Sirna Screening of the Kinome Identified Aurora a Kinase As a Therapeutic Target Gene in Cervical Cancer Fawzi Faisal A

Total Page:16

File Type:pdf, Size:1020Kb

Sirna Screening of the Kinome Identified Aurora a Kinase As a Therapeutic Target Gene in Cervical Cancer Fawzi Faisal A siRNA screening of the kinome identified Aurora A kinase as a therapeutic target gene in cervical cancer Fawzi Faisal A. Bokhari, M.Sc. A thesis submitted for the degree of Doctor of Philosophy at The University of Queensland in 2014 The University of Queensland Diamantina Institute Abstract HPV oncogenes disable a number of tumour suppressor pathways, including p53 and Rb, contributing to the transformed phenotype. Loss of these critical host cell functions may also provide an opportunity to selectively target the destruction of HPV-transformed cells. We have performed an siRNA screen using the kinome (779 genes) library to identify genes that when depleted are synthetically lethal with HPV transformation. The primary and validations screens have confirmed Aurora A kinase (AURKA) as a potential synthetic lethal target selective for HPV transformed cells. AURKA has been further investigated using the selective small molecule inhibitor MLN8237. We found that MLN8237 was significantly more potent towards the HPV transformed cells. The effect was not a consequence of targeting mitosis as two other mitotic inhibitors, PLK1 inhibitor (BI2536) and taxol, demonstrated no selectivity. Analysis of the nuclear structure and DNA content showed that Aurora A inhibition promoted a high level of polyploidy in non-HPV treated cells whilst this same degree of polyploidy was associate with apoptosis in the HPV-transformed cell lines. Whereas Bcl-2 over expression in HeLa cells had no effect on sensitivity to MLN8237, Mcl-1 overexpressing HeLa cells were less sensitive to the MLN8237 in comparison to the parental cell line, which may suggests the involvement of Noxa or Puma pro- apoptotic proteins in the induction of the apoptosis in the HPV-transformed cells. The transfection of the non-HPV C33A cervical cancer and SCC25 squamous cell carcinoma cell lines with the HPV16 oncogenic E7 increased sensitivity to MLN8237 between 3 >10 fold suggesting that the sensitivity to MLN8237-dependent killing was a direct consequence of HPV E7 expression. Xenograft experiments with cervical cancer cell lines in immunodeficient mice showed MLN8237 inhibited growth of HPV and non-HPV xenografts during treatment with 30mg/kg MLN8237 once a day for 10 consecutive days. However, outgrowth of tumour was noticed from the second day post-treatment in the non-HPV tumour group whereas the HPV-induced tumour group did not show cancer recurrence for 50 days post-treatment. These findings suggest that MLN8237 represent a promising novel therapeutic targeted agent against HPV-transformed cervical cancer. ii Declaration by author This thesis is composed of my original work, and contains no material previously published or written by another person except where due reference has been made in the text. I have clearly stated the contribution by others to jointly-authored works that I have included in my thesis. I have clearly stated the contribution of others to my thesis as a whole, including statistical assistance, survey design, data analysis, significant technical procedures, professional editorial advice, and any other original research work used or reported in my thesis. The content of my thesis is the result of work I have carried out since the commencement of my research higher degree candidature and does not include a substantial part of work that has been submitted to qualify for the award of any other degree or diploma in any university or other tertiary institution. I have clearly stated which parts of my thesis, if any, have been submitted to qualify for another award. I acknowledge that an electronic copy of my thesis must be lodged with the University Library and, subject to the General Award Rules of The University of Queensland, immediately made available for research and study in accordance with the Copyright Act 1968. I acknowledge that copyright of all material contained in my thesis resides with the copyright holder(s) of that material. Where appropriate I have obtained copyright permission from the copyright holder to reproduce material in this thesis. iii Publications during candidature Blake, SJ., Bokhari, FB., McMillan, NA. (2012). RNA interference for viral infections. Curr Drug Targets, Oct; 13(11):1411-20 Publications included in this thesis No publications included. iv Contributions by others to the thesis Technical assistance from Mr Max Ranall (ARVEC Unit UQDI) for the design and optimisation of the kinome screen. Statement of parts of the thesis submitted to qualify for the award of another degree None. v Acknowledgements “In the name of Allah, the most gracious, the most merciful” Thank you Allah for helping me to finish this PhD thesis. I