DOCSLIB.ORG

Metaproteomics of a Gutless Marine Worm and Its Symbiotic Microbial

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Metaproteomics of a Gutless Marine Worm and Its Symbiotic Microbial Metaproteomics of a gutless marine worm and its PNAS PLUS symbiotic microbial community reveal unusual pathways for carbon and energy use Manuel Kleinera,b,1, Cecilia Wentrupa, Christian Lotta,c, Hanno Teelinga, Silke Wetzela, Jacque Youngd,e, Yun-Juan Changd, Manesh Shahd, Nathan C. VerBerkmoesd, Jan Zarzyckif, Georg Fuchsf, Stephanie Markertg, Kristina Hempelb, Birgit Voigtb, Dörte Becherb, Manuel Liebekeh,i, Michael Lalkh, Dirk Albrechtb, Michael Heckerb,g, Thomas Schwederg,h,1, and Nicole Dubiliera,1 aSymbiosis Group, Max Planck Institute for Marine Microbiology, 28359 Bremen, Germany; bInstitute for Microbiology and hInstitute of Pharmacy, University of Greifswald, 17487 Greifswald, Germany; cElba Field Station, HYDRA Institute for Marine Sciences, Località Fetovaia, 57034 Campo nell’Elba, Italy; dOak Ridge National Laboratory, Chemical Science Division, Oak Ridge, TN 37831; eGraduate School for Genome Science and Technology, University of Tennessee, Knoxville, TN 37996; fDepartment of Microbiology, Faculty of Biology, University of Freiburg, 79104 Freiburg, Germany; gInstitute of Marine Biotechnology, 17489 Greifswald, Germany; and iBiomolecular Medicine, Department of Surgery and Cancer, Faculty of Medicine, Imperial College London, London, United Kingdom SW7 2AZ Edited by Charles R. Fisher, Pennsylvania State University, University Park, PA, and accepted by the Editorial Board February 29, 2012 (received for review December 22, 2011) Low nutrient and energy availability has led to the evolution of pounds. Chemosynthetic symbioses thus are able to thrive in numerous strategies for overcoming these limitations, of which habitats where organic carbon sources are rare, such as the deep symbiotic associations represent a key mechanism. Particularly sea, and the symbionts often are so efficient at providing nutri- striking are the associations between chemosynthetic bacteria and tion that many hosts have reduced their digestive systems (4). marine animals that thrive in nutrient-poor environments such as The marine oligochaete Olavius algarvensis is a particularly the deep sea because the symbionts allow their hosts to grow on extreme example of a nutritional symbiosis: These worms are fi inorganic energy and carbon sources such as sul de and CO2. Re- dependent on their chemosynthetic symbionts for both their nu- MICROBIOLOGY markably little is known about the physiological strategies that trition and their excretion, because they have reduced their enable chemosynthetic symbioses to colonize oligotrophic envi- mouth, gut, and nephridial excretory organs completely (5). O. ronments. In this study, we used metaproteomics and metabolo- algarvensis lives in coarse-grained coastal sediments off the island mics to investigate the intricate network of metabolic interactions of Elba, Italy, and migrates between the upper oxidized and the in the chemosynthetic association between Olavius algarvensis, lower reduced sediment layers (6). It hosts a stable and specific a gutless marine worm, and its bacterial symbionts. We propose microbial consortium consisting of five bacterial endosymbionts previously undescribed pathways for coping with energy and nu- in its body wall: two aerobic or denitrifying gammaproteobacterial trient limitation, some of which may be widespread in both free- sulfur oxidizers (γ1- and γ3-symbionts), two anaerobic deltapro- living and symbiotic bacteria. These pathways include (i) a path- teobacterial sulfate reducers (δ1- and δ4-symbionts), and a spi- way for symbiont assimilation of the host waste products acetate, rochete with an unknown metabolism (7, 8). The sulfate-reducing propionate, succinate and malate; (ii) the potential use of carbon δ-symbionts provide the sulfur-oxidizing γ-symbionts with re- monoxide