Platanthera Chapmanii: Culture, Population Augmentation, and Mycorrhizal Associations

Platanthera chapmanii: culture, population augmentation, and mycorrhizal associations

Kirsten Poff, B.S.

A Thesis In

Plant and Soil Science

Submitted to the Graduate Faculty of Texas Tech University in Partial Fulfillment of the Requirements for the Degree of

MASTER OF SCIENCE

Approved

Dr. Jyotsna Sharma Chair of Committee

Dr. Scott Longing

Dr. John Zak

Dr. Mark Sheridan Dean of the Graduate School

August, 2016

Texas Tech University, Kirsten Poff, August 2016

ACKNOWLEDGEMENTS

First I would like to thank my mentor and advisor, Dr. Jyotsna Sharma for all of her help and support. She has challenged and encouraged me throughout my program and the duration of this project. Thanks to her, I am light-years ahead of where I was two years ago. Texas Parks and Wildlife is also gratefully acknowledged for funding portions of this study.

I also wish to express my gratitude to Dr. John Zak for his enthusiasm and for encouraging my love of microbes. I also gratefully thank Dr. Scott Longing for his advice, and constructive comments. I sincerely thank all three committee members for all the time and energy they have spent on me throughout the duration of my project. I gratefully acknowledge Dr. Jason Woodward for his encouragement and recommendations as well. I also acknowledge Dr. Cynthia McKenney and Mr. Russel

Plowman for their support; I now have a passion for teaching, and a much better understanding of what it is like to teach college level courses. I want to also thank Mr.

Robby Carlson for his time and technological assistance.

I wish to extend a heartfelt thank you to my lab mates for their time and help. I extend my gratitude to Niraj Rayamajhi and Bianca Walker for teaching me a multitude of lab techniques. I want to also thank Jaspreet Kaur and Dr. Eeva Terhonen, specifically for all there help with data analyses. I thank Pablo Tovar for teaching me how to troubleshoot, none of my sequences would exist without him. I thank all of them for their friendship. I gratefully acknowledge the efforts of my professors at Texas Tech

Texas Tech University, Kirsten Poff, August 2016

University, I also thank the Plant and Soil Science Department administrative staff and chair Dr. Eric Hequet, all your advice and wisdom was well received.

To my parents, Leslie and Kevin Poff, and my siblings Kevin Scott Poff, Crista

Poff and Caroline Poff, thank you for all of your support and love. Last, I want to thank

Daniel Smith for his inspiration, love and encouragement, and for coming with me on this journey. This would not have been possible without all of these people, I am very lucky and thankful to have them.

iii

Texas Tech University, Kirsten Poff, August 2016

TABLE OF CONTENTS

ACKNOWLEDGEMENTS ...... ii

LIST OF TABLES ...... vii

LIST OF FIGURES ...... ix

I. INTRODUCTION AND BACKGROUND ...... 1

Introduction ...... 1

Orchid classification ...... 1

Orchid biology ...... 2

Orchid Conservation ...... 6

Genus Platanthera ...... 8

Platanthera chapmanii ...... 9

Background ...... 10

In vitro seed germination ...... 10

Greenhouse culture of plants ...... 14

Population augmentation ...... 16

Mycorrhizal associations ...... 19

Techniques for mycorrhizal identity ...... 22

Summary of Research Gaps ...... 24

Objectives of the study...... 26

Significance of the study ...... 26

Literature Cited ...... 27

II. COLD-MOIST STRATIFICATION IMPROVES GERMINATION IN A TEMPERATE TERRESTRIAL NORTH AMERICAN ORCHID ...... 38

Abstract ...... 38 iv

Texas Tech University, Kirsten Poff, August 2016

Introduction ...... 39

Materials and methods ...... 43

Seed stratification ...... 43

Seed plating and germination assessment ...... 44

Data analysis ...... 45

Results ...... 46

Seed germination ...... 46

Seedling development...... 47

Discussion ...... 48

Literature Cited ...... 52

III. PLATANTHERA CHAPMANII: NUTRIENT SUPPLEMENTATION AND POPULATION AUGMENTATION ...... 63

Abstract ...... 63

Introduction ...... 64

Materials and Methods ...... 69

Nutrient supplementation ...... 69

Population augmentation ...... 70

Results ...... 72

Nutrient supplementation ...... 72

Population augmentation ...... 73

Discussion ...... 73

Literature Cited ...... 77

IV. DIVERSITY OF MYCORRHIZAE FORMING TULASNELLACEAE IN A TEMPERATE TERRESTRIAL ORCHID IN EX SITU AND IN SITU ENVIRONMENTS ...... 83 v

Texas Tech University, Kirsten Poff, August 2016

Abstract ...... 83

Introduction ...... 85

Materials and methods ...... 90

Literature cited ...... 105

V. CONCLUSIONS ...... 127

Literature Cited ...... 130

Texas Tech University, Kirsten Poff, August 2016

LIST OF TABLES

2.1 Effect of cold-moist stratification (0, 8, or 12 weeks) on seed germination was experimentally tested in Platanthera chapmanii. An Analysis of Variance . (ANOVA) was conducted (a); Germination of seeds was categorized as Stage 0 (no further development), Stage 1 (germination; rhizoid development), or Stage 2 (leaf primordium development). Mean number of seeds that were plated in an experimental unit, mean number of viable seeds, and mean percent viability are presented. Mean germination percentages were calculated by using total number of seeds and number of viable seeds separately. Means followed by the same letter in each column were statistically similar based on Fisher’s Least Significant Difference (LSD) test…...... 55

2.2 Effect of cold-moist stratification (0, 8, and 12 weeks) on seedling development after germination and rhizoid development (Stage 1) was . experimentally tested in Platanthera chapmanii. An Analysis of Variance (ANOVA) was conducted (a); Seed development was categorized as Stage 2 (leaf primordium development) or Stage 3 (root development). Mean number of seedlings that were categorized as Stage 2 or Stage 3 after a 5 month exposure to 40-watt florescent bulbs set at a photoperiod of 12 hours.……...... 57

3.1 Effect of nutrient supplementation (0.0x, 0.25x, 0.5x) on Platanthera chapmanii above ground plant height after 14 weeks of treatment applied . every two weeks. Results of An Analysis of Variance (ANOVA) was conducted…………...... ……79

4.1 Representative sequence of each of the 18 fungal nrITS-based operational taxonomic units (OTUs) identified within the roots of Platanthera chapmanii plants cultured in vitro/greenhouse and those occurring naturally. Each culture condition was sampled three to four times between 2012 and 2015. The first letter of an OTU name represents the fungal family to which the OTU belongs: T, Tulasnellaceae; C, Ceratobasidiaceae. Values in parentheses are the total number of plants in which a specific OTU was documented. …..…....109

4.2 Number of root sections (i.e. sequences) representing each of the 18 fungal nrITS based operational taxonomic units (OTUs) identified within the roots . of Platanthera chapmanii plants cultured in vitro/greenhouse and those occurring naturally. Each culture condition was sampled three to four times between 2012 and 2015. The first letter of an OTU name represents the fungal family to which the OTU belongs: T, Tulasnellaceae; C, Ceratobasidiaceae. Values in parentheses are the total number of plants in which a specific OTU was documented……………………………....………..115

vii

Texas Tech University, Kirsten Poff, August 2016

4.3. Mean pairwise fungal internal transcribed spacer (nrITS) sequence distances (π ± SE; Nei and Kumar 2000), estimated based on Kimura’s 2-parameter model, within the fungal family Tulasnellaceae identified in the roots of Platanthera chapmanii plants that were either cultured in lab / greenhouse conditions (GF12, GF14, GSu15) or were obtained from a naturally occurring population (NF12, NF14, NSp15, NSu15).…………………………117

4.4. Mean pairwise distances among fungal nrITS sequences based on Kimura’s 2-parameter model were calculated for fungal communities identified within the roots of Platanthera chapmanii. Roots of plants raised in vitro and cultured in greenhouse, and from plants occurring naturally were sampled. All other mean pairwise distances, except for Platanthera praeclara (Tovar 2015) and Nervilia nipponica (Nomura et al. 2013) were calculated by Pandey et al. (2013).…...... …………………………………..….121

viii

Texas Tech University, Kirsten Poff, August 2016

LIST OF FIGURES

1.1. A photograph of Mesic to wet pine habitat of Platanthera chapmanii at Watson Native Plant Preserve, Tyler County, Texas (2014)…… ……….………..……..…36

1.2. A photograph of Platanthera chapmanii during anthesis at Watson Native Plant Preserve, Tyler County, Texas. Photograph by Jyotsna Sharma (2013)……..36

1.3. A map of the southeast United States showing the geographic range of Platanthera chapmanii. Areas within Texas, Florida, and Georgia where the species occurs naturally are shaded in blue blue……………………...……………37

1.4. A photograph of a cross section of Platanthera chapmanii root tissue showing coils of hyphae, pelotons, within the root cells documented in November 2014. Scale bar represents 100 µm………………………………………..………………37

2.1. Seed germination and plant development in Platanthera chapmanii was recorded by using four categories: Stage 0 (no germination), Stage 1 (germination; rhizoid development), Stage 2 (leaf primordium development), and Stage 3 (root development) ...……………………………. …………..……….58

2.2. Proportion of Stage 2 seedlings of Platanthera chapmanii that reached the developmental Stage 3 after exposure to light. Duration of exposure to light (1 to 5 months under 40-watt white florescent bulbs) influenced plant development to Stage 3. Pre-germination stratification of seeds for 0, 8, or 12 weeks did not influence development from Stage 2 to Stage 3, thus the means were pooled across the three stratification treatments. Means followed by the same letter were statistically similar based on Fisher’s Least Significant Difference (LSD) test…………………….…………..…………………………..…58

3.1 Three photographs of Platanthera chapmanii individuals after planting in 15 cm containers during nutrient supplementation. From left to right; one individual, one replicate, row of trays…………………………..……….…………80

3.2 A photograph of a typical Platanthera chapmanii individual after being planted into greenhouse medium….…………..………………………..…………..80

3.3 Two photographs of Platanthera chapmanii individuals. A greenhouse cultured Platanthera chapmanii individual (a) shown beside a naturally occurring Platanthera chapmanii individual (b) before planting in native habitat in southeast Texas during fall 2014……………..……...... ……...81

Texas Tech University, Kirsten Poff, August 2016

3.4 A photograph of a fall 2014 Platanthera chapmanii plot with both greenhouse cultured and native plants relocated in southeast Texas. An arrow is pointing to one individual………………………..………………...………………………..81

3.5 A photograph of a typical Platanthera chapmanii individual taken directly out of a culture vessel prior to planting in one of the three locations in southeast Texas in the spring 2015……...……..……………………...……..……..82

3.6 A photograph of one of the three plots of Platanthera chapmanii individuals taken directly out of sterile culture and planted in the spring 2015. All individuals were covered with sphagnum peat moss..……..…………………….....82

4.1 A photograph of root samples collected from in vitro propagated and greenhouse cultured Platanthera chapmanii individuals before processing for molecular analysis. ……………………………………………………………119

4.2 A photograph of a cross section of a root of Platanthera chapmanii showing mycorrhizal hyphal coils, i.e. pelotons, within the cortical cells………...………..120

4.3 Photographic documentation of moniliod cells and fungal hyphae isolated on potato dextrose agar (PDA). The mycorrhizal fungus was cultured from roots of Platanthera chapmanii…………………………..……………………….120 chapmanii……………………………………………………………………...145 4.4 Sample-based incidence data, individual-based abundance data and observed methods were used to construct cumulative, rarefied fungal operational taxonomic unit (OTU) diversity curves for Platanthera chapmanii extrapolated to 500 sequences. Operational taxonomic units were built using 122 mycorrhizal fungal sequences and 18 OTUs derived from the roots of plants that were either cultured in ex situ conditions or were obtained from a naturally occurring population between 2012 and 2015.…………………....…….121

4.5 A principal component analysis (PCA) scatterplot. Each of the circles represent one of seven treatments (NF12, NF14, NSp15, NSu15, GF12, GF14, GSu15) used to obtain mycorrhizal OTUs from the roots of Platanthera chapmanii plants that were either cultured in lab/greenhouse conditions (GF12, GF14, GSu15) or were obtained from a naturally occurring population (NF12, NF14, Nsp15, NSu15) between 2012 and 2015. The PCA shows PC1 and PC2 accounting for 60% of variation in the data...... ……………………..………..….122

Texas Tech University, Kirsten Poff, August 2016

4.6 A maximum likelihood tree of the fungal family Tulasnellaceae built with operational taxonomic units (OTUs) of nrITS sequences observed in Platanthera chapmanii roots that were either cultured in lab/greenhouse conditions (green), obtained from a naturally occurring population (red), or present in both environments (blue) and orchid mycorrhizal OTUs from previous publications. The tree was rooted with midpoint method. Bootstrap values ≤50 were omitted. The tree was built using 1000 bootstrap replicates. Of the nodes that have two values, the second values are Bayesian probability values from a Bayesian tree built using 1 million generations…………...... …...124

4.7 A maximum likelihood tree of the fungal family Ceratobasidiaceae built with operational taxonomic units (OTU) clustered using fungal nrITS sequences observed in Platanthera chapmanii root obtained from a naturally occurring population (C1) and other orchid mycorrhizal OTUs previously published. The tree was rooted with a species of Sistotrema. Bootstrap values ≤50 were omitted. The tree was built using 1000 bootstrap replicates. Of the nodes that have two values, the second values are Bayesian probability values from a Bayesian tree built using 1 million generation………………………..…..………126

Texas Tech University, Kirsten Poff, August 2016

CHAPTER I

INTRODUCTION AND BACKGROUND

Introduction

Orchid classification

Orchids belong to the phylum Angiospermae. There are two classes within this phylum of flowering plants that are important to recognize: 1) monocotyledon (monocot) and 2) dicotyledon (dicot). Normally, dicot species have a vascular cambium, which is a tissue system that is responsible for forming woody structures (i.e. bark) on the outside of a stem and soft tissues on the inside. This allows dicotyledon plants to continue to grow in diameter. Dicotyledon makes up the larger of the two classes of angiosperms with 267 families that can be divided into 19 suborders (Dressler 1981). Conversely, monocots do not contain a vascular cambium, meaning their stem diameter growth is usually limited to one growing season. Because of this, the growth of monocots is somewhat limited. There is a diversity of forms in which monocots have evolved, many of which are exhibited within the family Orchidaceae.

Orchidaceae is one of the largest families of flowering plants on earth (Dressler

1981). It has been estimated that there are more than 24,500 species of orchid (Dressler

2005). This number makes up about 10% of all angiosperms (Dressler 2005). Many orchid species occur in the tropics however species of orchid occur on every continent including some Antarctic islands (Roberts and Dixon 2003, Clements and Jones 2007), which gives support to the theory that Orchidaceae originated before the complete 1

Texas Tech University, Kirsten Poff, August 2016 separation of Pangea approximately 100 mya (Janssen and Bremer 2004, Smith and Read

2008). Because of their wide distribution and habitat range, they are considered by some to be the most evolved members of the plant kingdom.

The family Orchidaceae is divided into five subfamilies: Apostasiodeae,

Cypripedioideae, Vanillioideae, Orchidioideae, and Epidendrioideae. Epidendrioideae is considered the largest and most advanced group of orchid species (Singer et al. 2008,

Smith and Read 2008, Royal Botanical Gardens Kew, webpage accessed September

2015). The orchid family may also be divided into epiphytic and terrestrial species; epiphytic species making up 73% of Orchidaceae and terrestrial making up 27% (Roberts and Dixon 2008). Unlike epiphytes that anchor themselves on the surfaces of other plants, terrestrial orchid species establish themselves and grow in the ground, procuring nutrients from soil (Rassmussen 1995).

Orchid biology

There are some general characteristics that a monocot may exhibit for it to be considered an orchid. One of the petals of each orchid flower is typically modified to form a labellum (or 'lip'). Another trait that most orchid flowers exhibit is resupination.

Resupination refers to the rotation of the pedicel when the floral buds are developing, which leads to the labellum being positioned lower-most when the flower opens (Dressler

1981). Further, almost all orchid species have only one stamen although some species have two or three. The stamen, instead of being arranged in the middle of the flower which is common in angiosperms, is arranged on one side of the flower. Secondly, the

Texas Tech University, Kirsten Poff, August 2016 stamen and the pistil are either completely united or at least partially united. This combination of pistil and stamen is referred to as the column (Roberts and Dixon 2008).

The pollen is usually grouped in two large masses termed pollinia. The rostellum, or a beaklike modification of the stigma, holds the pollinia and separates the stamen and gynoecium. This separation minimizes or eliminates self-fertilization. All orchid species produce microscopic, rudimentary seeds that lack endosperm. Seeds range in size from

200 to1,700 µm, and weigh between 0.3-14 µg. A single capsule sometimes contains thousands of seeds depending on the orchid species (Smith and Read 2008).

Pollinators of orchid species encompass a variety of Animalia from insects to birds

(Johnson, 1995). This is partially due to the variety of habitats in which orchid individuals occur combined with the diversity of floral morphologies associated with the

Orchidaceae (Pijl and Dodson 1966). Sexual reproduction is often necessary for the persistence of orchid species and typically involves an insect vector to carry the pollinia from one flower to another (Nilsson 1992).

Roots of many orchid taxa share a common characteristic, which is the presence of a velamen. The velamen is the epidermal layer that is usually spongy and white and may contain multiple layers of cells (Dressler 1981). The velamen absorbs water, a trait that is especially favorable for the epiphytic taxa. However, the roots of terrestrial species may also have a multilayered velamen (Benzing et al. 1982).

It is estimated that 92% of all terrestrial plant species acquire nutrients from some form of fungal symbiont (Tendersoo et al. 2010). The two general types of mycorrhizae are endomycorrhizae and ectomycorrhizae. Ectomycorrhizae are characterized by fungal

Texas Tech University, Kirsten Poff, August 2016 growth on the outside of the root cells whereas endomycorrhizae are characterized by intracellular growth. Ectomycorrhizae are formed commonly by tree species, whereas a majority of herbaceous species form endomycorrhizae. Approximately 6,000 fungal species are currently known to form ectomycorrhizae (Barton and Northup 2011).

Ectomycorrhizae do not exhibit intracellular colonization within the roots of the host plant, but form hyphal networks growing in-between the epidermal and cortical cells.

Additionally, a fungal mantle is formed on the exterior of the root (Smith and Read

2008). Members of this type of mycorrhizae may belong to the fungal phyla

Basidiomycota or Ascomycota (Smith and Read 2008). Arbuscular mycorrhizae (AM), which are a major group within endomycorrhizae, are the most common type of mycorrhizae occurring in tracheophytes, pteridophytes, and bryophytes (Smith and Read

2008). Arbuscular mycorrhizae are currently estimated to encompass 120 fungal species

(Barton and Northup 2011). The fungi involved belong to the ancient phylum

Glomeromycota (Smith and Read 2008), which is likely to have originated over 400 mya

(Helgason and Fitter 2005, Schubler et al. 2011).

Arbuscular mycorrhizae are characterized by intercellular growth structures known as arbuscules and vesicles, and extracellular chlamydospores. Another morphotype of endomycorrhizae, ericoid mycorrhizae, involve ascomycetes that form hyphal coils in the root hairs of some Ericales and some bryophytes (Barton and Northup, 2011). Several mycorrhizal relationships have a mix of traits that are similar to those of endomycorrhizae and ectomycorrhizae, examples include ectendomycorrhizae, arbutoid mycorrhizae, and monotropoid mycorrhizae (Smith and Read 2008).

Texas Tech University, Kirsten Poff, August 2016

Orchid mycorrhizae represent yet another morphology of endomycorrhizae. Orchid mycorrhizae form large hyphal coils (i.e. pelotons) inside the cortical cells of orchid roots. Often the pelotons occupy a large volume of the cell and are very large when compared to other types of endomycorrhizal growth (Smith and Read 2008).

At maturity, most of Orchidaceae are at least partially photosynthetic, however, holomycoheterotrophy is also present in the Orchidaceae. More than 100 orchid species are achlorophyllous as adults (Dearnaley 2007). The majority of known orchid mycorrhizae belong to the phylum Basidiomycota. The mycobiont forms pelotons within the cortical cells of the orchid root. These structures are very large when compared to other types of endomycorrhizal growth (Smith and Read 2008). In other types of mycorrhizae, the plant provides carbohydrates for the fungus; however, during the early stages in the life of an orchid, orchidaceous fungus supplies carbohydrates to the plant

(Smith and Read, 2008). Depending on the way an adult orchid receives carbon, they may be divided into one of three groups. The three groups include: fully mycoheterotrophic species, fully autotrophic species and mixotrophic species (Dearnaley et.al 2012). Of the Basidiomycetes orchid species form symbioses with, most are of the fungal families Ceratobasidiaceae, Sebacinaceae, and Tulasnellaceae (Otero et al. 2002).

Germination of orchid seeds is fairly complex. While the majority of mycorrhizal relationships between angiosperms and fungi are established after the roots have developed, orchid seed germination differs in that mycotrophy is often essential for seed germination and early development (Rasmussen 1995). This is due to the microscopic, rudimentary embryos in orchid seeds. The undifferentiated embryo contains concentrated

Texas Tech University, Kirsten Poff, August 2016 lipid and protein bodies and very rarely starch grains and glucoprotein bodies

(Rasmussen 1995). These concentrated reserves may be difficult for the embryonic cells to metabolize, and gluconeogenesis typically occurs only after embryo cells develop a connection with suitable fungi (Rasmussen 1995, Cribb et al. 2003, Smith and Read

2008). During germination, epidermal cells of a seed lengthen into outgrowths called rhizoids. Mycorrhizal fungi may enter a seed through these filamentous outgrowths and form hyphal coils (Rasmussen 1995). The fungi then translocate carbon into the developing protocorm (i.e. leafless orchid seedling) allowing for differentiation (Smith and Read 2008). In some cases, even when an orchid seed is in symbiosis with a fungal species that would normally be compatible, plant development may not be successful

(Dressler 1981). Unlike other angiosperm seedlings, orchid seedlings do not produce a radicle (i.e. embryonic root). This is because the basal end of the seedling develops histological features specialized for mycotrophy (Rasmussen 1995).

Orchid Conservation

As stated previously, the Orchidaceae is both a large and widely distributed family.

However, most species of orchid are rare and threatened with extinction (Cribb et al.

2003). All orchid species are protected under the Convention on International Trade of

Endangered Species of Wild Fauna and Flora (CITES).

Globally, habitat loss and degradation is a large threat to Orchidaceae. However, relying solely on the conservation of rare plant habitat is not feasible to mitigate the loss of biodiversity the earth is experiencing (Swarts and Dixon 2009). Climate change also 6

Texas Tech University, Kirsten Poff, August 2016 poses a large threat to many orchid species (Liu et al. 2010). For example, in the Guangxi

Province in China, precipitation is expected to increase and soil moisture levels are expected to decrease (Liu et al. 2010). This decrease in soil moisture is likely to negatively affect orchid populations, whereby the species with small populations and narrow distributions will be most vulnerable to changes (Liu et al. 2010). The study by

Liu et al. 2010 further describes how changes in temperature may drive some orchid populations to become extinct. The majority of orchid species (72%) in the Yachang

Reserve have populations that occur very close to, or on, mountain tops. If the temperature in these areas rises, mountain top populations may not survive (Liu et al.

2010).

Orchid wild-collection and illegal trade is another threat that leads to the decline and extinction of many orchid species (Cribb et al. 2003). Collection is species dependent, but has led to the decline of many orchid taxa. For example, Cypripedium calceolus was historically occurring in several countries, but because of wild-collection, it became one of the rarest plants in the British Isles by the early 2000s (Cribb et al. 2003).

Cruz-Fernandez et al. (2010) suggested that natural ecosystem processes, such as self-thinning, are intimately related to the persistence of some orchid genera. In this particular study, they reported absence of a correlation between orchid species richness or abundance and timber extraction. However, they also reported a positive correlation between abundance of orchid taxa belonging to the genus Malaxis and abundance of standing dead trees (Cruz-Fernandez 2010). This provides evidence that some orchid

Texas Tech University, Kirsten Poff, August 2016 species may require natural disturbances such as self-thinning to persist (Coates et al.

2006, Cruz-Fernandez 2010).

Generally, quantifying suitable habitat is an important step for species preservation.

This can be done by developing species-specific modular regression models of areas using parameters such as, type of vegetation in the area, percent canopy, and soil moisture and nutrient content. Suitable habitat quantification has been done for some orchid species, including the federally threatened species Platanthera praeclara and

Isotria medeoloides (Sperduto and Congalton 1996, Wolken et al. 2001). For many species it is difficult for researchers to assign levels of extinction-threat because sufficient field data do not exist (Cribb et al. 2003).