would like to start the first acknowledgment in this section with the person who pushed me to go throughout all the postgraduate studies Masters and PhD. The person whom I will never forget and I wish he is now with me sharing with me these moments. But many times what we wish never comes to reality. To the person that I have lost in the mid of my PhD, to his soul; to my Father: I have made it to the end of the journey Dad. I hope this thesis will make your soul as happy as you would have been with me today. I owe you a lot and thank you is not even enough to what you have done for me; and all words will not be adequate to describe my feelings. I love you Dad. This PhD work would have not been done without the financial support I have received from the generous government of the Kingdom of Saudi Arabia and the support I had from the funding of Associate Professor Brian Gabrielli at the UQDI and Professor Nigel McMillan at Griffith University. Thank you all for your great support. Honestly I do not know how to thank my great supervisors, both Associate Professor Brian Gabrielli and Professor Nigel McMillan. I owe you a huge thank you for all what you have done with me. I HAVE LEARNT SO MUCH FROM YOU BOTH. Thank you for your usual support, understandings, guiding me throughout my PhD, and providing me with opportunities to learn and develop my skills to become a scientist. Your doors have been always open for guidance, discussions, ideas, and questions. Thank you so much. Special thanks also go to my previous associate supervisor Professor Tom Gonda who guided me throughout the beginning of this project. Your feedback and guidance have been always appreciated. To all the Gabrielli lab members, you have been great friends and colleagues to be with. I would like to specifically thank Dr Loredana Spoerri for her helps in reviewing my Materials and Methods vi Chapter of this thesis and for her continuous advices. Also, I will never forget to say thank you McMillan lab members past and present, I have enjoyed being with you all. Any work in this life has ups and downs and moments where you need special squad to make you feel you are still alive. To my amazing friends in Australia and in Saudi Arabia who helped me overcome all the hectic moments I have been through during this project (YES! Those Thursday nights at the La Dolce Vita Café having coffee, helped me so much). Last, but of course not least, this section is devoted to those who really being part of my life. Firstly, to my Mother, any word in this life will not be enough to convey my feelings towards you. Thank you for being with me all the time, for the support you gave me, for the advices that always put me on top of this life, thank you for everything you have given me. Without you, not only my PhD but also my whole life will be tasteless. I love you Mom. Secondly, my wife Nahla, the person who left everything behind to join me in this journey; thank you for all the cares you gave me, helps and encouragements. I would thank Allah everyday throughout my life for giving me such a great person like you. I owe you so much Nahla and, of course, I love you. To my brothers and sisters, Bassem, Ashwaq, AbdulRahman, and Ghazal. You are the great companion gifts from Allah to me in this life. Your support and helps were key players in finishing this work; thank you so much, I love you all. To my sons, who are my real eyes in this life, Faisal and AbdulRahman. All the pain, stress, and challenges resolve when I see your great smiles and hug you. You have been always and will remain the bright side of my life. vii Keywords siRNA, AURKA, AURKB, Haspin, GSG2, cervical cancer, HPV, synthetic lethality. Australian and New Zealand Standard Research Classifications (ANZSRC) ANZSRC code: 111207, Molecular Targets, 50% ANZSRC code: 111201, Cancer Cell Biology, 30% ANZSRC code: 111203, Cancer Genetics, 20% Fields of Research (FoR) Classification For code: 0604, Genetics 50% FoR code: 0601, Biochemistry and Cell Biology, 25% FoR code: 1112, Oncology and Carcinogenesis, 25% viii Table of Contents Abstract ............................................................................................................................................... ii Acknowledgements............................................................................................................................ vi List of Tables ................................................................................................................................... xiv List of Figures ................................................................................................................................... xv List of Abbreviations ..................................................................................................................... xvii 1 Literature Review .......................................................................................................................
