Acquired Tolerance to Oxygen Stress in Bifidobacterium longum Title 105-A by Heterologous Expression of Catalase Gene( 本文 （FULLTEXT) )
Author(s) 賀, 建龍
Report No.(Doctoral Degree) 博士(農学) 甲第583号
Issue Date 2012-03-13
Type 博士論文
Version publisher
URL http://hdl.handle.net/20.500.12099/42969
※この資料の著作権は、各資料の著者・学協会・出版社等に帰属します。
Contents
1. Introduction---I------1
1.1 Bljidobacterium------1 1.1.1 Description------1
1.1.2 History------4
1.1.3 Species------'------I------5
1.1.4 Ecology------6
1.2 Peroxidase------9
1.2.1 Description------i--i------9
1.2.2 GPX------i------10
1.2.3 Catalase------J------12
1.2.3. 1 Molecular mechanism------1 3
1.2.3.2 Cellular role------14
1.2.3.3 Distribution among organisms------1 5
1.3 Research the response of the Bljidobacterium to Oxygen------1 7
2. Materials and Methods------20
2. 1 Media and Buffer------i------20
2. 1.1 Luria Broth media------20
2.1.2 MRS media------,------20 2.1.3 TE buffer------I------21
2.1.4 PEG------:------21 2. 1.5 PBS buffer--I------21
2.2 Isolate DNA from microorganisms------2 1
2.3 Extract plasmid------2 1
2.3.1 With QIA prep spin Mini prep kit------21 2.3.2 With 2-propano1------22
2.3.2. 1 The reagent------.------22 2.3.2.1. 1 Solution I------22
2.3.2. 1.2 Solution II------22
2.3.2. 1.3 Solution III------22
2.3.2.2 Protocol------22
2.4 Purify DNA------23
2.4.1 With Nucleo Spin Extract II kit------24
2.4.2 With Ethano1------24
I 2.4.2. 1 The reagent------24 2.4.2.2 Protocol------24
I 2.4.3 With PEG------25
2.4.3. 1 The reagent------25 2.4.3.2 Protocol------25
2.5 Preparation of competent cell------25
2.5.1 Electrocompetent cell of BiBdobacterium------25
2.5. 1.1 The reagent------25 2.5.1.2 Protocol------26
2.5.2 Chemically competent cell of E.boli------26
2.5.2. 1 The reagent------26 2.5.2.2 Protocol------27
2.6 SDS-PAGE------i------27
2.6.1 The reagent------27 2.6.2 Protocol------i-I--29
2.7 Detection activity of catalase------32 2.7.1 Add H202 detect activity.f catalas;------i------32 2.7.1.1 The the.,y-;------i------32 2.7. 1.2 Protocol------.------32
2.7.2 Assay ofcatalase------32
2.7.2. 1 The reagent------33 2.7.2.2 Protocol------33
2.8 Short-term H202 exposure------34
2.8.1 The reagent------34 2.8.2 Protocol------34
2.9 Long-term with aerated cultures------35
2.9.1 The reagent------35 2.9.2 Protocol---I""_"___"__"______"__""_MM___M""__"Mum""__"__35
2. 10 PCR------3 5
2.10.1 With po1ymerase KOD-PLUS------i------35
2.10.2 With po1ymerase GO Taq------35 2. 1 1 DNA extraction from qgarose gels------36 2.12 Digestion with restriction enzyme------T------36 2. 12. 1 The restricti.n enzyme------J-i------36 2. 12.2 Protocol------36
2. 13 DNA ligation------I------36
2. 14 Transformation------36
2. 14.1 Chemical transformation------37
2. 14. 1.1 The reagent------37 2. 14. 1.2 Protocol------37
II 2. 14.2 Electroporation------38
2. 14.2. 1 The reagent-----;------38 2. 14.2.2 Protocol------i--38
2. 1 5 Gateway system------3 8
2.16 Flow cytometry------39
2. 16.1 The reagent------.------39 2. 16.2 The instrument------39
2. 17 Isolate RNA from microorganisms------I------39 2. 18 RT-PCR------39
2.19 qRT-PCR------39
2.19.1 The reagent------39 2. 19.2 The instrument------39
2.20 Assay of H202------40 2.20. 1 The reagent------i------40 2.20.2 Protocol------40
2.2 1 Site-Directed Mutagenesis------40
2.22 The strains, the plasmids and primers------42
3. Results------44
3.1 Isolate DNA &om microorganisms------i------44
3.2 Get the PCR product------45
3.2.1 Design the prim'ers------45 3.2.2 PCR------45
3.2.2. 1 PCR of Hup-promoter------45
3.2.2.2 PCR ofB-KatE------i_"MUM"___"__47
3.2.2.3 PCR of Hup-terminator------48
3.2.2.4 Overlap PCR------49
3.3 Construct destination vector------50
3.3.1 Digest pKKT427------50
3.3.2 Construct destination vector pGUOO1------51
3.4 Construct the plasmids------53
3.4. 1 BP reaction------53 3.4.2 LR ,eacti.n------_M"_"_"____""""q_____"_:MM____56 3.5 Analyze the sequences------57 3.5.1 Hup-promoter------58
3.5.2 Hup-terminator------58
3.5.3 Catalase gene------58
III 3.6 The catalase activity in E. coli UM255------58
3.7 The catalase activity in B. longum 1 05-A--.------59 3.7.1 pBCATOO1 (Heme-catalase)activity------59 3.8 Short-term H202 exposure OfB.longum 105-A------63
3.9 Long-term with aerated cultures ofB.longum 105-A-i------64 3.9. 1 0D------64
3.9.2 CFU------65
3.9.3 LIVE/DEAD------66
3.9.4 H202 accumulation------67
4. Discussion------68
4. 1 Protect Bljidobacterium from oxidative stress by expression of catalase---68
4.2 Improvement of catalase expression level------7 1 4.2.1 Transcription------71
4.2.2 Translation------75
5. Conclusion------85
6. References------89
7. Acknowledgments------1 0 1
IV Intro duction
1.1 Bljidobacterium
1.1.1- Description
At birth, the gastrointestinal tract is sterile and incapable of digesting food. Within
hours, bacteria ingested during the birthing process rapidly colonize the gut. The
as bacteria as are gastrointestinal tract soon contains about 1 0 times many there cells
in the body. Hundreds of species are present, many of which are uncultivable and
for remain unidentified. It is these bacteria that are responsible priming the
bacteria, gastrointestinal immune system. This gut flora includes 100 trillion some
three pounds, which are intimately linked to the bodyTs natural defense system. (18)
probiotics are deflned as live microbial food ingredients that benefit human health.
Most probiotics fall into the group of organisms known as lactic acid-producing
bacteria and are normally consumed in the form of yogurt, fermented milks or other
fermented foods. The concept ofprobiotics arose at the turn of the 20th century from
a hypothesis flrSt Proposed by. Noble Prize winning Russian scientist Elie
Metchnikoff, who suggest that the long, healthy life of Bulgarian peasants resulted
from their consumption of fermented milk products. He believed that when consumed,
the fermenting Bacillus (Lactobacillus)positively influenced the micro flora of the
colon, decreasing toxic microbial activities. The historical association of probiotics
with fermented dairy products, still true today, stems from these early observations.
Investigations in the probiotics field during the past several decades, however, have
expanded beyond bacteria isolated from fermented dairy products to those of
intestinal origin. (61,67, 76)
1 Possible health effects of probiotics
Intestinal eHects
･ Relieve effects, promote recovery from diarrhea (rotavirus,travelers' and
antibioticinduced)
･ produce lactase, alleviate symptoms of lactose intolerance and malabsorption
･ Relieve constipation
･ Treat colitis
Immune system eHects
･ Enhance specific and nonspeciflC immune response
･ Inhibit pathogen growth and translocation
･ Stimulate gastrointestinal immunity
･ Reduce chance of infection from common pathogens (Salmonella,Shigella)
Other eHects
･ Reduce risk of certain cancers (colon,bladder)
･ Detoxify carcinogens
･ Suppress tumors
･ Lower' serum cholesterol concentrations
･ Reduce blood pressure in hypertensives
･ Treat food allergies
･ synthesize nutrients (folicacid, niacin, riboflavin, vitamins B6 & B 12)
･ Increase nutrient bioavailability
･ Improve urogenital health
･ Optimize effects of vaccines (e.g.rotavirus vaccine, typhoid fever vaccine)
There is some debate about whether or not yogurt starter bacteria should be
bulgaricus consideredprobiotics. The yogurt starter cultures Lactobacillus and
2 Streptotoccus thermophilus are used to ferment milk and turn it into yogurt. But these cultures are not very resistant to conditions in the stomach and small intestine and
'Therefore, generally do not reach the gastrointestinal tract in very high numbers. they cannot mediate some probiotic effects. But these starter bacteria have been shown to improve lactose digestion in people lacking lactase and have demonstrated some itnmunity enhancing effects. For these reasons, they are often considered 'probiotic'.
Most gastrointestinal organisms are relatively benign. Some are potentially more pathogenic; however, many are actually beneficial; it is these beneBcial organisms that have attracted attention as.possible probiotics. The table below lists some suggested health benefits of consuming probiotics. Those that have signiflCant research to back up the claims are discussed in more depth later in this article. (79)
Bljidobacterium, one type of probiotics, are a natural part of the bacterial flora in the human body and have a symbiotic bacteria-host relationship with humans. B. longum promotes good digestion, boosts the immune system, and produces lactic and acetic acid that controls intestinal pH. These bacteria also inhibit the growth of
Candida albicans, E. coli (9),and other bacteria that have more pathogenic qualities than Bljidobacterium. Bljidobacterium are normal inhabitants of the human and animal colon. Newborns, especially those that are breast-fed, are colonized with bifldobacteria within days after birth. Bljidobacteriumwere first isolated &om the feces of breast-fed infants. The population of these bacteria in the colon appears relatively stable until advanced age, when it seems to decline. They are saccharolytic organisms that produce acetic and lactic acids without generation of CO2, except during degradation of gluconate. They are also classified as lactic acid bacteria
(LAB). (76,18)
3 Bindobacterium www. sciencephoto. com
1.1.2 History
Bljidobacterium was Brst isolated as a bacteria in France in 1899. It was found in a healthy breast-fed baby, but the bacteria did not come from the breast milk. It came
B-om something the baby had consumed. The first name bljidobacterium was called
Bacillus bljidus communis. There are 30 different types of bljidobaclerium species that exist. When this was known, in 1960, bljidobacterium was accepted as its own independent genus. (60) 1.1.3 Species
The table below lists the species ofbifidobacteria.
Bljidobacterium angulatum Bljidobacterium pseudolongum
Bljidobacterium animalis Bljidobacteriumpsych;aerophilum
Bljidobacterium asteroids Bljidobacteriumpullorum
Bljidobacterium bljidum Bljidobacterium ruminantium
Bljidobacterium boum Bljidobacterium saeculare
Bljidobacteriumbreve Bljidobacteriumscardovii
Bljidobacterium catenulatum Bljidobacterium simiae
Bljidobacterium choerinum Bljidobacterium subtile
Bljidobacteriumco7yneforme Bljidobacterium thermacidophilum
Bljidobacterium cuniculi Bljidobacterium thermophilum
Bljidobacterium dentium Bljidobacteriumurinalis
Bljidobacterium gallicum Bljidobacterium magnum
Bljidobacterium gallinarum Bljidobacterium m e7yCicum
Bljidobacterium indicum Bljidobacterium minimum
Bljidobacterium longum Bljidobacterium pseudocatenulatum
Bljidobacterium magnum Bljidobacterium minimum
Bljidobacterium mefyCicum Bljidobacterium pseudoca tenulatum
Bljidobacterium sp
5 1.1.4 Ecology
While Bljidobacterium infantis,B. brevi, and B. longum are the largest group of bacteria in the intestine of infants, Bljidobacteria are said to be only the 3rd or 4th largest group in adults (and comprise only 3-6% of adult fecal nora).The number-of
Bljidobacteriaactually decline in the human body with age. In infants who are breast-fed, Bljidobacteria constitute ab6ut90% of their intestinal bacteria;- however, this number is lower in bottle-fedinfants. When breast-fed infantsT diets are changed to cows milk and solid food, Bljidobacteria are joined by rising numbers of other bacteria found ih the human body such as Bacteroides and Streptococci lactobacilli.
The lower number in formula-fed babies might account for a higher ,ofBljidobacteria risk of diarrhea and allergies that is usually associated with babies who aren't breast-fed; in addition, because Bljidobacteria produces lactic acid instead of gas
in (likeE. colt),infants and people general with more Bljidobacteria than other bacteria will have less gas and digestive problems. There is also a significant difference in the incidence of antibiotic-associated diarrhea in the children receiving probiotic-supplemented (inriched with Bljidobacterium) formula (16%) than nonsupplemented formula (31%). (14,68, 88, 90)
Tissier described B. bljidus in the stools of breast-fed infants, it was recognized that the organisms became predominant in the stools between days 4 and 7 after birth.
Although L. acidophilus was the most numerous lorganism in the stools of bottle-fed infants, bifidobacteria were also found in smaller numbers. It was believed that bifidobacteria were present in small numbers in stools of adults, but they were difficult to isolate because of the lack of a suitable culture medium or method of reducing oxygen tension. For the next half century little progress was made in extending these observations. When more selective culture media became available,
6 interest in the occurrence and distribution of bifidobacteria was revived. Mata et a1. reported the average figures for the incidence of bifldobacteria in the feces of breast-fed infants to be approximately loll, in weanlings 1010, and in adults 101 organ.isms per g (wet weight).The figures expressed by these authors are in general agreement with those expressed earlier by Gyllenberg and Roin;, Smith and Crabb,
Zubrzycki and Spaulding, Weijers and van de Kamer, and Werner. They are somewhat higher than those reported by Kalser et a1. Werner and Seeliger, Mossel, and Gorbach et a1. In a study ofintestina1 flora in a rural area ofGuatemala, Mata and urrutia reported that bill-dobacteria appeared on the flrSt day of life in only a few infants. One-third of the babies they studied had these bacteria on the second day of life. By the end of the flrSt Week all infants had them in concentrations ranging &om
101 to loll organisms per g of feces. These workers also reported that Bacteroides and Veillonellae were not frequently found in the stools of breast-fed neonates, although their concentration ranged from 108 to 1011 when found. When 12 breast-fed infants were studied throughout the flrSt year Of life, bifldobacteria continued to be the most numerous bacterium, amounting to 1010 to 1011 organisms per g of feces.
With food supplementation the anaerobic gram-negative bacilli became more numerous and eventually outnumbered other bacterial groups. Mata and Urrutia
summarized their data by stating that nearly 100% of all bacteria cultured from the
stools of breast-fed infants were bifidobacteria. During weaning there was a decrease by 1 log and a proliferation of Bacteroides. In adults, Bacteroides outnumbered all
other groups. Although this study was a valuable aid in estimating the relative occurrence of various groups of intestinal organisms and their variation with age and
other factors, no attempt was made at a hef classification of members of the genus
Bifidobacterium. These organisms were simply referred to as the bifidobacteria group.
There is a definite need for such information based upon one of the recent
7 classiflCation schemes. Miller reported on the fecal flora of seven eskimo children.
