven H (1967) Evolution and speciation in Culex pipientis. In Genetics of Insects Vectors of Disease. Eds JW Wright R Pal. Holland: Elsvier, pp 251–271. Lawson-Balagbo ML, Gondim MGC, Moraes GJ, Hanna R, Schausberger, P. (2008) Exploration of acarine fauna on coconut palm in Brazil with emphasis on Aceria guerreronis (Acari: Eriophyidae) and its natural enemies. Bull Entomol Res 98:83–96. McMurtry JA (2010) Concepts of classification of the Phytoseiidae: Relevance to biological control of mites. In: Trends in Acarology - Proceedings of the 12th International Congress, MW Sabelis, J Bruin (Eds), pp. 339–397. Springer, Dordrecht, The Netherlands. Moraes GJ, Lopez PC, Fernando LCP (2004) Phytoseiid mites (Acari: Phytoseiidae) of coconut growing areas in Sri Lanka, with description of three new species. J Acar Soc Jpn 13:141–160. Navajas M, Gutierrez J, Lagnel L, Fauvel G, Gotoh T (1999) DNA sequences and cross-breeding experiments in the hawthorn spider mite Amphitetranychus viennensis reveal high genetic differentiation between Japanese and French populations. Entomol Exp Appl 90:113–122. Navajas M, Gutierrez M, Langnel J (1996) Mitochondrial cytochrome oxidase I in tetranychid mites: a comparison between molecular phylogeny and change of morphological and life history traits. Bull Entomol Res 86:407–417. Negloh K, Hanna R, Schausberger P (2011) The coconut mite, Aceria guerreronis, in Benin and Tanzania: occurrence, damage and associated acarine fauna. Exp Appl Acarol 55:361–374. Noronha ACS, Moraes GJ (2004) Reproductive compatibility between mite populations previously identified as Euseius concordis (Acari: Phytoseiidae). Exp Appl Acarol 32:271–279. Noronha ACS, Moraes GJ (2002) Variaçãoes morfológicas intra e interpopulacionaes de Euseius citrifolius Denmark & Muma e Euseius concordis Chant (Acari, Phytoseiidae). Rev Bras Zool 19:1111–1122. O’Neill SL (1989) Cytoplasmic incompatibility in Tribolium confusum. J Invert Pathol 53:132–134. O’Neill SL, Karr TL (1990) Bidirectional incompatibility between conspecific populations of Drosophila simulans. Nature 348:178–180. Okassa M, Tixier M-S, Cheval B, Kreiter S (2009) Molecular and morphological evidence for new species status within the genus Euseius (Acari: Phytoseiidae). Can J Zool 87:689–698. Pannebakker BA, Loppin B, Elemans CPH, Humblot L, Vavre F (2007) Parasitic inhibition of cell death falicitates symbiosis. PNAS 104:213–215. Pryke SR, Griffith SC (2008) Postzygotic genetic incompatibility between sympatric color morphs. Evolution 637:93–798.

45 Nazer-chap3.qxd 14-9-2012 11:00 Page 46

CHAPTER 3

Reis AC, Gondim MGC, Moraes GJ, Hanna R, Schausberger P, Lawson-Balagbo ML, Barros R (2008) Population dynamics of Aceria guerreronis Keifer (Acari: Eriophyidae) and associated predators on coconut fruits in Northeastern Brazil. Neotrop Entomol 37:457–462. Rigaud T, Juchault P, Mocquard JP (1997) The evolution of sex determination in isopod crus- taceans. BioEssays 19:409–416. Stouthamer R, Jochemsen P, Platner GR, Pinto JD (2000) Crossing incompatibility between Trichogramma minutum and T. platneri (Hymenoptera: Trichogrammatidae): implications for applications in biological control. Environ Entomol 29:832–837. Stouthamer R, Breeuwer JAJ, Hurst GDD (1999) Wolbachia pipientis: microbial manipulator of arthropod reproduction. Ann Rev Microbiol 53:71–102. Telschow A, Hammerstein P, Werren JH (2005) The effects of Wolbachia versus genetic incompatibilities on reinforcement and speciation. Evolution 59:1607–1619. Telschow A, Flor M, Kobayashi Y, Hammerstein P, Werren JH (2007) Wolbachia-induced unidirectional cytoplasmic incompatibility and speciation: Mainland-Island Model. PLoS ONE 2(8):e701. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTALW: improving the sensitivity of pro- gressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22:4673–4680. Tixier M-S, Kreiter S, Croft BA, Cheval B (2008) Kampimodromus aberrans (Acari: Phytoseiidae) from the USA: morphological and molecular assessment of its density. Bull Entomol Res 98:125–134. Toyoshima S, Nakamura M, Nagahama Y, Amano H (2000) Process of egg formation in the female body cavity and fertilization in male eggs of Phytoseiulus persimilis (Acari: Phytoseiidae). Exp Appl Acarol 24:441–451. Uesugi R, Goka K, Osakabe M (2003) Development of genetic differentiation and postzygotic isolation in experimental metapopulations of spider mites. Exp Appl Acarol 31:161–176. Vala F, Breeuwer JAJ, Sabelis MW (2000) Wolbachia-induced ‘hybrid breakdown’ in the two-spotted spider mite Tetranychus urticae Koch. Proc R Soc Lond B 267:1931–1937. Vavre F, Fleury F, Varaldi J, Fouillet P, Boulétreau M (2002) Infection polymorphism and cytoplasmic incompatibility in Hymenoptera-Wolbachia associations. Heredity 88:361–365. Wade MJ, Steven L (1985) Microorganism-mediated reproductive incompatibility in four beetles (Genus Tribolium). Science 227:527–528. Walsh PS, Metzger DA, Higuchi R (1991) Chelex 100 as medium for simple extraction of DNA for PCR-based typing for forensic material. Biotechniques 10:506–13. Werren JH (1998) Wolbachia and speciation. In: Howard D, Berlocher S, eds. Endless Forms: Species and Speciation. Oxford University Press, pp 245–260. Wu K, Hoy, MA (2012) Cardinium is associated with reproductive incompatibility in the predatory mite Metaseiulus occidentalis (Acari: Phytoseiidae). J Invert Path 110:359–365. Zindel R, Gottlieb Y, Aebi A (2011) Arthropod symbioses: a neglected parameter in pest- and disease-control programmes. J Appl Ecol 48:864–872.

46 Nazer-chap4.qxd 14-9-2012 10:36 Page 47 4 Morphological, molecular and cross-breeding analysis of geographic populations of coconut- mite associated predatory mites identified as Neoseiulus baraki: evidence for cryptic species?

ABSTRACT – Surveys were conducted in Brazil, Benin and Tanzania to collect predatory mites as candidates for control of the coconut mite Aceria guerreronis Keifer, a serious pest of coconut fruits. At all locations surveyed, one of the most dominant predators on infested coconut fruits was identified as Neoseiulus baraki Athias-Henriot, based on morphological similarity with regard to taxonomically relevant characters. However, scrutiny of our own and published descriptions suggests that consistent morphological differences may exist between the Benin population and those from the other geographic origins. In this study, we combined three methods to assess whether these populations belong to one species or a few distinct, yet closely related species. First, multivariate analysis of 32 morphological characters showed that the Benin population differed from the other three populations. Second, DNA sequence analysis based on the mitochondrial cytochrome oxidase subunit I (COI) showed the same difference between these populations. Third, cross-breeding between populations was unsuccessful in all combinations. These data provide evidence for the existence of cryptic species. Subsequent morphological research showed that the Benin population can be distinguished from the others by a new character (not included in the multivariate analysis), viz. the number of teeth on the fixed digit of the female chelicera.

Experimental and Applied Acarology (2012) 57: 15–26

ites of the family Phytoseiidae are important predators of phytophagous mites in Magricultural crops worldwide (McMurtry et al. 1970; Helle and Sabelis 1985; Lindquist et al. 1996; Sabelis and Van Rijn 1997; McMurtry and Croft 1997; Gerson et al. 2003). Conventionally, morphological characters such as body size, length of dorsal setae, leg chaetotaxy, shape and size of spermatheca, cheliceral length and dentition have been used to describe species in this family (see Chant and McMurtry 1994, 2006, 2007, 2009; Tixier et al. 2008). However, since the set of morphological characters is limited, there may still be variation expressed at the genetic, physiological and behavioural level that may justify splitting into more species. Such cryptic species or species complexes have been shown to exist in the Phytoseiidae (Muma and Denmark 1969; Rosen 1978; McMurtry et al. 1985; Monetti and Croft 1997; Tixier et al. 2003, 2004, 2006a, 2008a),

47 Nazer-chap4.qxd 14-9-2012 10:36 Page 48

CHAPTER 4

and also in other mite taxa (Krantz and Mellot 1972; Cicolani et al. 1981; Cicolani and Di Sabatino 1991; Bernini et al. 1991; Athias-Binche et al. 1993; Klimov et al. 2004). Hence, molecular and other tools may be helpful for taxonomic identification (Tixier et al. 2009). These techniques have allowed researchers to look beyond morphological similarities by searching for genetic and other differences to answer taxonomic questions (Navajas et al. 1996, 1998; Hinomoto et al. 2001, 2007; Jeyaprakash and Hoy 2002; Noronha et al. 2003; Ramadan et al. 2004; Klimov et al. 2004; Tixier et al. 2006a, 2010; Okassa et al. 2009, 2010, 2011; Kanouh et al. 2010; Ros and Breeuwer 2010). Here, we address the question whether predatory mites collected from different geographic localities and previously identified as Neoseiulus baraki Athias-Henriot represent more than one closely related species. These predatory mites are considered to be potential candidates for biological control of the coconut mite Aceria guerreronis Keifer, a serious pest of the coconut palm (Cocos nucifera L.) in Africa, Americas and part of Asia (Moore 2000). Whether differences between populations or cryptic species are relevant to achieve improvements in biological control remains to be seen, but to assess its relevance accurate identification is required (Moraes 1987). How to define and identify species has been a long-standing debate. The most accepted definition, the biological concept (Mayr 1940), defines a species as a group of organisms capable of interbreeding and producing fertile offspring of both sexes and separated from other such groups with which interbreeding does not normally happen (Mayr 1940; see also Mallet 1995). In surveys conducted in coconut production areas in Brazil, Benin, Tanzania, and Sri Lanka, populations of predatory mites on Aceria-infested coconut fruits were sampled and most of the individuals were assigned to N. baraki based on their morphological similarity (Moraes et al. 2004; Lawson-Balagbo et al. 2008; Reis et al. 2008; Negloh et al. 2011). However, scrutiny of the morphological descriptions published by Moraes et al. (2004) for a Sri Lanka population on coconut and by Zannou et al. (2006) for populations sampled from weeds in Africa, and observed by one of us (NFS) for Benin and Brazil populations from infested coconuts, revealed morphological differences between the Beninese specimens from coconuts or weeds and those from coconuts at other geographic localities. For instance, the Sri Lankan (as well as the Brazilian; NFS pers obs) specimens had 10-11 teeth on their fixed cheliceral digits (Moraes et al. 2004), whereas Beninese specimens from weeds and coconuts had 7-8 teeth (Zannou et al. 2006; NFS, pers obs). Moreover, demography and diet breadth of the Benin and Brazil populations differed (Negloh et al. 2008; Tixier et al. 2010; Zannou and Hanna 2011). Hence, we carried out a multidisciplinary approach to clarify the taxonomic status of these populations by using three methods. First, we used a morphometric approach using multivariate analysis, a method applied successfully to solve taxonomic problems in mites (Boyce et al. 1990; Tixier al. 2003, 2004, 2006b, 2008a,b; Akimov et al. 2003; Klimov et al. 2004; Navia et al. 2009; Vidovic et al. 2010; Okassa et al. 2010). Second, we sequenced part of

48 Nazer-chap4.qxd 14-9-2012 10:36 Page 49

Is Neoseiulus baraki a cryptic species?

Table 4.1 Collection localities of the specimens of predatory mites identified as Neoseiulus baraki studied. Country Locality District/Province/State Latitude Longitude Benin (West Africa) Gbehoue Department of Atlantique 06°21’S 01°55’E Tanzania (Eastern Africa) Nachenjele District of Mtwara 10°26’S 40°08’E Tanzania (Eastern Africa) Singino District of Kilwa Masoko 08°78’S 39°41’E Brazil (South America) Itamaraca State of Pernambuco 07°46’S 34°52’W

the mitochondrial cytochrome oxidase subunit I (COI), as widely used for phylogenetic studies of Phytoseiidae and Tetranychidae (Navajas et al. 1996, 1998; Toda et al. 2000; Hinomoto et al. 2001, 2007; Navajas and Boursot 2003; Ramadan et al. 2004; Klimov et al. 2004; Tixier et al. 2006a,b; Ros and Breeuwer 2010; Yang et al. 2010). Third, we conducted cross-breeding experiments to assess the degree of reproductive isolation between the populations under study.

Material and methods

Populations under study and laboratory propagation The origins of the specimens collected from infested coconut fruits in Brazil, Benin and Tanzania are described in Table 4.1. They were propagated in the laboratory using the method described in detail by Negloh et al. (2008; see also Famah Sourassou et al. 2011). The rearing unit consisted of a black PVC tile (4 × 4 × 0.1 cm) placed on top of a foam pad (4 × 4 × 1 cm) resting in a Petri dish (14.5 cm in diameter and 1 cm in height). The edges of the tile were covered with a band of tissue paper that also contacted the foam pad. To prevent mites from escaping, distilled water was supplied to the Petri dish on a daily basis to keep the foam pad and the tissue paper wet. A tuft of hydrophobic cotton wool covered by a piece of transparent plastic was placed in the center of each rearing unit to serve as oviposition substrate for the predators. All colonies were maintained in a room at 25-27 ºC, 70-90% relative humidity and a 12-12h light-dark cycle. At three- day intervals the colonies were provided with a fresh supply of prey consisting of immature stages of T. urticae. The lab-reared populations were maintained at least one year prior to the start of the experiments.

Morphological analysis A total of 30 adult females and 20 adult males of each colony were subject to morphometric analysis. Specimens were slide-mounted in Hoyer’s medium and examined with respect to 32 morphometric characters (see list of characters in Tables 4.2 and 4.3). In addition, the number of teeth on the movable and fixed cheliceral digits was assessed for all female specimens whose chelicerae were in an adequate position (lateral) to allow

49 Nazer-chap4.qxd 14-9-2012 10:36 Page 50

CHAPTER 4

visualization of the teeth (i.e., at least 10 individuals). Observation was also made on the ornamentation of the dorsal shield, and the shape of the spermatheca (if female) and the spermatodactyl (if male). Measurements and counts were done with a phase-contrast microscope at 40× or 100× magnification. Observations were made on the characters considered essential and sufficient for the description of phytoseiid species (Moraes et al. 2004; Zannou et al. 2006; Chant and McMurtry 2005, 2007; Tixier et al. 2008a,b). We followed the setal nomenclature of Lindquist and Evans (1965), as adapt- ed by Rowell et al. (1978) and Chant and Yoshida-Shaul (1991) for the phytoseiids. Unfortunately, we did not have specimens from Sri Lanka at our disposal, and therefore we relied on measurements given by Moraes et al. (2004). To enable comparison we also relied on measurements, given by Zannou et al. (2006) for the weed-associated specimens from Benin, and the measurements of the holotype (Athias-Henriot 1966). All measurements are given in micrometers. Morphological characters of males and females were analyzed separately. First, a one-way analysis of variance (Proc ANOVA) followed by Student-Newman-Keuls multiple range comparison tests (α = 0.05) was performed to test differences between populations for each of the 32 metric characters measured. Second, a discriminant analysis was conducted to evaluate how many individuals where correctly assigned into their original group. Third, a canonical discrimination analysis was performed to determine patterns of morphological variation and to identify morphological characters that contribute most to the morphological differentiation between populations. All statistical analyses were performed with SAS version 9.2 (SAS Institute 2005).

Crossing experiments Our preliminary investigations showed that the two Tanzania populations were reproductively compatible. Therefore, only one Tanzania population (Nachenjele) was included in the crossing experiments. For each of the three populations, experiments were started with a cohort of eggs, 1-day old since they were laid by 100 females on diet of T. urticae eggs in rearing units as described above. To rear them to adulthood, these predator eggs were transferred each separately to an experimental unit consisting of 2.5 cm diameter black PVC disk and provided with all stages of A. guerreronis as prey. When adult, each predator was sexed and kept on their experimental unit until it was used for crossing experiments. Intra- and inter-population crosses were set up as single pair matings between virgin females and males in experimental units similar to those described previously. All crosses were conducted simultaneously and under the same laboratory conditions as where the parental colonies were maintained. Additionally, 10 virgin females of each population were kept in isolation, to ascertain that mating is necessary for oviposition (Nguyen and Amano 2010). Ten experimental units from the same cross experiment were put togeth-

50 Nazer-chap4.qxd 14-9-2012 10:36 Page 51

Is Neoseiulus baraki a cryptic species?

er into one Petri dish (13.5 cm diameter and 1.7 cm high) filled with water-saturated cotton to prevent mites from escaping. Each pair was observed daily and the number of eggs laid was recorded for a period of 10 days. Eggs laid in arenas with the same combination of geographic origins for male and female were pooled in a rearing unit similar to that previously described (8.5 cm in diameter and 1.5 cm in height), and reared to adulthood to determine egg viability, post-embryonic survivorship and sex-ratio. A single factor ANOVA and Student-Newman-Keuls multiple range test (SAS v. 9.2; SAS Institute 2005) were used to test the effect of crossing combination on fecundity.

Molecular analysis DNA was extracted using the Chelex method (Walsh et al. 1991). This method is simple, fast, cost-effective and appropriate for reducing contamination risks because the entire extraction procedure is performed in a single tube. Per laboratory culture, 2-3 individuals were used for molecular analysis. Single female mites were crushed (using Precellys 24, Brevet Bertin Technology, France) in a sterile tube containing 100µl of 5% chelex solution and 4-5 sterile beads. Tubes were then vortexed, after which 5µl of proteinase K (20 mg/ml) was supplied and centrifuged briefly. Tubes were subsequently incubated at 56 °C for 1 h, and then heated at 95 °C for 8 min. Tubes were briefly centrifuged and stored at -20 °C until later use. A fragment of the mitochondrial cytochrome oxidase subunit one (COI) was PCR- amplified and sequenced. The COI primers used were those of Navajas et al. (1996), specifically designed for tetranychid mites (5’-TGATTTTTTGGTCACCCAGAAG and 5’-TACAGCTCCTATAGATAAAAC). The amplification reaction was carried out in a 25 µl reaction mixture containing 9 µl of sterile water, 2.5 µl 10X Super Taq Buffer (HT BioTechnology, Cambridge, UK), 5 µl dNTP mix (1 mM), 1.25 µl bovine serum albu-

min (10mg/ml), 1.25 µl MgCl2 (25 mM), 0.4 µl of each primer (10 µM), 0.2 µl of Super Taq (5U/µL), and 5 µl of DNA template. The PCR amplification was performed in a PTC-200 thermal cycler (BioRad) programmed as follow: 4 min at 95 °C, 35 cycles – 1 min at 94 °C, 1 min at 48 °C, and 1 min at 72 °C –, and 4 min at 72 °C. PCR products were purified using the Invitek DNA extraction kit (Invitek, UK). Both strands of the purified DNA were sequenced with the same COI primers as used in the PCR amplification, using the ABI Prism Big Dye Terminator cycling Sequencing Kit (Applied Biosystems, Nieuwerkerk a/d IJssel, The Netherlands). Sequence products were resolved on an ABI 3700 DNA sequencer. Quality checks of sequence chromatograms and construction of contigs were performed with BioEdit version 5.0.6 (Hall 1999). The forward and reverse sequences were pairwise aligned and checked manually to determine the consensus sequence. All four consensus sequences were aligned using ClustalW multiple alignment (Thompson et al. 1994). Each of the four consensus sequences was checked for the stop codons using the

51 Nazer-chap4.qxd 14-9-2012 10:36 Page 52

CHAPTER 4

invertebrate mitochondrial code (tansl_table=5; Elzanowski and Ostell 2010). The aligned sequences were used to construct a distance matrix using the Jukes-Cantor model (Jukes and Cantor 1969) (Transition/Transversion rate ~ 1) in MEGA® software v. 5.