as an energy source, a substrate previously not known duced sulfur compounds as an internal energy source for auto- to play a role in marine invertebrate symbioses; (iii) the potential trophic CO fixation via the Calvin–Benson cycle, thus explaining use of hydrogen as an energy source; (iv) the strong expression of 2 how O. algarvensis can thrive in its sulfide-poor environment (6, high-affinity uptake transporters; and (v) as yet undescribed en- 9). As in all living organisms, the symbiosis is dependent on ex- ergy-efficient steps in CO fixation and sulfate reduction. The high 2 ternal energy sources, but to date the identity of these sources has expression of proteins involved in pathways for energy and car- remained unclear. bon uptake and conservation in the O. algarvensis symbiosis indi- Like the vast majority of symbiotic microbes, the O. algarvensis cates that the oligotrophic nature of its environment exerted a fi strong selective pressure in shaping these associations. symbionts have de ed cultivation attempts, making cultivation- independent techniques essential for their analysis. A meta- 3-hydroxypropionate bi-cycle | Calvin cycle | proton-translocating genomic analysis of the O. algarvensis symbionts yielded initial pyrophosphatase | pyrophosphate dependent phosphofructokinase | insights into their potential metabolism (9), but the incomplete metagenomics genome sequences hindered the reconstruction of complete met- abolic pathways, leaving many questions unanswered (10). Fur- rowth in nutrient-limited environments presents numerous Gchallenges to organisms. Symbiotic and syntrophic relation- ships have evolved as particularly successful strategies for coping with these challenges. Such nutritional symbioses are widespread Author contributions: M.K., G.F., B.V., D.B., M. Liebeke, M. Lalk, M.H., and T.S. designed research; M.K., C.W., C.L., H.T., S.W., J.Y., Y.-J.C., N.C.V., J.Z., K.H., M. Liebeke, and D.A. in nature and, for example, have enabled plants to colonize ni- performed research; N.C.V., G.F., M. Lalk, M.H., T.S., and N.D. contributed new reagents/ trogen-poor soils and animals to thrive on food sources that lack analytic tools; M.K., C.W., J.Y., M.S., N.C.V., J.Z., S.M., B.V., D.B., M. Liebeke, and N.D. essential amino acids and vitamins (1). Chemosynthetic symbi- analyzed data; and M.K. and N.D. wrote the paper. oses, discovered only 35 years ago at hydrothermal vents in the The authors declare no conflict of interest. deep sea, revolutionized our understanding of nutritional asso- This article is a PNAS Direct Submission. C.R.F. is a guest editor invited by the Editorial Board. ciations, because these symbioses enable animals to live on in- Freely available online through the PNAS open access option. organic energy and carbon sources such as sulfide and CO2 (2, 3). 1To whom correspondence may be addressed. E-mail: [email protected], The chemosynthetic symbionts use the energy obtained from [email protected], or [email protected]. fi fi oxidizing reduced inorganic compounds such as sul de to x This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. CO2, ultimately providing their hosts with organic carbon com- 1073/pnas.1121198109/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1121198109 PNAS Early Edition | 1of10 Downloaded by guest on October 1, 2021 thermore, as in all genomic analyses, detailed insights into the physiology and metabolism of an organism are limited, because these analyses can predict only the metabolic potential of an or- ganism, not its actual metabolism and physiology (11). This lim- itation is most apparent in a multimember community in which the interactions between the different members and between these members and their environment lead to a level of metabolic complexity that can greatly exceed the predictive ability of genomic reconstructions from single species. Although metagenomic analyses reveal the metabolic poten- tial of a microbial community, metaproteomic