Genus Platanthera

A notable genus within the family Orchidaceae, Platanthera, belongs to the subfamily Orchidoideae, and subtribe Orchidinae (Dressler and Dodson 1960, Efimov

2011). The genus consists of about 200 terrestrial species that are distributed over parts of

North America, Europe, Asia, and North Africa (World Checklist of Selected Plant

Families, Royal Botanical Gardens Kew, webpage accessed October 2015). Most species in the genus are terrestrial herbs, although a few are humus epiphytes that grow near the ground (Efimov 2011). Habitats and ecosystems in which Platanthera species occur include forest, open tundra, and open mesic to wet grasslands. A few species also occur in the tropical montane rainforests of Borneo, but most inhabit the temperate zone in the northern hemisphere (Hapeman and Inoue 1997, Efimov 2011). Floral features of this 8

Texas Tech University, Kirsten Poff, August 2016 genus include wide anthers and can include fringed labella. Flowers may be orange, yellow, green, white, or purple (Hapeman and Inoue 1997, Efimov 2011).

Platanthera chapmanii

A species within the genus Platanthera, Platanthera chapmanii (Fig. 1) was first described in 1903 by J.K. Small (Small 1903) and can be distinguished from the similar looking and closely related Platanthera cristata and Platanthera ciliaris by floral morphology. The mouth of the nectar spur of P. chapmanii is circular, whereas the opening of P. cristata and P. ciliaris are more triangular (the nectar spur of P. ciliaris is also longer). The lobes protruding from the rostellum can be curved in P. chapmanii, whereas the lobes of P. cristata and P. ciliaris are only slightly curved (Royal Botanical

Gardens Kew, webpage accessed October 2015). These are important distinctions because P. cristata, P. ciliaris, and P. chapmanii have overlapping geographic distributions (Liggio and Liggio 1999). Like its close relatives, P. chapmanii flowers in

July to August producing >60 orange flowers on each inflorescence (Fig. 2, Liggio and

Liggio 1999).

Platanthera chapmanii occurs in mesic and wet pine flatwoods, barrens, and savannas in sandy loam soils in northern Florida, southern Georgia, and southeast Texas

(Fig. 3, Fig. 4). In Georgia the taxon has been reported recently in Camden, Charlton and

Brantley counties although reported population sizes are usually small (i.e. less than ten individuals) (Richards and Sharma 2014). In Florida, P. chapmanii has been reported previously in Baker, Clay, Columbia, Duval, Franklin, Jefferson, Liberty, Marion,

Texas Tech University, Kirsten Poff, August 2016

Taylor, Union, and Wakulla counties (Wunderlin and Hansen 2008). Although more recently it was reported to be restricted to the Apalachicola and Osceola National forests

(Brown 2004). In Texas, the taxon has been historically reported in Tyler, Hardin,

Orange, and Jefferson counties although recent observations have not been made in

Jefferson County (J. Sharma personal observation). One location in Tyler County is host to the largest known population that hosts up to 260 reproductive individuals (J. Sharma personal observation). However, the species distribution and habitat range is not completely known, newly documented populations of the taxon have been recently reported (Richards and Sharma 2014).

Biology and ecology of P. chapmanii is poorly understood, and there is a lack of empirically derived protocols for its propagation and reintroduction. A review of literature is presented below to support the identification of research gaps with respect to propagation, culture, population augmentation, and the diversity of mycorrhizal fungi associated with this taxon. Subsequently, the research objectives and hypotheses associated with each of these subjects are described

Background

In vitro seed germination

Most of what is known about germination and development of orchid seeds has been developed through in vitro studies (Arditti 1967, Rasmussen and Whigham 1993). Seed dormancy and other pre-germination requirements are known to occur in seeds of temperate terrestrial orchid species (Sharma et al. 2003a). Overcoming seed dormancy in 10

Texas Tech University, Kirsten Poff, August 2016 orchid species can, thus, be necessary to obtain germination in vitro (Lauzer et al. 2007).

This is especially true for terrestrial individuals which may have a complex dormancy pattern (Johansen and Rasmussen 1992, Lauzer et al. 2007). For example, seeds of

Epipactis palustris require a combination of scarification of the testa, an initial incubation for several weeks at 27°C, followed by cold stratification for 8-12 weeks to initiate germination. Without these pretreatments germination rate was poor, but once implemented, germination was increased to 50% (Rasmussen 1992). These complex patterns of dormancy are likely present in temperate orchid seeds because of the environmental conditions the seeds are exposed to. The seeds often experience cold and moist conditions along with some environmental weathering before experiencing a warming period when winter turns to spring and summer. Accordingly, to germinate seeds in vitro, these conditions must also be met, although species often vary in their response to pre-germination treatments.

One method to apply cold-moist stratification to the microscopic orchid seeds is by first surface sterilizing seeds, placing them in sterile vials containing sterile water and incubating in the dark at 4-5°C (Zetter et al. 2001, Sharma et al. 2003a). In some cases, stratification is performed by placing seeds directly onto germination medium then incubating in the dark at 4-5°C (Richards and Sharma 2014). Period of stratification can also have an effect on germination success. Species require variable periods of stratification. This is the case with Platanthera praeclara as well as Platanthera leucophaea (Zetter et al. 2001, Sharma et al. 2003a). However, not all Platanthera species require a stratification period to germinate. Platanthera integra, a species native

Texas Tech University, Kirsten Poff, August 2016 to the southeastern United States apparently does not have this pre-germination requirement (Zettler et al. 2000). Although stratification was not tested for P. integra, a prolonged scarification treatment was recorded to increased germination percentage

(Zettler et al. 2000). Germination without stratification may be possible because of the ecological requirements of species distributed in climates that do not experience excessively low minima during the dormant season.

Although germination in the absence of mycorrhizal fungi has not been documented in nature, it is possible to asymbiotically germinate orchid seeds in vitro by supplying exogenous sugars and nutrients (Smith 1973, Rasmussen 1995, Lo et al. 2004, Smith and

Read 2008, Godo et al. 2010). Germination of orchid seeds on culture medium containing salts and sucrose was first recorded in the 1920s (Knudson 1922). By 1967, in vitro protocols had been established for germinating seeds of some orchid species asymbiotically in sterile conditions (Arditti 1967). It is now known that orchid species can vary in their response to the composition of the media used for in vitro germination requiring empirical testing to identify the most effective germination conditions for each taxon (Arditti 1967, Olivia and Arditti 1984, Rasmussen and Whigham 1993, Stewart and

Kane 2006). While many orchid species are successfully propagated via this method, there is still a lack of information concerning germination and development of a multitude of orchid taxa, especially those that are native to temperate climates (Arditti et al. 1981, Rasmussen 1995).

Photoperiod is also known to affect orchid seed germination (Stewart and Kane

2006). It is common for seeds to be incubated in the dark during the initial stages of

Texas Tech University, Kirsten Poff, August 2016 germination experiments to simulate natural conditions whereby the seeds typically germinate below the soil surface (Zettler 1994, Sharma et al. 2003a, Stewart and Kane

2006). Occasionally, seeds are exposed to a short photoperiod prior to placing them under dark conditions. Platanthera integrilabia seeds were reported to germinate best when exposed to one week of 16 hr photoperiod followed by incubation in the dark continuously (Zettler 1994). After a leaf primordium begins to develop, protocorms may be exposed to a light/dark cycle to encourage further development. The terrestrial species

Habenaria macroceratitis produced the highest number of tubers per individual plant when exposed to a photoperiod of 8 hrs (Stewart and Kane 2006). Similar results were reported in Calopogon tuberosus var. tuberosus, whereby highest germination was recorded when seeds were exposed to a photoperiod of 8 hrs (Kauth et al. 2008).

Orchid seeds often exhibit a preference for an optimum germination temperature or temperature range (Rasmussen et al. 1990). Seeds of Dactylorhiza majalis were reported to have an optimum germination temperature between 23 and 25°C (Rasmussen et al.

1990). In one case, seeds of Dactylorhiza majalis were more sensitive to temperatures above their optimum range than below. Dactylorhiza majalis seeds had a higher germination percentage when exposed to temperatures below 23°C than above 25°C

(Rasmussen et al. 1990).

Platanthera chapmanii has been propagated successfully after a cold-moist stratification period of about 12 weeks. However, whether a stratification treatment is necessary or beneficial for inducing germination has not been empirically tested

(Richards and Sharma 2014).

Texas Tech University, Kirsten Poff, August 2016

Greenhouse culture of plants

Majority of the plant species cultured in vitro require an acclimatization process to ensure plant survival ex vitro (Hazarika 2003, Deb and Temjensangba 2006). When transitioning orchid seedlings from sterile culture conditions into a greenhouse, an acclimation procedure is often required (McKendrick 2000). It is common for some plants to perish during the transfer from aseptic in vitro conditions to a greenhouse setting

(Preece and Sutter 1991, Deb and Imchen 2010). This is due to multiple factors.

Humidity is typically lower in the immediate vicinity of individual plants in a greenhouse while the intensity of light can be higher or lower (Preece and Sutter 1991). There is also the unavoidable stress of a septic environment (Preece and Sutter 1991). If in vitro propagated plants are not acclimated appropriately to the greenhouse environment, they may show signs of stress including wilting, tip necrosis, and death (Preece and Sutter

1991). An orchid plantlet may require several weeks or months to acclimate to greenhouse conditions (McKendrick 2000, Deb and Temjensangba 2006). Duration of acclimatization is implicated in the long-term survival of individual plants (Zeng et al.

2012).

The terrestrial orchid Malaxis khasina is reported to be first acclimatized in vitro for

8-10 weeks before transferring to the greenhouse (Deb and Temjensangba 2006). The in vitro acclimatization may involve a medium transfer from agar-based medium to a mix of agar and other sterilized media such as coconut husk and forest litter (1:1:1 ratio) (Deb and Temjensangba 2006). A similar technique involving alternative substrates has been used for several members of the genera Arachnis and Cleisostoma (Deb and Imchen

Texas Tech University, Kirsten Poff, August 2016

2010). After this initial period, plant survival in greenhouse conditions increased (Deb and Temjensangba 2006, Deb and Imchen 2010).

According to a review by Hazarika (2003), acclimatization of plantlets can be expensive by constituting up to 60% of production costs, and is time consuming. For these reasons, sometimes plants are not acclimatized before greenhouse planting.

Additionally, acclimatization may not be equally necessary for every species (M.

Richards pers. comm.).

The medium used for greenhouse culture can be species-specific. Some epiphytic taxa, such as the medically important Dendrobium tosaense, have been successfully transferred from sterile agar medium to unsterilized sphagnum moss or tree fern (Lo et al.

2004). Terrestrial species require a weightier medium, although medium texture should mimic the soil in a taxon's native habitat. Orchid species such as P. chapmanii that occur in bog habitats with sandy soils typically require a medium that is well drained.

Platanthera chapmanii has been successfully cultured in a medium composed of builder’s sand, peat moss, milled sphagnum moss, and fine tree fern fiber (Richards and

Sharma, 2014).

Some terrestrial orchid species can be sensitive to conventional fertilizers. Even when exposed to low concentrations of inorganic (Nitrochalk (England), superphosphate, magnesium sulphate, potassium sulphate) and organic (hoof and horn, bonemeal and urea) fertilizers, detrimental effects have been measured (Silvertown et al. 1994). For example, a significant decrease in flowering was reported in Orchis morio when exposed

Texas Tech University, Kirsten Poff, August 2016 to what were considered low concentrations for agriculture (22-88 kg ha-1 N) (Silvertown et al.1994).

Platanthera chapmanii has been grown in greenhouse conditions (Richards and

Sharma 2014). When in vitro cultured plants were transferred to a greenhouse at the

Atlanta Botanical Garden (ABG), special acclimatization steps or conditions were not required (M. Richards, per. comm.). While plants of the taxon can be grown in a medium containing builder’s sand, peat moss, milled sphagnum moss, and fine tree fern fiber under greenhouse conditions where they produce flowers and capsules subsequently

(Richards and Sharma, 2014), it is not known how sensitive individuals of P. chapmanii are to fertilization when cultured in a greenhouse. Platanthera chapmanii has been grown without added nutrients while watered only with dechlorinated water (M. Richards, pers. comm.). Further, staff at ABG have at times attempted to treat P. chapmanii with a diluted solution of fertilizer, but whether this nutrient supplementation encouraged or hindered growth was not documented quantitatively (M. Richards pers. comm.).

Population augmentation

Degradation of rare plant habitat continues largely because of changes in land use practices and resource utilization (Rochefort 2000). Sphagnum is one example of a keystone genus in rare plant habitats that is wild-harvested for horticultural peat and fuel peat (Rochefort 2000). However, conservation of existing rare plant habitat alone is not sufficient to preserve biodiversity (Rochefort 2000, Cribb et al. 2003). Because such a

Texas Tech University, Kirsten Poff, August 2016 disproportional number of orchid species have populations that are in decline, special emphasis is required for this family of angiosperms (Cibb et al. 2003).

One aspect of restoration ecology, population augmentation, is a method to increase the size of a population (Batty et al. 2006, Decruse et al. 2013, Richards and Sharma

2014). Orchid plants grown from seeds in vitro and subsequently transplanted in native habitats is reported as a successful approach for Eulophia cullenii and for Platanthera chapmanii (Decruse et al. 2013, Richards and Sharma 2014). Another terrestrial species that was reintroduced successfully in its native habitat is Paphiopedilum wardii (Zeng et al. 2012). Plants grown from seed were acclimatized and reintroduced into native habitat in Gaoligong Mountain in Yunnan, new populations in areas where prior documentation was not recorded were established in Yangchun and Guangzhou in Guangdong (Zeng et al. 2012). The transplanted plants exhibited survival rates of approximately 50% or higher and persisted after two years (Zeng et al. 2012). The North American species

Spiranthes brevilabris has had similar success when transplanted into natural habitats subsequent to in vitro culture (Stewart 2003). Transplant success, however, is not equal across various taxa. For example, of the 165 Spiranthes brevilabris plants that were transplanted in the 2003 study, only 17 initiated anthesis after 6 months even though all

165 had survived the first month in the natural habitat (Stewart et al. 2003).

Clonal propagation of members of Orchidaceae may also be carried out for the purpose of restoration of natural populations (Martin 2003). When propagated clonally and introduced into the natural habitat, the endangered Ipsea malabarica was documented with a high survival and flowering rate (Martin 2003). All 50 of the

Texas Tech University, Kirsten Poff, August 2016 individuals transplanted survived and initiated anthesis normally (Martin 2003). An advantage of clonal propagation is that a large number of individuals can be obtained relatively rapidly that would otherwise take much longer if propagated by using seeds, however, the genetic diversity is highly compromised in clonal populations (Collins and

Dixon 1992, Martin 2003).

In situ seed sowing, seedling planting, or tuber transplant are additional approaches to population augmentation (Batty et al. 2006). In one study, 18% of Thelymitra manginiorum persisted 5 years subsequent to transplanting of seedlings and dormant tubers (Batty et al. 2006). It is also possible in some cases to sow seeds in situ to facilitate terrestrial orchid establishment in situ (Huber 2002). This method has been reported to be successful for Cypripedium kentuckiense (Huber 2002). In some cases, a carrier such as sugar or cracked corn is mixed with the seeds before sowing in an attempt to recruit new individuals (Huber 2002).

Field establishment of in vitro raised plants has been reported for P. chapmanii

(Richards and Sharma, 2014). In 2012 and 2013, two-year old plants of P. chapmanii were transplanted into an existing population. In August 2014, 76% (26 of 34) of the transplanted P. chapmanii were observed flowering (Richards and Sharma 2014, J.

Sharma pers. comm.). Whether in vitro grown plants can be successfully established within other natural populations or in potentially suitable habitat currently void of P. chapmanii plants is not documented. Additionally, whether in vitro raised plants have an advantage over naturally occurring individuals with respect to transplant success has not been recorded. If individuals growing naturally are recruited for transplanting and

Texas Tech University, Kirsten Poff, August 2016 relocating to another population, they may have an advantage over plants raised in vitro and then planted into native soil. On the other hand, plants raised in vitro and acclimatized in a greenhouse may be more robust than naturally occurring individuals giving the former an advantage.

Mycorrhizal associations

Orchid distribution and abundance patterns depend on a multitude of factors. One such inclusion could be the distribution and abundance of the suitable mycorrhizal fungal associates and / or the specificity of the mycorrhizal association (McCormick and

Jacquemyn 2013). Some examples of such correlations include the common species Disa bracteata and the widespread Pyrorchis nigricans, which have been documented to associate with diverse and widespread groups of fungi (Bonnardeaux et al. 2007). In the same study, Bonnardeaux et al. (2007) reported that the most disturbance-tolerant and rapidly spreading species of orchid were documented as having the broadest fungal webs.

In contrast, some of the more selective and slower-growing orchid species such as

Caladenia falcata and Pterostylis sanguinea form associations with smaller fungal webs

(Bonnardeaux et al. 2007).

Non-photosynthetic orchid taxa (e.g. members of the genus Hexalectris) have been documented exhibiting high specificity toward their fungal associates (Kennedy et al.

2011). However, there is growing documentation of photosynthetic species of orchid also exhibiting high specificity. The genus Cypripedium is one such example; species within this genus have been reported to associate largely with members of a narrow clade of 19

Texas Tech University, Kirsten Poff, August 2016

Tulasnellaceae (Shefferson et al. 2005). Because of the specificity of these relationships, the geographical range of species within the genus Cypripedium could be restricted by the availability of the mycobionts (Shefferson et al. 2005). There is not always a connection between narrow distribution of an orchid species and high mycorrhizal specificity. The endemic North American species Piperia yadonii has been recorded as associating with a diversity of fungi from three fungal families: Ceratobasidiaceae,

Tulasnellaceae, and Sebacinaceae (Pandey et al. 2013) despite being restricted to a single

County in California, USA.

The diversity of mycorrhizal fungi in and around the rhizosphere may affect the fungal species that colonize orchid roots. However, in some cases there are many root- exclusive species. Investigation of potential mycorrhizal fungi of the terrestrial orchid

Neottia ovata showed 68 total species of mycorrhizal fungi, 21 of which were exclusively present in the roots of the orchid (Jacquemyn et al. 2015).

Although a majority of the known orchid mycorrhizae belong to the phylum

Basidiomycota, some are Ascomycetes (Dearnaley 2007). Because mycorrhizae are indispensable in orchid development, their documentation and conservation is a part of orchid species conservation. The loss of suitable fungi could lead to the further decline of orchid populations (Sharma el al. 2003b).

There is documentation of mycobionts associating with species in the genus

Platanthera. It is common to find Tulasnellaceae and Ceratobasidiaceae in the roots of

Platanthera species including Platanthera praeclara and Platanthera leucophaea

(Currah et al. 1990, Zettler and Hofer 1998, Sharma et al. 2003b). Platanthera

Texas Tech University, Kirsten Poff, August 2016 leucophaea has been recorded associating largely with Ceratobasidiaceae in nine populations in Michigan and Illinois (Zettler and Piskin 2011). Across the nine populations, 75 plants were sampled. Eighty-eight percent of the fungal isolates were grown from these 75 plants were observed as Ceratobasidiaceae. These strains of

Ceratobasidiaceae were recovered from various stages of growth including protocorms, seedlings and mature plants of P. leucophaea (Zettler and Piskin 2011). Although results from this study suggested that Ceratobasidiaceae is a common associate to P. leucophea, abundance and distribution of specific strains within Ceratobasidiaceae were not recorded

(Zettler and Piskin 2011). A recent range-wide study of P. praeclara across its geographic range, spanning from Monitoba (Canada) to Missouri, showed

Ceratobasidiaceae being dominant in most populations (Tovar 2015). Species of

Platanthera are not strictly documented as being dominated by Ceratobasidiaceae.

Protocorms of Platanthera holochila, a Hawaiian endemic species, were documented to associate with strains of Tulasnellaceae (Zettler et al. 2011). Platanthera chapmanii is known to associate with Tulasnellaceae (Richards and Sharma 2014). However, the results from Richards and Sharma (2014) are preliminary and additional fungal data are necessary. It is not known how specific P. chapmanii mycorrhizal associations are compared to other terrestrial orchid taxa.

Temporal variation of mycorrhizae is not well documented for terrestrial orchid species. Throughout a growing season, mycorrhizal associations within a population may vary (Ercole et al. 2014). The meadow orchid Anacamptis morio has been recorded with mycorrhizal differences over several seasons; Tulasnella being more common in the

Texas Tech University, Kirsten Poff, August 2016 autumn and winter and in the summer Ceratobasidium was more common (Ercole et al.

2014). Platanthera praeclara was tested in a similar way, however the results of the 2015 study were only partially conclusive (Tovar 2015). Tovar (2015) observed an overall change in mycorrhizal community from one year to the next however whether these changes were significant were not recorded. In addition, whether terrestrial orchid species maintain mycorrhizal specificity when raised in vitro and cultured in a greenhouse (with or without nutrient supplementation) is not fully documented (Richards and Sharma

2014). In addition to revealing whether or not an orchid species is highly specific to its mycorrhizal associations, this could be important for species grown and cultured in vitro for restoration and re-introduction into native habitats.

Techniques for mycorrhizal identity

Much information on orchid mycorrhizae has been generated from in vitro isolation of fungi (Zettler et al. 2001, Sharma et al. 2003b, Zhu et al. 2008). This technique is performed by plating sections of surface sterilized roots or individual pelotons on an agar-based medium. With this technique, fungal isolates may be identified or used for symbiotic germination. However, it is often difficult to accurately identify the fungal isolates because contaminants and endophytes may be isolated and mistaken for mycorrhizae (Taylor and McCormick 2007, Zhu et al. 2008, Dearnaley et al. 2012). In addition, fungi from inactive pelotons may be excluded when using this method, or one peloton may contain several different fungal taxa making it difficult to isolate a single fungus (Zhu et al. 2008). Although there are multiple protocols that can be followed to 22

Texas Tech University, Kirsten Poff, August 2016 reduce these issues, molecular techniques can be more reliable than culture-based fungal identification methods (Zhu et al. 2008).

It is common to use DNA-based barcoding to identify fungi (Schoch et al. 2012).

The nuclear ribosomal internal transcribed spacer (ITS) region is a universal DNA barcode marker for fungi and is useful for identifying mycorrhizae (Schoch et al. 2012).

Orchid-fungus specific primers have been designed for the ITS region of the fungal nuclear DNA, including primers that are specific for Tulasnellaceae, Thelephoraceae and generalized basidiomycete fungi (Taylor and McCormick 2008). Before 2008, it was difficult to amplify Tulasnellaceae using standard primers because the family exhibits accelerated evolution of the nuclear ribosomal operon (Taylor and McCormick 2008).

The pair ITS4-1 and ITS1-OF were designed to help amplify basidiomycete fungal DNA.

If the target DNA is Tulasnellaceae, the primer ITS4-Tul can be paired with ITS1 or ITS5 to amplify this notoriously difficult to amplify group of fungi (Taylor and McCormick

2008). The primer pairs have been designed for Sanger sequencing and have proven useful in identifying orchid mycorrhizal species (Nontachaiyapoom et al. 2010,

Tendersoo et al. 2010, Roche et al. 2010, Bailarote et al. 2012, Jacquemyn et al. 2012,

Pandey et al. 2013). In addition, Sanger sequencing may offer higher resolution than 454- pyrosequencing but this is not always the case (Tedersoo et al. 2010). In Sanger sequencing, longer sequences can be achieved; next generation sequencing often sequences ITS-2 region resulting in shorter sequences (around 300 bp) then Sanger sequencing. In addition, because of the amount of data provided by next generation

Texas Tech University, Kirsten Poff, August 2016 sequencing, it may be difficult to distinguish between endophytes and peloton-forming mycorrhizal fungi (Tovar 2015).

Summary of Research Gaps

Minimal data are available on the biology and ecology of Platanthera chapmanii

(Small 1903, Liggio and Liggio 1999, Brown 2004, Richards and Sharma 2014). Some of the understudied areas include dormancy breaking techniques, seed viability, and germination rate. Overall, it appears that response of seeds to stratification is variable across species, and generalizations may not be possible (Zettler et al. 2000, Zettler et al.

2001, Sharma et al. 2003a, Lauzer et al. 2007). This may be especially true because of the local climatic adaptations of temperate species. Although asymbiotic germination is documented for the species, empirical data for P. chapmanii seed viability and optimal cold stratification period or its necessity is not known (Richards and Sharma 2014).

Greenhouse culture of P. chapmanii has been successful without an acclimatization period (M. Richards pers. comm.). However, nutrient supplementation has not been tested. Terrestrial orchid taxa can be sensitive to commercial fertilizers, even in diluted amounts but this is not recorded for many species (Silvertown et al. 1994).

Augmenting the existing populations or establishing new populations of terrestrial

Orchidaceae can be a successful method of conservation as it can directly increase numbers of individuals in a population (Cribb et al. 2003, Batty et al. 2006, Decruse et al.

2013, Richards and Sharma 2014). Augmentation of a natural population in Texas

[Watson Native Plant Preserve (WNPP)] was conducted by using individuals grown in 24

Texas Tech University, Kirsten Poff, August 2016 vitro and cultured in a greenhouse (Richards and Sharma 2014). An unanswered question though is whether this method is repeatable at additional sites. In addition, it is not known if the plants need to be cultured in a greenhouse prior to outplanting or if they can be established in the field directly after sterile culture.

