DOCSLIB.ORG

Mfge8 Is Critical for Mammary Gland Remodeling During Involution

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mfge8 Is Critical for Mammary Gland Remodeling During Involution Molecular Biology of the Cell Vol. 16, 5528–5537, December 2005 Mfge8 Is Critical for Mammary Gland Remodeling during Involution Kamran Atabai,*† Rafael Fernandez,*† Xiaozhu Huang,*† Iris Ueki,† Ahnika Kline,*† Yong Li,*† Sepid Sadatmansoori,*† Christine Smith-Steinhart,‡§ Weimin Zhu,ʈ Robert Pytela,ʈ Zena Werb,¶ and Dean Sheppard*† *Lung Biology Center, Cardiovascular Research Institute and Departments of †Medicine and ¶Anatomy, University of California–San Francisco, San Francisco, CA 94143; ‡Department of Immunology, §National Jewish Medical Center and §Department of Medicine, University of Colorado Health Science Center, Denver, CO 80206; and ʈEpitomics, Burlingame, CA 94010 Submitted February 15, 2005; Revised August 17, 2005; Accepted September 15, 2005 Monitoring Editor: M. Bishr Omary Apoptosis is a critical process in normal mammary gland development and the rapid clearance of apoptotic cells prevents tissue injury associated with the release of intracellular antigens from dying cells. Milk fat globule-EGF-factor 8 (Mfge8) is a milk glycoprotein that is abundantly expressed in the mammary gland epithelium and has been shown to facilitate the clearance of apoptotic lymphocytes by splenic macrophages. We report that mice with disruption of Mfge8 had normal mammary gland development until involution. However, abnormal mammary gland remodeling was observed postlac- tation in Mfge8 mutant mice. During early involution, Mfge8 mutant mice had increased numbers of apoptotic cells within the mammary gland associated with a delay in alveolar collapse and fat cell repopulation. As involution progressed, Mfge8 mutants developed inflammation as assessed by CD45 and CD11b staining of mammary gland tissue sections. With additional pregnancies, Mfge8 mutant mice developed progressive dilatation of the mammary gland ductal network. These data demonstrate that Mfge8 regulates the clearance of apoptotic epithelial cells during mammary gland involution and that the absence of Mfge8 leads to inflammation and abnormal mammary gland remodeling. INTRODUCTION ␣v␤5 integrins (Hanayama et al., 2002). The EGF-like do- mains are followed by two discoidinlike Factor 5/Factor 8 Milk fat is synthesized by differentiated mammary gland domains. The carboxyl-terminal discoidin domains bind epithelial cells and secreted into the ductal lumen enveloped phosphatidylserine residues expressed on the surface of ap- in a portion of the apical plasma membrane termed the milk optotic cells and are essential for Mfge8-mediated uptake of fat globule membrane (MFGM; Mather, 1987). The MFGM is these cells (Hanayama et al., 2002). Mfge8L contains an ad- made up of glycoproteins, proteins, cholesterol, and phos- ditional proline-threonine-rich domain inserted between the pholipids. In addition to providing nutrition, milk proteins EGF-like and discoidin domains. Mammary gland Mfge8L have antimicrobial and antiviral activity, promote the transcripts increase with pregnancy and lactation suggesting growth of beneficial bacteria, and aid in the development of the neonatal digestive tract (Mather, 1987; Lonnerdal, 2003). a specific role for this isoform in the pregnant and lactating Milk proteins may also play a role in mammary gland mammary gland (Oshima et al., 1999). development. Whey acidic protein and ␤-casein, two of the Initial interest in Mfge8 focused on lactadherin, the hu- most abundant milk proteins, serve as classical markers of man orthologue of Mfge8, and its potential role in mammary epithelial cell differentiation and a developmental role has gland carcinomas (Larocca et al., 1991; Carmon et al., 2002). been suggested for whey acidic protein (Shamay et al., 1992; More recently, Mfge8 has been shown to facilitate in vitro Hirai et al., 1998; Ikeda et al., 2002). phagocytosis