Results

Morphological analysis With respect to females, significant differences were observed between the four populations for most of the characters measured (P<0.05; Table 4.2), with the exception of the lengths of setae z2 and Z5 and the size (length, width) of the spermathecal calyx. With respect to males, also small differences were found between the four populations (P<0.05; Table 4.3), but not for the lengths of setae j4, j5, z5, Z1, R1 and the foot and shaft length of the spermatodactyl (Table 4.3). However, for both sexes, the differences were small, and the measurements of most characters analyzed did overlap. According to discriminant analysis, 92.5% of the female specimens and 78.7% of the male specimens of the four populations together were assigned to the population of their origin (Table 4.4). The specimens from Benin were most well-defined because no individuals from either of the two sexes were misclassified, followed by those from Brazil with only one misclassified female and no misclassified male. For Tanzania populations, there were 13.3% misclassifications in females, and 40-45% misclassifications in males. However, these misclassified specimens from the Brazil and the two Tanzania populations were never assigned to the Benin population, but to the Brazil or Tanzania population. The results from the discriminant analysis with respect to data on females yielded a complete separation of two groups (Figure 4.1a), one corresponding to the Benin population, and the other group formed by the remaining populations. With respect to male specimens, the polygons for the Benin population, the two Tanzania populations together and the Brazil population were all non-overlapping (Figure 4.1b). For both sexes, the Benin population and the Brazil population were the most distant. The length of the dorsal shield, the lengths of setae j1, R1, j3, Z4, S4, S5, and the length of chelicerae contributed the most to the morphological differentiation between female specimens. In males, the most important characters in differentiating specimens were the lengths of setae j1, j3, Z4, S5, STIV, the length and width of the dorsal shield and the posterior width of the ventrianal shield. All in all, we conclude that – besides having most of their setae relatively shorter – female specimens from the Benin population differed from those of the other three populations mainly by having 2-3 teeth less on their fixed digit. However, no morphological discontinuity could be detected between populations from Tanzania and Brazil.

52 Nazer-chap4.qxd 14-9-2012 10:36 Page 53

Is Neoseiulus baraki a cryptic species? n a = 0.05) α from four geographic origins. in micrometers. All measurements are given Neoseiulus baraki 2222 Gbehoue (Benin)Mean SE Min–Max (Tanzania) Nachenjele Mean SE Singino (Tanzania) Min–Max Mean SE Itamaraca (Brazil) Min–Max Mean SE P Min–Max ( Mean, standard error and range of of measured and the number 32 morphometric characters digits recorded teeth on the cheliceral Dorsal shield lengthDorsal shield width 361.3 b 0.93j1 159.1 c 352–370 0.38j3 360.1 b 155–167j4 0.78j5 161.8 b 351–367 0.50j6 361.8 b 158–165 0.87J2 161.4 b 348–368J5 0.52z2 373.9 a 158–168 0.51z4 10.0 c 167.3 a 367–377 0.21 0.46z5 12.8 c 0.26 162–171 0.0001 Z1 9–12 9.2 b 0.17Z4 0.0001 9–15 9.8 ab0.18Z5 11.3 b 12.7 b 0.29 7–10 0.32s4 10.7 b 9–12 0.28 15.9 b 0.39S2 9–12 9.8 b 9–15 0.17S4 9–12 13–19 9.3 b 9.6 a 0.14 0.18 9.2 b 11.7 bS5 0.17 0.27 11.9 ab0.24 9–12 13.1 br3 0.20 11.1 b 8.0 b 16.5 ab0.29 6–9 6–12 0.29 12.1 a 0.29 10–13R1 6–10 9–12 0.26 12–15 18.7 c 10.3 b 13–19St IV 10–13 0.26 0.17 6–9 75.2 a 10.0 a 12.3 aST1-ST3 9–15 0.45 0.21 13.5 a 0.23 9.6 a 10–13 15–19 9.4 c 13.9 a 0.26 0.10 17.2 aST2-ST2 14.2 c 0.10 0.28 12.1 a 0.29 0.29 69–79 0.30 15.0 cST5-ST5 9–12 13–16 11.3 a 9–15 0.30 8.3 b 12–16 0.32 10.2 b 9–12 22.3 b 15–19 12–15 6–10 0.28 20.4 cVSW-ANT 0.24 0.28 0.29 75.7 a 9–15 12–19 19.4 b 0.43VSW-POST 10.1 a 13.4 a 0.20 12.7 a 0.0001 9–15 19–25 0.0001 0.23 0.36 6–9 19–22 0.30 10.0 a 9–12 15.4 bVent. 10.2 a 13.1 c Shield length 0.21 70–79 0.20 0.24 0.20 11.4 ab0.28 19–22 83.4 b 12.8 b 16.4 b 32.7 d digit lengthFixed 0.38 10–16 0.14 10–15 0.30 0.48 9–12 11.3 a 23.2 a 53.8 b 13–16 26.8 b 12–15 116.5 b 12.1 a digit lengthMovable 0.36 0.38 0.23 9–13 0.29 9–13 0.47 0.21 9–13 79–89 75.8 a 12–15 13–19 9.6 a 28–38 59.1 c 25.5 a 96.7 c 0.47Length of 0.0034 0.10 0.44 13.4 a 111–120 0.36 0.30 calyx 10–15 19–28 51–57 81.2 c 10.3 a 27.5 c 25–28 21.9 c 0.32 15.9 b 0.0025 0.83Diameter of 15.7 b 0.26 0.26 0.0004 0.14 9–13 0.28 0.0096 73–79 calyx 0.32 117.2 b 54–63 84.2 b 92–101 22–28 16.4 a 15.9 b 38.5 c 0.41 0.42 9–12No. 10–15 0.35 0.26 digit teeth on fixed 0.37 63–89 53.2 b 25–28 19–22 12.2 a 22.7 ab0.21 13–19 0.35 25.8 a 12–19 9–13 114–120 101.0 b 0.25 0.0001 7-8 0.30 0.39 79–89 76.1 a 13–19 13–19 35–41 61.5 b 25.7 a 0.0001 0.31 22–25 9.8 a 0.39 10.1 a 51–57 115.1 b 3.8 a 0.33 10–15 85.9 a 0.17 0.37 30.1 b 0.23 23.5 b 22–28 0.14 0.23 98–105 17.2 a 15.9 b 0.29 0.46 0.36 0.32 73–79 0.23 57–66 84.4 b 111–120 22–28 17.5 a 16.3 a 36.6 b 0.0001 0.38 100.7 b 0.29 0.30 0.54 0.038 53.3 b 28–32 9–12 82–92 0.60 9–13 22–28 3–6 0.34 13–19 13–19 27.1 a 122.0 a 0.57 82–88 0.29 0.54 15–19 13–19 32–41 60.8 b 95–104 25.6 a 0.38 51–57 0.0001 117–127 0.30 30.6 b 84.2 b 0.0001 25.8 a 25–29 17.1 a 0.27 0.47 9.9 a 0.36 103.9 a 0.32 57–66 0.20 0.0001 87.1 a 3.7 a 0.36 0.0001 22–28 16.4 a 40.1 a 0.29 0.20 55.8 a 0.26 0.27 28–32 79–89 22–28 0.0001 101–108 0.32 13–19 9–12 85–89 10-11 63.7 a 0.35 0.0001 13–19 38–42 3–6 0.0001 54–60 32.1 c 87.2 a 0.0001 25.1 a 0.29 0.49 0.30 0.0001 60–66 10.0 a 0.0001 0.0001 0.21 0.0001 28–35 82–92 22–28 3.5 a 0.0001 0.17 9–12 0.0001 0.0001 0.0001 3–6 10.0 a 0.21 10-11 9–12 3.7 a 0.21 0.87 3–6 0.76 10-11 Table 4.2 Table on females specimens identified as No. teeth on mov. digit VSW-ANT, width of of shield at the level the ventrianal ZV2; with different letters are significantly (SNK,row VSW-POST, width of P<0.05) of shield at the level the ventrianal anus; means withi

53 Nazer-chap4.qxd 14-9-2012 10:36 Page 54

CHAPTER 4 n a Sri Lanka*Mean Min–Max Mean Benin-Burundi-Kenya** Min–Max Holotype (Athias-Henriot 1966) Continued. Dorsal shield lengthDorsal shield widthj1j3 350j4 160 330–375j5 146–175j6J2J5 353z2 157 336–365z4z5 142–168 14Z1 17Z4 13–16 11Z5 13–19 11s4 337 13S2 9–12 150 12 10–18S4 11 11–15S5 15 11 10–13r3 15 14 10–13R1 13–19 10–13 10St IV 9 12 13–18 10 10–15ST1-ST3 21 11ST2-ST2 9–15 13 11–14 69 8–10 8–11ST5-ST5 10 19–25 16 8–14VSW-ANT 11 11–14 60–73 15VSW-POST 13 13 25 14–17 8–11VSL 15 14–16 25 6–16 digit lengthFixed 13 9 11–16 23–27 15 digit lengthMovable 18 83 13 38 21–28 11 Length of 11 11–16 61 calyx 51 8–10 13–16Diameter of 13 11–24 calyx 78–87 58 14 12–15 13 87 31–42No. 53–67 83 digit teeth on fixed 29 16 31 49– 53 11 20 10-11 55–60 13–18 71–118 10 73–95 27–31 11–24 25 30–33 13 10 16–29 15 112 2 80 12 13 34 19–30 54 10 20 11–18 88–120 9–11 87 75–85 59 11–14 77 29–40 2–3 51–59 86 21 25 15 82–93 56–62 15 77–99 21–22 25–36 117 20 12 20 7 107–125 16 3 80 10 35 11–12 52 92 56 3–3 87 – – 112 10 2 – Table 4.2 Table No. teeth on mov. digit*Specimens from Sri Lanka on coconut, from Moraes et al. measurements taken (2004); **Specimens from Benin on weeds, measurements from Zannou et al.taken (2006) VSW-ANT, width of 2 of shield at the level the ventrianal ZV2; with different letters are significantly (SNK,row VSW-POST, width of P<0.05) of shield at the level the ventrianal anus; means withi 1 –

54 Nazer-chap4.qxd 14-9-2012 10:36 Page 55

Is Neoseiulus baraki a cryptic species? = 0.05) α from four nt (SNK, Neoseiulus baraki Gbehoue (Benin)Mean SE Min–Max (Tanzania) Nachenjele Mean SE Singino (Tanzania) Min–Max Mean SE Itamaraca (Brazil) Min–Max Mean SE P Min–Max ( Mean, standard error and range of measured on male specimens identified as 32 morphometric characters Dorsal shield lengthDorsal shield width 275.9 c 0.84j1 141.5 c 268–282 0.41j3 136–143j4 276.2 c 0.83j5 141.5 c 269–282 0.66j6 133–145 279.1 bJ2 1.01 145.2 bJ5 273–285 0.96z2 139–155 288.1 a 0.91z4 148.5 a 9.3 c 282–295 0.52z5 0.15 11.2 c 0.36 146–152Z1 0.0001 8.4 a 6–10Z4 0.34 0.0001 9–13 8.5 aZ5 0.33 9.2 b 6–9 10.6 b 0.21s4 0.41 9.0 b 13.4 b 6–9 0.25 0.55S2 9.0 a 6–10 0.25S4 9–15 10–15 8.5 b 6–9 0.33 9.3 a 10.1 cS5 0.15 0.29 6–10 9.0 a 10.4 ab0.33r3 11.1 b 0.25 6.8 a 13.8 b 6–9 0.36 10.3 a 0.47 0.25R1 6–10 9–12 0.38 10–13 9.9 a 15.5 cSt IV 6–10 0.25 10–16 0.50 8.4 ab0.34 9–13 6–9 56.2 bST1-ST3 7–13 0.60 11.4 ab0.35 10.3 a 10–13 8.7 b 10–19 8.4 a 0.31 0.31ST2-ST2 12.2 b 0.34 6–9 16.2 a 0.25 51–63 12.5 a 9.2 a 0.39 13.1 bST5-ST5 0.27 0.22 10.6 a 9–13 0.41 10.4 a 0.34 7.1 a 9–12 6–9 19.5 a 10–13 6–9 16.4 bVSW-ANT 0.33 0.31 13–19 0.25 0.29 58.3 a 10–16 9–16 0.62 6–10 16.0 bVSW-POST 7.6 b 12.3 a 0.27 9–13 10–13 0.35 19–25 15–19 0.39 6–9 15.4 b 0.0001 VSL 11.4 b 9.9 a 54–63 0.20 0.35 0.0001 0.25 9.5 a 15–19 69.1 b 11.8 a 14.2 a 8.5 a 26.4 d digit lengthFixed 0.37 10–15 0.22 6–9 0.31 0.36 0.34 0.33 9.0 a 10.7 a 13–16 19.3 a 40.7 b 20.3 a 0.25 digit length 9.6 ab0.15Movable 0.35 0.25 0.39 9–13 0.29 59.7 a 122.8 b 66–72 9–12 13–16 25–28 32.9 b 0.91 19.6 a 0.47 7.4 a 6–12Spermatodactyl_FL 0.35 9–13 6–9 10.6 bc0.34 0.29 0.34 38– 41 79.2 c 16–22 18.2 b 13.1 c 19–22 6–10 114–130 14.2 b 9–12 9–12 0.82 0.31 0.25 0.36 9.3 a 57–63 0.012 12.5 a 32–35 69.8 b 19–22 0.15 14.6 a 31.7 b 0.27 0.36 121.1 b 9–13 41.0 b 6–9 0.45 12.6 a 0.35 73–85 16–19 8.8 a 0.33 1.06 0.36 9.8 a 12–16 0.64 13–16 0.019 17.9 b 0.32 20.6 a 0.17 0.21 0.52 0.36 66–72 59.6 a 111–133 9.9 a 6–9 28–35 34.7 a 13–16 9–15 19.9 a 0.49 104.9 b 0.34 38–44 0.0001 0.53 0.85 0.33 13–22 79.5 c 18.7 ab0.31 9–15 123.9 b 14.7 b 19–22 6–12 13.6 a 9–12 0.82 0.85 0.41 7.7 a 0.33 57–63 32–38 69.7 b 0.36 98–111 19–22 9–12 29.8 c 0.0003 15.2 a 12.5 a 0.32 16–22 117–130 41.5 b 0.62 0.37 0.27 0.0001 67–85 0.31 12–19 13–16 12.3 a 0.0040 19.9 a 103.3 b 0.0001 0.31 9.2 a 66–73 0.46 126.6 a 0.62 6–9 0.42 25–35 33.1 b 13–19 0.21 0.96 38–44 19.3 a 0.36 19.8 a 9–13 0.21 0.0002 85.1 b 0.38 16.1 a 16–22 98–108 120–133 0.98 9–13 0.39 32–35 72.1 a 0.0025 6–10 19–22 0.20 34.5 a 0.31 16–22 43.2 a 104.1 b 0.0011 0.45 12.9 a 79–95 0.47 0.34 13–19 0.0001 0.31 12.8 a 70–73 101–108 35.8 a 0.0001 0.16 32–38 0.33 41–44 19.8 a 8.8 a 88.7 a 0.31 9–15 15.7 a 0.29 109.8 a 0.51 12–15 0.15 0.53 0.0001 34–38 0.0001 0.0001 19–22 104–114 85–91 0.0045 6–9 13–16 0.10 0.0001 0.0001 0.0014 0.0001 0.0001 9.6 a 0.15 9–12 0.14 geographic origins. in micrometers. All measurements are given Table 4.3 Table Spermatodactyl_SLFL; foot length; SL; shaft length; VSL,P<0.05) shield length; ventrianal 3.3 a with different letters are significantly differe means within a row 0.15 3–6 3.8 a 0.29 3–6 3.4 a 0.21 3–6 3.7 a 0.21 3–6 0.43

55 Nazer-chap4.qxd 14-9-2012 10:36 Page 56

CHAPTER 4

Table 4.4 Classification based on discriminant analysis of 32 morphometric characters evaluated on female and male specimens identified as Neoseiulus baraki from four geographic origins. % well- Gbehoue Nachenjele Singino Itamaraca classified* FEMALES Gbehoue (Benin) 100 30000 Nachenjele (Tanzania) 86.67 0 26 4 0 Singino (Tanzania) 86.67 0 2 26 2 Itamaraca (Brazil) 96.67 0 0 1 29 Total 92.50 30 28 27 31 MALES Gbehoue (Benin) 100 20100 Nachenjele (Tanzania) 55 1 11 8 0 Singino (Tanzania) 60 0 7 12 1 Itamaraca (Brazil) 100 0 0 0 20 Total 78.75 21 18 20 21 *Percentage of individuals correctly classified in their original populations

Cross-breeding analysis Mating is a prerequisite for oviposition, because none of the virgin females (n = 10) from each of the three populations produced eggs. All single pair matings within populations produced offspring (Table 4.5). In contrast, in inter-population single pair matings, not all females produced eggs: the percentage of ovipositing females ranged between 6 and 100%. Significant differences were observed in fecundity between differ-

ent combinations of females and males (F8,109 = 56.7; P<0.0001). The average total number of eggs produced per female in inter-population crosses ranged between 0.06 and 4.4 eggs per female over the 10-day observation period, compared with the range of 9.4 to 11.8 eggs per female recorded in the intra-population crosses. All eggs produced in the intra-population crosses were viable and gave rise to 59-74% female progeny. In contrast, eggs produced in inter-population crosses were not viable: all of these eggs shriveled and did not hatch, except in crosses between females of the Brazil population and males from the Benin population, where the four normal eggs laid gave rise only to males of which three died just after reaching the adult stage and only one survived much longer (Table 4.5). Back-crosses could not be performed because F1 progeny was not produced.

Molecular comparisons The length of the amplified COI gene was approximately 480 bp. No differences were found between forward and reverse sequences of the same amplicon. A final sequence length of 444 bp was used for further analysis (Figure 4.2). Neither stop codons nor indels were found in any of the sequences examined, indicating the absence of nuclear

56 Nazer-chap4.qxd 14-9-2012 10:36 Page 57

Is Neoseiulus baraki a cryptic species?

Table 4.5 Oviposition and offspring viability of crossings involving males and females of three geographic populations identified as Neoseiulus barakai. CROSS n % No. % % Immature % Female × Male ovipositing eggs/ shriveled egg survivorship female females female eggs hatchability offspring INTRA-POPULATION CROSSES Brazil × Brazil 15 100 11.8 ± 0.84 a 0.0 100 100 69.0 Benin × Benin 15 100 11.7 ± 0.75 a 0.0 100 100 59.3 Tanzania × Tanzania 11 100 9.4 ± 1.41 b 0.0 100 100 74.4 INTER-POPULATION CROSSES Brazil × Benin 15 53.3 1.0 ± 0.30 d 73.3 25 100 0.0* Benin × Brazil 15 6.0 0.06 ± 0.06 d 100 0.0 – – Brazil × Tanzania 10 100 3.7 ± 0.39 c 100 0.0 – – Tanzania × Brazil 10 90.0 1.7 ± 0.36 d 100 0.0 – – Benin × Tanzania 10 70.0 4.4 ± 0.52 c 100 0.0 – – Tanzania × Benin 10 10.0 0.1 ± 0.11 d 100 0.0 – – *Few male progeny only; Means within a column with different letters are significantly different (SNK, P<0.05)

copies of mtDNA (Numts) in our sequences. Sequences were deposited in GenBank under the following accession numbers: N. baraki from Brazil: JQ609092, N. baraki from Tanzania: JQ609093, N. baraki from Benin: JQ609094. The aligned sequences were similar in nucleotide composition and A-T rich (26.8% Adenine, 43.9% Thymine). The BLAST search in Genbank and EMBL data bases showed that all COI sequences matched COI sequences of Phytoseiidae, with identity score ranging between 83-86%. The best score was obtained with Phytoseiulus persimilis Athias-Henriot (Accession Number GQ222414; Dermauw et al. 2010), followed by N. californicus (Accession Number AB500128; Hinomoto et al. 2010), and Euseius sp. (Accession numbers FJ404589; FJ404590; Okassa et al. 2009), and by Kampimodromus sp. (Accession numbers EF372604, EF372605; Tixier et al. 2008b). A genetic dissimilarity of 12.7-13% was found between the Benin population and those of Brazil and Tanzania, whereas the genetic dissimilarity between the populations of Brazil and Tanzania was 0-0.2% (Table 4.6).