Peloton-forming fungi from the family Tulasnellaceae have been identified from the roots of P. chapmanii occurring naturally in the population at WNPP (Richards and

Sharma 2014). Whether the species is specific in its association with this single fungal family is not known because of the limited, preliminary data (Richards and Sharma

2014).

Soil microbial communities could have an effect on associations of P. chapmanii.

Roots of greenhouse acclimatized individuals of the taxon could have different peloton- forming species associating with them then naturally occurring individuals. Greenhouse medium is different from native soil, plants growing in a greenhouse may be associating with smaller fungal webs than those at WNPP.

Population augmentation has been proven somewhat successful with P. chapmanii

(Richards and Sharma 2014). In addition, knowledge concerning P. chapmanii development and mycorrhizal associations will be helpful in the conservation of the species. Three specific research questions concerning the biology of P. chapmanii were developed.

Texas Tech University, Kirsten Poff, August 2016

Objectives of the study

1) Evaluate the effect of 8 and 12 week cold-moist stratification pre-germination

treatments on seed germination and plant development in Platanthera chapmanii.

2) Evaluate the effect of supplemental nutrients on the plant height of in vitro raised

Platanthera chapmanii plants and compare above-ground emergence of in vitro /

greenhouse cultured plants of Platanthera chapmanii with naturally-occurring,

relocated Platanthera chapmanii plants after transplanting within naturally

occurring populations.

3) Document the diversity of mycorrhizae forming fungi of Platanthera chapmanii

in response to time and growing environment.

Significance of the study

This study will allow an evaluation of how effective the pre-germination treatment of cold-moist stratification is on P. chapmanii seeds. It will also estimate the effectiveness of nutrient supplementation and lend knowledge to how easily natural populations of P. chapmanii can be augmented using lab raised individuals. The importance of mycorrhizal associations in terrestrial orchids is well documented. Data from this study will lend identity to some associations of P. chapmanii. All of the information produced through this study will allow for the better conservation of the species P. chapmanii.

Texas Tech University, Kirsten Poff, August 2016

Literature Cited

Arditti, J. 1967. Factors affecting the germination of orchid seeds. The Botanical Review, 33(1):1-97.

Bailarote, B.C., Lievens, B., and H. Jacquemyn. 2012. Does mycorrhizal specificity affect orchid decline and rarity? American Journal of Botany, 99(10):1655-1665.

Barton, L.L., and D.E. Northup. 2011. Interactions between microorganisms and plants, Chapter 7 in Microbial ecology. John Wiley & Sons Inc., Hoboken, New Jersey.

Batty, A.L., Brundrett, M.C., Dixon K.W., and K. Sivasithamparam. 2006. In situ symbiotic seed germination and propagation of terrestrial orchid seedlings for establishment at field sites. Australian journal of botany, 54(4):375-381.

Benzing, D.H., Ott, D.W., and W.E. Friedman. 1982. Roots of Sobralia macrantha (Orchidaceae): structure and function of the velamen-exodermis complex. American journal of botany, 69(4):608-614.

Bonnardeaux, Y., Brundrett, M., Batty, A., Dixon, K., Koch, J., and K. Sivasithamparam. 2007. Diversity of mycorrhizal fungi of terrestrial orchids: compatibility webs, brief encounters, lasting relationships and alien invasions. Mycological Research, 111(1):51-61.

Brown, P.M. 2004. Understanding Platanthera chapmanii (Orchidaceae), its origins and hybrids. SIDA Contributions to Botany, 2:853-859.

Churchill, M.E., Ball, E.A., and J. Arditti. 1973. Tissue culture of orchids. I. Methods for leaf tips. New phyologist, 2(1):161-166.

Clements, M.A., and D.L. Jones. 2007. A new species of Nematoceras and characterization of N. dienemum (Orchidaceae), both from Macquarie Island. Telopea, 11(4), 405-411

Coates, F., Lunt, I.D., and R.L. Tremblay. 2006. Effects of disturbance on population dynamics of the threatened orchid Prasophyllum correctum D.L. Jones and implications for grassland management in south-eastern Australia. Biological Conservation, 129:59-69.

Collins, M.T., K.W. Dixon. 1992. Micropropagation of an Australian terrestrial orchid Diuris longifolia R. Br. Australian journal of experimental agriculture, 32(1):131- 135.

Texas Tech University, Kirsten Poff, August 2016

Cribb, P.J, Kell, S.P., Dixon, K.W., and R.L. Barrett. 2003. Orchid Conservation: A Global Perspective, Chapter 1 in Orchid conservation. Dixon W.K., Kell P.S., Barrett L.R., Cribb J.P. (Eds.). Natural History Publications (Borneo) Sdn. Bhd., Sabah, Malaysia.

Cruz-Fernández, C.T., Alquicira-Arteaga, M.L., A. Flores-Palacios. 2011. Is orchid species richness and abundance related to the conservation status of oak forest? Plant Ecology, 212(7):1091-1099.

Currah, R. S., Smreciu, E.A. and S. Hambleton. 1990. Mycorrhizae and mycorrhizal fungi of boreal species of Platanthera and Coeloglossum (Orchidaceae). Canadian Journal of Botany, 68(6):1171-1181.

Dearnaley, J. 2007. Further advances in orchid mycorrhizal research. Mycorrhiza, 17(6):475-486 Dearnaley, J.D.W., Martos, F., and M.A. Selosse. 2012. Orchid Mycorrhizas: Molecular Ecology, Physiology, Evolution and Conservation Aspects. Chapter 12 In Fungal associations, 2nd edition. The mycota IX. Hock B. (Ed.) pp. 207-230 Springer Berlin Heidelberg.

Deb, C.R., Temjensangba. 2006. In vitro propagation of threatened terrestrial orchid, Malaxis khasiana Soland ex. Swartz through immature seed culture. Indian Journal of Experimental Biology, 44:762-766.

Deb, C.R., Imchen, T. 2010. An efficient in vitro hardening technique of tissue culture raised plants. Biotechnology, 9(1):79-83.

Debergh, P.C., and R.H. Zimmerman. 1991. Micropropagation, Chapter 1 in Micropropagation technology and application. Debergh P.C., Zimmerman R.H. (eds). Kluwer Academic Publishers, Dordrecht, Netherlands.

Decruse, S.W., Reny, N., Shylajakumari, S., and P.N. Krishnan. 2013. In vitro propagation and field establishment of Eulophia cullenii (Wright) B1., a critically endangered orchid of western Ghats, India through culture of seeds and axenic seedling-derived rhizomes. In vitro Cell & Developmental Biology-Plant, 49(5):520-528.

Dressler RL. 2005. How many orchid species? Selbyana, 26:155–158.

Dressler R.L. 1981. The orchids: natural history and classification. Harvard University Press, Cambridge, Massachusetts and London, England.

Dressler, R.L., and C.H. Dodson. 1960. Classification and phylogeny in the Orchidaceae. Annals of the Missouri Botanical Garden, 47(1):25-68.

Texas Tech University, Kirsten Poff, August 2016

Efimov, P.G. 2011. An intriguing morphological variability of Platanthera S.L. European Journal of Environmental Science, 1(2):125-136.

Ercole, E., Admao, M., Rodda, M., Gebauer, G., Girlanda, M., and S. Perotto. 2014. Temporal variation in mycorrhizal diversity and carbon and nitrogen stable isotope abundance in the wintergreen meadow orchid Anacamptis morio. New Phytologist, 205:1308-1319.

Hazarika B.N. 2003. Acclimatization of tissue-cultured plants. Current Science, 85(12):1704-1712.

Hapeman, J.R., Inoue, K. 1997. Chapter 15: Plant-pollinator interactions and floral radiation in Platanthera (Orchidaceae)". In Givnish, Thomas J.; Sytsma, Kenneth J. Molecular Evolution and Adaptive Radiation. Cambridge University Press. pp. 433–454.

Helgason, T., and A. Fitter. 2005. The ecology and evolution of the arbuscular mycorrhizal fungi. Mycologist, 19(3):96-101.

Hosomi S.T., Custodio C.C., Seaton P.T., Marks T.R., Machado-Neto N.B. (2012) Improved assessment of viability and germination of cattleya (orchidaceae) seeds following storage. In vitro cellular and developmental biology. Plant. Volume 48(1), pp. 127-136.

Huber A. 2002. Mountain lady’s slipper (Cypripedium montanum) establishment form seeds in forest openings. Native Plants Journal, 3(2):151-154.

Jacquemyn, H., Brys, R., Lievens, B., and T., Wiegand. 2012. Spatial variation in below- ground seed germination and divergent mycorrhizal associations correlate with spatial segregation of three co-occurring orchid species. Journal of Ecology, 100(6):1328-1337.

Jacquemyn, H., Waud, M., Merckx, V.S.F.T., Lievens B., and R. Brys. 2015. Mycorrhizal diversity seed germination and long-term population size across nine populations of the terrestrial orchid Neottia ovata. Molecular ecology, 24(13):3269-3280.

Janssen T., and K. Bremer. 2004. The age of major monocot groups inferred from 800+ rbcL sequences. Botanical Journal of the Linnean Society, 146:385-398.

Johnson S.D. 1995. Bird pollination in South African species of Satrium (Orchidaceae). Plant Systematics and Evolution, 203:91-98.

Texas Tech University, Kirsten Poff, August 2016

Kauth, P.J., Kane, M.E., Vendrame, W.A., and C. Reinhardt-Adams. 2008. Asymbiotic germination response to photoperiod and nutritional media in six populations of Calopogon tuberosus var. tuberosus (Orchidaceae): Evidence of ecotypic differentiation. Annals of Botany, 102(5):783-793.

Kennedy, A.H., Taylor, D.L., and L.E. Watson. 2011. Mycorrhizal specificity in the fully mycoheterotrophic Hexalectris Raf. (Orchidaceae: Epidendroideae). Molecular Ecology, 20(6):1303-1316.

Kew Royal Botanical Gardens. Orchidaceae: Orchid fact file-the origin and affinities of orchids. Richmond, England. Webpage accessed September 2015.

Knudson, L. 1922. Non-symbiotic germination of orchid seeds. Botanical Gazette, 73:1- 25. Lakon, G. 1949. The topographical tetrazolium method for determining the germination capacity of the seed. Plant Physiology, 24:389-394.

Lauzer, D., Renaut, S., and D. St-Arnaud Barabe. (2007). In vitro asymbiotic germination, protocorm development and plantlet acclimation of Aplectrum hyemale (Muhl Ex Willd.) Torr. (Orchidaceae). The Journal of the Torrey botanical society. Volume 134(3):344-348.

Liggio, J., and A.O. Liggio. 1999. Wild orchids of Texas. The University of Texas Press, Austin, Texas.

Liu, H., Feng, C.L., Luo, Y.B., Chen, B.S., Wang, Z.S., and H.Y. Gu. 2010. Potential challenges of climate change to orchid conservation in a wild orchid hotspot in southwestern China. The botanical review, 76(2):174-192.

Lo, S.F., Nalawade, S.M., Kuo, C.L., Chen, C.L., and H.S. Tsey. 2004. Asymbiotic germination of immature seeds, plantlet development and ex situ establishment of plants of Dendrobium tosaense Makino: a medically important orchid. In vitro cellular & developmental biology. Plant, 40(5):528-535.

McCormick, M.K., and H. Jacquemyn. 2013. What constrains the distribution of orchid populations? New phytologist, 202(2):392-400.

Mckendrick, S. 2000. In vitro germination of orchids: a manual, Ceiba. Foundation for Tropical Conservation.

Martin, K.P. 2003. Clonal propagation, encapsulation and reintroduction of Ipsea malabarica (Reichb. f.) J.D. Hook., an endangered orchid. In vitro Cellular and Developmental Biology-Plant, 39(3):322-326 .

Texas Tech University, Kirsten Poff, August 2016

Masuhara, G., and K. Katsuya. 1994. In situ and in vitro specificity between rhizoctonia spp. and spiranthes sinensis (Persoon) Ames. var. amoena (M. Bieberstein) Hara (Orchidaceae). New Phytologist, 127(4):711-718.

Nontachaiyiapoom, S., Sasirat, S., and L. Manoch. 2010. Isolation and identification of Rhizoctonia-like fungi from roots of three orchid genera, Paphiopedilum, Dendrobium, and Cymbidium, collected in Chiang Rai and Chiang Mai provinces in Thailand. Mycorrhiza, 20(7):459-471.

Nilsson, L.A. 1992. Orchid pollination biology. Trends in ecology and evolution, 7(8):255-259. Olivia, A.P, and J. Arditti. 1984. Seed germination of North American orchids. II. Native California and related species of Aplectrum, Cypripedium, and Spiranthes. Botanical gazette, 145(4):495-501.

Otero, J.T., Ackerman., J.D., and P. Bayman. 2002. Diversity and host specificity of endophytic Rhizoctonia-like fungi from tropical orchids. American Journal of Botany, 89(11):1852-1858.

Palma, M.A., Chen, Y.J., Hall, C., Bessler, D., and D. Leatham. 2010. Consumer preferences for potted orchids in the Hawaiian market. Horttechnology, 20(1):239- 244.

Pandey, M., Sharma, J., Taylor, D., and V. Yadon. 2013. A narrowly endemic photosynthetic orchid is non-specific in its mycorrhizal associations. Molecular Ecology, 22(8):2341-2354.

Pijl, L.V.D., and C.H. Dodson. 1966. Introduction-the orchid flower, Chapter 1 in Orchid flowers their pollination and evolution. University of Miami Press, Coral Gables, Florida.

Preece, J.E. and E.G. Sutter. Acclimatization of micropropagated plants to the greenhouse and field, Chapter 1 in Micropropagation. Debergh P. and Zimmerman R.H. (Eds.). Kluwer, Dordrecht, The Netherlands, pp. 71-93.

Rasmussen, H.N., Anderson, T.F., and B. Johansen. 1990. Temperature sensitivity of in vitro germination and seedling development of Dactylorhiza majalis (Orchidaceae) with and without a mycorrhizal fungus. Plant, cell and environment. Volume 13, pp. 171-177.

Rasmussen, H.N. 1992. Seed dormancy pattern in Epipactis palustris (Orchidaceae): requirements for germination and establishment of mycorrhiza. Physiologia plantarum. Volume 86(1), pp. 161-167.

Texas Tech University, Kirsten Poff, August 2016

Rasmussen, H.N. 1995. Terrestrial orchids: from seed to mycotrophic plant. Cambridge University Press, Cambridge, England.

Rasmussen, H.N. 1993. Seed ecology of dust seeds in situ: a new study technique and its application in terrestrial orchids. American Journal of Botany, 80(12):1374-1378.

Richards, M. and J. Sharma. 2014. Review of Conservation Efforts for Platanthera chapmanii in Texas and Georgia. The Native Orchid Conference Journal, 11(1)1- 11.

Roberts, D.L., K.W., Dixon. 2008. Orchids. Current biology, 18(22):R325-R329.

Robertson, J.L., and R. Wyatt. 1990. Evidence for pollination ecotypes in the yellow- fringed orchid, Platanthera ciliaris. Evolution, 44(1):121-133.

Roche, S.A., Carter, R.J., Peakall, R., Smith, L.M., Whitehead, M.R., and C.C. Linde. 2010. A narrow group of monophyletic Tulasnella (Tulasnellaceae) symbiont lineages are associated with multiple species of Chiloglottis (Orchidaceae): Implications for orchid diversity. American Journal of Botany, 97(8):1313-1327.

Rochefort, L. 2000. Sphagnum- a keystone genus in habitat restoration. The Bryologist, 103(3):503-508.

Schoch, C.L., Seifert, K.A., Huhndorf, S., Robert, V., Spouge, J.L., Levesque, C.A., Chen W. and Fungal Barcoding consortium. 2012. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for fungi. Proceedings from the National Academy of Sciences of the United States of America, 109(16):6241-6246.

Schubler, A., Schwarzott, D., and W. Christopher. 2001. A new fungal phylum, the glomeromycota: phylogeny and evolution. Mycological Research, 105(12):1413- 1221.

Sharma, J., Zettler, L.W., Van Sambeek, J.W., Ellersieck, M.R., and C.J. Starbuck. 2003a. Symbiotic seed germination and mycorrhizae of federally threatened Platanthera praeclara (Orchidaceae). American Midland Naturalist, 149(1):104-120.

Sharma, J., Zettler, L.W., and J.W. Van Sambeek. 2003b. A survey of mycobionts of the federally threatened Platanthera praeclara (Orchidaceae). Symbiosis, 34:145-155.

Shefferson, R.P., WEIß, M., Kull, T. and D.L. Taylor. 2005. High specificity generally characterizes mycorrhizal association in rare lady's slipper orchids, genus Cypripedium. Molecular Ecology, 14(2):613-626.

Texas Tech University, Kirsten Poff, August 2016

Sieg, C.H., and R.M. King. 1995. Influence of environmental factors and preliminary demographic analyses of a threatened orchid, Platanthera praeclara. American Midland Naturalist, 134(2):307-323.

Silvertown, J., Wells, D.A., Gillman, M., Dodd, M.E., Robertson, H., and K.H. Lakhani. 1994. Short term and long term effects of fertilizer application on the flowering population of the green-winged orchid Orchis morio. Biological Conservation, 69:191-197.

Singer, R. B., Gravendeel, B., Cross, H., and S.R. Ramirez. 2008. The use of orchid pollinia or pollinaria for taxonomic identification. Selbyana, 29(1):6-19.

Sperduto, M.B., Congalton, R.G. 1996. Predicting rare orchid (small whorled pogonia) habitat using GIS. Photogrammetric Engineering & Remote Sensing, 64(11):1269- 1279

Smal,l J. K. 1903. Flora of the Southeastern United States. Small J.K., New York, New York.

Smith, S.E. and D.J. Read. 2008. Mycorrhizal symbiosis, 2nd ed. Academic Press, San Diego, California

Smith, G.R., Snow, G.E. 1976. Pollination ecology of Platanthera (habenaria) ciliaris and P. blephariglottis (orchidaceae). Botanical Gazette, 37(2):133-140.

Stewart, S.L. and M.E. Kane. 2006. Asymbiotic seed germination and in vitro seedling development of Habenaria macroceratitis (Orchidaceae) a rare Florida terrestrial orchid. Plant Cell Tissue Organ Culture, 86:147-158.

Stewart, S.L., Zettler, L.W., Minso, J., and P.M. Brown. 2003. Symbiotic germination and reintroduction of Spiranthes brevilabris Lindley, an endangered orchid native to Florida. Selbyana, 24(1):64-70.

Swarts, N.D., Batty, A.L., Hopper, S., and K.W. Dixon. 2007. Does integrated conservation of terrestrial orchids work? Lankesteriana, 7(2-1):219-222.

Swarts, N.D., and K.W. Dixon. 2009. Terrestrial orchid conservation in the age of extinction. Annals of Botany, 104(3):543-556.

Taylor, D.L., and M.K. McCormick. (2008). Internal transcribed spacer primers and sequences for improved characterization of basidiomycetous orchid fungi. New Phytologist, 177:1020-1033.

Texas Tech University, Kirsten Poff, August 2016

Tendersoo, L., May, T.W., and M.E. Smith. 2010. Ectomycorrhizal lifestyle in fungi: global diversity, distribution, and evolution of phytogenetic lineages. Mycorrhiza, 20(4):217-263.

Tendersoo, L., Nilsson, R.H., Abarenkov, K., Jairus, T., Sadam, A., Saar, I., Bahram, M., Becham, E., Chuyong, G., and U. Koljag. 2010. 454-pyrosequencing and Sanger sequencing of tropical mycorrhizal fungi provide similar results but reveal substantial methodological biases. New phytologist, 188(1):291-301.

Tovar, P.A. 2015. Spatial and temporal variation in mycorrhizal associations in a rare North American orchid. Texas Tech University, Master’s thesis.

Wolken, P.M., Sieg, C.H., and S.E. Williams. 2001. Quantifying suitable habitat of the threatened western prairie fringed orchid. Journal of Range Management, 54(5):611-616.

Wunderlin, R.P., and B.F. Hansen. 2008. Atlas of Florida vascular plants. Institute for systematic botany, university of south Florida, Tampa. Webpage accessed October 2015 at http://florida.plantatlas.usf.edu/

Vujanovic, V., St. Arnaud, M., Barabe, D., and G. Thibeault. 2000. Viability testing of orchid seed and promotion of colouration and germination. Annals of Botany, 86:76-86.

World checklist of selected plant families. 2015. World checklist of selected plant families. Facilitated by the Royal Botanic Gardens, Kew. Published on the Internet; http://apps.kew.org/wcsp/ Retrieved May 21, 2015.

Zeng, S., Wu, K., Teixeira da Silva, J.A., Zhang, J., Chen, Z., Xia, N., and J. Duan. 2012. Asymbiotic seed germination, seedling development and reintroduction of Paphiopedilum wardii Sumerh., an endangered terrestrial orchid. Scientia Horticulturae, 138(1):198-209.

Zettler, L.W. 1994. Light enhancement of symbiotic seed germination and development of anendangered terrestrial orchid (Platanthera integrilabia). Plant science, 102(2):133-138.

Zettler, L.W., and C.J. Hofer. 1998. Propagation of the little club-spur orchid (Platanthera clavellata) by symbiotic seed germination and its ecological implications. Environmental and Experimental Botany, 39(1):189-195.

Zettler, L.W., Stewart, S. L., Bowles, M. L., and K.A. Jacobs. 2001. Cold assisted symbiotic germination of the federally threatened orchid, Platanthera leucophaea (Nuttall) Lindley. American Midland Naturalist, 145:168-175.

Texas Tech University, Kirsten Poff, August 2016

Zettler, L.W., Sunley, J.A., and T.W. Delaney. 2000. Symbiotic seed germination of an orchid in decline (Platanthera integra) from the Green Swamp, North Carolina. Castanea, 65(3):207-212.

Zettler, L.W., and K.A. Piskin. 2011. Mycorrhizal fungi from protocorms, seedlings and mature plants of the eastern prairie fringed orchid, Platanthera leucophea (Nutt.) Lindley: a comprehensive list to augment conservation. The American Midland Naturalist, 166(1):29-39.

Zettler, L.W., Wood, E.M., Johnson, L.J.A.N., Kirk, A.K., and S.P. Perlman. 2011. Seed propagation and re-introduction of the U.S. federally endangered Hawaiian endemic, Platanthera holochila (HBD.) KRZL. (Orchidaceae). European Journal of Environmental Sciences, 1(2):80-94.

Zhu, G.S., Yu, Z.N., Gui, Y., and Z.Y. Liu. 2008. A novel technique for isolating orchid mycorrhizal fungi. Fungal Diversity, 33:123-137.

Texas Tech University, Kirsten Poff, August 2016

Figure 1.1. A photograph of Mesic to wet pine habitat of Platanthera chapmanii at Watson Native Plant Preserve, Tyler County, Texas (2014).

Figure 1.2. A photograph of Platanthera chapmanii during anthesis at Watson Native Plant Preserve, Tyler County, Texas. Photograph by Jyotsna Sharma (2013).

Texas Tech University, Kirsten Poff, August 2016

Figure 1.3. A map of the southeast United States showing the geographic range of Platanthera chapmanii. Areas within Texas, Florida, and Georgia where the species occurs naturally are shaded in blue.

100 µm.

Figure 1.4. A photograph of a cross section of Platanthera chapmanii root tissue showing coils of hyphae, pelotons, within the root cells documented in November 2014.

Texas Tech University, Kirsten Poff, August 2016

CHAPTER II

COLD-MOIST STRATIFICATION IMPROVES GERMINATION IN A TEMPERATE TERRESTRIAL NORTH AMERICAN ORCHID

Abstract

Seed dormancy is a common evolutionary adaptation in temperate plant taxa.

Dormancy mechanisms can prevent seeds from germinating at inopportune times, such as a cold period. The influence of pre-germination stratification treatments on in vitro seed germination and seedling development in Platanthera chapmanii, a rare temperate terrestrial orchid native to the southeastern United States is reported. Seeds were subjected to either 0, 8, or 12 weeks of cold-moist stratification at 5°C. Mean seed viability was 89%. Nine months after plating, seeds exposed to 8 and 12 weeks of stratification resulted in higher germination (Stage 1; 32% and 35%, respectively) in comparison to 25% germination in non-stratified seeds. Once a protocorm developed a leaf primordium (i.e., reached Stage 2), development to Stage 3 (root development) was independent of the pre-germination treatments. Exposure to artificial lights for 3, 4, and 5 months resulted in 32%, 44%, and 63% of the Stage 2 seedlings developing into Stage 3 photosynthetic root-bearing seedlings. The results indicate that in vitro seed germination in this temperate terrestrial orchid can be improved by using cold-stratification. Further, leaf- and root-bearing seedlings can be obtained through the methods reported herein.

Key words: Asymbiotic germination, cold-moist stratification, seed dormancy, sterile culture, plant conservation, Orchidaceae.