of apoptotic T-cells by activated peritoneal Milk fat globule-EGF- factor 8 (Mfge8) is a glycoprotein macrophages and to enhance the in vivo clearance of apo- that makes up part of the MFGM (Stubbs et al., 1990). Mfge8 ptotic lymphocytes by splenic macrophages (Hanayama et found in mouse mammary gland milk consists of a long and al., 2002, 2004). short (Mfge8L and Mfge8S) isoform (Oshima et al., 1999). The importance of apoptosis throughout mammary gland Both isoforms have two N-terminal Notch-like EGF do- development (Strange et al., 2001) and the ability of Mfge8 to mains. The second EGF-like domain is highly conserved facilitate the clearance of apoptotic leukocytes suggests a across species and contains an arginine-glycine-aspartic acid potentially important function for Mfge8 in mammary gland (RGD) sequence that has been shown to bind the ␣v␤3 and development. Though apoptosis is critical in prepregnancy mammary gland development (Humphreys et al., 1996, 1999), the tissue remodeling that takes place during mam- This article was published online ahead of print in MBC in Press mary gland involution requires programmed cell death and (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E05–02–0128) removal of ϳ90% of the mammary gland epithelium (Wise- on September 29, 2005. man and Werb, 2002). Despite this massive cell turnover, Address correspondence to: Dean Sheppard (dean.sheppard@ mammary gland involution is nearly complete by 10 d, at ucsf.edu). which time there is scant evidence of apoptotic cells (Fadok, 5528 © 2005 by The American Society for Cell Biology Mfge8 and Mammary Gland Involution 1999). For involution to proceed in an orderly manner apo- mice. Splenocytes from immunized rabbits were fused with rabbit plasmacy- ptotic cells must be cleared quickly and completely and milk toma 240E cells and the resultant hybridomas were screened by immunohis- tochemistry with tissue sections from mouse mammary tumors. The 4F6 remaining in the ductal lumen must be reabsorbed (Wilde et antibody stained both normal and malignant mammary epithelium. Specific- al., 1999). As epithelial cells undergo apoptosis they are ity for Mfge8 was demonstrated because, as shown by immunocytochemistry, phagocytosed by adjacent epithelial cells or are shed into the the antibody strongly reacted with HEK-293 cells transfected with an Mfge8 ductal lumen where they are engulfed by phagocytic cells cDNA expression vector, but not with mock-transfected HEK-293 cells (un- published data). Antibody specificity was confirmed by Western blot analysis (Monks et al., 2005). Mfge8 on the milk membrane and on the of mammary tumor cell lysates, showing a pattern of bands consistent with apical surface of viable epithelial cells is in close proximity the previously described molecular forms of Mfge8. with apoptotic epithelial cells and is in the ideal location to facilitate rapid and orderly clearance of these cells. Whole Mount Preparation In this study we have generated mice homozygous for a The inguinal mammary gland was removed and fixed overnight in Carnoy’s gene trap mutation that disrupts Mfge8 and eliminates the solution (3:1 ratio of alcohol/glacial acetic acid), hydrated, and stained over- night with carmine alum (0.2% carmine dye and 0.5% aluminum potassium carboxy terminal discoidin domain (Silvestre et al., 2005). sulfate), dehydrated, defatted with xylene, mounted and photographed. For Here we report that despite normal mammary gland devel- evaluation of ductal diameter, whole mounts from mice greater than 10 d opment during puberty, Mfge8 mutant mice fail to rapidly postinvolution were photographed and the diameter of the largest primary clear apoptotic cells and develop progressive inflammation duct along its course adjacent to the central lymph node (5–15 measurements during involution coupled with destruction of mammary per duct) was measured using NIH image 1.63. gland architecture after successive pregnancies. These stud- Morphometry ies show