Malaysian Fisheries Journal 10: 93 - 104 (December 2011)

Induced in vitro Mutagenesis of Aquatic Plant Cryptocoryne willisii Engler ex Baum Using Gamma Irradiation to Develop New Varieties

NORHANIZAN SAHIDIN1/,3/, NURAINI ABD WAHID3/, ROFINA YASMIN OTHMAN2/.3/ & NORZULAANI KHALID2/,3/

1/Freshwater Fisheries Research Division, FRI Glami Lemi, Department of Fisheries, Jelebu, 71650 Negeri Sembilan, Malaysia 2/Centre for Research in Biotechnology for Agriculture (CEBAR), University of Malaya, 50603 Kuala Lumpur 3/Institute of Biological Sciences, Faculty of Science, University of Malaya, 50603 Kuala Lumpur

Abstract: Two new varieties of Cryptocoryne willisii were developed through mutagenesis in this work, where shoot-tip explants of C. willisii were subjected to a range of 60Co gamma ray irradiations: (0, 100, 200, 300, 400,

500, 600, 700 and 800 Gray). The LD50 for the tissue culture plants of C. willisii was at 25 Gy, which was considered as an appropriate dosage to induced mutations in this plant. About two thousand shoot-tip explants were irradiated at 25 Gy and variants from the M1, M2, M3 and M4 generations were screened for morphological differences. The shoots were th subcultured repeatedly until the 4 generation (M4) to ensure stability of mutants. Although initially many regenerants with different morphological traits were produced, only two mutants remained stable. The mutants obtained were dwarf plants (D1) and plants of taller stature with pigmented leaves (G1) in comparison to control cultures. This was verified from the significant F value from the ANOVA test, where P<0.05. The Inter-Retrotransposon Amplified Polymorphism (IRAP) markers were used to distinguish the D1 and G1 genomes from normal C. willisii genomes. The analysis revealed two specific bands 325 bp and 420 bp using Nikita primer for the D1 mutant and 240 bp and 300 bp using combination of 3'LTR primer and LTR 6149 primer for the G1 mutant.

Keywords: Cryptocoryne willisii, gamma irradiation, mutagenesis, Inter-Retrotransposon Analysis Polymorphism analysis

Abstrak: Dua variasi baru Cryptocoryne willisii teleh dibangunkan melalui mutagenesis dalam kajian ini, di mana eksplan pucuk C. Willisii telah didedahkankepadasinaran gamma 60Co yang berbeza: (0, 100, 200, 300, 400, 500, 600, 700 and 800 Gray). Dos kematian 50% (LD50) untuktumbuhan tisu kultur C. xwillisii ialah pada dos 25 Gray. Dan oleh itu, nilai dos tersebut telah digunakan untuk mengakibatkan mutasi pada tumbuhan. Lebih kurang dua ribu eksplan pucuk telah diradiasi pada 25 Gy dan varian-varian dari generasi M1, M2, M3 and M4 telah ditapis untuk perubahan morfologi. Pucuk-pucuk tersebut telah disubkultur berulang kali sehingga generasi ke-4 (M4) bagi memastikan kestabilan mutan.Walaupun pada peringkat awal banyak regeneran dengansifat-sifat morfologi yang berbeza terhasil, namun hanya dua sahaja mutan yang stabil. Mutan yang terhasil adalah tumbuhan kerdil (D1) dan tumbuhan tinggi dengan daun berpigmentasi (G1) berbanding dengan kultur kawalan. Ini disahkan oleh nilai F signifikan dari ujian ANOVA, dimanaP<0.05. Penanda Inter-Retrotransposon Amplified Polymorphism (IRAP) telah digunakan untuk pengesahan genom D1 dan G1 dari normal genom C. willisii. Analisis tersebut telah dapat menunjukkan dua jalur spesifik 325 bp dan 420 bp dengan menggunakan primer Nikita untuk mutan D1 dan untuk G1, dua jalur spesifik adalah 240 bp dan 300 bp dengan menggunakan primer 3'LTR primer dan LTR 6149.

93 Induced Mutagenesis of Cryptocoryne willisii Using Gamma Irradiation 94

Introduction

Cryptocoryne willisii Engler ex Baum belongs to the family Araceae, genus Cryptocoryne Fischer ex Wydl is commonly distributed in Sri Lanka. Its synonyms are C. pseudo-beckettii (De Wit, 1964), C. axelrodii Rataj (Rataj, 1977) and C. undulata Wendt (Rataj, 1977).

C. willisii is a small aquatic plant, originated from Sri Lanka. In nature, this plant propagates through runners. The substrate for planting in aquarium is plain washed gravel, with lighting from moderate to bright white light, at pH 6.8-7.2 (aquarium water), and water hardness at 3-8ºdH. The ideal water temperature for the growth of Cryptocoryne is around 20-26ºC. In aquarium, C. willisii can grow up to 20 cm height. The morphology of the stemmed leaves is oblong-oval to lanceolate and green in colour with brownish to green stems.

C. willisii seldom flowers and during seasonal flowering it produces non viable seeds when grown in natural habitat. (Rataj, 1977; Windelov, 1987; Cook, 1996). Thus, production of new plant variety through cross breeding between species is not possible. However, C. willisii is one of the most popular aquarium plants in the world and a novel variety is very much sought for in order to be competitive in this aquarium business (Hiscock, 2005). In this paper, novel mutants of C. willisii were obtained through gamma irradiation.

Mutants were distinguished by the morphological differences from normal plants. Besides that, mutants were also distinguished by using molecular marker technique. Recently, more advance molecular marker techniques are used in mutation study. Advance molecular marker techniques are the combination of several advantages of basic techniques and incorporated with modification in the methodology to gain better result of the genetic material. The among advance techniques are the transposable elements-based molecular marker andretrotransposon-based molecular marker including (1) Inter-retrotransposon amplified polymorphism (IRAP) and Retrotransposon-microsatellite amplified polymorphism (REMAP), Norhanizan et al. 95

(2) sequence-specific amplification polymorphism (S-SAP), (3) Retrotransposon-based insertion polymorphism (RBIP).

IRAP analysis was firstly described by Kalendar et al. (1999). IRAP is based on the PCR amplification of genomic DNA fragments, which lie between two-retrotransposon insertion sites.

Polymorphism is detected by the presence or absence of the PCR product. Lack of amplification indicates the absence of the retrotransposon at the particular locus. The technique was originally developed using the

BARE-1 retrotransposon, which is present in the barley genome in numerous copies. About thirty bands were visualized by a single PCR reaction (Kalendar et al., 1999). IRAP markers were extremely polymorphic, which made them useful for evaluating intraspecific relationships, investigating linkage, evolution, determination of varieties and mutants and genetics diversity in plants (Dariusz, 2006).

The objective of this study is to develop new variety of C.willisii by using gamma irradiation.

Materials and Methods

Plant material and growth conditions

Plants of C. willisii, were received from Freshwater Fisheries Research Centre (Titi, Jelebu,

Negeri Sembilan, Malaysia) were used as starting material. The shoots were cut from rhizome and were used as explants for micropropagation. The shoots were excised at 1.5 cm from runners and washed under running tap water, 1 h. The shoots were then agitated and soaked in warm soapy water (added 2-3 drops of tween 20) for 1 min. Then the shoots were rinse again under tap water for 15 min.

Under aseptic conditions (in laminar flow cabinet), the shoots were surface sterilized with 30% chlorox for 30 s and rinsed three times in sterile distilled water. The shoots were then blot-dried on sterile filter paper and cut into appropriate size on sterile petri dish. The sterile explants were cut into small pieces about 1.0 cm length each.

The clean explants were then cultured on Murashige and Skoog (MS) medium (Murashige and

Skoog, 1962) supplemented with 3% (30g/L) sucrose with 20 l BA (N6-benzyladenine) and 0.5 l NAA (1- Induced Mutagenesis of Cryptocoryne willisii Using Gamma Irradiation 96

napthaleneacetic acid). The media pH was adjusted to 5.8 with 1N NaOH plus to the adding 2 g of Phytagel as the gelling agent.

The cultures were maintained in the growth room at 25 ± 2°C with 60-70% relative humidity in a 16 hour light cycle with fluorescence light of 1000-3000 lux. The plants were subcultured every 60 days until sufficient numbers of regenerants were available for mutagenesis. For this study, more than 2000 regenerants were used.

Gamma irradiation

LD50 experiment

Gamma irradiation was carried out using 60Co source (Gamma cell 220, Physic Department,

Faculty of Science, University Malaya, Kuala Lumpur, Malaysia). Regenerants were excised and transferred to 30 ml universal container with growth regulator-free semi-solid MS medium. One universal container consists of ten regenerants. The regenerants were cultured for 7 days in the medium before being subjected to mutagenesis experiment.

LD50 experiment was done for optimizing the suitable dose to induce mutation. For the LD50 experiment, regenerants were exposed to different doses 0-800 Gray (Gy). After one-day treatment, the irradiated plants were transferred into fresh MS medium with 20 l BA and 0.5 l NAA individually in 30 ml universal container. Observations to access plant survival following treatment with different high dosages of gamma ray were made after 30, 40 and 60 days in culture; however these subjected to high dosages were only occurred after 60 days.

Mutagenesis experiment

For the mutagenesis experiment, optimum dosage of the LD50 that was 25 Gy was used as the treatment dosage. More than 2000 regenerants of C. willisii were exposed to acute irradiation of 60Co at treatment dosage. After one-day following treatment, the irradiated individual shoots were transferred into fresh MS medium supplemented with 20 l BA and 0.5 l NAA in 30 ml universal container each. Norhanizan et al. 97

After 60 days in culture, new shoots were seen had developed. The 0 Gy plants served as the control plants. A few variants were observed from irradiated plants in some of the containers, some irradiated plants produce normal shoots, but some did not survive. Shoots from control and selected variant

were subcultured onto fresh medium. This is now the M1 generation. The variant shoots were selected again

th and subcultured repeatedly until the 4 generation (M4) to ensure stability of mutants. Control plants were

also subcultured to the M4 generation.

DNA extraction and Inter-Retrotransposon Amplified Polymorphism (IRAP) Analysis

In most of the plant genomes, retrotransposon are highly abundant and dispersed. The characters of ubiquitous distribution, high copy number and widespread chromosomal dispersion of the retrotransposon have the potential to be used as DNA-based marker system (Kalendar et al., 1999;

Kalendar, 2005; Teo, 2005). The IRAP markers were successfully used in phylogenetic analysis such as in

Spartina sp. (Baumel, 2002), banana (Teo, 2005), Brassica sp. (Karine, 2004) and apple (Kristiina, 2006).

Genomic DNA of D1 mutant, G1 mutant and Control (C) of the Cryptocorynes was extracted from young fresh leaves as previously described in Doyle and Doyle (1990). Following extraction, genomic

DNA samples were diluted with sterile distilled water to 50 ng/l. The IRAP-PCR was performed in a 20 l reaction mixture (rxn) containing 2 l DNA samples, 1 l (5 pmol) primer A and 1l (5 pmol) primer B, 16 l sterile distilled water and Maxime PCR Premix (i-Taq; for 20 l rxn). Component in 20 l reaction Premix:

2.5 U i-TaqTM DNA Polymerase, 2.5 mM each dNTPs, 1X reaction buffer and 1X gel loading buffer).

Amplification was performed using Biometra, T. personal Thermocycler. The PCR reaction parameters consists of: 95C, 2 min; 40 cycles of 95C, 1 min; annealing at 36.3C, 1 min; 72C, a final extension at 72C, 10 min. PCR products were analyzed by electrophoresis on 1% (w/v) agarose gel and detected by ethidium bromide staining. The IRAP banding pattern was scored using Gel-Pro Imager (The

Integrated Solution). Induced Mutagenesis of Cryptocoryne willisii Using Gamma Irradiation 98

Table 1: Primers for IRAP Retrotransposon Accession, Name Sequence source position Z17327 LTR6149 BARE-1® CTCGCTCGCCCACTACATCAACCGCGT TTATT 1993-2012 CTGGTTCGGCCCATGTCTATGTATCCACACATGT Z1 7327 LTR6150 BARE-1¬ A 418-439 Z17327 5’LTR1 BARE-1¬ TTGCCTCTAGGGCATATTTCCAACA 1-26 Z17327 5’LTR2 BARE-1¬ ATCATTCCCTCTAGGGCATAATTC 314-338 Z17327 3’LTR BARE-1® TGTTTCCCATGCGACGTTCCCCAACA 2112-2138 AY054376 Sukkula Sukkula® GATAGGGTCGCATCTTGGGCGTGAC 4301-4326 AY078073 AY078074 Nikita Nikita ® CGCATTTGTTCAAGCCTAAACC AY078075 1-22

Results and Discussion

Gamma irradiation

LD50 experiment

The results of gamma irradiation for the LD50 experiments are shown in Fig. 1 and Fig. 2. At high

dosage experiments (600, 700 and 800 Gy), more than 50% of the irradiated plants survived after 30 days of

incubation. After 40 days incubation, the 0, 100, 150, and 200 Gy irradiated explants still showed more than

50% survival rates. The 250 and 300 Gy irradiated explants showed less than 50% survival rates. All

explants unfortunately died when exposed to dosage higher than 400 Gy.

After 60 days incubation, all explants died when exposed to gamma irradiation at or more than 100

Gy. The results showing that the LD50 can only be achieved if the explants were exposed to dosage lower

than 100 Gy.