Texas Tech University, Kirsten Poff, August 2016

Introduction

Seed dormancy is a consequence of evolutionary adaptation and an important survival mechanism in many plant species (McMahon et al. 2011). Dormancy prevents seed germination until adverse conditions abate because seedlings that develop in unfavorable environmental conditions may perish without reproducing. Types of dormancies exhibited across the plant kingdom vary by species and are a result of the specific adaptations of a species to its local climatic conditions. Typically, temperate species tend to manifest seed dormancy during cold periods. Within the temperate biomes, seeds of species native to colder latitudes may be adapted to longer dormancy periods compared to those that occur in the warmer temperate regions. Further, the mechanism of dormancy may be physical or physiological, and sometimes a complex combination of dormancies may occur in seeds in response to evolutionary pressures

(Baskin and Baskin 1998). For example, physical dormancy is a type of exogenous dormancy that requires scarification for water to pass through the impermeable layers of a seed coat (Baskin and Baskin 1998). Seeds with other dormancies, such as physiological or chemical dormancy, may be permeable to water but require a metabolic change to occur before germination (Baskin and Baskin 1998). Understanding the dormancy mechanisms in seeds has implications for plant reproductive ecology, biology, and propagation.

The microscopic dust-like seeds in the family Orchidaceae, the largest angiosperm family on earth with an estimated 25,000 to 30,000 species distributed across the planet, represent a variety of complex seed dormancy mechanisms (Johansen and 39

Texas Tech University, Kirsten Poff, August 2016

Rasmussen 1992, Rasmussen 1995, Lauzer et al. 2007). When used for in vitro propagation, orchid seeds can require pre-germination treatments to overcome physical and / or physiological dormancy (Johansen and Rasmussen 1992, Rasmussen 1995,

Zettler et al. 2001, Sharma et al. 2003, Lauzer et al. 2007). For example, seeds of

Platanthera praeclara Sheviak and M.L. Bowles, which is native to the midwestern U.S., germinated in vitro only after they were exposed to 4 or 6 month cold-moist stratification periods (Sharma et al. 2003). Seeds of Platanthera leucophaea (Nutt.) Lindl., a sister species, have also been documented to require at least 2 months of cold stratification to germinate (Stoutamire 1996). Another study on in vitro seed germination of P. leucophaea documented that non-stratified seeds showed ≤ 5% germination, whereas 8 week and 16 week stratification increased germination to <20% and >30%, respectively

(Bowles et al. 2002). Conversely, seeds of Platanthera integra (Nutt.) A. Gray, a species native to the southeastern United States responded to scarification with an ethanol: 5.25% sodium hypochlorite (NaOCl) (Clorox): deionized water (1:1:1,v:v:v) solution.

Germination percentage and protocorm development increased to 14.5% and 27.2% in seeds scarified for 1 or 2 hours respectively, in comparison to 1.6% and 6% with shorter

(1 min or 30 min, respectively) scarification treatments (Zettler et al. 2000). Given that P. integra is native to acidic bog habitats in warmer temperate zones, its seeds may have developed a physical dormancy mechanism instead.

Considering that the family Orchidaceae exemplifies evolutionary advances in angiosperms and that a majority of orchid taxa are rare, and routinely require specialized in vitro propagation techniques (Dressler 1981), knowledge of species-specific

Texas Tech University, Kirsten Poff, August 2016 propagation protocols is necessary to produce propagules for both research and conservation. However, empirically developed propagation protocols exist for relatively few species. This lack of knowledge is especially evident in the temperate terrestrial orchid taxa native to North America, perhaps because of a perceived lack of their commercial value. At the same time, conservation threats (i.e. changes in land use) to rare plants are increasing globally (Swarts and Dixon 2009). In fact, little is known about the biology and ecology of most orchid species. Platanthera chapmanii (Small) Luer, a rare species native to the southeastern United States, faces similar knowledge gaps. This severely understudied taxon has a geographic range limited to northern Florida, southeast

Georgia, and southeast Texas (Poole et al. 2007). Because of conversion from native longleaf pine (Pinus palustris Mill.) to industrial pine forest and urban development, the quality of habitat in which P. chapmanii naturally occurs continues to decline (Gilliam and Platt 2006). Populations of P. chapmanii are often small with ≤10 individuals, and the only large population with ≥100 flowering individuals occurs in southeast Texas

(Richards and Sharma 2014). Anthesis time for P. chapmanii is between late July and early August when individual plants produce single inflorescences with ≥60 orange flowers (Liggio and Liggio 1999). The taxon is assumed to be an obligate outcrossing or facultative outcrossing species, as is the case with most species of Platanthera (Argue

2012). According to a multi-species study conducted on the coastal plain of Florida and

Alabama, P. chapmanii has been documented to be pollinated by several species of long- tongued butterflies including Phoebis sennae (Linnaeus), Papilio troilus (Linnaeus),

Papilio palamedes (Drury), and Papilio marcellus (Cramer) (Argue 2012). In southeast

Texas Tech University, Kirsten Poff, August 2016

Texas, Papilio palamedes has been documented carrying P. chapmanii pollinia (J.

Sharma, pers. obs.). If pollination and fertilization is successful, each flower can potentially produce a capsule containing thousands of dust-like seeds. Capsule dehiscence typically occurs in October, and subsequently seeds are presumed to experience cold and moist conditions during the winter before environmental conditions change to facilitate germination and seedling development. Information on reproductive biology and natural recruitment is not available for this taxon. However, a preliminary study reported in vitro propagation, culture, and outplanting of laboratory raised plants into the wild for population augmentation (Richards and Sharma 2014). Experimental data on germination and development however do not exist.

The objective of this study was to quantify the influence of cold stratification on in vitro seed germination and plant development in a North American terrestrial temperate orchid, P. chapmanii. Considering that the seeds of P. chapmanii are exposed to average minima as low as -9°C at 32°N and -7°C at 29°N (USDA 2016), it was hypothesized that non-stratified seeds of P. chapmanii will exhibit a lower germination percentage in comparison to cold stratified seeds. Further, it was expected that seeds stratified for 8 weeks at 5°C will yield similar germination and plant development as those stratified for 12 weeks at 5°C; this expectation was based on the relatively short

(~10-40 days below 0°C) cold period the species experiences across its natural distribution (NOAA 2016).

Texas Tech University, Kirsten Poff, August 2016

Materials and methods

Seed stratification

Seeds were collected from multiple capsules in October 2014 from haphazardly selected individuals of P. chapmanii at a population in southeast Texas. A maximum of one seed capsule was collected from each selected plant. Capsules were placed on a filter paper at room temperature at approximately 40% RH to allow them to desiccate further and dehisce. Seeds were then collected and placed in a 1.5ml glass vial. The vial containing the seeds was stored over silica gel desiccant at -20°C until further use.

Seeds were prepared for the 8 and 12 week cold-moist stratification treatments by first surface sterilizing them with a 0.6% NaOCl solution for 3 min. Seeds were then rinsed in sterile ultrapure water and approximately equal portions were placed in each of two 2ml safe-lock microcentrifuge tubes (Eppendorf, Hamburg, Germany) containing approximately 1-1.5ml sterile ultrapure water. The vials were inverted several times, wrapped in aluminum foil, and stored at 5°C for their respective stratification periods.

The timing of initiating the stratification treatments was staggered (8 and 12) to allow for the seeds in all three treatments to be plated at one time.

Once the stratification treatments had been applied, the seeds from both 8 and 12 week treatments were again surface sterilized by submerging in a 0.6% NaOCl solution for an additional 6 min prior to plating on sterile nutrient medium. At this time, the seeds in the 0 week cold-moist stratification treatment were surface sterilized by submerging in a 0.6% solution of NaOCl for 12 min. The difference in total NaOCl exposure time from

9 min (8 and 12 week cold-moist stratification) to 12 min (0 week cold-moist 43

Texas Tech University, Kirsten Poff, August 2016 stratification) prior to plating of seeds was to ensure that the embryos softened by cold- moist stratification were not damaged during the second surface sterilization procedure.

Seed plating and germination assessment

After the seeds were subjected to their respective pre-germination treatments, they were plated onto sterile P723 medium (Phytotechnology Laboratories, Overland Park,

Kansas) contained in sterile single-use Stericon-4 237 ml polystyrene containers

(Phytotechnology Laboratories, Overland Park, Kansas) in February 2015.

Approximately 80 ml of medium was used per vessel and between 100 and 500 seeds were spread onto each vessel. Each of the three cold-moist stratification treatments was replicated 30 times with an experimental unit defined as one culture vessel. After the seeds were plated, a dissecting microscope was used to count and record the total number of seeds within each of the 90 vessels. At the same time, a count of viable seeds was performed. Within the 30 containers representing the 0 week stratification treatment, each seed was observed for presence of a healthy embryo (defined as a clear, hyaline, rounded embryo) to be categorized as a viable seed (Figure 2.1). However, water imbibition instead was used as a measure of viability for seeds in the remaining 60 plates which contained seeds that were cold-moist stratified for 8 or 12 weeks. A swollen embryo

(indicating imbibition) was counted as a viable embryo (Figure 2.2).

A visual assessment of germination and development was performed by inspecting all seeds in each experimental unit every 30 days. Germinating seeds and developing seedlings were categorized in one of the three categories, i.e., Stage 1, 2, or 3 (Figure 44

Texas Tech University, Kirsten Poff, August 2016

2.4). Stage 1 was defined as germination and the presence of one or more rhizoids; Stage

2 as the presence of a leaf primordium on the developing protocorm; and Stage 3 as the presence of at least one root.

Once a seed reached Stage 2, it was transferred to new containers with fresh P723 medium. Sterile Magenta GA-7 vessels (Sigma-Aldrich, St. Louis, Missouri), with approximately 50 ml of P723 medium were used for the transfer. The newly transferred protocorms were then placed on a culture rack and exposed to 40-watt white florescent light bulbs set at a photoperiod of 12 hours. The developing seedlings were subsequently examined every 30 days for further development (Figure 2.5. Nine months after the seed plating, young plants were individually examined for root development. After this, they were placed in autoclaved PTcon 947 ml culture vessels (Phytotechnology laboratories,

Overland Park, Kansas) with approximately 150-200 ml of autoclaved P723 medium for further development. The experimental data collection for this study was considered complete at this time.

Data analysis

A one-way Analysis of Variance (ANOVA) was performed with Stage 0, Stage 1,

Stage 2, and Stage 3 germination as the dependent variables and stratification treatment as the independent variable. The means were separated using Fisher’s Least Significant

Difference (LSD) test. To test whether each treatment received a similar number of seeds,

ANOVA was performed using the total number of seeds plated in each experimental unit.

Texas Tech University, Kirsten Poff, August 2016

A similar procedure was also used to test the differences in viability among the plated seeds.

Further, a two-way ANOVA was performed with stratification period and duration of exposure to light as the two independent variables and Stage 3 proportions as the dependent variable. Means were separated by using Fisher’s LSD test.

All statistical analyses were performed using RStudio 0.99.842 (RStudio Team

2015) using the agricolae package with α = 0.05.

Results

Seed germination

Among the approximate 22,348 individual seeds used across the three stratification treatments, mean viability was 89% (Table 2.1). Results from an ANOVA and Fisher’s LSD test showed that P. chapmanii seeds exposed to the 0 week stratification treatment had lower Stage 1 germination percentage than the 8 and 12 week cold-moist stratification treatments. When the total number of seeds sown was used as the denominator for calculating percent of seeds that reached Stage 1 germination, the 0 week stratification treatment had lowest germination (mean = 22.8%; p = 0.00), whereas the means were statistically similar for the 8 and 12 week treatments (28.7% and 30.7%, respectively) (Table 2.1). Similar results were observed when the number of viable seeds was used as the denominator to calculate germination percentages. In this case, mean germination in the 0 week cold-moist stratification treatment was 25.4% (p = 0.00),

Texas Tech University, Kirsten Poff, August 2016 whereas 32.4% and 35.1% germination among the 8 and 12 week treatments, respectively was observed. Finally, the highest percentage of un-germinated seeds was observed in the

0 week stratification treatment (77.3% of all plated seeds and 74.6% of viable seeds) while both 8 and 12 week stratification treatments had lower percentages of un- germinated seeds (Table 2.1).

Seedling development

When data for seedling development from Stage 2 to Stage 3 were analyzed using a two-way ANOVA including stratification and duration of exposure to light, there were no interactive effects or effect of stratification treatments on the means. However, an influence of duration of exposure to light on seedling development was observed.

Even though not significantly different (p = 0.27), the absolute means of Stage 3 seedlings ranged from 16.4% (12 week cold-moist stratification) to 22.1% (0 week cold- moist stratification across the three stratification treatments) (Table 2.2).

In response to exposure to light, seedlings that reached Stage 2 required at least 1 month of exposure to artificial lights to develop roots (i.e., to reach Stage 3; Figure 2.6,

Figure 2.7). As the duration of exposure to lights increased from 1 to 5 months, the mean percentage of Stage 3 seedlings increased significantly (Figure 2.6, Figure 2.7). While the means for 1 and 2 month exposure were similar, 32%, 44%, and 63% of Stage 2 seedlings reached Stage 3 after 3, 4, and 5 months, respectively (Figure 2.6, Figure 2.7).

Texas Tech University, Kirsten Poff, August 2016

Discussion

As in many plant species, seed dormancy in temperate terrestrial orchids is common (Johansen and Rasmussen 1992, Rasmussen 1995, Lauzer et al. 2007). The duration and type of seed dormancy, however, is often species- and climate- dependent.

Temperate terrestrial species sometimes require a cold-moist stratification period of at least 8 weeks to initiate germination (Rasmussen 1992, Sharma et al. 2003). Although

Richards and Sharma (2014) reported propagation of P. chapmanii from seed after ≥12 weeks of exposure to cold-moist stratification conditions, germination percentages were not quantified in their study; the resulting plants however, were reported to survive for >3 years. Further, the authors documented reproduction and survival of the artificially propagated plants both in cultivation in a greenhouse environment and in the native habitat of the species (Richards and Sharma 2014). In the present study, it is reported that cold-moist stratification improves asymbiotic in vitro germination among P. chapmanii seeds when compared to non-stratified seeds. An increase of approximately 10% was observed when seeds were stratified for either 8 or 12 weeks; however, differential influence of stratification on plant development past Stage 1 (germination and rhizoid development) was not observed. While lower than the mean germination obtained after treating seeds with stratification, up to 25.4% germination in non-stratified seeds was observed. Similarly, Zettler et al. (2000) reported a low (15%) germination in non- stratified P. integra seeds collected in North Carolina; however, seeds in their study were not plated on nutrient-rich asymbiotic medium. Cold-moist stratification treatments were not included in their study, hence it is not known whether P. integra, which is native to

Texas Tech University, Kirsten Poff, August 2016 similar habitats and climate as P. chapmanii, has similar pre-germination stratification requirements. Another congeneric species native to southeastern U.S., Platanthera clavellata (Michx.) Luer, however, yielded much higher (47%) germination in non- stratified seeds collected from Tennessee and South Carolina (Zettler and Hofer 1998).

Altogether, these two species have an overlapping distribution with P. chapmanii in southeast Texas and northern Florida, although, P. clavellata extends also to northern latitudes in Quebec and Ontario (USDA 2016). The germination percentage for non- stratified seeds reported in P. clavellata is higher than those observed both in P. chapmanii and P. integra. These data confirm that results from any individual species should not be broadly applied to even the congeners from similar habitats, and that species-specific studies are necessary to understand the nuances within each taxon. It is also clear that additional and alternative pre-germination treatments should be examined for P. chapmanii such as scarification or different light / dark periods. At the same time, it is possible that cold stratification may improve the germination among P. integra and

P. clavellata seeds. On the other hand, testing the efficacy of symbiotic fungi in improving germination in P. chapmanii could also be considered.

The similarity between the germination percentages obtained from 8 and 12 week stratification treatments in the study suggests that stratification periods longer than 8 weeks may not be necessary to improve germination. In fact, it is possible that a stratification period between 0 and 8 weeks could optimize germination in P. chapmanii.

In southeast Texas, where the seeds for this experiment were collected, the average minima for the coldest month (January) ranged from -2°C to 4°C between 2012 and

Texas Tech University, Kirsten Poff, August 2016

2016, whereas the average maxima ranged from 15°C to 21°C between 2012 and 2016

(NOAA 2016). Considering this, continuous cold-moist stratification at 5°C for 8 weeks might have been excessive. Whether a shorter stratification duration, or other pre- germination treatment combinations, would increase germination beyond 35.1%

(maximum observed in this study) remains to be empirically tested, however.

Additionally, because germination rates can vary among disjunct populations of the same species, germination studies with seeds from additional populations of P. chapmanii could help to further clarify differences in germination in relation to provenance.

Although the species has a wide range from east to west (81° W to 94° W), P. chapmanii populations are disjunct, small and occur north to south within a relatively narrow latitudinal zone between 29° N and 32° N (NOAA 2016). Seeds used in the current study were collected from a single population, though it is the largest documented population of the species and potentially the most genetically diverse. However, even this relatively large population may contain reduced genetic variation considering the long inter- population distances. In some plants, germination percentages correlate positively with genetic diversity and population size as in the perennial prairie species Silene regia Sims

(Menges 1991). Similarly, the North American species Ipomopsis aggregata (Pursh) V.E.

Grant exhibited reduced germination in seeds from populations with ≤100 individuals than seeds collected from larger populations (Heschel and Paige 1995). Conversely, a study on the perennial rock plant Draba aizoides Pall. Ex M. Bieb showed that populations with lower genetic variation exhibited high germination rates when compared to populations with higher genetic variation (Vogler and Reisch 2013). Combined with

Texas Tech University, Kirsten Poff, August 2016 population genetic diversity analyses, range-wide germination studies should be pursued to elucidate provenance differences and to assist with conservation of P. chapmanii.

The effect of climate change is reported to be more severe on rare plants with fragmented populations. According to a review by Walther et al. (2002), the vegetative growth and flowering in multiple plant species in Germany is occurring progressively earlier in the year since the 1960s. The capacity of orchid seeds from temperate regions to germinate in the absence of stratification, as documented in this and other studies, could be an increasingly useful evolutionary adaptation as the climate changes (Canadell and

Noble 2001). This strategy could allow natural recruitment and time for adaptation under milder climatic conditions.

Stratification treatments also may influence growth and development beyond germination in temperate orchid taxa. For example, seeds of P. praeclara stratified for 6 months and cultured symbiotically developed roots after 60 days of culture. In comparison, the 4 month stratification period did not yield root-bearing seedlings

(Sharma et al. 2003). Considering that plants developed to Stage 3 (root-bearing, photosynthetic seedlings) in the study consistently across the three stratification treatments, it is evident that plant development up to 9 months beyond germination

(Stage 1) is independent of the pre-germination stratification period in P. chapmanii.

While additional reproductive biology and recruitment studies must be conducted for P. chapmanii, the results provide an effective and efficient protocol for generating plants of the species for experimental and conservation applications.

Texas Tech University, Kirsten Poff, August 2016

Literature Cited

Argue, C.L. 2012. The pollination biology of North American orchids. Volume 1: Springer publishing, New York, New York.

Baskin, C.C., and J.M. Baskin. 1998. Seeds: ecology, biogeography, and evolution of dormancy and germination. Academic Press, New York, New York.

Bowles, M.L., Jacobs, K.A., Zettler, L.W., and T.W. Delaney. 2002. Crossing effects on seed viability and experimental germination of the federal threatened Platanthera leucophaea. Rhodora 104:14-30.

Canadell, J., and I. Noble. 2001. Challenges of a changing earth. Trends in Ecology and Evolution 16: 664–666.

Dressler, R.L. 1981. The orchids: natural history and classification. Harvard University Press, Cambridge, Massachusetts.

Gilliam, F.S., and W.J. Platt. 2006. Conservation and restoration of the Pinus palustris ecosystem. Applied Vegetation Science 9:7-10.

Heschel, M.S. and K.N. Paige. 1995. Inbreeding depression, environmental stress, and population size variation in scarlet gilia (Ipomopsis aggregata). Conservation Biology 9:126-133.

Johansen, B., and H. Rasmussen. 1992. Ex situ conservations of orchids. Opera Botanica 113:43–48.

Lauzer, D., Renaut, S., St-Arnaud, M., and D. Barabe. 2007. In vitro asymbiotic germination, protocorm development and plantlet acclimation of Aplectrum hyemale (Muhl Ex Willd.) Torr.(Orchidaceae). The Journal of the Torrey Botanical Society 134: 344-348.

Ligio, J., and A.O. Liggio. 1999. Wild orchids of Texas. The University of Texas Press, Austin, Texas.

McMahon, M.J., Kofranek, A.M., and V.E. Rubatzky. 2011. Plant science. Prentice Hall, Upper Saddle River, New Jersey.

Menges, E.S. 1991. Seed germination percentage increases with population size in a fragmented prairie species. Conservation Biology 5:158-164.

NOAA, NCEI. 2016. Monthly Summaries Map (https://gis.ncdc.noaa.gov/maps, 29 March 2016). NCEI GIS Agile Team, Asheville, NS 28801-5001 USA.

Texas Tech University, Kirsten Poff, August 2016

Poole, J. M., Carr, W. R., Price, D. M., and J.R. Singhurst. 2007. Rare plants of Texas. Texas A&M University Press, College Station, Texas.

Rasmussen, H.N. 1992. Seed dormancy pattern in Epipactis palustris (Orchidaceae): requirements for germination and establishment of mycorrhiza. Physiologia Plantarum, 86(1):161-167.

Rasmussen, H.N. 1995. Terrestrial orchids: from seed to mycotrophic plant. Cambridge University Press, Cambridge, England.

Richards, M. and J., Sharma. 2014. Review of Conservation Efforts for Platanthera chapmanii in Texas and Georgia. The Native Orchid Conference Journal 11:1-11.

RStudio Team. 2015. RStudio: Integrated development for R. RStudio, Inc., Boston, MA URL http://www.rstudio.com.

Sharma, J., Zettler, L.W., Van Sambeek, J.W., Ellersieck, M.R., and C.J. Starbuck. 2003. Symbiotic seed germination and mycorrhizae of federally threatened Platanthera praeclara (Orchidaceae). American Midland Naturalist 149:104-120.

Small, J. K. 1903. Flora of the Southeastern United States. Small J.K., New York, New York.

Stoutamire, W.P. 1996. Seeds and seedlings of Platanthera leucophaea (Orchidaceae). p. 55-61. In: C. Allen (ed.). Proceedings of the North American Native Terrestrial Orchid-Propagation and Production Conference. National Arboretum, Washington, D.C.

Swarts, N.D., and K.W. Dixon. 2009. Terrestrial orchid conservation in the age of extinction. Annals of botany 104:543-556.

USDA, NRCS. 2016. The PLANTS Database (http://plants.usda.gov, 29 March 2016). National Plant Data Team, Greensboro, NC 27401-4901 USA.

Vogler, F. and C. Reisch. 2013. Vital survivors: low genetic variation but high germination in glacial relict populations of the typical rock plant Draba aizoides. Biodiversity and Conservation 22:1301-1316.

Walther, G.R., Post, E., Convey, P., Menzel, A., Parmesan, C., Beebee, T.J., Fromentin, J.M., Hoegh-Guldberg, O. and F. Bairlein. 2002. Ecological responses to recent climate change. Nature 416:389-395.

Texas Tech University, Kirsten Poff, August 2016

Zettler, L.W. and C.J. Hofer. 1998. Propagation of the little club-spur orchid (Platanthera clavellata) by symbiotic seed germination and its ecological implications. Environmental and Experimental Botany 39:189-195.

Zettler L.W., Stewart S. L., Bowles M. L., Jacobs K. A. 2001. Cold assisted symbiotic germination of the federally threatened orchid, Platanthera leucophaea (Nuttall) Lindley. American Midland Naturalist 145:168-17

Zettler, L.W., Sunley, J.A., and T.W. Delaney. 2000. Symbiotic seed germination of an orchid in decline (Platanthera integra) from the Green Swamp, North Carolina. Castanea 65:207-212

Texas Tech University, Kirsten Poff, August 2016

Table 2.1. Effect of cold-moist stratification (0, 8, or 12 weeks) on seed germination was experimentally tested in Platanthera chapmanii. An Analysis of Variance (ANOVA) was conducted (a); Germination of seeds was categorized as Stage 0 (no further development), Stage 1 (germination; rhizoid development), or Stage 2 (leaf primordium development). Mean number of seeds that were plated in an experimental unit, mean number of viable seeds, and mean percent viability are presented. Mean germination percentages were calculated by using total number of seeds and number of viable seeds separately. Means followed by the same letter in each column were statistically similar based on Fisher’s Least Significant Difference (LSD) test.