Table 4.6 Pairwise nucleotide distance among specimens of predatory mites identified as Neoseiulus baraki from four geographic localities based upon 444 bp fragment of the COI. Gbehoue Nachenjele Singino Itamaraca Gbehoue (Benin) - Nachenjele (Tanzania) 0.1266 - Singino (Tanzania) 0.1297 0.0023 - Itamaraca (Brazil) 0.1266 0 0.0023 -

57 Nazer-chap4.qxd 14-9-2012 10:36 Page 58

CHAPTER 4

Discussion In this article on different geographic populations – from Brazil, Benin and Tanzania – of predatory mites previously identified as N. baraki, we present three lines of evidence that the Benin population should have a taxonomic status different from the other populations under study. Below we will discuss each of the three lines and we will argue that the Benin population is more close to the holotype and should be designated as N. baraki. If so, the other populations formerly designated as N. baraki should be re-assigned to a new species. Multivariate analyses of the 32 metric characters showed a clear separation between the Benin population on coconut and the other populations on coconut in Tanzania (this

High value of DSL (a)

High values of j1, STIV, j3, FCD, R1, Z4, S5, S4

Low values of S4, S5, Z4 (b)

High values of j3, j1, DSL, STIV

Figure 4.1 Canonical discrimination analysis of 32 morphometric characters measured on female (a) and male (b) populations of predatory mites identified as Neoseiulus baraki from four geographic origins: Polygons formed based on the projection of the individuals onto the canonical variables 1 and 2. The amount of variation explained by each of the two canonical variables is shown in parentheses. DSL, dorsal shield length; FCD, fixed cheliceral digit (length).

58 Nazer-chap4.qxd 14-9-2012 10:36 Page 59

Is Neoseiulus baraki a cryptic species?

article), Brazil (this article) and Sri Lanka (Moraes et al. 2004). This separation was consistent with the number of teeth on the fixed cheliceral digit, which was similar for the Brazilian, Tanzanian and Sri Lankan (Moraes et al. 2004) females, but different for the Beninese females from coconut and weeds (Zannou et al. 2006). These differences cannot be a simple consequence of allometry. The three African populations (one Beninese and two Tanzanian) have similar lengths and widths of the dorsal shield which is a good measure of their size, but the Brazil population stands out as being somewhat larger (Table 4.2). Thus, allometry would predict similar length of setae and smaller number of teeth for all the African populations. Clearly, this was not the case: only the Benin population had relatively shorter setae and fewer teeth on their fixed cheliceral digit. The problem that now arises is which of these populations (the Beninese or the others) is closer to the holotype. The species N. baraki was first described by Athias- Henriot (1966) from specimens collected on Phalaris plants in Algeria, and subsequently recorded in China, Puerto Rico, Taiwan, Thailand, Africa (Moraes et al. 2004; Zannou et al. 2006) and more recently in Africa, Brazil and Sri Lanka from coconut palms. Athias-Henriot’s (1966) original description of N. baraki was not sufficiently detailed, based on an insufficient number of specimens (one female) and contained no information on the cheliceral dentition. Also in the re-description provided by Ehara and Bandhoufalck (1977), the number of teeth on the fixed digit was not provided, but the authors did record 2 teeth on the movable digit, which corresponds to the 2 teeth recorded in the present and previous studies (Moraes et al. 2004). Based on multivariate analyses of the 32 characters studied, the Benin populations (either from coconut or weeds) are closer to the holotype than are the populations from Brazil, Tanzania and Sri Lanka (see Figure 4.1). The single tooth on the movable digit recorded from specimens

Figure 4.2 COI sequences of specimens identified as Neoseiulus baraki from four geographic localities. Dots indicate identity with the first sequence.

59 Nazer-chap4.qxd 14-9-2012 10:36 Page 60

CHAPTER 4

collected from weeds by Zannou et al. (2006) was probably a mistake (see Table 4.2). What is still needed is scrutiny of the number of teeth on the movable cheliceral digit for the specimens from weeds in Benin, and the number of teeth on the fixed cheliceral digit for the specimens from the same geographic origin as the holotype. The molecular analysis of specimens from the four populations studied also showed that the Benin population differed from all others, in line with the morphological differences. The genetic divergence of the Benin population had a magnitude similar to that observed for phytoseiid species. The genetic distance found in the present study is within the range (11.9-18.4%) reported for different species of the genus Kampimodromus Nesbitt (Acari: Phytoseiidae) (Tixier al. 2008b) on the same DNA fragment, low compared to those reported for different Euseius species (17%-25%) (Okassa et al. 2009), and similar to that between Tetranychus and Bryobia species (Acari: Tetranychidae) (Navajas et al. 1998; Ros et al. 2008, 2010). However, the genetic distance found between the Tanzanian and Brazilian populations is far less than the intra-specific genetic distance observed for Kampimodromus species (Tixier et al. 2008b) and within the range observed for Euseius sp. (0-5%) (Okassa et al. 2009). In addition to genetic differences observed, the cross-breeding experiments showed that populations studied represent distinct biological entities (biological species, sensu Mayr 1940), as has been observed for several phytoseiid and phytophagous mite species (McMurtry et al. 1976; Mahr and McMurtry 1979; Monetti and Croft 1997; Klimov et al. 2004; Noronha and Moraes 2004; Famah Sourassou et al. 2011). There are several explanations for the absence of offspring in crosses between populations. They can roughly be divided in pre- and post-zygotic isolation mechanisms. Pre-zygotic isolation would result in a lack of egg production, since virgin females do not produce eggs. We cannot rule out the possibility of non-mating (Hoy and Cave 1988) because we did not make these behavioral observations. Nevertheless, the net result would be that the populations represent different ‘species’ as a result of pre-zygotic isolation. In case of post-zygotic isolation, reduced numbers of offspring can be the result of genetic incompatibilities or cytoplasmic incompatibilities due to intracellular bacteria such as Wolbachia or Cardinium (O’Neill and Karr 1990; Perrot-Minnot et al. 1996; Breeuwer 1997; Gotoh et al. 2007). The incompatibility between the Benin population and those from Brazil and Tanzania could be the result of their genetic divergence, or from mutu- al interactions with reproductive parasites. Whether due to genetic divergence or endosymbionts or a combination of both, reproductive isolation is evident between the Benin population and the other two. Crossing experiments in combination with antibiotic treatment may help to clarify whether bacteria are the cause of the observed incompatibilities (Breeuwer 1997). Based on COI sequences, specimens from Brazil and Tanzania (and possibly those from Sri Lanka because of the close morphological similarity) may belong to the same

60 Nazer-chap4.qxd 14-9-2012 10:36 Page 61

Is Neoseiulus baraki a cryptic species?

species, whereas specimens from Benin may represent a distinct species, the females of which can be separated from those of Brazil and Tanzania based mainly on the number of teeth on the fixed cheliceral digit. Three cases have been reported earlier where morphological analysis and molecular methods, cross-breeding tests, or behaviour studies led to separation in cryptic species in the Phytoseiidae. First, the original morphological descriptions of Typhlodromus exhilaratus and T. phialatus Athias-Henriot were virtually the same, but molecular analysis and cross-breeding experiments showed differences that were later confirmed by the discovery of a new taxonomic character to separate the two species: the shape of the spermatheca (Tixier et al. 2006a). Second, using a combination of molecular markers and morphological characters, Tixier et al. (2008) showed that the species of Kampimodromus they considered in their study could be separated by cheliceral dentition. Third, the original morphological descriptions of N. cucumeris Oudemans and N. bellinus (Womersley) were similar, but behavioural observations revealed differences, that were later confirmed by the discovery of new taxonomic characters to separate the two species: the number of teeth on the fixed cheliceral digit and the setal and cheliceral lengths (Beard 1999). In the study by Lofego et al. (2009) considerable variation in the number of cheliceral teeth between specimens of N. benjamini Schicha from a same plant and locality (or even between right and left chelicerae of the same individual) and has been reported, but no further studies have been carried out to elucidate the cause of this variation. Other cases where an integrative approach was also used to identify cryptic species (or complex of species) have been reported in other mite taxa. For example, Heethoff et al. (2011) used integrative taxonomy, combining morphological, molecular and chemical methods to delineate species in the parthenogenetic Trhypochthonius tectorum complex. Klimov et al. (2004) employed the same methods, as used in the present study (morphological, cross-breeding and molecular) to identify two cryptic species of Sancassania mites, Sancassania salasi Klimov, Lekveishvili & OConnor and S. ochoai Klimov, Lekveishvili & OConnor. Summarizing the three approaches we applied, the four geographic populations of N. baraki are similar in most of morphological characters examined, in that differences observed are small and the measurements overlap for most of the characters. The main morphological difference between the Benin population and the other populations is the number of teeth on the fixed cheliceral digit of female specimens. In the morphometric analysis, the Benin population is distinct from the other three, therefore indicating the existence of two different morphological groups, which is consistent with the differences in the number of teeth on the fixed cheliceral digit. This close relationship is also supported by the molecular analysis showing a species-level genetic difference between the Benin population and the three others. Moreover, cross-breeding tests indicate that the populations studied represent different biological entities. The species morphologically most close to N. baraki (as far as reported in the literature) are N. paspalivorus DeLeon

61 Nazer-chap4.qxd 14-9-2012 10:36 Page 62

CHAPTER 4

and N. mumai Denmark (Moraes et al. 2004), which, however, differed from the former species by a number of morphological characters. We conclude that the population from Benin and those from the other geographic origins represent cryptic species. The deep- er lesson of all these cases of cryptic (or complexes of) species is that an integrative approach combining morphological, molecular, behavioural or compatibility level is required to distinguish between these taxonomic entities and that – only if these distinc- tions are made – we can begin to assess whether they are relevant to biological control.

Acknowledgements The present study which is a part of PhD Thesis of the senior author was supported by the International Institute of Tropical Agriculture (IITA) and the University of Amsterdam, The Netherlands, through a grant from the Board of the Netherlands Foundation for the advancement of Tropical Research (WOTRO). We are grateful to Betsie Voetdijk, Peter Kuperus, and Lin Dong for their availability and assistance during the molecular work. We thank Sam Korie for the statistical analysis of the data, and R. Houndafoche, P. Sovimi, C. Kededji and B. Bovis for their assistance in maintaining the predator colonies and conducting experiments. We also thank K. Negloh, A. Onzo and A. Bokonon-Ganta for their useful advices.

References Akimov IA, Benedyk SV, Zaloznaya LM (2003) Complex analysis of morphological characters of gamasid mite Varroa destructor (Parasitiformes, Varroidea). Vestnik Zoologii 38(5):57-66. Athias-Binche F, Schwerz HH, Meierhofer I (1993) Phoretic association of Neoseius novus Ouds (Acari: Uropodina) with Necrphorus spp. (Celeoptera: Silphidae): a case of sympatric speciation? Int J Acarol 19:75-86. Athias-Henriot C (1966) Contribution a l’étude des Amblyseius palearctiques (Acariens anactinotri- ches, Phytoseiidae). Bulletin Scientifique de Bourgogne 24:181-230. Beard JJ (1999) Taxonomy and biological control: Neoseiulus cucumeris (Acari: Phytoseiidae), a case study. Aust J Entomol 38:51–59. Bernini F, Avanzati AM, Barati M (1991) Biochemical and morphological systematics in the genus Amerus (Acarida: Oribatida). In: Dusbabek F and Bukva V (Eds) Modern Acarology, volume 2. Prague: Academia and The Hague: SPB Academic Publishing, pp. 213-217. Boyce W, Elliot L, Clark R, Jessup D (1990) Morphometric analysis of the Psoroptes spp. mites from bighorn sheep, mule deer, cattle, and rabbits. J Parasitol 76(6):823–828. Breeuwer JAJ (1997) Wolbachia and cytoplasmic incompatibility in the spider mite Tetranychus urticae and T. turkestani. Heredity 79:41–47. Chant DA, McMurtry JA (1994) A review of the subfamilies Phytoseiinae and Typholodrominae (Acari: Phytoseiidae). In J Acarol 20(4):223–310. Chant DA, McMurtry JA (2005) Review of the subfamily Amblyseiinae Muma (Acari: Phytoseiidae) Part IV. The tribe Euseiini N. tribe, subtribes Typhlodromalina, N. subtribe, Euseiina N. subtribe and Ricoseiina N. subtribe. Int J Acarol 31:187–222. Chant DA, McMurtry JA (2006) A review of the subfamily Amblyseiinae Muma (Acari: Phytoseiidae) Part IX. An overview. Int J Acarol 32:125–152. Chant DA, McMurtry JA (2007) Illustrated Keys and Diagnoses for the Genera and Subgenera of the Phytoseiidae of the World (Acari: Mesostigmata). Indira Publishing House, West Bloomfield, MI, USA. Chant DA, Yoshida-Shaul E (1991) Adult ventral setal patterns in the family Phytoseiidae (Acari: Gamasina). Int J Acarol 17(3):187–199.

62 Nazer-chap4.qxd 14-9-2012 10:36 Page 63

Is Neoseiulus baraki a cryptic species?

Cicolani B, Di Sabatino A (1991) Genetic differentiation between Macrocheles penciliger and Macrocheles minervae (Acari: Mesostigmata). In: Dusbabek F and Bukva V (Eds) Modern Acarology vol. 2. Prague: Academia and The Hague: SPB Academic Publishing, pp. 437-432. Cicolani B, Bullini APB, Bullini L (1981) Morphological and genetic differentiation between Macrocheles glaber and Macrocheles perglaber. Int J Acarol 7:221–224. Dermauw W, Vanholme B, Tirry L, Van Leeuwen T (2010) Mitochondrial genome analysis of the predatory mite Phytoseiulus persimilis and a revisit of the Metaseiulus occidentalis mitochondrial genome. Genome 53(4):285-301. Ehara S, Bandhoufalck A (1977) Phytoseiid mites of Thailand (Acarina: Mesostigmata). J Fac Educ, Tottori Univ, Nat Sc 27:43–82. Elzanowski A, Ostell J (2010) The Genetic Codes. Natl Center for Biotechnology Information (NCBI), Bethesda, MD, USA. http://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi. Famah Sourassou N, Hanna R, Zannou I, Moraes GJ, Negloh K, Sabelis MW (2011) Morphological variation and reproductive incompatibility of three coconut-mite-associated populations of predatory mites identified as Neoseiulus paspalivorus (Acari: Phytoseiidae). Exp Appl Acarol 53:323–338. Gerson U, Smiley RL, Ochoa, R (2003) Mites (Acari) for Pest Control. Blackwell Science, UK, p 539. Gotoh T, Noda H, Ito S (2007) Cardinium symbionts cause cytoplasmic incompatibility in spider mites. Heredity 98:13–20. Hall TA (1999) BioEdit. A user-friendly biological sequence editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser 41:95-98. Heethoff M, Laumann M, Weigmann G, Raspotnig G (2011) Integrative taxonomy: combining morphological, molecular and chemical data for species delineation in the parthenogenetic Trhypochthonius tectorum complex (Acari, Oribatida, Trhypochtoniidae). Front Zool 8(1):2. Helle W, Sabelis MW (1985) Spider Mites: Their Biology, Natural Enemies and Control. Vol. 1B. Elsvier, Amsterdam, The Netherlands. Hinomoto N, Osakabe M, Gotoh, T, Takafuji A (2001) Phylogenetic analysis of the green and red forms of the two-spotted spider mite, Tetranychus urticae Koch (Acari: Tetranychidae), in Japan, based on the mitochondrial cytochrome oxidase subunit I sequences. Appl Entomol Zool 36(4): 459-564. Hinomoto N, Tran PD, Pham AT, Le, TBN, Tajima R, Ohashi K, Osakabe M, Takafuji A (2007) Identification of spider mite (Acari: Tetranychidae) by DNA sequence: A case study in North Vietnam. Int J Acarol 33:53-60. Hinomoto N, Shintaku T, Amano H (2010) Comparison of genetic diversity among three phytoseiid mite species in Japan by Mitochondrial DNA analysis. J Acarol Soc Jpn 19(1):1–14. Hoy MA, Cave FE (1988) Premating and post-mating isolation among populations of Metaseiulus occidentalis (Nesbitt) (Acarina: Phytoseiidae). Hilgardia 56: 1-20. Jeyaprakash A and Hoy MA (2002) Mitochondrial 12S rRNA sequences used to design molecular ladder assay to identify six commercially available phytoseiids (Acari: Phytoseiidae). Biol Control 25:136–142. Jukes TH and Cantor CR (1969) Evolution of protein molecules. Pp. 21-132 In: Munro HN (Ed.) Mammalian Protein Metabolism. Academic Press, New York, USA. Kanouh M, Tixier M-S, Okassa M, Kreiter S (2010) Phylogenetic and biogeographic analysis of the genus Phytoseiulus (Acari: Phytoseiidae) Zool Scripta 39(5):450–461. Klimov PB, Lekveishvili M, Dowling APG, OConnor BM (2004) Multivariate analysis of morphological variation in two cryptic species of Sancassania (Acari: Acaridae) from Costa Rica. Ann Entomol Soc Am 97(2):322–345. Krantz GW, Mellot JL (1972) Study on phytoseiid specificity in Macrocheles mycotrupetes and M. peliotrupetes Krantz and Mellot (Acari: Macrochelidae) associates of geotrupine Scarabicidae. Acarologia 14:317–344.