He reported B. adolescentis in concentration of 108 to loll per g in all the specimens studied and noted that in one case members of the genus bifidobactera exceeded those of the bacteroides group. In a study of the intestinal flora of adults, Moore et a1. reported that in some cases members of bifldobactera outnumbered bacteroides, thus confirming the observations of some earlier workers on this point. Significant differences in incidence of bifidobacteria among individuals and possibly among certain restricted populations are evident. An investigation of variation in the incidence ofbifidobacteria among newborns was carried out in our laboratory. In the course of investigations, we noted fewer bifidobacteria in newborns in a large, urban universityl hospital than in a suburban hospital in the same area. In the past, bifldobacteria could readily be cultured from the stools 6f breast-fed infants at the
Hospital of the University of Pennsylvania. Recently, difficulty was experienced in culturing these organisms from the stools of infants in the nursery. Gram-stained spreads of feces of breast-fedinfants, 3 to 4 days old, were examined. Of 61 breast-fed infants (14,35, 36, 37, 38, 66)
Bljidobacteria as well as other beneficial bacteria can be found in fermented dairy foods, especially yogurt. Eating substances rich with these probiotics is a sort of home remedy for diarrhea, vaginitis, and infections because it promotes the _yeast growth of these as opposed to other bacteria. B. infantis has been proven to dramatically reduce imitable bowel sydrome (IBS) in patients and if given alone can almost normalize the patient. Genealogical tree see below:
8 StzlePtOCOCCUS
S. thern70PJLj]usATCC l9258 S.8Lljb,ATCC437 65
IF OeJ20CLmuS OeL7j JCM6 I25
Gran(-) Lactococcus
Genealogical tree
1.2 Peroxidase
1.2.1 Description
Peroxidases (EC number 1.ll.1.A) are a large family of enzymes that typically
catalyze a reaction of the form:
ROORr + electron donor (2 e-)+ 2H' - Roll + R'OI1
For many of these enzymes the optimal substrate is hydrogen peroxide, but others
are more active with organic hydroperc.xides such as lipid peroxides. Peroxidases can
contain a heme co factor in their active sites, or redox-active cysteine or
selenocysteine residues.
Peroxidase can be used for treatment of industrial waste waters. For example,
phenols, which are important pollutants, can be removed by enzyme-catalyzed
po1ymerization using horseradish peroxidase. Thus phenols are oxidized to phenoxy radicals, which participate in reactions where polymers and oligomers are produced that are less toxic than phenols.
Furthermore, peroxidases can be an alternative option of a number of harsh chemicals, eliminating harsh reaction conditions. There are many investigations about the use of peroxidase in many manufacturing processes like adhesives, computer chips, carparts, and linings of drums and cans. (10,13, 20, 34, 43, 63, 74)
The table below lists the types ofperoxidases.
I Glutathione peroxidase (GPX)
･ Myeloperoxidase (MPO)
･ Catalase(Rat)
･ Hemoprotein
･ Peroxide
I Animal heme-dependent peroxidases
I Vanadium bromoperoxidase
1.2.2 GPX
Glutathione peroxidase (GPX) (EC 1.ll.1.9)is the general name of an enzyme family with peroxidase activity whose main biological role is to protect the organism from oxidative damage. The biochemica1 functiohof glutathione peroxidase is to reduce lipid hydroperoxides to their corresponding alcohols and to reduce free
10 hydrogen peroxide to water. (2,3, 6, 34, 54)
GPX family is well studied in eukaryote, especially in animals, and act a key role in H202 scavenging. In the case of bacteria, very limited information about GPX were available. It was reported in few of species, Neisseria meningitidis (Aho E. L. et a1.
1995) Streptococcuspyogenes (King K. Y. et aL. 2000) and Eschericha colt (Arenas F.
an important in A. et al 2010). It is not commonly accepted that GPX plays role bacteria, especially in anaerobic bacteria. No orthologue to these 3 bacterial GPX
(also Eukaryotic GPX) has been found in the bifidobacterial genome. Glutathione
synthesize pathway has not been found in bifidobacteria (figuresee below). (79, 80)
ll 1.2.3 Catalase
Catalase is a common enzyme found in nearly all living organisms which are exposed to oxygen, where it functions to catalyze the decomposition of hydrogen peroxide to water and oxygen. Catalase has one of the highest turnover numbers of all enzymes; one molecule of catalase can convert millions of molecules of hydrogen peroxide to water and oxygen per second. (1,5, 10, 20, 22, 23, 45, 50, 63, 72)
Catalase is a tetramer of four polypeptide chains, each over 500 amino acids long.
It contains four porphyrin heme (iron)groups that allow the enzyme to react with the hydrogen peroxide. The optimum pH for catalase is approximately 7, while the optimum temperature varies by species.
Catalase (EC 1.1 1.1.6)catalyzes disproportioning ofH202 tO H20 and 02 and thus protects the cells against the oxidative effect of H202. This enzyme is present in all aerobes and many aerotolerant anaerobes. Two types of phylogenetically remote heme catalases are known: monofunctional catalases and bifunctional catalases peroxidases, which for the catalase activity use H202 (Km - 2.5 6.5 mM) as an electron donor and for the peroxidase activity (Km - 0.2 0.7 mM) use various organic compounds byroga11o1,diaminobenzidine, dimethoxybenzidine, dianizidine,
NADH, NADPH, etc.).Monofunctional catalases are found in all three empires of living nature, whereas the distribution of bifunctional heme catalases is limited (with. rare exceptions)to bacteria and archaea.
Unlike mono- and dimeric bifunctional catalases-peroxidases, monofunctional catalases are mainly tetrameric proteins characterized by higher temperature stability, wide pH optimum (5.5-16.5),and lack of inactivation with ethan.I/ch1.r.f.rm.
However, 3-amino-1 is a inhibitor ,2,4-triazole specific of monofunctional catalases.
12 In addition to heme catalases, there are Mn catalases with a unique primary structure and resistance to N3-, which have been found in some facultative anaerobes such as the lactic acid bacterium Lactobacillus plantarum and the hyperthermophilic archaeon
Pyrobaculum calidifontis.
Catalase was first noticed as a substance in 1811 when Louis Jacques Th6nard, who discovered H202 (hydrogen peroxide),suggested that its breakdown is caused by a substance. In 1900, Oscar Loew was the first to give itthe name catalase, and found its presence in many plants and animals. In 1937 catalase &om beef liver was crystallised by James B. Sumner and the molecular weight worked out in 1938. In
1969 the amino acid sequence of bovine catalase was worked out. Then in 1981, the
3D structure of the protein was revealedi
1.2.3.1 Molecular mechanism
The reaction of catalase in the decomposition of hydrogen peroxide is:
2H202 -+ 2H20+02
While the complete mechanism of catalase is not currently known, the reaction is believed to occur in two stages:
H202 + Fe(III)-E.)H20 + 0-Fe(IV)-E(.+)
H202 + 0-Fe(IV)-E(.+) - H20 + Fe(III)-E+ 02
Here Fe()-E represents the iron centre of the heme group attached to the enzyme.
Fe(IV)-E(.+)is a mesomeric form of Fe(V)-E, meaning that iron is not completely oxidized to +V but receives some T'supporting electron'' A.om the heme ligand. This heme has to be drawn then as radical cation (+).
13 As hydrogen peroxide enters' the active site, it interacts with the amino acids
Asn147 (asparagineat position 147) and His74, causing a proton (hydrogen ion) to transfer between the oxygen atoms. The free oxygen atom coordinates, freeing the newly-formed water molecule and Fe(IV)-0. Fe(IV)-0 reacts with a second
rand hydrogen peroxide molecule to reform Fe(III)-E produce water and oxygen. The reactivity of the iron center may be improved by the presence of the phenolate ligand of Tyr357 in the fifth iron ligand, which can assist in the oxidation of the Fe(III)to
Fe(IV). The efflCiency of the reaction may also be improved by the interactions of
His74 and Asn147 with reaction intermediates. In general, the rate of the reaction can be determined by the Michaelis-Menten equation.
Catalase can also oxidize different toxins, such as formaldehyde, formic acid, phenols, and alcohols. In doing so, it uses hydrogen peroxide according to the following reaction:
H202+ H2R -> 2H20 + R
Again, the exact mechanism of this reaction is not known.
Any heavy metal ion (such as copper cations in copper(II)sulfate)will act as a noncompetitive inhibitor on catalase. Also, the poison cyanide is a competitive inhibitorl of catalase, strongly binding to the heme of catalase and stopping the enzymeTs action.
Three-dimensional protein structures of the peroxidated catalase intermediates are available at the Protein Data Bank. This enzyme is commonly used in laboratories as a tool for leaming the effect of enzymes upon reaction rates.
1.2.3.2 Cellularrole
14 Hydrogen peroxide is a harmful by-product of many normal metabolic processes:
To prevent damage, it must be quickly converted into other, less dangerous substances. To this end, catalase is frequently used by cells to rapidly catalyze the decomposition of hydrogen peroxide into less reactive gaseous oxygen and water molecules.
The true biological signiflCanCe Of catalase is not always straightforward to assess:
Mice genetically engineered to lack catalase are phenotypically normal, indicating that this enzyme is dispensable in animals under some conditions.
Some human beings have very low levels of catalase (acatalasia),yet show few ill effects. It is likely that the predominant scavengers of H202 in normal mammalian cells are peroxiredoxins rather than catalase.
Catalase works at an optimum temperature of 37 oC, which is approximately the temperature of the human body.
Catalase is usually located in a cellular organelle called the peroxisome.
Peroxisomes in plant cells are involved in photorespiration (the use of oxygen and production of carbon dioxide)and symbiotic nitrogen fixation (thebreaking apart of diatomic nitrogen P2) tO reactive nitrogen atoms).
Hydrogen peroxide is used as a potent antimicrobial agent when cells are infected with a pathogen. Pathogens that are catalase-positive, such as Mycoba;terium tuberculosis, Legionella pneumophila, and Campylobacter jejuni,make catalase in order to deactivate the peroxide radicals, thus allowing them to survive unharmed within the host.
1.2.3.3 Distribution among organisms
15 All known animals use catalase in every organ, with particularly high concentrations occuming in the liver. One unique use of catalase occurs in bombardier beetle. The beetle has two sets of chemicals ordinarily stored separately in its paired glands. The larger of the pail, the storage chamber or reservoir, contains hydroquinones and hydrogen peroxide, whereas the smaller of the pair, the reaction chamber, contains catalases and peroxidases. To activate the spray;the beetle mixes the contents of the two compartments, causing oxygen to be liberated from hydrogen peroxide. The oxygen oxidizes the hydroquinones and also acts as the propellant.
Catalase is also universal among plants, but not among fungi, although some species have been found to produce the enzyme when growing in an environment with a low pH and warm temperatures.
Very few aerobic microorganisms are known that do not use catalase.
Streptococcus species are an example of aerobic bacteria that do not possess catalase.
Catalase has also been observed in some anaerobic microorganisms, such as
Methanosarcina barkeri.
Catalase is used in the food industry for removing hydrogen peroxide &om milk prior to cheese production. Another use is in food wrappers, where it prevents food from oxidizing. Catalase is also used in the textile industry, removing hydrogen peroxide from fabrics to make sure the material is peroxide-free. A minor use is in contact lens hygiene - a few lens-cleaning products disinfect the lens using a hydrogen peroxide solution; a solution containing catalase is then used to decompose the hydrogen peroxide before the lens is used again. Recently, catalase has also begun to be used in the aesthetics industry. Several mask treatments combine the enzyme with hydrogen peroxide on the face with the intent of increasing cellular oxygenation in the upper layers of the epidermis.
16 1.3 Research the response of the Btjidobactert'umto Oxygen
In de Vries et al. study, bifldobacteria were divided into three groups (84).The fact
that none of the Bljidobacterium strains used in the present investigation grew on
agar plates under aerobic conditions, is in accordance with the.observations ofDehi T.
and S. Bald et al.. It is evident that bifldobacteria cannot tolerate the 0- tension of air.
Accumulation ofH202 Seems tO be a minor factor in explaining the high sensitivity of
ttvo other Bljidobacterium strains tor 02 (S 822 and i 328, group III).Despite of the
fact that small amounts ofH202 Were formed by cell suspensions and cell-free extracts
of these strains, no H202 could be detected in aerated cultures. The partial
inactivation of fructose-6-phosphate phosphoketolase observed in aerated cultures
was presumably caused by traces of intracellular H202. Even in the absence of 02,
concentrated cell suspensions of these strains do not succeed in establishing the
oxidation-reduction potential required for fermentation of glucose. Addition of
cystcine or ascorbic acid lowers the oxidationreduction potehtialto the required value.
This is true for both anaerobically-grown cells as cells from aerated cultures. In the
absence of cysteine, anaerobic growth of these strains is slow. Cells do not succeed in
bringing the oxidation-reduction potential of the medium to a value suitable for more
rapid growth until the concentration of the cells exceeds a given value. The1
oxidation-reduction potential obtained finally in such a culture is very low. From the
results, it is evident that does not exert a lethal action on these strains (group III),but
prevents growth by establishing a too high oxidation-reduction potential. (18, 38, 46,
47,77,89)
In Kawasaki S. et al. study, B. boum and B. thermophilum show growth
stimulation in the presence of 02. These two species do not form colonies under air
17 conditions, so they are reasonably classified as anaerobes. The accumulation of H202 in 02-Sensitive species must be the end product of 02 reduction. NADH-dependent oxidase activities were detected as part of an 02 reduction system. Although the total activity of NADH dependent oxidase in the CFE was similar among species, the activity profiles differed between 02-Sensitive and microaerophilic species. The growth inhibition ofB. bljidum and B. longum under 20% 02 conditions was partially reversed when catalase was added to the medium. The inability of exogenously added catalase to decompose intracellular H202 might be a reason for the failureto obtain complete growth recoveries. These results indicate that the primary factor in aerobic inhibition is the production ofH202 derived from 02 reduction. (39,40)
Oxidative stress can be defined as an excess of reactive oxygen species (ROS) that have strong oxidizing potential for tells. ROS cause damage to macromolecular constituents such as DNA, RNA, proteins and lipids. Toxicity occurs when the degree of oxidative stress exceeds the capacity of cell defence systems. ROS originate &om partial.reduction of molecular oxygen (02) tO SuPerOXide (02-),hydrogen peroxide
(H202) and hydroxyl radical (OH. ).The biological sources ofROS are numerous, e.g. they can be generated in aerobiosis by flavoproteins, and by macrophages during inflammatory reactions. Thus, oxidative stress plays an important role in pathologies of the gastrointestinal tract ofhumans such as inflammatory bowel diseases and in the radio-induced tissue injurythat may occur during radiotherapy.
As probiotics, some species of Bljidobacterium are widely used in various therapeutics and food products. However, as bifidobacteria are obligate anaerobic bacteria, their sensitivity to 02 limits their manufacturing and storage. Bifidobacteria have an oxidase function that uses 02 aS an electron acceptor to reduce to H20 and
H202, although the production of H202 Was thought to be the primary reason for
18 aerobic growth inhibition in bifidobacteria. Although NADH peroxidase was found in bifldobacteria and some types of peroxidases were predicted, including thiol peroxidase, alkyl hydroperoxide reductase, and peptide methionine sulfoxide redhctase, these peroxidases are unable to decompose the H202 Produced by bifldobacteria under aerobic conditions. In addition, we could not detect H202 scavenging activity in B. longum 105-A.
Superoxide dismutase, catalase, and glutathione peroxidase (GPX) constitute the enzymatic antioxidant system. GPX and catalase are the enzymes that can decompose
H202 tO H20. GPX was mainly studied in eukaryotic organisms; however, little is known about GPX activity in prokaryotic organisms, and a GPX gene has not been detected in the genomic sequences ofbifidobacteria. In addition, bifidobacteria do not carry glutathione synthesize pathway. Catalase is an enzyme commonly found in aerobic bacteria but is absent in almost all anaerobic bacteria lincluding
Bljidobacterium.B. subtilis KatE (heme-dependent catalase)is a well-known catalase that is used to improve the viability of some species of bacteria via heterologous expression (13,50, 63).In this study, we investigated the effects of expressing B. subtilis heme-dependent catalase on the oxidative stress resistance of B. longum
1 05-A. For comparison, the effects ofAexogenously added cafalase on B. longum were also tested.