that Mfge8 plays a central role in orchestrating For morphometric evaluation of epithelial and fat content of the mammary postlactational mammary gland remodeling. gland, 5-␮m sections were stained with hematoxylin and eosin (H & E), and images were obtained from 10 randomly selected fields (Leica, Deerfield, IL; DM 5000 B, 100ϫ) using SPOT software. A grid was superimposed on the MATERIALS AND METHODS digital images and the number of intersections that marked epithelium and adipocytes was counted and expressed as a percentage. The investigator was Generation of Mfge8 Mutant Mice blinded to the genotype of the sections. For evaluation of the phagocytic index ␮ Mfge8 mutant mice were generated by blastocyst injection of KST227 embry- of epithelial cells, 5- m sections from day 2 of involution were stained with onic stem cells that harbor an insertion of the pGT1-pfs gene trap-vector in H & E and the number of ingested particles within alveolar epithelial cells intron 7 of Mfge8 (Silvestre et al., 2005). The pGT1-pfs vector is designed to was counted from 10 randomly chosen high-powered fields using an oil ϫ trap secretory proteins at the cell surface through its transmembrane domain. objective (1000 ). Ingestions were counted as apoptotic particles if a whole Southern blot experiments using a digoxin-labeled (Roche, Indianapolis, IN) apoptotic cell or a round apoptotic body with a clear rim surrounding it genomic probe (forward 5Ј CTGTTCTGATGGTGGTGGTG and reverse 5Ј (spacious phagosome) was observed within the cytoplasm of an epithelial cell TAAGCACCCACGTGTTTGAG) spanning a 580-base pair segment flanking lining the alveolar lumen (Monks et al., 2005). The phagocytic index was exon 7 detected a 10.5-kb BamHI fragment for the wild-type allele and an calculated as the
Load more

Recommended publications
  • Differential Expression Profile Prioritization of Positional Candidate Glaucoma Genes the GLC1C Locus
    LABORATORY SCIENCES Differential Expression Profile Prioritization of Positional Candidate Glaucoma Genes The GLC1C Locus Frank W. Rozsa, PhD; Kathleen M. Scott, BS; Hemant Pawar, PhD; John R. Samples, MD; Mary K. Wirtz, PhD; Julia E. Richards, PhD Objectives: To develop and apply a model for priori- est because of moderate expression and changes in tization of candidate glaucoma genes. expression. Transcription factor ZBTB38 emerges as an interesting candidate gene because of the overall expres- Methods: This Affymetrix GeneChip (Affymetrix, Santa sion level, differential expression, and function. Clara, Calif) study of gene expression in primary cul- ture human trabecular meshwork cells uses a positional Conclusions: Only1geneintheGLC1C interval fits our differential expression profile model for prioritization of model for differential expression under multiple glau- candidate genes within the GLC1C genetic inclusion in- coma risk conditions. The use of multiple prioritization terval. models resulted in filtering 7 candidate genes of higher interest out of the 41 known genes in the region. Results: Sixteen genes were expressed under all condi- tions within the GLC1C interval. TMEM22 was the only Clinical Relevance: This study identified a small sub- gene within the interval with differential expression in set of genes that are most likely to harbor mutations that the same direction under both conditions tested. Two cause glaucoma linked to GLC1C. genes, ATP1B3 and COPB2, are of interest in the con- text of a protein-misfolding model for candidate selec- tion. SLC25A36, PCCB, and FNDC6 are of lesser inter- Arch Ophthalmol. 2007;125:117-127 IGH PREVALENCE AND PO- identification of additional GLC1C fami- tential for severe out- lies7,18-20 who provide optimal samples for come combine to make screening candidate genes for muta- adult-onset primary tions.7,18,20 The existence of 2 distinct open-angle glaucoma GLC1C haplotypes suggests that muta- (POAG) a significant public health prob- tions will not be limited to rare descen- H1 lem.