63 Nazer-chap4.qxd 14-9-2012 10:36 Page 64

CHAPTER 4

Lawson-Balagbo ML, Gondim MGC, Moraes GJ, Hanna R, Schausberger P (2008) Exploration of acarine fauna on coconut palm in Brazil with emphasis on Aceria guerreronis (Acari: Eriophyidae) and its natural enemies. Bull Entomol Res 98:83–96. Lindquist EE, Sabelis MW, Bruin J (eds.) (1996) Eriophyoid Mites - Their Biology, Natural Enemies and Control. WCP Vol. 6, Elsevier Science, Amsterdam, The Netherlands, 790 + xxxii pp. Lindquist EE, Evans GO (1965) Taxonomic concept in the Ascidae, with a modified setal nomenclature for the idiosoma of the Gamasina (Acari: Mesostigmata). Mem Entomol Soc Can 47:1–64 Lofego AC, Demite PR, Kishimoto RG, Moraes GJ (2009) Phytoseiid mites on grasses in Brazil (Acarai: Phytoseiidae) Zootaxa 2240:41–59. Mahr DL, McMurtry JA (1979) Cross-breeding studies involving populations of Typhlodromus citri Garman and McGregor, T. arboreus Chant, and a sibling species of each (Mesostigmata: Phytoseiidae). Int J Acarol 5:155–161. Mallet J (1995) A species definition for the Modern Synthesis. TREE 10(7):294–299. Mayr E (1940) Speciation phenomena in birds. Am Nat 74:249–278. McMurtry JA, Badii MH, Congdon B D (1985) Studies on a Euseius species complex on avocado in Mexico and Central America, with a description of a new species (Acari: Phytoseiidae). Int J Acarol 26:107–116. McMurtry JA, Mah DL, Johnson HG (1976) Geographic races in the predaceous mite Amblyseius potentillae (Acari: Phytoseiidae). Int J Acarol 2:23–28. McMurtry JA, Croft BA (1997) Life-styles of phytoseiid mites and their roles in biological control. Annu Rev Entomol 42:291–321. McMurtry JA, Huffaker CB, Van de Vrie M (1970) Ecology of tetranychid mites and their natural enemies: a review. I. Tetranychid enemies: their biological characters and the impact of spray practices. Hilgardia 40(11):331–390. Monetti LN, Croft BA (1997) Mating, cross-mating and related behaviours in of Neoseiulus californicus and Neoseiulus fallacis (Acari: Phytoseiidae) Exp Appl Acarol 21:67–74. Moore D (2000) Non-chemical control of Aceria guerreronis on coconuts. Biocontrol News and Information 21 (3):83-88. Moraes GJ (1987) Importance of taxonomy in biological control. Insect Sci Appl 8:841–844. Moraes GJ, Lopez PC, Fernando LCP (2004) Phytoseiid mites (Acari: Phytoseiidae) of coconut growing areas in Sri Lanka, with description of three new species. J Acarol Soc Jpn 13(2): 141–160. Muma MH, Denmark HA (1969) Sibling species of Phytoseiidae (Acari: Mesostigmata). Fla Entomol 52(2):67–72. Navajas M, Boursot P (2003) Nuclear ribosomal DNA monophyly versus mitochondrial DNA polyphyly in two closely related mite species: Influence of life history and molecular drive. Proc R Soc B 270:124–127 Navajas M, Gutierrez M, Langnel J (1996) Mitochondrial cytochrome oxidase I in tetranychid mites: a comparison between molecular phylogeny and change of morphological and life history traits. Bull Entomol Res 86:407–417. Navajas M, Langnel J, Gutierrez M, Boursot P (1998) Species wide homogeneity of nuclear ribosomal ITS2 sequences in the spider-mite Tetranychus urticae contrasts with extensive mitochondrial COI polymorphism. Heredity 87:742–752 Navia D, Moares GJ, Querino RB (2009) Geographic pattern of morphological variation of the coconut mite, Aceria guerreronis Keifer (Acari: Eriophyidae), using multivariate morphometric. Braz J Biol 69(3): 773–783. Negloh K, Hanna R, Schausberger P (2011) The coconut mite, Aceria guerreronis, in Benin and Tanzania: occurrence, damage and associated acarine fauna. Exp Appl Acarol 55:361-374. Negloh K, Hanna R, Schausberger P (2008) Comparative demography and diet breadth of Brazilian and African populations of the predatory mite Neoseiulus baraki, a candidate for biological control of coconut mite. Biol Cont 46:523–531.

64 Nazer-chap4.qxd 14-9-2012 10:36 Page 65

Is Neoseiulus baraki a cryptic species?

Nguyen TTP, Amano H (2010) Sperm reception and egg production of mating-interrupted, single-mated and multi-mated females of Neoseiulus californicus (McGregor) (Acari: Phytoseiidae) at different temperatures. J Acarol Soc Jpn 19(2):97–106. Noronha ACS, Moraes GJ (2004) Reproductive incompatibility between mite populations previously identified as Euseius concordis (Acari: Phytoseiidae). Exp Appl Acarol 32:271–279. Noronha ACS, Mota A, Moraes GJ, Coutinho LL (2003) Caracterização Molecular de Populações de Euseius citrifolis Denmark and Muma e Euseius concordis Chant (Acari: Phytoseiidea) utilizan- do o seqüciamento das Regiões ITS1 e ITS2. Neotrop Entomol 32(4): 591–596. O’Neil SL, Karr TL (1990) Bidirectional incompatibility between conspecific populations of Drosophila simulans. Nature 348:178-180. Okassa M, Tixier M-S, Cheval B, Kreiter S (2009) Molecular and morphological evidence for new species status within the genus Euseius (Acari: Phytoseiidae). Can J Zool 87:689–698. Okassa M, Tixier M-S, Kreiter S (2010) Morphological and molecular diagnostics of Phytoseiulus persimilis and Phytoseiulus macropilis (Acari: Phytoseiidae). Exp Appl Acarol 52:291–303. Perrot-Minnot M-J, Guo LR, Werren JH (1996) Single and double infection with Wolbachia in the parasitic wasp Nasonia vitripennis: Effects on compatibility. Genetics 143:961–972. Ramadan HAI, El-Banhawy EM, Hassan AA, Afia SI (2004) Genetic variation in the predacious phytoseiid mite, Amblysieus swirskii (Acari: Phytoseiidae): Analysis of specific mitochondrial and nuclear sequences. Arab J Biotech 7(2):189–196. Reis AC, Gondim MGC, Moraes GJ, Hanna R, Schausberger P, Lawson-Balagbo ML, Barros R (2008) Population dynamics of Aceria guerreronis Keifer (Acari: Eriophyidae) and associated predators on coconut fruits in Northeastern Brazil. Neotrop Entomol 37(4):457–462. Ros VID, Breeuwer JAJ (2010) Spider mite (Acari: Tetranychidae) mitonchondrial COI phylogeny reviewed: host plant relationships, phylogeography, reproductive parasites and barcoding. Exp Appl Acarol 49:239–262. Ros VID, Breeuwer JAJ, Menken SBJ (2008) Origins of asexuality in Bryobia mites (Acari: Tetranychidae). BMC Evol Biol 8:153. Rosen D (1978) The importance of cryptic species and specific identifications as related to biological control. In: Biosystematics in Agriculture, Vol. II (ed. JA Romberger), pp. 23–25. Wiley, New York, USA. Rowell HJ, Chant DA, Hansel RIC (1978) The discrimination of setal homologies and setal patterns on the dorsal shield in the family Phytoseiidae (Acarina: Mesostigmata). Can Entomol 110:859-876. Sabelis MW, Van Rijn PCJ (1997) Predation by insects and mites. In: T Lewis (ed.) Thrips as Crop Pests. CAB-International, UK, pp. 259–354. SAS (2005) SAS Institute, version 9.2 Inc., Cary. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTALW: improving the sensitivity of pro- gressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucl Acids Res 22:4673–4680. Tixier M-S, Ferrero M, Okassa M, Guichou S, Kreiter S (2010) On the specific identity of specimens of Phytoseiulus longipes Evans (Mesostigmata: Phytoseiidae) showing different feeding behaviours: morphological and molecular analyses. Bull Entomol Res 17:1–11. Tixier M-S, Okassa M, Kreiter S (2009) On the way to the molecular diagnostic of species of Phytoseiidae. Euraac Newsletter 1+2. Tixier M-S, Guichou S, Kreiter S (2008a) Morphological variation of the species Neoseiulus californicus (McGregor) (Acari: Phytoseiidae): importance for diagnostic reliability and synonymies. Invert Syst 22:453–469. Tixier M-S, Kreiter S, Croft BA, Cheval B (2008b) Kampimodromus aberrans (Acari: Phytoseiidae) from the USA: morphological and molecular assessment of its density. Bull Entomol Res 98:125–134.

65 Nazer-chap4.qxd 14-9-2012 10:36 Page 66

CHAPTER 4

Tixier M-S, Kreiter S, Barbar Z, Ragusa S, Cheval B (2006a) The status of two cryptic species: Typhlodromus exhilaratus Ragusa and Typhlodromus phialatus Athias-Henriot (Acari: Phytoseiidae): consequences for taxonomy. Zool Scripta 35:115–122. Tixier M-S, Kreiter S, Ferragut F, Cheval B (2006b) The suspected synonymy of Kampimodromus hmiminai and Kampimodromus adrianae (Acari: Phytoseiidae): morphological and molecular investigations. Can J Zool 84:1216–1222. Tixier M-S, Kreiter S, Croft BA, Cheval B (2004) Morphological and molecular differences in the genus Kampimodromus Nesbitt. Implications for taxonomy. Phytophaga 14:361–375. Tixier M-S, Kreiter S, Cheval B, Auger P (2003) Morphometric variation between populations of Kampimodromus aberrans Oudemans (Acari: Phytoseiidae). Implications for the taxonomy of the genus. Invert Syst 17(2):349–358. Toda S, Osakabe M, Kumazaki S (2000) Interspecific diversity of mitochondrial COI sequence in Japanese Panonychus species (Acari: Tetranychidae). Exp Appl Acarol 24:621–629. Vidovic B, Stanisavljevic L, Petanovic R (2010) Phenotypic variability in five Aceria spp. (Acari: Prostigmata: Eriophyiddae) inhabiting Cirsium species (Asteracea) in Serbia. Exp Appl Acarol 52:169–181. Walsh PS, Metzger DA, Higuchi R (1991) Chelex 100 as medium for simple extraction of DNA for PCR-based typing for forensic material. Biotechniques 10(4):506-13. Yang B, Cai J, Cheng X (2010) Identification of astigmatid mites using ITS2 and COI regions. Parasitol Res 108:497–503. Zannou ID, Hanna R (2011) Clarifying the identity of Amblyseius swirskii and Amblyseius rykei: are they two distinct species or two populations of one species? Exp Appl Acarol 53(4):339–347. Zannou ID, Moraes GJ, Ueckermann EA, Olivera AR, Yaninek JS, Hanna R (2006) Phytoseiid mites of the genus Neoseiulus Hughes (Acari: Phytoseiidae) from Sub-Saharan Africa. Int J Acarol 32:241–276.

66 Nazer-chap5.qxd 14-9-2012 10:37 Page 67 5 Females as intraguild predators of males in cross-pairing experiments with phytoseiid mites

ABSTRACT – Studies on intraguild interactions between phytoseiid species have shown that intraguild predation occurs and is most commonly manifested as adult females of one species feeding on juveniles of another. Whether such intraguild interactions can also occur between adult females of one species and adult males of another, is not known. Herein, we report on intraguild interactions between adults of the two sexes in cross-breeding experiments involving three related phytoseiid species (Neoseiulus paspalivorus, N. baraki and N. neobaraki) that are potential candidates for controlling the coconut mite Aceria guerreronis, a serious pest of coconut palms in tropical countries. For comparative reasons, the experiments were repeated with larvae instead of males, and with only males or only females of two different species together. In the presence of an ample supply of prey, females of N. neobaraki never fed on individuals of their own species, yet appeared to be very aggressive against males, as well as larvae of the other two phytoseiid species. They also fed on females of N. paspalivorus, but rarely on females of N. baraki. Males of N. neobaraki did not suffer mortality when together with females of either of the two other phytoseiid species. Males of N. baraki did not suffer predation from females of N. paspalivorus, but males of N. paspalivorus suffered some mortality (15%) from N. baraki females. Larvae of each of the three species were vulnerable to intraguild predation by heterospecific females, except for N. neobaraki larvae when together with N. baraki females. The absence or presence of intraguild predation is largely explained by the size ratios of the individuals that were put together: large individuals feed on smaller ones, but never the reverse. For each stage and sex, size declines in the following order: N. neobaraki > N. baraki,> N. paspalivorus. Moreover, for each species, females are larger than males and males are larger than larvae. Strikingly, however, females did not kill males and larvae of their own species. We propose that niche competition between related phytoseiid species is not only determined by intraguild predation, but also by the limited availability of males from the intraguild prey because phytoseiid females being pseudo-arrhenotokous require insemination to produce offspring of both sexes.

Submitted manuscript

here is a growing awareness that biological control agents can be involved in Tintraguild interactions. (Rosenheim et al. 1995; Zannou et al. 2005; Negloh et al. 2012). Intraguild predation may interfere with the goals of biological control, especially when a less effective predator feeds on another, resulting in an overall decrease in pre-

67 Nazer-chap5.qxd 14-9-2012 10:37 Page 68

CHAPTER 5

dation pressure on the target pest (Rosenheim et al. 1995; Schausberger and Croft 2000; Zannou et al. 2005; Negloh et al. 2012). Such interactions may be relevant especially when different predator species are used to control a single pest. This is the case with respect to the coconut mite Aceria guerreronis Keifer, a serious pest of coconut palms in South and Central America, the Caribbean and Africa, because there are three candidate predators of the target prey: Neoseiulus paspalivorus DeLeon, N. baraki Athias-Henriot and N. neobaraki Zannou, Moraes and Oliveira. The first two species were reported from surveys conducted in Africa, South America and Asia, while the latter was found in Africa only (Moraes et al. 2004; Lawson-Balagbo et al. 2008; Negloh et al. 2011; Zannou et al. unpubl. data). The three species, particularly N. baraki and N. neobaraki, are morphologically very similar, and can be separated only on the basis of a few morphological characters (Moraes et al. 2004; Zannou et al. 2006; Famah Sourassou et al. 2012). As part of a series of studies on their taxonomic relationships (Moraes et al. 2004; Zannou et al. 2006), we carried out cross-pairing experiments with the aim to assess reproductive barriers between N. baraki and N. neobaraki. Instead of interspecific mating and hybridization, however, we observed that females of one species exhibited high tendency to kill males of the other in all pairings (Famah Sourassou, personal observations). Field surveys conducted in Benin and Tanzania showed that the three species are rarely observed together under the bracts of Aceria-infested coconut fruits, although it is possible to find them sharing the same palm (Negloh et al. 2011; I. Zannou, pers. comm.). This behaviour, together with the spatially segregated distribution of the three phytoseiids species on coconut palms, underscores the need to investigate intraguild interactions between females and males of the three phytoseiid species. In this article, we report on intraguild predation between females and males in cross-pairing experiments with N. neobaraki, N. baraki and N. paspalivorus.

Material and methods The predators used originate from colonies of the three species N. neobaraki, N. baraki and N. paspalivorus (see Table 5.1 for information about collection), maintained at 25- 27ºC, 70-90% r.h. and L12:D12 h, at the IITA-Benin Acarology Laboratory. Their rearing units consisted of a black PVC tile (4 × 4 × 0.1 cm) on top of a foam pad (4 × 4 × 1 cm) in a Petri dish (14.5 cm diameter, 1 cm height). The edges of the tile (and part of the foam pad) were covered with a band of tissue paper. To prevent mites from escaping, distilled water was supplied to the Petri dish to create a barrier and this was maintained on a daily basis to keep the foam pad and the tissue paper wet. A small tuft of hydrophobic cotton wool covered by a piece of transparent plastic was placed in the center of each rearing unit to serve as an oviposition site for the predators. All colonies were provided with a fresh supply of prey consisting of eggs of Tetranychus urticae Koch.

68 Nazer-chap5.qxd 14-9-2012 10:37 Page 69

Females as intraguild predators of males

Table 5.1 Collection localities, host plant and date of collection of predatory mites used in the study. Species Country Locality Host plant Latitude Longitude Collection No. date colonizing females Neoseiulus paspalivorus Benin Ouidah Cocos nucifera 06°21’N 02°09’E Oct 2005 52 Ghana Winneba Cocos nucifera 05°22’N 00°38’W Dec 2008 11 Brazil Itamaraca Cocos nucifera 07°46’N 34°52’W Sept 2006 5 Neoseiulus baraki Benin Gbehoue Cocos nucifera 06°21’S 01°55’E Feb 2009 4 Tanzania Nachenjele Cocos nucifera 08°78’S 39°41’E June 2010 5 Brazil Itamaraca Cocos nucifera 07°46’S 34°52’W July 2006 8 Neoseiulus neobaraki Benin Gbehoue Cocos nucifera 06°21’S 01°55’E Nov 2005 11 Tanzania Kiparanganda Cocos nucifera 07°07’S 39°12’E Jun 2010 Unknown

All possible combinations involving females and males of the three species were created in cross-pairing experiments in the presence of A. guerreronis as prey. Following the findings from the first set of experiments on the high aggressiveness of N. neobaraki females, we performed the following treatments (see Table 5.6): a) N. neobaraki females were paired with N. baraki male and the mortality was recorded for 48 h; b) all dead males were removed and replaced by N. neobaraki males; c) After 48 h, surviving N. neobaraki males were removed and replaced by N. baraki males; d) N. neobaraki females were paired with two different males, a conspecific and a N. baraki male. For comparative reasons, we also examined pairings between males (‘male × male’) and between females (‘female × female’) of the three species under study, as well as pairings between females and heterospecific larvae (‘female × larva’). The experiments were conducted under laboratory conditions (25-27ºC, 70-90% r.h. and L12:D12 h), in arenas consisting of 2.5 cm diameter black PVC tiles placed on moist cotton wool in a 14.5 cm diameter Petri dish. The experiments were replicated with new pairs of individuals for 20-40 times. Occurrence of intraguild predation was assessed after 48 h. The number of heterospecifics (males, female or larvae) killed after 48 h was used as a proxy for intraguild predation. Occurrence of intraguild predation for each cross-pairing experiment is expressed as a percentage calculated from the ratio of the scored number of pairings yielding individuals (males, or females, or larvae) killed (i.e., the scored number of pairings with dead individuals) to the total number (N) of pairings for that cross-pairing experiment. We arranged data in 2 × 2 contingency tables and performed a Chi-square test of independ- ence (using SAS version 9.2, SAS Institute 2005) to test whether the occurrence of intraguild predation and cross-pairing type (interspecific pairings vs. intraspecific pairings) are independent.

69 Nazer-chap5.qxd 14-9-2012 10:37 Page 70

CHAPTER 5

Results In pairings with heterospecific males of N. baraki and N. paspalivorus, N. neobaraki females killed all males (100% male mortality; Table 5.2). Moreover, when paired with females of the two other species, N. neobaraki females killed all N. paspalivorus females, but only 10% of the N. baraki females (Table 5.3). In pairings with N. paspalivorus males, N. baraki females killed 15% of the males. However, N. paspalivorus females did not kill any males of N. baraki. When pairing either only females or only males of the latter two species, no mortality was recorded (Tables 5.3 and 5.4). Male mortalities recorded in interspecific pairings were significantly different from those in intraspecific pairings (control) (Table 5.2), as were female mortalities in interspecific pairings when tested against intraspecific pairings (Table 5.3).

