Mfge8 Is Critical for Mammary Gland Remodeling During Involution
Total Page:16
File Type:pdf, Size:1020Kb
Molecular Biology of the Cell Vol. 16, 5528–5537, December 2005 Mfge8 Is Critical for Mammary Gland Remodeling during Involution Kamran Atabai,*† Rafael Fernandez,*† Xiaozhu Huang,*† Iris Ueki,† Ahnika Kline,*† Yong Li,*† Sepid Sadatmansoori,*† Christine Smith-Steinhart,‡§ Weimin Zhu,ʈ Robert Pytela,ʈ Zena Werb,¶ and Dean Sheppard*† *Lung Biology Center, Cardiovascular Research Institute and Departments of †Medicine and ¶Anatomy, University of California–San Francisco, San Francisco, CA 94143; ‡Department of Immunology, §National Jewish Medical Center and §Department of Medicine, University of Colorado Health Science Center, Denver, CO 80206; and ʈEpitomics, Burlingame, CA 94010 Submitted February 15, 2005; Revised August 17, 2005; Accepted September 15, 2005 Monitoring Editor: M. Bishr Omary Apoptosis is a critical process in normal mammary gland development and the rapid clearance of apoptotic cells prevents tissue injury associated with the release of intracellular antigens from dying cells. Milk fat globule-EGF-factor 8 (Mfge8) is a milk glycoprotein that is abundantly expressed in the mammary gland epithelium and has been shown to facilitate the clearance of apoptotic lymphocytes by splenic macrophages. We report that mice with disruption of Mfge8 had normal mammary gland development until involution. However, abnormal mammary gland remodeling was observed postlac- tation in Mfge8 mutant mice. During early involution, Mfge8 mutant mice had increased numbers of apoptotic cells within the mammary gland associated with a delay in alveolar collapse and fat cell repopulation. As involution progressed, Mfge8 mutants developed inflammation as assessed by CD45 and CD11b staining of mammary gland tissue sections. With additional pregnancies, Mfge8 mutant mice developed progressive dilatation of the mammary gland ductal network. These data demonstrate that Mfge8 regulates the clearance of apoptotic epithelial cells during mammary gland involution and that the absence of Mfge8 leads to inflammation and abnormal mammary gland remodeling. INTRODUCTION ␣v5 integrins (Hanayama et al., 2002). The EGF-like do- mains are followed by two discoidinlike Factor 5/Factor 8 Milk fat is synthesized by differentiated mammary gland domains. The carboxyl-terminal discoidin domains bind epithelial cells and secreted into the ductal lumen enveloped phosphatidylserine residues expressed on the surface of ap- in a portion of the apical plasma membrane termed the milk optotic cells and are essential for Mfge8-mediated uptake of fat globule membrane (MFGM; Mather, 1987). The MFGM is these cells (Hanayama et al., 2002). Mfge8L contains an ad- made up of glycoproteins, proteins, cholesterol, and phos- ditional proline-threonine-rich domain inserted between the pholipids. In addition to providing nutrition, milk proteins EGF-like and discoidin domains. Mammary gland Mfge8L have antimicrobial and antiviral activity, promote the transcripts increase with pregnancy and lactation suggesting growth of beneficial bacteria, and aid in the development of the neonatal digestive tract (Mather, 1987; Lonnerdal, 2003). a specific role for this isoform in the pregnant and lactating Milk proteins may also play a role in mammary gland mammary gland (Oshima et al., 1999). development. Whey acidic protein and -casein, two of the Initial interest in Mfge8 focused on lactadherin, the hu- most abundant milk proteins, serve as classical markers of man orthologue of Mfge8, and its potential role in mammary epithelial cell differentiation and a developmental role has gland carcinomas (Larocca et al., 1991; Carmon et al., 2002). been suggested for whey acidic protein (Shamay et al., 1992; More recently, Mfge8 has been shown to facilitate in vitro Hirai et al., 1998; Ikeda et al., 2002). phagocytosis of apoptotic T-cells by activated peritoneal Milk fat globule-EGF- factor 8 (Mfge8) is a glycoprotein macrophages and to enhance the in vivo clearance of apo- that makes up part of the MFGM (Stubbs et al., 1990). Mfge8 ptotic lymphocytes by splenic macrophages (Hanayama et found in mouse mammary gland milk consists of a long and al., 2002, 2004). short (Mfge8L and Mfge8S) isoform (Oshima et al., 1999). The importance of apoptosis throughout mammary gland Both isoforms have two N-terminal Notch-like EGF do- development (Strange et al., 2001) and the ability of Mfge8 to mains. The second EGF-like domain is highly conserved facilitate the clearance of apoptotic leukocytes suggests a across species and contains an arginine-glycine-aspartic acid potentially important function for Mfge8 in mammary gland (RGD) sequence that has been shown to bind the ␣v3 and development. Though apoptosis is critical in prepregnancy mammary gland