At lower dosage experiment (Fig. 2), the 40 to 100 Gy irradiated plants were totally dead after 60 days of

irradiation. From the experiment, the LD50 is between 0 to 35 Gy. And from best linear graph (Fig. 3), the

LD50 is 25 Gy. Norhanizan et al. 99

Figure 1: Percentage of survival of Cryptocoryne willisii on different high dosages of gamma irradiation after 30, 40 and 60 days incubations

Figure 2: Percentage of survival of C. willisii on different low dosages of gamma irradiation after 60 days incubations Induced Mutagenesis of Cryptocoryne willisii Using Gamma Irradiation 100

Figure 3: The graft showed LD50 for C. willisii is 25 Gray

Mutagenesis experiment

th The shoots were subcultured repeatedly until the 4 generation (M4) to ensure stability of the mutants. Although initially many variants were produced, only two mutants remain morphologically stable.

The significant value of the F test in the ANOVA table is 0.000. Reject the hypothesis that means length of the plants are equal across different groups.

The means lengths of the plants are significantly different between the groups. Mean length of normal plants (Picture 1) is 5.18 ± 1.57 cm, mean length for D1 plants (Picture 2) is 3.53 ± 0.89 cm and mean length for G1 plants (Picture 3) is 6.92 ± 1.79 cm.

A total of 36 combinations of primers were screened for marker of the mutant in the present experiment. Out of these combinations, two of the primers were sensitive enough to distinguished the D1 mutant and the G1 mutant from control plants. Norhanizan et al. 101

Picture 1: Normal plants of C. willisii (C)

1cm

Picture 2: Mutant D1, plants showing dwarfness compare to control plants

1cm Picture 3: Mutant G1, plants colours are brownish and taller than control plants Induced Mutagenesis of Cryptocoryne willisii Using Gamma Irradiation 102

The analysis revealed two polymorphic bands (225 bp and 320 bp) using Nikita primer for the D1 mutant (Fig. 4) and revealed two polymorphic bands (240 bp and 300 bp) using combination of 3'LTR primer and LTR 6149 primer for the G1 mutant (Fig. 5). G1 mutant can only be distinguished when the combination primers of 3'LTR primer and LTR 6149 were used.

Figure 4: IRAP profile of the D1 mutant, G1 mutants and C (control) plant of C. willisii obtained with primer Nikita showing two polymorphic bands (arrows). L: 100 bp plus DNA ladder

Figure 5: IRAP profile of the D1 mutant, G1 mutants and C (control) plant of C. willisii obtained with primer 3'LTR x LTR6149 showing two polymorphic bands (arrows). L: 100 bp plus DNA ladder Norhanizan et al. 103

Among the main advantages of in vitro mutagenesis is the ability to uniformly treat large number of cells with mutagen and the cells are able to grow in uniformly under control environment. Multiplication of the mutant clones is possible via micropropagation.

In this study, all regenerants were showing necrosis when exposed to high dosage of gamma

irradiation. Only when the regenerant were subject to lower dose of the gamma ray, the LD50 can be

achieved. The LD50 in the study is 25 Gy and the treatments for mutagenesis are between 0 to 30 Gy. After treatment with gamma irradiation, some of the new shoots showed differences in their morphology, where some showed necrosis and others did not show any changes. These morphologically different progenies are often called variants.

In the present study, many variants were established after irradiation, such as variants with curly

leaves, pink petiole, albino plants, dwarf plants and taller plants were developed at M1 generation. These

variants were selected and subcultured until M4 generation to confirm stability.

All the variants were reverted to normal plants (control) after the second subculture (M2) except for

variants with two characters, the dwarf and the taller plants. At this M4 generation, the two variants were stable and were called mutants. The first mutant, D1 is smaller in sizes compare to normal plants (C), particularly its leaf size and light green leaves. The second mutant, G1 had bigger and larger leaves compared to normal plants (C), with brownish leaf colour.

Beside the differences in morphology of the mutant plants, conformations of the mutants were also done using molecular markers. In this study, the IRAP markers were used to distinguish the D1 and G1 genomes from normal C. willisii genomes. The analysis revealed two polymorphic bands (225 bp and 320 bp) using Nikita primer for the D1 mutant and two polymorphic bands (240 bp and 300 bp) using combination of 3'LTR primer and LTR 6149 primer for the G1 mutant. From this study, it is clear that in vitro mutagenesis proves to be a very promising way to produce new variety for C. willisii and other aquatic plants. Induced Mutagenesis of Cryptocoryne willisii Using Gamma Irradiation 104

Acknowledgements

The authors would like to acknowledge Plant Biotechnology Incubator Unit, Institute of Science, Faculty of

Science, University Malaya and Freshwater Fisheries Research Division, FRI Glami Lemi, Department of

Fisheries for their providing the facilities and financial support of the project.

References

Baumel, A., Ainouche, M, Kalendar, R. and Schulman, A.H. 2002. Inter-Retrotransposon Amplified Polymorphsm (IRAP) and retrotrasposon microsatellite amplified polymorphism (REMAP) in population of the youngallopolyploid species Spartina angelica Hubbard (Poaceae). Molecular Biology Evolution, 19: 1218-1227.

Cook, Christopher D.K. 1996. Aquatic and Wetland Plants of India. Oxford University Press Inc. New York.

Dariusz, Grzebelus, 2006. Transposon insertion polymorphismas a new source of molecular markers. Journal of Fruit and Ornamental Plant Research. Vol. 14 (Suppl. 1): 21-29.

De Wit, H. C. D. 1964. Aquarium Plants. London Blandford Press Ltd.

Doyle, J.J. and J.L. Doyle. 1990. A rapid total DNA preparation procedure for fresh plant tissue. Focus, 12: 13-15.

Hiscock, P. 2005. Mini Encyclopedia. Aquarium Plant: Comprehensive coverage, from growing them to perfection to choosing the best varieties. Barron's Educational Series, Inc.

Kalendar, R., Grab, T., Regina M., Suoniemi A. and Schulman A.H. 1999. IRAP and REMAP: Two new retrotransposon-based DNA fingerprinting techniques. Theoretical and Applied Genetics, 98:704-711.

Karine Alix and J. S. (Pat) Heslop-Harrison 2004. The diversity of retroelements in diploid and allotetraploid Brassica species. Plant Molecular Biology, 54: 895–909.

Kristiina Antonius-Klemola, Ruslan Kalendar and Alan H. Schulman 2006. TRIM retrotransposons occur in apple and are polymorphic between varieties but not sports. Theoretical and Applied Genetics.

Murashige, T. and Skoog, F. 1962. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiology Plant, 15: 431-497.

Rataj, K. and Horeman,T.J. 1977. Aquarium Plants: their identification, cultivation and ecology. T.F.H. Publications, Inc. Ltd.

Teo, C.H., Tan, S.H., Ho, C.L., Qamaruz, F.Z., Othman, R.Y., Heslop-Harrison, J.S., Kalendar R. and Schulman A.H. 2005. Genome constitution and classification using retrotransposon-based markers in the orphan crop banana. Journal of Plant Biology, 48(1):96-105.

Windelov, H. 1987. Aquarium Plants. T.F.H. Neptune City, N.J. C M

Y K

Malaysia Vol. 10 December 2011

Malaysian Fisheries Journal V o l .

1 0

D e c e m b e r A Journal of the Fisheries Research Institute, Department of Fisheries, Malaysia

2 0 1 1

C M

Y K EDITOR BOARD

Advisor : Y.M. Raja Mohammad Noordin Raja Omar Ainuddin Editorial Board : Ahmad Adnan Nuruddin (Chief Editor) Faazaz Abdul Latiff Ismail Ishak Kamal Zaman Mohamed Abu Talib Ahmad Mohammad Pauzi Abdullah Abdul Razak Latun Devakie Nair Wan Norhana Noordin Secretary : Wan Norhana Noordin Roziawati Mohd. Razali

Published by Fisheries Research Institute 11960 Batu Maung Pulau Pinang Malaysia I S S N 1 5 1 1 - 7 2 8 6

9 7 7 1 5 1 1 7 2 8 0 0 4 CONTENTS PAGES

1. Hatchery Production Performance of the Green Mussel, Perna 1 - 17 viridis (Linnaeus, 1758) - by MOHD SALEH MOHD TAHA

2. Demersal Fish Resources Stock Assessment of East Coast Sabah- 18 - 92 The Sulu Sulawesi Seas Economic Exclusive Zone of Malaysia - by HADIL R, JAMIL, M. and ANNIE LIM P.K.

3. Induced in vitro Mutagenesis of Aquatic Plant Cryptocoryne 93 – 104 willisii Engler ex Baum Using Gamma Irradiation to Develop New Varieties - by NORHANIZAN SAHIDIN, NURAINI ABD WAHID, ROFINA YASMIN OTHMAN and NORZULAANI KHALID

4. Disease prevalence of tiger grouper, Epinephelus fuscoguttatus 105 - 123 cultured in nursery cages in Sabah, Malaysia - by KUA BENC CHU, AZILA ABDULLAH, IFTIKHAR AHMAD and NIK NAZLI EFFENDY

5. Potentially Harmful Microalgae From Cockle Culture Area in Sg. 124 - 141 Jarum Mas, Perak - by ROZIAWATI M.R. and FAAZAZ A.L.

Malaysian Fisheries Journal 10: 1-17 (December 2011)

Hatchery Production Performance of the Green Mussel, Perna viridis (Linnaeus, 1758)

MOHD SALEH MOHD TAHA

Fisheries Research Institute Pulau Sayak, Kg. Pulau Sayak, 08500 Kota Kuala Muda, Kedah, Malaysia

Abstract: The mussel farms in Malaysia are currently dependent on limited spatfall areas and facing inconsistency in the seed supply due to vagaries of nature, pollution, predators, fouling and diseases. As such, the only alternative to overcome the shortage in mussel spat supply is to opt for hatchery production. This project was aimed at producing mussel seeds on a pilot scale so that crucial factors and problems associated with hatchery production of mussel spats in the hatchery could be determined and resolved. Small scale hatchery propagation technique of the green mussel, Perna viridis had been developed at Fisheries Research Institute Pulau Sayak, Kedah since 2007. A total of 32 trials on green mussel larviculture were carried out between 2007- 2009 i.e. 8 batches in 2007, 13 batches in 2008 and 11 batches in 2009. From these trials, a total of 43 million eyed larvae were produced with an average survival rate of 6.8% (ranging from 1% to 24%). A total of 569,430 spat ranging from 0.5 to 1.0 cm in size were produced with an average setting rate of 1.6% (ranged from 0.1% to 4.4%). The average density of spat on the rope collectors were 246 spat per meter for low density (ranged from 20 to 527 spat per meter) and 1,067 spat per meter for high density (ranged from 790 to 1,752 spat per meter). Some problems encountered during larviculture were presence of ciliates and uneven spat settlement on the collectors which need to be overcome. The most serious problem was the presence of ciliates which caused heavy mortality of the mussel larvae beginning second week onwards of the culture period.

Keywords: Perna viridis, larval rearing, spat production, setting rate, survival rate

Abstrak: Ladang-ladang ternakan siput sudu di Malaysia pada masa ini sangat bergantung kepada sumber benih siput sudu daripada kawasan semulajadi yang begitu terhad dan masih menghadapi masalah bekalan benih siput sudu yang mencukupi secara berterusan kesan daripada faktor-faktor seperti fenomena perubahan alamiah, pencemaran, pemangsaan, kekotoran dan penyakit. Oleh itu, alternaf pilihan yang ada untuk mengatasi kekurangan bekalan benih siput sudu ini adalah melalui aktiviti pengeluaran benih siput sudu daripada hatceri. Kajian ini dijalankan untuk menghasilkan benih-benih siput sudu di dalam hatceri pada skala percubaan supaya faktor-faktor penting dan permasalahan yang wujud semasa proses penghasilan benih siput sudu tersebut dapat dikenalpasti dan diselesaikan. Pembangunan teknik penghasilan benih siput sudu dalam hatceri telah dijalankan di Fisheries Research Institute Pulau Sayak, Kedah sejak 2007 pada skala kecil. Sebanyak 32 percubaan asuhan larva siput sudu dalam hatceri telah dijalankan diantara 2007-2009 iaitu 8 asuhan pada 2007, 13 asuhan pada 2008 dan 11 asuhan pada 2009. Daripada percubaan-percubaan ini, sejumlah 43 juta larva bermata telah dihasilkan dengan purata kadar hidup sebanyak 6.8% (julat antara 1% hingga 24%). Sejumlah 569,430 benih bersaiz 0.5-1.0 cm berjaya dihasilkan dengan kadar pemendapan larva sebanyak 1.6% (julat antara 0.1% hingga 4.4%). Purata kepadatan benih siput sudu di atas tali pemunggut adalah 246 spat permeter tali bagi kepadatan rendah (julat antara 20-527 spat permeter tali) manakala kepadatan tinggi yang dihasilkan adalah 1,067 spat permeter tali (julat antara 790-1,752 spat permeter tali). Antara masalah-masalah yang telah dikenalpasti semasa asuhan larva dan perlu diatasi adalah kehadiran siliat dan ketidaksekataan pemendapan larva di atas tali pemunggut . Masalah utama yang wujud adalah kehadiran siliat semasa asuhan larva memasuki tempoh asuhan minggu ke-2 yang memberi kesan kematian yang amat nyata.

1 Hatchery Production Preformance of the Green Mussel 2

Introduction

Mussel farming is a well established industry in many countries. Although the culture activities deploy intensive labour, it generates good economic returns with relatively little environmental impact. The mussel industry in Malaysia with a production barely exceeding 6,905 metric tons and valued at RM3.86 million in 2006 is sustained by moderate scale cultures in the states of Johor (Selat Tebrau) and Malacca

(Sebatu). With the recent increase in the market price for mussels, there is a growing interest among culturists to expand their existing culture areas and explore new areas in other states such as Kedah (Sg.

Merbok), Penang (Penaga), Perak (Sg. Dinding and Kuala Rungkup) and Selangor (Kuala Langat and Kuala

Selangor) to farm this species. In addition, there are also a number of opportunities for developing mussel aquaculture activities by exploring and developing new areas including offshore coastal areas.