Recommended publications
  • Aurora Kinase a in Gastrointestinal Cancers: Time to Target Ahmed Katsha1, Abbes Belkhiri1, Laura Goff3 and Wael El-Rifai1,2,4*
    Katsha et al. Molecular Cancer (2015) 14:106 DOI 10.1186/s12943-015-0375-4 REVIEW Open Access Aurora kinase A in gastrointestinal cancers: time to target Ahmed Katsha1, Abbes Belkhiri1, Laura Goff3 and Wael El-Rifai1,2,4* Abstract Gastrointestinal (GI) cancers are a major cause of cancer-related deaths. During the last two decades, several studies have shown amplification and overexpression of Aurora kinase A (AURKA) in several GI malignancies. These studies demonstrated that AURKA not only plays a role in regulating cell cycle and mitosis, but also regulates a number of key oncogenic signaling pathways. Although AURKA inhibitors have moved to phase III clinical trials in lymphomas, there has been slower progress in GI cancers and solid tumors. Ongoing clinical trials testing AURKA inhibitors as a single agent or in combination with conventional chemotherapies are expected to provide important clinical information for targeting AURKA in GI cancers. It is, therefore, imperative to consider investigations of molecular determinants of response and resistance to this class of inhibitors. This will improve evaluation of the efficacy of these drugs and establish biomarker based strategies for enrollment into clinical trials, which hold the future direction for personalized cancer therapy. In this review, we will discuss the available data on AURKA in GI cancers. We will also summarize the major AURKA inhibitors that have been developed and tested in pre-clinical and clinical settings. Keywords: Aurora kinases, Therapy, AURKA inhibitors, MNL8237, Alisertib, Gastrointestinal, Cancer, Signaling pathways Introduction stage [9-11]. Furthermore, AURKA is critical for Mitotic kinases are the main proteins that coordinate ac- bipolar-spindle assembly where it interacts with Ran- curate mitotic processing [1].
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Targeted Kinase Inhibitor Profiling Using a Hybrid Quadrupole-Orbitrap Mass Spectrometer
    Targeted Kinase Inhibitor Profiling Note Application Using a Hybrid Quadrupole-Orbitrap Mass Spectrometer 1 2 3 Scott Peterman , Ryan D. Bomgarden , Rosa Viner 574 1Thermo Fisher Scientific, Cambridge, MA;2 Thermo Fisher Scientific, Rockford, IL; 3Thermo Fisher Scientific, San Jose, CA Key Words An emerging technology for identifying kinase inhibitor Q Exactive, targeted peptide quantification, msxSIM, kinome profiling by targets is based on chemical proteomic profiling of kinase MS, desthiobiotin nucleotide probes inhibitor specificity and binding affinity. This technology combines mass spectrometry (MS)-based identification Goal and quantitation with small molecule probe binding and To identify and quantify kinase inhibition by staurosporine using kinase enrichment to determine kinase active site occupancy active sites probes in combination with targeted, multiplexed SIM (msxSIM). during inhibition. One of these methods uses novel biotinylated ATP and/or ADP probes that irreversibly react with conserved lysine residues of kinase ATP binding Introduction sites.1,2 Selective enrichment of active-site peptides from Protein kinases are key enzymes involved in a wide array labeled kinase digests dramatically reduces background of complex cellular functions and pathways. Misregulation matrix and increases signal for MS analysis of low- or mutation of protein kinases underlies numerous disease abundance kinase peptides. Using this method, more than states, including tumorigenesis, making them ideal candidates 400 different protein and lipid kinases from various for drug development. However, identifying specific mammalian tissues and cell lines have been identified and kinase inhibitors is challenging due to the high degree of functionally assayed using targeted acquisition on an ion homology among subfamily members of the 500+ human trap mass spectrometer.1 The assays are available kinases.
