Download This Publication (PDF File)
Total Page：16
File Type：pdf, Size：1020Kb
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Aug. 2006, p. 5626–5630 Vol. 72, No. 8 0099-2240/06/$08.00ϩ0 doi:10.1128/AEM.00586-06 Copyright © 2006, American Society for Microbiology. All Rights Reserved. Development of a Dinoflagellate-Oriented PCR Primer Set Leads to Detection of Picoplanktonic Dinoflagellates from Long Island Sound† Senjie Lin,1* Huan Zhang,1 Yubo Hou,1 Lilibeth Miranda,1 and Debashish Bhattacharya2 Department of Marine Sciences, University of Connecticut, Groton, Connecticut 06340,1 and Department of Biological Sciences and Roy J. Carver Center for Comparative Genomics, University of Iowa, 446 Biology Building, Iowa City, Iowa 52242-13242 Received 12 March 2006/Accepted 18 May 2006 We developed dinoflagellate-specific 18S rRNA gene primers. PCR amplification using these oligonucleo- tides for a picoplanktonic DNA sample from Long Island Sound yielded 24 clones, and all but one of these clones were dinoflagellates primarily belonging to undescribed and Amoebophrya-like lineages. These results highlight the need for a systematic investigation of picodinoflagellate diversity in both coastal and oceanic ecosystems. Dinoflagellates have received considerable attention due to Research, Orange, CA). With these DNA samples as tem- their ecological and economical significance and their remark- plates, PCR was performed using five combinations of the able cytological and genetic features (6, 7, 20). However, our primers, as follows: primers 18ScomF1 and Dino18SR1 (ex- knowledge of the species diversity of these organisms remains pected product size, 0.65 kb), primers 18ScomF1 and limited even though novel living (2, 3, 10, 14) and fossil lin- Dino18SR2 (0.92 kb), primers Dino18F1 and 18Scom R1 (1.60 eages (4, 19) have been discovered. Knowledge of the diversity kb), primers Dino18F2 and 18Scom R1 (0.92 kb), and primers of “small” dinoflagellates is particularly deficient. The recent Dino18F3 and 18S com R1 (0.90 kb). All primer sets except the discovery of ultraplanktonic (Ͻ5-m) and picoplanktonic (Ͻ3- Dino18SF2-18ScomR1 set exhibited specificity for dinoflagel- m) dinoflagellates in Antarctica and the Pacific Ocean (13, late 18S rRNA genes, which allowed amplification from most 15), respectively, is the first demonstration of a rich biodiver- taxa examined (Table 2). The only exceptions were O. marina sity of small dinoflagellates that have escaped routine micro- (often referred to as an ancestral dinoflagellate [17] or a scopic detection. A better understanding of dinoflagellate predinoflagellate [18]) and Exuviaella cassubica, for which all biodiversity requires targeted approaches, particularly for pico- primers failed, likely because their 18S rRNA gene sequences planktonic species. are significantly divergent. Of the four pairs of dinoflagellate- Development of dinoflagellate-oriented primers. Based on a specific primers, 18ScomF1-Dino18SR1 and Dino18F1- large database of nuclear small-subunit (18S) rRNA genes, we 18ScomR1 showed superior sensitivity and were able to detect designed PCR primers that target dinoflagellates. A total of 1 to 10 cells/reaction mixture for most of the