The expansion of mussel production from its current limited base is expected to bring exponential socio-economic benefits, as it would attract the development of local mussel processing capacity with its associated employment opportunities which will generate income. However, with the increasing areas for culture, the industry is expected to face an acute shortage of mussel seed supply even to sustain the present production. The mussel farms are currently dependent on limited spatfall areas (presently confined to

Sebatu, Melaka and Selat Tebrau, Johor) where the problem of inconsistency in supply is further aggravated by vagaries of nature, pollution, predators, fouling and diseases. As such, the only alternative to overcome the shortage in mussel spat supply is to look into ways of producing spat from the hatchery. Jeffs (2003) stated that mussel spat can be produced artificially through breeding mussel and raising them in a shellfish hatchery. There exist the potential to develop the technology for large scale hatchery rearing of mussel spat which will greatly reduce the cost of the spat production. Additionally, the value of hatchery mussel spat can be raised by producing a more valuable product. With the hatchery production of mussel spat, it may also be possible to conduct selective breeding of mussels with more valuable traits, such as enhanced shell colour, faster growth or more nutritious meat. Another area where hatchery spat excels over wild spat is that it is Mohd Saleh, M.T. 3

more reliable as there have been several periods of up to a year in Malaysia when wild mussel spat has not been available. A mussel spat hatchery has the potential to supply spat during these periods and attract a commercial premium due to the unavailability of wild spat alternatives. The larval rearing techniques in tropical areas, has been used successfully for the reliable spat production of the green mussel, Mytilus viridis

(AQUACOP, 1979). A hatchery-nursery program was initiated at the Centre Oceanologique du Pacifique

(COP), dealing at first with Crassostrea gigas. The technique developed by AQUACOP (1977) was adapted from classical methods described by Loosanoff and Davis (1963), Walne (1966) and Dupuy et al. (1977).

This technique has been adapted to the tropical conditions and was modified for Perna viridis (AQUACOP,

1979; 1980a) where about 8.5 million Perna viridis spat was produced (Coeroli et al., 1984).

In Malaysia, the hatchery propagation of green mussels, P. viridis has been developed at the

Fisheries Research Institute (FRI) Pulau Sayak, Kedah on a small scale since 2007 using methods deployed by Tan (1975), Virabhadra Rao et al. (1976) and Sivalingam (1977). Preliminary observation indicated that there is great potential for commercial production which would be beneficial in terms of quality and reliability of seed supply. The viability of hatchery production versus wild collection however, will depend on factors such as the cost of production of spat, mussel prices, and the costs of wild spat collection. To date, there is no commercial mussel hatchery operating in Malaysia. As such, this project (at FRI Pulau Sayak) is aimed to record the larvae and spat production performance of green mussel P.viridis on a pilot scale which also include the larvae hatching rate, gross observation, survival rate, setting rate and growth.

Material and Methods

Broodstock and Conditioning

A good mussel broodstock batch was procured from mussel culturists and maintained in nearby vicinities (Sg. Dedap, Kedah and Penaga in Penang) of FRI Pulau Sayak so that they can be readily available for spawning in the hatchery. The gonad conditions of the mussels were monitored from time to time by sacrificing a few adults. Normally ten adults size of 7-8 cm were picked randomly from the cultured site Hatchery Production Preformance of the Green Mussel 4

which represents a mark of 10% each during the gonad observation. All the mussel broodstock were opened using oyster knife and each of the gonads were analysed through its shape whether it is full, half full or empty by gross eye observation.

Spawning

Adult mussels were conditioned in holding tanks at ambient temperature and salinity and were fed mixed algal cultures (Chaetoceros sp., Skeletonema sp. and Isochrysis sp.) ad libitum. Mature mussels (50 to 100 in number) were selected by plucking them out randomly from the culture ropes. Caution was exercised to retain their byssus to prevent mortality. They were brushed clean and put into a plastic basket

(50 cm x 40 cm x 17 cm). Spawning was induced either by thermal or salinity shocks. For thermal shock, spawning was stimulated by alternately immersing the basket containing mussels in cold water (25°C) for

20 min and subsequently at ambient temperature for another 20 min (29-30°C). As for salinity shock, the basket was immersed alternately in freshwater (0 ppt) first for 20 min and then in seawater (30 ppt) for another 20 min. Usually the males were seen to release the gametes first, followed by the females. The whole spawning process took about an hour. Once spawning was complete, the eggs were collected on a screen (mesh size 15 µm) and subsequently transferred into a bucket for embryo count. After counting, the larvae were transferred into an incubation tank at 20 million/ton. Generally, the fertilised embryo requires about 18 h to attain the straight hinge stage. At this stage, the larvae were harvested and observed under a microscope to confirm that they have successfully developed into the straight hinge or 'D' shaped stage.

Larval Growth and Survival

At 'D' stage, the larvae from the production trials were stocked into the larval culture tanks of 2 ton capacity at 3-6 million per culture tank. For growth rate monitoring, a total of 100 larvae/day were sampled from each tank. The length and width of the larvae (n=100) were recorded using the micrometer scale on the Mohd Saleh, M.T. 5

microscope. As for the survival rate, samples of larvae were taken during complete water change. Larvae were collected in a 20 L bucket and well stirred. Two aliquots of 1 ml samples were taken from each bucket and number of larvae counted. This procedure was repeated for the duration of culture until the larvae attained the pediveliger or setting stage.

Water exchange

Total water change was carried out on alternate days until the larvae attained the eyed stage.

However, at this point, water change was done on a daily basis to transfer the pediveligers (those that retained on 200 µm) to the setting tank while returning the smaller larvae to the culture tank (those that pass through 200 µm). A series of screen sizes ranging from 15 to 250 µm were used during water change to grade the larvae.

Feeding

Feeding of algae commenced from the second day of culture onwards. Isochrysis sp. was used during the first 7-10 days and mixtures of Isochrysis sp. and Chaetoceros sp. thereafter till the eyed larvae stage. Algae densities given ranged from 10-30 x103 cells/ml for the first week and then increased to 30-70 x

103 cells/ml during the second week of culture. Once the larvae had set, mixtures of Isochrysis sp.,

Chaetoceros sp. and Skeletonema sp. were fed at a density greater than 100 x103 cell/ml since the filtering rate of the spats is more efficient.

Water quality monitoring

Physical parameters such as temperature, salinity and pH were recorded daily in the morning between 1100-1200 h using thermometer, refractometer and pH meter, respectively. Hatchery Production Preformance of the Green Mussel 6

Setting and Density Count on Collectors

Pedivelligers with a black spot or often termed as the 'eye spot' on the body shell were found to retain on screens with a mesh size of 200 µm. These were transferred into setting tanks with rope collectors suspended in the water column. Generally, all larvae were considered set if no larvae were found retained on the screens during water exchange. From this point onwards, the newly set larvae termed spat were fed on mixed algae (Isochrysis sp., Chaetoceros sp. and Skeletonema sp.). They were fed at a density of more than

100 x103 cell/ml as at this stage as the filtering rate of the spats become more efficient. These spat were nursed until they attain a mean length of 5 mm when the density on the clutch could be recorded to determine the setting rate.

Results

Thirty two batches of green mussel larviculture were carried out between 2007-2009 i.e 8 batches in 2007, 13 batches in 2008 and 11 batches in 2009 respectively. Details on the production results are shown in Table 1, Table 2 and Table 3, respectively.

Larval production

A total of 2.9 billion embryos were produced during the spawning processes in the hatchery between 2007-2009 i.e. 422 million eggs in 2007, 1,657 million in 2008 and 819 million in 2009. Out of this number, a total of 860 million developed into D-hinge larvae stage i.e. 167 million larvae in 2007, 429 million larvae in 2008 and 264 millions larvae in 2009. A total of 43.39 million of eyed larvae stage i.e. 6.55 million in 2007, 24.66 million in 2008 and 12.18 million in 2009 were produced (Table 1, 2 and 3). The mean hatching rate of embryo to D-hinge larvae are between 34-51% (51% in 2007, 34% in 2008 and 37% in

2009) (Table 1, 2 and 3). After 14-20 days of culture, the mean larvae survival rate from D-hinge larvae to eyed larvae stage obtained are between 5-9% (5% in 2007, 9% in 2008 and 5% in 2009) (Table 1, 2 and 3).

The eyed larvae which retained on the 200 µm screen and stocked in the attachment or setting tank were allowed for settlement on rope collectors for about one week where the mean average setting rate of the eyed Mohd Saleh, M.T. 7

larvae obtained after the process were observed to be very low between 1-2% (1% in 2007, 2% in 2008 and

1% in 2009) (Table 1, 2 and 3).

Spat production

The spat density and production from 2007-2009 are shown in Tables 4. A total of 569,430 spats with a size range of 0.5-1.0 cm were produced from the 32 batches of larviculture between 2007-2009 i.e

76,694 spats in 2007, 447,606 spats in 2008 and 45,130 spats in 2009. The average density of spats on the rope collectors was 246 spats per meter for low density (ranged from 20 to 482 spats per meter) whereas for high density was 1067 spats per meter (ranged from 790 to 1,752 spats per meter) as shown in Table 4.

Larval Growth

The growth of the green mussel larvae from 8 trials in 2007-2009 are shown in Fig. 1. Results showed that the D-hinge larvae (length and width size of 83.0 ± 5.0 µm and 61.0 ± 5.0 µm, respectively) attained the eyed larvae stage mostly at day 14 with length and width size of 274.0 ± 25.0 µm and 249.0 ±

27.0 µm, respectively.

Larval survival

The survival rate of the green mussel larvae from 25 trials between 2007-2009 are shown in Fig. 2.

Survival rate was around 57% at day 7 and dropped drastically thereafter from day 9 until the end of the larviculture i.e. at day 15 attaining mean survival rate of 7%.

Water Quality

The physical water quality parameters i.e. temperature, salinity and pH are shown in Fig. 3. These parameters monitored did not exhibit any major fluctuations during the culture periods and were observed to be within the optimal values for larval rearing. The temperature was in the range of 28.5 – 30.0ºC, salinity

30-31 ppt and pH ranged from 7.4-8.0 throughout the culture period. Table 1: Larvae and spat production performance of green mussel P. viridis on a pilot scale in 2007

2007 (8 Batches) Mean Mussel Stage /Tota l 1/2007 2/2007 3/2007 4/2007 5/2007 6/2007 7/2007 8/2007

1. Embryo (million) 13.92 n.a n.a n.a 374.40 n.a n.a 47.50 422

2. Larvae (million) 5.20 14.59 0.65 12.03 84.70 5.25 27.20 37.50 167

3. Hatching Rate (Embryo to D- 37% 23% 79% 5 1%

hinge larva e) (%) Hatchery ProductionPreformanceoftheGreenMussel 4. Eyed larvae (mi llion) Dead D11 Dead D9 Dead D7 De ad D13 2.08 Dead D 15 1.97 2.50 6 .55

5. Larvae s urvival rate (D-hinge 2% 7% 7% 5. 3% larvae to eyed larvae) (%)

6. Setting rate (%) 1.5% 0.2% 1.6% 1.1%

Table 2: Larvae and spat production performance of green mussel P. viridis on a pilot scale in 2008

2008 ( 13 Batches) Mean Mussel Stage /Total 1 /2008 2/20 08 3/200 8 4/2008 5/2008 6/2008 7/ 2008 8/20 08 9/2008 10/2008 11 /2008 12/2 008 13/200 8

1. Em bryo (million ) 1 42.00 121. 00 210.4 8 156.30 119.00 36.69 7 4.43 248. 00 66.97 15.94 5.17 95 .43 384.00 1675

2. Larvae (million) 24.33 61.58 40.61 39.20 27.37 26.83 23.50 31.40 12.91 7.50 2.92 45.55 85.00 429

3. Hat ching Rate 17% 51% 19% 25% 23% 73% 32% 13 % 19% 47% 56% 4 8% 22% 34% (Embryo to D-hinge larvae) (%) 4. Eyed larvae (million) 1.08 1. 17 Dead Dead 3.99 1.67 5.09 4.59 2.67 0.27 Dead 1.00 3.13 24.66

D1 3 D13 D12

5. Larvae survival rate 4% 2% 15% 6% 24% 13% 21% 4% 2% 4% 9.5% (D-hinge larvae to eye d larvae) (%) 6. Setting rate (%) 3.0% 2.6% 3.8% 4.4% 1.0% 1.8% 0.4% - - 0.5% 2.2% 8

Table 3: Larvae and spat production performance of green mussel P. viridis on a pilot scale in 2009

2009 (11 Batches) Mean

Mussel Stage /Total 1/2009 2/2009 3/2009 4/2009 5/2009 6/2009 7/2009 8/2009 9/2009 10/2009 11/2009

1. Embryo (million) 36.88 172.54 12.00 17.65 62.48 36.77 26.62 30.00 105.00 34.45 285.00 819

2. Larvae (million) 18.16 34.31 8.90 3.57 12.99 8.84 13.15 10.87 27.65 17.00 108.57 264

3. Hatching Rate (Embryo to D- 49% 20 % 74% 20% 21% 24% 49 % 36% 26% 49% 38% 37% hing e larvae) (%) 4. Eyed larv ae (million) 1.50 1. 30 0.20 0.15 0.55 0.23 2 .30 0.60 0.40 0.35 4.60 12. 18

5. Larvae survival rate (D-hinge 7% 3% 2% 4% 4% 3% 17% 5% 1% 2% 4% 4.7% larvae to eyed larvae) (% )

6. Setting rate (% ) 1.4% - - - - 0.6% 0.9% 0.1% - - 0.001% 0.6% Mohd Saleh,M.T

Table 4: Spat production performance of green mussel P. viridis on a pilot scale in 2007 to 2009 . 2007 (3 Batches) 2008 (8 Batches) 2009 (4 Batches) Density/Yea r Mean/To tal 5/2007 7/2007* 8/2007 1/2008 2/2008 5/2008 6/2008 7/2008 8/2008 9/2008 13/2008 1/2009 6/2009 7/2009 8/2009