    [Show full text]
  • Peripheral Nerve Single-Cell Analysis Identifies Mesenchymal Ligands That Promote Axonal Growth
    Research Article: New Research Development Peripheral Nerve Single-Cell Analysis Identifies Mesenchymal Ligands that Promote Axonal Growth Jeremy S. Toma,1 Konstantina Karamboulas,1,ª Matthew J. Carr,1,2,ª Adelaida Kolaj,1,3 Scott A. Yuzwa,1 Neemat Mahmud,1,3 Mekayla A. Storer,1 David R. Kaplan,1,2,4 and Freda D. Miller1,2,3,4 https://doi.org/10.1523/ENEURO.0066-20.2020 1Program in Neurosciences and Mental Health, Hospital for Sick Children, 555 University Avenue, Toronto, Ontario M5G 1X8, Canada, 2Institute of Medical Sciences University of Toronto, Toronto, Ontario M5G 1A8, Canada, 3Department of Physiology, University of Toronto, Toronto, Ontario M5G 1A8, Canada, and 4Department of Molecular Genetics, University of Toronto, Toronto, Ontario M5G 1A8, Canada Abstract Peripheral nerves provide a supportive growth environment for developing and regenerating axons and are es- sential for maintenance and repair of many non-neural tissues. This capacity has largely been ascribed to paracrine factors secreted by nerve-resident Schwann cells. Here, we used single-cell transcriptional profiling to identify ligands made by different injured rodent nerve cell types and have combined this with cell-surface mass spectrometry to computationally model potential paracrine interactions with peripheral neurons. These analyses show that peripheral nerves make many ligands predicted to act on peripheral and CNS neurons, in- cluding known and previously uncharacterized ligands. While Schwann cells are an important ligand source within injured nerves, more than half of the predicted ligands are made by nerve-resident mesenchymal cells, including the endoneurial cells most closely associated with peripheral axons. At least three of these mesen- chymal ligands, ANGPT1, CCL11, and VEGFC, promote growth when locally applied on sympathetic axons.
    [Show full text]
  • Downloaded from the NIH Phase I/II Neoadjuvant Trials Using Combined Celecoxib GDC Data Portal (
    Tian et al. Breast Cancer Research (2021) 23:23 https://doi.org/10.1186/s13058-021-01401-2 RESEARCH ARTICLE Open Access Identification of MFGE8 and KLK5/7 as mediators of breast tumorigenesis and resistance to COX-2 inhibition Jun Tian, Vivian Wang, Ni Wang, Baharak Khadang, Julien Boudreault, Khldoun Bakdounes, Suhad Ali and Jean-Jacques Lebrun* Abstract Background: Cyclooxygenase 2 (COX-2) promotes stemness in triple negative breast cancer (TNBC), highlighting COX-2 as a promising therapeutic target in these tumors. However, to date, clinical trials using COX-2 inhibitors in breast cancer only showed variable patient responses with no clear significant clinical benefits, suggesting underlying molecular mechanisms contributing to resistance to COX-2 inhibitors. Methods: By combining in silico analysis of human breast cancer RNA-seq data with interrogation of public patient databases and their associated transcriptomic, genomic, and clinical profiles, we identified COX-2 associated genes whose expression correlate with aggressive TNBC features and resistance to COX-2 inhibitors. We then assessed their individual contributions to TNBC metastasis and resistance to COX-2 inhibitors, using CRISPR gene knockout approaches in both in vitro and in vivo preclinical models of TNBC. Results: We identified multiple COX-2 associated genes (TPM4, RGS2, LAMC2, SERPINB5, KLK7, MFGE8, KLK5, ID4, RBP1, SLC2A1) that regulate tumor lung colonization in TNBC. Furthermore, we found that silencing MFGE8 and KLK5/7 gene expression in TNBC cells markedly restored sensitivity to COX-2 selective inhibitor both in vitro and in vivo. Conclusions: Together, our study supports the establishment and use of novel COX-2 inhibitor-based combination therapies as future strategies for TNBC treatment.