    [Show full text]
  • RASSF1A Interacts with and Activates the Mitotic Kinase Aurora-A
    Oncogene (2008) 27, 6175–6186 & 2008 Macmillan Publishers Limited All rights reserved 0950-9232/08 $32.00 www.nature.com/onc ORIGINAL ARTICLE RASSF1A interacts with and activates the mitotic kinase Aurora-A L Liu1, C Guo1, R Dammann2, S Tommasi1 and GP Pfeifer1 1Division of Biology, Beckman Research Institute, City of Hope Cancer Center, Duarte, CA, USA and 2Institute of Genetics, University of Giessen, Giessen, Germany The RAS association domain family 1A (RASSF1A) gene tumorigenesis and carcinogen-induced tumorigenesis is located at chromosome 3p21.3 within a specific area of (Tommasi et al., 2005; van der Weyden et al., 2005), common heterozygous and homozygous deletions. RASS- supporting the notion that RASSF1A is a bona fide F1A frequently undergoes promoter methylation-asso- tumor suppressor. However, it is not fully understood ciated inactivation in human cancers. Rassf1aÀ/À mice how RASSF1A is involved in tumor suppression. are prone to both spontaneous and carcinogen-induced The biochemical function of the RASSF1A protein is tumorigenesis, supporting the notion that RASSF1A is a largely unknown. The homology of RASSF1A with the tumor suppressor. However, it is not fully understood how mammalian Ras effector novel Ras effector (NORE)1 RASSF1A is involved in tumor suppression pathways. suggests that the RASSF1A gene product may function Here we show that overexpression of RASSF1A inhibits in signal transduction pathways involving Ras-like centrosome separation. RASSF1A interacts with Aurora-A, proteins. However, recent data indicate that RASSF1A a mitotic kinase. Surprisingly, knockdown of RASS- itself binds to RAS only weakly and that binding to F1A by siRNA led to reduced activation of Aurora-A, RAS may require heterodimerization of RASSF1A and whereas overexpression of RASSF1A resulted in in- NORE1 (Ortiz-Vega et al., 2002).
    [Show full text]
  • Structure-Based Discovery and Bioactivity Evaluation of Novel
    molecules Article Structure-Based Discovery and Bioactivity Evaluation of Novel Aurora-A Kinase Inhibitors as Anticancer Agents via Docking-Based Comparative Intermolecular Contacts Analysis (dbCICA) Majd S. Hijjawi 1 , Reem Fawaz Abutayeh 2 and Mutasem O. Taha 3,* 1 Department of Pharmacology, Faculty of Medicine, The University of Jordan, Amman 11942, Jordan; [email protected] 2 Department of Pharmaceutical Chemistry and Pharmacognosy, Faculty of Pharmacy, Applied Science Private University, Amman 11931, Jordan; [email protected] 3 Department of Pharmaceutical Sciences, Faculty of Pharmacy, University of Jordan, Amman 11942, Jordan * Correspondence: [email protected]; Tel.: +962-6-535-5000 Academic Editors: Helen Osborn, Mohammad Najlah, Jean Jacques Vanden Eynde, Annie Mayence and Tien L. Huang Received: 15 October 2020; Accepted: 11 December 2020; Published: 18 December 2020 Abstract: Aurora-A kinase plays a central role in mitosis, where aberrant activation contributes to cancer by promoting cell cycle progression, genomic instability, epithelial-mesenchymal transition, and cancer stemness. Aurora-A kinase inhibitors have shown encouraging results in clinical trials but have not gained Food and Drug Administration (FDA) approval. An innovative computational workflow named Docking-based Comparative Intermolecular Contacts Analysis (dbCICA) was applied—aiming to identify novel Aurora-A kinase inhibitors—using seventy-nine reported Aurora-A kinase inhibitors to specify the best possible docking settings needed to fit into the active-site binding pocket of Aurora-A kinase crystal structure, in a process that only potent ligands contact critical binding-site spots, distinct from those occupied by less-active ligands. Optimal dbCICA models were transformed into two corresponding pharmacophores.