No. of Colle ctor 270 85 100 100 3 10 120 100 130 67 120 50 40 100 2 7 1,619

Spat/rope - 853 790 1,752 1,108 801 1,096 - - - - - 1,067 Spat Densit y : High No. of rope - 17 24 79 39 30 31 - - - - - 220

Spat/rope 116 477 213 149 53 382 399 482 169 128 527 71 154 20 239 Spat Density : Low No. of rope 270 85 83 76 2 31 81 70 99 67 120 50 40 100 2 7 1,399

Total spat pr oduced 31 ,400 4,749 40,545 32,180 3 0,284 15,06 51 74,154 51,960 81,694 11, 323 15,360 26,350 2,840 1,5 400 54 0 569,430

Note*: Spat settled on the wall of the culture tank 9

Hatchery Production Preformance of the Green Mussel 10

Figure 1 : Growth (Length and Width) of the green mussel larvae from D-hinge larvae to eye larvae stage in culture tank

Figure 2: Mean survival rate (%) of the green mussel larvae from D-hinge larvae to eyed larvae stage in culture tank Mohd Saleh, M.T. 11

Figure 3: Water quality parameter of the green mussel larviculture trials from 2007-2009

Gross and microscopic observation

Gross observations were recorded during the larviculture activity as shown in Fig. 4-7. Fig. 4 shows observation on colour changes of larvae within the 14 days of culture period. The colour changed from orange at day 1 (embryo or egg) to purplish from day 1-2 (D-hinge larvae), brownish from day 3-9

(early to mid umbo), greyish brown from day 10-13 (late umbo) and finally to black from day 14 (eyed stage) to pediveliger stage. Fig. 5 shows the microscopic shape of the various larval stages according to colour changes as mentioned above. During the eyed larvae stage, lots of whitish streaks of byssal thread were seen in the bucket filled with mussel larvae (Fig. 6) harvested from the culture tank, indicating that it is time to transfer the larvae into the setting tank. Hatchery Production Preformance of the Green Mussel 12

Figure 4: Gross observation of mussel larvae on harvest screen

Figure 5: Microscopic observation of mussel larvae under microscope Mohd Saleh, M.T. 13

Figure 6: Gross indication of larval setting (red arrows - whitish streaks of byssal threads)

Figure 7: Presence of ciliates in mussel larvae shell at pediveliger stage (red arrows) Hatchery Production Preformance of the Green Mussel 14

Low survival rate experienced throughout the culture trial from 2007-2009 showed that the main cause of mass mortality in almost every culture batch was due to the mass presence of ciliates in the culture tank. Ciliates are living protozoans and are known to multiply rapidly by consuming dead organisms in which in this case is dead mussel larvae. Once they are dominant in the culture tanks, they can be seen in every empty shell of the dead larvae (Fig. 7).

Discussion

In Tahiti, where no species of mussels are found in the natural environment, large scale culture operations had to rely on the hatchery spat production. Since 1978, induced spawning was routinely achieved throughout the year using imported broodstock, and larval rearing method proved to be reliable

(AQUACOP, 1979). Among those who had put into effort on developing the hatchery spat production is

Rao et al. (1976) who described spawning, fertilization and larval development of the green mussel

P.viridis from the Goa Coast in India and Appukuttan et al. (1987) who detailed larval rearing and spat production of the brown mussel Perna indica. To determine the viability of green mussel seed production in the hatchery, the survival and setting rate should be an important indicator besides the growth (length and width). In this study, the survival rate obtained was 57% at day 7, 30-50% at day 10 and further dropped below 10% at day 15 (Fig. 2). These survival rates are generally low as compared to the results achieved by

French Polynesia (Table 6). AQUACOP (1980a) reported that only 5-20% of larvae attained settlement stage in many bivalve species, whereas these rates recorded about 50% for Perna viridis. As for the survival rate between the D-stage and marketable sized spat obtained was only 10% (AQUACOP, 1979). Efforts are being geared towards increasing the survival rate from Day 7 onwards through the target lines as shown in

Fig. 8 from 10% to 30-40%. This could be done by controlling the feeding and stocking densities in the culture tank. The use of tropical algal strains Isochrysis sp and Chaetoceros gracilis improved the quality of Mohd Saleh, M.T. 15

Figure 8: Target for survival rate improvement plan in the mussel larviculture in the hatchery

diet. The use of a mixture of two tropical strains Isochrysis sp.-Chaetoceros gracilis enhanced the growth rate and resulted in better survival rates at day 10. Another suggestion was to deploy bigger tanks in the second week of culture where eight 800 liter tanks were compared to a 10,000 litre tank for an equivalent production which consumed less water. The use of such rearing tanks is cheaper and easier to build besides increasing the efficiency of the design as well (AQUACOP, 1979).

The same situation was also experienced with the setting rate i.e. very low setting rate (mean setting rate of 1.6%) obtained in this study as compared to 30-60% setting rate achieved by French

Polynesia as shown in Table 5. The settlement rate was estimated at 45% where this rate takes into consideration the spat settled on the collectors and on the walls of the 10 m³ tank. Improvement in the settlement rate could be obtained by hanging up more nylon net collectors in the rearing tanks to maximise surface areas for settlement. The density before settlement had to be adjusted to 2,000 larvae per liter, as it Hatchery Production Preformance of the Green Mussel 16

was shown that higher density at that stage induced a delay in settlement (AQUACOP, 1979).

Results from these propagation trials appear promising i.e. achieved 57% survival at day 7 while more research work is needed to reduce mass mortality during the second week of the culture period.

However, several other problems related to production and survival rates also need to be overcome. Some of the problems include the presence of ciliates, poor water quality condition due to silt, solving inconsistent supply of matured broodstock due to unpredictable weather conditions and innovations to solve uneven density of spat settlement on collectors. AQUACOP (1979) had reported that chemicals such as sulfadimerazine can be use to control ciliates. It was observed that bacteria control using this chemical gave good results when culture water was treated with 14 mg per liter of sulfadimerazine every 2 days (Coeroli et al., 1984). However, Utting and Spencer (1991) were of the opinion that successful hatchery production of larvae and spat is more related to the skill and experience of the staff rather than the facilities and equipment.

Among future focus of studies are on effects of water flow and aeration bubbles on spat settlement, using bigger capacity tanks i.e. more than 10 tons of water during the second week of culture, using other types of collectors and controlled feeding by changing the feeding rate from number of cells per ml of water to number of cells per individual larvae.

Acknowledgements

The author wishes to gratefully acknowledge Ms. Devakie Nair (Senior Research Officer) for sharing her ideas and experiences on this project and also for reviewing the manuscript. Thanks are also due to Mr. Mohd. Amer Halib (Research Assistant) for the hard work during hatchery operation and to Mr.

Mohd. Khairul Anwar Zakaria (Contract Worker) for helping out with the ground work. Mohd Saleh, M.T. 17

References

Appukuttan, K.K., Mathew, Joseph and Thomas, K.J. 1987. Larval rearing and spat production of the brown mussel Perna indica Kuriakose and Nair at Vizhinjam, southwest coast of India. Nat. Sem. Shellfish Res. Farming, Tuticorin. CMFRI Bull. 42 (pt.II): 337-343.

AQUACOP, 1977. Elevage larvaire et production de naissain de Crassostrea gigas en milieu tropical. Proceeding Jrd. Meeting, ICES working Group on Mariculture. Actes de Colloques du CNEXO 4:331-346.

AQUACOP, 1979. Larval Rearing and Spat Production of Green Mussel Mytilus viridis Linnaeus in French Polynesia. Proceeding of World Mariculture Society 10:641-647.

AQUACOP, 1980a. Essais de production controlee de naissain d'huitre perliere Pinctada margaritifera en laboratoire. Convention CNEXO/COP, SOCREDO. Territoire de Polynesie Francaise, Rapport COP/AQ 80.017, 32 pp.

Coeroli, M., Gaillande, D. and Landret, J.P. 1984. Recent innovation in cultivation of molluscs in French Polynesia. Aquaculture 39:45-67.

Dupuy, J.L., Windsor, N.T. and Sutton, C.E. 1977. Manual for design and operation of an oyster seed hatchery for the American oyster Crassostrea virginica. VIMS/Sea Grant Program Special Report no. 142, W.J. Margis, Jr., Director. Gloucester Point, 96 pp.

Jeffs, A. 2003. Assessment of the Potential for Mussel Aquaculture in Northland. NIWA Client Report AKL2003-057. 10 pp.

Loosanoff, V.L. and Davis, C. 1963. Rearing of bivalve molluscs. Pages 1-136 in F.S. Russel (Ed.), Advances in Marine Biology. Acedamic Press, London.

Rao, K.V., Kumari, L.K. and Qasim, S.Z. 1976. Aquaculture of green mussel Mytilis viridis L: Spawning, fertilization and larval development. Indian Journal Marine Science 5: 113-116.

Sivalingam, P.M. 1977. Aquaculture of the green mussel Mytilus viridis Linnaeus, in Malaysia. Aquaculture 11: 297-312.

Tan, W.H. 1975. Egg and larval development in the green mussel Mytilus viridis Linnaeus. The Veliger, 10: 151-155.

Utting, S.D. and Spencer, B.E. 1991. The hatchery culture of bivalve mollusk larvae and juveniles. Lab. Leafl., MAFF Fish. Res., Lowestoft, (68), 31 pp.

Virabhadra Rao, K., Krishna Kumari, L. and Qasim, S.Z. 1976. Aquaculture of green mussel Mytilus viridis L. : Spawning, fertilization and larval development. Indian Journal of Marine Science 5: 113-116.

Walne, P.R. 1966. Experiments in the large-scale culture of the larvae of Ostrea edulis (L.). Fishery Investigations (London), Sec. 2, 25(4): 53 pp.

Malaysian Fisheries Journal 10: 18 – 92 (December 2011) 18

Demersal Fish Resources Stock Assessment o f East Coast Sabah-The Sulu Sulawesi Seas Economic Exclusive Zo ne of Malaysia

HADIL R, JAMIL, M. & ANNI E LIM P.K.

Fisheries Research Institute Bintawa, Jalan Perbadanan, Bintawa, P.O. Box 2243, 93744, Kuching, Sarawak, Malaysia

Abstract: This was the very first demersal survey ever carried out in east coast Sabah. A total of 4 cruises , covering 40 stations were completed utilizing the trawl net of research vessel, KK MANCHONG from the 15th to 31st July 2009. The survey area was divided into three depth strata [1: 10-30 fathoms (18-55 m), 2: 20-50 fathoms (56-91 m) and 3: 50-100 fathom s (92-185 m)] and into three Sulu-Sulawesi mar ine ecoregions: SSME 1, SSM E 2 and SSME 3. A total of 213 species -1 with an overall average catch rate of 59.74 kghr were recorded during the survey. Of this, demersal fish contributed 25.29 kghr-1 or 42%, pelagic fish contributed 11.89 kghr-1 or 20%, while 22.56 kghr-1 or 38% was attributed to trash fish. Biomass estimates of demersal and trash fish resource was calculated using Swept Area Method. The biomass distribution in the three surveyed strata and 3 SSMEs was roughly in percentage ratios of 32: 9: 59 and 44: 28: 28 for strata 1, 2 and 3 and SSME 1, SSME 2 and SSME 3 respectively. In the estimation of Maximum Sustainable Yield (MSY) of demersal fish, the acceptable figure was a summation of the 3 SSMEs’ potential yield that was 44,718 tons with the demersal fish productivity at 5.295 tonsNM-2yr-1. The exploitation rate for the combination of catchability coefficient, q=0.6 and mortality rate, M=1.66 per year at yield, Y=45,450.6 tons was at 0.58 per year, indicating over exploitation of the demersal resource in the surveyed area.

Taking the precautionary approach to fisheries management, it was suggested that the present level of demersal fish resource exploitation be reduced.

Keywords: Demersal, fish, stock assessment, EEZ, Sabah

Abstrak: Ini merupakan survei yang julung kali dibuat bagi pantai timur Sabah. Dari 15 hingga 31 Julai 2009, KK MANCHONG, kapal pukat tunda penyelidikan telah menjalankan penundaan di 40 stesen. Perairan survei dibahagi kepada tiga kedalaman air [1: 10-30 fathoms (18-55 m), 2: 20-50 fathoms (56-91 m) dan 3: 50-100 fathoms (92-185 m)] dan tiga kawasan marin Sulu-Sulawesi: SSME 1, SSME 2 dan SSME 3. Sebanyak 213 spesis ikan telah dikenalpasti semasa survei ini dengan keseluruhan purata tangkapan sebanyak 59.74 kgjam-1. Dari purata kadar tangkapan tersebut ikan demersal, ikan pelagik dan ikan baja masing-masing menyumbangkan 25.29 kgjam-1 atau 42%, 11.89 kgjam-1 atau 20% dan 22.56 kgjam-1 atau 38%. Kaedah anggaran biomas bagi ikan demersal dan ikan baja adalah menggunakan kaedah penyapuan kawasan. Taburan biomas bagi tiga kedalaman air dan 3 kawasan marin yang disurvei mempunyai anggaran nisbah peratusan 32: 9: 59 dan 44: 28: 28 bagi kedalaman air 1, 2 dan 3 dan kawasan marin, SSME 1, SSME 2 dam SSME 3 masing-masing. Anggaran tahap tuaian mampan maksima bagi ikan demersal adalah 44,718 tan hasil dari gabungan potensi kesemua 3 SSME dengan produktiviti ikan demersal sebanyak 5.295 tan BN-2tahun-1. Kadar eksploitasi bagi kombinasi koeffisien tangkapan, q = 0.6 dan kadar kematian, M = 1.66 tahun-1 d engan pendaratan, Y = 45,450.6 tan adalah 0.58 tahun-1, menunjukkan bahawa terdapat lebihan eksploitasi sumber ikan demersal di kawasan survei. Dengan mengambil langkah berwaspada dalam pengurusan perikanan, adalah dicadangkan tahap eksploitasi semasa sumber ikan demersal dikurangkan.