2.1a.

y x Sum of Squares Mean Square f value p value

z strat_stage 0t 0.48 0.01 15.36 0.00 strat_stage 0v 0.59 0.01 17.82 0.00 strat_stage 1t 0.45 0.01 13.71 0.00 strat_stage 1v 0.56 0.01 16.21 0.00 strat_stage 2t 0.12 0.00 12.20 0.00 strat_stage 2v 0.15 0.00 11.46 0.00 Total seeds 839462 11499 0.91 0.34 Viable seeds 658411 9019 0.95 0.33 Viability 0.14 0.00 0.86 0.36

z’t’ = proportions calculated by using total number of seeds that were plated; ‘v’ = proportions calculated by using only the number of viable seeds yFactor level df = 1; residual df = 73 xα = 0.05

Texas Tech University, Kirsten Poff, August 2016

2.1b.

z y Stratification n total seeds viable seeds viability Stage 0t Stage 0v Stage 1t Stage 1v Stage 2t Stage 2v (# of weeks) (#) (#) (%) (%) (%) (%) (%) (%) (%)

0 26 282 251 89.5w ax 77.3 b 74.6 b 22.8 b 25.4 b 11.6 b 13.0 b 8 26 361 321 89.2 a 71.3 a 67.7 a 28.7 a 32.4 a 14.1 a 15.7 a 12 23 223 198 88.3 a 68.4 a 64.0 a 30.7 a 35.1 a 15.5 a 17.4 a p-value 0.34 0.33 0.36 0.00 0.00 0.00 0.00 0.00 0.00

z A single vessel containing multiple orchid seeds served as an experimental unit y’t’ = percentages calculated by using total number of seeds that were plated; ‘v’ = percentages calculated by using only the number of viable seeds x Proportions were converted to percentages for presentation in the tables w α = 0.0

Texas Tech University, Kirsten Poff, August 2016

Table 2.2. Effect of cold-moist stratification (0, 8, and 12 weeks) on seedling development after germination and rhizoid development (Stage 1) was experimentally tested in Platanthera chapmanii. An Analysis of Variance (ANOVA) was conducted (a); Seed development was categorized as Stage 2 (leaf primordium development) or Stage 3 (root development). Mean number of seedlings that were categorized as Stage 2 or Stage 3 after a 5 month exposure to 40-watt florescent bulbs set at a photoperiod of 12 hours. 2.2a

df Sum of Mean f value p valuex

Squaresy Square

zstrat_stage3 125 8.29 0.07 1.24 0.27

yFactor level df = 1; residual df = 125 xα = 0.05 2.2b

Stratification nz Stage 2 Stage 3 (# of weeks) (#) (%)

0 45 21 22.1 ay 8 46 34 16.5 a 12 36 28 16.5 a p-value 0.27 z A single vessel containing multiple orchid seeds served as an experimental unit yα = 0.05

Texas Tech University, Kirsten Poff, August 2016

Figure 2.1. Two photographs of Platanthera chapmanii seeds prior to cold-moist stratification at lower and higher magnification.

1 mm

Figure 2.2. Two photographs of Platanthera chapmanii seeds after cold-moist stratification showing imbibition at lower and higher magnification.

Texas Tech University, Kirsten Poff, August 2016

Stage 0 Stage 1 Stage 2 Stage 3

1 mm 2 mm 1 mm 1 cm

Figure 2.4. Seed germination and plant development in Platanthera chapmanii was recorded by using four categories: Stage 0 (no germination), Stage 1 (germination; rhizoid development), Stage 2 (leaf primordium development), and Stage 3 (root development).

Texas Tech University, Kirsten Poff, August 2016

1 cm

Figure 2.5. A photograph of Platanthera chapmanii seedlings at Stage 2 (leaf primordia development) after being exposed to light for approximately 3 weeks.

Texas Tech University, Kirsten Poff, August 2016

0.7 0.63 d 0.6

0.5 0.44 c

0.4 0.32 b 0.3

0.2 Proportion of Seedlings of Proportion

0.1 0.02 a 0 a 0 1 2 3 4 5 Time under lights (Months)

Figure 2.6. Proportion of Stage 2 seedlings of Platanthera chapmanii that reached the developmental Stage 3 after exposure to light. Duration of exposure to light (1 to 5 months under 40-watt white florescent bulbs) influenced plant development to Stage 3. Pre-germination stratification of seeds for 0, 8, or 12 weeks did not influence development from Stage 2 to Stage 3, thus the means were pooled across the three stratification treatments. Means followed by the same letter were statistically similar based on Fisher’s Least Significant Difference (LSD) test.

Texas Tech University, Kirsten Poff, August 2016

Month 1 Month 2 Month 3 Month 4 Month 5 0.7 0.64 d 0.63 d 0.62 d 0.6 0.53 c 0.5 0.46 b 0.46 c

0.4 0.35 c

0.3 0.27 b 0.21 b 0.2

Proportion Proportion seedlings of 0.1 0.03 a 0 a 0.02 a 0 a 0.02 a 0 a 0 0 8 12 Stratification treatment (# of weeks)

Figure 2.7. Proportion of Platanthera chapmanii Stage 2 seedlings that reached plant development Stage 3 when subjected to cold-moist stratification for 0, 8, or 12 weeks. Duration of exposure to light (1 to 5 months under 40-watt white florescent bulbs) influenced plant development to Stage 3. Means followed by the same letter in each column were statistically similar based on Fisher’s Least Significant Difference (LSD) test.

Texas Tech University, Kirsten Poff, August 2016

CHAPTER III

PLATANTHERA CHAPMANII: NUTRIENT SUPPLEMENTATION AND POPULATION AUGMENTATION

Abstract

There is lack of protocols describing greenhouse culture of temperate terrestrial orchid species along with the protocols of their field establishment. Platanthera chapmanii is a rare species of temperate terrestrial orchid native to the southeastern

United States. Its geographic range is restricted to fragmented populations in Georgia,

Florida and southeast Texas. The current preliminary study attempts to measure the effects of supplemental nutrients on plant height in P. chapmanii individuals being cultured in a greenhouse. In addition, it compares above-ground emergence during flowering season of in vitro / greenhouse cultured plants to naturally occurring individuals after being transplanted into native habitat in the fall and spring seasons.

Plants were first propagated in vitro and then planted in containers in a greenhouse setting. The plants were exposed to 0.00x, 0.25x, and 0.50x concentration of commercial solution of supplemental nutrients once every other week. After a period of 14 weeks, there was no difference between the three treatments in terms of plant height (p = 0.14).

When the preliminary data were collected in August 2015 for all the plants in the transplanting experiment, none of the plants, in any treatment were above ground. These data are a good basis for future studies on the culture and outplanting of temperate terrestrial orchid species. As anthropogenic changes in land-use continue, restoration

Texas Tech University, Kirsten Poff, August 2016 ecology is becoming an increasing important means for temperate terrestrial orchid conservation.

Introduction

With evidence of a serious extinction crisis mounting, the need to conserve biodiversity is growing (Canadell and Noble 2001, IUCN 2009). Up to 70% of plant species assessed by the International Union for the Conservation of Nature are threatened with extinction (IUCN 2015). Destruction and degradation of natural systems are largely responsible for this. According to Brooks et al. (2002) about 50% of the world's vascular flora is restricted to 25 regional hotspots. Of these hotspots, at least two-thirds have experienced anthropogenic changes in land-use causing the degradation and destruction of rare plant habitat (Brooks et al. 2002). With this in mind, it is unlikely that conservation of all plant species can be accomplished by reservation and preservation alone (Swarts and Dixon 2009).

Orchidaceae is the largest family of flowering plants with species estimates between 25,000-35,000 (Dressler 1981). Not only is it the largest, but also one of the most diverse and widespread (Dressler 1981, Swarts and Dixon 2009). Although the majority of orchid species are considered rare, the family is severely understudied

(Dressler 1981). Terrestrial species encompass one-third of orchid species and up to half of the total extinct species in the family (Swarts and Dixon 2009, IUCN 1999).

Temperate terrestrial orchids of North America are under continuing threat because of changes in land-use and conservation efforts that involve restoration of the North

Texas Tech University, Kirsten Poff, August 2016

American terrestrial orchid habitats are few. One aspect of restoration ecology, population augmentation, is a method that can be utilized to increase the size of rare plant populations directly (Batty et al. 2006, Decruse et al. 2013, Richards and Sharma 2014).

Propagation and culture protocol knowledge is necessary to produce propagules for restoration purposes.

Most of what is documented on orchid propagation and culture is developed for horticulturally or medically important genera (Griesbach 2002, Park et al. 2002, Lo et al.

2004). In such protocols, an acclimatization period is often used for orchid species propagated in vitro to ensure survival in the field (Hazarika 2003, Deb and Temjensangba

2006). This usually involves slowly transitioning orchid protocorms or seedlings from sterile culture conditions into a greenhouse, where the plants are cultured for some time before they become robust enough to be planted ex vitro (McKendrick 2000). It is common for some plants to die during the transition between sterile conditions and greenhouse setting because of a sharp change in abiotic factors (e.g. humidity and temperature) (Preece and Sutter 1991, Deb and Imchen 2010). Once the plant is in the greenhouse, depending on the species, an orchid seedling may require several weeks or months to acclimate to the new environmental conditions (McKendrick 2000, Deb and

Temjensangba 2006). Duration of acclimatization is implicated in the long-term survival of individual plants (Zeng et al. 2012).

Nutrient supplementation during greenhouse culture is documented for some horticultural epiphytic species but very rarely for terrestrial species (Wang and Gregg

1994, Wang 1996). The threatened terrestrial orchid Bletia purpurea, after being

Texas Tech University, Kirsten Poff, August 2016 transferred from aseptic conditions to a greenhouse setting, was successfully treated with

150 ppm N-P-K balanced liquid fertilizer (Peter’s 20-20-20, The Scott’s Company,

Marysville, OH). Whether supplementing with nutrients during greenhouse culture aided the growth of the individuals remains unstudied (Dutra et al. 2008). For some terrestrial species, conventional fertilizers may hinder growth, even when exposed to low concentrations. For example, significant decreases in flowering in populations of Orchis morio was measured after the naturally occurring plants were exposed to what were considered low concentrations of organic and inorganic fertilizers (22-88 kg ha-1 N)

(Silvertown et al. 1994).

Growing and culturing orchid species in vitro and subsequently transplanting them into native habitat has been reported as a successful approach for some temperate terrestrial species (Stewart et al. 2003, Zeng et al. 2012, Decruse et al. 2013, Richards and Sharma 2014). The species Paphiopedilum wardii was established successfully into native habitat after being cultured in vitro (Zeng et al. 2012). In the study by Zeng et al., plants grown from seed were first acclimatized, then used to augment a population in

Gaoligong Mountain in Yunnan. New populations of P. wardii were established in areas where no prior documentation was recorded in Yangchun and Guangdong (Zeng et al.

2012). Not only did the field established plants exhibit survival percentages ≥50, the populations persisted after two years (Zeng et al. 2012). The temperate terrestrial North

American species Spiranthes brevilabris has had similar success when transplanted into its native habitat after in vitro culture (Stewart et al. 2003). Of the 165 Spiranthes

Texas Tech University, Kirsten Poff, August 2016 brevilabris individuals transplanted, survival was 100% after a month in the field, although only 17 initiated anthesis after 6 months (Stewart et al. 2003).

Clonal propagation of certain members of Orchidaceae for the purpose of native population restoration is also possible (Martin 2003). The endangered Ipsea malabarica was documented with a high survival and flowering rate after being introduced into native habitat. In the 2003 study, all 50 individuals transplanted survived and initiated anthesis normally (Martin 2003). An advantage of clonal propagation is that a large number of individuals can be obtained relatively rapidly, this would otherwise take much longer if propagated by using seeds. However, the genetic diversity is highly compromised in clonal populations and is therefore often not used for ecological purposes (Collins and Dixon 1992, Martin 2003).

Platanthera chapmanii (Small 1903), a temperate terrestrial species that is relatively quick growing has had some success with field establishment (Richards and

Sharma 2014). The taxon is native to the southeastern United States, it’s geographic range is limited to highly fragmented populations in southern Georgia, northern Florida and southeastern Texas (Liggio and Liggio 1999). In 2012 and 2013, acclimatized two- year old plants of P. chapmanii were transplanted into an existing population. In August

2014, 76% (26 of 34) of the transplanted P. chapmanii were observed flowering

(Richards and Sharma 2014, J. Sharma pers. comm.). In vitro asymbiotic propagation and greenhouse culture may be an efficient way to augment native populations, and establish new populations of certain temperate terrestrial orchid species. Before field establishment can be attempted, it is thought that individuals should undergo greenhouse

Texas Tech University, Kirsten Poff, August 2016 acclimatization and culture so that they are robust enough to survive ex vitro. Whether or not supplementing terrestrial orchids with nutrients during greenhouse culture would be beneficial is not well reported.

The objective of this study was to quantify the effect of nutrient supplementation on P. chapmanii above ground plant height when cultured in a greenhouse setting. Also, to quantify the effect of greenhouse acclimatization, plant source, and planting date on plant emergence after outplanting P. chapmanii into native habitat. Commercial fertilizer may be detrimental to some species of terrestrial orchids. Platanthera chapmanii has been cultured in a greenhouse setting with the assistance of fertilizer and without (M.

Richards, pers. comm.). Effects of this nutrient supplementation have not been quantified.

Because of this knowledge, it was expected that plants treated with a very low concentration of fertilizer to benefit from the added nutrients and plants treated with higher concentrations to have detrimental effects. Considering the preliminary study by

Richards and Sharma (2014), fairly good survival percentage for both fall and spring plantings were expected. Because of what is known about acclimatization, the more robust greenhouse acclimatized individuals should have higher survival percentage than the individuals planted directly from aseptic culture. Further, naturally occurring P. chapmanii individuals that are relocated will most likely have a lower rate of plant emergence than those individuals that were raised and cultured in vitro because of how robust the greenhouse cultured plants are.

Texas Tech University, Kirsten Poff, August 2016

Materials and Methods

Nutrient supplementation

To test the effect of nutrient supplementation on growth of two-year old P. chapmanii plants, 64 in vitro grown individuals were used in this experiment.

Experimental treatments included: 1) biweekly application of 0.5x dilution of the recommended concentration of Scotts Miracle-Gro 24-8-16 (Scotts Company LLC.,

Marysville, Ohio), 2) biweekly application of 0.25x dilution of the same fertilizer as above, and 3) no supplemental nutrient solution. Twenty-one or 22 individuals were haphazardly assigned to each of the three experimental treatments.

Plants cultured under sterile conditions were used in this experiment. The vessels containing the plants were stored at 5°C from November 2014 to April 2015. At the time of transferring into greenhouse conditions, plants were removed from culture vessels and rinsed with reverse osmosis water to remove sterile culture medium. Plants were then planted directly into 15 centimeter wide plastic greenhouse containers filled with a soilless medium composed of 44% sphagnum peat moss (Premier Tech Horticulture Ltd,

Quebec, Canada), 26% milled sphagnum moss (Mosser Lee, Millston, Wisconsin), 20% all-purpose coarse grain builders sand (Quikrete, Atlanta, Georgia), and 10% small tree fern fiber (repotme, Georgetown, Delaware) v:v:v:v. The Containers were distributed across 12 trays that were 28 cm long, 56 cm wide and 6.3 cm deep with an approximately

2.5 cm deep layer of reverse osmosis water. Nutrient treatments described above were commenced after giving the plants about 3-4 weeks to acclimate to greenhouse conditions. Height of each plant was measured every 14th day for 14 weeks for the

Texas Tech University, Kirsten Poff, August 2016 duration of the experiment. Because the plants were placed in trays in groups of 5 or 6, each tray served as an experimental unit.

Population augmentation

Platanthera chapmanii seeds collected in 2009 from a large population in southeast

Texas were germinated and propagated in sterile conditions by Atlanta Botanical Garden.

After sterile germination and propagation, the plants were cultured in a greenhouse until they were excavated and shipped to Texas Tech University. The plants were stored at 5°C from November 2014 until their planting. Platanthera chapmanii were stored with sphagnum moss and kept moist with deionized water to prevent drying until they were used for experimental purposes. In November 2014 the fall transplanting experiment was initiated. Twelve of the in vitro propagated plants and twelve naturally occurring individuals of P. chapmanii from a population in southeast Texas were used for transplanting into an experimental location in Big Thicket National Preserve (BTNP).

Approximately 8 kg of soil were collected from the immediate vicinity of the plants collected to serve as inoculum at the recipient site at BTNP. It was ensured that soil was excavated without disturbing or destroying any non-target plants of P. chapmanii. All experimental activities were conducted under valid permits obtained from the state of

Texas.

At BTNP, two experimental plots were established. The locations of these plots were determined after examining the area for suitable habitat. Six from each source (in vitro raised or those excavated from the naturally occurring population) were planted into each

Texas Tech University, Kirsten Poff, August 2016 of the two experimental plots. To plant an individual, a mixture of sphagnum peat moss

(Scott’s Miracle-Gro company, Marysville, OH) and natural soil was used in about a 1:1

(v:v). The sphagnum moss that the lab-raised plants were shipped from ABG in, and the

8 kg of soil from the native population was also distributed across the 24 plants. In vitro raised plants were labeled with a single metal tag engraved G1 through G12, while the native plants were labeled N1 through N12.

The experimental plots for spring 2015 were established in mid-March. These experimental plots were located in close proximity to the fall 2014 plots. The same protocol as above was followed for the two spring 2015 plots. The metal label codes were modified to GS1 through GS12, and NS1 through NS12 to denote greenhouse spring and native spring respectively.

Three more plots were made in the spring of 2015 for one hundred P. chapmanii individuals that were planted directly from sterile culture into native soil. The location of each plot was chosen by looking for areas with little shade and soil that was saturated with water. The plots were constructed by digging holes approximately 15 cm apart. Individuals were planted by mixing sphagnum peat moss and natural soil in each hole in a ratio of about

1:1, v:v. The soil was packed lightly around each seedling and a thin layer of sphagnum was placed on top of each seedling. Each plot was watered thoroughly. Planting for all three plots was performed in March 2015.

The first plot included 34 seedlings. This plot was located in southeast Texas close to

Big Thicket National Preserve. This specific area was chosen because it is known to be able to support P. chapmanii. It is the same area in which the native adult individuals of

P. chapmanii were relocated from. 71

Texas Tech University, Kirsten Poff, August 2016

The second plot included 35 plants and was planted in close proximity to the fall and spring greenhouse acclimated/native relocated plots. This area was chosen because it is known to support P. chapmanii, had relatively little shade and the soil was water- saturated.

The third plot included 31 seedlings and was planted inside BTNP at an area along the Pitcher Plant Bog Trail. The area was chosen in a similar fashion as the previous plant plots, but there are no P. chapmanii individuals that are known to occur at this specific location.

In early August 2015 presence or absence and flowering or vegetative data were collected from all 7 plots for analysis. All metal labels were located and the emergence or non-emergence of each plant was recorded.

Results

Nutrient supplementation

When change in P. chapmanii above ground plant height was evaluated, according to an analysis of variance (ANOVA) there was no significant difference between the three treatments after a duration of 14 weeks (p = 0.14, Table 3.1). The changes in plant height averages ranged from 1.7 cm in the zero nutrient treatment to 4.8 cm in the 0.5x nutrient treatment but variation in the data was too high for the differences to be significant.

Texas Tech University, Kirsten Poff, August 2016

Population augmentation

When above ground emergence was compared across the treatments during data collection in August, zero plants were above ground. When the native and lab raised plants were compared over the two planting dates using a Fisher’s Exact Test, there was no significant differences in above ground emergence for the groups (p = 1).

Discussion

Rare plant habitat is being degraded globally (Brooks et al. 2002). With the disappearance of habitat restoration ecology is becoming increasingly more important for species conservation (Swarts and Dixon 2009). Developing protocols for the propagation and culture of plants in vitro is critical to produce propagules for restoration measures.

The ability for researchers to propagate and culture rare plants in vitro for field establishment is a proven way to directly increase the population numbers of some rare species (Batty et al. 2006, Decruse et al. 2013, Richards and Sharma 2014). Because protocols exist for a relatively small number of rare plants, and an even smaller number of temperate terrestrial orchid species, the current study is relevant for restoration ecologists and conservation enthusiasts.

The asymbiotic germination and propagation of P. chapmanii has been previously documented (Richards and Sharma 2014). The current study is helpful for elaborating on greenhouse culture conditions favored by the study species. Commercial fertilizer used in this experiment was diluted to 0.5x and 0.25x concentrations. Because it is not documented whether fertilizer has a positive effect on P. chapmanii growth, extracaution

Texas Tech University, Kirsten Poff, August 2016 was taken with protocol development. The rare plant is known to grow without nutrient supplementation. A diluted solution of fertilizer was used for the treatments since the study was preliminary. Because of a lack of documentation on greenhouse culture of temperate terrestrial orchids native to North America, acclimatization procedures were not available to us. Individuals were planted directly from aseptic culture vessels into orchid bog mix. By the end of the experiment, many of the plants, regardless of treatment, had tip necrosis. Perhaps the decrease in humidity and increase in temperature from the culture vessels to the green house had an adverse effect. In addition, the trays used during the experiment were not optimal. The 56 by 28 by 6.3 cm trays used to increase humidity and soil water saturation made the experiment more self-sufficient.

Because the trays were fairly large they only needed to be refilled with water every other to every two days depending on weather. However, because more plants were placed in each of these large trays, this decreased the amount of true replicates in the experiment drastically from 64 to 12. The current preliminary study was more focused on the successful culture and growth of P. chapmanii plants in a greenhouse setting then forcing a treatment effect on the rare species. For future studies, it is recommended that plants be acclimatized more slowly into greenhouse conditions then placed in individual trays. This may be helpful if environmental conditions (e.g. temperature, light intensity and humidity) are especially different than in vitro germination and propagation conditions.

The greenhouse culture of these rare plants is critical so that by the time they are transplanted to the field, they are robust enough to survive natural conditions.

Texas Tech University, Kirsten Poff, August 2016

Platanthera chapmanii individuals used in these experiments all originated from seeds collected at the largest known population of the species in southeast Texas. Being the largest population, it is most likely the most genetically diverse. In addition, there may be an overabundance of necessary mycorrhizal fungi at this location. Although, these are speculations as no soil microbial or genetic analyses have been performed. In the study by Richards and Sharma (2014) P. chapmanii individuals germinated and propagated asymbiotically and cultured in a greenhouse setting were successfully introduced into the largest population in southeast Texas. During the current study, an attempt to augment another population was made, as well as augmenting this large population. The population that was attempted to augment with robust, greenhouse acclimatized plants had only one naturally occurring individual. Although most documented populations of P. chapmanii across its range have ≤10 individuals, only one documented individual would be considered a small population. In the current study, the majority of adult plants transplanted in the fall of 2014 had emerged in March 2015, including the naturally occurring individual. In August there were no above ground growth from any of the plots. The naturally occurring individual was also not above ground. Data collected in August 2016 may be helpful in determining whether or not the plants in the experiment survived. Although, some species of terrestrial orchids have been recorded as remaining dormant for multiple years (Rasmussen 1995).

Of the individuals that were planted directly into native soil from in vitro conditions, none were above ground at any of the three plot areas. Even the plot that was meant to augment the largest population of individuals did not have any above ground

Texas Tech University, Kirsten Poff, August 2016 growth during the August data collection. These plants may be in a dormant state, or the direct transition from sterile conditions to native soil may have been too big of a shock.

Additionally, the soil may have been lacking compatible mycorrhizae which the mixotrophic species may require to become established (Rasmussen 1995). Platanthera chapmanii is a rare species whose habitat is in decline (Gilliam and Platt 2006). Results from these preliminary studies should be used to help develop protocols for the propagation of P. chapmanii and similar species of temperate terrestrial orchid, for conservation efforts.

Texas Tech University, Kirsten Poff, August 2016

Literature Cited

Brooks, T.M., Mittermeier, R.A., Mittermeier, C.G., Gustavo, A.B.D.F., Rylands, A.B., Konstant, W.R., Flick, P., Pilgrim, J., Oldfield, S., Magin G., and C. Hilton- Taylor. 2002. Habitat loss and extinction in the hotspots of biodiversity. Conservation Biology, 16: 909–923.

Canadell, J, and I. Noble. 2001. Challenges of a changing earth. Trends in Ecology and Evolution, 16: 664–666.

Dressler, R.L. 1981. The orchids: natural history and classification. Harvard University Press, Cambridge, Massachusetts and London, England.

Dutra, D., Johnson, T.R., Kauth, P.J., Stewart, S.L., Kane, M.E. and L. Richardson. 2008. Asymbiotic seed germination, in vitro seedling development, and greenhouse acclimatization of the threatened terrestrial orchid Bletia purpurea. Plant Cell, Tissue and Organ Culture, 94(1):11-21.

Gilliam, F.S., Platt, W.J. 2006. Conservation and restoration of the Pinus palustris ecosystem. Applied Vegetation Science, 9:7-10.

Griesbach, R.J. 2002. Development of Phalaenopsis Orchids for the Mass-Market. p. 458–465. In: J. Janick and A. Whipkey (eds.), Trends in new crops and new uses. ASHS Press, Alexandria, VA.

IUCN. 1999. IUCN guidelines for the prevention of biodiversity loss due to biological invasion. Species, 31–32: 28–42.