19 Materials and Methods
2.1 Medium and Buffer
E. coli and B. subtilis were grown in LB medium at 37oC. For anaerobic culture, B.
longum 105-A was grown in MRS medium (Difco,Franklin, New Jersey)containing
0.34% L-ascOrbic acid sodium salt Papalai Tesque, Kyoto, Japan),0.02% L-cysteine
pacalai Tesque),and 50 mM sucrose at 37oC. For aerobic culture,I B. longum 105-A
was grown in MRS medium containing 50 mM sucrose and 10 LIM hemin
(Sigma-Aldrich,St. Louis, MO) at 37oC. When necessary, antibiotics were used at the
kanamycin following concentrations: chloramphenico1 (Cm; 25 LLg/mL), (h; 50
pg/mL) and spectinomycin (Sp; 75 LLg/mL). Aerated cultures (10 mL) of
Bljidobacterium were grown in 25-mL tubes using silicone plugs with shaking at 120 rpm. Anaerobic cultures (10 mL) were grown in 12-mL test tubes with screw caps.
CFUs ofB. longum 105-A were counted as follows: appropriate sample dilutions were
prepared in sucrose solution (50 mM sucrose and 1 mM triammonium citrate, pH 6.0),
plated on MRS agar, and incubated for 48 h at 37oC under anaerobic conditions using
the AnaeroPack system (Mitsubishi.Gas Chemical, Tokyo, Japan).
2.1.1 LuriaBrothmedia(LB)
Trypto ne
Yeast extract ...... 0.5%
Agrose 1.5% (ifnecessary)
2.1.2 MRSmedium
Difco Lactobacilli MRS Broth
20 *Approximat6 Fomul Per Liter
Protesose Peptone
Beef Extract
Yeast Extract
Dextrose
Polysorbate 80
Ammonium Citrate
Sodium Acetate
Magnesium sulfate
Manganese sulfate
Dipotassium phosphate
L-Ascorbic Acid Sodium Salt (Vc) 0.34%
L- Cysteine 0.02%
Agrose 1.5% (ifnecessary)
2.1.3 TEbuffer
Tris-HC1(pH8) 10mM
EDTA(pH 8)
2.1.4 PEG
Polyethylene glycol 6000
* Use a brown bottle in one month.
2.1.5 PBSbuffer
KC1 0.02%
21 Na2HPO4 0.144%
KH2PO4 0.024%
*Adjust the pH to 7.4 with HC1.
Because that the solution can't be stored, so the concentration be 10 x to stored.
2.2 Isolate DNA from microorganisms
Using UltraClean Microbial DNA Isolation kit.
2.3 Extractplasmid
2.3.1 With QIA prep spin Mini prep kit
Using QIA prep spin Mini prep kit.
2.3.2 With 2-propano1
2.3.2.1 Thereagent
2.3.2.1.1 SolutionI
50mM
Tris-HC1(pH8) 25mM
EDTA(pH8) 10mM
*Confect the lM ofTris-HCl to store. Ajust pH with lM ofNaOH.
Confect the lM ofEDTA to store. Ajust pH with lM ofNaOH.
2.3.2.1.2 SolutionII
22 NaOH
*Because that the solution can't be stored, so the concentration be 10 x to
When it, SDS is last into stored. useing provisional confect. the one added
the tube.
SDS :sodium dodecyl sulfate
2.3.2.1.2 SolutionIII
Potassium Acetate(5M) 60mL
Acetate ll.5mL
28.5mL
2.3.2.2 Protocol
1. Transfer the microbial culture to a microcentrifuge tube.
2. Centrifuge for 2 min at 12,000 rpm (-12,000 x g),discard the supematant.
3. Add 200 pl Solution I and mix thoroughly by vortexing.
4. Add 400 LilSolution II and mix thoroughly by inverting the tube 4-6 times.
5. Add 300 pl Solution III and mix thoroughly by inverting the tube 4-6 times.
6. Wait 5 min.
for 7. C)entrifuge 10 min at 12,000 rpm (-12,000 x g),transfer the supernatant to
a new microcentrifuge tube.
8. Add lLtl of 10 mg/mL RNAse into the microcentrifuge tube.
9. Incubate at 37oC for 30-60 min.
10. Add 600 Lil of 2-propanol and mix thoroughly by inverting the tube 4-6
23 times.
ll. Centrifuge for 15 min at 12,000 rpm (-12,000 x g),transfer the supernatant
to a new microcentrifuge tube.
12. Add 500 lil of 70% ethanol and mix thoroughly by inverting the tube 2
times.
13. Centrifuge for 10 min at 1'2,000 rpm (-12,000 x g),discard the supernatant.
14. Centrifuge for an additional 1 min at 12,000 rpm (-12,000 x g) to remove
residual ethano1.
15. Dry the pellet in the incubator or in the aspirator.
16. About 15 min later, dissolved in 50 lilofTE buffer.
Store p.1asmid fi.ozen (-20oC).
2.4 PurifyDNA
2.4.1 With Nucleo Spin Extract II kit
using PCR clean-up Gel extraction NucleoSpin@ Extract II. MACHEREY-NAGEL
kit.
2.4.2 With Ethano1
2.4.2.1 Thereagent
lI3M Sodium Acetate buffer, pH 5.2 (stoleat 4 oC)
lICold 100% Ethano1 (-20oC)
tCold 70% Ethanol in sterile dH20 (-20oC)
)DNA sample
24 4 oC Microc'entrifuge (normal microcentrifuge in cold room works fine).All
centrifugations should be on "soft'' (no brake)setting.
2.4.2.2 Protocol
1. Transfer DNA to a container where it f111s one fourth the total volume. (a 500
pl tube should have no more than 125 LilofDNA solution, for example)
2.I Add one tenth volume of Sodium Acetate buffer to equalize ion
concentrations.
3. Add least two 100% let in freezer for at volumes ofcold ethano1; stand -20oC
at least one hour.
4. Centrifuge sample for 15 minutes at highest speed in a 4oC microcentrifuge.
5. Remove as much supernatant as possible with a 1 mL micropipet; recentrifuge,
then remove the rest with a 200 pl pipet.
6. Add 200 pl ofcold 70% ethano1; centrifuge for 5 minutes in a 4 oC centrifuge.
7. Remove supernatant with a 200 Lil pipet; evaporate remaining ethanol in a
37 oC water bath.
8. Resuspend pellet in desired volume of water or TE buffer.
2.4.3 With PEG
2.4.3.1 The reagent
LPEG
A70% Ethanol in sterile dH20 (-20oC)
IIDNA sample
2.4.3.2 Protocol
25 1. Mix 1 volume ofDNA sample with 1 volumes of PEG.
2. Incubate at 4oC for 30 min.
3. Centrifuge for 15 min at 4oC with 15,000 rpm, discard the supematant.
4. Add 500 Lil70% ethanol and don't mix.
5. Centrifuge for 15 min at 4oC with 15,000 rpm, discard the supematant.
L15,000 6. Centrifuge for 1 min at 4oC with rpm to remove the residual ethano1.
7. Dry the pellet in the incubator or in the aspirator.
8. About 1 5 min later, resuspend pellet in desired volume ofddH20.
2.5 Preparation of competent cell
2.5.1 Electrocompetent cell ofBifidobacterium
2.5.1.1 Thereagent
Sucrose buffer
Sucrose 1.712%
100mM Ammonium citrate bH6.0)
* AjustpH &ith lM citrate.
Autoclave 121oC for 20 min.
MRS medium
2.5.1.2 Protocol
1. Incubate the Bifidobacteria at 37oC with anaerobic culture by MRS medium.
2. When OD660-0.5, stop culture.
26 3. Transfer 10 mL culture to the tube.
4. Centrifuge for 10min at 4oC with 6,000 rpm, discard the supernatant.
5. Add 10 mL sucrose buffer and mix thoroughly by vortexing.
6. Centrifuge for 10min at 4oC with 6,000 rpm, discard the supernatant.
7. Add 5 mL sucrose buffer and mix thoroughly by vortexing.
8. Centrifuge for 10min at 4oC with 6,000 rpm, discard the supernatant
remaining 1 mL.
9. Transfer 50 lilto a new microcentrifuge.
10. Transfer the tube to ice. Use it in 1 hour.
2.5.2 Chemically competent cell ofE.coli
2.5.2.1 Thereagent
0.1 M CaC12
LB medium
2.5.2.2 Protocol
1. Incubate E. coli at 37oC with 120 rpm shaking.
2. When OD660-0.5, stop culture.
3. Transfer 1.5 ml culture to a microcentrifuge tube, and chill on ice for 10
minutes.
4. Pellet the cells by centrifugation at 3000 x g for 5 minutes at 4oC, discard the
Sup ernatant.
5. Add 100 lilcold 0.1 M CaC12 and mix throughly by mild vortexing.
27 6. Incubate tubes on ice for 20 minutes. -as 7. Pellet the c-ells before(3000 x g, 5 minutes, 4oC), discard the supernatant.
8. Add 100 pl cold 0.1 M CaC12 and mix throughly by mild vortexing.
Store the competent cells frot2en (-80oC).
2.6 SDS-PAGE
2.6.1 Thereagent
Acrylamide / bisacrylamide monomer stock solution (30% / 0.8%)
Acrylamide monomer 29.2%
N,N-methylenebi sacrylamide
4 x Running gel buffer (1.5M Tris-HCl, pH8.8)
Tris-HC1 18.15%
*AjustpH with HC1. Store at 4oC.
4 x Stacking gel buffer (500 mM Tris-HC1, pH6.8)
Tris-HC1
*Ajust pH with HC1. Store at 4oC.
5 x Sample Buffer
Glycerol
Tris-HCl bH6.8) 0.2mM
Bromophenolblue 0.05%
28 SDS stock solution (10%)
APS-Ammonim persulfate initiator solution (10%)
Ammonium persulfate......
TEMED-N, N, NT, NT-tetramethylethylenediamine
1 x Running buffer
Tris-HCl 25mM
Glycine 200mM
CBB stain solution
CBB-R250 0.25%
Methanol
Acetic acid
Protein MW Maker (Daiichi) from top to bottom
1. 97,400; 2. 66,267; 3. 42,400; 4. 30,000; 5. 20,100; 6. 14,400
CBB destain solution
Acetic acid
Methanol
2.6.2 Protocol
1. Pouring the gels
29 1 x Running Gel Solution
7 0/o 10 0/o 120/o 150/o
H20 15.3 ml 12.3 ml 10.2 m1 7.2 m1
1.5 M Tris-HCl, pH 8.8 7.5 ml 7.5 ml 7.5 ml 7.5 m1
10% (w/v) SDS 0.3 m1 0.3 ml 0.3 ml 0.3 ml
AcrylamideBis-acrylamide
6.9 ml 9.9 ml 12.0 ml 15.0 ml (30%/0.8% w/v)
10% (w/v) ammonium persulfate (APS) 0.15 m1 0.15 m1 0.15 ml 0.15 ml
TEMED 0.02 m1 0.02 ml 0.02 m1 0.02 m1
Stacking Gel Solution (4% Acrylamide)
II20 3.075 ml
0.5 M Tris-HCl, pH 6.8 1.25 ml
20% (w/v) SDS 0.025 m1
Acrylamidemis-acrylamide (30%/0.8% w/v) 0.67 m1
10% (w/v)ammonium persulfate (APS) 0.025 m1
TEMED 0.005 ml
Choose a percentage acrylamide based on the molecular weight range of proteins you wish to separate:
% Gel M.W. Range
50 kDa- 500kDa
20 kDa- 300kDa
30 12 10 kDa- 200 kDa
15 3kDa- 100kDa
2. Preparing Sample
- Mix protein : 5 x samplebuffer : 2-mercaptoethano1 20 : 5 : 1.
Heat sample by boiling for 5-10 minutes.
Cool down the temperature on ice.
Centrifuge the sample and use the supernatant.
3. Loading samples on gel
Pull the combs out- straight upwards.
Wash-out the wells and fillthe wells with 1 x Running buffer.
Add the samples and protein MW marker into the wells
4. Electrophorese
When the samples in the stacking gel, adjust20 mA for -30 min.
The samples into the running gel, adjustto 30 mA until the samples move to the bottom of the gel
5. Finished Gel: Remove from Rig
6. Staining the gel with CBB stain solution for 30 min.
7. Destaining
Remove staining solution, rinse gels twice with dH20.
31 Add CBB destain solution and shaking ovemight.
Remove de-staining solution, rinse gels twice with dH20.
8. Take the photo.
2.7 Detection activity of catalase
2.7.1 Add H202 tO detect activity ofcatalase
2.7.1.1 Thetheory
Catalase (EC 1.1 1.1.6),present in the peroxisomes of nearly all aerobic cells,
serves to protect the cell from the toxic effects of hydrogen peroxide by
catalyzing its decomposition into molecular oxygen and water without the
production of fi:ee radicals. The mechanism of catalysis is not fully elucidated,
but the overall reaction is as follows:
2H202--2H20+02
The presence of catalase activity leads to bubble formation resulting from the
transformation ofH202 tO H20 and gaseous 02.
2.7.1.2 Protocol
1. Incubate the bacteria until-OD660 -1.0.
2. Transfer 15 mL of the bacteria culture to a microcentrifuge tube.
3. Centrifuge for 10 min at 12,000 g and discard the supernatant.
4. Add lmL PBS buffer and mix thoroughly by vortexing.
5. Centrifuge for 10 min at 12,000 g and discard the supernatant.
32 6. Resuspend the pellet with 30 pl PBS buffer.
7. Samples(20-pl)ofPBS resuspended cells were mixed with 10 ml H202(8.8 M)
2.7.2 Assayofcatalase
2.7.2.1 Thereagent
Dichromate solution
Potassium dichromate 1.67%
Acetic acid 6.67%
PBS buffer
H202 0n Various concentrations 0.1mM -1mM
2.7.2.2 Protocol
Draw the standard curve
1. Transfer 900 pl dichromate solution to a microcentrifuge tube.
2. Add 300 pl H202 0fvarious concentrations and mix thoroughly by vortexing.
3. Heat sample by boiling for 5-10 minutes.
4. Down the temperature to -25oC.
5. Measure the sample at OD570.
6. Drawing the standard curve.
Assay of the samples
1. Transfer 900 Lildichromate solution to a microcentrifuge tube.
2. Wash the bacteria culture by PBS.
33 3. Bacteia samples (109c.f.u.)are mixed with 0.88 mM H202 in PBS buffer.
4. Transfer 300 lilof the mixture to the tube and mix thoroughly by vortexing.
5. Heat sample by boiling for 5-10 minLtes.
6. Down the temperature to -25oC.
7. Measure the sample at OD570.
8. Calculate the data base on the standard curve.
2.8 Short-term H202 exposure
2.8.1 Thereagent
MRS medium
PBS buffer
Hemin
H202
C atalase ...... 10U
Sucrose buffer
Sucrose 1.712%
100mM Ammonium citrate bH6.0)
* Ajust pH with lM citrate.
Autoclave 121oC for 20 min.
2.8.2 Protocol
1. Incubate the Bifldobacterium with MRS + 10 LIM hemin.
2. Transfer 1 mL culture to a microcentrifuge tube.
3. Centrifuge for 10 min at 12,000 x g and discard the supernatant.
34 4. Add 1 mL PBS buffer and mix thoroughly by vortexing.
5. Centrifuge for 10 min at 12,000 x g and discard the supernatant.
6. Add 1 mL MRS medium and mix thoroughly by vortexing.
7. Incubate at 37oC with 4.4 mM H202 for 1 h.
*Negative: With 0 M H202.
8. Remove the H202 by addition ofcatalase (10 U mL-1).
9. Spread desired dilution volume of culture on MRS plate and incubate for 48
hours.
10. Take count of the colonies.
2.9 Long-term with_aerated cultures
2.9.1 Thereagent
MRS medium
Hemin
2.9.2 Protocol
1. Anaerobic incubate the Bifidobacterium with MRS.
2. Inoculate 160 pl Bifidobacterium to 8 mL MRS not contain Vc with aerobic
method.