and metabolomic analyses provide evidence for the metabolic and physiological processes that actually are used by the community. In this study, we used metaproteomics and metabolomics as well as enzyme assays and in situ analyses of potential energy sources to gain an in-depth understanding of the intricate interactions between O. algarvensis and its microbial symbiont community and between the members of this community and their environment. Our goal was to identify the compounds that provide energy for the Fig. 1. Positive effect of symbiont enrichment using density-gradient cen- symbiosis, the functional roles of the different partners, and their trifugation. Enrichment considerably increased the number of identified interactions within the symbiosis. proteins from a given symbiont compared with analyses of whole worms. Average protein numbers were calculated for 2D LC-MS/MS experiments (SI γ δ Results and Discussion Appendix, Table S1). n = 2 for 1-symbiont enrichments; n = 2 for 1-sym- biont enrichments; and n = 4 for whole-worm samples. Both metagenomic High Coverage of the Symbiosis Metaproteome and Metabolome. We and proteomic binning information was used for assignment of proteins to identified and quantified a total of 2,819 proteins and 97 a symbiont. metabolites in O. algarvensis and its symbiotic community (SI Appendix, Tables S1 and S2 and Datasets S1 and S2) using dif- ferent methods for both the metaproteomic and the metab- teomic analyses are consistent with this model of syntrophic olomic analyses to overcome the intrinsic biases inherent in sulfur cycling, with abundantly expressed sulfur oxidation pro- a single detection method (SI Appendix, SI Text). For host pro- teins detected in the γ-symbionts and sulfate reduction proteins
Load more

Recommended publications
  • Galactokinase (B) Glucokinase (C) Galactose-1-Phosphate Uridyltransferase (D) UDP-Galactose 4- Epimerase Sol
    1. Which of the following enzymes are not involved in galactose metabolism? (a) Galactokinase (b) Glucokinase (c) Galactose-1-Phosphate Uridyltransferase (d) UDP-Galactose 4- epimerase Sol. (b) Glucokinase. 2. Which of the following enzymes leads to a glycogen storage disease known as Tarui’s disease? (a) Glucokinase (b) Pyruvate Kinase (c) Phosphofructokinase (d) Phosphoglucomutase Sol. (c) Phosphofructokinase. 3. Which of the following enzymes is defective in galactosemia- a fatal genetic disorder in infants? (a) Glucokinase (b) Galactokinase (c) UDP-Galactose 4- epimerase (d) Galactose-1-Phosphate Uridyltransferase Sol. (d) Galactose-1-Phosphate Uridyltransferase. 4. Which of the following enzyme deficiency leads to hemolytic anaemia? (a) Glucokinase (b) Pyruvate Kinase (c) Phosphoglucomutase (d) Phosphofructokinase Sol. (b) Pyruvate Kinase. 5. Which of the following glucose transporters are important in fructose transport in the intestine? (a) GLUT5 (b) GLUT3 (c) GLUT4 (d) GLUT7 Sol. (a) GLUT5. 6. Which of the following is a tricarboxylic acid? (a) Acetic acid (b) Succinic acid (c) Oxaloacetic acid (d) Citric acid Sol.(d) Citric acid. 7. Which of the following enzymes plays an important role in tumour metabolism? (a) Glucokinase (b) Pyruvate Kinase M2 (c) Phosphoglucomutase (d) Phosphofructokinase Sol. (b) Pyruvate Kinase M2. 8. Which of the following metabolites negatively regulates pyruvate kinase? 1. (a) Citrate (b) Alanine (c) Acetyl CoA (d) Fructose-1,6-Bisphosphate Sol. (b) Alanine 9. The glycerol phosphate shuttle functions in___________. (a) Lipid catabolism (b) Triglyceride synthesis (c) Anaerobic glycolysis for the regeneration of NAD (d) Aerobic glycolysis to transport NADH equivalents resulting from glycolysis into mitochondria. Sol. (d) Aerobic glycolysis to transport NADH equivalents resulting from glycolysis into mitochondria.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Pyruvate-Phosphate Dikinase of Oxymonads and Parabasalia and the Evolution of Pyrophosphate-Dependent Glycolysis in Anaerobic Eukaryotes† Claudio H