Demersal Fish Stock Assessment of EE Z East Coast Sabah 19

Introduction

The Malaysian fisheries industry plays an important role in the economic development of the country.

Besides providing cheap protein (per capita fish consumption: 55.9 kgyear-1 (Food and Agriculture Organization

(FAO), 2006) or 38.2% of the total animal protein intake), it also provides various socio-economic opportunities including employment for some 99,617 full-time fishermen (Anon., 2007) in the country.

During the last decade, the value of fisheries exports from Sabah had increased many folds. These products, mainly from the coastal capture fisheries sector, were exported as raw materials or semi-processed products with only minimum value added. Some of the fisheries resources for example shrimps within the 12- nautical mile coastal zone had already shown some probable signs of over-exploitation. At present, there is a paucity of comprehensive information on the distribution, biology, potential yield and exploit ation status of fisheries resources in both coastal and offshore waters of Sabah. These were more critical for the east coast of

Sabah, the Sulu-Sulawesi seas knowing the fact that piracy was the main treat. The first fisheries resource survey in the Economic Exclusive Zone (EEZ) of Malaysia was conducted from 1985-1987 (Anon., 1988) and the second survey was carried out from 1996-1997 (Anon., 2000). These surveys estimated the demersal and semi-pelagic/pelagic fish biomass and potential yield in the waters of the

Malaysian EEZ, covering the west and east coasts of Peninsular Malaysia as well as the South China Sea area off Sarawak and Sabah. Due to security reason, fish resource survey was not carried out in the Sulu and

Sulawesi seas east coast of Sabah. The results from the surveys provided the Department of Fisheries Malaysia with baseline resource information for the formulation of plans for the development of the fisheries. The systematic development of the fisheries industry is expected to increase fish production to meet the demand for food.

This present survey is part of the inaugural Malaysian Sulu-Sulawesi scientific expedition organized by the National Oceanography Directorate (NOD), Ministry of Science, Technology and Innovation, MOSTI. It was the first ever carried out in this water and its aims to assess the status of the demersal fish resource of east coast Sabah. In this survey, the demersal fish biomass and potential yield will be determined. The detailed programme of this east coast Sabah demersal survey was prepared by the Fisheries Research Institute (FRI)

Bintawa, Kuching. The Swept Area Method was used to estimate demersal fish density and biomass (Hadil et al., 2008). This survey was carried out using the research vessel K.K. MANCHONG from FRI-Bintawa. Results of this survey also give catch rates, density distribution and species composition of fish.

Hadil et al. 20

Materials and Methods

The area surveyed extended seawards beyond the coastline to about 100 fathom depth contour from

8oN to 4oN on the east coast of Sabah. This area was divided into three depth strata i.e. stratum 1 from 10-30 fathoms (18-55 m), stratum 2 from 30-50 fathoms (56-91 m) and stratum 3 from 50-100 fathoms (92-185 m).

The division of the survey area into depth strata followed the standard procedure used by FRI in earlier, EEZ fish resource survey using RV RASTRELLIGER (Anon., 1988). The area was also divided into 3 Sulu-Sulawesi

Marine Ecoregion, SSME (figure 1) as mentioned by Biusing (2001). The three SSME comprised three zones:

SSME 1 (Kudat, Kota Marudu, Pitas) on the northern part of Sabah; SSME 2 (Sandakan, Kinabatangan,

Beluran) on the northeast; and SSME 3 (Tawau, Lahad Datu, Semporna, Kunak) on the southeast.

Figure 1: Sulu-Sulawesi Marine Ecoregions, SSME of east coast Sabah (adapted from Biusing, 2001)

K.K. MANCHONG is a research trawler based at FRI-Bintawa. Some of the principal details of the vessel and her equipment are given in Hadil et al. (2008) and Anon. (2000). The design of the trawl net and otter boards used and some of its principal features were illustrated in Hadil and Richard (1991). The net was made of polyethylene with a cod-end mesh size of 38 mm. The polyvalent otter-boards used weighed 350 kg each.

Demersal Fish Stock Assessment of EEZ East Coast Sabah 21

The survey methodology used was adopted from Hadil et al. (2008) that closely followed the standard methodology outlined in Mackett (1973) and Sparre and Venema (1992). Sampling was conducted using the stratified random sampling technique. Within each stratum, trawl stations were selected randomly such that at least one trawl station will be covered in each grid of 15 x 15 square nautical miles. Table 1 shows the distribution of the stations after been randomly selected with SSME 1 having only shallow water trawl stations and only SSME 3 having deep water trawl stations. The Malaysian EEZ in the east coast of Sabah is very narrow and with rugged sea bottom (untrawable), the furthest being <30NM and only SSME 3 is having bigger area and deeper water.

Table 1: Possible trawl stations planned for 3 depth strata under respective SSME Depth strata\SSM E SSME 1 SSME 2 SSME 3 10-30 fathoms (18-55m ) 5 stations (st. 1-5) 10 stations (st. 6-13,15,20) 7 stations (st. 30-36)

30-50 fathoms (56-91m ) 5 stations (st. 14,16-19) 8 stations (st. 21-26, 28, 29)

50-100 fathoms (92-185m ) 5 stations (st. 27, 37-40)

The total area covered in this survey was calculated from maps digitized using the software Exp lorer. The cruise track was fixed after considering the port at the beginning and the end of each cruise. A total of 4 cruises, covering 40 stations were completed from 15th. July to 31st. July 2009. The distribution of stations by depth is shown in Figure 2 and Appendix 1. The names of personnel involved were listed in Appendix 3 .

Treatment of samples and catch analysis followed methods stipulated by Hadil et al. (2008).

Hadil et al. 22

Figure 2: Thirty-three trawling stations successfully carried out by KK MANCHONG in the Sulu-Sulawesi seas th st EEZ Malaysia east coast Sabah from 15 to 31 July 2009

Results

Four cruises were completed from 15th. July to 31st. July 2009. A total of 33 hauls were successfully conducted at an average of three hauls per day. Seven trawl operations were aborted due to rough grounds, very deep water or very strong water current. Details on each haul are given in Appendix 1. Fig. 2 shows the distribution of the trawl stations in the surveyed area.

The catch rates for the first few hauls were high at > 100 kghr-1 (Table 2 and Fig. 3). The rest of the hauls were in the region of 50 kghr-1 more or less. The highest catch rate at 228.51 kghr-1 was obtained from trawl station 1. The next 4 high catc h rates were obtained from station 5 at 195.79 kghr-1; statio n 26 at 133.50 kghr-1; station 3 at 124.52 kghr-1 and station 2 at 102.04 kghr-1.

Demersal Fish Stock Assessment of EEZ East Coast Sabah 23

Table 2: The commercial and trash fish percentage composition for all the successful trawl hauls conducted by KK MANCHONG in east coast Sabah 2009 S tation Catch ra te Commer cial Trash Total No. of No. of No. of Depth SSME No. (kghr-1) Sp (%) Fish (%) Species Comm Trash r ange (m) Sp. Sp. Stratum 18-55m 1 1 228.51 93 7 31 29 2 22

2 102.04 13 87 22 16 6 32-39 3 124.52 61 39 35 21 14 32 4 28.4 0 79 21 32 17 5 21-24 5 195.79 22 78 45 34 11 27 2 6 41.7 8 29 71 31 25 6 15-27 7 7.0 8 66 34 15 11 4 36-40 8 18.52 90 10 32 23 9 34

9 22.55 32 68 16 12 4 10-21

10 47.25 41 59 28 23 5 27-32

11 65.14 46 54 44 30 11 40-44 12 65.8 3 74 26 8 33 41 29-32 13 53.1 7 66 34 12 33 45 39-51 15 30.9 1 85 15 20 18 2 41-63 20 45.4 8 53 47 24 20 4 34-43 3 32 21.96 35 65 13 7 6 21-23

34 34.60 60.9 39.1 35 25 10 20-21

35 50.89 90 10 59 49 10 20-29

36 30.51 82 18 34 25 9 27-36 Average 63.94 58.84 41.16 28 24 11

Stratum 56-91m 2 14 35.78 91 9 33 29 4 55-62

16 32.03 99 1 27 23 4 60-67

17 48.7 67 33 47 28 19 66-69 18 61.52 96 4 46 27 19 73-76

19 76.65 66 34 40 24 16 66-67 3 21 71.7 61 39 34 15 19 71-76

22 59.41 94 6 40 20 20 64-68 23 16.6 78 22 14 8 6 78-95

24 67.8 6 89 11 32 23 9 53-70 25 35.9 8 95 5 32 21 11 69-71 26 133 .5 17 83 23 14 9 76-78 28 33.4 5 77 23 37 26 11 51-61 29 43.44 69 31 23 12 11 75-78

Average 55.12 76.85 23.15 33 21 12

Stratum 92-185m

27 39.71 93.1 9.6 31 17 14 100-118 3 Overall- Av. 59.74 76.26 24.64 30.71 20.50 12.30

Hadil et al. 24

250

200 ) r h / g

k 150 (

e t a r

h 100 c t a C 50

0 1 3 5 7 9 11 13 20 34 36 16 18 21 23 25 28 27 trawl station number

Figure 3: KK MANCHONG trawl catch rates (kghr-1) distribution for the east coast Sabah 2009

Overall an average catch rate of 59.74 kghr-1 was recorded from the 33 trawl hauls conducted (Table

-1 -1 3). Of this, demersal fish species contributed 21.95 kghr or 36.75%, pelagic fish contributed 11.89 kghr or

-1 19.90%, while trash fish contributed 22.56 kghr or 37.77% (Fig. 4 and 5). The rest of the catch contributing 5.58% comprised elasmobranchs, crabs, shrimps, mollusc, lobsters and cephalopods.

Table 3: KK MANCHONG trawl total catch and average catch rate composition for east coast Sabah 2009

Fish Group Total Catch (kg) (%) Av. Catch Rate (kg/hr) Std (+/-)

Demersal fish 724.46 36.75 21.95 66.999 Pelagic fish 392.32 19.90 11.89 41.940 Elasmob ranchs 12.91 0.65 0.39 2.129 Crabs 23.78 1.21 0.72 2.428 Sh rimps 8.12 0.41 0.25 1.126 Mollu sc 3.96 0.20 0.12 0.431 Lobs ters 2.68 0.14 0.08 0.293 Ceph alopods 58.58 2.97 1.78 3.000 Trash fish 744.45 37.77 22.56 85.520 Total 1,971.26 100 59.74 203.866

Demersal Fish Stock Assessment of EEZ East Coast Sabah 25

Demersal Fish Pelagic Fish 22.56 21.95 Elasmobranchs Crabs Shrimps Molluscs Lobsters 1.78 11.89 Cephalopods 0.08 0.39 Trash Fish 0.12 0.25 0.72

Figure 4: KK MANCHONG trawl total catch (in kghr-1) composition for east coast Sabah 2009

Demersal Fish Pelagic Fish

37.77 36.75 Elasmobranchs Crabs Shrimps Mollusc Lobster Cephalopod 19.90 2.97 Trash Fish 0.14 0.41 0.65 0.20 1.21

Figure 5: KK MANCHONG trawl total catch (in percentage) composition for east coast Sabah 2009

Table 4 shows the distribution of average catch rates and their percentage contribution to the respective SSME under different stratum. Under stratum 1 (18-55 m), SSME 1 was the most productive having the highest

-1 -1 -1 average catch rate of 140.3 kghr compared to SSME 2 (43.8 kghr ) and SSME (35.8 kghr ). The contribution of trash fish in the catch of SSME 1 under stratum 1 was very high at 44.5%. But, under stratum 1 significant contribution of demersal and pelagic fish was observed in the average catch rates of SSME 2 (66.9%) and

SSME 3 (53.8%) as compared to SSME 1 (51%). Significantly high contribution of demersal and pelagic fish was also observed in the average catch rates of SSME 2 (70.4%) and SSME 3 (49.3%) under stratum 2. The high average catch rate of SSME 3 (58.7 kghr-1) was attributed to the high percentage (46.7%) of trash fish in

Hadil et al. 26 the catch. At stratum 3 only one haul (station 27) can be managed by KK MANCHONG and this might not represent the average catch rate of the stratum. But it’s obvious to note that since station 27 was in deeper water, a very high (86.8%) contribution of demersal fish to the trawl catch was understandable. Throughout the surveyed area, the contribution by invertebrates was rather low ranging from 1.3 to 9.2% of the average catch rate.

Table 4: KK MANCHONG average catch rate a nd percentage composition for the three depth strata under different SSME of east coast Saba h 2009 Stratum 1 2 3

SSME 1 2 3 2 3 3 Av. Av. Av. Av. Av. Av.