Table 5.2 Percent mortality in interspecific and intraspecific pairings between females and males of three phytoseiid species. The 2 × 2 contingency table and Chi-square test are given below. CROSS-PAIRINGS Female × male n Males killed Females killed INTER-SPECIES PAIRINGS N. neobaraki × N. paspalivorus 40 100 0 N. neobaraki × N. baraki 40 100 0 N. baraki × N. paspalivorus 40 15 0 N. baraki × N. neobaraki 40 0 0 N. paspalivorus × N. baraki 40 0 0 N. paspalivorus × N. neobaraki 40 0 0 INTRA-SPECIES PAIRINGS N. paspalivorus × N. paspalivorus 20 0 0 N. baraki × N. baraki 20 0 0 N. neobaraki × N. neobaraki 20 0 0 CHI-SQUARE TEST Cross Dead Alive Total X2 df P Intra-specific pairings 86 154 240 30.1 1 <<0.0001 Inter-specific pairings 0 240 240 Total 86 394 480

Table 5.3 Percent mortality in intra- and interspecific pairings between females of three phytoseiid species. The 2 × 2 contingency table and Chi-square test are given below. n N. paspalivorus N. baraki N. neobaraki N. paspalivorus 20 0 N. baraki 20 0 0 N. neobaraki 20 100 10 0 CHI-SQUARE TEST Cross Dead Alive Total X2 df P Intra-specific pairings 22 18 40 42.3 1 <<0.0001 Intra-specific pairings 0 60 60 Total 22 78

70 Nazer-chap5.qxd 14-9-2012 10:37 Page 71

Females as intraguild predators of males

Table 5.4 Mortality (%) in intra- and interspecific pairings between males of three phytoseiid species. n N. paspalivorus N. baraki N. neobaraki N. paspalivorus 20 0 N. baraki 20 0 0 N. neobaraki 20000

Table 5.5 Mortality (%) in inter- and intraspecific pairings between females and larvae of three phytoseiid species. The 2 × 2 contingency table and Chi-square test are given below. CROSS-PAIRINGS Female × male n Mortality (%) INTERSPECIFIC PAIRINGS N. neobaraki × N. paspalivorus 40 100 N. neobaraki × N. baraki 40 100 N. baraki × N. paspalivorus 40 100 N. baraki × N. neobaraki 40 0 N. paspalivorus × N. baraki 40 35 N. paspalivorus × N. neobaraki 40 15 INTRASPECIFIC PAIRINGS N. neobaraki × N. neobaraki 40 2.5 N. baraki × N. baraki 40 0

Table 5.6 Male mortality (%) in a series of experiments involving Neoseiulus neobaraki females (n = 20) on the one hand and conspecific and/or heterospecific (N. baraki) males on the other. (a) (b) (c) (d) 1 male 1 male 1 male 1 male + 1 male N. baraki N. neobaraki N. baraki N. baraki N. neobaraki Female N. neobaraki 100 0 100 100 + 0

To assess whether the conditions under which we observed intraguild predation among adults, also allowed for predation by females of one species on larvae of the other, we paired N. neobaraki females with larvae of N. baraki or larvae of N. paspalivorus and found 100% larval mortality within 24 h, in all cases. Also, N. baraki females killed all N. paspalivorus larvae, but they killed none of the N. neobaraki larvae. Finally N. paspalivorus females killed only few N. neobaraki larvae (15%) and not many N. baraki larvae (35%) (Table 5.5). Larval mortalities recorded in interspecific pairings were significantly different from those recorded in control pairings (Table 5.5). To assess the individual ability of N. neobaraki females to discriminate interspecifi- cally, we carried an additional series of experiments in which we confronted them with either heterospecific or conspecific males or both in a sequence of 4 experimental rounds. First, N. neobaraki females paired with N. baraki males killed all heterospecific males within 48 h (Table 5.6a). Second, after removal of the dead heterospecific males

71 Nazer-chap5.qxd 14-9-2012 10:37 Page 72

CHAPTER 5

and replacement by conspecific males, none of the latter males was killed (Table 5.6b). Third, after removal of the conspecific males and replacement by heterospecific males again, all of the latter males were killed (Table 5.6c). Fourth, when given a simultaneous choice between a conspecific male and an heterospecific male, all N. baraki males were killed, whereas all conspecific males survived (Table 5.6d). We conclude that females of N. neobaraki can discriminate between conspecific and heterospecific males, because they kill only the latter.

Discussion To the best of our knowledge (see Croft 1970; Menotti and Croft 1997; McMurtry et al. 1976; Hoying and Croft 1977; Mahr and McMurtry 1979; Congdon and McMurtry 1986) our results are the first to show that phytoseiid females can act as intraguild predators of heterospecific males, whereas they do not kill conspecific males (Table 5.2). No male killing (or predation) was observed in intraspecific crosses between geographic populations of each of the two species (Famah Sourassou et al. 2011, 2012). In terms of aggressiveness between species, N. neobaraki was superior over N. baraki and, N. baraki was superior over N. paspalivorus. When paired with a conspecific male and a heterospecific male together, each N. neobaraki female discriminated and killed only the heterospecific male (Table 5.6). This implicates species recognition prior to the decision to attack an intraguild prey. Strikingly, we never observed an attempt of males to mount a heterospecific female, let alone to mate with her. Thus, discrimination probably occurs prior to courtship. We have no reason to suppose that phytoseiid females specifically aim to attack heterospecific males. This is because they also attack heterospecific females and heterospecific larvae (Tables 5.3 and 5.5). Moreover, size differences matter to who is the intraguild predator and who is the intraguild prey (Lucas et al. 1998; Hindayana et al. 2001; Sato et al. 2003; Janssen et al. 2007): large individuals feed on smaller ones, but never the reverse. For each stage and sex, size declines in the following species order: N. neobaraki > N. baraki,> N. paspalivorus (Figure 5.1). Moreover, for each species, females are larger than males and males are larger than larvae. We conclude that the data in Tables 5.2-5.5 largely confirm that the intraguild predator is larger in size than the intraguild prey and that predation of females on heterospecific males is no exception to this rule. However, we cannot explain why N. baraki females did not prey on N. neobaraki larvae. This requires scrutiny. When sizes differed only little, as in pairings involving females of N. neobaraki and females of N. baraki, mortality was very low. While this again confirms the rule that dif- ferential size matters, behavioural observations on these females also showed that there is an alternative to being killed: N. neobaraki females stayed in the centre of the discs where the prey was placed, but N. baraki females moved along the edges of the discs. This may be interpreted as escape behaviour, a response commonly observed in

72 Nazer-chap5.qxd 14-9-2012 10:37 Page 73

Females as intraguild predators of males

Figure 5.1 Ratio body length (a) and width (b) of female/male between Neoseiulus paspalivorus, N. baraki and N. neobaraki. Measurements from 20 specimens of each species.

intraguild prey (Hindayana et al. 2001; Yasuda et al. 2001; Michaud and Grant 2003; Janssen et al. 2007). In our experiments individuals cannot escape, but, under field conditions, individuals may move away (e.g., out of the area under the perianth) upon encountering an intraguild predator. Thus, caution should be exercised when extrapolat- ing lab observations to the field. Usually, intraguild predation decreases as the density of the shared, extraguild prey increases (Schausberger 2003; Zannou et al. 2005). Indeed, females of N. paspalivorus become less aggressive towards larvae of N. neobaraki when the density of coconut mites, their prey, increases (Negloh et al. 2012). However, in our study where we offered coconut mites as prey to mimick conditions where they feed and compete for prey, N. neobaraki females exhibited intraguild predation on heterospecific larvae, females and males despite the presence of prey. This implies that niche competition between phytoseiid species is not only determined by food competition and intraguild predation on smaller species, but also by imposing greater mortality on males than on females of the other species. Since phytoseiid females reproduce by pseudo-arrhenotoky and thus require insemination to produce daughters and sons (Sabelis et al. 2002), smaller phytoseiid species may go extinct when males become too rare due to intraguild predation, unless there is a refuge where they can escape from this. These mechanisms may explain why the three phytoseiid species under study were not, or rarely, found co-occurring under the same perianth of an Aceria-infested coconut fruit. In Tanzania where N. neobaraki is prevalent, only one out of the 18 locations surveyed, had N. neobaraki and N. paspalivorus occurring together on two nuts from two different palms (Negloh et al. 2011), but unfortunately no information was provided on the sex of the co-occurring individuals of the two species. If it is true that intraguild predation limits co-occurrence of phytoseiid species under the perianth of the same coconut, then there would be little room for synergistic

73 Nazer-chap5.qxd 14-9-2012 10:37 Page 74

CHAPTER 5

effects between the three phytoseiid species and therefore also no reason for strategies to combat coconut mites with all three species together. However, if there are refuges from intraguild predation under the perianth (e.g., N. paspalivorus occupying below-perianth space too narrow for the other two species), then coexistence may be possible, and possibly also synergistic effects of two or more phytoseiid species on suppression of coconut mites. We consider this to be a key issue for future research on multiple predator species that are used to control coconut mites.

Acknowledgements We thank R. Houndafoche and P. Sovimi for their assistance in maintaining the predator colonies and conducting experiments. This research was supported by the International Institute of Tropical Agriculture (IITA) and the University of Amsterdam, the Netherlands, through a grant from the Board of the Netherlands Foundation for the advancement of Tropical Research (WOTRO). This study is part of the PhD Thesis of the senior author.

References Congdon BD, McMurtry JA (986) The distribution and taxonomic relationships of Euseius quetzali McMurtry in California (Acari: Phytoseiidae). Int J Acarol 12: 7–11. Croft BA (1970) Comparative studies on four strains of Typhlodromus occidentalis Nesbitt (Acarina: Phytoseiidae). I. Hybridization and reproductive isolation studies. Ann Entomol Soc Am 63:1528–1531. Famah Sourassou N, Hanna R, Zannou I, Breeuwer JAJ, Moraes G, Sabelis MW (2012) Morphological, molecular and cross-breeding analysis of geographic populations of coconut mite-associated predatory mites identified as Neoseiulus baraki: evidence for cryptic species? Exp Appl Acarol 57:15–36. Hindayana D, Meyhöfer R, Scholz D, Poehling H-M (2001) Intraguild predation among the hov- erfly Episyrphus balteatus de Geer (Diptera: Syrphidae) and other aphidophagous predators. Biol Control 20:236–246. Hoying SA, Croft BA (1977) Comparisons between populations of Typhlodromus longipilus Nesbitt and T. occidentalis Nesbitt: taxonomy, distribution and hybridization. Ann Entomol Soc Am 70: 150–159. Janssen A, Sabelis MW, Magalhães S, Montserrat M, Van der Hammen T (2007) Habitat structure affects intraguild predation. Ecology 88:2713–2719. Lawson-Balagbo ML, Gondim MGC, Moraes GJ, Hanna R, Schausberger P (2008). Exploration of acarine fauna on coconut palm in Brazil with emphasis on Aceria guerreronis (Acari: Eriophyidae) and its natural enemies. Bull Entomol Res 98:83–96. Lucas É, Coderre D, Brodeur J (1998) Intraguild predation among aphid predators: characterization and influence of the extraguild prey density. Ecology 79:1084–1092. Mahr DL, McMurtry JA (1979) Crossbreeding studies involving populations of Typhlodromus citri Garman and T. arboreus Chant and a sibling species of each. Int J Acarol 5:155–161. McMurtry JA Mahr DL, Johnson HG (1976) Geographic races in the predaceous mite, Amblyseius potentillae (Acari: Phytoseiidae). Ann Entomol Soc Am 57:649–655. Michaud JP, Grant AK (2003) Intraguild predation among ladybeetles and a green lacewing: do the larval spines of Curinus coeruleus (Coleoptera: Coccinellidae) serve as a defensive function? Bull Entomol Res 93:499–505. Monetti LN, Croft BA (1997) Mating, cross-mating and related behaviours in of Neoseiulus californicus and Neoseiulus fallacis (Acari: Phytoseiidae). Exp Appl Acarol 21:67–74.

74 Nazer-chap5.qxd 14-9-2012 10:37 Page 75

Females as intraguild predators of males

Moraes GJ, Lopez PC, Fernando LCP (2004) Phytoseiid mites (Acari: Phytoseiidae) of coconut growing areas in Sri Lanka, with description of three new species. J Acarol Soc Jpn 13:141–160. Negloh K, Hanna R, Schausberger P (2012) Intraguild predation and cannibalism between the predatory mites Neoseiulus neobaraki and N. paspalivorus, natural enemies of the coconut mite Aceria guerreronis. Exp Appl Acarol 58(3) DOI 10.1007/s10493-012-9581-6. Negloh K, Hanna R, Schausberger P (2011) The coconut mite, Aceria guerreronis, in Benin and Tanzania: occurrence, damage and associated acarine fauna. Exp Appl Acarol 55:361-374. Rosenheim JA, Kaya HK, Ehler LE, Marois JJ, Jaffee BA (1995) Intraguild predation among biological control agents; theory and evidence. Biol Control 5:303–335. Sabelis MW, Nagelkerke CJ, Breeuwer JAJ (2002) Sex ratio control in arrhenotokous and pseudo- arrhenotokous mites. In: Sex Ratios, Concepts and Research Methods (ICW Hardy, ed.), Cam- bridge University Press, Cambridge, UK, pp. 235-253. SAS (2005) SAS Institute, version 9.2 Inc., Cary. Sato S, Dixon AFG, Yasuda H (2003) Effects of emigration on cannibalism and intraguild predation in aphidophagous ladybirds. Ecol Entomol 28:628–633. Schausberger P (2003) Cannibalism among phytoseiid mites: a review. Exp Appl Acarol 29:173–191 Schausberger P, Croft B (2000) Cannibalism and intraguild predation among phytoseiid mites: Are aggressiveness and prey preference related to diet specialization? Exp Appl Acarol 24:709–725. Yasuda H, Kikuchi T, Kindlmann P, Sato S (2001) Relationships between attack and escape rates, cannibalism, and predation in larvae of two predatory ladybirds. J Ins Behav 14:373–384. Zannou ID, Moraes GJ, Ueckermann EA, Olivera AR, Yaninek JS, Hanna R (2006) Phytoseiid mites of the genus Neoseiulus Hughes (Acari: Phytoseiidae) from Sub-Saharan Africa. Int J Acarol 32:241–276. Zannou I, Hanna R, Moraes JG, Kreiter S (2005) Cannibalism and interspecific predation in a phytoseiid predator guild from cassava field in Africa: Evidence from the laboratory. Exp Appl Acarol 37:27–42.

75 Nazer-chap5.qxd 14-9-2012 10:37 Page 76 Nazer-chap6.qxd 14-9-2012 10:37 Page 77 6 Predatory mites found under the bracts of coconuts and their potential for controlling Aceria guerreronis: review and hypotheses

ABSTRACT – The coconut mite Aceria guerreronis feeds on the meristematic tissue under the bracts of coconuts and is a serious pest of coconut palms. Predatory mites found on Aceria-infested coconuts are reviewed based on extensive surveys in Benin, Tanzania, Brazil, Colombia, Mexico, Venezuela, Sri Lanka, Oman and India, carried out to explore possibilities for biological control of coconut mites. Three closely related species, Neoseiulus paspalivorus, N. baraki and N. neobaraki, stand out as being most abundant and closely associated with coconut mites under the bracts of coconuts. Unlike N. neobaraki found to occur in Africa only, the other two predator species were present in all continents explored, but geographic populations of these two species were reproductively isolated due to endosymbiont infections and/or genetic factors. A COI-based phylogenetic analysis as well as morphological analysis of geographic populations of each of the three species led to the hypothesis that the predatory mite N. paspalivorus has followed the same route of continental invasions as coconut mites, their prey, whereas N. baraki (especially from Benin) and N. neobaraki belong to a complex species that had much of their early evolutionary history on weeds and moved to coconut palms more recently. Based on their reproductive incompatibilities we used geographic populations as the basic genetic entities for evaluating the biological characteristics of these two predator species for their use in biological control. We found differences in life history traits and ability to utilize pollen such that there was a tendency for relatively high population growth capacities to be associated with lower abilities to utilize pollen. Although this trait association is premature and needs statistical validation, it poses a testable hypothesis on a trade-off between population growth and alternative food utilization and this hypothesis is crucial for determining which geographic race is the best candidate for coconut mite control.

Unpublished manuscript

ased on socio-economic impact the coconut palm, Cocos nucifera L., has been classi- Bfied among the most important crops in the world and especially in the Tropics (Vietmeyer 1986). However, its yield is significantly reduced by several arthropods that feed on this plant (Lever 1969; Krantz et al. 1978). The coconut mite, Aceria guerreronis Keifer (Acari: Eriophyidae), is one of the most important arthropod pests of this crop worldwide. It was originally described from specimens collected on coconut fruits in

77 Nazer-chap6.qxd 14-9-2012 10:37 Page 78

CHAPTER 6

Guerrero, Mexico (Keifer 1965). It is a specialist herbivore of young coconuts, attacking mainly the meristematic zone covered by the perianth (Moore et al. 1989). Damage to coconut production ranges between 67-85% in Benin (West Africa) and 43-81% in Tanzania (East Africa) (Negloh et al. 2011). Increasing public concern over the use of insecticides, together with the fact that several insecticides have become ineffective or their application became impracticable (Moore and Alexander 1987; Moore et al. 1989) has provided the impetus to develop more sustainable and environmentally safe strategies for controlling the coconut mite, such as biological control. Predatory mites are widely distributed in most terrestrial ecosystems, and effective biological control agents of a wide range of harmful mites and insects have been reported (Helle and Sabelis 1985; Lindquist et al. 1996; McMurtry and Croft 1997). This paper provides a review of the predatory mites reported from surveys conducted in several African, Asian, South-, Central- and North-American countries. We focus on the three most abundant and apparently most important mite predators of A. guerreronis. Based on the distribution of these predator species over the continents, their genetic and morphological variability in each of the continents and an earlier assessment of the invasion history of coconut mites (Navia et al. 2005) we develop a hypothesis on the invasion routes (or the absence thereof) for each of the three predator species. Next, we consider genetic variation among reproductively isolated, geographic populations of these predators with particular emphasis for traits relevant to biological control of coconut mites.

Methodology A total of 9 countries from 3 continents (Africa, Asia, and America) were surveyed for the occurrence of natural enemies of A. guerreronis on coconuts while still attached to the palm (excluding fallen coconuts, leaves, branches and inflorescences) (Table 6.1). Data from surveys conducted in Brazil (Lawson-Balagbo et al. 2008a; Reis et al. 2008), Colombia, Mexico and Venezuela (Silva et al. unpublished), Benin and Tanzania (Negloh et al. 2011; Zannou et al. unpublished), India (Banerjee and Gupta 2011), Oman (Hountondji et al. 2010), Sri Lanka (Moraes et al. 2004; Fernando and Aratchige 2009) were put together not only to provide a species list but also to assess the relative abundance of each species in each country.

Predatory mites associated with Aceria guerreronis Altogether, about 60 predatory mite species belonging to 6 families have been reported from surveys conducted in Africa, the Americas and Asia (Table 6.2). The most frequently-found species belong to the Phytoseiidae and Ascidae sensu lato (Lindquist et al. 2009). Other less abundant predatory mites belong to Bdellidae, Cheyletidae, Cunaxidae and Tydeidae (Table 6.2, Figure 6.1).

78 Nazer-chap6.qxd 14-9-2012 10:37 Page 79

Predators under coconut bracts: review and hypotheses

Table 6.1 Continents and countries surveyed for natural enemies of Aceria guerreronis. Continent Country References Africa Benin (1) Negloh et al. 2011; (2) Zannou et al. unpublished data Tanzania (1) Negloh et al. 2011; (2) Zannou et al. unpublished data Americas Brazil (3) Lawson-Balagbo et al. 2008; (4) Reis et al. 2008; Oliveira et al. 2012 Colombia (5) Silva et al. unpublished data Mexico (5) Silva et al. unpublished data Venezuela (5) Silva et al. unpublished data Asia India (6) Banerjee and Gupta 2011 Oman (7) Hountondji et al. 2010 Sri Lanka (8) Moraes et al. 2004; (9) Fernando and Aratchige 2011 Numbers in parentheses refer to the superscripts in Table 6.2.

Phytoseiidae Overall, 32 phytoseiid species belonging to eleven genera have been collected on infested coconut fruits (Table 6.2), representing 53% of all predatory mite species (Figure 6.1). In each of the locations surveyed three closely related phytoseiid species, namely Neoseiulus paspalivorus De Leon, N. baraki Athias-Henriot and N. neobaraki Zannou, Moraes & Oliveira are by far the most abundant and the most frequently-found in close association with A. guerreronis under the bracts of coconuts (Table 6.3). Evidently, their size permits them to move into the space between the bracts and the fruit surface. Because of their their exclusive occurrence on coconut in association with A. guerreronis

Figure 6.1 Overall percent relative abundance of species in the most important families of predatory mites reported from survey conducted in Africa, South America and Asia. Percents were calculated based on data provided by Lawson-Balagbo et al. (2008), Reis et al. (2008), Negloh et al. (2011), Banerjee and Gupta (2011), Fernando and Aratchige (2011), Silva et al. (unpublished), and Zannou et al. (unpublished). The percent relative abundance of mite species in each family was calculated by dividing the number of mite species recorded for that family in all these locations surveyed by the total of all mite species recorded.