3. Incubate at 120 rpm and spread desired dilution volume on MRS plate at 12-h
intervals during 2 days.
4. Take count of the colonies.
35 2.10 PCR
2.10.1 With po1ymerase KOD-PLUS
Using KOD kit. -Plus-
2.10.2 With po1ymerase GOTaq
using GoTaq@ DNA kit.
2.ll DNA extraction from agarose gels
using PCR clean-up Gel extraction NucleoSpin@ Extract II. MACHEREY-NAGEL
kit.
2.12 Digestion with restriction enzyme
2.12.1 The restriction enzyme
The restriction enzymes are applied by TAKARA or NEB.
2.12.2 Protocol
Combine the following in a microfuge tube in order :
1LL1 10 x Buffer
6.5 lilH20
2 lilDNA
0.5 LilEnzym9
Incubate for 2 hour at 37oC in a waterbath.
36 2.13 DNAligation
Using DNA Ligation kit < Mighty Mix > kit.
2.14 Transformation
2.14.1 Chemical transformation
2.14.1.1 Thereagent
Competent cells
Plasmid
S.0.C medium or LB medium
Selective plate
Ampicillin (AmpR) 100pg/mL
Kanamycin (KmR) 50pg/mL
spectinomycin (SpR) 75 pg/mL
chloramphenico1 (CmR) 25 pg/mL
2.14.1.2 Protocol
1. Thaw, on ice, one vial of chemically competent cells for each transformation.
2. Add 1 lilplasmid (-50ng) into a vial of chemically competent cells and mix
gently. Do not mix by pipetting up and down.
3. Incubate the vial(s)on ice for 30 minutes.
4. Heat-shock the cells for 30 seconds at 42oC without shaking.
5. Remove the vial(s)from the 42oC bath and place them on ice for 2 minutes.
37 6. Add 250 pl of room temperature S.0.C. medium (orLB medium) to each vial.
7. Cap the vial(s)tightly and shake horizontally (120 rpm) at 37oC for 1 hour.
8. Spread 20 pl and 100 pl kom each transformation on a prewarmed selective
plate and incubate ovemight at 37oC. We recommend plating 2 different
volumes to ensure that at least 1 plate has well-spaced colonies.
2.14.2 Electroporation
2.14.2.1 The reagent
MRS medium
Competent cells
Plasmid
* Selective plate Th'e same as 2.14.1.1.
2.14.2.2 Protocol
1. Add 1 pl plasmid (-50ng) into a vial of competent cells (-50p1) and mix
gently. Do not mix by pipetting up and down.
2. Incubate the vial(s)on ice for 15 minutes.
3. Prepare the tube added 1 mL of MRS medium.
4. Transfer the mixed competent cells to a 2-mm cuvette.
5. Electroporation was camied out with EasyjecT (EQUIBIO), set at 12kV/cm
(timeconstants obtained between 3.9 and 4.2 ms).
6. Transfer the cells to the tube added MRS medium.
7. Incubater the tube ar 37oC for 3 hours.
8. Spread 20 Lll and 100 lil from each transformation on a selective plate and
38 incubate at 37oC for 2-3 days. We recommend plating 2 different volumes to
ensure that at least 1 plate has well-spaced colonies.
2.15 Gateway system
using MultiSite Gateway@ Pro kit.
2.16 Flow cytometry
2.16.1 Thereagent
Using LIVE/DEAD@ BacLightTM Bacterial Viability and Counting kit.
2.16.2 Theinstrument
cell Lab QuantaTM SC MPL. Betkmanc.ulter.
2.17 Isolate NA from microorganisms
Using RNeasy Mini kit.
2.18 RT-PCR
Using TURBO DNA-free kit; High Capacity CDNA Reverse Transcription kit.
2.19 qRT-PCR
2.19.1 Thereagent
39 Using SYBR Premix Ex Taq kit.
2.19.2 The instrument
StepOnePlus Real-Time PCR system. Applied Biosystems.
2.20 AssayofH202
2.20.1 Thereagent
Triton X-1 00
Horseradish peroxidase 0.01%
o-dianisidine dihydrochloride 0.63mM
PBS buffer
2.20.2 Protocol
Culture supernatants were diluted 3:2 with a solution of 0.2% Triton X-100, 0.01%
horseradish peroxidase, and 0.63 mM o-dianisidine dihydrochloride in 50 mM acetate
buffer, pH 5.0. The accumulation of H202 in the culture medium was assayed
spectrophotometrically at 460 nm by detecting the oxidation of o-dianisidine
dihydro chloride.
2.21 Site-Directed Mutagenesis
40 using KOI) plus Mutagenesis kit. (Process see below)
prCA:mLASE )
Patabsq&--1 I.P7c:T:01 i Dpn.
atalas tfLD5 pB CATOO1 / i_ L-LL
Ligation
//I Tl pBCATOO1 ::FtBSn
Catala / 1 ･- GCTT ATGAG... RBSn Cata[ase
41 2.22 The strains, the plasmids and primers
Strains, plasmids or primers Characteristic(s)
Bacterial strains
B. longum 105-A Wild type
Bacillus subtilis GTCO 1672 Wild type
E. coli DH5a F- endAl glnV44 thi-1 recAl relAl gy7A96 deoR nupG p80dlacZ4M15 A PacZYA-argF) U1 69, hsdR1 7jrK-mK'),L- E. coli One Shot MachlTM TIR F- p80PacZ)AM15 AlacX74 hsdR(rKmK+) ArecA1398 endAl tonA
E. coli One Shot ccdB SurvivalTM TIR F- mcrA A(mrr-hsdRMS-mcrBC) 80lacZAM15 AlacX74 recAl araA139 7697 D(ara-leu) galUgalK rpsL (StrR) endAl nupG tonAI:Ptrc -ccdA E. colt UM255 pro leu rpsL hsdM hsdR endl lacy kalG2 katEI:Tn10 recA
Plasmids
pDONRTM22 1-P 1-P5r pDONRTM221; CmrKmr; ccdB; attP1; attP5r
1 1; Cmr Kmr; pDONRTM22 -P5-P2 pDONRTM22 ccdB; attP5; attP2
pDOm1 5r: :HpkatE PDO-TM221-P 1-P5r; Kmr; carrying the B. subtilis katE ; hup promoter
pDONR52: :hupT PDO-TM221-P5-P2; Kmr; ca-rrying the hup terminator
pKKT427 Spr; A shuttle vector between E. coli and Bljidobacterium, 3.9 kb modiflCation of pBRATA1 0 1 pGU100 pKKT427; Cmr, Spr; ccdB; Reading Frame Cassette A
P rimers
kat- f atgagtgatgaccaaaaca
kat-r ggggaca a cttttgta ta caa agttgttc aaattc gtc tatc c c aat
hup-f I gggga caagtttgta ca aa a aagcaggcttttc c gc c actttg ct
hup-r ttggtcatcactcataaaagcatccttcttggg
5 ca a ta ca aa c tc attB -hupTf gggga ctttgta agttgc cttc tg gtag cg atta
attB 2-hupTr gggga cca ctttgta ca aga a agctgggta tggaag c gc tgaac tagtc c
prRB Sh9 AATAAAGCATCCTTCTTGG
prRBSh8 AAAAAGCATCCTTCTTGGG
prRB Sh7 AAJuG CATCCTTCTTGGGT
prRB Sh6 AAAGCATCCTTCTTGGGTC
prRB Sh5 AAGCATCCTTCTTGGGTCA
prRB Sh4 AG CATCCTTCTTGGGTCAG
prRB Sh3 GCATCCTTCTTGGGTCAGG
prRB Sh2 CATCCTTCTTGGGTCAGG G
prWS1 1 AAGCCTCCTTGGGTCAGGGGACAAGCACTT
prRBS 10 AAGCACTCCTTGGGTCAGGGGACAAGCACTT
42 prRBS9 juGCATCTCCTGGGTCAGGGGACAAGCACTT prRBS8 AAGCATTCCTTGGGTCAGGGGACAAGCACTT prRB S 7 AAGCATCTCCTTGGGTCAGGGGACAAGCACTT prRBS6 AAGCATCTCCTTTGGGTCAGGGGACjuGCACTT prRBS5 AAGCATCCTCCTTTGGGTCAGGGGACAAGCACTT prRB S4 AAGCATACCTCCTTTGGGTCAGGGGACAAGCACTT prRB S3 AAGCATCACCTCCTTTGGGTCAGGGGACAAGCACTT prRB S2 AAGCATACCTCCTTTCGGGTCAGGGGACAAGCACTT prRBS 1 juGCATACCTCCTTTCTGGGTCAGGGGACAAGCACTT prCATALASE ATGAGTGATGACCAAAACAAACGTGTAAATGAACACTCAA
a Spr, to kanamycin, cmr , Kmr and resistance chloramphenicol, and spectinomycin, respectively. b Italicized oligonucleotide sequences denote the attB sites.
43 Results
3.1 Isolate DNA froJn miCrOOrgamiSmS
Isolate DNA &om microorganisms:
strain No. Biosafety level
Bacillus subtilis GTCO1672 BLSI
Bljidobacterium longum 105-A BLS 1
Bacillus subtilis was grown in LB at 37oC.
Bljidobacterium longum 105-A was grown in MRS at 37oC.
Isolated DNA of Bacillus subtilis (0.8% agarose, 1 00v, 30min, Fig. 1a).
Fig. 1a Isolated DNA. Lane M: A EcoT marker, lane 2: B. subtilis.
44 100v, 30min, Isolated DNA ofBlj;dobacteyium longumlO5-A (0.8% agarose, Fig.1b).
r T f 'J7
M 1
Fig. 1b Isolated DNA. Lane M: A EcoT marker, lane 1: B. longum105-A.
3.2 Get the PCRproduct
3.2.1 Theprimers
The primers used in this study are listed in 2.22.
3.2.2 PCR
3.2.2.1 PCR ofhup-promoter
Obtained the hup-promoter per product ltom B. longum105-A and purified by
extracting &om gels. Named Hup-BKE (288bps), Fig.2.
Po1ymerase: KOD-PLUS
45 Template: DNA ofB. longum105-A
Forward primer: Hup-f
Reverse primer: BKatE-hup-r
Cycling step:
Pre-denaturation : 94oC, 2min
Denaturation : 94oC, 15sec------
Annealing : 55oC, 30sec---X 30 cycles--
Extension : 68oC, 20sec------
M 1 2 3
Fig. 2 Hup-promoter (2% agarose, 100V, 30min). Lane M: 100bp marker, lane
3 :Hup-BKE
46 312_2.2 PCRofB-KatE
obtained the B-KatE (Heme-catalase gene, 2071bps) per product &om B.
subtilis and purified by extracting iiom gels. Fig. 3.
Po1ymerase: KOD-PLUS
Template: DNA of B. subtilis
Forward primer: BKatEj
Reverse primer: BKatE-r
Cycling step:
Pre-denaturation : 94oC, 2min
D enaturation : 94oC, 1 5sec------
Amealing: 45oC, 30sec----X 30 cycles---
Extension : 68oC, 20sec------
M 1
Fig. 3 B-KatE (2% agarose, 100V, 30min). Lane M: 100bp marker, lane 1 : B-KatE.
47 3.2.2.3 PCR ofHup-terminator
obtained the Hup-terminator (187bps) per product &om B. longu7n 105-A and
puriGed by extracting from gels. Fig. 4.
Po1ymerase: ROD-PLUS
Template.. DNA ofB. Longum
Forward primer: Ten-f
Reverse primer: Ten-r
Cycling step:
Pre-denaturation : 94oC, 2min
D enaturation : 94oC, 15sec------
Annealing : 60oC, 30sec----X 30 cycles---
Extension : 68oC, 15sec------
M I
Fig. 4. Hup-terminator (2% agarose, 100V, 30min). Lane M: 100bp marker,
lane 1 : Hup-terminator.
48 3.2.2.4 0verlapPCR
The overlap extension po1ymerase chain reaction is a variant of PCR which can
produce polynucleotides from smaller fi:agments.
1. Fuse Hup-promoter and B-KatE by overlap per.
The fused per product P-BKatE was 2343bps and purified by extracting from
gels. Fig. 5.
Po1ymerase: KOD-PLUS
Template: Hup-BKE and B-KatE
Forward primer: Hup-f
I
Reverse primer: BKatE-r
Cycling step:
Pre-denaturation : 94oC, 2min
D enaturation : 94oC, 15sec------
Annealing : 55oC, 30sec----X 30 cycles---
Extension: 68oC, 2min20sec------
49 M 1
Fig. 5. P-BKatE (0.8% agaroSe, 100V, 30min). Lane M: i EcoTmarker, lane
1 : P-BKatE.
3.3 Construct destination Vector
Constructed the destination vector PGUOO 1.
3.3.1 Digest pKKT427
Digested pKKT427 with StuI (Takara) at 37oC for 16 hours.
Plasmid pKKT427 is showed in Fig. 6.
The components of reaction:
2 p1 10xMBuffer
l3 BllddH20
3.5 p1 (-1mg) pKKT427
50 I.5 LilStuI
Lined pKKT427 was purified with PEG.
Fig. 6. The map ofplasmid pKKT427.
3.3.2 Construct destination vector pGUOO1
1. Ligation lined pKKT427 with rfcA (Gateway reading &ame cassetteA)
Ligated lined pKKT427 with rfcA (-1.7kb) at 16oC for 30min with DNA
Ligation Kit. The components of reaction:
1 Lillined pKKT427
3 pl Gateway reading frame cassetteA
4 pl ligate solution .
2. Transformation One Shot ccdB Survival TIR E. coli.
Add 2 pl ligated mixture into One Shot ccdB Survival TIR E. coli.
51 spread the 50 pl culture selective plates (cmR) and incubate ovemight at 37oC.
3. Check the plasmid pGUOO1 with PCR.
Po1ymerase: GO Taq
Template: PGUOO I
Cycling step:
Pre-denaturation : 95oC, 2min
Denaturation : 95oC, 1min------
Amealing : 48oC, 1min------X 30 cycles---
Extension : 68oC, 2min------
Per product rfcA's length was -1.7kb (Fig. 7).
I M
Fig. 7. RfcA (0.8% agarose, 100V, 30min). Lane M: i EcoT marker, lane 1 : RfcA.
52 3.4 Construct the plasmids
3.4.1 BPreaction
P1 Transfer P-BKatE into the vector PDONR -P5r.
Trahsfer Hup-terminater into the vector PDONR P5-P2.
The components of reaction:
Fragment PDONR vector TE buffer
P-BKatE 1p1 (-80ng) 1p1 6Lll
Hup-teminator 1 p1 (-80ng) 1p1 6p1
The PDONR: :Hup-terminater, PDONR::P-BKatE by BP reacted were checked by
PCR with GOTaq. Fig. 8.
Template: PDONR:P-BKatE
r Primer:
PDONR:P-BKatE-- Hup-f and BKatE-r
Cycling step:
Pre-denaturation : 95oC, 2min
D enaturation : 95oC, 1min------
Annealing : 55oC, 1min--i-X 30 cycles-----
Extension: 68oC, 2min20sec------.------
Template: PDONR:Hup-terminator
Forward primer: Tem-f
Forward primer: Tem-r
53 Cycling step:
Pre-denaturation : 95oC, 2min
D enaturation : 95oC, 1min------
Amealing : 60oC, lmin------X 30 cycles-----
Extension : 68oC, 15sec------
1 2 3 4 5 6 7 8 9 M
Fig, 8a. PDONR::P-BKatE (0.8% agarose, 100V, 30min). Lane M: i EcoT marker, lane 4-6: PDONR: :P-BKatE.
54 Fig. 8b, PDONR:Hup-terminator (2% agarose, 100V, 30min). Lane M: lOObp marker, lane 1 : PDONR:Hup-terminator.
55 3.4.2 LR reaction
Ligated Hup-terminater and P-BKatE by LR reaction.