    [Show full text]
  • Genetic Mutations and Mechanisms in Dilated Cardiomyopathy
    Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, … , Jessica R. Golbus, Megan J. Puckelwartz J Clin Invest. 2013;123(1):19-26. https://doi.org/10.1172/JCI62862. Review Series Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of congestive heart failure. In hypertrophic cardiomyopathy (HCM), cardiac output is limited by the thickened myocardium through impaired filling and outflow. Mutations in the genes encoding the thick filament components myosin heavy chain and myosin binding protein C (MYH7 and MYBPC3) together explain 75% of inherited HCMs, leading to the observation that HCM is a disease of the sarcomere. Many mutations are “private” or rare variants, often unique to families. In contrast, dilated cardiomyopathy (DCM) is far more genetically heterogeneous, with mutations in genes encoding cytoskeletal, nucleoskeletal, mitochondrial, and calcium-handling proteins. DCM is characterized by enlarged ventricular dimensions and impaired systolic and diastolic function. Private mutations account for most DCMs, with few hotspots or recurring mutations. More than 50 single genes are linked to inherited DCM, including many genes that also link to HCM. Relatively few clinical clues guide the diagnosis of inherited DCM, but emerging evidence supports the use of genetic testing to identify those patients at risk for faster disease progression, congestive heart failure, and arrhythmia. Find the latest version: https://jci.me/62862/pdf Review series Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, Jessica R. Golbus, and Megan J. Puckelwartz Department of Human Genetics, University of Chicago, Chicago, Illinois, USA. Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of conges- tive heart failure.
    [Show full text]
  • HIPK2 and Extrachromosomal Histone H2B Are Separately Recruited by Aurora-B for Cytokinesis
    Oncogene https://doi.org/10.1038/s41388-018-0191-6 ARTICLE HIPK2 and extrachromosomal histone H2B are separately recruited by Aurora-B for cytokinesis 1 1 2 3 2 Laura Monteonofrio ● Davide Valente ● Manuela Ferrara ● Serena Camerini ● Roberta Miscione ● 3 1,2 1 Marco Crescenzi ● Cinzia Rinaldo ● Silvia Soddu Received: 14 November 2017 / Revised: 24 January 2018 / Accepted: 5 February 2018 © The Author(s) 2018. This article is published with open access Abstract Cytokinesis, the final phase of cell division, is necessary to form two distinct daughter cells with correct distribution of genomic and cytoplasmic materials. Its failure provokes genetically unstable states, such as tetraploidization and polyploidization, which can contribute to tumorigenesis. Aurora-B kinase controls multiple cytokinetic events, from chromosome condensation to abscission when the midbody is severed. We have previously shown that HIPK2, a kinase involved in DNA damage response and development, localizes at the midbody and contributes to abscission by phosphorylating extrachromosomal histone H2B at Ser14. Of relevance, HIPK2-defective cells do not phosphorylate H2B 1234567890();,: and do not successfully complete cytokinesis leading to accumulation of binucleated cells, chromosomal instability, and increased tumorigenicity. However, how HIPK2 and H2B are recruited to the midbody during cytokinesis is still unknown. Here, we show that regardless of their direct (H2B) and indirect (HIPK2) binding of chromosomal DNA, both H2B and HIPK2 localize at the midbody independently of nucleic acids. Instead, by using mitotic kinase-specific inhibitors in a spatio-temporal regulated manner, we found that Aurora-B kinase activity is required to recruit both HIPK2 and H2B to the midbody.