IUCN. 2009. Extinction crisis continues apace. International News Release. http://www.iucn.org/?4143/Extinction-crisis-continues-apace

Liggio, J., and A.O. Liggio. 1999. Wild orchids of Texas. The University of Texas Press, Austin, Texas.

Lo, S.F., Nalawade, S.M., Kuo, C.L., Chen, C.L. and H.S. Tsay. 2004. Asymbiotic germination of immature seeds, plantlet development and ex vitro establishment of plants of Dendrobium tosaense makino—A medicinally important orchid. In Vitro Cellular & Developmental Biology-Plant, 40(5):528-535.

Park, S.Y., Murthy, H.N. and K.Y. Paek. 2002. Rapid propagation of Phalaenopsis from floral stalk-derived leaves. In Vitro Cellular & Developmental Biology- Plant, 38(2):168-172.

Texas Tech University, Kirsten Poff, August 2016

Small, J. K. 1903. Flora of the Southeastern United States. Small J.K., New York, New York.

Swarts, N.D., and K.W. Dixon. 2009. Terrestrial orchid conservation in the age of extinction. Annals of Botany, 104(3):543-556.

Wang, Y.T., and L.L. Gregg. 1994. Medium and fertilizer affect the performance of Phalaenopsis orchids during two flowering cycles. HortScience, 29(4):269-271.

Wang, Y.T. 1996. Effects of six fertilizers on vegetative growth and flowering of Phalaenopsis orchids. Scientia Horticulturae, 65(2):191-197.

Texas Tech University, Kirsten Poff, August 2016

Table 3.1. Effect of nutrient supplementation (0.0x, 0.25x, 0.5x) on Platanthera chapmanii above ground plant height after 14 weeks of treatment applied every two weeks. Results of an Analysis of Variance (ANOVA) are presented.

ANOVA df Sum of Squaresy Mean Square f value p valuex

NutriSup_PlantHeight 9 39.57 10.78 2.46 0.14

Texas Tech University, Kirsten Poff, August 2016

Figure 3.1. Three photographs of Platanthera chapmanii individuals after planting in 15 cm containers during nutrient supplementation. From left to right; one individual, one replicate, row of trays.

Figure 3.2. A photograph of a typical Platanthera chapmanii individual after being planted into greenhouse medium.

Texas Tech University, Kirsten Poff, August 2016

a b

1 cm

Figure 3.3. Two photographs of Platanthera chapmanii individuals. A greenhouse cultured Platanthera chapmanii individual (a) shown beside a naturally occurring Platanthera chapmanii individual (b) before planting in native habitat in southeast Texas during fall 2014.

Figure 3.4. A photograph of a fall 2014 Platanthera chapmanii plot with both greenhouse cultured and native plants relocatedin southeast Texas. An arrow is pointing to one individual.

Texas Tech University, Kirsten Poff, August 2016

Figure 3.5. A photograph of a typical Platanthera chapmanii individual taken directly out of a culture vessel prior to planting in one of the three locations in southeast Texas in the spring 2015.

Figure 3.6. A photograph of one of the three plots of Platanthera chapmanii individuals taken directly out of sterile culture and planted in the spring 2015. All individuals were covered with sphagnum peat moss.

Texas Tech University, Kirsten Poff, August 2016

CHAPTER IV

DIVERSITY OF MYCORRHIZAE FORMING TULASNELLACEAE IN A TEMPERATE TERRESTRIAL ORCHID IN EX SITU AND IN SITU ENVIRONMENTS

Abstract

Variation in mycorrhizal fungal diversity and specificity within the Orchidaceae is of special interest considering the intimate involvement of orchid associated fungi in germination and development of individuals. Generally, only a few plants from a few populations are sampled once to document orchid mycorrhizal fungi without explaining temporal and spatial variation in the associations. Further, use of mycorrhizal fungi is recommended for propagating orchid plants for conservation activities, however the availability and diversity of orchid mycorrhizal fungi in ex situ growing environments is not documented. The first comparison of mycorrhizal associations of plants of a temperate terrestrial orchid from in situ and ex situ environments is reported. The fungal nuclear ribosomal internal transcribed spacer (nrITS) region was amplified and sequenced from roots collected between 2012 and 2015 at multiple phenological stages from plants cultured ex situ in laboratory and greenhouse and from the natural habitat.

Across seven sampling events, 122 sequences and 18 operational taxonomic units

(OTUs) were identified, 17 of which represented the fungal family Tulasnellaceae and one belonged to the Ceratobasidiaceae. Two of the 18 OTUs were shared by individuals from both growing environments. Of the OTUs originating from the ex situ environment, eight were exclusive and were genetically closely related. Plants growing in situ also

Texas Tech University, Kirsten Poff, August 2016 hosted eight exclusive OTUs, seven of which belonged to the Tulasnellaceae. Temporal variation in abundance-based diversity was supported by a principal component analysis

(PCA) but was not by Fisher’s exact test or Kruskal-Wallis. Although the mycorrhizal fungi from in situ and ex situ conditions segregated in different OTUs within the

Tulasnellaceae, 13 of the 17 OTUs clustered within a single clade in the phylogram. Two of the 18 OTUs consisted of individual sequences originating from both sources. Overall, little variation among the mycorrhizal fungi associated with juveniles, plants in anthesis, and plants entering dormancy was detected. The data suggest that P. chapmanii prefers

OTUs within a few narrow clades of Tulasnellaceae regardless of its phenological stage or growing environment

Texas Tech University, Kirsten Poff, August 2016

Introduction

Symbioses involve the coexistence of two dissimilar species. Microbial symbioses are common and have at times led to the development of new cellular structures and physiological processes in both symbionts (Barton and Northrup 2011). The theory of endosymbiosis is a good example of this (Rost et al. 2006). In biology, symbioses describe interactions ranging from parasite-host interactions to interactions in which both organisms benefit mutually. Symbiotic interactions have been reported across the six taxonomic kingdoms and include a large diversity of organisms (Ricklefs 2010).

Mycorrhizal associations describe the symbiotic relationship between the roots of a plant and fungi. It is estimated that 90% of terrestrial plant species form mycorrhizal associations of some type (Smith and Read 2008). Mycorrhizal relationships can be mutualistic as the case in vesicular-arbuscular mycorrhizae, the most common mycorrhizal association. In a mutualistic mycorrhizal relationship, fungi receive carbohydrates from the phytobiont and in return provide nutrients, especially phosphorous (Smith and Read 2008, Barton and Northrup 2011). Orchid mycorrhizae, however, are considered less mutualistic and more parasitic (Taylor et al. 2002). The family Orchidaceae is estimated to contain approximately 35,000 species (Dressler 1981), of which two-thirds are epiphytic or lithophytic while the remaining third are terrestrial.

For an orchid seed to germinate and develop in nature, it must first be colonized by a compatible fungal symbiont (Rasmussen 1995). Orchid plants receive both nutrients (e.g. phosphorous) and carbohydrates from their fungal partners (Smith and Read 2008). The intracellular hyphal coils, i.e. pelotons, occur in the cortical cells of roots and are

Texas Tech University, Kirsten Poff, August 2016 characteristic of orchid mycorrhizae. Pelotons are known to be digested and utilized by the orchid (Senthikumar and Krishnamurthy 1998). Orchid mycorrhizae are unusual in that mycorrhizal symbiosis is considered necessary for germination and early development in a majority of orchid taxa, whereas most other types of mycorrhizae form after early plant development (Rasmussen 1995, Smith and Read 2008). Orchids produce microscopic seeds with undifferentiated embryos and a small amount of concentrated nutrient reserve. A germinating orchid seed is often considered fully mycotrophic until it acquires photosynthetic capability; adults are typically mixotrophic utilizing both photosynthesis and mycotrophy simultaneously to acquire carbon. Conversely, nonphotosynthetic orchid taxa remain mycotrophic throughout their life and are thus categorized as holomycoheterotrophic.

A majority of fungi that form orchid mycorrhizae belong to the phylum

Basidiomycota with few belonging to Ascomycota (Dearnaley 2007). Globally, a large majority of the reported orchid mycorrhizae belong to the basidiomycete families

Tulasnellaceae, Sebacinaceae, and Ceratobasidiaceae (Shefferson et al. 2005, Dearnaley

2007). It is thought that orchid-fungal associations may generally be broad in photosynthetic orchid species, especially when they are compared to holomycoheterotrophic genera such as Hexalectris (McCormick et al. 2004, Taylor and

Bruns 2002, Pandey et al. 2013). However, exceptions include several species in the photosynthetic genus Cypripedium, which exhibit high specificity by associating only with narrow clades within the Tulasnellaceae (Shefferson et al. 2005; Shefferson et al.

2007).

Texas Tech University, Kirsten Poff, August 2016

In addition to carbon acquisition strategies, geographic range, and plant species abundance may also play a role in symbiont specificity and diversity (McCormick et al.

2004). Despite their wide geographic ranges, several orchid taxa are reported to associate with relatively narrow clades of fungi. For example, three fairly widespread photosynthetic genera native to North America, Liparis lilifolia, Goodyera pubescens, and Tipularia discolor were documented associating with a low diversity of fungi

(McCormick et al. 2004). In this study, 53 fungal isolates from root fragments and protocorms collected between 1997 and 2001 yielded lower or equal mycorrhizal fungal diversity in comparison to the nonphotosynthetic orchid Cephalanthera austinae which is known to exhibit high specificity (McCormick et al. 2004). The use of widely distributed fungi by an orchid might enable wide plant distributions regardless of mycorrhizal specificity. When 13 plants of Pheladenia deformis were sampled from 9 locations across

≥2000 km in Western Australia and Victoria, all except one of the 26 fungal isolates grouped in a single operational taxonomic unit (OTU) within the genus Sebacina (Davis et al. 2015). However, conclusions about specificity of orchid mycorrhizal partners may be inaccurate when only cultured fungi are included in the analyses. And while it is difficult to closely compare studies that utilize different techniques, broad comparisons among studies may be made based on the genetic similarity of OTUs.

The narrowly distributed and endemic orchid Piperia yadonii which was shown to be generally non-specific in its mycorrhizal associations, although it exhibits variation in associations because of habitat (Pandey et al. 2013). Along with geographic variation, evidence for seasonal variation in mycorrhizal associations exists for some

Texas Tech University, Kirsten Poff, August 2016 photosynthetic terrestrial species although this subject largely remains understudied

(Ercole et al. 2014). Six different individuals were sampled at five sampling events within a single population of Anacamptis morio. The species was recorded associating with the genus Tulasnella in the autumn and winter whereas Ceratobasidium was much more common in the summer (Ercole et al. 2014).

Considering that a majority of orchid taxa are rare, conservation activities, including propagation and reintroduction of in vitro propagated plants, are utilized to improve the conservation status of a species. Because mycorrhizal fungi are inseparable from orchid biology, it is necessary to consider the mycorrhizal specificity and the ability of propagated plants in forming partnerships with suitable fungi. Some options to maximize fungal compatibility in the propagated plants include: (1) introducing asymbiotically propagated seedlings directly into their natural habitats; (2) first corroborating and isolating fungi that the orchid taxon prefers in its natural habitat and then utilizing the isolates in symbiotic propagation; (3) generating asymbiotically propagated seedlings that are further raised in greenhouse conditions and then introducing them in the wild habitat. There is some concern with the third option that the orchid may form mycorrhizal associations with fungal strains that are not available in the natural habitat and that ‘foreign’ strains could be introduced into natural habitats as a result. While the orchid plants may succeed after introduction, the mycorrhizal fungal strains might disturb the microbial community dynamics in the soil otherwise. Because the transplant success of asymbiotic seedlings is low, and symbiotically propagated plants are also exposed to greenhouse environments and thus likely become mycorrhizal with

Texas Tech University, Kirsten Poff, August 2016 additional fungi even if sterile medium is used initially, the third option appears equally viable. However, the most important step that researchers can include is to confirm the similarity or differences in the fungi that form mycorrhizae with orchids in cultivation and in nature to inform the re-introduction decisions. Such comparisons, however, are very limited so far. One study reported that orchid plants, including P. chapmanii, propagated in sterile culture and subsequently grown in greenhouse environments can become mycorrhizal with orchid mycorrhizal fungi (Richards and Sharma 2014). The organic components (peat, milled sphagnum, and fine fern fiber) of the substrates used for cultivating Platanthera species native to bog habitats likely contain saprophytic fungi including those that can form orchid mycorrhizae. Whether the orchid plants utilize the same or similar mycorrhizal symbionts in an ex situ environment that they associate with in their native habitats, however, has not been studied empirically. In a preliminary study,

Richards and Sharma (2014) reported peloton forming fungi belonging to the

Tulasnellaceae within the roots of asymbiotically cultured plants of P. chapmanii that were cultivated in a peat-based substrate for >1 year. This bog-orchid substrate was composed of 44% peat moss, 26% milled sphagnum, 20% sand, and 10% fine tree fern fiber (v:v:v:v). The same study by Sharma and Richards (2014) also reported

Tulasnellaceae in the roots of naturally occurring plants. However, the phylogenetic relationship between peloton forming fungi from plants cultivated in the greenhouse directly after sterile in vitro culture and those that occur naturally in their wild habitats were not reported. The temperate terrestrial orchid taxon, P. chapmanii, was used to test the hypothesis that plants obtained via asymbiotic germination methods and subsequent

Texas Tech University, Kirsten Poff, August 2016 greenhouse culture will have a different suite of mycorrhizal fungi when compared to plants of the same species occurring in their natural habitat. Platanthera chapmanii is a suitable model for testing the study questions because it responds relatively quickly to both in vitro and greenhouse culture conditions. To test the hypothesis, influence of growing environment (i.e., greenhouse cultivated plants that were never exposed to the natural habitat and those occurring in their natural habitat) on mycorrhizal fungal community composition was quantified. Further, whether the mycorrhizal communities within the roots of P. chapmanii exhibit phenological variation within each of the two growing environments (i.e., ex situ or native habitat) was tested.

Materials and methods

Study species

Platanthera chapmanii is a temperate terrestrial orchid native to North America.

The rare perennial occurs in mesic and wet pine flatwoods, barrens, and savannas in sandy loam soils. Its disjunct populations occur in southern Georgia, northern Florida and southeastern Texas within the United States (Liggio and Liggio 1999; Poole et al. 2007;

Richards and Sharma 2014). Populations are often small with ≤10 individuals, and so far only one population is known to host ≥100 plants (Richards and Sharma 2014).

Individuals of P. chapmanii typically emerge above-ground between late February and early March, and flower from late July to early August when they produce a single raceme with ≥60 orange flowers. Seeds dehisce from mid to late October when above- ground organs begin to senesce. 90

Texas Tech University, Kirsten Poff, August 2016

Root collection and surface sterilization

Roots were collected between 2012 and 2014 from ex situ cultured plants and naturally occurring plants (Figure 4.1, Richards and Sharma 2014). Each sampling event was considered an experimental treatment.

In a preliminary study in November 2012, roots representing greenhouse culture conditions (GF12) and natural habitat conditions (NF12) were sampled to develop species-specific methods for molecular identification of orchid mycorrhizal fungi. In

November 2014, up to 30 cm root tissue from each of five ex situ cultured plants (GF14) and each of six individuals from a natural population in southeastern Texas (NF14) was collected. To compare the fungal species composition in fall (November) and spring, up to 12 cm root tissue was collected from each of the four sampled individuals from the same native population in March 2015 (NSp15). Greenhouse cultured plants were not sampled in March 2015 because the group of plants that were sampled in November 2014 were being vernalized at 4°C in a refrigerator at this time and would not have had the opportunity to associate with new fungi between November 2014 and March 2015 while being stored at 4°C.

Subsequently, in August 2015, 15 greenhouse cultured plants were sampled (GSu15) by collecting up to 10 cm of tissue from each individual. At this time, between 12 and 18 cm of root tissues from eight plants at the same native population (NSu15) that was previously sampled in November 2012, November 2014, and March 2015 was collected.

Texas Tech University, Kirsten Poff, August 2016

At each sampling event, roots were stored on ice immediately after collection and transported to the laboratory. Within 48 hours of collection, roots were washed free of soil and other debris and examined for the presence of pelotons (Figure 4.2). Peloton containing roots were surface sterilized by exposing the tissues to: 1) a 30s rinse in 70% ethanol, 2) a 30s rinse in 0.6% sodium hypochlorite, and 3) a 30s rinse in 70% ethanol.

The root pieces were then washed with sterile ultrapure water until they were free of the residues of ethanol and sodium hypochlorite. After surface sterilization, the epidermis was removed before the roots were divided into smaller (~3 cm) pieces for further processing. Finally, individual root segments were finely minced and stored at -80oC until

DNA was extracted. Additionally, culture of peloton-forming fungi from roots collected from the native habitat in August 2015 was attempted. The root fragments that were used to culture fungi on nutrient medium were surface-sterilized and processed similarly except instead of ultralow freezing, the finely macerated tissue was suspended in molten potato dextrose agar (PDA) contained within a 14 cm petri dish. The plates were examined every 1 to 3 days for growth of fungi with characteristics of orchid mycorrhizal fungi. Hyphae from actively growing fungi were collected and cultured in individual plates to obtain pure cultures.

DNA extraction, PCR amplification and PCR product cleaning

Deoxyribose nucleic acid (DNA) was extracted from each sample by using the

DNeasy Plant Mini Kit (Qiagen, Germany) and protocol with a few modifications. Prior to lysing the tissues, samples were dehydrated with liquid nitrogen, and immediately

Texas Tech University, Kirsten Poff, August 2016 lysed in a tissuelyser for 3 min at 30 disruptions / sec. After this initial lysis, 400 µl of

3.3% solution of polyvinylpyrrolidone (PVP) in AP1 lysis buffer was added to each sample. Further, incubation time during the cell disruption step was increased to 2 hours at 65°C during which the samples were shaken and vortexed every 30 minutes.

Deoxyribonucleic acid was not extracted from the cultured fungi; instead, fungal mycelium from pure cultures was examined and presence of moniliod cells was confirmed prior to subjecting the fungus to direct Polymerase Chain Reaction (PCR)

(Figure 4.3).

Polymerase chain reaction of the nuclear ribosomal internal transcribed spacer region

(nrITS) region was accomplished using the primer pairs ITS1-OF / ITS4-OF or ITS1 /

ITS4-Tul (Taylor and McCormick 2008, Sigma-Aldrich, Missouri, USA). Each 25 µl reaction was prepared using Promega GoTaq Flexi DNA polymerase reagent kit using 4

µl of DNA (Promega, Wisconsin, USA). The thermocycling profile included: initial hold for 2 mins at 95°C followed by 35 cycles of: denaturation of 45s at 94°C, annealing at either 52°C or 58°C for 45 seconds, and extension at 72°C for 2 minutes. After the 35 cycles, the reactions underwent a final extension at 72°C for 5 minutes (Pandey et al.

2013). A positive and a negative control for each set of PCR reactions that were prepared and run together was used.

A 2% agarose gel electrophoresis was carried out to verify amplification by using 4 ul of PCR product. Ethidium bromide was used as the florescent dye, and a 1 kb ladder was used to estimate fragment size. Samples that showed a clear, single band between

600-800 bp were cleaned using DNA Clean and Concentrator 5 kit (Zymo Research,

Texas Tech University, Kirsten Poff, August 2016

Irvine, USA). The concentration (ng/µl) and quality of the cleaned product was measured in NanoDrop 2000c (Thermo Scientific, USA). Samples that showed multiple bands or bands that were wide and / or unclear underwent a gel extraction protocol after performing electrophoresis with 21 to 25 µl PCR product. The desired bands (~600-800 bp) were then extracted from the gel and cleaned using the Genelute gel extraction kit

(Sigma-Aldrich, St. Louis, Missouri). Sequencing reactions were prepared and sent for sequencing at the DNA Analysis Facility on Science Hill at Yale University (New Haven,

CT).

Data analyses

Editing and assembly of the raw sequences was performed with CodonCode

Aligner version 6.0.2 (CodonCode Corporation, Centerville, Massachusetts). Sequences were trimmed at both ends by removing 25 bp sections that had ≥3 bases with phred scores below 20. If the resulting trimmed sequences were shorter than 400 bp the entire sequence was excluded from the analyses. Subsequently, the following procedures were performed on the 122 sequences that passed quality control filters.

The taxonomic identity of each sequence was determined at family level by using

BLAST (NCBI Genbank, http://www.ncbi.nlm.nih.gov/genbank/). The FASTX-Toolkit version 2.0 was used to trim sequence ends so that the final length of all sequences was

455 bp (Gordon and Hannon 2010). SWARM version 2.5 was used to build OTUs (d =

12) without data dereplication (Dales 2000). The sequence that was most abundant in an

OTU was used as the representative sequence for that OTU.

Texas Tech University, Kirsten Poff, August 2016

To estimate sequence distances within the Tulasnellaceae, sequences were first aligned using MUSCLE in MEGA version 6 (Tamura et al. 2013). Mean pairwise distances among all sequences within the family were calculated using Kimura’s 2- parameter model and a gamma distribution. Further, pairwise distances were calculated separately for sequences originating from plants from the greenhouse environment, the natural environment, and each sampling event within the two categories.

Cumulative, rarefied OTU diversity curves were constructed by including all 18

OTUs in EstimateS version 9.1.0 with sample-based incidence, individual-based abundance and observed methods (Colwell 2006). Shannon and Simpson diversity indices were calculated for each treatment with RStudio version 8 using the Phyloseq package (RStudio Team).

A principal component analysis (PCA) was performed based on the abundances of OTUs in each of the seven treatments using a correlation cross-products matrix in SAS version 9.4 (SAS Institute Inc. 2013). A Fisher’s exact test and Kruskal-Wallis tests were performed to evaluate whether the abundances of the OTUs were significantly different among the treatments. Phylograms were generated separately for Tulasnellaceae and

Ceratobasidiaceae by using the self-generated OTU data and previously published sequences of orchid mycorrhizal fungi from NCBI GenBank

(http://www.ncbi.nlm.nih.gov/genbank/) to place fungal OTUs from P. chapmanii in the context of known orchid mycorrhizal fungi. Reference sequences and OTU representative sequences were aligned by using MUSCLE in MEGA version 6. Maximum-likelihood trees were then constructed in MEGA using Kimura’s 2-parameter model, as it was

Texas Tech University, Kirsten Poff, August 2016 estimated to be the best fit for the data. Support values were estimated via 1000 bootstrap replications. Bayesian trees were also constructed for both families using MrBayes version 3.2.6 with 1 million generations until the standard deviation between two runs was <0.01. Trees from the initial 250,000 generations were discarded (Huelsenbeck and

Ronquist. 2001). The Ceratobasidiaceae maximum likelihood and Bayesian trees were rooted with Sistotrema sp. Because of the accelerated diversification within the

Tulasnellaceae nuclear ribosomal region, the conserved 5.8s region was extracted from the full ITS sequences by using ITSx software version 1.0.11 (Bengtsson-Palme et al.

2013) before phylograms were constructed. Similar tree building protocol was followed as described above except the 5.8s Tulasnellaceae tree was midpoint rooted due to a lack of a defensible related outgroup. Using FigTree version 1.4.2, nodes were arranged in an increasing order and topology was transformed to a cladogram (Rambaut 2007). Because the topologies were similar for both types of trees for each fungal family, Bayesian probability values along with bootstrap values ≤50 were included in the maximum- likelihood trees.

Results

Eighteen fungal OTUs representing two fungal families, Tulasnellaceae and

Ceratobasidiaceae, were identified from the roots of P. chapmanii across all sampling events. Of the 18 OTUs, 17 belonged to the Tulasnellaceae and one to the

Ceratobasidiaceae (Table 4.1; Table 4.2). Tulasnellaceae was represented by 121 (99.2%) of the 122 sequences. Among the 18 OTUs, 5 were singletons. Across all treatments,

Texas Tech University, Kirsten Poff, August 2016

44.4% of the OTUs were observed in multiple plants (Table 4.2). None of the sampled plants hosted fungi belonging to multiple families (Table 4.2). Ceratobasidiaceae was observed only in one individual in the NSp15 treatment, while the NSu15 treatment had the highest fungal richness with eight OTUs, three of which were exclusive to that treatment. Treatments GF12 and NF12 were represented exclusively by one OTU each.

The most frequently encountered OTU (T8) was observed in 11 naturally occurring individuals representing three sampling events (NF14, NSp15, and NSu15).

The mean pairwise sequence distance among P. chapmanii mycorrhizal fungal sequences in this study was 0.094 ± 0.031. The mean pairwise sequence distance among the ex situ cultured plants (π = 0.064 ± 0.013) was lower than the mean distance observed among the Tulasnellaceae obtained from plants growing in their native habitat (π = 0.116

± 0.036) (Table 4.3). Of the greenhouse treatments, GF14 had the largest mean pairwise distance (π = 0.047 ± 0.009), whereas among the sampling events from naturally occurring populations, the largest mean pairwise distances were within NSp15 (0.228 ±

0.065) and NSu15 (0.209 ± 0.035). These two sampling events also represented the highest mean pairwise distances across all treatments (Table 4.3). When compared to other orchid species, the mean pairwise sequence distance among mycorrhizal fungal sequences of P. chapmanii from plants growing in their natural habitat (π = 0.116 ±

0.036) was larger than some widely distributed temperate terrestrial orchids (e.g.