    EUKARYOTIC CELL, Jan. 2006, p. 148–154 Vol. 5, No. 1 1535-9778/06/$08.00ϩ0 doi:10.1128/EC.5.1.148–154.2006 Copyright © 2006, American Society for Microbiology. All Rights Reserved. Pyruvate-Phosphate Dikinase of Oxymonads and Parabasalia and the Evolution of Pyrophosphate-Dependent Glycolysis in Anaerobic Eukaryotes† Claudio H. Slamovits and Patrick J. Keeling* Canadian Institute for Advanced Research, Botany Department, University of British Columbia, 3529-6270 University Boulevard, Vancouver, British Columbia V6T 1Z4, Canada Received 29 September 2005/Accepted 8 November 2005 In pyrophosphate-dependent glycolysis, the ATP/ADP-dependent enzymes phosphofructokinase (PFK) and pyruvate kinase are replaced by the pyrophosphate-dependent PFK and pyruvate phosphate dikinase (PPDK), respectively. This variant of glycolysis is widespread among bacteria, but it also occurs in a few parasitic anaerobic eukaryotes such as Giardia and Entamoeba spp. We sequenced two genes for PPDK from the amitochondriate oxymonad Streblomastix strix and found evidence for PPDK in Trichomonas vaginalis and other parabasalia, where this enzyme was thought to be absent. The Streblomastix and Giardia genes may be related to one another, but those of Entamoeba and perhaps Trichomonas are distinct and more closely related to bacterial homologues. These findings suggest that pyrophosphate-dependent glycolysis is more widespread in eukaryotes than previously thought, enzymes from the pathway coexists with ATP-dependent more often than previously thought and may be spread by lateral transfer of genes for pyrophosphate-dependent enzymes from bacteria. Adaptation to anaerobic metabolism is a complex process (PPDK), respectively (for a comparison of these reactions, see involving changes to many proteins and pathways of critical reference 21).
    [Show full text]
  • The Gut Microbiome of the Sea Urchin, Lytechinus Variegatus, from Its Natural Habitat Demonstrates Selective Attributes of Micro
    FEMS Microbiology Ecology, 92, 2016, fiw146 doi: 10.1093/femsec/fiw146 Advance Access Publication Date: 1 July 2016 Research Article RESEARCH ARTICLE The gut microbiome of the sea urchin, Lytechinus variegatus, from its natural habitat demonstrates selective attributes of microbial taxa and predictive metabolic profiles Joseph A. Hakim1,†, Hyunmin Koo1,†, Ranjit Kumar2, Elliot J. Lefkowitz2,3, Casey D. Morrow4, Mickie L. Powell1, Stephen A. Watts1,∗ and Asim K. Bej1,∗ 1Department of Biology, University of Alabama at Birmingham, 1300 University Blvd, Birmingham, AL 35294, USA, 2Center for Clinical and Translational Sciences, University of Alabama at Birmingham, Birmingham, AL 35294, USA, 3Department of Microbiology, University of Alabama at Birmingham, Birmingham, AL 35294, USA and 4Department of Cell, Developmental and Integrative Biology, University of Alabama at Birmingham, 1918 University Blvd., Birmingham, AL 35294, USA ∗Corresponding authors: Department of Biology, University of Alabama at Birmingham, 1300 University Blvd, CH464, Birmingham, AL 35294-1170, USA. Tel: +1-(205)-934-8308; Fax: +1-(205)-975-6097; E-mail: [email protected]; [email protected] †These authors contributed equally to this work. One sentence summary: This study describes the distribution of microbiota, and their predicted functional attributes, in the gut ecosystem of sea urchin, Lytechinus variegatus, from its natural habitat of Gulf of Mexico. Editor: Julian Marchesi ABSTRACT In this paper, we describe the microbial composition and their predictive metabolic profile in the sea urchin Lytechinus variegatus gut ecosystem along with samples from its habitat by using NextGen amplicon sequencing and downstream bioinformatics analyses. The microbial communities of the gut tissue revealed a near-exclusive abundance of Campylobacteraceae, whereas the pharynx tissue consisted of Tenericutes, followed by Gamma-, Alpha- and Epsilonproteobacteria at approximately equal capacities.