The components of reaction:
TE buffer PDONR PGUOO 1 PDONR:
Hup-terminator
pBCATOO1 1pl(-10hol) 1p1(-20ho1) 1pl(-10hol) 5p1
The plasmids, pBCATOOl were checked by PCR with GOTaq. Fig. 9.
M l 2 3 4 5 6 7 8
Fig. 9. pBCATOO1 (0.8% agarose, 100V, 30min). Lane M: i EcoT marker, lane 4-6:
pBCATOO1.
56 3.5 Analyze the sequences
The plasmid pBCATOOl is showed below (Fig. 10):
...aacgcgggttTTcgcagaaaCatgCgCtagfaTcLTftgatgacaacatgg actaagcaaaagtgcttgtcccctgacccaAGAAGGatgcttt4TG-..
".ccttctgctcgtagcgattacttcgagcattaCtgaCgaCaaagaeCC( gaccgagatggtcggggtctttttgttgtggTgCtgtgaCgtgttgtCea -.
P: hup Fig. 10. The map of pBCATOOl construction using the Gateway system.
Spr: promoter; T: hup teminator; katE: B. subtilis heme-dependent catalase;
initiation; ColEl spectinomycin resistance; repB: Bljidobacterium replication ori:
Gateway bold: colicine El origin of replication; attB1, attB2, attB5: system sites;
italic: RBS; italic: palindromes; proposed -35 and -10; uppercase: proposed uppercase
the initiation codon_
57 3.5.1 Hup-promoter
The Hup-promoter sequence is showed below:
tagatgtgaaaacccttataaaacgcgggt gaaacatgcgctaa;i;*gatgacaacatggactaagc
-35 -10
aaaagtgcttgtcccctgacccaagaaggatgcttt
RBS
The a ribosomal binding boxed proposed promoter (-35,-10) and sequence were
and underlined with a double line, respectively.
3.5.2 Hup-terminator
The Hup-terminator sequence is showed below:
ccttctgctcgtagcgattacttcgagcattactgacgacaaagaccccgaccgatggtcggggtctttttgttgtggt
gctgtgacgtgttgtccaaccgtattattccggactagttcagcg
The regions of dayd symmetry are indicated by horizontal arrows and the
following T-rich sequence is showed by a double line.
3.5.3 Catalasegene
Comparison of the B-KatE (Heme-catalase) of B. subtilis GTCO1672 with B.
subtilis subsp. subtilis st7: 168 indicated no mismatched.
3.6 The catalase activity inE. coli UM255
Escherichia coli UM255 bro leu rpsL hsdM hsdR endl lacy katG2 katE::Tn10 recA)
was used as a host strain for the gene cloing of catalase. Transformated E. coli
58 uM255 with pBCATOO1. Detected activity of catalase by adding H202 tO the Plate
colonies. See the SDS-PAGE in the Fig. 12.
was in E. UM255. 1n Fig. 11, catalase activity observed colt
Fig. 1 1. The presence ofE. colt UM255 bBCATOO1) catalase activity leads to bubble
02. formation resulting &om the transformation of H202 tO H20 and
3.7 The catalase activity in B. Longum 105-A
detected the The catalase activity was observed in E. colt UM255, then, catalase
activity in B. longum lO5-A.
3.7. 1 PBCATOO I (Heme-catalase) activity
The gene encoding the Heme-dependent catalase (pBCATOO1) of B. subtilis was
introduced into B. longum 105-A. Transformated B. Longum lO5-A was grown in
MRS medium. Catalase activity was checked by adding H202. No bubble was
observed. Then, transformated B. longum 105-A was grown in MRS medium added
Hemin (10LtM). Checked the catalase activity with the method 2.7.1.
We then determined the catalase protein in A colt UM255 and B. longum 105-A
kDa band was detected cultures on SDS-PAGE. In the fractions, one -77 migrating
and present in E. colt UM255bBCATOO1) extract, suggesting that it could
59 UM255 with pBCATOO1. Detected activity of catalase by adding H202 tO the plate
colonies. See the SDS-PAGE in the Fig. 12.
In Fig. ll, catalase activity was observed in E. coli UM255.
T-I I
Fig. 1 1. The presence ofE. coli UM255 bBCATOO1) catalase activity leads to bubble
formation resulting from the transformation ofH202 tO H20 and 02.
3.7 The catalase activity in B. longum 105-A
The catalase activity was observed in E. coli UM255, then, detected the catalase
activity in B. longum 105-A.
3.7. 1 pBCATOO1 (Heme-catalase)activity
The gene encoding the Heme-dependent catalase bBCATOO1) of B. subtilis was
introduced into B. longum 105-A. Transformated B. longum 105-A was grown in
MRS medium. Catalase activity was checked by adding H202. No bubble was
observed. Then, transformated B. longum 105-A was grown in MRS medium added
Hemin (10pM). Checked the catalase activity with the method 2.7.1.
We then determined the catalase protein in E. coli UM255 and B. longum 105-A
cultures on SDS-PAGE. In the fractions, one -77 kDa migrating band was detected
and present in E. coli UM255bBCATOO1) extract, suggesting that it could
59 correspond to BKatE. No corresponding band was detected in B. longum 105-A. The
protein ofcatalase was checked by SDS-PAGE (Fig. 12).
Fig. 12. Catalase in E. coli UM255 and B. longum lO5-A on SDS-PAGE (10% running gel, 4% stacking gel). BKatE (Heme-catalase from B. subtilis)in E. coli
UM255 was visible. BKatE in B. longum 105-A was invisible. Lane M: Protein MW
Maker (Daiichi),lane 2: E. coli UM255 bBCATOO1), lane 4: B. longum 105-A, lane 6:
B. longum 105-A bBCATOO1).
60 In Fig. 13, catalase activity was observed in B. longum 105-A.
a) B. longum 105-A bKKT427)
B, longum lO5-A O)BCATOO1)
r = l3 - 0 LI A En E ～ = tJ >
:iO < 0 u) ～ 7; 1I ql O 0
A B C
Fig. l3. Comparative assay of KatE activity. The degradation of H202 Was measured in crude protein extracts. A: B. longum 105-A harboring pBCATOO1 (hup promc.ter);B: B, longum 105-A harboring pBCATOO2 kap promoter); C: B. longum 105-A harboring
bars errors the pBCATOO3 (BkatE native promoter). Error correspond to the standard of
means.
61 The catalase activity data see below:
Table S2. The catalase activities of crude extract. (U/mg) B. longum B. longum B. longum Hemina . 105-A (wild 105-A 105-A type) bKKT427) bBCATOO 1)
nd nd 39
nd nd nd
em in in/ m e dium ' iEgd:e:r:aidi1;;:eenrco:efge(c;e;nsdilttnioa;e.d?ilBE6;fg??oT
62 3.8 Short-term H202 exposure OfB. longum 105-A
The production of BKatE by B. longum 105-A effect under oxidative stress
conditions was evaluated by oxidative stress induced by adding H202.
B. longum 105-A (pBCATOO1) was incubated for 1 h in MRS medium in the
presence of 4.4 mM H202 concentrations to determine discriminating conditions that
would allow the evaluation of the effect of BKatE on the survival of exponentially
growing cells (OD660-0.6) or stationary-phasep cells (OD660-1.0).The production of
BKatE in B. longum 105-A conferred improved survival rates were better H202
resistance than the control strain. The survival of exponentially growing cells and
stationary-phase cells in response to 4.4 mM H202 Was increased 120-fold (The data
see below).
CFU/mL and survival rates after H202 exposure for 1 h
CFU/mL after H202 exposure Survival Gro wth Survival Strain rate phase OmMH202 4.4mMH202 rateSa increasesb
B. longum Exponential 7.00x 108 1.20x 105 105-A 0.00017 0D660 0.6 (iO.34) (iO.20) bKKT42 7) B. longum 8.00x 108 1.64x 107 105-A 0.021 120 fold (iO.16) (iO.26) (PBCATOO 1) B. longum S tationary 1.68x 109 2.lox 106 105-A 0.0013 OD660 1.0 (j=0.22) (iO.40) (pKKT42 7) B. longum 1.56x 109 2.00x 108 105-A 0.13 103 fold (iO.34) (j=0.14) (PBCATOO 1)
a Survival rates were generated by comparing the colony counts for 0 versus 4.4 mM
H202 exposure for 1 h at 37oC. b survival rate increases were compared for B. longum 105-A (pBCATOO1) and B. longum 105-A bKKT427). *Data are the means i standard deviations of three independent experiments.
63 3.9 Long-term 'with aerated cultures ofB. longum 105-A
B. longum is known to accumulate H202 during its growth in the presence of 02.
We therefore also compared the long-term survival ofB. longum 105-A (pBCATOO1)
during aerated growth. Since BKatE requires exogenous hemin for activity, these
aerated cultures supplemented with hemin will lead to respiratory metabolism.
3.9.1 0D
The OD values under aerobic and anaerobic condition were assayed.
0 1 0 20 30 40 50 Time (h)
Fig. 14. Cultured B. longum 105-A bKKT427 or pBCATOO1) under aerobic or
anaerobic conditions. Growth (OD660) Of the cultured B. longum 105-A. Closed circle
(.),B. longum 105-A bKKT427) cultured under aerobic conditions; open circle (o),
B. longum 105-A bBCATOO1) cultured under aerobic conditions; closed triangle (A),
B. longum 105-A bKKT427) cultured under ahaerobicconditions; closed square (-),
B. longum 105-A (pKKT427) cultured using exogenously added catalase (3000 U/mL
medium) under aerobic conditions; open square (u),B. longum 105-A (pKKT427)
cultured using exogenously added catalase (100 U/mL medium) under aerobic
conditions. The results presented correspond to the averages of three different assays.
Error bars correspond to the standard errors of the mean value.
64 3.9,2 CFU
The CFU under under aerobic and anaerobic condition were assayed.
9
A 7 !g55 25E 3
10 20 30 40 50 Time (h)
Fig. 15. Cultured B. longum lO5-A bKKT427 or pBCATOO1) under aerobic or anaerobic conditions. Counts of B, longum 105-A cultured under aerobic conditions.
Closed circle (.),B. longum 105-A O)KKT427) cultured under aerobic conditions; open circle (o), B. longum 105-A bBCATOO1) cultured under aerobic conditions; closed square ((), B. longum 105-A (pKKT427) cultured using exogenously added catalase
(3000 U/mL medium) under aerobic conditions; open square (u), B. longum lO5-A bKKT427) cultured using exogenously added catalase (100 U/mL medium) under aerobic conditions. The results presented correspond to the averages of three different assays. Error bars correspond to the standard errors of the mean value.
65 3.9.3 LIVE/DEAD
The live and dead cells under aerobic and anaerobic condition were assayed using flow cytometry.
8
A W J ? E Bi7 jP V
6
10 20 30 40 50 Time (h)
Fig. 16. Cultured B. longum 105-A bKKT427 or pBCATOO1) under aerobic or
anaerobic conditions. L/D assay of B, longum 105-A cultured under aerobic
conditions. Closed circle (.), BJongum 105-A bKKT427) cultured under aerobic
conditions; open circle (o), B. longum 105-A (pBCATOO1) cultured under aerobic
conditions; The results presented correspond to the averages of three different assays.
Error bars correspond to the standard errors of the mean value.
66 3.9.4 H202 accumulation
The H202 accumulation under aerobic and anaerobic condition were assayed.
0.12
A 2 E ～ 0 L5 E o O .06 oNo ～ .04 I o .02 0
1 0 20 30 40 50 Time (h)
Fig. 17. Cultured B. longum 105-A (pKKT427 or pBCATOO1) under aerobic or
anaerobic conditions. H202 accumulation by B. longum 105-A cultured under aerobic
conditions. Closed circle (+), B. longum, 105-A (pKKT427) cultured under aerobic
conditions; open circle (p),B. longum 105-A (pBCATOO1) cultured under aerobic
conditions; The results presented correspond to the averages of three different assays.
Error bars correspond to the standard errors of the mean value.
67 I)iscussion
Bljidobacterium is anaerobic microorganisms which are often exposed to oxygen during industrial fermentation, product handling, and storage (11).Oxygen is generally
associated with toxicity in these bacteria that can not use oxygen as a terminal electron
acceptor. Catalase addition is currently used in numerous industrial applications to remove H202 from milk and avoid variable lag phase growth of starter cultures due to
the presence of oxygen in the medium (Pifferiet a1., 1993).The growth inhibition ofB.
longum under 20% 02 conditions was partially reversed when catalase was added to the
medium (ShinjiKawasaki et a1., 2006).Heterologous expression of a heme-dependent
catalase has been used to improve the oxidative stress-tolerance of Lactococcus lactis.
However, there are no reports about the effects of catalase expression in
Bljidobacterium. Therefore, we investigated how a heterologous catalase might be used
to protectB. longum from theH202 itproduces. (8, 15, 19, 32, 39, 40, 41, 44, 45, 51, 55,
86,87)
4.1 Protect Btjidobacterium from oxidative stress by expression of catalase
To express katE of B. subtilis, we constructed an expression vector pBCATOOl
derived from the plasmid pKKT427 by inserting the B. subtilis KatE gene within the
promoter and terminator of hup of B. lbngum and then introduced it into B. longum
105-A. The catalase activity was examined by detecting bubble (02)formation upon the
addition of 30% H202 tO the cell pellet. To determine the activity of KatE, hemin (10
pM, Sigma-Aldrich, St. Louis, MO) was added to the medium because bifidobacteria do
not synthesize heme. Catalase activity was only detected ih the cell fraction, 39 U/mg
crude protein in B. longum (pBCATOO1) vs. less than 0.1 U/mg in B. longum bKKT427)
68 under anaerobic conditions (OD660 - 1.0),whereas the extracellular catalase activity less
than 0.4%. (53,56, 57, 85)
We investigated the effect of KatE on the short-term H202 tolerance of B. longum
105-A. The survival rates ofB. longum 105-A bBCATOO1, pKKT427) were detehmined
by incubating cultures for 1 h in MRS medium with 4.4 mM H202 at 37oC. The survival /
rates of B. longum 105-A bBCATOO1) during the exponential and stationary phases
were significantly increased by 120- and 103-fold, respectively, compared to that ofB.
longum 105-A (pKKT427). The data in Table 1 illustrate that exponential-phase cells
were more sensitive to H202 than stationary-phase cells. (50)
We also investigated the physiology ofB. longum 105-A under aerobic conditions. B.
longum 105-A bKKT427) reached a maximum growth rate at 12 h aRer inoculation
under anaerobic conditions. The growth ofB. longum 105-A (pBCATOO1) was partially
inhibited and B. longum 105-A bRT427) was nearly stopped under aerobic culture
conditions (Fig. 14). To measure growth rates, cells were cultured and then
plate-counted. Although most of the B. longum 105-A bKKT427) specimens survived
12 h of aerobic culture, cell growth began to sharply decrease and became almost
unculturable aRer 24 h in aerobic culture. However, B. longum 105-A bBCATOO1)
exhibited high survival (1x107 colony-forming units (CFU)/mL) at 24 h and only
became unculturable after 48 h in aerobic conditions (Fig.15).The presence of KatE
protected B. longum 105-A from aerobic culture-induced death.
The concomitant generation of H202 Was also measured (Fig.17).The accumulation
of H202 in B. longum 105-A (pKKT427) increased for 18 h and peaked at 0.1 mM.
H202 Was scavenged by the genetically expressed catalase during the exponential phase,
and it did not begin to accumulate in the medium ofB. longum 105-A bBCATO'01) until
the stationary phase. At this time, the cells became unculturable (Fig.1 5).Interestingly,
the decrease in the growth of B. longum 105-A bKKT427) was faster than that of B.
69 longum 105-A bBCATOO1). This might be because the concentration of H202 in B. longum 105-A bBRT427) was 2-fold higher than that ofB. longum 105-A bBCATOO1) in aerated cultures. B. longum 105-A bBCATOO1) survived longer due to the increased period of time in which H202 had not accumulated. This difference in growth suggests that H202 Was Primarily responsible for B. longum 105-A becoming unculturable under
aerobic conditions.