    [Show full text]
  • Elicits Strong Trans-Activation of the MFG-E8/Lactadherin/ BA46 Gene Through Interactions Between the TA and DN Isoforms
    Oncogene (2008) 27, 308–317 & 2008 Nature Publishing Group All rights reserved 0950-9232/08 $30.00 www.nature.com/onc ORIGINAL ARTICLE p63(TP63) elicits strong trans-activation of the MFG-E8/lactadherin/ BA46 gene through interactions between the TA and DN isoforms T Okuyama1,2,3, S Kurata4,5, Y Tomimori1, N Fukunishi4, S Sato6, M Osada7, K Tsukinoki5, H-F Jin8, A Yamashita8, M Ito8, S Kobayashi2, R-I Hata5, Y Ikawa1,9 and I Katoh1,8 1Ikawa Laboratory, RIKEN, Wako, Japan; 2Department of Molecular Physiology, Kyoritsu University of Pharmacy, Tokyo, Japan; 3Department of Cell Regulation, Medical Research Institute, Tokyo Medical and Dental University, Tokyo, Japan; 4Department of Redox Response Cell Biology, Medical Research Institute, Tokyo Medical and Dental University, Tokyo, Japan; 5Oral Health Science Research Center, Kanagawa Dental College, Yokosuka, Japan; 6Department of Immune Regulation, Tokyo Medical and Dental University, Tokyo, Japan; 7Human Gene Sciences Center, Tokyo Medical and Dental University, Tokyo, Japan; 8Department of Microbiology, Interdisciplinary Graduate School of Medicine and Engineering, University of Yamanashi, Yamanashi, Japan and 9Department of Hematology, Tokyo Medical and Dental University, Tokyo, Japan We report here that human MFGE8 encoding milk fat Introduction globule-EGF factor 8 protein (MFG-E8), also termed 46 kDa breast epithelial antigen and lactadherin, is p63 (TP63), a member of the p53 (TP53) gene family transcriptionally activated by p63, or TP63, a p53 (TP53) (Osada et al., 1998; Yang et al., 1998), is essential for family protein frequently overexpressed in head-and-neck embryonic epithelial tissue development (Celli et al., squamous cell carcinomas, mammary carcinomas and so 1999; Mills et al., 1999; Yang et al., 1999; Pellegrini on.
    [Show full text]
  • Oviduct Extracellular Vesicles Protein Content and Their Role During Oviduct–Embryo Cross-Talk
    REPRODUCTIONRESEARCH Oviduct extracellular vesicles protein content and their role during oviduct–embryo cross-talk Carmen Almiñana1, Emilie Corbin1, Guillaume Tsikis1, Agostinho S Alcântara-Neto1, Valérie Labas1,2, Karine Reynaud1, Laurent Galio3, Rustem Uzbekov4,5, Anastasiia S Garanina4, Xavier Druart1 and Pascal Mermillod1 1UMR0085 Physiologie de la Reproduction et des Comportements (PRC), Institut National de la Recherche Agronomique (INRA)/CNRS/Univ. Tours, Nouzilly, France, 2UFR, CHU, Pôle d’Imagerie de la Plate-forme de Chirurgie et Imagerie pour la Recherche et l’Enseignement (CIRE), INRA Nouzilly, France, 3UMR1198, Biologie du Développement et Reproduction, INRA Jouy-en-Josas, France, 4Laboratoire Biologie Cellulaire et Microscopie Electronique, Faculté de Médecine, Université François Rabelais, Tours, France and 5Faculty of Bioengineering and Bioinformatics, Moscow State University, Moscow, Russia Correspondence should be addressed to C Almiñana; Email: [email protected] Abstract Successful pregnancy requires an appropriate communication between the mother and the embryo. Recently, exosomes and microvesicles, both membrane-bound extracellular vesicles (EVs) present in the oviduct fluid have been proposed as key modulators of this unique cross-talk. However, little is known about their content and their role during oviduct-embryo dialog. Given the known differences in secretions by in vivo and in vitro oviduct epithelial cells (OEC), we aimed at deciphering the oviduct EVs protein content from both sources. Moreover, we analyzed their functional effect on embryo development. Our study demonstrated for the first time the substantial differences between in vivo and in vitro oviduct EVs secretion/content. Mass spectrometry analysis identified 319 proteins in EVs, from which 186 were differentially expressed when in vivo and in vitro EVs were compared (P < 0.01).