    [Show full text]
  • Annelida, Oligochaeta) from the Island of Elba (Italy)
    Org. Divers. Evol. 2, 289–297 (2002) © Urban & Fischer Verlag http://www.urbanfischer.de/journals/ode Taxonomy and new bacterial symbioses of gutless marine Tubificidae (Annelida, Oligochaeta) from the Island of Elba (Italy) Olav Giere1,*, Christer Erséus2 1 Zoologisches Institut und Zoologisches Museum, Universität Hamburg, Germany 2 Department of Invertebrate Zoology, Swedish Museum of Natural History, Stockholm Received 15 April 2002 · Accepted 9 July 2002 Abstract In shallow sublittoral sediments of the north-west coast of the Island of Elba, Italy, a new gutless marine oligochaete, Olavius ilvae n. sp., was found together with a congeneric but not closely related species, O. algarvensis Giere et al., 1998. In diagnostic features of the genital organs, the new species differs from other Olavius species in having bipartite atria and very long, often folded spermathecae, but lacking penial chaetae.The Elba form of O. algarvensis has some structural differences from the original type described from the Algarve coast (Portugal).The two species from Elba share characteristics not previously reported for gutless oligochaetes: the lumen of the body cavity is unusually constrict- ed and often filled with chloragocytes, and the symbiotic bacteria are often enclosed in vacuoles of the epidermal cells. Regarding the bacterial ultrastructure, the species share three similar morphotypes as symbionts; additionally, in O. algarvensis a rare fourth type was found.The diver- gence of the symbioses in O. algarvensis, and the coincidence in structural
    [Show full text]
  • Bellec Et Al.5)
    Chemosynthetic ectosymbionts associated with a shallow-water marine nematode Laure Bellec, Marie-Anne Cambon Bonavita, Stéphane Hourdez, Mohamed Jebbar, Aurélie Tasiemski, Lucile Durand, Nicolas Gayet, Daniela Zeppilli To cite this version: Laure Bellec, Marie-Anne Cambon Bonavita, Stéphane Hourdez, Mohamed Jebbar, Aurélie Tasiemski, et al.. Chemosynthetic ectosymbionts associated with a shallow-water marine nematode. Scientific Reports, Nature Publishing Group, 2019, 9 (1), 10.1038/s41598-019-43517-8. hal-02265357 HAL Id: hal-02265357 https://hal.archives-ouvertes.fr/hal-02265357 Submitted on 9 Aug 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. www.nature.com/scientificreports OPEN Chemosynthetic ectosymbionts associated with a shallow-water marine nematode Received: 30 October 2018 Laure Bellec1,2,3,4, Marie-Anne Cambon Bonavita2,3,4, Stéphane Hourdez5,6, Mohamed Jebbar 3,4, Accepted: 2 April 2019 Aurélie Tasiemski 7, Lucile Durand2,3,4, Nicolas Gayet1 & Daniela Zeppilli1 Published: xx xx xxxx Prokaryotes and free-living nematodes are both very abundant and co-occur in marine environments, but little is known about their possible association. Our objective was to characterize the microbiome of a neglected but ecologically important group of free-living benthic nematodes of the Oncholaimidae family.
    [Show full text]
  • Pyrophosphate-Dependent Enzymes in Walled Bacteria Phylogenetically Related to the Wall-Less Bacteria of the Class Mollicutes?