Lahtinen et al. reported that B. longum lost culturability quickly during storage, but the cells still maintained intact membranes (47).H202 is known to damage DNA and protein; however, it is unknown whether H202 Can easily damage the B. longum membrane. Therefore, we investigated whether it was possible that B. longum 105-A
lost their culturability but maintained an intact membrane. These experiments were
conducted using the LIVE/DEAD BacLight bacterial viabilitykit (L/D; hviLfr.gen).
After 24 h in aerobic culture, B. longum 105-A containing pKKT427 remained relatively stable, and lx107 'viable' cells/mL were maintained (Fig.16); however, the
survival decreased to lx101-2 cFu/mL (Fig.15).Based on this information, we were
only able to make the decision that the cells had intact membranes, but it is still
unknown whether the cells were dead. To conf1rm Whether cells maintain viability,
further studies are needed, such as examining the synthesis ofDNA, RNA, and protein.
Some studies reported that adding exogenous catalase to the liquid medium improved
aerobic growth of bifidobacteria. Because H202 readily difhses across cell membranes
but exogenously added catalase cannot penetrate cell membranes, we therefore
compared the culturable B. longum 105-A protected by catalase expression with the
culturable B. longum 105-A protected by the addition of exogenous catalase. Although
the counts of B. longum 105-A bKKT427) recovered when cultured under aerobic
conditions with exogenously added catalase from bovine liver (100 and 3000 U/mL
medium, C1345-1G, SIGMA), the counts ofB. longum 105-A bKKT427) were similar
70 regardless of concentration of added catalase. Interestingly, the counts of B. longum
105-A protected by addition of exogenous catalase were nearly identical those of to B.
longum 105-AbBCATO61) when ae,.bically cultured f.r 18 h, alth.ugh the
concentrations of exogenously added catalase were much higher than the levels of
expressed catalase. B. longum 105-A that was protected by exogenously added catalase
was unculturable aRer 36 h in aerated culture; however, B. longum 105-A bBCATOO1)
did not become unculturable until 48 h in aerated culture. These results indicate that B.
longum maintained intact cell membranes whereas induced exogenously added catalase
eliminated extracellular H202 but was unable to eliminate intracellular H202.
H202 Was a Primary factor in Bljidobacterium becoming unculturable under aerobic
conditions; the addition of exogenous catalase or the genetic expression of catalase
could protect Bljidobacterium from oxidative stress. This effect was weaker for
exogenous catalase than for heterologously expressed catalase. Further studies are
needed to find a promoter that can induce higher and prolonged expression of catalase
that will allow for complete scavenging of H202 and improve viability under aerobic
conditions.
4.2 Improvement of catalase expression level
Although expression of catalase could protect Bljidobacterium from oxidative stress,
the expression level was stilllow. To improve the expression level, we tried to improve
the transcription and translation of catalase level.
4.2. 1 Transcription
It is difrlCult to obtain high levels of expression of foreign genes in Bljidobacterium,
71 some shuttle vectors have been reported. The promoters of the gap, a-galactosidase, lacl
family transcriptional regulator, 16s rRNA, and hup genes from Bljidobacterium have been used to express foreign genes in B. longum and B. breve. In this study, the B.
subtilis catalase gene could not be expressed under the control of its native promoter. To
obtain high catalase activity in Bljidobacterium, a strong, organism-specific promoter
have high indices in B. was needed. The gap and hup genes codon adaptation (CAIs)
longum, 0.742 and 0.629, respectively, and both are highly expressed in Bljidobacterium.
Homology searches were performed for the upstream regions of gap and hup in B.
adolescentis ATCC15703, B. animalis lactis ADOll, B. bljidum PRL2010, B. dentium
Bd1, and B. longumNCC2705 (Fig.18). The gap and hup upstream regions have a
highly conserved putative ribosome binding site (RBS). By comparison to the typical
TTGACA TATAAT, TTGGCN -35 and -10 promoter consensus sequences of and and
TANTAT for hup were possible candidate the gene -35 and -10 sequences, respectively.
For TACAGT, was in the gap gene, the promoter -10 sequence, conserved all strains.
H.wever, TTGCCC in was the putative p,.m.te, -35 sequence all Pljidobacte,ium
B. lactis ADOll, strains except animalis whose putative prorpoter -35 sequence was
TTGAAG. In distance between addition, the the putative -35 with -10 regions of the
hup promoters in five Bljidobacteria strains and the gap promoter in B. animalis lactis
were shorter than the typical distance; however, the distance between them in the gap
promoters in B. adolescentis, B. bljidum, B. dentium, and B. longum was 18 nucleotides.
Since littleis known about the po1ymerase in Bljidobacteria compared to those of other
bacteria, further experiments will be required to understand the upstream regions of
these genes (28,29, 30, 33, 48, 52, 59, 75, 80, 81).
The results of quantitative RT-PCR for catalase transcript in B. longum 105-A
bBCATOOl and pBCATOO2) are shown on flg. 19. The quantity of catalase transcript
was close to each other under the control of hup and gap promoter either at the
72 exponential phase or stationary phase, and the catalase activity also was close (1.18-fold, hup promoter vs. gap promoter, Fig. 13).
A -35 ･1ql -loo I a.dqllium Bdl ITIAe rIII T PrT*c TIAAAcAcACGllLIJceI7Ac TTGCe #5GTAC:ACT)GJ 54 a.adolescenLis A 7CC 75703 ILll CRT TT It>AACACQCG IILCl5l AAC TGCt 8Jorgum NCC2705 1LIII TTT rrT IAAACE}CACG IIJTQ AAC TGCC Ef:;2:::!i;I5545 s4 LLbiGdum PRL20 10 ::I.::LLLll TTT AT L^AdCAAd[CG IbLOA Ace TGCT gLt81'ACA6L1@b QdG 55 a.admalis lacEls JWO1 1 II(AArtIITC:C AA ;r!!-iLTTE:QOC4CG JILcd TGAA P?ABCAA.L)qll TGCC CqlSOnSUS ANNACNCCNTTTTT6C -CNAAACACGCG-CCNCGNAAC -10 a_dLZnILum Bdl CQC TARAQ 111 111 a_i)doltrsconLLs A 71CC15703 CC;C TA#AG ;:::::;::::::T,::E::S::I:E2:E:::!Gi::::::: 8Jorgum NC C2705 GGC TA8AG T6TT66TAAACAATR66C 110 a_bill-dun PRL20 10 C6C TACAG IC&IT6TT6GTAAACAA4GGC 110 1{1 a.admaJjs lac(Is ADO1 1 CCG TAgAA GIcAJTGTTGGTTAACC^ALT;CCII -^GCAI(;TGI)AICCATCCGI TACAG GNCANTGT TGGTAAACAATGGCNTCAGTGN6CCNNANGCACGCGN
･20 FIBS l a.dqlLEum Bdl BGgCPACCCTA AGGGA TilTA 138 a.adoLEFSCeI7Lis A 7CC 75703 AGE?C#Al= C CTA AG6GA WTA 13$ BJotvum NCC2705 AGICF]Al=CCTAI WTA 138 a. bJlidum PFIL2010 #GPCPIACCCTAJ A6G6A Fq-A 138 a,8nlnL?Ills lacds ADO1 7 B6gC&TCCCC AG G6A F=TA 134 Ccnsensus AG6GA TTA
B :ttl -120 I I a.adolEZSCOhuS A TCC 7 5703 cTTAtAAAATQaCA a.dmlium Bd1 cT TAIAGA^TQE:qQ 8Jongum NCC2705 c T Ti(A AAA EW.e@GIa] a.bJGhTr7 Pt?L2010 CTTL A^A^TGCQQ By8dm3IJs lacLLS ADO1 1 Tt) AAAC&Cbgo CmsbnSUB T TNAACCCCCNTNNNNGNAANAAANT6NGCGAAAACCCTTATAAAATGC6GGT
-6D JW -10 L 1 1 16 a_adolDSLHnLLls A TCC15703 ALVA cT1^TGA^CgT4qIA11TTdllL:; LAAqeIQL4TSyCCCCTG &dentlum 8d7 11t5 AITA ;iT_iATr.^ACGTQGACiTCii BJorqum NCC2705 All7fA IAAAE)IG)1-T4QccccTG 116 a.bd7dtln7 PRL2010 JdAAQ]gIAIA 116 AICA LTTI^TGAACACCE)qgLATIll EIAAVCIOLATQTccccTG-@gCCCC?6 a_brrmalJs lacrjs ADO7 7 LggALcLTGAG AIBA llTltTTGAACATMQqTAIMBIAATQIQIATT Fig. 18. Alignment of the upstream sequences of gap (A) and hup (B) genes. The start were blocked. codon, proposed RBS, -35 and -10 sites 73 0 U) a -a ～ a O I+ 0 JJ> 'j= E a = O 4) > i; -q} EE 0 Exponential-phase Stationary-phase Fig. 19. Relative quantity (RQ) of catalase transcripts in B. longum 105-A bKKT427-HkatE or pKKT427-GkatE) at exponential-phase (OD660 0f -0.6) and Data were to the stationary-phase (OD660 0f -1.0). normalized chromosomal gap gene and analyzed by the 2-AACT method. Values represent the fold change compared with B. longum 105-A bKKT427-HkatE). The quantity of catalase transcript in B. longum 105-A Q)KKT427-GkatE) was 1.058-fold than the B. longum 105-A bKKT427-HkatE) at exponential-phase, and the quantity of catalase transcript in B. longum 105-A bKKT427-llkatE) was 1.047-fold than the B. longum 105-A b)KKT427-GkatE) at stationary-phase. Empty bar: B. longum 105-A bKKT427-HkatE); solid bar: B. longum 1 05-A bKKT427-GkatE). Error bars correspond to the standard errors of the means, 74 4.2.2 Translation 0 In prokaryotes, the promoter consists of2 short sequences at the -1 and -35 positions length from 3 to 9 upstream &om the transcription start site. The ofa RBS varies nt, and the distance bet&een the RBS and the initiation codon ranges from 5 to 13 nt. considering the promoter size, and the length of the RBS and spacer, we investigated the upstream areas of the 1,243 genes in which the interspaces of the coding region are hypothetical longer than 50 nt in B. longum NCC2705, which carries 1,727 genes. We + high in counted the A, T, G, C &equency (Fig.20).The A G contents are very 18 nt upstream of the initiation codon. We then counted the frequently appearing sequences 5 to Almost high &equency nt, 6 nt and 7nt from positions-1 -18 (Fig.21). all sequenceg were complemented to the 3'-end of B. longum 16S rRNA. AAGGAG showed the highest 6 nt frequency which was 2.8-fold compared to AGGAGG. We designed various RBSs with lengths from 5 nt to ll nt, and with a 6 nt spacer, according to the B. longum 16S 3'-end AAGGAG was as a core rRNA (5'-...CACCUCCUUUCU -3'); used sequence (Fig.22).These sequences were introduced into expression vectors and we assayed their catalase activities. Quantitative analysis of catalase activity was measured by the decrease of optical density at 240 nm as described. The strain had the greatest activity when the RBS was AAGGAG (6nt)which matched the statistical data (Fig.23). When the RBS was longer than 6 nt, the activity decreased in B. longum. This might be because the ribosome bound to mRNA so tightly that disturbed releasing the ribosome to start the translation. We also counted the 6 nt nucleotides with upstream fi.equencies with the same manual in other Bljidobacteria species, including B. adolescentis ATCC15703, B. bljidumPRL2010 and B. animalis subsp. lactis ADOll. AAGGAG was the most common 6 nt nucleotide in all of the strains. These results indicated that AAGGAG was the canonical RBS in Blf2iobacteria.(7,12, 16, 17, 31, 58, 62, 82, 83) 75 600 > O =q) 400 = a 300 L LL 200 0 -27 -24 -21 -18 -15 -12 -9 -6 -3 Position Fig. 20. The A, T, G, C &equency in the upstream areas of the genes with interspaces of the coding region longer than 50 nt in B. longum NCC2705. 6 7 The frequency of5 nt, nt, and nt frompositions -1 to -18 AAG GA 315 AAGGAG166 CAAGGAG 51 AGGAG 268 AAAGGA 110 GAAAG GA 48 AAAGG 181 GAAAGG 97 AAAGGAG 47 AG GAA 163 CjuGGA 74 AAGGAGA 38 GGAGG 147 AAGGAA 72 GAAGG AG 35 GAAAG 135 GjuGGA 65 TAA G GAG 33 GAG GA 135 AGGAGG 62 AjuGG AA 32 GAA GG 126 TAAGGA 55 AAGGAGG 29 GGAGA 115 AGGAGA 52 AGAAAGG 29 CAAGG 96 AGAAAG 44 CGAAAGG 27 Fig. 21. The top 10 frequently appearing 5 nt, 6 nt, and 7 nt nucleotides from to in areas the interspaces the positions -1 -18 the upstream of genes where of coding region are longer than 50 nt in B. longum NCC2705. 76 RBSn Sequence RBSI CCC AG GGA GT ATGCTT ATG WS2 CCC G GGA T ATGCTT ATG RBS3 CCC GGA TG ATGCTTATG RBS4 CCC GGA T ATGCTT ATG RBS5 CCC GGA ATGCTT ATG WS6 CCC GGA ATGCTT ATG RBS7 CCC GGA ATGCTT ATG WS8 CCC GGA ATGCTT ATG RBS9 CCC A GGA ATGCTT ATG I['IJII 3'- UCU tJCCUC CAC... -5' B. longum 16S rNA Fig. 22. RBSs were designed according to B. longum 16S rRNA 3'-end (5' Bold indicate the WS. Italic indicate -...CACCUCCUUUCU- 3'). characters characters the initiation codon. 77 Jl = %110 L a- 100 D 5 90 = v> 80 - :i 70 - a 60 S50 40 a 1 2 3 4 5 6 7 8 9 O RBSn Fig. 23. Sequence comparison and translation efnciency of various RBSs in B. longum. The catalase activities are compared in B. longum 105-A. The results presented correspond to the averages of 3 different assays. Error bars correspond to the standard errors of the mean value. longum we analyzed the spacers between AAGGAG and the initiation codon in B. in longum and some other strains. The spacer lengths were mainly from 5 nt to 8 nt B. NCC2705 (Fig. 24), and similar results were obtained in other Bljidobacteria (Figure S2). We designed spacers of various lengths ranging from 4 nt to 9 nt between RBS (AAGGAG) and the initiation codon (Figure 2B). The activity with a 5 nt spacer was the strongest which also matched the statistical data (Figure2C). The activity with a 4 nt spacer was significantly lower, and showed only 15% of the activity obtained using a 5 nt spacer. The activity of the optimized RBS10 Was 2.8-fold greater than that of the hup RBS (Figure 2).However the spacers ofRBS3-5 included the sequence binding to the B. longum 16S rRNA 3'-end which might affect the translation. Therefore we designed another series RBShn tO compare the spacer lengths. 78 B. longum NCC2705 60 50 > g40 0 a30 0 L20 10 0 3 4 5 6 7 8 9 10 ll 12 Spacer (nt) B. bI'hdum PRL201 0 60 50 > E 40 0 a30 0 i 20 10 0 3 4 5 6 7 8 9 10 ll 12 Spacer (nt) 79 B. an/'malI'S Subsp. lactjs ADO1 1 60 50 &40 = 930 g e 20 L.L 10 0 3 4 5 6 7 8 9 10 ll 12 Spacer (nt) B. ado/escentis ATCC 1 5703 > O = 0 = g P LL 0 3 4 5 6 7 8 9 10 ll 12 Spacer (nt) Fig. 24. The frequencies ofAAGGAG appearing in B. longum NCC2705, B. animalis subsp. lactis ADOll, B. bljidum PRL2010 and B. adolescentis ATCC15703, with spacers &om 3 nt to 12 nt. 80 mSn Sequence Spacer msll CCt AAGGA GCTT ATG 4 mSlO CCC AAG GA TGCTT ATG 5 RBS7 CCC AAGGA ATGCTT ATG 6 RBS6 CCCA AAG GA ATGCTT ATG 6 RBS5 CCCA AAG GA GATGCTT ATG 7 WS4 CCCA AAG GA GTATGCTT ATG 8 mS3 CCCA AAG GA GTGATGCTT ATG 9 J[J[H UUCC UC CAC... 3'-UC -5' B. longum 16S rmA hup RBS CCCAAGAAGGATGCTTT ATG Fig. 25. The lengths of spacers between AAGGAG and the initiation codon in B. longum. RBS was AAGGAG with various spacers from 4 nt to 9 nt and the hup sequence upstream of the initiation codon. Bold characters indicate the RBS. Italic characters indicate the initiation codon. 