Wt % Wt % Wt % Wt % Wt % Wt %

Demersals 38.4 27.4 9.4 21.4 17.1 47.8 21.3 44.3 20.8 35.4 34.5 86.8

Pelagics 33.1 23.6 14.2 32.4 6.9 19.1 12.6 26.1 8.2 13.9 0.1 0.3 Elasmobranc hs 0 .5 0 .3 0. 0 0.0 1.0 2.8 0.4 0.8 0.5 0.9 1.9 4.8 Cr abs 1 .0 0 .7 0. 7 1.7 1.5 4.2 1.8 3.7 0.0 0.0 0.0 0.0 Shrim ps 0 .1 0 .1 0. 2 0.4 0.3 0.9 0.0 0.1 0.6 1.0 0.0 0.0 Mollu scs 0 .5 0 .4 0. 0 0.1 0.3 0.8 0.0 0.0 0.0 0.0 0.0 0.0 Lobs ters 0 .2 0 .1 0. 2 0.5 0.1 0.4 0.0 0.0 0.0 0.0 0.0 0.0 Cephalopo ds 4 .0 2 .9 1. 3 3.0 0.7 1.9 2.6 5.4 1.1 1.9 0.5 1.3 T.Invertebra tes 5 .8 4 .2 2. 5 5.7 2.9 8.2 4.4 9.2 1.7 2.9 0.5 1.3 Trash F ish 62 .5 44.5 17.7 40.5 7.9 22.1 9.5 19.7 27.5 46.9 2.8 6.9 To tal 140 .3 100 .0 43.8 100.0 35.8 100.0 48.2 100.0 58.7 100.0 39.7 100.0

In term of stratum by stratum observation, the overall average catch rate of Stratum 1 were higher

(63.94 kghr-1) than the overall catch rate of the whole survey area. But this was contributed in large by the higher average catch rate of trash fish (Table 5) at 27.24 kghr-1 (42.61%). The average catch rate increased as trawling get deeper; from 19.12 kghr-1 at stratum 1; 25.13 kghr-1 at stratum 2 and 34.45 kghr-1 at stratum 3 (Fig.

6, 8 and 10). The opposite holds true for pelagic and trash fish catch. This phenomenon was in tandem with the percentage contribution to the total catch rate (Fig. 7, 9 and 11).

Demersal Fish Stock Assessment of EEZ East Coast Sabah 27

Table 5: KK MANCHONG average catch rate and percentage composition for the three depth strata of east coast Sabah 2009 Stratum 18-55m 56-91m 92-185m

Catch rate Per centage Catch ra te Perce ntage Catch rat e Percenta ge Fish Group (kg/h r) (%) (kg/hr ) (%) (kg/hr) (%) Demersal F ishes 19.12 29.91 25.13 45.59 34.45 86.75 Pelagic Fishes 14.10 22.06 9.56 17.34 0.11 0.28 Elasmobranchs 0.3 3 0.52 0.36 0.66 1.9 0 4.78 Crabs 0.7 9 1.23 0.68 1.23 - - Shrimps 0.15 0.23 0.41 0.74 - -

Molluscs 0.21 0.33 - - - -

Lobsters 0.14 0.22 - - - -

Cephalopods 1.85 2.90 1.76 3.19 0.50 1.26

Trash Fishes 27.24 42.61 17.23 31.25 2.75 6.93

Total 63.94 100 55.12 100 39.71 100

No of trawl station 19 19 13 13 1 1

Demersal Fish 19.12 Pelagic Fish 0.33 Elasmobranchs 27.25 0.79 Crabs 0.15 Shrimps Molluscs 0.21 Lobsters 0.14 Cephalopods 1.85 Trash Fish 14.10

-1 Figure 6: KK MANCHONG trawl average catch rate (in kghr ) composition for stratum 18-55 m east coast Sabah 2009

Hadil et al. 28

Demersal Fish 29.91 Pelagic Fish 42.61 0.52 Elasmobranchs 1.23 Crabs

0.23 Shrimps Molluscs 22.06 0.33 Lobsters 0.22 Cephalopods 2.90 Trash Fish

Figure 7: KK MANCHONG trawl average catch rate (in percentage) composition for stratum 18-55 m east coast Sabah 200 9

17.23 Demersal Fish Pelagic Fish 25.13 0.36 Elasmobranchs 0.68 Crabs

0.41 Shrimps Cephalopod 1.76 Trash Fish

9.56

-1 Figure 8: KK MANCHONG trawl average catch rate (in kghr ) composition for stratum 56-91 m east coast Sabah 2009

Demersal Fish Stock Assessment of EEZ East Coast Sabah 29

Demersal Fish 31.25 45.59 Pelagic Fish 0.66 Elasmobranchs 1.23 Crabs

0.74 Shrimps 17.34 Cephalopod 3.19 Trash Fish

Figure 9: KK MANCHONG trawl average catch rate (in percentage) composition for stratum 56-91 m east coast Sabah 200 9

2.75

Demersal Fish 0.11 Pelagic Fish

1.90 Elasmobranchs

0.50 Cephalopod Trash Fish

34.45

-1 Figure 10: KK MANCHONG trawl average catch rate (in kghr ) composition for stratum 92-185 m east coast Sabah 2009

Hadil et al. 30

4.8 6.9

Demersal Fish 0.3 Pelagic Fish Elasmobranchs Cephalopod 86.8 1.3 Trash Fish

Figure 11: KK MANCHONG trawl average catch rate (in percentage) composition for stratum 92-185 m east coast Sabah 200 9

Among the SSMEs, there was a big different in the average catch rates recorded for SSME 1 (135.85 kghr-1) compared with SSME 2 (43.49 kghr-1) and 3 (49.20 kghr-1). Table 6 shows that this observation was largely attributed to the high catch of both demersal and pelagic fish (Fig. 12) coupled with a high percentage (62.51%) of trash fish (Fig. 13) landed at SSME 1. Overall SSME 2 was not so productive, having the lowest average catch rate (Fig. 14 and 15). It can also be rightly said for SSME 3 where the average catch rate was not substantially high (Fig. 16) even though the percentage of demersal fish caught was high at 47.95% (Fig. 17).

Table 6: Average catch rates (kghr-1) for different fish groups caught by KK MANCHONG trawl at different SSME waters EEZ Malaysia Sulu-Sulawe si seas, east coast Sabah SSME 1 SSME 2 SSME 3 Fish group Av. Catch Av. Catch Av. Catch -1 % -1 % -1 % rate (kghr ) rate (kghr ) rate (kghr )

Demersal fish 39.40 29.00 14.72 33.84 23.59 47.95 Pelagic fish 27.63 20.34 11.20 25.75 6.63 13.47 Elasmobra nchs 0.4 7 0.35 0.12 0.28 0.67 1.36 Crabs 0.98 0.72 0.86 1.98 0.46 0.93

Shrimps 0.11 0.08 0.08 0.17 0.49 1.01 Mo lluscs 0.5 3 0.39 0.01 0.02 0.09 0.19 Lobste rs 0.1 9 0.14 0.08 0.18 0.04 0.09 Cepha lopods 4.0 3 2.97 1.70 3.90 1.00 2.02 Trash fish 62.51 46.0 2 14.73 33.86 16.23 32.99 Total 135 .85 100 43.49 100 49.20 100 No. of s tation 5 15 13

Demersal Fish Stock Assessment of EEZ East Coast Sabah 31

Demersal Fish 0.47 39.40 Pelagic Fish 0.98 Elasmobranchs Crabs 62.51 0.11 Shrimps 0.53 Molluscs 0.19 Lobsters Cephalopods 4.03 27.63 Trash Fish

Figure 12: KK MANCHONG trawl average catch rate (in kghr-1) composition for SSME 1 waters east coast Sabah 200 9

Demersal Fish 29.00 Pelagic Fish 46.02 0.35 Elasmobranchs Crabs 0.72 Shrimps 0.08 Mollusc 20.34 0.39 Lobster 0.14 Cephalopod 2.97 Trash Fish

Figure 13: KK MANCHONG trawl average catch rate (in percentage) composition for SSME 1 waters east coast Sabah 2009

Hadil et al. 32

Demersal Fish Pelagic Fish 14.73 14.72 0.12 Elasmobranchs 0.86 Crabs 0.08 Shrimps

0.01 Molluscs 0.08 Lobsters Cephalopods 1.70 Trash Fish 11.20

Figure 14: KK MANCHONG trawl average catch rate (in kghr-1) composition for SSME 2 waters east coast Sabah 200 9

Demersal Fish 33.86 33.84 Pelagic Fish 0.28 Elasmobranchs 1.98 Crabs 0.17 Shrimps Molluscs 0.02 25.75 Lobsters 0.18 Cephalopods 3.90 Trash Fish

Figure 15: KK MANCHONG trawl average catch rate (in percentage) composition for SSME 2 waters east coast Sabah 2009

Demersal Fish Stock Assessment of EEZ East Coast Sabah 33

Demersal Fish Pelagic Fish 16.23 0.67 Elasmobranchs 0.46 Crabs 23.59 0.49 Shrimps 0.09 Molluscs 0.04 Lobsters 1.00 Cephalopods Trash Fish 6.63

Figure 16: KK MANCHONG trawl average catch rate (in kghr-1) composition for SSME 3 waters east coast Sabah 2009

Demersal Fish

32.99 Pelagic Fish Elasmobranchs 47.95 1.36 Crabs 0.93 Shrimps 1.01 Molluscs 0.19 13.47 Lobsters 0.09 Cephalopods 2.02 Trash Fish

Figure 17: KK MANCHONG trawl average catch rate (in percentage) for SSME 3 waters east coast Sabah 2009

A total of 213 species (78 demersal fish, 39 pelagic fish, 8 elasmobranchs, 7 crabs, 9 shrimps, one mollusc, 2 lobsters , 4 cephalopods and 65 trash fish) were recorded during this survey (Appendices 2a-g). Table

7 shows the dominant 30 species caught by KK MANCHONG. The dominant species identified in term of higher average catch rate were Leiognathus spp. (9.8 kghr-1); Jellyfish (3.78 kghr-1); Plotosus lineatus (2.70 kghr-1); Leiognathus splendens (2.45 kghr-1); Saurida undosquamis (2.32 kghr-1); Rachycentron canadum (1.76

Hadil et al. 34

-1 -1 -1 -1 kghr ); Saurida tumbil (1.52kghr ); Pentaprion longimanus (1.20 kghr ); loligo spp. (1.20 kghr ) and others. Beside Rachycentron canadum and Pentaprion longimanus, the other dominant pelagic fish species caught were

Stolephorus indicus (0.89 kghr-1); Selar crumenophthalmus (0.64 kghr-1); Scomberomorus commerson (0.51 kghr-1) and Rastrelliger brachysoma (0.44 kghr-1).

Table 7: The 30 dominan t demersal and pelagic species caught by KK MANCHONG trawl in the waters of east coast Sabah 2009

Total catch Total Average STDev Average STDev weight catch catch wt. catch wt. catch no. catch no. Species number per haul per haul

Leiognathus spp. 323.45 60,888 9.80 22.785 1845.1 4,402.508

JELLYFISH 124.70 157 3.78 20.794 4.8 21.208 Plotosus lineatus 89.00 405 2.70 15.733 12.3 71.595 Leiognathus splende ns 80.89 6,588 2.45 14.138 199.6 1,159.503 Saurida undosquamis 76.49 2,843 2.32 3.876 86.2 227.358 Rachycentron canadu m 58.00 98 1.76 11.375 3.0 19.219 Saurida tum bil 50.13 345 1.52 1.816 10.5 17.244 Pentaprion longiman us 39.69 3,025 1.20 2.463 91.7 177.221 Loligo s pp. 39.61 2,679 1.20 1.502 81.2 112.814 Gazza minu ta 32.33 1,613 0.98 5.940 48.9 287.295 Scolopsis taeniopter us 31.70 871 0.96 2.631 26.4 92.743 Nemipterus nemur us 31.66 438 0.96 2.609 13.3 31.024 Priacanthus macracanthu s 30.80 346 0.93 1.970 10.5 24.481 Priacanthus tayenus 30.57 564 0.93 1.115 17.1 29.064

Saurida longimanus 29.49 2,884 0.89 1.862 87.4 195.427

Stolephorus indicus 29.31 1,204 0.89 2.306 36.5 61.561

Nemipterus furcosus 28.80 682 0.87 2.311 20.7 69.371

Apogon ellioti 27.51 1,805 0.83 1.177 54.7 137.357

Upeneus sulphureus 27.32 1,311 0.83 1.862 39.7 103.879 Alepes vari 25.60 154 0.78 5.000 4.7 29.999 Nemipte rus bathybius 23.79 439 0.72 2.102 13.3 39.974 Caranx sexfasciatu s 22.70 133 0.69 3.733 4.0 22.406 Selar crumenopht halmus 21.26 241 0.64 1.092 7.3 13.737 Upeneus japonicus 19.98 819 0.61 1.626 24.8 66.041 Tentoriceps crista tus 17.98 313 0.54 1.340 9.5 25.012 Dussumieria acuta 17.17 501 0.52 1.186 15.2 36.354 Scomberomorus commerson 16.95 18 0.51 1.895 0.5 1.347 Carangoides malabaricus 16.64 250 0.50 1.061 7.6 14.968 Nemipterus nematophor us 16.47 472 0.50 0.947 14.3 31.755 Rastrelliger brachysoma 14.68 133 0.44 1.969 4.0 16.831 Nemipterus marginatus 13.83 461 0.42 0.783 14.0 30.558

Demersal Fish Stock Assessment of EEZ East Coast Sabah 35

Density and biomass estimates of demersal fish for the east coast Sabah calculated using Swept Area

Method is summarized in Table 8. The biomass was almost 15,000 tons when catchability coefficient, q equals

1.0 and close to 25,000 tons when q equals 0.6. The biomass distribution among the fish groups seems to show that the demersal fish resource was comparable to the trash fish component. Pelagic fish resource available to trawl was quite substantial that was at 20% of the overall biomass. Contributing to only 5% of the overall biomass, the invertebrate resources were quite scarce in the surveyed area.