development (Humphreys et al., 1996, 1999), the tissue remodeling that takes place during mam- This article was published online ahead of print in MBC in Press mary gland involution requires programmed cell death and (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E05–02–0128) removal of ϳ90% of the mammary gland epithelium (Wise- on September 29, 2005. man and Werb, 2002). Despite this massive cell turnover, Address correspondence to: Dean Sheppard (dean.sheppard@ mammary gland involution is nearly complete by 10 d, at ucsf.edu). which time there is scant evidence of apoptotic cells (Fadok, 5528 © 2005 by The American Society for Cell Biology Mfge8 and Mammary Gland Involution 1999). For involution to proceed in an orderly manner apo- mice. Splenocytes from immunized rabbits were fused with rabbit plasmacy- ptotic cells must be cleared quickly and completely and milk toma 240E cells and the resultant hybridomas were screened by immunohis- tochemistry with tissue sections from mouse mammary tumors. The 4F6 remaining in the ductal lumen must be reabsorbed (Wilde et antibody stained both normal and malignant mammary epithelium. Specific- al., 1999). As epithelial cells undergo apoptosis they are ity for Mfge8 was demonstrated because, as shown by immunocytochemistry, phagocytosed by adjacent epithelial cells or are shed into the the antibody strongly reacted with HEK-293 cells transfected with an Mfge8 ductal lumen where they are engulfed by phagocytic cells cDNA expression vector, but not with mock-transfected HEK-293 cells (un- published data). Antibody specificity was confirmed by Western blot analysis (Monks et al., 2005). Mfge8 on the milk membrane and on the of mammary tumor cell lysates, showing a pattern of bands consistent with apical surface of viable epithelial cells is in close proximity the previously described molecular forms of Mfge8. with apoptotic epithelial cells and is in the ideal location to facilitate rapid and orderly clearance of these cells. Whole Mount Preparation In this study we have generated mice homozygous for a The inguinal mammary gland was removed and fixed overnight in Carnoy’s gene trap mutation that disrupts Mfge8 and eliminates the solution (3:1 ratio of alcohol/glacial acetic acid), hydrated, and stained over- night with carmine alum (0.2% carmine dye and 0.5% aluminum potassium carboxy terminal discoidin domain (Silvestre et al., 2005). sulfate), dehydrated, defatted with xylene, mounted and photographed. For Here we report that despite normal mammary gland devel- evaluation of ductal diameter, whole mounts from mice greater than 10 d opment during puberty, Mfge8 mutant mice fail to rapidly postinvolution were photographed and the diameter of the largest primary clear apoptotic cells and develop progressive inflammation duct along its course adjacent to the central lymph node (5–15 measurements during involution coupled with destruction of mammary per duct) was measured using NIH image 1.63. gland architecture after successive pregnancies. These stud- Morphometry ies show that Mfge8 plays a central role in orchestrating For morphometric evaluation of epithelial and fat content of the mammary postlactational mammary gland remodeling. gland, 5-m sections were stained with hematoxylin and eosin (H & E), and images were obtained from 10 randomly selected fields (Leica, Deerfield, IL; DM 5000 B, 100ϫ) using SPOT software. A grid was superimposed on the MATERIALS AND METHODS digital images and the number of intersections that marked epithelium and adipocytes was counted and expressed as a percentage. The investigator was Generation of Mfge8 Mutant Mice blinded to the genotype of the sections. For evaluation of the phagocytic index Mfge8 mutant mice were generated by blastocyst injection of KST227 embry- of epithelial cells, 5- m sections from day 2 of involution were stained with onic stem cells that harbor an insertion of the pGT1-pfs gene trap-vector in H & E and the number of ingested particles within alveolar epithelial cells intron 7 of Mfge8 (Silvestre et al., 2005). The pGT1-pfs vector is designed to was counted from 10 randomly chosen high-powered fields using an oil ϫ trap secretory proteins at the cell surface through its transmembrane domain. objective (1000 ). Ingestions were counted as apoptotic particles if a whole Southern blot experiments using a digoxin-labeled (Roche, Indianapolis, IN) apoptotic cell or a round apoptotic body with a clear rim surrounding it genomic probe (forward 5Ј CTGTTCTGATGGTGGTGGTG and reverse 5Ј (spacious phagosome) was observed within the cytoplasm of an epithelial cell TAAGCACCCACGTGTTTGAG) spanning a 580-base pair segment flanking lining the alveolar lumen (Monks et al., 2005). The phagocytic index was exon 7 detected a 10.5-kb BamHI fragment for the wild-type allele and an calculated as the