81 J～ = l5 l- O 140 i 1 D 120 E 't 100 = V 80 60 :-;15 < 40 4) u) a 20 -o3 - a 0 O ll 10 7 6 5 4 3 RBSn Fig. 26, The lengths of spacers between AAGGAG and the initiatK,n COdon in B- longumL The catalase activities are compared in B. longum 105-A. The spacers are above the histogram. The resu)ts presented correspond to the averages of3 different assays, Error bars correspond to the stiuldard errors of the meEul Value, The sequence of the hup gene upstream is 5'- CCCAAGAAGGATGCTTT. The 3'-end longum NCC2705 16s is 5'-...CACCUCCUUUCU We sequence ofB. rRNA -3'. calculated the binding energies of the 2 sequences using the program at http://mfold.rna.albany.edu//?q-DINAMelt/Two-state-melting. In the hup gene upstream, GAAGGA had the strongest binding force, with AG of-4.5 kcal/mol, the AG for AGAAGG was kcal/mol the AG for AAGGAT was kcal/mol. This -3.6 and -3.9 suggested that the proposed RBS should be GAAGGA. We constructed plasmids having various spacer lengths in the series RBSlm and introduced them into B. longum 105-A to 82 assay the catalase activity (Fig.27).B. longum 105-A had the strongest catalase activity when the spacer was 5 nt. Catalase activity was not observed in B. longum 105-A when the spacers were 3 nt and 2 nt. The activity ofB. longum 105-A with a 4 nt spacer was only 30% compared to activity with a 5 nt spacer. The results also matched with our hypothesi s. RB Shn Sequence Sp acer mSh2 CCC GAAGG TG ATG 2 RBSh3 CCC GAAG G TGC ATG 3 RBSh4 CCC GjuGG TGCT ATG 4 RBSh5 CCC GJuG G TGCTT ATG 5 RBSh6 CCC GAAGG TGCTTT ATG 6 mSh7 CCC GAAGG TGCTTTT ATG 7 RBSh8 CCC GAAGG TGCTTTTT ATG 8 RBSh9 CCC GAAGG TGCTTATTT ATG 9 iJ[JJI UUUCCU CCAC-. 3'-UC -5' B. longum 16S rRNA Fig. 27. The lengths of spacers between GAAGGA and the initiation codon in B. longum. RBS was GAAGGA with various spacers &om 2 nt to 9 nt. Bold characters indicate the RBS. Italic characters indicate the initiation' codon 83 A = JB 70 0 i60 tD E 50 i a40 > f30 - Fig. 28. The lengths of spacers between GAAGGA and the initiation codon in B. longum. The catalase activities are compared in B. longum 105-A. The results presented correspond to the averages of 3 different assays. Error bars correspond to the standard errors of the mean value. 84 Conclusion Bljidobacteria are probiotics widely used in various therapeutics and food products, including yogurt, fermenteld bilk, and dietary supplements, to balance the natural flora of the gut, which protects against intestinal infections. To be effective, Bljidobacteria must remain viable until reaching the intestinal tract. However, Bljidobacteria are obligate anaerobic bacteria, and their sensitivity to 02 limits manufacturing and because shelf-life. Anaerobic bacteria cannot grow under aerobic conditions the organisms produce H202 and OH radicals, which are toxic molecules that damage DNA, 1ipids, and proteins, and the organisms lack a hydrogen peroxide (H202) detoxiflCation system. Bljidobacteria have an oxidase that uses 02 aS an electronacceptor reduced to H20 and H202, and pr.ducti.n.f H202 is the primary reason for bljidobacteriaaerobic growth inhibition. H202 accumulates in the cultured medium ofBljidobacteriumlongum and Bljidobacterium bljidum under 10% and 20% 02 conditions. Kawasaki et al. purified b-type dihydroorotate dehydrogenase, an H202-forming NADH oxidase, from B. bljidum. Although some types of peroxidases are found in Bljidobacteria,including NADH peroxidase, thiol peroxidase, alkyl hydroperoxide reductase, and peptide methionine sulfoxide reductase, the activities of these peroxidases are so weak that they cannot decompose the H202 Produced by Bljidobacteriaunder aerobic conditions. Several methods have been used to generate oxidative stress-resistant Bljidobacteria. H202-adapted cells were selected by Continuous culture with cell immobilization. Adding exogenous catalase to the liquid medium improved Bljidobacterium aerobic growth. Various vitamins and antioxidants, including white grape seed extract, green tea extract, and vitamin C, were tested for their ability to improve the stability of Bljidobacterium in yogurts and fruit juices.However, molecular biology techniques have nitbeen used t. gene,ate.xidative st,ess-resistant Bljidobacte,ium. (25,42, 64, 67,68) 85 Superoxide dismutase, catalase, and glutathione peroxidase (GPX) constitute the enzymatic antioxidant system. GPX and catalase are the enzymes that can decompose H202 tO H20. GPX was mainly studied in eukaryotic organisms; however, little is known about GPX activity in prokaryotic organisms, and a GPX gene has not been detected in the genomic sequences of bifidobacteria. In addition, bifidobacteria do not found in carry glutathione synthesize pathway. Catalase is an enzyme commonly aerobic bacteria but is absent in almost all anaerobic bacteria including Bljidobacterium. Two tkes of catalases are known: heme-dependent catalase and manganese-dependent is catalase. B. subtilis KatE (heme-dependent catalase)is a well-known catalase that used to improve the viability of some species of bacteria via hete;ologousexpression. (72,74) In this study, we tested the effects of production of B. subtilis heme-dependent c-atalase under the strongest promoter on the oxidative stress resistance of B. longum 1 05-A in comparison to culturing B. longum in medium containing exogenous catalase. As a result, heterologously expressed catalase in B. longum 105-A might eliminate H202 and improve antioxidant properties for more than 20 h under aerobic conditions. Futher study will be required to determine a promoter that can sustain expression of foreign genes during stationary phase in Bljidobacterium.(73) However the expressed catalase activity was still low in Bljidobacterium. The high level expression of protein depends on many factors, including transcription, translation and protein degradation. To improve catalase expression level, we tried to improve catalase transcription and translation level in B. longum. The gap gene, which encodes the enzyme glyceraldehyde 3-phosphate dehydrogenase, and the hup gene, which encodes a histone-like protein HU, are highly expressed in B. longum (http://genomes.urv.cat/HEG-DB).We compared the activities of the native B. subtilis heme-dependent catalase (KatE) promoter, the gap promoter, and the hup 86 had promoter. As a result, the native B. subtilis heme-dependent catalase promoter no activity in B. longum, activity ofhup promoter was close to gap promoter. (71) ,the Translation is an important process for expression and is divided into 4 phases: initiation, elongation, termination, and ribosome recycling. In these phases, translation initiation is regarded as the rate limiting and most highly regulated phase. Shine and Dalgarno flrSt identifled the ribosome-binding site (RBS) that interacts with the 3' 16S during translation initiation, found that complementary -end of rRNA and AGGAGG was the canonical RBS. Barrk. D. et al. expressed P-galactosidasewith > randomized ribosome binding sites and translation yields varied by 3000-fold. Wilson B. S. et al. increased protein expression by mutating the RBS. Ringquist S. et al. confirmed there was an optimal spacer between RBS and the initiation codon. Chen H. et al. conBrmed the efrlCient spacer using TAAGGAGGT as a RBS. Gold L. et al reported that a spacer of 5 nt to 13 nt influenced the efrlCiency oftranslational initiation in E. colt. These results suggested the nucleotide sequence of the RBS and the spacer were critical for translation initiation. However, the studies conceming RBS were mainly conducted in Escherichia coli, and Very limited information is available on simila, studies c.nducted in.the, g;ne,a(21,24, 26, 27, 65, 66, 69, 70). Bljidobacterium inhabits the gastrointestinal tract, vagina, and mouth, and is thought to be beneficial in humans. During recent decades, Bljidobacterium has been widely used in many flelds, including food products and therapeutics. With the development of science and technology, molecular biological techniques are also widely used to study Bljidobacterium. However, for high expression ofa foreign gene, little is known about the roles ofthe plasmids, strong promoters, and highly ej?PcientRBS inJBljidobacie,ium, although several RBSs for some upstream genes were proposed such as GGAGG, AAGGAA, GAGGA, AGGAGG, AGGAG, and AGAAGG. The lengths of the proposed RBSs in Bljidobacterium focused on 5 nt and 6 nt. However, it was stillunknown which 87 RBS and spacer length was the most efncient in Bljidobacterium. In summery, we have conf1rmed that P) H202 is a main factor in Bljidobacterium becoming unculturable under aerobic conditions and PI) addition of exogenous catalase was for protected Bljidobacterium; PII) however, the effe6/t weaker exogenous catalase than heterologously expressed catalase. Catalase expression in B. longum 105-A might eliminate H202 and improve antioxidant properties for more than 20 h under aerobic conditions. Futher study will be required to determine a promoter that can sustain expression of foreign genes during stationary phase in Bljidobacterium. And we demonstrated that in B. longum, PV) the efrlCient RBS was AAGGAG and m the efficient spacer was 5 nt. Informatics showed- good correlation with the experimental results; therefore, qI) we propose these predictions should be applicable to other bacteria. 88 Reference 1. Abriouel, H., A. Herrmann, J. Starke, N. M. Yousif, A. Wijaya, B. Tauscher, W. IIolzapfel, and C. M. Franz. 2004. Cloning and heterologous expression of hematin-dependent catalase produced by Lactobacillus plantarum CNRZ 1228. Appl Environ Mi&obio1 70:603-606. Aho, E. L., and L. P. Kelly. 1995. Identification of a glutathione peroxidase homolog in Neisseria meningitidis. DNA Sequence 6:55-60. Arenas, F. A., W. A. Dial, C. A. Leal, J. M. Perez-Donoso, J. A. Inlay, and c. c. vasquez. 2010. The Eschehchia coli btuE gene, encodes a glutathione peroxidase that is induced under oxidative stress conditions. Biochemical and Biophysical Research Communications 398:690-694. Barrick, D., K. Villanueba, J. Childs, R. Kalil, T. D. Schneider, C. E. Lawrence, L. Gold, and G. D. Stormo. 1994. Quantitative analysis of ribosome binding sites in E.coli. Nucleic acids research 22:1287-1295. Beckman, J. S., R. L. Minor, Jr., C. W. White, J. E. Repine, G. M. Rosen, and B. A. Freeman. 1988. Superoxide dismutase and catalase conjugated to polyethylene glycol increases endothelial enzyme activity and oxidant resistance. J Biol Chem 263:6884-6892. Behl, C., J. B. Davis, R. Lesley, and D. Schubert. 1994. Hydrogen peroxide mediates amyloid beta protein toxicity. Cell 77:8 17-827. Berwal, S. K., R. K. Sreejith, and J. K Pal. 2010. Distance between RBS and AUG plays an important role in overexpression of recombinant proteins. Analytical Biochemistry 405:275-277. Bin-Nun, A., R. Bromiker, M. Wilschanski; M. Kaplan, B. Rudensky, M. Caplan, and C. IIammerman. 2005. Oral probiotics prevent necrotizing enterocolitis in very low birth weight neonates. Journal of Pediatrics 89 147:192-196. Blattner, F. R., G. Plunkett, 3rd, C. A. Bloch, N. T. Perna, V. Burland, M. Riley, J. Collado-Vides, J. D. Glasner, C. K. Rode, G. F. Mayhew, J. Gregor, N. W. Davis, H. A. Kirkpatrick, M. A. Goeden, D. J. Rose, B. Mau, and Y. Shao. 1997. The complete genome sequence of Escherichia coli K-12. Science Pew York, N.Y.) 277:1453-1462. 10. Brioukhanov, A. L., and A. I. Netrusov. 2004. Catalase and superoxide dismutase: Distribution, properties, and physiological role in cells of strict anaerobes. Biochemistry-Moscow 69:949-962. ll. Caglar, E., 0. 0. Kuscu, S. S. Kuvvetli, S. K. Cildiri N. Sandalli, and S. Twetman. 2008. Short-term effect of ice-cream containing Bifldobacterium lactis Bb-12 on the number of salivary mutans streptococci and lactobacilli. Acta Odontologica Scandinavica 66: 1 54-1 58. 12. Chen, H., M. Bjerknes, R. Kumar, and E. Jay..1994. Determination of the optimal aligned spacing between the Shine-Dalgarno sequence and the translation initiation codon of Escherichia coli mRNAs. Nucleic acids research 22:4953-4957. 13. Chen, L., L. Keramati, and J. D. Helmann. 1995. Coordinate regulation of Bacillus subtilis peroxide stress genes by hydrogen rperoxide and metal ions. Proceedings of the National Academy of Sciences of the United States of America 92:8190-8194. 14. Cronin, M., M. Knobel, M. 0'Connell-Motherway, G. F. Fitzgerald, and D. van Sinderen. 2007. Molecular dissection of a Bifidobacterial replicon. Applied and Environmental Microbiology 73 :7858-7866. 15. Dave, R. I., and N. P. Shah. 1997. Effectiveness ofascorbic acid as an oxygen scavenger in improving viability of probiotic bacteria in yoghurts made with 90 commercial starter cultures. International Dairy Journal 7:435-443. 16. De Boer, H. A., L. J. Comstock, A. Hui, E. Wong, and M. Vasser. 1983. A hybrid promoter and portable Shine-Dalgarno regions of Escherichia coli. Biochem Soc Symp 48:233-244. 17. de Smit, M. H., and J. van Duin. 1990. Secondary structure of the ribosome binding site determines translational efflCiency: a quantitative analysis. Proc Natl Acad Sci U S A 87:7668-7672. 18. de Vries, W., and A. II. Stouthamer. 1969. Factors determining the degree of anaerobiosis of Bifldobacterium strains. Arch Mikrobio1 65:275-287. 19. DeShazer, D., G. E. Wood, and R. L. Friedman. 1994. Molecular characterization of catalase from Bordetella pertussis: identification of the katA promoter in an upstream r insertion sequence. Molecular microbiology 14:123-130. 20. Farr, S. B., and T. Kogoma. 1991. Oxidative stress responses in Escherichia Salmonella Microbiol Rev 55:561 coli and typhimurium. -585. 21. Federici, F., B. Vitali, R. Gotti, M. R. Pasca, S. Gobbi, A. B. Peck, and P. Brigidi. 2004. Characterization and heterologous expression of the oxalyl coenzyme A decarboxylase gene from Bifidobacterium lactis. Applied and Environmental Microbiology 70:5066-5073. 