    [Show full text]
  • Transcriptomes in Lymph Node and Follicular Dendritic Cell
    Lymphotoxin-β Receptor-Dependent Genes in Lymph Node and Follicular Dendritic Cell Transcriptomes This information is current as Christoph Huber, Caroline Thielen, Harald Seeger, Petra of September 28, 2021. Schwarz, Fabio Montrasio, Mark R. Wilson, Ernst Heinen, Yang-Xin Fu, Gino Miele and Adriano Aguzzi J Immunol 2005; 174:5526-5536; ; doi: 10.4049/jimmunol.174.9.5526 http://www.jimmunol.org/content/174/9/5526 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2005/04/18/174.9.5526.DC1 Material http://www.jimmunol.org/ References This article cites 52 articles, 25 of which you can access for free at: http://www.jimmunol.org/content/174/9/5526.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 28, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2005 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Lymphotoxin-␤ Receptor-Dependent Genes in Lymph Node and Follicular Dendritic Cell Transcriptomes1 Christoph Huber,* Caroline Thielen,† Harald Seeger,* Petra Schwarz,* Fabio Montrasio,* Mark R.
    [Show full text]
  • Single-Cell Transcriptional Dynamics and Origins of Neuronal Diversity in the Developing Mouse Neocortex
    bioRxiv preprint doi: https://doi.org/10.1101/409458; this version posted September 6, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Single-cell transcriptional dynamics and origins of neuronal diversity in the developing mouse neocortex L. Telley1,3*†, G. Agirman1,4†, J. Prados1, S. Fièvre1, P. Oberst1, I. Vitali1, L. Nguyen4, A. Dayer1,5, D. Jabaudon1,2* 1 Department of Basic Neurosciences, University of Geneva, Geneva, Switzerland. 2 Clinic of Neurology, Geneva University Hospital, Geneva, Switzerland. 3 Current address: Department of Basic Neuroscience, University of Lausanne, Switzerland. 4 GIGA-Neurosciences, University of Liège, C.H.U. Sart Tilman, Liège, Belgium. 5 Department of Psychiatry, Geneva University Hospital, Geneva, Switzerland. † equally contributed to this work. * Correspondence to: [email protected]; [email protected] During cortical development, distinct subtypes of glutamatergic neurons are sequentially born and differentiate from dynamic populations of progenitors. The neurogenic competence of these progenitors progresses as corticogenesis proceeds; likewise, newborn neurons transit through sequential states as they differentiate. Here, we trace the developmental transcriptional trajectories of successive generations of apical progenitors (APs) and isochronic cohorts of their daughter neurons using parallel single-cell RNA sequencing between embryonic day (E) 12 and E15 in the mouse
    [Show full text]
  • Data-Driven and Knowledge-Driven Computational Models of Angiogenesis in Application to Peripheral Arterial Disease
    DATA-DRIVEN AND KNOWLEDGE-DRIVEN COMPUTATIONAL MODELS OF ANGIOGENESIS IN APPLICATION TO PERIPHERAL ARTERIAL DISEASE by Liang-Hui Chu A dissertation submitted to Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland March, 2015 © 2015 Liang-Hui Chu All Rights Reserved Abstract Angiogenesis, the formation of new blood vessels from pre-existing vessels, is involved in both physiological conditions (e.g. development, wound healing and exercise) and diseases (e.g. cancer, age-related macular degeneration, and ischemic diseases such as coronary artery disease and peripheral arterial disease). Peripheral arterial disease (PAD) affects approximately 8 to 12 million people in United States, especially those over the age of 50 and its prevalence is now comparable to that of coronary artery disease. To date, all clinical trials that includes stimulation of VEGF (vascular endothelial growth factor) and FGF (fibroblast growth factor) have failed. There is an unmet need to find novel genes and drug targets and predict potential therapeutics in PAD. We use the data-driven bioinformatic approach to identify angiogenesis-associated genes and predict new targets and repositioned drugs in PAD. We also formulate a mechanistic three- compartment model that includes the anti-angiogenic isoform VEGF165b. The thesis can serve as a framework for computational and experimental validations of novel drug targets and drugs in PAD. ii Acknowledgements I appreciate my advisor Dr. Aleksander S. Popel to guide my PhD studies for the five years at Johns Hopkins University. I also appreciate several professors on my thesis committee, Dr. Joel S. Bader, Dr.