    INTERNATIONALJOURNAL OF SYSTEMATICBACTERIOLOGY, Oct. 1989, p. 413419 Vol. 39, No. 4 OO20-7713/89/O4O413-07$02.00/0 Copyright 0 1989, International Union of Microbiological Societies Pyrophosphate-Dependent Enzymes in Walled Bacteria Phylogenetically Related to the Wall-Less Bacteria of the Class Mollicutes? JAMES P. PETZEL,'S PAUL A. HARTMAN,'* AND MILTON J. ALLISON2 Department of Microbiology, Iowa State University, Ames, Iowa 5001 1-321I ,I and National Animal Disease Center, U.S. Department of Agriculture, Ames, Iowa 500102 Some of the wall-less bacteria of the class Mollicutes (mycoplasmas) have pyrophosphate (PP,)-dependent enzymic activities, including PP,-dependent phosphofructokinase (PP,-PFK), PP,-dependent nucleoside kinase, and pyruvate,orthophosphate dikinase (PPDK) activities. In most other bacteria, adenosine 5'-triphosphate (ATP), not PP,, is the cofactor of analogous enzymic reactions. Because PP,-dependent enzymes are more common among mollicutes than other bacteria, we describe here an examination of the six walled bacteria that have been reported to be phylogenetically related to the mollicutes (Clostridium innocuum, Clostridium ramosum, Erysipelothrix rhusiopathiae, Lactobacillus catenaformis, Lactobacillus vitulinus, and Streptococcus pleomorphus) for PP,-PFK, ATP-dependent PFK, phosphoenolpyruvate carboxytransphosphorylase, PPDK, and PP,- and ATP-dependent acetate kinases. Two anaerobic mollicutes, Anaeroplasma intermedium and Asteroleplasma anuerobium, were also tested. C. innocuum, E. rhusiopathiue, S. pleomorphus, and Anuero- plasma intermedium had PPi-PFK activities, whereas C. ramosum, the two lactobacilli, and Asteroleplasma anaerobium had only ATP-dependent PFK activities. Asteroleplasma anaerobium and all of the walled bacteria except E. rhusiopathiue had PPDK activities. All of the species except Asteroleplasma anaerobium and E. rhusiopathiae also had pyruvate kinase activities; the effects of allosteric activators were tested.
    [Show full text]
  • Phylogenetic and Functional Characterization of Symbiotic Bacteria in Gutless Marine Worms (Annelida, Oligochaeta)
    Phylogenetic and functional characterization of symbiotic bacteria in gutless marine worms (Annelida, Oligochaeta) Dissertation zur Erlangung des Grades eines Doktors der Naturwissenschaften -Dr. rer. nat.- dem Fachbereich Biologie/Chemie der Universität Bremen vorgelegt von Anna Blazejak Oktober 2005 Die vorliegende Arbeit wurde in der Zeit vom März 2002 bis Oktober 2005 am Max-Planck-Institut für Marine Mikrobiologie in Bremen angefertigt. 1. Gutachter: Prof. Dr. Rudolf Amann 2. Gutachter: Prof. Dr. Ulrich Fischer Tag des Promotionskolloquiums: 22. November 2005 Contents Summary ………………………………………………………………………………….… 1 Zusammenfassung ………………………………………………………………………… 2 Part I: Combined Presentation of Results A Introduction .…………………………………………………………………… 4 1 Definition and characteristics of symbiosis ...……………………………………. 4 2 Chemoautotrophic symbioses ..…………………………………………………… 6 2.1 Habitats of chemoautotrophic symbioses .………………………………… 8 2.2 Diversity of hosts harboring chemoautotrophic bacteria ………………… 10 2.2.1 Phylogenetic diversity of chemoautotrophic symbionts …………… 11 3 Symbiotic associations in gutless oligochaetes ………………………………… 13 3.1 Biogeography and phylogeny of the hosts …..……………………………. 13 3.2 The environment …..…………………………………………………………. 14 3.3 Structure of the symbiosis ………..…………………………………………. 16 3.4 Transmission of the symbionts ………..……………………………………. 18 3.5 Molecular characterization of the symbionts …..………………………….. 19 3.6 Function of the symbionts in gutless oligochaetes ..…..…………………. 20 4 Goals of this thesis …….…………………………………………………………..