22. Fridovich, I. 1998. Oxygen toxicity: A radical explanation. Journal of Experimental Biology 201 : 1203-1209. 23. Fridovich, I. 1995. Superoxide radical and superoxide dismutases. Annu Rev Biochem 64:97-1 12. A 24. George, H. J., J. J. L'Italien, W. P. Pilacinski, D. L. Glassman, and R. A. Krzyzek. 1985. High-level expression in Escherichia coli of biologically active bovine growth hormone. DNA 4:273-281. 91 25. Gill, H. S., K. J. Rutherfurd, M. L. Cross, and P. K. Gopal. 2001. I Enhancement of immunity in the elderly by dietary supplementation with the probiotic Bifidobacterium lactis HNO1 9. American Journal of Clinical Nutrition 74:833-839. , 26. Gold, L. 1988. Posttranscriptional regulatory mechanisms in Escherichia coli. Annu Rev Biochem 57:199-233. 27. 'Goulas, T. K., A. K. Goulas, G. Tzortzis, and G. R. Gibson. 2007. Molecular cloning and comparative analysis of four beta-galactosidase genes from Bifidobacterium bifidum NCIMB41171. Applied Microbiology and Biotechnology 76: 1365-1 372. 28. Guglielmetti, S., A. Ciranna, D. Mora, C. Parini, and M. Karp. 2008. Construction, characterization and exempliflCative application of bioluminescent Bifldobacterium longum biovar longum. Int J Food Microbio1 124:285-290. 29. Guglielmetti, S., M. Karp, I). Mora, I. Tamagnini, and C. Parini. 2007. Molecular characterization of Bifidobacterium longum biovar longum NAL8 plasmids and construction of a novel replicon screening system. Appl Microbiol Biotechno1 74:1053-1061. 30. Guyonnet, D., 0. Chassany, P. Ducrotte, C. Picard, M. Mouret, C. II. Mercier, and C. Matuchansky. 2007. Effect of a fermented milk containing Bifidobacterium animalis DN-173 010 on thehealth-related quality of life and symptoms in imitable bowel syndrome in adults in primary care: a multicentre, randomized, double-blind, controlled trial. Alimentary Pharmacology & Therapeutics 26:47i486. 31. Hall, M. N., J. Gabay, M. Debarbouille, and M. Schwartz. 1982. A role for mRNA secondary structure in the control of translaJtion initiation. Nature 295:616-618. 92 32. Hamaji, Y., M. Fujimori, T. Sasaki, H. Matsuhashi, K. Matsui-Seki, Y. Shimatani-Shibata, Y. Kano, J. Amano, and S. Taniguchi. 2007. Strong enhancement of recombinant cytosine deaminase activity in Bifldobacterium longum for tumor-targeting enzyme/prodrug therapy. Bioscience Biotechnology and Biochemistry 71:874-883. 33. Hartz, D., D. S. M;Pheeters,and L. Gold. 1991. Influence of mRNA determinants on translation initiation in Escherichia coli. J Mol Biol 218:83-97. 34. Herbette, S., P. Roeckel-Drevet, and J. R. Drevet. 2007. Seleno-independent glutathione peroxidases - More than simple antioxidant scavengers. Febs Journal 274:2163-2180. 35. Hidaka, A., Y. Hamaji, T. Sasaki, S. Taniguchi, and M. Fujimori. 2007. Exogeneous cytosine deaminas;gene expression in Bifldobacterium breve 1 for therapy. Bioscience Biotechnology -53-8w tumor-targeting enzyme/prodrug and Biochemistry 71 :2921-2926. 36. Hu6rta, A. M., M. P. Francino, E. Morett, and J. Collado-Vides. 2006. Selection for unequal densities of sigma70 promoter-like signals in different regions oflarge bacterial genomes. PLoS Genet 2:e185. 37. Itamii T., M. Asano, K. Tokushige, K. Kubono, A. Nakagawa, N. Takeno, H. Nishimura, M. Maeda, M. Rondo, and Y. Takahashi. 1998. Enhancement of disease resistance of kuruma shrimp, Penaeus japonicus, after oral administration of peptidoglycan derived from Bifidobacterium thermophilum. Aquaculture 164 :277-288. 38. Jayamanne, V. S., and M. R. Adams. 2006. Determination ofsurviva1, identity and stress resistance of probiotic bifidobacteria in bio-yoghurts. Letters in Applied Microbiology 42: 189-1 94. 39. Kawasaki, S., T. Mimura, T. Satoh, K. Takeda, and Y. Niimura. 2006. 93 324:255-258. 47. Lahtinen, S. J., M. Gueimonde, A. C. Ouwehand, J. P. Reimikainen, and S. J. Salminen. 2005. Probiotic bacteria may become dormant during storage. Applied and environmental microbiology 71: 1662-1 663. 48. Laursen, B. S., II. P. Sorensen, K. K. Mortensen, and H. U. Sperling-Petersen. 2005. Initiation of protein synthesis in bacteria. Microbiology and Molecular Biology Reviews 69: 1 01-123. 49. Li, Y., and H. E. Schellhorn. 2007. Rapid kinetic microassay for catalase activity. J Biomol Tech 18:185-187. 50. Loewen, P. C., and J. Switala. 1987. Multiple catalases in Bacillus subtilis. Journal ofbacteriology 169:3601-3607. 51. Long,R. T.,W. S.Zeng,L.Y. Chen,J. Guo,Y.Z. Lin,Q. S.Huang,and S. Q. Luo. 2010. Bifidobacterium as an oral delivery Gamier of oxyntomodulin for obesity therapy: inhibitory effects on food intake and body weight in overweight mice. Intemational Journal of Obesity 34:712-71 9. 52. Makrides, S. C. 1996. Strategies for achieving high-level expression of genes in Escherichia coli. Microbiological Reviews 60:5 12-538. 53. Matsumura, H., A. Takeuchi, and Y. Kano. 1997. Construction ofEscherichia coli Bifidobacterium longum shuttle vector transforming B-1ongum 105-A and 108-A. Bioscience Biotechnology and Biochemistry 61:121 1-1212. 54. Mills, G. C. 1957. Hemoglobin catabolism. I. Glutathione peroxidase, an erythrocyte enzyme which protects hemoglobin from oxidative breakdown. The Journal ofbiological chemistry 229: 189-1 97. 55. Moller, P. L., F. Jorgensen, 0. C. Hansen, S. M. Madsen, and P. Stougaard. 2001. Intra- and extracellular beta-galactosidases from Bifldobacterium bifidum and B-infantis: Molecular cloning, heterologous expression, and comparative 95 characterization. Applied and Environmental Microbiology 67:2276-2283. 56. Mozzetti, V., F. Grattepanche, D. Moine, B. Berger, E. Rezzonico, L. Meile, F. Arigoni, and C. Lacroix. 2010. New method for selection of hydrogen peroxide adapted bifidobacteria cells using continuous culture and immobilized cell techno16gy. Microb Cell Fact 9:60. 57. Mulvey, M. R., P. A. Sorby, B. L. Triggs-Raine, and P. C. Loewen. 1988. Cloning and physical characterization of katE and katF required for catalase HPII expression in Escherichia coli. Gene 73:337-345. 58. Nishizawa, A., M. Nakayama, T. Uemura, Y. Fukuda, and S. Kimura. 2010. Ribosome-binding site interference caused by Shine-Dalgarno-like nucleotide sequences in Escherichia coli cells. Journal of Biochemistry 147:433-443. 59. Park, M. S., B. Kwon, J. J. Skim, C. S. Huh, and G. E. Ji. 2008. Heterologous expression of cholesterol oxidase in Bifidobacterium longum under the control of 16S rRNA gene promoter of bifldobacteria. Biotechnol Lett 30:165-172. 60. Poupard, J. A., I. Husain, and A. F. Norris. 1973. Biology of the bifidobacteria. Bacteriol Rev 37: 1 36-1 65. 61. Reyes Escogido, M. L., A. De Leon Rodriguez, and A. P. Barba de la Rosa. 2007. A novel binary expression vector for production of human IL10 in Escherichia coli and Bifidobacterium longum. Biotechnol Lett 29: 1249-1253. 62. Ringquist, S., S. Shinedling, D. Barrick, L. Green, J. Binkley, G. D. Stormo, and L. Gold. 1992. Translation initiation in Escherichia coli: sequences within the ribosome-binding site. Mol Microbio1 6: 121 9-1229. 63. Rochat, T., A. Miyoshi, J. J. Gratadoux, P. I)uwat, S. Sourice, V. Azevedo, and P. Langella. 2005. High-level resistance to oxidative stress in Lactococcus lactis conferred by Bacillus subtilis catalase KatE. Microbiology 96 151:3011-3018. 64. Rossi, M., P. Brigidi,and D. Matteuzzi. 1998. Improved cloning vectors for Bifidobacterium spp. Lett Appl Microbiol 26: 101-1 04. 65. Ryan, S. M., G. F. Fitzgerald, and D. van Sinderen. 2005. Transcriptional regulation and characterization of a novel beta-hctofuranosidase-encoding gene from Bifidobacterium breve UCC2003. Applied and Environmental Microbiology 71:3475-3482. 66. Schell, M. A., M. Karmirantzou, B. Snel, D. Vilanova, B. Berger, G. Pessi, M. C. Zwahlen, F. Desiere, P. Bork, M. Delley, R. D. Pridmore, and F. Arigomi. 2002. The genome sequence of Bifldobacterium longum reflects its adaptation to the human gastrointestinal tract. Proceedings of the National Academy of Sciences of the United States of America 99: 14422-14427. 67. Shah, N. P., W. K. Ding, M. J. Fallourd, and G. Leyer. 2010. Improving the Stability of Probiotic Bacteria in Model Fruit Juices Using Vitamins and Antioxidants. Journal ofFood Science 75:M278-M282. 68. Shimamura, S., F. Abe, N. Ishibashi, H. Miyakawa, T. Yaeshima, T. Araya, and M. Tomita. 1992. Relationship between oxygen sensitivity and oxygen metabolism ofBifidobacterium species. J Dairy Sci 75:3296-3306. 69. Shine, J., and L. Dalgarno. 1975. Determinant of cistron specificity in bacterial ribosomes. Nature 254:34-38. 70. Shine, J., and L. Dalgarno. 1974. The 3'-terminal sequence of Escherichia coli 16S ribosomal RNA: complementarity to nonsense triplets.and ribosomebinding sites. Proceedings of the National Academy of Sciences of the United States of America 71..1342-1346. 71. Shkoporov, A. N., B. A. Efimov, E. V. hokhlova, L. I. Kafarskaia, and V. V. Smeianov. 2008. Production of human basic fibroblast growth factor 97 (FGF-2) in Bifldobacterium breve using a series of novel expression/secretion vectors. Biotechnol Lett 30:1983-1988. 72. Sics, H. 1993. Strategies ofantioxidant defense. EurJ Biochem 215:213-219. 73. Sinha, A. K. 1972. Colorimetric assay ofcatalase. Anal Biochem 47:389-394. 74. Storz, G., and J. A. Inlay. 1999. Oxidative stress. Curr Opin Microbio1 2:188-194. 75. Takeuchi, A., II. Matsumura, and Y. Kano. 2002. Cloning and expression ih Escherichia 6oliof a gene, hup, encoding the histone-like protein HU of Bifldobacterium longum. Bioscience Biotechnology and Biochemistry 66:598-603. 76. Talwalkar, A., and K. Kailasapathy. 2004. The role of oxygen in the viability of probiotic bacteria with reference to L. acidophilus and Bifidobacterium spp. Current issues in intestinal 5: 1 microbiology -8. 77. Tan'aka, K., K. Samura, and Y. Kano. 2005. Structural and functional analysis of pTB6 from Bifldobacterium longum. Bioscience Biotechnology and Biochemistry 69:422-425. 78. Trindade, M. I., V. R. Abratt, and S. J. Reid. 2003. Induction of sucrose -raffinose. utilization genes fi:om Bifidobacterium lactis by sucrose and Appl Environ Microbio1 69:24-32. 79. Turroni, F., F. Bottacimi, E. Foroni, I. Mulder, J.-H. Kin, A. Zomer, B. Sanchez, A. Bidossi, A. Ferrarini, V. Giubellimi, M. Delledonne, B. IIenrissat, P. Coutinho, M. Oggioni, G. F. Fitzgerald, D. Mills, A. Margolles, D. Kelly, D. van Sinderen, and M. Ventura. 2010. Genome analysis of Bifidobacterium bifldum PRL20 10 reveals metabolic pathways for host-derived glycan foraging. Proceedings of the National Academy of Sciences of the United States of America 107:19514-19519. 98 80. Turroni, F., E. Foroni, M. 0. Motherway, F. Bottacini, V. Giubellini, A. Zomer, A. Ferrarini, M. Delledonne, Z. Zhang, D. van Sinderen, and M. Ventura. 2010. Characterization of the Serpin-Encoding Gene of Bifidobacterium breve 210B. Applied and Environmental Microbiology 76:3206-3219. 81. Ventura, M., C. Canchaya, Z. Zhang, G. F. Fitzgerald, and D. van Sinderen. 2007. Molecular characterization of hsp20, encoding a small heat shock protein of Bifldobacterium breve UCC2003. Applied and Environmental Microbiology 73:4695-4703. 82. Ventura, M., G. F. Fitzgerald, and D. van Sinderen. 2005. Genetic and transcriptional organization of the clpC locus in Bifldobacterium b;eveUCC 2003. Appl Environ Microbio1 71:6282-6291. 83. Ventura, M., Z. Zhang, M. Cronin, C. Canchaya, J. G. Kenny, G. F. Fitzgerald, and I). van Sinderen. 2005. The ClgR protein regulates transcription of the clpP operon in Bifldobacterium breve UCC 2003. J Bacterio1 187:8411-8426. 84. Vries, W., and A. H. Stouthamer. 1969. Factors determining the degree of anaerobiosis ofBljidobacterium strains. Archives of Microbiology 65:275-287. 85. Watson, I)., R. D. Sleator, C. IIill,and C. G. M. Gahan. 2008. Enhancing bile tolerance improves survival and persistence of Bifidobacterium and Lactococcus in the murine gastrointestinal tract. Bmc Microbiology 8. 86. Wilson, B. S., C. R. Kautzer, and D. E. Antelman. 1994. Increased protein expression through improved ribosome-binding sites obtained by library mutagenesis. BioTechniques 17:944-953. 87. Xiao, J. Z., S. Rondo, N. Takahashi, K Miyaji, K. Oshida, A. Hiramatsu, K. Iwatsuki, S. Kokubo, and A. Hosono. 2003. Effects of milk products 99 fermented by Bifldobacterium longum on blood lipids in rats and healthy adult male volunteers. Joumal of Dairy Science 86:2452-2461. 88. Xu,Y. F.,L. P. Zhu, B. IIu, G. F. Fu, H. Y. Zhang,J. J.Wang, and G.X. Xu. 2007. A new expression plasmid in Bifldobacterium longum as a delivery for Cancer Gene Therapy 14: 15 1 55. system of endostatin cancer gene therapy. -1 89. Yasui, K, Y. Kano, K. Tanaka, K. Watanabe, M. Shimizu-Kadota, II. Yoshikawa, and T. Suzuki. 2009. Improvement Qf bacterial transformation efflCiency using plasmid artificial modification. Nucleic Acids Res 37:e3. 90. Yasui, K, M. Tabata, S. Yamada, T. Abe, T. Ikemura, R. Osawa, and T. Suzuki. 2009. Intra-species diversity between seven Bifldobacterium adolescentis strains identified by genome-wide tiling array analysis. Bioscience, biotechnology, and biochemistry 73: 1422- 1424. 100 Acknowledgments My deepest first foremost to Professor Tohru Suzuki gratitude goes and , my major professor, for his constant encouragement and guidance. He has walked me through all the stages of the writing of this thesis. Without his consistent and illuminating instruction, this thesis could not have reached its present form. I am also greatly indebted to Professor Kazhuhiro Takamizawa, Professor Naoto Ogawa, who have instructed and helped me a lot in the past two years. I also owe my sincere gratitude to my friends and my classmates who gave me their help and time in listening to me and helping me work out my problems during the difrlCult course of the thesis. Last my thanks would go to my beloved family for their loving considerations and great confidence in me all through these years. 12-12-2011 101