    [Show full text]
  • Spatiotemporal Dynamics of Aurora B-PLK1-MCAK Signaling Axis
    www.nature.com/scientificreports OPEN Spatiotemporal dynamics of Aurora B-PLK1-MCAK signaling axis orchestrates kinetochore Received: 21 October 2014 Accepted: 13 May 2015 bi-orientation and faithful Published: 24 July 2015 chromosome segregation Hengyi Shao1, Yuejia Huang2,3, Liangyu Zhang1,3, Kai Yuan1, Youjun Chu1,3, Zhen Dou1,2, Changjiang Jin1, Minerva Garcia-Barrio3, Xing Liu1,2,3 & Xuebiao Yao1 Chromosome segregation in mitosis is orchestrated by the dynamic interactions between the kinetochore and spindle microtubules. The microtubule depolymerase mitotic centromere-associated kinesin (MCAK) is a key regulator for an accurate kinetochore-microtubule attachment. However, the regulatory mechanism underlying precise MCAK depolymerase activity control during mitosis remains elusive. Here, we describe a novel pathway involving an Aurora B-PLK1 axis for regulation of MCAK activity in mitosis. Aurora B phosphorylates PLK1 on Thr210 to activate its kinase activity at the kinetochores during mitosis. Aurora B-orchestrated PLK1 kinase activity was examined in real- time mitosis using a fluorescence resonance energy transfer-based reporter and quantitative analysis of native PLK1 substrate phosphorylation. Active PLK1, in turn, phosphorylates MCAK at Ser715 which promotes its microtubule depolymerase activity essential for faithful chromosome segregation. Importantly, inhibition of PLK1 kinase activity or expression of a non-phosphorylatable MCAK mutant prevents correct kinetochore-microtubule attachment, resulting in abnormal anaphase with chromosome bridges. We reason that the Aurora B-PLK1 signaling at the kinetochore orchestrates MCAK activity, which is essential for timely correction of aberrant kinetochore attachment to ensure accurate chromosome segregation during mitosis. During cell division, accurate chromosome segregation requires dynamic interactions between kineto- chores and spindle microtubules (MTs), which results in accurate chromosome bi-orientation1–4.
    [Show full text]
  • Profiling Data
    Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8
    [Show full text]
  • Supplementary Table 1
    SI Table S1. Broad protein kinase selectivity for PF-2771. Kinase, PF-2771 % Inhibition at 10 μM Service Kinase, PF-2771 % Inhibition at 1 μM Service rat RPS6KA1 (RSK1) 39 Dundee AURKA (AURA) 24 Invitrogen IKBKB (IKKb) 26 Dundee CDK2 /CyclinA 21 Invitrogen mouse LCK 25 Dundee rabbit MAP2K1 (MEK1) 19 Dundee AKT1 (AKT) 21 Dundee IKBKB (IKKb) 16 Dundee CAMK1 (CaMK1a) 19 Dundee PKN2 (PRK2) 14 Dundee RPS6KA5 (MSK1) 18 Dundee MAPKAPK5 14 Dundee PRKD1 (PKD1) 13 Dundee PIM3 12 Dundee MKNK2 (MNK2) 12 Dundee PRKD1 (PKD1) 12 Dundee MARK3 10 Dundee NTRK1 (TRKA) 12 Invitrogen SRPK1 9 Dundee MAPK12 (p38g) 11 Dundee MAPKAPK5 9 Dundee MAPK8 (JNK1a) 11 Dundee MAPK13 (p38d) 8 Dundee rat PRKAA2 (AMPKa2) 11 Dundee AURKB (AURB) 5 Dundee NEK2 11 Invitrogen CSK 5 Dundee CHEK2 (CHK2) 11 Invitrogen EEF2K (EEF-2 kinase) 4 Dundee MAPK9 (JNK2) 9 Dundee PRKCA (PKCa) 4 Dundee rat RPS6KA1 (RSK1) 8 Dundee rat PRKAA2 (AMPKa2) 4 Dundee DYRK2 7 Dundee rat CSNK1D (CKId) 3 Dundee AKT1 (AKT) 7 Dundee LYN 3 BioPrint PIM2 7 Invitrogen CSNK2A1 (CKIIa) 3 Dundee MAPK15 (ERK7) 6 Dundee CAMKK2 (CAMKKB) 1 Dundee mouse LCK 5 Dundee PIM3 1 Dundee PDPK1 (PDK1) (directed 5 Invitrogen rat DYRK1A (MNB) 1 Dundee RPS6KB1 (p70S6K) 5 Dundee PBK 0 Dundee CSNK2A1 (CKIIa) 4 Dundee PIM1 -1 Dundee CAMKK2 (CAMKKB) 4 Dundee DYRK2 -2 Dundee SRC 4 Invitrogen MAPK12 (p38g) -2 Dundee MYLK2 (MLCK_sk) 3 Invitrogen NEK6 -3 Dundee MKNK2 (MNK2) 2 Dundee RPS6KB1 (p70S6K) -3 Dundee SRPK1 2 Dundee AKT2 -3 Dundee MKNK1 (MNK1) 2 Dundee RPS6KA3 (RSK2) -3 Dundee CHEK1 (CHK1) 2 Invitrogen rabbit MAP2K1 (MEK1) -4 Dundee