Cypripedium japonicum and Cypripedium candidum) and smaller than others (e.g.

Piperia yadonii and Ophrys fuciflora) (Table 4.4).

Texas Tech University, Kirsten Poff, August 2016

The diversity curves estimated a higher OTU count at a larger sample size of up to 500 sequences. At the extrapolated value of 500 sequences, the slopes of both the sample-based and individual-based OTU diversity curves started to level but the slope did not reach zero (Figure 4.4). Both Shannon and Simpson indices showed that NSp15 and

NSu15 hosted the highest fungal diversity with Shannon index values of 1.30 and 1.55, respectively, and Simpson index values of 0.72 and 0.71, respectively. Of the ex situ treatments, GSu15 was the most diverse (Shannon’s index of 1.14 and Simpson’s index of 0.63).

The PCA showed that 60% of the variation among treatments was explained by

PC1 and PC2 (Figure 4.5). Principal component one was negatively correlated with T3,

T4, T5, T6, and T7 (all eigenvector values = -0.33) and most positively correlated with

T13, T14, and T15 (all eigenvector values = 0.26). Principal component three accounted for 20.5% of the variation in the data and was most negatively correlated with T1 (all eigenvector values = -0.22) and most positively correlated with T16 (all eigenvector values = 0.41). Four of the seven treatments clustered together in the center of the scatterplot (GF12, NSp15, NF12, and NF14) while the remaining three (GF14, NSu15, and GSu15) separated from the cluster as individual points (Figure 4.5). Results from the

Fisher’s exact test and Kruskal-Wallis analysis of variance did not support differences in

OTU abundances among the seven treatments. The Fisher’s exact test yielded a P-value of 1, and the P-value from the Kruskal-Wallis test was 0.423.

Maximum likelihood and Bayesian trees showed similar relationships among the fungal OTUs. The bootstrap values that exhibited weak branch support values (≤50) were

Texas Tech University, Kirsten Poff, August 2016 not considered. With this criterion, thirteen of the 17 OTUs representing both sources of plants (GF12, GF14, GSu15, NF14, NSp15, and NSu15) grouped together in the same clade. These OTUs grouped with Tulasnella sp. from the European orchid A. morio and

Tulasnellaceae from the North American species Goodyera pubescens, Cymbidium faberi, Platanthera Praeclara, and Tipularia discolor among others (Figure 4.6). Apart from the main clade that included 13 OTUs, two OTUs representing mycorrhizal fungi from the greenhouse environment grouped together in a separate monophyletic clade next to uncultured Tulasnellaceae from Epidendrum firmum. The remaining two OTUs representing fungi from naturally occurring plants separated in the farthest clade closer to uncultured Tulasnellaceae from Paphiopedilum dianthum and E. firmum (Figure 4.6).

The single Ceratobasidiaceae OTU segregated in a node next to a species of uncultured

Ceratobasidiaceae from the endemic North American orchid Piperia yadonii (Figure 4.7).

Discussion

Mycorrhizal specificity among the Orchidaceae is variable across the family depending on the life history or distribution of a taxon (Arditti et al. 1990; Masuhara et al. 1993; McKendrick et al. 2002; Selosse et al. 2002; Otero et al. 2004; Pandey et al.

2013; Bonnardeaux et al. 2014; Ercole et al. 2014; Jacquemyn et al. 2015). Considering that there are approximately 35,000 taxa distributed across the planet, broad generalizations are difficult to make and are likely inappropriate until a majority of the taxa are studied extensively. Majority of the orchid species are rare in their occurrence and thus are the target of conservation efforts including augmentation and restoration of

Texas Tech University, Kirsten Poff, August 2016 natural populations. Because orchid mycorrhizal fungi are necessary for germination and development of plants, consideration of fungal specificity and maintaining the integrity of local genotypes becomes significant. While orchid mycorrhizal fungi are free-living saprophytic fungi with cosmopolitan distributions, orchid-fungus partnerships can be highly specific (Selosse et al. 2002; McCormick et al. 2004; Shefferson et al. 2005;

Shefferson et al. 2007; Nomura et al. 2013) or general (Pandey et al. 2013; Bonnerdeaux et al. 2014) depending on the life history of an orchid taxon and its adaptive traits.

It is reported that a rare terrestrial temperate orchid with small, disjunct populations distributed across a wide geographic area in the southeastern United States is specific in its mycorrhizal relationships with fungi from a few clades within the

Tulasnellaceae (Tables 1, 2, 3, Figure 4.6) regardless of the growing substrate and environment. Only a single OTU belonging to the Ceratobasidiaceae was recovered across all sample sources and events (Table 4.2). Further, the orchid mycorrhizal relationship remained specific over time through phenological stages and years in both the naturally occurring plants and in plants that acquired mycorrhizal fungi during greenhouse culture after sterile in vitro germination and development (Table 2, Figure

4.6). Because seeds from the same natural population that was studied for variation in natural fungal diversity were used, the possibility that the genotype or ecotype of the orchid was a factor in dictating the mycorrhizal diversity associated with P. chapmanii in two disparate growing environments can be largely ruled out. It is possible though that if other natural populations of P. chapmanii are studied similarly, regional variation in mycorrhizal diversity and specificity patterns might emerge. The rarefaction curves

100

Texas Tech University, Kirsten Poff, August 2016 generated with data originating from the experiment predicted that more OTUs would be discovered by increasing the sample size, which could increase the possibility of recovering additional OTUs from the Tulasnellaceae or fungi from other lineages (Figure

4.4). Considering that the fungal OTUs associated with P. chapmanii roots in all seven treatments, including the greenhouse environment approximately 1160 km from the natural population in Texas, showed phylogenetic similarity, it is unlikely that additional sampling of the same population will increase mycorrhizal diversity beyond the

Tulasnellaceae. It is, however, possible that the particular plant genotype (or ecotype) used to test the hypothesis is more specific toward the Tulasnellaceae from the clades identified, and that other natural populations (in GA, for example) and their progeny form mycorrhizae with fungi from additional lineages. Spatial variation in mycorrhizal diversity has been previously documented in other temperate terrestrial orchids

(Masuhara and Katsuya 1994; Taylor and Bruns 1999; Shefferson et al. 2005; Pandey et al. 2013). Platanthera chapmanii was observed with small mycorrhizal diversity differences and high specificity regardless of growing environment.

When mycorrhizal fungal sequences obtained from the naturally occurring P. chapmanii were compared with laboratory and greenhouse cultured, higher diversity was observed in naturally occurring fungi (Table 4.3). Although differences in pairwise distances exist among the seven treatments, the differences are slight and among small numbers (Table 4.3). When compared to other temperate terrestrial orchids with a wide geographic range including Platanthera praeclara, Anacampis laxiflora, Ophrys fuciflora, the mean pairwise sequence distance within the Tulasnellaceae sequences from

101

Texas Tech University, Kirsten Poff, August 2016 the naturally occurring P. chapmanii was average to low (Tables 3, 4). Similarly, a congeneric species, Platanthera praeclara, which has a wide geographic range in North

America associated with fungal species of Tulasnellaceae. Mean pairwise distance (0.135

± 0.006) among P. praeclara-associated Tulasnellaceae was higher than in P. chapmanii

(0.116 ± 0.036; Table 4.4). A narrowly endemic relative, Piperia yadonii, also exhibited higher mean pairwise distance within the family Tulasnellaceae (0.231 ± 0.026) than fungi from either P. chapmanii or P. praeclara while it also associated with fungi from

Ceratobasidiaceae and Sebacinaceae (Pandey et al. 2013). The majority of the species mentioned above are considered as having high specificity towards their mycorrhizal associations. Since fungi from P. chapmanii follow the same pattern, there is evidence for high mycorrhizal specificity in the taxon.

Although a narrow phylogenetic breath of fungi was observed among all the sampling treatments, temporal variation in OTU richness and evenness among sampling events was observed in this study (Table 1, Figure 4.4). The abundance-based PCA also suggests temporal variation in the fall and summer sampling events from the ex situ environment (GF14 and GSu15), whereby these two treatments segregated independently from the cluster of all treatments except NSu15 (Figure 4.5). Five exclusive OTUs were observed (T3, T4, T5, T6, T7) in GF14, whereas GSu15 had two (T16, T17) of the four

OTUs exclusive to the sampling event while the remaining two were shared with NSu15.

Similarly, NSu15 segregated from all other samples originating from the natural population (NF12, NF14, and NSp15) and was the most OTU-rich (8 OTUs) treatment hosting three exclusive OTUs (T12, T13, T14). The clustering observed in the

102

Texas Tech University, Kirsten Poff, August 2016 abundance-based PCA in addition to the variation among the treatments observed in the mean pairwise distances indicate slight temporal variation within each environment

(Table 1, Figure 4.5). This is also supported by both Shannon and Simpson indices; the fall treatments hosting lower diversity (GF12, NF12, GF14, and NF15) clustered together while the spring and summer samples hosting higher diversity (GSu15, NSp15 and

NSu15) separated. However, because 13 of the 17 Tulasnellaceae OTUs clustered together in the same clade of the maximum likelihood tree, this variation appears to be among closely related species of fungi (Figure 4.6). Additionally, the abundance of the 18

OTUs was different among the seven sampling events according to the Fisher’s exact test

(p = 1.00) and the Kruskal-Wallis (p = 0.42). Altogether, strong evidence for sampling- event based difference was not detected. This was not the case with Tovar 2015 or Ercole et al. 2014. Ercole et al. (2014) observed large seasonal differences of fungi associating with A. morio. Tovar (2015) observed some spatial and temporal differences in fungi associating with P. praeclara. Both studies showed much larger temporal variation than was observed in P. chapmanii. Based on the data, P. chapmanii exhibits lower temporal and spatial variation of mycorrhizal fungal diversity than either A. morio or P. praeclara.

Because of a lack of documentation, further temporal comparisons to P. chapmanii cannot be made at this time.

The current paradigm suggests that high mycorrhizal specificity is not limited to nonphotosynthetic orchids but is also present in many photosynthetic terrestrial orchids

(Selosse et al. 2002; McCormick et al. 2004; Shefferson et al. 2005; Shefferson et al.

2007; Nomura et al. 2013). With some exceptions (Pandey et al. 2013; Bonnerdeaux et al.

103

Texas Tech University, Kirsten Poff, August 2016

2014) temperate terrestrial orchids have been documented associating with fungi that exhibit narrow phylogenetic breadth (Selosse et al. 2002; McCormick et al. 2004;

Shefferson et al. 2005; Shefferson et al. 2007; Nomura et al. 2013). In the current study, a high abundance of mycorrhizal fungi from the same or closely related clades within the

Tulasnellaceae was observed regardless of whether the species was cultured ex situ or sampled from its natural habitat. With some evidence for temporal and growing environment variation, the observed orchid mycorrhizal diversity within the roots of P. chapmanii generally remains low across phenological stage and year of sampling. The data also clearly suggest that that the mycorrhizal fungi that P. chapmanii prefers in its natural habitat are widely distributed and available in peat-based greenhouse substrate.

104

Texas Tech University, Kirsten Poff, August 2016

Literature cited

Barton, L.L., and D.E. Northup. 2011. Interactions between microorganisms and plants, Chapter 7 in Microbial ecology. John Wiley & Sons Inc., Hoboken, New Jersey.

Bengtsson-Palme, J., Ryberg, M., Hartmann, M., Branco, S., Wang, Z., Godhe, A., De Wit, P., Sanchez-Garcia, M., Ebersberger, I., Sousa, F., Amend, A,m Jumpponen, A., Unterseher, M, Kristiansson, E., Abarenkov, K., Bertrand, Y.J.K., Sanli, K., Eriksson, K.M., Vik, U., Veldre, V., and R.H. Nilsson. 2013. Improved software detection and extraction of ITS1 and ITS2 from ribosomal ITS sequences of fungi and other eukaryotes for analysis of environmental sequencing data. Methods in Ecology and Evolution, 4(10):914-919.

Bidartondo, M.I., and D.J. Read. 2008. Fungal specificity bottlenecks during orchid germination and development. Molecular Ecology, 17:3707–3716.

Bonnardeaux Y., Brundrett M., Batty A., Dixon K., Koch J., and K. Sivasithamparam. 2014. Diversity of mycorrhizal fungi of terrestrial orchids: compatibility webs, brief encounters, lasting relationships and alien invasions. Mycological research, 111(1):51-61.

Colwell, R. K. 2006. EstimateS. Version 9.1.0. (http://viceroy.eeb.uconn.edu/estimates/index.html, accessed June 12 2016)

Dales, M. 2000. SWARM-Software. Version 2.5. (http://volcanoes.usgs.gov/software/swarm/download.php, accessed June 12, 2016)

Davis, B.J., Phil1lips, R.D., Wright, M., Linde, C.C., and K.W. Dixon. 2015. Continent- wide distribution in mycorrhizal fungi: implications for the biogeography of specialized orchids. Annals of botany, 116(3):413-421

Dearnaley, J.D.W. 2007. Further advances in orchid mycorrhizal research. Mycorrhiza, 17(6):475-486

Dearnaley, J.D.W., Martos, F., and M.A., Selosse. 2012. 12 Orchid Mycorrhizas: Molecular Ecology, Physiology, Evolution and Conservation Aspects. In Fungal associations (pp. 20 207-230). Springer Berlin Heidelberg.

Dressler R.L. 1981. The orchids: natural history and classification. Harvard University Press, Cambridge, Massachusetts and London, England.

105

Texas Tech University, Kirsten Poff, August 2016

Gordon, A., and G. J. Hannon. Fastx-toolkit. Computer program distributed by the author (http://hannonlab.cshl.edu/fastx_toolkit/.), accessed 30 May 2016). 2010.

Huelsenbeck, J. P. and F. Ronquist. 2001. MRBAYES: Bayesian inference of phylogeny. Bioinformatics. 17:754-755.

Liggio, J., and A.O. Liggio. 1999. Wild orchids of Texas. The University of Texas Press, Austin, Texas.

Masuhara, G., Katsuya, K., and K. Yamaguchi. 1993. Potential for symbiosis of Rhizoctonia solani and binucleate Rhizoctonia with seeds of Spiranthes amoena var. amoena in vitro. Mycological Research, 97:746–752.

Masuhara, G. and K. Katsuya. 1994. In situ and in vitro specificity between Rhizoctonia spp. and Spiranthes sinensis (Persoon) Ames. Var. amoena (M. Bieberstien) Hara (Orchidaceae). New Phytologist, 127:711-718.

McCormick, M. K., Whigham, D.F., and J. O'Neill. 2004. Mycorrhizal diversity in photosynthetic terrestrial orchids. New Phytologist, 163(2):425-438.

McKendrick, S.L., Leake, J.L., Taylor, D.L. and D.J. Read. 2002. Symbiotic germination and development of the myco-heterotrophic orchid Neottia nidus-avis in nature and its requirements for locally distributed Sebacina spp. New Phytologist, 154:233–247.

Nomura, N., Ogura-Tsujita, Y., Gale, S. W., Maeda, A., Umata, H., Hosaka, K., and T. Yukawa. 2013. The rare terrestrial orchid Nervilia nipponica consistently associates with a single group of novel mycobionts. Journal of Plant Research, 126(5):613-623.

Otero, J.T., Ackerman, J.D., and P. Bayman. 2004 Differences in mycorrhizal preferences between two tropical orchids. Molecular Ecology, 13(8): 2393-2404.

Pandey, M., Sharma, J., Taylor, D., and V. Yadon. 2013. A narrowly endemic photosynthetic orchid is non-specific in its mycorrhizal associations. Molecular Ecology, 22(8):2341-2354.

Poole, J.M., Carr, W.R., Price, D.M., and J.R. Singhurst. 2007. Rare plants of Texas. Texas A&M University Press, College Station, Texas.

106

Texas Tech University, Kirsten Poff, August 2016

Rasmussen, H.N. 1995. Terrestrial orchids: from seed to mycotrophic plant. Cambridge University Press, Cambridge, England.

Richards, M., and J. Sharma. 2014. Review of Conservation Efforts for Platanthera chapmanii in Texas and Georgia. The Native Orchid Conference Journal, 11(1):1- 11.

Ricklefs, R.E. 2010. The Economy of Nature. WH Freeman and Company, New York.

Rost, T.L., Barbour, M.G., Stocking, C.R., Murphy, T.M. 2006. Plant Biology. Thomson Brooks, Canada.

Selosse, M.A., Weiß, M., Jany, J.L., and A. Tiller. 2002. Communities and populations of sebacinoid basidiomycetes associated with the achlorophyllous orchid Neottia nidus-avis (L.) L.C.M. Rich. and neighbouring tree ectomycorrhizae. Molecular Ecology, 11:1831–1844.

Senthilkumar, S., and K.V. Krishnamurthy. 1998. A cytochemical study on the mycorrhizae of Spathoglottis plicata. Biologia Plantarum, 41(1):111-119.

Shefferson, R.P., Taylor, D.L., Weiß, M., Garnica, S., McCormick, M.K., Adams, S., Gray, H.M., McFarland, J.W., Kull, T., Tali, K. and Yukawa, T., Kawahara T., Miyoshi K., and L. Yung-I. 2007. The evolutionary history of mycorrhizal specificity among lady's slipper orchids. Evolution, 61(6):1380-1390.

Shefferson, R.P., Weiß, M., Kull, T., and D.L. Taylor. 2005. High specificity generally characterizes mycorrhizal association in rare lady's slipper orchids, genus Cypripedium. Molecular Ecology, 14(2):613-626.

Small, J. K. 1903. Flora of the Southeastern United States. Small J.K., New York, New York.

Smith, S.E. and D.J. Read. 2008. Mycorrhizal symbiosis, 2nd ed. Academic Press, San Diego, California.

Stewart, S.L., and L.W. Zettler. 2002. Symbiotic germination of three semi-aquatic rein orchids (Habenaria repens, H. quinquiseta, H. macroceratitis) from Florida. Aquatic Botany, 72(1):25-35.

Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S. 2013. MEGA: Molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution: 30:2725-2729.

107

Texas Tech University, Kirsten Poff, August 2016

Taylor, D.L., and T.D. Bruns. 1999. Population, habitat and genetic correlates of mycorrhizal specialization in the ‘cheating’ orchids Corallorhiza maculata and C. mertensiana. Molecular Ecology, 8:1719–1732.

Taylor, D.L., Bruns, T.D., Leake, J.R., and D.J. Read. 2002. Mycorrhizal specificity and function in myco-heterotrophic plants. Springer, Berlin, Heidelberg.

Tovar, P.A. 2015. Spatial and temporal variation in mycorrhizal associations in a rare North American orchid. Texas Tech University, Master’s thesis 1-164p.

108

Texas Tech University, Kirsten Poff, August 2016

Table 4.1. Representative sequence of each of the 18 fungal nrITS-based operational taxonomic units (OTUs) identified within the roots of Platanthera chapmanii plants cultured in vitro/greenhouse and those occurring naturally. Each culture condition was sampled three to four times between 2012 and 2015. The first letter of an OTU name represents the fungal family to which the OTU belongs: T, Tulasnellaceae; C, Ceratobasidiaceae. Values in parentheses are the total number of plants in which a specific OTU was documented.

109

Texas Tech University, Kirsten Poff, August 2016

Fungal OTU Trimmed sequence

T1 >PCG1_ITS4_TUL tacaaccggtagcgctggatcccttggcacgtcattcgatgaagaccgttgcaaattgcgataaagtgatgtgatgcgcaagtccaccacttatacgtgaatcatcgagttgttgaa cgcattgcaccgcgccctaaaccggctgcggtatgcccctttgagcgtcattacatccttcgggagtctccttttctggagacccgagttcggagtcctcggtcccttgggatcgtgt tctctcagatgcatcgcgccgatcgctttgatgggtactctaatgcctgagcgtggagtccctctgaagtcgagacgcgtttgaccgggtggtgagcccgtgtcggcaagtccacg tccgctgcgacgtcggtactacaaccacatgacctcattggggtaggacaacccgctagacttaagcatattaatcagcggaggaaaagaaactaaccaggatc

T2 >PCN1_ITS4_TUL tacgtgtcttgtagactctgatgataagaaatacaaccagtagcactggatccctcggcatgccattcgatgaagaccgtagcgagttgcgataagcgatgtgatatgcgagtccca aactgatacgtgaaccatcggatcgtcgaacgcactgcaccgaggattgcccatccacggtataccacattgagtgtcattattcgttcgtctctgacgagttcggggtccacggcc ttgccgcgttccctcagattgaagtctgtggcgtcaacctgaccttgctagtgtctgtcgagccccctttgacgagttcactgggtacgctacgtccgcaccacaggtcggtctggc cgggacgcttgcgtccaaccgttctctaatgatgacctcacggtggtaagattacccgctaaacttaagcatattaatcagcggaggaaaagaaactaacaagg

T3 >PchG1-1-ITS4-Tul taacacttttacaaccggtagcgctggatcccttggcacgtcattcgatgaagaccgttgcaaattgcgataaagtgatgtgatgcgcaagtccaccacttatacgtgaatcatcgag ttgttgaacgcactgcaccgcgccctaatccggctgcggtatgcccctttgagcgtcattgtatcccttcgggagtcttttcgttaagacccgagttcggagtcctcggtcttcggatc gtgttctcttagatgcgtcgcgccgatcgcctgatgggtcactctaatgcctgagcgtggagtccctcggagctgagaggcgcttgaccgagtgttgagctcgcgtcgccaagtcc gcacgtcttggacgtcggtactacaacgcatgacctcattggggtaggacaacccgctagacttaagcatattaatcagcggaggaaaagaaactaaccagg

T4 >PchG3-5-ITS4-Tul tccgcgttgtgagtctaacaccagttgtaacacttttacaaccggtagcgctggatcccttggcacgtcattcgatgaagaccgttgcaaattgcgataaagtgatgtgatgcgcaag tccaccacttatacgtgaatcatcgagttgttgaacgcactgcaccgcgccctaatccggctgcggtatgcccctttgagcgtcattgtatcccttcgggagtcttttcgttaagaccc gagttcggagtcctcggtcttcggatcgtgttctcttagatgcgtcgcgccgatcgcctgatgggtcactctaatgcctgagcgtggagtccctcggagctgagaggcgcttgacc gagtgttgagctcgcgtcgccaagtccgcacgtcttggacgtcggtactacaacgcatgacctcattggggtaggacaacccgctagacttaagcatattaa

T5 >PchG3-6-ITS4-Tul ttttacaaccggtagcgatggatcccttggcacgtcattcgatgaagaccgttgcaaattgcgataaagtgatgtgatgcgcaagtccaccacttatacgtgaatcatcgagttgttga acgcattgcaccgcgccctaatccggctgcggtatgcccctttgagcgtcattgtattccttcgggagtcctttttccaaaggaccggagttgggattcttggttctttggatcgtgttct cttagatgtgtcacaccgatcgcctgatgggtcctctaatgcctaagcgtggagttcctgaaagtctgagacgtgcttgaccgggtcttgagctcgcgtcaccaagtctgcctaaca agcagtactacaacacatgacctcattggggtaggacaacccgctagacttaagcatattaatcagcggaggaaaagaaactaaccaggatccctcag

110

Texas Tech University, Kirsten Poff, August 2016

Fungal OTU Trimmed Sequence

T6 >PchG4-1-ITS4-Tul ttttacaaccggtagcgatggtcccttggcacgtcattcgatgaagaccgttgcaaattgcgataaagtgatgtgatgcgcaagtccaccacttatacgtgaatcatcgagttgttgaa cgcattgcaccgcgccctaatccggctgcggtatgcccctttgagcgtcattgtaatccttcgggagtccttttaactaaggacccgagttcggagtcctcggtcctctggatcgtgtt ctcttagatgcgtcgcaccgatcgcctgatgggtcctctaatgcctaagcgtggagttccttcagagtccgaaacgtgcttgaccgggtgttgagctcgcgtcaccaagtctgccta accagcagtactacaacgcatgacctcattggggtaggacaacccgctagacttaagcatattaatcagcggaggaaaagaaactaactaggatccctca

T7 >PchG4-5-ITS4-Tul aaactttttacaaccggtagcgatggatcccttggcacgtcattcgatgaagaccgttgcaaattgcgataaagtgatgtgatgcgcaagtcccccacttatacgtgaatcatcgagt tgttgaacgcattgcaccgcgccctaatccggctgcggtatgcccctttgagcgtcattgtaatccttcgggagtccttttaactaaggacccgagttcggagtcctcggtcctctgg atcgtgtttttttagatgcgtcgccccgatcgcctgatgggtcctctaatgcctaagcgtggagttccttcagagtccgaaacgtgcttgaccgggtgttgagctcgcgtcaccaagt ctgcctaaccagcagtactacaacgcatgacctcattggggtaggacaacccgctagacttaagcatattaatcagcggaggaaaagaaactaactaggat