79 Nazer-chap6.qxd 14-9-2012 10:37 Page 80

CHAPTER 6 8,9 Sri Lanka 7 Oman 6 India 5 Venezuela 5 Mexico 5 Keifer at different locations surveyed.Keifer Colombia 3,4 A. guerreronis Brazil 1,2 Tanzania 1,2 +------Zannou et al. + ------Moraes et al. + ------(Gondim Jr. & Moraes - - + ------Ehara - - + ------Moraes et al. + ------Muma & Denmark - - + + + + - - - MumaGarman - - - - + - - + - + - + ------Daneshvar ------+ - Blommers - - + ------Ueckermann & Kreiter - + ------DeLeon + + + + + + + + + Denmark & Muma - - + ------Muma Chant + ------Muma + + + + + + + + + Zannou, Moraes & Olivera + + ------Gondim Jr. & Moraes - - + ------Berlese + - - + + - - - - Muma - - + ------Moraes & McMurtry + ------Denmark - - - + - - - - - Athias-Henriot + + + + + + - - + Ueckermann & Loots + ------Swirski & Amitai ------+ - DeLeon - - + ------sp. - - - + + + - - - Pritchard & BakerPritchard + ------sp +-+------sp sp. - - - + - - - - - Extant of predatory mite species reported in association with sp. - - - + - + - - - sp. ------+ - Euseius beninensis Neoseiulus paspalivorus Neoseiulus mumai Proprioseiopsis cannaensis Amblyseius tamatavensis Amblyseius negevi Cydnoseius Euseius alatus Euseius dossei Galendromus Iphiseius degenerans Meyerius Neoseiulus baraki Neoseiulus neobaraki Neoseiulus recifensis Neoseiulus wiesei Phytoscutus Proprioseiopsis mexicanus Proprioseiopsis Typhlodromips cananeiensis Typhlodromus (A.) asperosetosus eastafricae Ueckermannseius quilicii Ueckermannseius Amblyseius largoensisAmblyseius Amblyseius Typhlodromina subtropica Typhlodromus aff. vulgaris Typhlodromus dalfardicus Typhlodromus ornatus Amblyseius aerialis Amblyseius Amblyseius herbicolus Amblyseius adhatodae Amblyseius Genera and Species Benin neohavu Ueckermannseius Table 6.2 Table FamilyPhytoseiidae Africa Americas Asia +Found; -Not found Superscripts behind countries: 6.1 see references in Table

80 Nazer-chap6.qxd 14-9-2012 10:37 Page 81

Predators under coconut bracts: review and hypotheses 8,9 Sri Lanka 7 Oman are placed in Ascidae, 6 India Gamasellodes 5 and Asca are placed in Melicharidae Venezuela 5 Mexico 5 Proctolaelaps and Colombia 3,4 Melichares Brazil 1,2 Tanzania 1,2 are placed in Blattisociidae, whereas Lasioseius Athias-Henriot - - + ------and Chant + - + ------Moraes et al. - - + ------Fain, Bochk. & Corp.-Raros ------+ - Oudemans ------+ - - Bram + - + + + + - - - Hering - - + ------Karg & Rodriguez - - + ------Fox - - +------sp. - - +------Baker and BaloghBaker + + + ------sp. - - +------sp - - +------1 sp +------sp. - - ++++ ++- sp. - - - +++ --- sp. - - +------sp. -+ ------Hoploseius sp. - + +------sp. ------sp. +------sp. ------Continued. sp. Berlese + + - - + + + - - DeLeon - - + ------, sp. - - - +-- --- sp +- --++ -- sp. - - +------Afrotydeus Metapronematus Armascirus Cheletomimus Cheletomimus gracilis Cheyletus malaccensis Hemicheyletia Mexecheles Parachelytia Bdella distincta Cyta Bdella Spinibdella Gamasellodes Genera and SpeciesAsca foxi Asca Blattisocius keegani Hoploseius Lasioseius subterraneus Benin Pronematus Lasioseius Melichares aff. agilis Proctolaelaps bickleyi Proctolaelaps coffeae Proctolaelaps intermedius Proctolaelaps bulbosus Proctolaelaps This group recently split into three families (Lindquist et al. was 2009); according to this system, Tydeidae Cunaxidae Cheyletidae Bdellidae Table 6.2 Table FamilyAscidae s. lato Africa Americas Asia 1 Blattisocius

81 Nazer-chap6.qxd 14-9-2012 10:37 Page 82

CHAPTER 6

Table 6.3 Percent relative abundance of Neoseiulus paspalivorus, N. baraki and N. neobaraki at different locations surveyed. Benin Tanzania Brazil Colombia Mexico Venezuela N. paspalivorus 84.5 15.3 61 77 21.3 71.5 N. baraki 12.5 22.7 26 5.8 11.1 4.2 N. neobaraki 1.7590000 Others 1.3 3 13 7.2 66.7 4.3

and their demonstrated ability to feed and reproduce on a diet of coconut mite alone (Lawson-Balagbo et al. 2007; Negloh et al. 2008), these species are generally considered the most important predators of coconut mites. The Amblyseius species are the second most abundant group of predators collected from Aceria-infested coconuts. Amblyseius largoensis (Muma) was reported from all locations surveyed, but in very low numbers per coconut, and occasionally found under the bracts of Aceria-infested fruits. This species is larger than the three above-mentioned Neoseiulus species found under the bracts, what suggests that its size limits access to the area under the bracts. It is found much more abundantly elsewhere on the coconut palm, especially on coconut leaves and fallen coconuts (Fernando and Aratchige 2009; Negloh et al. 2011; Lawson-Balagbo et al. 2008a; Silva et al. unpublished). Specimens identified as belonging to Proprioseiopsis, Typhlodromina and Typhlodromips were reported from South America, but not from Africa or Asia. Species of Typhlodromus were recorded only in South America and Africa. According to I. Zannou (personal communication) a specimen from Benin mistakenly identified as a Galendromus species (Negloh et al. (2011), was upon examination of additional specimens observed to cor- respond to a Typhlodromus species (Anthoseius). Other genera rarely represented were Iphiseius from Benin, Colombia and Mexico and Meyerius and Cydnoseius from Oman.

Ascidae sensu lato This group was recently split into three families (Lindquist et al. 2009); according to this new system, Asca and Gamasellodes were kept in the Ascidae, Blattisocius, Hoploseius and Lasioseius were placed in Blattisociidae, whereas Melichares and Proctolaelaps were placed in Melicharidae. Given the considerable morphological and behavioural similarities between them, we retain in this paper the old classification system (Lindquist and Evans 1965), referring to them as Ascidae sensu lato. This group accounts for 22% of the predatory mite species found on coconuts attached to the palm (Figure 6.1). Among them, Proctolaelaps species dominate, but they have not been found in Tanzania, Oman and Sri Lanka. These species are much less abundant on the coconuts attached to the palm tree than they are on fallen coconuts on which they can reach large numbers. Bracts on fallen coconuts stand more distantly from the fruit surface, thereby providing Proctolaelaps predators with access to the space under the bracts despite being larger than the three

82 Nazer-chap6.qxd 14-9-2012 10:37 Page 83

Predators under coconut bracts: review and hypotheses

Neoseiulus species. The larger body size is probably a major limitation for Proctolaelaps bickleyi (Bram) and P. bulbosus (Moraes, Reis and Gondim Jr.) to become effective predators of A. guerreronis on fruits attached to palms despite their relatively voracity and population growth (Lawson-Balagbo et al. 2007; Galvão et al. 2011b; Lima et al. 2012). The second most abundant ascid group belongs to Lasioseius. It is reported from coconuts in South America and Africa, but not from Oman and Sri Lanka. No detailed investigation about the potential of species from this group has been carried out.

Bdellidae, Chelytidae, Tydeidae and Cunaxidae Bdellidae account for 10% of all predatory mite species collected from coconut. Bdella spp. have been reported in Brazil, Benin, Tanzania and Colombia, whereas Spinibdella spp. have been reported from Tanzania and Brazil and Cyta spp. from Brazil. Cheyletidae represent 7% of all predatory mite species collected from coconut, and were reported from South America and Asia. Cunaxidae represent 7% of all species and were represented by Armascirus species in Brazil. Tydeidae were rare and represented by Afrotydeus sp. in Benin, Pronematus sp. in Tanzania, and Metapronematus sp. in Brazil. All these non- phytoseiid species were collected mainly from the exposed surface of coconut fruits.

Candidate biocontrol agents of coconut mites Three phytoseiid species, Neoseiulus paspalivorus, N. baraki and N. neobaraki, stand out as candidate biocontrol agents of coconut mites, because they are the most abundant species associated with coconut mites. The first two are common on all continents included in the surveys, but the third species is only found in Africa and is most prevalent in Tanzania. Depending on location surveyed, the three species comprise up to 80- 98% of the phytoseiids associated with A. guerreronis under the bracts. The relatively small, flat and elongated body shape of these mites facilitates their access under the bracts of coconuts, being the microhabitat inhabited by the target prey (Moraes et al. 2004). Neoseiulus paspalivorus was first described by De Leon (1957) from specimens collected from a Paspalum grass species in association with Steneotarsonemus spp., on which it could be feeding (De Leon 1957). This predator has been reported from all countries where surveys were made of the predators under the bracts of Aceria-infested coconuts, in some occasions also in association with Steneotarsonemus spp. (Moraes et al. 2004; Lawson-Balagbo et al. 2008a; Reis et al. 2008; Negloh et al. 2011; Fernando and Aratchige 2009; Hountondji et al. 2010; Banerjee and Gupta 2011, Silva et al. unpublished). It is by far the most dominant predator in all countries surveyed, except in Tanzania (Africa) and Mexico (North America) (Lawson-Balagbo et al. 2007; Negloh et al. 2011; Silva et al. unpublished data) (Table 6.3). Compared to other Neoseiulus species found on coconut, N. paspalivorus has the smallest size and the shortest legs (Figure 6.2).

83 Nazer-chap6.qxd 14-9-2012 10:37 Page 84

CHAPTER 6

Neoseiulus baraki was first described by Athias-Henriot (1966) from specimens collected from weeds (Phalaris sp.) in Algeria (Africa). Further morphological information about this species was provided by Ehara and Bandhufalck (1977), Schicha (1981), Moraes et al. (2004) and Famah Sourassou et al. (2012). This species is slightly larger than N. paspalivorus and has slightly longer legs (Figure 6.2). It has been the second most frequently reported phytoseiid species in all countries surveyed, except in India and Oman where this species was not found (Hountondji et al. 2010; Banerjee and Gupta 2011). Neoseiulus baraki is the most dominant phytoseiid in Sri Lanka, almost as dominant as N. neobaraki in Tanzania (Zannou et al. unpublished data), but the second most prevalent phytoseiid species in Brazil and Benin (Negloh et al. 2011; Lawson-Balagbo et al. 2008; Zannou et al. unpublished data). Neoseiulus neobaraki is so far found in Benin and Tanzania only, being the most prevalent species in the latter country. It is the largest of the three Neoseiulus species (Figure 6.2). It was described by Zannou et al. (2006) from specimens collected from the weed Andropogon gayanus and from coconut, and is morphologically close to N. baraki.

Climatic requirements Surveys conducted in Brazil (Lawson-Balagbo et al. 2008; Reis et al. 2008) and Benin (Negloh et al. 2011; Zannou et al. unpublished data) suggest that N. paspalivorus thrives in dry areas, but N. baraki and N. neobaraki in humid areas. However, a study conducted in Sri Lanka reported N. paspalivorus prevailing at relatively humid areas and N. baraki in relatively dry areas, both species co-occurring in areas with intermediate climatic conditions (Fernando and Aratchige 2009). To understand these contrasting observations there is a need to quantify the extent to which an area is relatively dry/humid, but

Figure 6.2 Length and width of the dorsal shield of Neoseiulus paspalivorus, N. baraki and N. neobaraki. Proctolaelaps bickleyi was included for comparison.

84 Nazer-chap6.qxd 14-9-2012 10:37 Page 85

Predators under coconut bracts: review and hypotheses

also the extent to which populations in different geographic areas are genetically similar or dissimilar. In addition, it should be noted that these species live exclusively under the bracts where the microclimate differs dramatically from the ambient climate.

Biology and behaviour Based on data availability and the supposed relevance to biological control, we focus on two traits of the Neoseiulus predators: (1) the population growth under conditions of ample supply of coconut mites as prey, and (2) the ability to utilize coconut pollen as food source for survival, development and reproduction. We assessed these data for N. paspalivorus populations from Benin, Ghana and Brazil. All assessments were done at 25±1 °C, 70-90% RH and 12:12h light-dark cycle. All N. paspalivorus populations were observed to feed, develop and reproduce successfully on A. guerreronis (Table 6.4), but they differed in population growth rates and in ability to utilize coconut pollen for survival, and development. In particular, none of the populations could reproduce on coconut pollen. Moreover, the population from Benin was not able to develop on a diet of coconut pollen, whereas the other populations studied did so successfully. These results suggest other possible differences between these reproductively isolated populations. The data also indicated a negative relation between the ability to utilize pollen for development and adult survival and the population growth on a diet of coconut mites, as shown in Figure 6.4 where the intrinsic rate of population increase (rm) is plotted against the developmental rate (inverse of developmental time) and longevity on a diet of coconut pollen. We will further refer to this trend as the negative trade-off hypothesis. A special note should be made with respect to data on a population of N. paspalivorus from Brazil (Acaraú) (Lawson-Balagbo et al. 2007). The results from that study differ strikingly from the results from the present study in that the predators were able to reproduce on pollen. However, we emphasize that these data cannot be compared with ours because reproduction on a diet of coconut pollen was measured using females that completed their development on a diet of coconut mites. In our study (where we found no such egg production) we used females that completed their development on coconut pollen. Complementary studies are needed to resolve this issue. For populations previously identified as N. baraki, the population growth rates on a diet of coconut mites and the ability to utilize pollen were published by Negloh et al. (2008). That study showed that population growth on a diet of coconut mites was higher in the Brazil population, but the ability to utilize pollen was higher for the Benin population whose females could reproduce (after reaching adulthood and mating on coconut pollen). This is again in agreement with the hypothesis of a negative trade-off between population growth rate on a diet of coconut mites and the ability to utilize coconut pollen as food. Unfortunately, nothing is known about the life history of N. neobaraki on different diets because these data could also serve to test the trade-off hypothesis.

85 Nazer-chap6.qxd 14-9-2012 10:37 Page 86

CHAPTER 6 m r 5 , intrinsic rate m r Sex ratio Total duration of Total 1 4 3 Percentage female offspring; Percentage Post-oviposition Fecundity 5 Hughes. 3 Neoseiulus geographic populations on three different foods types. 3 Eggs per female day; 4 Pre- Oviposition 3 Neoseiulus paspalivorus Mean in days; 3 12345678910 % females Longevity gravid oviposition 2 1. Brazil 2. Ghana3. Benin (1)4. Benin (2) 0.003 0.0005. Brazil 0.000 0.003 6. Tanzania 0.0037. Tanzania 0.363 0.3638. Benin 0.000 0.363 0.3639. 0.363 Benin 0.363 0.363 0.350 0.363 0.363 0.363 0.363 0.354 0.363 0.363 0.363 0.000 0.350 0.000 0.363 0.350 0.000 0.363 0.127 0.133 0.127 0.133 0.127 0.133 0.118 10. Tanzania 0.338 0.342 0.338 0.338 0.142 0.142 0.142 0.152 0.089 Survival Percentage reaching adulthood; reaching Percentage 1 2 (outgroup) 11. Benin 0.322 0.326 0.322 0.322 0.363 0.36.3 0.363 0.342 0.346 0.342 Egg-Adult Summary of the life history parameters of three mite-associated three coconut distance matrix within- and between Pairwise Itamaraca 11.1 ± 0.22 b 70 (70) 0.0 (24) 13.1 ± 1.3 b – – – – – BeninGhanaItamaraca 5.6 ± 0.05 b 6.2 ± 0.08 a 5.6 ± 0.05 b 100 (50) 100 (50)Benin 98 (50) 100 (34)Ghana 100 (30) 100 (31) 13.6 ± 1.11 a 37.3 ± 2.5 b 44.3 ± 1.8 a 9.9 ± 0.10 b 1.8 ± 0.1 b 35.9 ± 3.2 b 7.1 (70) 2.1 ± 0.1 ab 2.6 ± 0.3 a 91.4 (70) 23.1 ± 1.1 a 18.4 ± 0.8 b 0.0 (3) 12.2 ± 2.1 b 26.1 ± 1.9 a 23.1 ± 1.9 a 0.0 (34) 1.4 ± 0.04 b 1.8 ± 0.06 a 26.7 ± 2.1 a 9.6 ± 2.5 b 69.8 7.4 ± 1.8 c 69.5 – 1.1 ± 0.05 c – 69.1 0.191 0.207 0.149 – – – – – – – – development (in days); development Different letters indicate significant differences per food type among predator populations (pairwise Student’s t-test;Different letters indicate significant differences per food type among predator populations (pairwise Student’s P<0.05); N. paspalivorusN. Table 6.4 Table A. guerreronis pollen Coconut 6.5 Table Species baraki N. Populations neobaraki N. Proctolaelaps bickleyi 5. version and Cantor 1969) in MEGA® software model (Jukes The constructed distance matrix was using the Jukes-Cantor of population increase

86 Nazer-chap6.qxd 14-9-2012 10:37 Page 87

Predators under coconut bracts: review and hypotheses

Phylogenetic relationships Using published data on cytochrome oxidase subunit I (COI) sequences for N. baraki (Famah Sourassou et al. 2012; GenBank accession numbers JQ609092/93/94), Neoseiulus californicus McGregor (GenBank AB500127/29/30/31), Neoseiulus womersleyi (Schicha) (GenBank AB500132/33/34/35/36) and Iphiseius degenerans (Berlese) (GenBank FM210120) and data on N. paspalivorus (to be submitted to GenBank) and N. neobaraki (to be submitted to GenBank) we carried out a phylogenetic analysis, the results of which

Figure 6.3 Phylogenetic relationships of predatory mites identified as Neoseiulus paspalivorus, N. baraki and N. neobaraki. 1Singino; 2Nachenjele; 3Specimens from coconut; 4Specimens from weeds; A search was performed in the GenBank in an attempt to retrieve COI sequences of all Neoseiulus species available. Our search conducted on Mars 13, 2012 resulted in only 9 COI sequences from 2 Neoseiulus species. The 9 COI sequences from the GenBank, in addition to the 10 COI sequences from this study, were automatically aligned by the aid of ClustalW (Thompson et al. 1994). COI sequences of Iphiseius degenerans from the GenBank was added in the phylogenetic analysis as out-group. A global alignment of approximately 361 base pairs was reached with the 20 COI sequences, which was then used for phylogenetic analysis. Tree based on Neighbor-Joining method was constructed in MEGA5 using the Juke-Cantor model with 1000 bootstrap replications.

87 Nazer-chap6.qxd 14-9-2012 10:37 Page 88

CHAPTER 6

are presented in Figure 6.3 and Table 6.5. Neoseiulus paspalivorus appeared genetically the most distant from N. baraki and N. neobaraki as indicated by the 34-36% genetic dissimilarity. However, the 12-15% genetic dissimilarity between specimens identified as N. baraki and those identified as N. neobaraki is comparable to that between specimens from Benin and those from Tanzania and Brazil previously identified as ‘N. baraki’, but now considered to be a cryptic species. A genetic dissimilarity of 9% was found between specimens from Benin and those Tanzania identified as N. neobaraki. In the phylogenetic tree, N. paspalivorus formed a completely separate monophyletic group, whereas specimens identified as N. baraki from Benin, from Tanzania and Brazil, and N. neobaraki from Benin and Tanzania formed together another monophyletic group (Figure 6.3). Regarding the taxonomic status of the three phytoseiid species so far examined, the phylogeny based on COI sequences suggests that a complex of species may occur in Africa, comprising specimens identified as N. baraki from Benin, specimens identified as N. baraki from Tanzania, and specimens identified as N. neobaraki from Benin and Tanzania. Only one species from this complex in Africa is also found in Brazil and in Sri Lanka.