dinoflagellates 140 18S rRNA gene sequences, including sequences from tested. Primers Dino18F1 and 18Scom R1 was chosen for dinoflagellates, diatoms, chlorophytes, haptophytes, crypto- further study because they spanned a larger 18S rRNA gene phytes, and other algae, were obtained from GenBank and region (1.6 kb). were aligned using ClustalW1.8; 11 of the dinoflagellate spe- Detection of picodinoflagellates in Long Island Sound. cies were sequenced in this study (GenBank accession no. Three water samples collected on 8 September 2005 along the DQ388456 to DQ388466). Regions unique to dinoflagellates boat dock of the University of Connecticut Avery Point cam- were used to design three forward and two reverse PCR prim- pus (Long Island Sound) were combined and mixed. Micro- ers (Table 1), which were paired with previously described scopic examination of a subsample revealed that phytoplank- eukaryotic 18S rRNA gene universal primers (22) for DNA ton lineages such as Nitzschia, Navicula, Chaetoceros, and amplification. Eucampia were dominant. A 2-liter subsample was pre- The primers were tested with 33 genera of cultured screened (100-m mesh), and this was followed by passage dinoflagellates (35 species, including Oxyrrhis marina), as well through a 3-m polycarbonate membrane (Nuclepore, Pleas- as nine other taxa (Table 2). Algal cultures were grown in f/2 anton, CA) under a low vacuum pressure (Ͻ10 lb/in2). One medium (28‰ or 15‰ salinity), cells were harvested, and liter of the filtrate was collected and filtered onto a 0.2-m- DNA was purified as previously described (23). Briefly, after pore-size, 47-mm-diameter polycarbonate membrane (Nucle- cell lysis in 1 ml DNA buffer (100 mM EDTA [pH 8.0], 0.5% pore). The filter membrane was cut into small pieces using Ϫ1 sodium dodecyl sulfate, 200 gml proteinase K), DNA was sterile scissors, placed in a 1.5-ml microcentrifuge tube, and purified using DNA Clean and Concentrator columns (Zymo stored at Ϫ80°C until DNA extraction. To examine whether any large plankton were present in the sample, 100 ml of the 3-m filtrate was filtered onto a 0.2-m-pore size, 25-mm- * Corresponding author. Mailing address: Department of Marine diameter black Poretics polycarbonate membrane (Osmonics Sciences, University of Connecticut, Groton, CT 06340. Phone: (860) Inc., Minnetonka, MN), fixed with 1% paraformaldehyde, and 405-9168. Fax: (860) 405-9153. E-mail: [email protected]. † Supplemental material for this article may be found at http://aem stained with 0.005% acridine orange. Observation with an epi- .asm.org/. fluorescence microscope (Olympus BX51) revealed only small 5626 VOL. 72, 2006 DINOFLAGELLATE PCR PRIMERS AND PICODINOFLAGELLATES 5627 TABLE 1. 18S rRNA gene PCR primers designed in the present study organisms except for one large cell (length, ϳ12 m) that Source or appeared to be a Heterocapsa cell. Primera Sequence (5Ј–3Ј) reference DNA extracted from the Ͻ3-m plankton sample as described Dino18SF1 AAGGGTTGTGTTYATTAGNTACARAAC This study above was used for PCR amplification with primers Dino18F1 Dino18SF2 ATTAATAGGGATAGTTGGGGGC This study and 18Scom R1. The PCR was performed using Takara ExTaq Dino18SF3 GTCAGAGGTGAAATTCTTGGATTTGTT This study Dino18SR1 