    [Show full text]
  • Pathway-Focused Gene Interaction Analysis Reveals the Regulation Of
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 10 July 2019 doi:10.20944/preprints201907.0140.v1 1 Article 2 Pathway-Focused Gene Interaction Analysis Reveals 3 the Regulation of TGFβ, Pentose Phosphate and 4 Antioxidant Defense System by Placental Growth 5 Factor in Retinal Endothelial Cell Functions: 6 Implication in Diabetic Retinopathy 7 Hu Huang 1,*, Madhu Sudhana Saddala 1, Anton Lennikov 1, Anthony Mukwaya 2 and Lijuan 8 Fan1 9 1 Mason Eye Institute, University of Missouri, Columbia, Missouri, United States of America 10 2 Department of Ophthalmology, Institute for Clinical and Experimental Medicine, Faculty of Health 11 Sciences, Linköping University, Linköping, Sweden 12 * Correspondence: [email protected]; Tel.: +1-573-882-9899 (H.H.) 13 Abstract: 14 Placental growth factor (PlGF or PGF) is a member of the VEGF family, which is known to play a 15 critical role in pathological angiogenesis, inflammation, and endothelial cell barrier function. 16 However, the molecular mechanisms by which PlGF mediates its effects in non-proliferative 17 diabetic retinopathy (DR) remain elusive. In this study, we performed transcriptome-wide profiling 18 of differential gene expression for human retinal endothelial cells (HRECs) treated with PlGF 19 antibody. The effect of antibody treatment on the samples was validated using trans-endothelial 20 electric resistance (TEER), and western blot. A total of 3760 genes (1750 upregulated and 2010 21 downregulated) were found to be differentially expressed between the control and PlGF antibody 22 treatment group. These differentially expressed genes (DEGs) were used for gene ontology and 23 enrichment analysis to identify gene function, signal pathway, and interaction networks.
    [Show full text]
  • MFGE8, ALB, APOB, APOE, SAA1, A2M, and C3 As Novel Biomarkers for Stress Cardiomyopathy
    Hindawi Cardiovascular erapeutics Volume 2020, Article ID 1615826, 11 pages https://doi.org/10.1155/2020/1615826 Research Article MFGE8, ALB, APOB, APOE, SAA1, A2M, and C3 as Novel Biomarkers for Stress Cardiomyopathy Xiao-Yu Pan 1,2 and Zai-Wei Zhang 2,3 1Department of Clinical Medical College, Jining Medical University, Jining, Shandong 272067, China 2Department of Cardiology, Jining No. 1 People’s Hospital, Jining, Shandong 272011, China 3Cardiovascular Research Institute, Jining No.1 People’s Hospital, Jining, Shandong 272011, China Correspondence should be addressed to Zai-Wei Zhang; [email protected] Received 14 March 2020; Accepted 2 June 2020; Published 1 July 2020 Guest Editor: Annalisa Romani Copyright © 2020 Xiao-Yu Pan and Zai-Wei Zhang. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Background. Stress cardiomyopathy (SCM) is a transient reversible left ventricular dysfunction that more often occurs in women. Symptoms of SCM patients are similar to those of acute coronary syndrome (ACS), but little is known about biomarkers. The goals of this study were to identify the potentially crucial genes and pathways associated with SCM. Methods. We analyzed microarray datasets GSE95368 derived from the Gene Expression Omnibus (GEO) database. Firstly, identify the differentially expressed genes (DEGs) between SCM patients in normal patients. Then, the DEGs were used for Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis. Finally, the protein-protein interaction (PPI) network was constructed and Cytoscape was used to find the key genes.