Invasion route A study by Navia et al. (2005) has shown that South America is likely to be the area of origin of the pest A. guerreronis, from where it invaded first Africa, and then Sri Lanka and India. This prompts the question: what has been the invasion route for the predatory mites associated with A. guerreronis? Did the predators follow the same route as their prey or are they endemic on other host plants and moved to coconut palms later on? Summarizing the patterns of geographic distribution, together with morphological and molecular data presented above, we propose that only N. paspalivorus followed the invasion route of its prey, whereas N. baraki is a complex of species that had a prior evolutionary history on an endemic host plant before moving onto coconut palms. This conclusion is reached based on: (a) N. paspalivorus is the only species found in all geograph-

Figure 6.4 Trend between the intrinsic rate of population increase (rm) on measured diet of Aceria guerreronis and and the developmental rate (inverse of developmental time) and longevity on a diet of coconut pollen. Different letters indicate significant differences between populations in rm and longevity on diets of A. guerreronis and coconut pollen (pairwise Student’s t-test; P<0.05).

88 Nazer-chap6.qxd 14-9-2012 10:37 Page 89

Predators under coconut bracts: review and hypotheses

ic locations/continents surveyed; (b) specimens of N. paspalivorus from the different geographic localities surveyed are morphologically and genetically similar, but clearly more samples from a wide range of geographic localities are needed to critically test our hypothesis;(c) specimens identified as N. baraki and N. neobaraki from Africa are a species-complex with only one species (from Tanzania) being morphologically and genetically similar to the one population studied from Brazil and another from Sri Lanka. Yet again, a more detailed study involving samples from a wider geographic range is still needed to fully determine the invasion route of the species in this complex. Discussion To date, exploration for predatory mites on coconuts infested by A. guerreronis has yielded about 60 species of predatory mites, with Phytoseiidae being represented by 32 species and being the most abundant group in all locations surveyed. The phytoseiid species N. paspalivorus, N. baraki and N. neobaraki stand out because they are (1) closely associated with coconut mites under the bracts of the coconut (in contrast to many other species recorded, such as Amblyseius spp. and species of Ascidae sensu lato, Bdellidae, Cheyletidae, Cunaxidae and Tydeidae) and (2) by far the most dominant. In addition, except for N. neobaraki being found in Africa only, N. paspalivorus and N. baraki are found in samples of all continents. Predatory mites identified as N. paspalivorus were found in all locations surveyed in Africa, Asia and South America, either alone or with predatory mites identified as N. baraki and/or N. neobaraki. However, not included in this review, is a recently published survey conducted in Southeastern Brazil (São Paulo), which yielded neither N. paspalivorus nor N. baraki (Oliveira et al. 2012). This is probably due to the fact that (1) coconut cultivation was only relatively recently introduced into that area, (2) A. guerreronis was probably only recently introduced to that area, and (3) the climatic conditions in Sao Paulo are very different from areas where this mite has been found in other parts of the world. Based on phylogenetic and morphological analyses of the species identified as N. paspalivorus, N. baraki or N. neobaraki we propose that N. paspalivorus has followed the same invasion route as the coconut mites (from South-America to Africa and then to Asia) because it is found on all locations and all continents explored and because their geographic populations on different continents are morphologically and genetically similar. We also propose that species previously identified as N. baraki moved from weeds to coconut palms after their introduction into the area and from Africa to other continents because they are part of a highly differentiated species complex occurring in Africa and because specimens identified as N. baraki have been found on weeds in Africa (Famah Sourassou et al. 2012; this study; Zannou, pers. comm.). These two proposals are no more than hypotheses that need to be tested much more extensively by sampling from a wider range of geographic localities in all three continents. Such extended surveys and analyses

89 Nazer-chap6.qxd 14-9-2012 10:37 Page 90

CHAPTER 6

could help to test whether N. paspalivorus has its greatest genetic diversity in South America (as expected from our hypothesis) and whether Asian and South American populations identified as N. baraki are less genetically diversified than those in Africa. These hypotheses on invasion routes are helpful in making decisions on releases of populations from one continent into another. If the area of origin of the predatory mites is indicated by higher genetic diversity, then it follows that exploration of this genetic diversity for traits relevant to biological control may yield candidate strains for improving coconut mite control in areas elsewhere. We hypothesize that the following predator traits are determinants of their impact on coconut mite populations: (1) size- dependent access to the space under the bracts of coconuts (Aratchige et al. 2007; Lima et al. 2012), (2) the functional and numerical response to the density of coconut mites (Lima et al. 2012) and (3) the ability to survive on alternative food, such as coconut pollen (Lawson-Balagbo et al. 2007; Negloh et al. 2008). Our data suggest that the capacity for population increase on a diet of coconut mites is negatively related to the ability to utilize coconut pollen (Figure 6.4). While this is no more than a trend based on small sample, this hypotehesis is worthy testing by more in-depth research, especially because the phytoseiids at large also show such a negative relation (McMurtry and Croft 1997). If this negative trade-off holds, then we need to determine which combination of the two traits involved in the trade-off is best for biological control. This is an important issue for future research. It is also not yet clear how important climatic adaptations are because the mites live under the bracts of coconuts and thus in a protected environment. However, in Sri Lanka N. paspalivorus inhabits relatively humid areas and N. baraki lives in dry areas whereas the two species co-occur in areas with an intermediate climate (Fernando and Aratchige 2009). This suggests that climatic adaptations do play a role, but it is not a proof and more research is needed to establish this. We consider size-dependent access to the space under the coconut bracts as one of the most critical features of the predator-prey system (Aratchige et al. 2007; Lima et al. 2012). The smaller size of A. guerreronis in relation to the three Neoseiulus species most commonly found associated with it gives it a head start in moving under the tightly appressed bracts of young coconuts. Thus predatory mites are only expected to be able to exert their impact on coconut mites by the time the bracts stand sufficiently distant from the fruit. As this process of morphological change of the bracts takes time (Aratchige et al. 2007), it comes as no surprise that in field experiments conducted in Benin and Brazil it was found that the coconut mites infest the fruits when they are only 1-month old, whereas the predatory mites, N. paspalivorus and N. baraki, invade infested nuts two-three months later (Negloh et al. 2011; Galvão et al. 2011a). This delay in predator impact poses a serious limitation on biological control of coconut mites. We suggest that this delay may be shortened by selecting coconut varieties with bracts that exhibit a faster morphological response to coconut mite infestation.

90 Nazer-chap6.qxd 14-9-2012 10:37 Page 91

Predators under coconut bracts: review and hypotheses

Acknowledgements This research was supported by the International Institute of Tropical Agriculture (IITA) and the University of Amsterdam, the Netherlands, through a grant from the Board of the Netherlands Foundation for the advancement of Tropical Research (WOTRO). This study is part of the PhD Thesis of the senior author.

References Aratchige NS, Sabelis MW, Lesna I (2007) Plant structural changes due to herbivory: Do changes in Aceria-infested coconut fruits allow predatory mites to move under perianth? Exp Appl Acarol 43: 97-107. Athias-Henriot C (1966) Contribution à l’étude des Amblyseius paléarctiques (Acariens anactinotri- ches, Phytoseiidae). Bull Scientifique de Bourgogne 24:181-230. Banerjee D, Gupta SK (2011) Incidence and seasonal occurrence of mites (Acari) on coconut in West Bengal, India. Zoosymposia 6:82–85. De Leon D (1957) Three new Typhlodromus from southern Florida (Acarina: Phytoseiidae). Fla Entomol 40:141–144. Ehara S, Bandhoufalck A (1977) Phytoseiid mites of Thailand (Acarina: Mesostigmata). J Fac Educ, Tott Univ, Nat Sci 27:43–82. Famah Sourassou N, Hanna R, Zannou I, Breeuwer JAJ, Moraes GJ, Sabelis MW (2012) Morphological, molecular and cross-breeding analysis of geographic populations of coconut-mite associated predatory mites identified as Neoseiulus baraki: evidence for cryptic species? Exp Appl Acarol 57:15–36. Fernando LCP, Aratchige NS (2009) Status of coconut mite Aceria guerreronis and biological control research in Sri Lanka. Trends in Acarology - Proceedings of the 12th International Congress. In: MW Sabelis and J Bruin (eds.), Springer, Dordrecht, The Netherlands, pp. 419–423. Galvão AS, Gondim MGC, Moraes GJ, Melo JWS (2011a) Distribution of Aceria guerreronis and Neo- seiulus baraki among and within coconut bunches in northeast Brazil. Exp Appl Acarol 54: 373–384. Galvão AS, Gondim Jr. MGC, Moraes GJ (2011b) Life history of Proctolaelaps bulbosus feeding on the coconut mite Aceria guerreronis and other possible food types occurring on coconut fruits. Exp Appl Acarol 53:245–252. Helle W, Sabelis MW (1985) Spider Mites: Their Biology, Natural Enemies and Control. Vol. 1B. Elsvier, Amsterdam, The Netherlands. Hountondji FCC, Moraes GJ, Al-Zawamri H (2010) Mites (Acari) on coconut, date palm and associated plants in Oman. Syst Appl Acarol 15:228–234. Jukes TH, Cantor CR (1969) Evolution of protein molecules. Mammalian Protein Metabolism. In Munro HN (ed.), Academic Press, New York, USA, pp. 21-132. Keifer HH (1965) Eriophyid Studies B-14. Bureau of Entomology, California Department of Agriculture, Sacramento, CA, USA, 20 p. Krantz J, Schmutterer K, Koch W (1978) Disease, Pests and Weeds in Tropical Crops. Wiley, Chichester, 666p. Lawson-Balagbo LM, Gondim Jr, MGC, De Moraes GJ, Hanna R, Schausberger P (2008b) Compatibility of Neoseiulus paspalivorus and Proctolaelaps bickleyi, candidate biocontrol agents of the coconut mite Aceria guerreronis: Exp Appl Acarol 45:1–13. Lawson-Balagbo ML, Gondim Jr MGC, Moraes GJ, Hanna R, Schausberger P (2007) Life history of the predatory mites Neoseiulus paspalivorus and Proctolaelaps bickleyi, candidates for biological control of Aceria guerreronis. Exp Appl Acarol 34:49–61. Lawson-Balagbo ML, Gondim MGC, Moraes GJ, Hanna R, Schausberger P (2008a) Exploration of acarine fauna on coconut palm in Brazil with emphasis on Aceria guerreronis (Acari: Eriophyidae) and its natural enemies. Bull Entomol Res 98:83–96.

91 Nazer-chap6.qxd 14-9-2012 10:37 Page 92

CHAPTER 6

Lever RJAW (1969) Pests of the Coconut Palm. FAO agricultural studies. No 77, Rome, 190p. Lima DB, da Silva Melo JW, Gondim MGC, Moraes GJ (2012) Limitations of Neoseiulus baraki and Proctolaelaps bickleyi as control agents of Aceria guerreronis. Exp Appl Acarol 56:233–245. Lindquist EE, Evans GO (1965) Taxonomic concepts in the Ascidae, with a modified setal nomenclature for the idiosoma of the Gamasina (Acarina: Mesostigmata). Mem Entomol Soc Can 47:1–64. Lindquist EE, Sabelis MW, Bruin J (eds.) (1996) Eriophyoid Mites - Their Biology, Natural Enemies and Control. WCP Vol. 6, Elsevier Science, Amsterdam, The Netherlands, 790 + xxxii pp. Lindquist EE, Krantz GW,Walter DE (2009) Order Mesostigmata. In: Krantz GW and Walter DE (Eds.), A Manual of Acarology. 3 ed., Texas Tech University Press, Lubbock, pp.124-232. McMurtry JA, Croft BA (1997) Life-styles of phytoseiid mites and their roles in biological control. Annu Rev Entomol 42:291–321. Moore D, Alexander L (1987) Stem injection of vamidothion for control of coconut mite, Eriophyes guerreronis Keifer in St Lucia. Crop Protection 6:329–333. Moore D, Alexander L, Hall RA (1989) The coconut mite, Eriophyes guerreronis Keifer in St. Lucia: yield losses and attempts to control it with acaricide, polybutene and Hirsutella fungus. Trop Pest Manag 35:83–98. Moraes GJ, Lopez PC, Fernando CP (2004) Phytoseiid mites (Acari: Phytoseiidae) of coconut growing areas in Sri Lanka, with description of 3 new species. J Acarol Soc Jpn 13:141–160. Navia D, Moraes GJ, Roderick G, Navajas M (2005) The invasive coconut mite Aceria guerreronis (Acari: Eriophyidae): origin and invasion sources inferred from mitochondrial (16S) and nuclear sequences. Bull Entomol Res 95:105–116. Negloh K, Hanna R, Schausberger P (2012) Intraguild predation and cannibalism between the predatory mites Neoseiulus neobaraki and N. paspalivorus, natural enemies of the coconut mite Aceria guerreronis. Exp Appl Acarol 58(3) DOI 10.1007/s10493-012-9581-6. Negloh K, Hanna R, Schausberger P (2011) The coconut mite, Aceria guerreronis, in Benin and Tanzania: occurrence, damage and associated acarine fauna. Exp Appl Acarol 55:361-374. Negloh K, Hanna R, Schausberger P (2010) Season- and fruit age-dependent population dynamics of Aceria guerreronis and its associated predatory mite Neoseiulus paspalivorus on coconut in Benin. Biol Control 54:349–358. Negloh K, Hanna R, Schausberger P (2008) Comparative demography and diet breadth of Brazilian and African populations of the predatory mite Neoseiulus baraki, a candidate for biological control of coconut mite. Biol Control 46:523–531. Oliveira DC, Moraes GJ de, Dias CTS (2012) Status of Aceria guerreronis Keifer (Acari: Eriophyidae) as a pest of coconut in the state of São Paulo, southeastern Brazil. Neotrop Entomol 41:315–323. Reis AC, Gondim MGC, Moraes GJ, Hanna R, Schausberger P, Lawson-Balagbo LE, Barros R (2008) Population dynamics of Aceria guerreronis Keifer (Acari: Eriophyidae) and associated predators on coconut fruits in northeastern Brazil. Neotrop Entomol 37:457–462. Sabelis MW (1985) Reproduction and sex allocation. In: W Helle and MW Sabelis (eds.) Spider mites - Their Biology, Natural Enemies and Control. Elsevier, Amsterdam, pp. 73-94. Schicha E (1981) A new species of Amblyseius (Acari: Phytoseiidae) from Australia compared to ten closely related species from Asia, America and Africa. Int J Acarol 7:203–2016. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTALW: improving the sensitivity of pro- gressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680. Vietmeyer ND (1986) Lesser-known plants of potential use in agriculture and forestry. Science 232:1379–1384. Zannou ID, Moraes GJ, Ueckermann EA, Oliveira AR, Yaninek JS, Hanna R (2006) Phytoseiid mites of the genus Neoseiulus Hughes (Acari: Phytoseiidae) from Sub-Saharan Africa. Int J Acarol 32:241–276.

92 Nazer-chap7.qxd 14-9-2012 10:37 Page 93 7 General discussion

n biological pest control it is not only important to identify and characterize the pest Ispecies, but also the natural enemies that are found in association with the target pest species (Moraes et al. 1987; McMurtry 2010). However, the traits of the natural enemies may vary with the genetic entities considered. Such entities may be represented by genotypes, bio- or eco-type, geographic populations, cryptic species or species. In this thesis, I focused on geographically isolated populations and studied the extent to which these populations are reproductively incompatible, because this has consequences for mass rearing and for introducing a strain from one geographic area into the area of another strain. For one thing mixing different geographic strains in mass culture may have negative effects on population growth rates if the strains are reproductively incompatible (Stouthamer et al. 2000; Mochiah et al. 2002). For another, reproductive incompatibility ensures reproductive isolation, thereby possibly maintaining the genetic integrity of the geographic strain even after it has been released in the geographic area of another strain. Having established the reproductive isolation between geographic populations of the natural enemies (Chapters 2, 3 and 4), I reviewed and assembled data to demonstrate the extent to which these geographic populations exhibit genetic variation in traits relevant to biological pest control. Moreover, by reconstructing the invasion routes of the natural enemies I tried to determine their geographic area of origin, which most likely is the area where they exhibit the greatest genetic diversity. In this way it is possible to plan releases of natural enemies in other areas where their genetic variation is limited. So, what can be learnt from the results presented in this thesis with respect to geographic populations of mainly two species of predatory mites (Acari: Phytoseiidae) that are found in close association with coconut mites under the bracts of coconuts? I have presented evidence for reproductive isolation between geographic populations of the predatory mite Neoseiulus paspalivorus and N. baraki and showed that this was due to the presence of endosymbionts in one of the two predator species (N. paspalivorus) (Chapters 2 and 3). Moreover, I showed that the other predator species, N. baraki,is actually a species complex with two cryptic species, one from Benin and the other occurring in Tanzania, Brazil and Sri Lanka (Chapter 4). I also argued that a third predator species, N. neobaraki, also belongs to this complex (Chapter 6). Phylogenetic analysis of all Neoseiulus species together (plus an outgroup) suggests that the centre of genetic diversity of Neoseiulus species is in Africa, but there were no differences in genetic diversity among populations of N. paspalivorus from different countries (Chapter 6). This led to the hypothesis that N. baraki moved from weeds to coconut palms in Africa and that one cryptic species from Africa invaded the other continents, whereas N. pas-

93 Nazer-chap7.qxd 18-9-2012 2:51 Page 94

CHAPTER 7

palivorus from South-America followed the same invasion route as proposed for its prey, the coconut mites (Navia et al. 2005). If this hypothesis holds, then it makes sense to introduce geographic strains of N. baraki from Africa into other continents, but there is as yet no reason to do that with strains of N. paspalivorus. Now the question arises which traits are relevant to biological control and whether geographic populations differ in these traits. While this still requires an in-depth analysis, it is good to identify some general trends that may serve as a hypothesis. First, I assumed that two traits are of particular importance: the population growth rate on a diet of coconut mites and the ability to utilize pollen for survival. Then, I observed a trend in that high values of the first trait are associated with lower abilities concerning the second trait (and vice versa). Thus, it seems that there is no master of all trades (good in population growth and in pollen utilization) and that there is a trade-off between two traits that I assumed to be crucial for biological control. Unfortunately, there is no hard theory stating which combination of the two traits is best to achieve (short- or long-term) biological control of coconut mites. In absence of such a theory there is a need to perform experimental tests with strains exhibiting contrasting combinations of the two traits. Apart from testing which combination of the two traits is best for biological control there are several other issues that need scrutiny before accepting the hypotheses proposed in this Thesis. First, I would recommend doing research that establishes the metabolic and/or genetic reasons for a trade-off between population growth on a diet of coconut mites and the ability to utilize coconut pollen for survival and development. Since the presence of endosymbionts may come at a cost to reproduction (Stouthamer et al. 1999; Bordenstein and Werren 2000), one may wonder how an individual predatory mite can profit from an infection by endosymbionts, unless the endosymbiont con- fers an advantage, e.g. in digestion of proteins from coconut pollen. Second, I would favour carrying out a more extensive sampling program to test our hypotheses on the centres of genetic diversity (and consequently the invasion routes). Third, I have assumed that the reproductive isolation I have assessed indeed leads to reproductive isolation in the field. If a geographic strain from one area would be released in the area of another, can I assume that reproductive isolation is retained? Clearly, this is a question that needs further research because there is evidence that mating preferences depend on the environment (e.g. diet) (e.g. Kokko et al. 2002) and it is still a major question whether the impact of endosymbionts is under control of the endosymbionts, their host or both.

References Bordenstein SR, Werren JH (2000) Do Wolbachia influence fecundity in Nasonia vitripennis? Heredity, 84:54–62. Stouthamer R, Jochemsen P, Platner GR, Pinto JD (2000) Crossing incompatibility between Trichogramma minutum and T. platneri (Hymenoptera: Trichogrammatidae): implications for applications in biological control. Environ Entomol 29:832–837.