Table 8: The density and biomass derived by “swept area” method based upon different catchability

coefficients, q for east coast Sabah (total area-8445 NM2) demersal survey 2009 “Swept area” = a Velocity, V Duration, t (hr) Distant, D=V*t Headrope length, Gear mouth a=D*h*x (knot=NMhr -1) h=20.5m (NM) opening , x (NM2) 4 1 4 0.0111 0.76 0.0337

Fish Grou p Catch rate, CR CR per unit area @ density Biomass, Bc (tons) at (kghr-1 ) (Cw/t)/(a/t) kgNM-2 q=1 q=0.6 Demersal Fish 21.95 652.40 5510 9183 Pelagic Fish 11.89 353.30 2984 4973 Elasmobranc hs 0.39 11.63 98 164 Cra bs 0.72 21.41 181 301 62 103 Shrimp s 0.25 7.31 Molluscs 0.12 3.57 30 50

Lobsters 0.08 2.41 20 34

Cephalopods 1.78 52.75 446 743

Trash Fish 22.56 670.40 5662 9436

Total 59.74 1,775.18 14,993 24,989

There was an obvious pattern of density distribution along the east coast of Sabah as shown by Fig. 18.

Significantly high density (>3 tonNM-2) of demersal resource seems to concentrate in the northern part, Kudat or the SSME 1 region. Then, the density decreased towards SSME 2 of Sandakan and SSME 3 of Tawau regions.

Hadil et al. 36

Figure 18: The density distribution of demersal fish in east coast of Sabah 2009

The density and biomass distribution for all the resource components within different depth zone areas are summarized in Tables 9, 10 and 11. The shallowest stratum (18 -55 m) have the highest density at 1.9 tonNM-2 (Table 9) compared to 1.6 tonNM-2 (Table 10) for 56-92 m stratum and 1.2 tonNM-2 for the deepest stratum , >92 m (Table 11). The trend in biomas s distribution followed that of density, whereby the b io mass per unit area was highest at the shallow water and decreased in deeper water. About 30% of the biomass was attributed to the demersal fish resource with the trash fish resource as the major contributor (43%) to the high density in the shallow water (Table 9). But the trend in demersal fish contribution seems to increase as the water gets deeper: 46% for stratum 56-92 m and 87% for the deepest stratum. The reverse was true for trash fish resource: 31% (stratum 55-92 m) and 7% (stratum >92 m). The distribution of biomass by depth strata indicated that about 53% of the biomass was found at the deepest stratum; 37% at stratum 18-55 m and the reminding

10% found in stratum 56-92 m. This distribution was synonymous with area contribution of these strata: 64%

(stratum>92 m); 27% (stratum18-55 m) and 9% (stratum 56-92 m). The density and biomass estimates for the deepest stratum (>92 m) should be treated with caution since they were derived from only one trawl catch.

Demersal Fish Stock Assessment of EEZ East Coast Sabah 37

Table 9: The density and biomass of various fish groups for Stratum 18-55 m (area-2325 NM2) east coast Sabah derived by “swept area” method Fish Group Catch rate , CR CR per unit area@ density Biomass, Bc (tons) at -2 (k g/hr) (Cw/t)/(a/t) kgNM q=1 q=0.6 Demersal Fish 19.12 568.23 1,321 2,202

Pelagic Fish 14.10 419.06 974 1,624

Elasmobranchs 0.33 9.85 23 38

Crabs 0.79 23.35 54 90 Shrimps 0.15 4.44 10 17 Mollusc 0.21 6.19 14 24 Lobsters 0.14 4.19 10 16 Cep halopods 1.85 55.10 128 214 T rash Fish 2 7.25 809.82 1,883 3,138 Total 6 3.94 1,900.25 4,418 7,363

Table 10: The density and biomass of various fish groups for Stratum 56-91 m (area-725 NM2) east coast Sabah derived by “swept area” method Fish Group Catch rate, C R CR per unit area @ density Biomass, Bc (tons) at (kg/hr) (Cw/t)/(a/t) kgNM-2 q=1 q=0.6 Demersal Fish 2 5.13 746.85 541 902 Pelagi c Fish 9.56 284.10 206 343 Ela smobranchs 0.36 10.77 8 13 Crabs 0.68 20.23 15 24

Shrimps 0.41 12.07 9 15

Cephalopods 1.76 52.23 38 63

Trash Fish 17.23 511.92 371 619 Total 5 5.12 1,638.17 1,188 1,979

Table 11 : The density and biomass of various fish groups for Stratum >92m (area-5395 NM2) east coast Sabah derived by “swept area” method Fish Group Catch rate, CR CR per unit area @ density Biomass, Bc (tons.) at (kg/hr) (Cw/t)/(a/t) kgNM-2 q=1 q=0.6

Demersal Fish 34.45 1,023.77 5,523 9,205

Pelagic Fish 0.11 3.27 18 29

Elasmobranchs 1.90 56.46 305 508

Cephalopods 0.50 14.86 80 134 Tra sh Fish 2.75 81.72 441 735 Total 3 9.71 1,180.09 6,367 10,611

Tables 12, 13 and 14 give the values of densities and biomasses of the demersal fish resources within the waters of SSME 1, SSME 2 and SSME 3 respectively. SSME 1 water was the richest with density at 4.0 tonNM-2; followed by SSME 3 (1.5 ton NM-2) and SSME 2 (1.3 tonNM-2). This trend was also been depicted by

Hadil et al. 38

Fig. 18. Biomass per unit area followed the density trend. Although SSME 1 had a smaller area, the density being high, the biomass recorded for the area was the highest as compared to SSMEs 3 and 2. About 29% of the

SSME 1 demersal resource biomass was attributed to demersal fish with the larger portion at 46% contributed by trash fish. But demersal fish contributions seem to increase toward SSMEs 2 (34%) and 3 (48%). The reverse holds true for trash fish contribution: SSME 2 (34%) and SSME 3 (33%). Biomass was distributed 45% at

SSME 1 water; 30% at SSME 2 and the remaining 25% contributed by SSME 3 .

2 Table 12: The density and biomass of various fish groups for SSME-1 waters (area-2193 NM ) east coast Sabah derived by “swept area” method Fish Group Catch rate, C R CR per unit area @ density Biomass, Bc (tons) at

(kg/hr) (Cw/t)/(a/t) kgNM-2 q=1 q=0.6 Demersal Fish 39.40 1170.75 2567 4279 Pe lagic Fish 27.63 821.0 4 1801 3001 Elasmobranchs 0.47 13.9 7 31 51 Cra bs 0.98 29.1 2 64 106 Shrimps 0.11 3.2 7 7 12 Molluscs 0.53 15.75 35 58

Lobsters 0.19 5.65 12 21

Cephalopods 4.03 119.88 263 438 Trash Fish 62.51 1857.7 7 4074 6790 T otal 135.85 4037.19 8854 14756

2 Table 13: The density and biomass of various fish groups for SSME-2 waters (area-2799 NM ) east coast Sabah derived by “swept area” method Fish Group Catch rate, CR CR per unit area @ density Biomass, Bc (tons) at

-2 (kg/hr) (Cw/t)/(a/t) kgNM q=1 q=0.6 Demersal Fish 14.72 437.42 1,224 3401 P elagic Fish 11.20 332.88 932 2,588 Elasmobranchs 0.12 3.6 7 10 28 Crab s 0.86 25.6 2 72 199 S hrimps 0.08 2.2 6 6 18 Moll uscs 0.01 0.2 2 1 2 Lobsters 0.08 2.34 7 18

Cephalopods 1.70 50.46 141 392

Trash Fish 14.73 437.64 1,225 3403 Total 43.49 1,292.5 0 3,618 10,049

Demersal Fish Stock Assessment of EEZ East Coast Sabah 39

2 Table 14 : The density and biomass of various fish groups for SSME-3 waters (area-3453 NM ) east coast Sabah derived by “swept area” method Fish Group Catch rate, CR CR per unit area @ density B iomass, Bc (tons) at -2 (kg/hr ) (Cw/t)/(a/t) kgNM q=1 q=0.6 Dermersa l Fish 23.59 701.08 2,421 4,035 Pelagic Fish 6.63 196.96 680 1,133 Ela smobranchs 0.67 19.91 69 115 Crabs 0.46 13.60 47 78 Shrim ps 0.49 14.70 51 85 Mollusc 0.09 2.74 9 16

Lobster 0.04 1.26 4 7

Cephalopod 1.00 29.58 102 170

Trash Fish 16.23 482.29 1,665 2,776

Total 49.20 1,462.13 5,049 8,415

The available data on current yield (Y) taken from the survey area are the landings of all demersal fish species in 2008 (Anon., 2009) and this gives the yield at 45,450.60 tons for east coast Sabah. Natural mortality

(M) values for demersal fish in the area surveyed were rather limited (Abu Talib et al., 2003). However many workers in the region had estimated M using the formula of Pauly (1980). Since most values of M were between one and two, these values were used in the equations to determine MSY. For comparison with the results obtained from KK MANCHONG west coast Sabah survey in 1998, a value of M equal 1.66 (Anon., 2000; Abu Talib et al., 2003) was also used to calculate the maximum sustainable yield, MSY or the exploitable potential yield.

Table 15 gives the MSY for selected values of q and M. The MSY of between 26,328 to 42,738 tons of demersal fish in the area surveyed as estimated using the Cadima’s equation (Sparre and Venema, 1992 ) at

Y=45,450.60 tons. The MSY values calculated under Schaefer’s Model (Garcia et al., 1989) were between -

73,836 to 223,482 tons and these values obtained were unrealistic. The exploitation rate for any combination of q and M at Y=45,450.60 tons was in the range of 0.53 to 0.79 (Table 15), indicating over-fishing.

Hadil et al. 40

Table 15: Maximum Sustainable Yield, MSY and exploitation rate, E(yr -1) for the demersal fish resource in the EEZ Malaysia waters, east coast Sabah 2009 asse ssed at catchability coefficient, q=0.6 and q=1.0; using different model and mortality coefficient, ( M)

Formula q=0 .6, Bc=20,013 tons q=1.0, B c=12,008 tons [Model-Reference] M=1.0 M=1.6 6 M=2.0 M=1.0 M=1.66 M=2.0 MSY=0.5*(Y+MBc) 32,732 39,336 42,738 26,328 32,692 34,733 Cadima (Spare and Venema, 1992)

MSY=M²Bc²/(2MBc-Y ) -73,836 52,574 46,301 -6,727 -71,147 223,482 Schaefer (Garcia et al., 1989)

Parameter q=0.6, Bc=20,013 tons q=1.0 Bc=12,008 tons

MSY followed Cadima’s MSY followed Cadima’s Natural mortali ty (M) M= 1.0 M=1.6 6 M=2.0 M=1.0 M=1.66 M=2.0 E=(Y/Bc)/[(Y/B c)+M] 0 .69 0.5 8 0.53 0.79 0.70 0.65

The yield, Y or landings of demersal fish for east coast Sabah in 2008 (Anon., 2009) was at 45,450.6 tons

Using specific yield figures from different SSME regions: 10,025.22 tons (SSME 1); 15,611.73 tons (SSME 2) and 19,813.65 tons (SSME 3), the demersal fish MSY and exploitation rate of the respective SSME were derived as shown by Tables 16, 17 and 18. The MSY values for the demersal fish resource of SSME 1 were between 8,539 to 16,768 tons with the exploitation rates of between 0.30 to 0.59 per annum (Table 16).

MSY values for SSME 2 were between -80,720 to 15,645 tons with the exploitation rate of between 0.51 to 0.85 per annum (Table 17). For SSME 3 (Table 18), the MSY values calculated were between -32,636 to 17,188 tons having the exploitation rate figures between 0.58 to 0.82 per annum.

Table 16: Maximum Sustainable Yield, MSY and exploitation rate (yr -1) for the demersal fish resource in the SSME 1 waters, east coast Sabah 2009 assessed at catchability coefficient, q=0.6 and q=1.0; using different model and mortality coefficient, (M) Formula q=0.6 Bc=11,755 tons q=1.0 Bc= 7,053 tons [Model-Reference] M=1.0 M=1.66 M=2.0 M=1.0 M=1.66 M=2.0 M SY=0.5*(Y+MBc) 10890 14769 16768 8539 1086 7 12066 Cadima (Spa re & Venema, 1992)

MSY=M²Bc²/( 2MBc-Y) 102 47 1312 9 14941 12190 10237 10941 Schaefer (Garcia et al, 1989 )

Parameter q=0.6 Bc=11,75 5 tons q=1.0 Bc= 7,053 tons MSY followed Cadima’s MSY followed Cadima’s Natural mortality (M) M=1.0 M=1.66 M=2.0 M=1.0 M=1.66 M=2.0

E=(Y/Bc)/[(Y/Bc)+M] 0.46 0.34 0.30 0.59 0.54 0.4 2

The yield, Y o r landings of demersal fish for SSME 1 east coast S abah in 2008 (A non. 2009) wa s at 10,025.22 tons

Demersal Fish Stock Assessment of EEZ East Coast Sabah 41

Table 17: Maximum Sustainable Yield, MSY and exploitation rate (yr -1) for the demersal fish resource in the SSME 2 waters, east coast Sabah 2009 asse ssed at catchability coefficient, q=0.6 and q=1.0; using different model and mortality coefficient, (M) Formula q=0.6 B c=7,461 tons q=1.0 Bc= 2, 686 tons [Model-Reference]

M=1.0 M=1.6 6 M=2.0 M=1.0 M=1.66 M=2.0 MSY=0.5*(Y+MBc) 11536 13999 15267 9149 10035 10492 Cadima (Spare & Venema, 1992)

MSY=M²Bc²/(2MBc-Y ) -80720 16748 15645 -705 -2970 -5928 Schaefer (Garcia et al, 1989) P arameter q=0.6 Bc=7,4 61 tons q=1.0 Bc=2,686 ton s MSY followed Cadima’ s MSY followed Cadima’s Natural mortal ity (M) M= 1.0 M=1.6 6 M=2.0 M=1.0 M=1.66 M=2.0

E=(Y/Bc)/[(Y/B c)+M] 0 .68 0.5 6 0.51 0.85 0.78 0.74

The yield, Y or landings of demersal fish for SSME 2 east coast Sabah in 2008 (Anon., 2009) was at 15,611.73 tons

Table 18: Maximum Sustainable Yield, MSY and exploitation rate (yr -1) for the demersal fish resource in the SSME 3 waters, east coast Sabah 2009 assessed at catchability coefficient, q=0.6 and q=1.0; using different model and mortality coefficient, (M)

Formula q=0.6 Bc=7,281 tons q=1.0 Bc=4,369 tons [ Model-Reference] M=1.0 M=1.6 6 M=2.0 M=1.0 M=1.66 M=2.0 Cadima (in S pare & Venema, 1992) MSY=0.5*(Y+MBc) 13547 15950 17188 12091 13533 14275 Schaefer (Garcia et al, 1989)

MSY=M²Bc²/(2MBc-Y) -10095 33510 22776 -1723 -9904 -32636

Parameter q=0.6 Bc=7,281 tons q=1.0 Bc=4,369 tons

MSY followed Cadima’s MSY followed Cadima’s N atural mortality (M) M=1.0 M=1.66 M=2.0 M=1.0 M=1 .66 M=2.0 E=(Y/Bc)/[(Y/Bc)+M] 0.73 0 .62 0.58 0.82 0.73 0.69

The yield, Y or landings of demersal fish for SSME 3 east coast Sabah in 2008 (Anon ., 2009) was at 1 9,813.65 tons

Discussion

This was the first ever demersal survey conducted in the Sulu-Sulawesi seas east coast Sabah. The area covered by this survey was generally the whole extend of the Malaysian EEZ where the furthest area was slightly over 30 NM. The first Malaysian EEZ survey using the R.V.RASTRELLIGER (Anon., 1 988) was conducted in 1986 to 1987 covered the whole EEZ area of Malaysia with the exception of east coast Sabah.