    [Show full text]
  • Dilated Cardiomyopathy Caused by Truncating Titin Variants
    BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Med Genet Dilated cardiomyopathy caused by truncating titin variants – Long-term outcomes, arrhythmias, response to treatment and sex differences SUPPLEMENTARY MATERIAL Christoffer Rasmus Vissing1*, MD; Torsten Bloch Rasmussen2, MD, PhD; Anne Mette Dybro2, MD; Morten Salling Olesen3,4, MSc, PhD; Lisbeth Nørum Pedersen5; MSc, PhD; Morten Jensen, MD, PhD2; Henning Bundgaard1, MD, DMSc; Alex Hørby Christensen1,6 MD, PhD 1The Capital Region’s Unit for Inherited Cardiac Diseases, Department of Cardiology, Rigshospitalet, Copenhagen University Hospital, Copenhagen, Denmark 2Department of Cardiology, Aarhus University Hospital, Aarhus, Denmark 3Laboratory for Molecular Cardiology, University of Copenhagen, Copenhagen, Denmark 4Department of Biomedical Sciences, University of Copenhagen, Copenhagen, 2200 N, Denmark 5Department of Molecular Medicine, Aarhus University Hospital, Denmark. 6Department of Cardiology, Herlev-Gentofte Hospital, Copenhagen University Hospital, Copenhagen, Denmark *Corresponding author: Christoffer Rasmus Vissing, MD The Capital Region’s Unit for Inherited Cardiac Diseases, Department of Cardiology, The Heart Center, Rigshospitalet, Copenhagen University Hospital, Blegdamsvej 9, DK-2100 Copenhagen, Denmark, E-mail: [email protected]; Phone +45 3545 5045 1 Vissing CR, et al. J Med Genet 2020;0:1–10.
    [Show full text]
  • The Aurora B Kinase Activity Is Required for the Maintenance of the Differentiated State of Murine Myoblasts
    Cell Death and Differentiation (2009) 16, 321–330 & 2009 Macmillan Publishers Limited All rights reserved 1350-9047/09 $32.00 www.nature.com/cdd The Aurora B kinase activity is required for the maintenance of the differentiated state of murine myoblasts G Amabile1,2, AM D’Alise1, M Iovino1, P Jones3, S Santaguida4, A Musacchio4, S Taylor5 and R Cortese*,1 Reversine is a synthetic molecule capable of inducing dedifferentiation of C2C12, a murine myoblast cell line, into multipotent progenitor cells, which can be redirected to differentiate in nonmuscle cell types under appropriate conditions. Reversine is also a potent inhibitor of Aurora B, a protein kinase required for mitotic chromosome segregation, spindle checkpoint function, cytokinesis and histone H3 phosphorylation, raising the possibility that the dedifferentiation capability of reversine is mediated through the inhibition of Aurora B. Indeed, here we show that several other well-characterized Aurora B inhibitors are capable of dedifferentiating C2C12 myoblasts. Significantly, expressing drug-resistant Aurora B mutants, which are insensitive to reversine block the dedifferentiation process, indicating that Aurora B kinase activity is required to maintain the differentiated state. We show that the inhibition of the spindle checkpoint or cytokinesis per se is not sufficient for dedifferentiation. Rather, our data support a model whereby changes in histone H3 phosphorylation result in chromatin remodeling, which in turn restores the multipotent state. Cell Death and Differentiation (2009) 16, 321–330; doi:10.1038/cdd.2008.156; published online 31 October 2008 Lineage-restricted cells can be reprogramed to a state Evidence is emerging that the role of Aurora B is not of pluripotency by several different manipulations, including restricted to mitosis and cell division.
    [Show full text]