94 Nazer-chap7.qxd 14-9-2012 10:37 Page 95

General discussion

Moraes GJ (1987) Importance of taxonomy in biological control. Insect Sci Appl 8:841–844. Muma MH, Denmark HA (1969) Sibling species of Phytoseiidae (Acari: Mesostigmata). Fla Entomol 52(2):67–72. McMurtry JA, Badii MH, Congdon BD (1985) Studies on a Euseius species complex on avocado in Mexico and Central America, with a description of a new species (Acari: Phytoseiidae). Int J Acarol 26:107–116. Navia D, Moraes GJ, Roderick G, Navajas M (2005) The invasive coconut mite Aceria guerreronis (Acari: Eriophyidae): origin and invasion sources inferred from mitochondrial (16S) and nuclear sequences. Bull Entomol Res 95:105–116. Mochiach MB, Ngi-Song AJ, Overholt WA, Stouthamer R (2002) Wolbachia infection in Cotesia sesamiae (Hymenoptera: Braconidae) causes cytoplasmic incompatibility: implications for biological control. Biol Control 25:74–80. Kokko H, Brooks R, McNamara JM, Houston AI (2002) The sexual selection continuum. Proc R Soc Lond B 269:1331–1340.

95 Nazer-chap7.qxd 14-9-2012 10:37 Page 96 Nazer-summary.qxd 14-9-2012 10:38 Page 97

Summary

ver since its discovery as a pest of coconut palms in Mexico in 1965, the coconut Emite Aceria guerreronis Keifer has been reported from other countries, first in South- America, then in Africa and finally also in Asia. With the aim to establish biological control of this pest, a search for candidate natural enemies associated with this pest has been conducted in several countries in each of these geographic areas. Prior to the work described in this Thesis, two species of predatory mites (Acari: Phytoseiidae) were found to co-occur in Brazil, Tanzania, Benin and Sri Lanka and, based solely on morphological criteria, they have been identified as Neoseiulus paspalivorus DeLeon and N. baraki Athias-Henriot. Because these species inhabit widely different geographic areas, there may be genetic variation between geographic populations of each of these two species that is worth to be explored in order to improve the effectiveness of biological control. The aim of the work presented in this Thesis is to assess the genetic entities (biotypes, cryptic species, subspecies and species) that should be considered for their impact on biological control. Therefore, this Thesis is largely a biosystematic study that serves as a basis for future studies on biological control. This is done by a combination of morphological measurements, crossbreeding experiments and molecular analysis. It was found that geographic populations of Neoseiulus paspalivorus were morphologically similar, yet reproductively incompatible (CHAPTER 2). Females of each population were able to mate with males from the other populations, but they laid fewer eggs and most of these eggs did not hatch because they shrivelled. Moreover (CHAPTER 3), the populations were genetically identical, based on the mitochondrial cytochrome oxidase subunit I (CO1-sequences). Then, using the 16S rDNA primers, the three populations were checked for the presence of two endosymbiotic bacteria, Wolbachia and Cardinium known to cause reproductive abnormalities in their hosts, and their phylogenetic relationships were analysed (CHAPTER 3). Different Wolbachia strains were detected in the populations from Benin and Brazil whereas a population from Ghana har- boured only Cardinium symbionts. An antibiotic test showed that removing the symbionts from females of each population made them incompatible with males of the same population. Moreover, these tests restored compatibility between the populations from Benin and Brazil in one direction, but not in the reciprocal cross, suggesting incompatibility arising from interactions between nuclear and cytoplasmic genes. Antibiotic-treated females of the population from Ghana produced hardly any progeny, so that we were not able to establish a Cardinium-free line and hence no crossings with other populations. Given the symbiont-associated reproductive isolation, genetic differentiation between the three populations remains a possibility worth to be explored for

97 Nazer-summary.qxd 18-9-2012 2:53 Page 98

Summary

traits relevant to biological control. However, we conclude that the three populations belong to a single species. Following the same approach we found that geographic populations of predatory mites, previously identified as N. baraki, are reproductively incompatible, differ genetically with respect to mitochondrial CO1 sequences and some morphological traits (i.e., number of teeth on the fixed digit of female chelicera) and therefore do not belong to one species. In particular, the population from Benin was distinct from the other populations studied (Brazil, Tanzania and possibly also Sri Lanka) and may represent a cryptic species (CHAPTER 4). Because scrutiny of the holotype was not possible, it cannot be inferred which of the two cryptic species is the real N. baraki. Nevertheless, these genetic entities seem worth to be explored for genetic traits relevant to biological control. Whereas in each of the geographic areas studied N. paspalivorus co-occurs with one or the other cryptic species closely related to N. baraki and in Africa also with another predator species, i.e., N. neobaraki, they may also co-occur in the same palm tree. However, they almost never co-occur within the same bunch of coconuts and on the same coconut. This lack of coexistence at a local scale, yet apparent coexistence at a larger scale, may arise from priority effects emerging in Lotka-Volterra competition models for two species competing for the same resource, and in models of reciprocal intraguild predation. However, the cross-pairing studies (CHAPTER 5) described in this Thesis also revealed another mechanism preventing local coexistence. Cross-pairings between species revealed intraguild predation by females of one predator species on the males and larvae of the other. Since size determines who is the intraguild predator and who is the intraguild prey, the largest of the three predator species (N. neobaraki) was more aggressive than the smallest (N. paspalivorus). Such intraguild interactions may drive the intraguild prey extinct not only because of the mortality inflicted on the intraguild prey, but also because it reduces the chances for females of the intraguild prey to find a male. In the final part of the Thesis (CHAPTER 6) an up-to-date review is provided of all species of predatory mites found under the bracts of coconuts. Out of a total of 60 species, 32 species belong to the Phytoseiidae which in terms of their abundance represent 53% of all specimens found. Among the Phytoseiidae three species stand out as being predominant: N. paspalivorus, N. baraki and N. neobaraki. In most geographic areas studied the most dominant of these three is N. paspalivorus, possibly because it may have better access to the area under the bracts of the coconut due to its smaller size. However, in Tanzania, N. neobaraki, the largest of the three predator species, dominates, but the reasons for this dominance are still unclear. Virtually always the predators with intermediate abundance are the two cryptic species closely related to N. baraki, being the predator of intermediate size. For two of the abundant predator species, the biological characteristics are summarised, as far as available in the literature, and supplied, where

98 Nazer-summary.qxd 14-9-2012 10:38 Page 99

Summary

no data are available. This shows that N. baraki and N. paspalivorus from Brazil tend to have higher capacity for population increase on a diet of coconut mites than the same two species from Africa. However, the cryptic species closely related to N. baraki from Benin is better able to survive and reproduce on coconut pollen than that from Brazil. Compared to species closely related to N. baraki, populations of N. paspalivorus have equal or higher capacities for population increase on a diet of coconut mites and they also vary in the ability to utilize coconut pollen. The populations from Ghana and Brazil (Acarau) are relatively better in pollen utilization whereas that from Benin is relatively worse. Overall, there is a trend for populations to have lower capacities for population increase (on a diet of coconut mites) when they are better in utilizing pollen. Which of these combinations is best for biological control of coconut mites is still to be determined.

99 Nazer-summary.qxd 14-9-2012 10:38 Page 100 Nazer-samenvatting.qxd 14-9-2012 10:38 Page 101

Samenvatting

inds zijn ontdekking in 1965 als plaag van kokospalm in Mexico is de kokosnootmijt SAceria guerreronis Keifer gemeld van andere landen, eerst in Zuid-Amerika, toen in Afrika en ten slotte ook in Azië. Met als doel de biologische bestrijding van deze plaag- mijt is in verscheidene landen op elk van de drie continenten gezocht naar natuurlijke vijanden die samen met A. guerreronis voorkomen. Voorafgaand aan het werk dat beschreven staat in dit proefschrift waren twee roofmijtsoorten (Acari: Phytoseiidae) gevonden in Brazilië, Tanzania, Benin en Sri Lanka – op basis van alleen morfologische kenmerken zijn de roofmijten geïdentificeerd als Neoseiulus paspalivorus DeLeon and N. baraki Athias-Henriot. Omdat deze soorten voorkomen in zeer verschillende geografische gebieden zou er wel eens genetische variatie kunnen bestaan tussen geografische populaties, die van belang kan zijn voor verbetering van de effectiviteit van biologische bestrijding. Doel van het werk beschreven in dit proefschrift is het bepalen van de genetische eenheden (o.a. biotypes, cryptische soorten, ondersoorten, ‘echte’ soorten) die relevant zijn binnen de context van biologische bestrijding. Daarom beslaat dit proefschrift in de eerste plaats een biosystematische studie – bestaande uit een combinatie van morfologische metingen, kruisingsproeven en moleculaire analyse – die als basis kan dienen voor toekomstig werk aan biologische bestrijding. Geografische populaties van N. paspalivorus bleken weliswaar morfologisch eender, maar reproductief incompatibel: vrouwtjes van elke populatie waren in staat om te paren met mannetjes van de andere populaties, maar ze legden daarna minder eieren, die in meerderheid verschrompelden (HOOFDSTUK 2). Genetisch – op basis van mitochon- driale CO1 sequenties – bleken de populaties identiek (HOOFDSTUK 3). Vervolgens zijn de drie populaties met behulp van 16S rDNA primers onderzocht op het voorkomen van twee endosymbiontische bacteriën, te weten Wolbachia en Cardinium, waarvan bekend is dat ze reproductieve abnormaliteiten bij hun gastheren kunnen veroorzaken. Ook zijn de fylogenetische relaties geanalyseerd (HOOFDSTUK 3). Verscheidene Wolbachia-stammen werden gevonden in de populaties uit Benin en Brazilië, terwijl een populatie uit Ghana alleen Cardinium-symbionten bleek te bevatten. Uitschakeling van de symbionten door middel van antibiotica maakte vrouwtjes van elke populatie incompatibel met mannetjes van de eigen populatie (dat wil zeggen: paring van vrouwtjes en mannetjes leidde niet tot nakomelingen). Bovendien bleek dat met deze proeven de compatibiliteit tussen populaties uit Benin en Brazilië hersteld werd in één richting, maar niet in de reciproke richting (dus wel succesvolle paring tussen vrouwtjes van de ene en mannetjes van de andere populatie, maar niet tussen mannetjes van de ene en vrouwtjes van de andere). Een dergelijke uitkomst wijst erop dat de incompatibiliteit het gevolg is

101 Nazer-samenvatting.qxd 14-9-2012 10:38 Page 102

Samenvatting

van de wisselwerking tussen genen uit de kern en genen uit het cytoplasma. Met antibiotica behandelde vrouwtjes van de Ghanese populatie produceerden nauwelijks nakomelingen, zodat we geen Cardinium-vrije lijn van mijten konden kruisen met andere populaties. De met de symbionten samenhangende reproductieve isolatie geeft aan dat genetische differentiatie tussen de drie populaties mogelijk is en dat het de moeite waard blijft om verschillen in eigenschappen te onderzoeken die van belang zijn voor de biologische bestrijding. Wij concluderen echter dat de drie populaties behoren tot een enkele soort. Op vergelijkbare wijze hebben we gevonden dat geografische populaties van de roofmijt N. baraki reproductief incompatibel zijn en genetisch verschillen op basis van mt-CO1 sequenties en enkele morfologische eigenschappen (zoals het aantal tanden op de onbeweeglijke helft [fixed digit] van de vrouwelijke monddelen [chelicera]) – deze populaties behoren daarom niet tot een enkele soort. Vooral de Beninese populatie week af van de andere populaties (uit Brazilië, Tanzania en mogelijk ook Sri Lanka) en er zou wel eens sprake kunnen zijn van twee cryptische soorten (HOOFDSTUK 4). Omdat bestudering van het holotype niet mogelijk was, kunnen we niet beslissen welke van de twee cryptische soorten de echte N. baraki is. Hoe dan ook, deze twee genetische eenheden lijken relevant voor vervolgonderzoek naar verschillen in eigenschappen die van belang zijn voor de biologische bestrijding. In elk van de geografische gebieden komt N. paspalivorus voor samen met (de ene of de andere cryptische soort die nauw verwant is met) N. baraki en in Afrika ook met een tweede roofmijt, namelijk N. neobaraki. Deze soorten kunnen samen voorkomen op een enkele palmboom, ze worden echter vrijwel nooit samen gevonden op een enkele kokosnoot of een enkele tros kokosnoten. Coexistentie op een regionale schaal, maar niet op lokale schaal, kan tot stand komen door voorrangseffecten (priority effects) binnen Lotka-Volterramodellen voor competitie tussen twee soorten om een enkele ‘resource’, en in modellen voor wederkerige predatie binnen voedingsgilden (reciprocal intraguild predation). De paringsproeven beschreven in HOOFDSTUK 5 van dit proefschrift brachten echter nog een ander mechanisme voor het tegengaan van plaatselijke coexistentie aan het licht. Paringen tussen soorten toonden het bestaan aan van (intraguild) predatie door vrouwtjes van de ene roofmijtsoort op mannetjes en larven van de andere. Aangezien grootte bepalend is voor de rolverdeling tussen (intraguild) predator en prooi, was de grootste van de drie roofmijtsoorten (N. neobaraki) agressie- ver dan de kleinste soort (N. paspalivorus). Dergelijke ‘intraguild’ interacties kunnen lei- den tot het verdwijnen van de (intraguild) prooi, niet alleen door sterfte als gevolg van vraat maar ook door het verkleinen van de kans voor vrouwtjes van de (intraguild) prooi om een mannetje te vinden om mee te paren. In het laatste deel van het proefschrift (HOOFDSTUK 6) wordt een actueel overzicht gegeven van alle soorten roofmijten die gevonden worden in de nauwe ruimte onder de

102 Nazer-samenvatting.qxd 14-9-2012 10:38 Page 103

Samenvatting

huid van de kokosnoot. Van de in totaal 60 soorten behoren er 32 tot de familie Phytoseiidae (of te wel 53% van alle individuele roofmijten). Binnen de Phytoseiidae domineren drie soorten: N. paspalivorus, N. baraki en N. neobaraki. In de meeste gebieden overheerst van deze drie soorten N. paspalivorus, mogelijk omdat mijten van deze soort het kleinst zijn en dus het makkelijkst toegang hebben tot de nauwe ruimte onder de huid van de kokosnoten. In Tanzania overheerst echter N. neobaraki, de grootste van de drie roofmijtsoorten – de verklaring daarvoor is nog onduidelijk. Vrijwel in alle gevallen zijn de mijten van (de twee cryptische soorten nauw verwant aan) N. baraki zowel inter- mediair in grootte als in aantal. De biologische eigenschappen van de twee meest voorkomende roofmijtsoorten worden opgesomd, voor zover bekend uit de literatuur of uit eigen onderzoek. Dit overzicht laat zien dat N. baraki en N. paspalivorus uit Brazilië een grotere populatiegroeipotentie hebben op een dieet van kokosnootmijten dan dezelfde twee soorten uit Afrika. Neoseiulus baraki (de twee cryptische soorten) uit Benin is echter beter in staat te overleven en zich voort te planten op een dieet van kokospalmstuifmeel dan die uit Brazilië. Vergeleken met (de twee soorten nauw verwant aan) N. baraki hebben populaties van N. paspalivorus een gelijke of grotere populatiegroeipotentie op een dieet van kokosnootmijten en ze variëren in de mate waarin ze zich kunnen voeden met kokospalmstuifmeel. De populaties uit Ghana en Brazilië (Acarau) kunnen verhoudingsgewijs goed overweg met stuifmeel, terwijl de populatie uit Benin er naar verhouding slecht in is. Al met al lijkt het erop dat populaties een kleinere groeipotentie hebben op een dieet van kokosnootmijten naarmate ze beter overweg kunnen met stuifmeel. Welke combinatie van eigenschappen het beste is voor de biologische bestrijding van de kokosnootmijt valt nog te bezien.

103 Nazer-samenvatting.qxd 14-9-2012 10:38 Page 104 Nazer-CV+Acknowl.qxd 14-9-2012 10:38 Page 105

Curriculum vitae

Nazer Famah Sourassou was born on December 31st, 1973 in Paratao (Togo). He started his school education in 1979, and obtained his primary school certificate ‘C.E.P.D.’ in 1985, and his secondary school certificate (B.E.P.C) in 1989. In the same year, he started his high school education at ‘Lyceé d’Enseignement General de Sokodé’ where he graduated with high school diploma ‘Baccalauréat D’. He started his university studies at the University of Lomé (Lomé, Togo) in 1994, stayed one year at the Faculty of Medical Science, before moving to the Faculty of Agriculture ‘Ecole Superieure d’Agronomie’. In November 2001, he graduated with ‘Diplôme d’Ingénieur Agronome’. He worked as research consultant at IITA-Benin till September 2005. In the same year he was granted a scholarship by the Vlaamse Interuniversitaire Raad (VLIR) to undertake a 2-year master programme in molecular biology in Belgium conjointly organized by the University of Brussels and the Catholic University of Leuven. He started in October 2005 and graduated in September 2007 with a diploma ‘Master of Science in molecular biology’. In 2008, he was granted a fellowship by the Netherlands Foundation for the Advancement of Tropical Research (WOTRO) and the International Institute of Tropical Agriculture (IITA). He started his PhD-project May 1st, 2008 at the Institute of Biodiversity and Ecosystem Dynamics (IBED), University of Amsterdam. In 2011, he was awarded a Donald E. Johnston fellowship to participate in the International Acarology Course held at Ohio State University, Columbus, USA.

105 Nazer-CV+Acknowl.qxd 14-9-2012 10:38 Page 106

Acknowledgements

would like to express my thanks to a number of people who in one way or another Icontributed to the preparation and completion of this Thesis. It is to them that I owe my deepest gratitude. First and foremost, I would like to express my deep and sincere gratitude to my Promotor, Professor Maurice W. Sabelis, who despite his many other academic and pro- fessional commitments was available every time I need him. His detailed and constructive comments have provided a good basis for the present thesis. His personal guidance and important support throughout this work have been of great value for me. I appre- ciated his great effort to explain things simply and clearly. Special thanks for giving the opportunity to attend the Acarology Summer Course in Columbus, Ohio, USA, and the 7th European Association of Acarology (EURAAC) Congress in Vienna, Austria. I am deeply grateful to my supervisor Dr. Rachid Hanna for giving me the opportunity to do this PhD study. The good advice, support and guidance throughout this study have been invaluable on both academic and personal level, for which I am extremely grateful. Thank you for your friendship, assistance over the past years. I also owe much gratitude to Dr. Hans Breeuwer, for allowing conducting my molecular work in his laboratory. His extensive and constructive discussions around my work have been very helpful. In the laboratories, I have been aided by many some people which I would like to express my gratitude: Richard Houndafoche, Pierre Sovimi, Bovis Bonaventure at the laboratory of IITA-Benin for their assistance in maintaining predatory mites and conducting experiences; Betsie Voetdijk, Peter Kuperus and Lin Dong for their assistance during molecular work at the University of Amsterdam. I also deserve my sincerest thanks to my colleagues from the International institute of Tropical Agriculture (IITA- Benin), and from the Institute of Biodiversity of Ecosystem Dynamics (IBED), University of Amsterdam. Their friendship and assistance has meant more to me than I could ever express. The financial support of the Board of the Netherlands Foundation for the advancement of Tropical Research (WOTRO) is gratefully acknowledged. Finally, I would like to express my greatest thanks to my family members, especially my wife Rahamatou Issaka and my sons Abdul-Raouf and Abdul-Madjid. Their infi- nite patience, encouragements and enthusiasm were important for the completion of this Thesis. A vous tous, je vous dis infinément merci. Bio-systematics of predatory mites used for control of the coconut mite

Bio-systematics of predatory mites used for control of the coconut mite Nazer Famah Sourassou Nazer

Nazer Famah Sourassou