    [Show full text]
  • Envall Et Al
    Molecular Phylogenetics and Evolution 40 (2006) 570–584 www.elsevier.com/locate/ympev Molecular evidence for the non-monophyletic status of Naidinae (Annelida, Clitellata, TubiWcidae) Ida Envall a,b,c,¤, Mari Källersjö c, Christer Erséus d a Department of Zoology, Stockholm University, SE-106 91 Stockholm, Sweden b Department of Invertebrate Zoology, Swedish Museum of Natural History, Box 50007, SE-104 05 Stockholm, Sweden c Laboratory of Molecular Systematics, Swedish Museum of Natural History, Box 50007, SE-104 05 Stockholm, Sweden d Department of Zoology, Göteborg University, Box 463, SE-405 30 Göteborg, Sweden Received 24 October 2005; revised 9 February 2006; accepted 15 March 2006 Available online 8 May 2006 Abstract Naidinae (former Naididae) is a group of small aquatic clitellate annelids, common worldwide. In this study, we evaluated the phylo- genetic status of Naidinae, and examined the phylogenetic relationships within the group. Sequence data from two mitochondrial genes (12S rDNA and 16S rDNA), and one nuclear gene (18S rDNA), were used. Sequences were obtained from 27 naidine species, 24 species from the other tubiWcid subfamilies, and Wve outgroup taxa. New sequences (in all 108) as well as GenBank data were used. The data were analysed by parsimony and Bayesian inference. The tree topologies emanating from the diVerent analyses are congruent to a great extent. Naidinae is not found to be monophyletic. The naidine genus Pristina appears to be a derived group within a clade consisting of several genera (Ainudrilus, Epirodrilus, Monopylephorus, and Rhyacodrilus) from another tubiWcid subfamily, Rhyacodrilinae. These results dem- onstrate the need for a taxonomic revision: either Ainudrilus, Epirodrilus, Monopylephorus, and Rhyacodrilus should be included within Naidinae, or Pristina should be excluded from this subfamily.
    [Show full text]
  • High Content of Proteins Containing 21St and 22Nd Amino Acids
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Vadim Gladyshev Publications Biochemistry, Department of July 2007 High content of proteins containing 21st and 22nd amino acids, selenocysteine and pyrrolysine, in a symbiotic deltaproteobacterium of gutless worm Olavius algarvensis Yan Zhang University of Nebraska-Lincoln, [email protected] Vadim N. Gladyshev University of Nebraska-Lincoln, [email protected] Follow this and additional works at: https://digitalcommons.unl.edu/biochemgladyshev Part of the Biochemistry, Biophysics, and Structural Biology Commons Zhang, Yan and Gladyshev, Vadim N., "High content of proteins containing 21st and 22nd amino acids, selenocysteine and pyrrolysine, in a symbiotic deltaproteobacterium of gutless worm Olavius algarvensis" (2007). Vadim Gladyshev Publications. 56. https://digitalcommons.unl.edu/biochemgladyshev/56 This Article is brought to you for free and open access by the Biochemistry, Department of at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Vadim Gladyshev Publications by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. 4952–4963 Nucleic Acids Research, 2007, Vol. 35, No. 15 Published online 11 July 2007 doi:10.1093/nar/gkm514 High content of proteins containing 21st and 22nd amino acids, selenocysteine and pyrrolysine, in a symbiotic deltaproteobacterium of gutless worm Olavius algarvensis Yan Zhang and Vadim N. Gladyshev* Department of Biochemistry, University of Nebraska, Lincoln, NE 68588-0664, USA Received May 24, 2007; Revised and Accepted June 14, 2007 ABSTRACT bacteria and eukaryotes (1–4). Biosynthesis of Sec and its cotranslational insertion into polypeptides require a Selenocysteine (Sec) and pyrrolysine (Pyl) are rare complex molecular machinery that recodes in-frame UGA amino acids that are cotranslationally inserted into codons, which normally function as stop signals, to serve proteins and known as the 21st and 22nd amino as Sec codons (5–9).