T8 >PchN1-1-ITS4-Tul aaactttttacaaccggtagcgatggatcccttggcacgtcattcgatgaagaccgttgcaaattgcgataaagtgatgtgatgcgcaagtccaccacttatacgtgaatcatcgagt tgttgaacgcattgcaccgcgccctaatccggctgcggtatgcccctttgagcgtcattgtattccttcgggagtccttttccaaggacccgagttcggagtcctcggtcccacctgg atcgtgttctctcagatgcgtcgcaccgatcgcctgatgggtcctctaatgcctaagcgtggagttccttcagagtcccacacgtgcttgaccgagtcttgagctcgcgtcaccaagt ccgccttaaccagcggtactacaacgcatgacctcattggggtaggacaacccgctagacttaagcatattaatcagcggaggaaaagaaactaaccagga

T9 >PchN3-1-ITS4-Tul agttgtataaactttttacaaccggtagcgatggatcccttggcacgtcattcgatgaagaccgttgcaaattgcgataaagtgatgtgatgcgcaagtccaccacttatacgtgaatc atcgagttgttgaacgcattgcaccgcgccctaatccggctgcggtatgcccctttgagcgtcattgtattccttcgggagtccttttccaaggacccgagttcggagtcctcggtcc cacctggatcgtgttctctcagatgcgtcgcaccgatcgcctgatgggtcctctaatgcctaagcgtggagttccttcagagtcccacacgtgcttgaccgagtcttgagctcgcgtc accaagtccgccttaaccagcggtactacaacgcatgacctcattggggtaggacaacccgctagacttaagcatattaatcagcggaggaaaagaaact

111

Texas Tech University, Kirsten Poff, August 2016

Fungal OTU Trimmed Sequence

T10 >PCHSN1-1-ITS4-OF ccgtgttactcctcgtgagcacacgctaaagagcgatatacgtgtcttgtagactctgatgataagaaatacaaccagtagcactggatccctcggcatgccattcgatgaagaccg tagcgagttgcgataagcgatgtgatatgcgagtcccaaactgatacgtgaaccatcggatcgtcgaacgcactgcaccgaggattgcccatccacggtataccacattgagtgt cattattcgttcgtctctgacgagttcggggtccacggccttgccgcgttccctcagattgaagtctgtggcgtcaacctgaccttgctagtgtctgtcgagccccctttgactgagttc actgggtacgctacgtccgcaccacaggtcggtctggccgggacgcttgcgtccaaccgttctctaatgatgacctcacggtggtaagattacccgctaaact

T11 >PchNs3-3-ITS4-TUl tacaaccggtagcgatggatcccttggcacgtcattcgatgaagaccgttgcaaattgcgataaagtgatgtgatgcgcaagtccaccacttatacgtgaatcatcgagttgttgaa cgcattgcaccgcgccctaatccggctgcggtatgcccctttgagcgtcattgtattccttcgggagtccttttacaaggacccgagttcggagtcctcggtcctcttctggatcgtgt tctcttagatgcgtcgcaccgatcgcctgatgggtcctctaatgcctaagcgtggagttccttcagagtccgagacgtgcttgaccgggtcttgagctcgcgtcaccaagtctgccg taacaagcagtactacaacgcatgacctcattggggtaggacaacccgctagacttaagcatattaatcagcggaggaaaagaaactaaccaggatccctca

T12 >PchNsu2-3-ITS4-TUl actttttacaaccggtagcgctggatcccttggcacgtcattcgatgaagaccgttgcaaattgcgataaagtgatgtgatgcgcaagtccaccacttatacgtaaatcatcgagttgt taaacgcattgcaccgcgccctaatccggctgcggtatgcccctttgagcgtcattgtatcccttcgggagtcctttacaaggacccgagttcggagtcctcggtccgacctggatc gtgttctcttagatgcgtcgcaccgatcgcctgatgggtcctctaatgcctaagcgtggagttccttcagggtccgacacgtgcttgaccgggtcttgagcctgtgtcaccaagtctg cccaacaagcagtactacaacgcatgacctcattggggtaggacaacccgctagacttaagcatattaatcagcggaggaaaagaaactaaccaggatccc

T13 >PchNsu8-1-ITS4-TUL taaagaacgttccgcattgtgagtctaacaccagttgtaaacttttacaaccggcagcgctggatcccttggcacgtcattcgatgaagaccgttgcaaattgcgataaagtgatgtg atgcgcaagtccaccacttatacgtgaatcatcgagttgttgaacgcattgcaccgcgccctaatccggctgcggtatgcccctttgagcgtcattgtattccttcgggagtctttcctt gcgaaagacccgagttcggagtcctcggtcttttggatcgtgttctcttagatgcgtcgcgccgatcgcctgatgggtactctaatgcctgagcgtggagtccctctgggtttgagac gcgcttgaccggccattgggctcgcgtcaccaagtccacatcctttgggatgctggtactacaacgcatgacctcatcggggtaggacaacccgctaga

112

Texas Tech University, Kirsten Poff, August 2016

Fungal OTU Trimmed Sequences

T14 >PchNsu8-4-ITS4-TUL atggatcccttggcacgtcattcgatgaagaccgttgcaaattgcgataaagtgatgtgatgcgcaagtccaccacttatacgtgaatcatcgagttgttgaacgcactgcaccgcg ccctaaaccggctgcggtatgcccctttgagcgtcattgcattccttcgggagtctcctttcgagagacccgagttcggagtcctcggtcctctggggaccgtgttctctcagatgcg tcgcgccgatcgcccgatgggtcgctctcatgcctgagcgtagagtccctctggagtcgagacgcgctggaccgggcgtttgggcccgccgtcgccaagtccgacccgatgct tttctgcatgggtttcggtactacaaccacatgacctcattggggtaggacaacccgctagacttaagcatattaatcagcggaggaaaagaaactaaccaggatcc

T15 >PchNSu8-9-ITS4-TUL tttacaaccggtagcgatggatcccttggcacgtcattcgatgaagaccgttgcaaattgcgataaagtgatgtgatgcgcaagtccaccacttatacgtgaatcatcgagttgttga acgcattgcaccgcgccctaaaccggctgcggtatgcccctttgagcgtcattgtattccttcgggagtcctttttacaaaggacccgagttcggagtcctcggtcctctggatcgtg ttctcttagatgcgtcgcaccgatcgcctgatgggtctctaatgcctaagcgtggagttccttcagagtccgagacgtgcttgaccgggtgttgagctcgcgtcaccaagtctgcctc acaagcagtactacaacgcatgacctcattggggtaggacaacccgctagacttaagcatattaatcagcggaggaaaagaaactaaccaggatccctcag

T16 >Pch.253-1-ITS4-TUL caaccggcagcgctggatcccttggcacgtcattcgatgaagaccgttgcaaattgcgataaagtgatgtgatgcgcaagtccaccacttatacgtgaatcatcgagttgttgaacg cattgcaccgcgccctaatccggctgcggtatgcccctttgagcgtcattgtattccttcgggagtctttccttgcgaaagacccgagttcggagtcctcggtcttttggatcgtgttct cttagatgcgtcgcgccgatcgcctgatgggtactctaatgcctgagcgtggagtccctctgggtttgagacgcgcttgaccggccattgggctcgcgtcaccaagtccacatcct ttgggatgctggtactacaacgcatgacctcatcggggtaggacaacccgctagacttaagcatattaatcagcggaggaaaagaaactaaccaggatcccc

T17 >Pch.255-1-ITS4-TUL caaccggcagcgctggatcccttggcacgtcattcgatgaagaccgttgcaaattgcgataaagtgatgtgatgcgcaagtccaccacttatacgtgaatcatcgagttgttgaacg cattgcaccgcgccctaaaccggctgcggtatgcccctttgagcgtcattgtattccttcgggagtctttccttgctgaaagacccgagcttggagtcctcggtcctttggatcgtgtt ctctcagatgcgtcgcgccgatcgcctgatgggtactctaatgcctgagcgtggagtcccttcgagtttgagacgcgcttgaccggccgttgggctcgcgtcaccaagtccgcgt cctcctggacgtcggtactacaacgcatgacctcattggggtaggacaacccgctagacttaagcatattaatcagcggaggaaaagaaactaaccaggatccc

113

Texas Tech University, Kirsten Poff, August 2016

Fungal OTU Trimmed Sequence

C1 >PCHSN3-1-ITS4-OF tgtgagacggattgaccctctcgggggacggtccgtctattatacataaactccaataattaaatttgaatgtaatttgatgtaacgcatctttgaactaagtttcaacaacggatctctt ggctctcgcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcaccttgcgctccttggtattcctcggagcatg cctgtttgagtatcatgaaattctcaaaataaatcttttgttaactcgattgattttattttggacttggaggtctgcagattcacgtctgctcctcttaaatttattagctggatctctgtgacat cggttccactcggcgtgataagtatcactcgctgaggacactgtaaaaggtggccggagttactgaagaaccgcttctaatagtccattg

114

Texas Tech University, Kirsten Poff, August 2016

Table 4.2. Number of root sections (i.e. sequences) representing each of the 18 fungal nrITS based operational taxonomic units (OTUs) identified within the roots of Platanthera chapmanii plants cultured in vitro/greenhouse and those occurring naturally. Each culture condition was sampled three to four times between 2012 and 2015. The first letter of an OTU name represents the fungal family to which the OTU belongs: T, Tulasnellaceae; C, Ceratobasidiaceae. Values in parentheses are the total number of plants in which a specific OTU was documented.

115

Texas Tech University, Kirsten Poff, August 2016 Plant source Lab / Greenhouse Natural Population

Fall 2012 Fall 2014 Summer 2015 Fall 2012 Fall 2014 Spring 2015 Summer 2015 OTU GF12 GF14 GSu15 NF12 NF14 NSp15 NSu15

Tulasnellaceae T1 8 (1) 0 0 0 0 0 0 T2 0 0 0 6 (1) 0 0 9 (2) T3 0 20 (4) 0 0 0 0 0 T4 0 1 (1) 0 0 0 0 0 T5 0 6 (2) 0 0 0 0 0 T6 0 3 (1) 0 0 0 0 0 T7 0 1 (1) 0 0 0 0 0 T8 0 0 0 0 13 (5) 2 (1) 18 (5) T9 0 0 0 0 2 (2) 0 1 (1) T10 0 0 0 0 0 2 (1) 0 T11 0 0 9 (6) 0 0 1 (1) 5 (2) T12 0 0 0 0 0 0 1 (1) T13 0 0 0 0 0 0 1 (1) T14 0 0 0 0 0 0 2 (1) T15 0 0 4 (3) 0 0 0 2 (1) T16 0 0 3 (2) 0 0 0 0 T17 0 0 1 (1) 0 0 0 0 Ceratobasidiaceae C1 0 0 0 0 0 1 (1) 0

Total sequences 8 31 17 6 15 6 39 Total OTUs 1 5 4 1 2 3 8

116

Texas Tech University, Kirsten Poff, August 2016

Table 4.3. Mean pairwise fungal internal transcribed spacer (nrITS) sequence distances (π ± SE; Nei and Kumar 2000), estimated based on Kimura’s 2-parameter model, within the fungal family Tulasnellaceae identified in the roots of Platanthera chapmanii plants that were either cultured in lab / greenhouse conditions (GF12, GF14, GSu15) or were obtained from a naturally occurring population (NF12, NF14, NSp15, NSu15).

Platanthera chapmanii mycorrhizal community Tulasnellaceae

n π-distance ± SE

Sequences from all sources 121 0.094 ± 0.031

Sequences from greenhouse cultured plants 56 0.064 ± 0.013

GF12 8 0.000 ± 0.000

GF14 31 0.047 ± 0.009

GSu15 17 0.037 ± 0.008

Sequences from naturally occurring plants 65 0.116 ± 0.036

NF12 6 0.000 ± 0.000

NF14 15 0.001 ± 0.001

NSp15 5 0.228 ± 0.065

NSu15 39 0.209 ± 0.035

117

Texas Tech University, Kirsten Poff, August 2016

Table 4.4. Mean pairwise distances among fungal nrITS sequences based on Kimura’s 2- parameter model were calculated for fungal communities identified within the roots of Platanthera chapmanii. Roots of plants raised in vitro and cultured in greenhouse, and from plants occurring naturally were sampled. All other mean pairwise distances, except for Platanthera praeclara (Tovar 2015) and Nervilia nipponica (Nomura et al. 2013) were calculated by Pandey et al. (2013).

Geographic Taxon Tulasnellaceae Ceratobasidiaceae range n π-distance n π-distance

Platanthera chapmanii 65 0.116 ± 0.036 Wide Platanthera praeclara 69 0.135 ± 0.006 238 0.039 ± 0.003 Wide Anacamptis laxiflora 12 0.186 ± 0.009 12 0.071 ± 0.006 Wide Ophrys fuciflora 12 0.225 ± 0.010 7 0.063 ± 0.006 Wide Orchis purpurea 9 0.089 ± 0.008 Wide Serapias vomeracea 27 0.097 ± 0.007 8 0.038 ± 0.004 Wide Nervilia nipponica 9 0.157 ± 0.007 Wide Chiloglottis trapeziformis 12 0.006 ± 0.002 Wide Goodyera foliosa 7 0.062 ± 0.009 Wide Goodyera tesselata 5 0.044 ± 0.006 Wide Cypripedium japonicum 18 0.033 ± 0.006 Wide Cypripedium candidum 7 0.003 ± 0.002 Wide Goodyera hachijoensis 5 0.103 ± 0.009 Moderate Cypripedium calceolus 12 0.005 ± 0.002 Moderate Hexalectris grandiflora 6 0.023 ± 0.003 Moderate Piperia yadonii 58 0.231 ± 0.026 71 0.077 ± 0.006 Restricted Chiloglottis aff. jeanesii 14 0.014 ± 0.003 Restricted

118

Texas Tech University, Kirsten Poff, August 2016

Figure 4.1. A photograph of root samples collected from in vitro propagated and greenhouse cultured Platanthera chapmanii individuals before processing for molecular analysis.

119

Texas Tech University, Kirsten Poff, August 2016

100 µm

Figure 4.2. A photograph of a cross section of a root of Platanthera chapmanii showing mycorrhizal hyphal coils, i.e. pelotons, within the cortical cells.

100 µm

Figure 4.3. Photographic documentation of moniliod cells and fungal hyphae isolated on potato dextrose agar (PDA). The mycorrhizal fungus was cultured from roots of Platanthera chapmanii.

120

Texas Tech University, Kirsten Poff, August 2016

20 Observed cumulative OTU diversity

# of # OTUs 15 Series2 10 Individual-based rarefied cumulative 5 OTU diversity

0 0 100 200 300 400 500 # of Sequences

Figure 4.4. Sample-based incidence data, individual-based abundance data and observed methods were used to construct cumulative, rarefied fungal operational taxonomic unit (OTU) diversity curves for Platanthera chapmanii extrapolated to 500 sequences. Operational taxonomic units were built using 122 mycorrhizal fungal sequences and 18 OTUs derived from the roots of plants that were either cultured in ex situ conditions or were obtained from a naturally occurring population between 2012 and 2015.

121

Texas Tech University, Kirsten Poff, August 2016

Figure 4.5. A principal component analysis (PCA) scatterplot. Each of the circles represent one of seven treatments (NF12, NF14, NSp15, NSu15, GF12, GF14, GSu15) used to obtain mycorrhizal OTUs from the roots of Platanthera chapmanii plants that were either cultured in lab/greenhouse conditions (GF12, GF14, GSu15) or were obtained from a naturally occurring population (NF12, NF14, Nsp15, NSu15) between 2012 and 2015. The PCA shows PC1 and PC2 accounting for 60% of variation in the data.

122

Texas Tech University, Kirsten Poff, August 2016

T9 T11 T8 T7 T6 T5 T15 JX649085_Uncultured_Tulasnellaceae_Anacamptis_morio FJ613162_Tulasnella_calospora_Cymbidium_faberi KU664578_Tulasnella_sp._Goodyera_pubescens AY373276_Tulasnella_sp._Goodyera_pubescens AY373290_Tulasnella_bifrons_Tipularia_discolor T14 62/94 DQ388045_Tulasnella_calospora_Pleurothallis_lilijae JX649080_Uncultured_Tulasnellaceae_Dactylorhiza_fuchsii AY373291_Tulasnella_deliquescens_Goodyera_pubescens T13 T17 DQ068773_Epulohiza_sp._Platanthera_praeclara T16 KJ495969_Tulasnella_sp._Anoectochilus_formosanus 71/95 T1 T12 T4 JX998854_Uncultured_Tulasnellaceae_Epidendrum_firmum T3 AJ549127_Tulasnellaceae_Orchis_morio AY634122_Uncultured_Tulasnellaceae_Epipactis_gigantea 89/90 AY373299_Tulasnella_sp._Tipularia_discolor JF691517_Uncultured_Tulasnellaceae_Agraecum_ramosum EU218891_Epulorhiza_anaticula_Corallarhiza_sp. AY373297_Tulasnella_danica_Goodyera_pubescens AY373310_Tulasnella_sp._Tipularia_discolor 65 AY373302_Tulasnella_sp._Tipularia_discolor 99/92 85 JQ994433_Uncultured_Tulasnellaceae_Piperia_yadonii AY373304_Tulasnella_sp._Tipularia_discolor 69 JQ994441_Uncultured_Tulasnellaceae_Piperia_yadonii 63 DQ178073_Uncultured_Tulasnella_Stelis_hallii 66 77 JQ994406_Uncultured_Tulasnellaceae_Piperia_yadonii HM802322_Uncultured_Tulasnella_Singularybas_oblongus DQ388046_Tulasnella_asymmetrica_Thelymitra_luteocilium GQ241845_Uncultured_Tulasnellaceae_Paphiopedilum_dianthum 100/100 T2 T10 JX998909_Uncultured_Tulasnellaceae_Epidendrum_firmum 1/1 AY373296_Tulasnella_tomaculum_Goodyera_pubescens JN655638_Tulasnella_sp._Pseudorchis_albida 98/62 JF926488_Uncultured_Tulasnella_Orchis_purpurea 68/1 AB369929_Epulorhiza_sp._Cypripedium_macranthos JF926484_Uncultured_Tulasnella_Orchis_purpurea 77/1 GU066935_Uncultured_Tulasnellaceae_Orchis_mascula 95/1 GU066934_Uncultured_Tulasnellaceae_Orchis_mascula EF433953_Uncultured_Tulasnellaceae_Cypripedium_guttatum DQ925640_Unculured_Tulasnellaceae_Cypripedium_reginae 99/94 EU583714_Uncultured_Tulasnellaceae_Orchis_simia GQ907249_Uncultured_Tulasnellaceae_Orchis_anthropophora GQ907273_Uncultured_Tulasnellaceae_Orchis_anthropophora

2.0 123

Texas Tech University, Kirsten Poff, August 2016

Figure 4.6. A maximum likelihood tree of the fungal family Tulasnellaceae built with operational taxonomic units (OTUs) of nrITS sequences observed in Platanthera chapmanii roots that were either cultured in lab/greenhouse conditions (green), obtained from a naturally occurring population (red), or present in both environments (blue) and orchid mycorrhizal OTUs from previous publications. The tree was rooted with midpoint method. Bootstrap values ≤50 were omitted. The tree was built using 1000 bootstrap replicates. Of the nodes that have two values, the second values are Bayesian probability values from a Bayesian tree built using 1 million generations.

124

Texas Tech University, Kirsten Poff, August 2016

54/97 JQ972064_Uncultured_Ceratobasidiaceae_Piperia_yadonii

89/97 C1 100/99 JQ972091_Uncultured_Ceratobasidiaceae_Piperia_yadonii AY634119_Uncultured_Ceratobasidiaceae_Epipactis_gigantea HM141020_Uncultured_Ceratobasidiaceae_Goodyera_pendula 98/98 JQ972104_Uncultured_Ceratobasidiaceae_Piperia_yadonii

FJ788724_Uncultured_Ceratobasidiaceae_Pterygodium_catholicum

EU218895_Ceratohiza_sp._Goodyera_repentis

DQ068771_Ceratobasidiaceae_Platanthera_praeclara

GQ405535_Ceratobasidium_sp._Pterostylis_sp.

64/83 JF273479_Ceratobasidiaceae_Erycina_pusilla 77/93 AF503970_Ceratobasidiaceae_Tolumnia_variegata HQ914117_Ceratobasidium_sp._Plectorrhiza_tridentata

88/100 DQ834419_Thanatephorus_sp._Vanilla_planifolia

70/97 EU218892_Thanatephorus_ochraceus_Corallorhiza_sp. KF151202_Rhizoctonia_sp._Aa_achalensis 99/97 KF151201_Rhizoctonia_sp._Aa_achalensis AJ549180_Ceratobasidiaceae_Orchis_laxiflora

AJ549123_Ceratobasidiaceae_Dactylorhiza_incarnata

GU066936_Uncultured_Ceratobasidiaceae_Orchis_morio AF345558_Sistotrema_Dactylorhiza_majalis

2.0

125

Texas Tech University, Kirsten Poff, August 2016

Figure 4.7. A maximum likelihood tree of the fungal family Ceratobasidiaceae built with operational taxonomic units (OTU) clustered using fungal nrITS sequences observed in Platanthera chapmanii root obtained from a naturally occurring population (C1) and other orchid mycorrhizal OTUs previously published. The tree was rooted with a species of Sistotrema. Bootstrap values ≤50 were omitted. The tree was built using 1000 bootstrap replicates. Of the nodes that have two values, the second values are Bayesian probability values from a Bayesian tree built using 1 million generation.

126

Texas Tech University, Kirsten Poff, August 2016

CHAPTER V

CONCLUSIONS

Much is unknown concerning the molecular and reproductive ecology of temperate terrestrial orchid species. The rare species Platanthera chapmanii was used in this study because of its wide geographic range, relatively quick growth and development, and its known ability to be asymbiotically propagated. Seed dormancy is a survival mechanism that can be evolutionarily advantageous for many temperate orchid species. Many temperate terrestrial species are known to require pre-germination treatments (e.g. cold-moist stratification) to induce germination. Based on an Analysis of

Variance and Fisher’s Least Significant Difference test, P. chapmanii seeds that were treated with cold-moist stratification conditions at 5°C for 8 or 12 weeks had a higher rate of germination than seeds that are not cold-moist stratified. After germination, however, development up to nine months was independent of the pre-germination treatment. This is most likely because of dormancy mechanisms the species has adapted to prevent germination at inopportune times. Many species of temperate terrestrial orchids exhibit extremely low germination rates (≤5%) when they do not undergo cold-moist stratification (Bowles et al. 2002). The southern distribution of P. chapmanii may be the reason for a relatively high germination rate without the cold-moist stratification treatment (25%). This capacity to germinate in the absence of stratification could be a useful adaptation as climate continues to change.

127

Texas Tech University, Kirsten Poff, August 2016

Rare terrestrial orchids are thought to be sensitive to commercial fertilizers, and the nutrient supplementation study described above was designed with this in mind

(Silvertown et al. 1994). There were no significant differences in plant height between the three nutrient treatments (0.00x, 0.25x, and 0.50x). It is possible that significant differences would exist if other response variables including chlorosis and tip necrosis were measured, or if the concentration of fertilizer was increased. Differences in shoot height was highly variable among treatments, and hence an increase in replications could also add more confidence in the data. From the population augmentation studies, strong conclusions cannot yet be drawn.

In this research, Platanthera chapmanii was documented to form mycorrhizal pelotons with fungi from the families Tulasnellaceae and Ceratobasidiaceae. Of the 122 high quality fungal nuclear ribosomal internal transcribed spacer (nrITS) sequences, 121 were of Tulasnellaceae. The only Ceratobasidiaceae sequence was from a naturally occurring P. chapmanii individual that was sampled in spring 2015. Mean pairwise distance of the sequences from greenhouse sources were smaller than the mean pairwise distance of sequences from naturally occurring plants, but OTU richness was the same. In addition, a majority of the OTUs (13) clustered together on the same clade of the maximum likelihood tree independent of treatment. Because the majority of sequences were obtained with Tulasnellaceae specific primers, results may have been biased towards Tulasnellaceae. However, high quality sequences could not be generated using primers that were designed for other families within Basidiomycota including

Sebacinaceae and Ceratobasidiaceae indicating that the results represent the mycorrhizal

128

Texas Tech University, Kirsten Poff, August 2016 preference of the P. chapmanii reliably. Since the pairwise distances between sequences were fairly small, and the OTUs clustered closely on the maximum likelihood tree, it is suggested that the taxon is specific towards associations with narrow clades of the

Tulasnellaceae.

129

Texas Tech University, Kirsten Poff, August 2016

Literature Cited

Bowles, M.L., Jacobs, K.A., Zettler, L.W., and T.W. Delaney. 2002. Crossing effects on seed viability and experimental germination of the federal threatened Platanthera leucophaea. Rhodora 104:14-30.

130