    [Show full text]
  • Anti-MFGE8 (Full Length) Polyclonal Antibody (DPABH-07389) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use
    Anti-MFGE8 (full length) polyclonal antibody (DPABH-07389) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Antigen Description Plays an important role in the maintenance of intestinal epithelial homeostasis and the promotion of mucosal healing. Promotes VEGF-dependent neovascularization (By similarity). Contributes to phagocytic removal of apoptotic cells in many tissues. Specific ligand for the alpha-v/beta-3 and alpha-v/beta-5 receptors. Also binds to phosphatidylserine-enriched cell surfaces in a receptor- independent manner. Zona pellucida-binding protein which may play a role in gamete interaction. Binds specifically to rotavirus and inhibits its replication.Medin is the main constituent of aortic medial amyloid. Immunogen Recombinant full length protein corresponding to amino acids 1-387 of Human Human Milk Fat Globule 1 (NP_005919.1) Isotype IgG Source/Host Rabbit Species Reactivity Human Purification Protein A purified Conjugate Unconjugated Applications WB Format Liquid Size 100 μg Buffer pH: 7.20; Constituent: 100% PBS Preservative None Storage Store at 4°C short term (1-2 weeks). Aliquot and store at -20°C long term. Avoid repeated freeze / thaw cycles. GENE INFORMATION 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved Gene Name MFGE8 milk fat globule-EGF factor 9 protein [ Homo sapiens ] Official Symbol MFGE8 Synonyms MFGE8; milk fat globule-EGF factor 8 protein;
    [Show full text]
  • Systems Biology Comprehensive Analysis on Breast Cancer For
    www.nature.com/scientificreports OPEN Systems biology comprehensive analysis on breast cancer for identifcation of key gene modules and genes associated with TNM‑based clinical stages Elham Amjad1,3, Solmaz Asnaashari1,3, Babak Sokouti1* & Siavoush Dastmalchi1,2* Breast cancer (BC), as one of the leading causes of death among women, comprises several subtypes with controversial and poor prognosis. Considering the TNM (tumor, lymph node, metastasis) based classifcation for staging of breast cancer, it is essential to diagnose the disease at early stages. The present study aims to take advantage of the systems biology approach on genome wide gene expression profling datasets to identify the potential biomarkers involved at stage I, stage II, stage III, and stage IV as well as in the integrated group. Three HER2-negative breast cancer microarray datasets were retrieved from the GEO database, including normal, stage I, stage II, stage III, and stage IV samples. Additionally, one dataset was also extracted to test the developed predictive models trained on the three datasets. The analysis of gene expression profles to identify diferentially expressed genes (DEGs) was performed after preprocessing and normalization of data. Then, statistically signifcant prioritized DEGs were used to construct protein–protein interaction networks for the stages for module analysis and biomarker identifcation. Furthermore, the prioritized DEGs were used to determine the involved GO enrichment and KEGG signaling pathways at various stages of the breast cancer. The recurrence survival rate analysis of the identifed gene biomarkers was conducted based on Kaplan–Meier methodology. Furthermore, the identifed genes were validated not only by using several classifcation models but also through screening the experimental literature reports on the target genes.
    [Show full text]