    [Show full text]
  • Chemosynthetic Symbiont with a Drastically Reduced Genome Serves As Primary Energy Storage in the Marine Flatworm Paracatenula
    Chemosynthetic symbiont with a drastically reduced genome serves as primary energy storage in the marine flatworm Paracatenula Oliver Jäcklea, Brandon K. B. Seaha, Målin Tietjena, Nikolaus Leischa, Manuel Liebekea, Manuel Kleinerb,c, Jasmine S. Berga,d, and Harald R. Gruber-Vodickaa,1 aMax Planck Institute for Marine Microbiology, 28359 Bremen, Germany; bDepartment of Geoscience, University of Calgary, AB T2N 1N4, Canada; cDepartment of Plant & Microbial Biology, North Carolina State University, Raleigh, NC 27695; and dInstitut de Minéralogie, Physique des Matériaux et Cosmochimie, Université Pierre et Marie Curie, 75252 Paris Cedex 05, France Edited by Margaret J. McFall-Ngai, University of Hawaii at Manoa, Honolulu, HI, and approved March 1, 2019 (received for review November 7, 2018) Hosts of chemoautotrophic bacteria typically have much higher thrive in both free-living environmental and symbiotic states, it is biomass than their symbionts and consume symbiont cells for difficult to attribute their genomic features to either functions nutrition. In contrast to this, chemoautotrophic Candidatus Riegeria they provide to their host, or traits that are necessary for envi- symbionts in mouthless Paracatenula flatworms comprise up to ronmental survival or to both. half of the biomass of the consortium. Each species of Paracate- The smallest genomes of chemoautotrophic symbionts have nula harbors a specific Ca. Riegeria, and the endosymbionts have been observed for the gammaproteobacterial symbionts of ves- been vertically transmitted for at least 500 million years. Such icomyid clams that are directly transmitted between host genera- prolonged strict vertical transmission leads to streamlining of sym- tions (13, 14). Such strict vertical transmission leads to substantial biont genomes, and the retained physiological capacities reveal and ongoing genome reduction.
    [Show full text]
  • High Diversity of Anaerobic Alkane-Degrading Microbial Communities in Marine Seep Sediments Based on (1-Methylalkyl)Succinate Synthase Genes
    ORIGINAL RESEARCH published: 07 January 2016 doi: 10.3389/fmicb.2015.01511 High Diversity of Anaerobic Alkane-Degrading Microbial Communities in Marine Seep Sediments Based on (1-methylalkyl)succinate Synthase Genes Marion H. Stagars1,S.EmilRuff1,2† , Rudolf Amann1 and Katrin Knittel1* 1 Department of Molecular Ecology, Max Planck Institute for Marine Microbiology, Bremen, Germany, 2 HGF MPG Joint Research Group for Deep-Sea Ecology and Technology, Max Planck Institute for Marine Microbiology, Bremen, Germany Edited by: Alkanes comprise a substantial fraction of crude oil and are prevalent at marine seeps. Hans H. Richnow, These environments are typically anoxic and host diverse microbial communities that Helmholtz Centre for Environmental Research, Germany grow on alkanes. The most widely distributed mechanism of anaerobic alkane activation Reviewed by: is the addition of alkanes to fumarate by (1-methylalkyl)succinate synthase (Mas). Here Beth Orcutt, we studied the diversity of MasD, the catalytic subunit of the enzyme, in 12 marine Bigelow Laboratory for Ocean sediments sampled at seven seeps. We aimed to identify cosmopolitan species as well Sciences, USA Zhidan Liu, as to identify factors structuring the alkane-degrading community. Using next generation China Agricultural University, China sequencing we obtained a total of 420 MasD species-level operational taxonomic units *Correspondence: (OTU0.96) at 96% amino acid identity. Diversity analysis shows a high richness and Katrin Knittel [email protected] evenness of alkane-degrading bacteria. Sites with similar hydrocarbon composition harbored similar alkane-degrading communities based on MasD genes; the MasD †Present address: community structure is clearly driven by the hydrocarbon source available at the various S.
    [Show full text]