GAGCCAGATRCDCACCCA This study DNA polymerase (Takara Mirus Bio, Madison, WI) following the Dino18SR2 TGCTTTCGCAGTAGTYYGTCTTTAAC This study manufacturer’s instructions, with an annealing temperature of 18ScomF1 GCTTGTCTCAAAGATTAAGCCATGC 22 18ScomR1 CACCTACGGAAACCTTGTTACGAC 22 58°C. The amplicon was cloned into a TA vector, and 24 of the aIn primer designations, F indicates a forward primer and R indicates a reverse clones were randomly selected and sequenced (GenBank acces- primer. sion no. DQ386737 to DQ386760). A BLAST search showed that TABLE 2. Specificity of primers (in five pairs) with various protists Amplification with the indicated primer set Organism 18ScomF1- 18ScomF1- Dino18SF1- Dino18SF2- Dino18SF3- Dino18SR1 Dino18SR2 18ScomR1 18ScomR1 18ScomR1 Nondinoflagellates Ditylum brightwellii ϪϪϪϪ Ϫ Dunaliella tertiolecta ϪϪϪϪ Ϫ Emiliania huxleyii ϪϪϪϩ Ϫ Isochrysis galbana ϪϪϪϩ Ϫ Neoparamoeba aestuarina ϪϪϪϩ Ϫ Nitzschia alba ϪϪϪϪ Ϫ Perkinsus marinus Ϫϩϩϩ ϩ Rhodomonas sp. ϪϪϪϩ Ϫ Skeletonema costatum ϪϪϪϪ Ϫ Dinoflagellates Adenoides eludens ϩϩϩϩ ϩ Akashiwo sanguinea ϩϩϩϩ ϩ Alexandrium affine ϩϩϩϩ ϩ Alexandrium tamarense ϩϩϩϩ ϩ Amoebophrya sp. ϪϪϩϩ Ϫ Amphidinium carterae ϩϩϪϩ Ϫ Ceratium longipes ϩϩϩϩ ϩ Ceratocorys horrida ϩϩϩϪ ϩ Coolia monotis ϩϪϩϪ ϩ Crypthecodinium cohnii ϩϩϪϩ ϩ Cryptoperidiniopsis sp. strain CCMP1828 ϩϩϩϩ ϩ Dinophysis acuminata ϩϩϩϩ ϩ Exuviaella cassubica (synonym, Prorocentrum ϩϩϩϩ ϩ cassubicum) Exuviaella pusilla (synonym, Prorocentrum ϪϪϪϪ Ϫ nanum) Gambierdiscus toxicus ϩϪϪϩ Ϫ Gonyaulax cochlea ϩϩϪϩ ϩ Gymnodinium catenatum ϩϩϩϩ ϩ Gyrodinium dorsum ϩϩϩϩ ϩ Heterocapsa triquetra ϩϩϩϩ ϩ Karenia brevis ϩϩϩϩ ϩ Karlodinium micrum (synonym, Gyrodinium ϩϩϩϩ ϩ galatheanum) Katodinium rotundatum ϩϩϩϩ ϩ Lingulodinium polyedrum ϩϩϩϪ ϩ Noctiluca scintillans Ϫϩϩϩ ϩ Oxyrrhis marina ϪϪϪϪ Ϫ Peridinium foliaceum (ϭ Kryptoperidinium Ϫϩϩϩ ϩ foliaceum) Pfiesteria piscicida ϩϩϩϩ ϩ Pseudopfiesteria shumwayae ϩϩϩϩ ϩ Prorocentrum lima ϩϩϩϪ Ϫ Prorocentrum minimum ϩϩϩϩ ϩ Pyrocystis lunula ϩϩϪϩ ϩ Pyrodinium bahamense ϩϩϩϩ ϩ Scrippsiella sweeneyae ϩϩϩϩ ϩ Symbiodinium microadriaticum ϩϩϩϩ ϩ Thecadinium inclinatum ϩϩϩϩ ϩ 5628 LIN ET AL. APPL.ENVIRON.MICROBIOL. FIG. 1. Maximum likelihood tree of dinoflagellates constructed using Phyml V2.4.4. T. gondii was used as the outgroup. The parameters of the GTR ϩ I ϩ⌫model of nucleotide substitution were estimated as follows: the frequencies of nucleotides were 0.23931 for A, 0.31386 for T, 0.18944 for C, and 0.25739 for G; the rate parameters were 1.1979 for A 7 C, 3.3746 for A 7 G, 1.3953 for A 7 T, 0.9178 for C 7 G, 5.1569 for C 7 T, and 1.0 (fixed) for G 7 T; the fraction of invariant sites was 0.2824; the shape parameter (␣) was 0.6838; and the likelihood value (loglk) was Ϫ34037. The robustness of species groups was assessed using the bootstrap approach with 100 resamplings. The thickest lines indicate bootstrap values of Ͼ80%, the thick lines indicate bootstrap values of Ͼ50%, and the thin lines indicate bootstrap values of Ͻ50%. Scale bar ϭ 0.1 substitution per base. VOL. 72, 2006 DINOFLAGELLATE PCR PRIMERS AND PICODINOFLAGELLATES 5629 all 24 clones were related to dinoflagellates. These sequences shown). In addition, lineages close to Gymnodinium/Symbio-