Hadil et al. 42

In this survey using bottom trawl net, pelagic fish will inevitably also be caught due to the “high opening” of the net and the diurnal vertical migration of pelagic fish. Densities of demersal fish, comprising the commercial and trash species, were calculated from total catch rates after the pelagics were excluded. This was done because the pelagic nature and the schooling behaviour of pelagic fish violate the assumption of normally distributed demersal fish stock.

The catch rates from this demersal fish survey show the productivity of east coast Sabah. Compared to the previous survey using the same vessel, K.K.MANCHONG (Anon., 2000; Abu Talib et al., 2003) in west coast Sabah (catch rate -71.6 kghr-1), the total catch rate from this survey (catch rate -47.85 kghr-1) was substantially low by at least 30%.

For comparison, in 1972 and 1973, the coastal (shallower waters of 10 to 60 m deep) demersal fish resource surveys were conducted by K.K. JENAHAK in the west coast Sabah, gave average catch rates of 512 and 210 kghr-1 respectively (Mohammed Shaari et al., 1976). K.K. MANCHONG conducted an exploratory trawling in the area between 10 to 100 m deep on the west coast of Sabah in 1993 gave an average catch rate of commercial and trash fish of 16 9 kghr-1 for coastal and at 265 kghr-1 for offshore waters (Biusing et al., 1995).

The overall catch rates by depth recorded from this surv ey did not show any large variation from the shallow to the deep stratum. Significantly high contribution of demersal and pelagic fish for the 3 SSMEs ranging from 49 to 70% for stratum 1 and 2 indicated that the productivity of the water is still sizeable. But, contribution by demersal fish in term of weight and percentage of the total catch rate seems to increase substantially from the shallow to the deepest stratum. This was obvious as the catches of pelagic fish and trash fish were lower from the deeper waters. In fact, the trend of decreasing catch rate appeared from Stratum 1 to 3, but this was not really significant. The fact that only one station was in the deepest stratum did not qualify to represent the depth stratum and this maybe an artifact of the limited number of stations. In this survey, SSME 1 water was found to be the most productive. Therefore the fishing ground off

Kudat is richer than the grounds off Sandakan and Tawau. High catch rate of demersal fish as well as trash fish was probably due to the fact that the area was subjected to large water outflow during the period of June-

August. This large water interchange brings in nutrients from the Sulu sea to South China sea through the

Balabac strait (Wyrtki, 1961).

In the east coast Sabah, commercial trawl landings comprised 56% demersal fish; 23% pelagic fish and

21% invertebrates (Biusing, 2001). But invertebrates caught by KK MANCHONG trawl contributed only about

4%. This was probably due to the fact that commercial trawlers tend to fish in shallower and near coastal waters

Demersal Fish Stock Assessment of EEZ East Coast Sabah 43 where there is high concentration of invertebrates like shrimps, cephalopods, crabs and lobsters. At 20% of the total catch, pelagic fish composition caught by KK MANCHONG was similar to that of commercial trawl landings.

The dominant groups and species recorded in trawl commercial landings (Biusing, 2001) and the current survey was comparable in that the dominant commercial groups (nemipterids, synodontids, leiognatids and mullids) were similar. The order of dominant in trawl commercial landings was slightly different due to commercial preferences.

The overall density of demersal fish (commercial and trash fish) for east coast Sabah was 1.42 tonsNM-

2 compared to about 6.86 tonsNM-2 (2 tonskm-2) for west coast Sabah ten years ago (Anon., 2000; Abu Talib et al., 2003). The demersal fish density of west coast Sabah has declined by about 36% in 10 years (Anon., 2000;

Abu Talib et al., 2003). If the demersal fish density of east coast Sabah assumed to decline in a similar pattern

-2 as for the west coast Sabah, the value would be about 2.22 tonsNM ten years ago.

Mohammed Shaari (1976) estimated the density of fish in the continental shelf area of west coast Sabah less than 60 m deep at 17 tonsNM-2. Assuming this was the density when the demersal fishery was in virgin state for the whole of Sabah water, the decline in the fish density from the virgin state is approximately

90%. However it is believed that the 18-55 m deep area is richer in fish compared to the deeper areas, thus the density of deeper waters would be lower than 17 tonsNM-2 when in the virgin state.

Based on the current estimated density, the total biomass of demersal fish calculated from this survey, using q=0.6, was 20,016 tons. The total area used in this calculation was 8,445 NM2. For west coast Sabah, ten years ago the estimated biomass was 23,723 tons in an area of 5,437 NM2 at the same q value (Anon., 2000).

Assuming that the rate of exploitation was the same for both east and west coast Sabah, obviously the biomass had declined substantially in ten years, not considering the larger area covered in this current survey. Assuming a density of 17 tonsNM-2 (Mohammed Shaari, 1976), the virgin biomass in this area before the onset of trawling could have been 143 ,565 tons (if q=0.6). Following this, the estimated MSY using Gulland’s formula (Sparre and Venema 1992) would be around 72,000 tons (assuming M=1).

The biomass of demersal fish estimated here was based on the results of only one survey conducted over a limited period only. A better biomass estimate using the average result from a series of surveys con ducted in different months in the same area would provide a better estimate of the actual standing stock. A series of surveys should cover the seasonal variation in the standing stock.

Hadil et al. 44

The MSY of the demersal fish resources was estimated from the biomass estimates. The value of

44,718tons was accepted as the potential for exploitation. This estimate was derived from using assumptions for values like the catchability coefficient (q), natural mortality (M) and yield from the fisheries (Y), which was estimated from the landings of demersal fish species. In such a situation, a change in either one of the three variables used will change the estimate of MSY and potential yield.

Different values of catchability coefficients were used because the actual performance of the trawl is not known. It could be possible that some fish may escape being caught or all the fish in the area swept could be caught. The choice of natural mortality values used also affects the MSY estimated. In Gulland’s formula

(Sparre and Venema 1992), the use of M=2 instead of M=1 will almost double the MSY. The choice of M values used here was based on values of M determined for tropical fish in this region. Natural mortality, M=1.66 was derived from fish species data collected from previous survey in the west coast of Sabah (Abu Talib et al.,

2003). This value was finally chosen for the estimate of potential yield.

In the estimates of current demersal yield, it was based on all demersal fish species landed from the east coast of Sabah in 2008 (Anon., 2009). It would be preferable to use landings of 2009 when this survey was conducte d.

Fish productivity (tonsNM-2yr-1) is the value derived from the estimated maximum potential yield,

MSY per unit area represented. The demersal fish productivity of east coast Sabah derived from the chosen

-2 -1 -2 -1 MSY (39336 tons) was at 4.66 tonsNM yr (1.36 tonskm yr ). SSME 1 was the most productive where the demersal fish productivity was estimated at 6.73 tonsNM-2yr-1 or 1.96 tonskm-2yr-1 followed by SSME 2 at 5.00 tonsNM-2yr-1 and SSME 3 at 4.62 tonsNM-2yr-1. Its shows that the waters of east coast Sabah is still relatively productive as compared to the Philippines part of the Sulu sea where the estimate of productivity was at 0.91 tonskm-2yr-1 (3.12 tonsNM-2yr-1 ) for demersals (Miclat et al., 2003).

The estimate of exploitation (E) rates for demersal fish resource ranges from 0.34 to 0.62 yr-1 for the three SSME regions with an average value of 0.58 yr-1 for the whole east coast Sabah. The exploitation rates were comparable to the status of the west coast Sabah in 1997. In the survey carried out in 1997 (Anon., 2000;

Abu Talib et al., 2003) the length frequency data on 10 demersal fish, three pelagic fish and one cephalopod analysed gave a mean E value of 0.62 yr-1. The result of this present survey shows that the east coast Sabah demersal fish resource is experiencing over-exploitation. Thus, the demersal fisheries on the east coast of Sabah cannot be further developed through the addition of fishing effort.

Demersal Fish Stock Assessment of EEZ East Coast Sabah 45

Conclusion

This was the very first demersal survey ever carried out in east coast Sabah. It was estimated that about

44,718 tons of demersal fish can be harvested annually but currently, east coast Sabah is experiencing over- exploitation of this resource. The demersal fisheries of east coast Sabah are exploited mainly by trawlers. The efficiency of trawlers has increased many-fold compared to the efficiency of those used in the early seventies when they were first introduced to the region. Most of the trawls presently being used are “high opening”.

Trawlers currently used bigger nets and more powerful engines. Area of fishing operation is very near to the port and transporting back of catches is extremely easy. While the licensing of fishing boats and gear has helped to control the increase in fishing effort, this was insufficient since fishing efficiency and total fishing effort has increased through the use of additional and new technology in fishing.

Effective management measures must be implemented and enforced to reduce the fishing effort before the demersal fisheries collapse. Besides just limiting fishing effort through licence limitation, additional technical measures like having juvenile and turtle excluder device, JTED and increasing the cod-end mesh of commercial trawlers should be seriously considered. The cod-end mesh size permitted by regulation is now

38mm. With the use of JTED and a larger cod-end mesh size, large proportion of under-sized fish will be allowed to escape and these fish will contribute to a larger yield when caught at a later stage and at a large size.

In order to evaluate the effectiveness of any management measure implemented, continuous monitoring and research preferably by annual experimental surveys should be undertaken following the implementation and effective enforcement of such a measure. Monitoring the performance of commercial fishing boats should be conducted parallel to experimental fishing by research vessels to ensure that the current status of the fisheries is known, fisheries being dynamic in nature. This is also to ascertain that new and additional information is made available for the formulation of new and the refinement of the old ones.

Acknowledgements

The authors wish to thank Y. Bhg. Dato’ Junaidi bin Che Ayub, Director General, Department of

Fisheries Malaysia, YM Tn Hj. Raja Mohammad Noordin bin Raja Omar Ainuddin, Director of Research, Mr .

Rayner Datuk Stuel Galid, Director of Sabah Fish eries Dept., Tn. Hj. Azlisha bin Abdul Aziz, Director of Marine Fisheries Dept. Sarawak, Mr. Albert Chuan Gambang, Director of Fisheries Research Institute Bintawa,

Sarawak and Mr. Bohari bin Leng, Director of FT Labuan Fisheries Dept. for their support in carrying out this

Hadil et al. 46 expedition. We would like to acknowledge our sincere appreciation to the prime mover of this Sulu -Sulawesi expedition, Prof. Dr. Nor Aieni Binti Haji Mokhtar, Director of NOD-Ministry of Science, Technology and

Innovations, MOSTI. To Tn. Hj. Gulamsarwar bin Jan Mohamad, Director of Licensing and Resource management DOF, NOD, MFRDMD-Kuala Terengganu and all our sponsors who have make this expedition a success, thank you very much. Last but not least appreciation also goes to the Malaysian Navy in particular the

National Hydrographic Centre for providing safety coverage during this inaugural expedition. Finally, we thank

Mr. Irman Isnain, Mr. Harun Duin, Mr. Kamal Salleh and Mr. Amjah Hj. Kadis of Saba h Fisheries Dept., Staff of KPM YELLOWFIN vessel, the Captain and crew of KK MANCHONG who gave full support and commitment throughout the course of this surve y.

References

Abu Talib, A., M. Mohammad Isa, I. Mohamad Saupi and Y. Sharum. 2003. Status of d emersal fishery resources of Malaysia. p. 83 - 136. In G. Silvestre, L. Garces, I. Stobutzki, M.Ahmed, N.A. Valmonte- Santos, C. Luna, L. Lac hica-Aliño, P. Munro, V. Christensen and D. Pauly (eds.) In: Assessment, Management and Future Directions for Coastal Fisheries in Asian Countries. WorldFish Center Conference Proceedings 67, 1 120 p.

Anonymous, 1988. Deep-Sea Fisheries Re source Survey Within the Malaysian Exclusive Economic Zone Final Report. Department of Fisheries Malaysia, Kuala Lumpur, Malaysia.

Anonymous, 2000. Fisheries Resources Survey in the Exclusive Economic Zone (EEZ) of Malaysia (1997 - 99). The Status of Demersal and Pelangic Resources. Department of Fisheries, Malaysia.

Anonymous. 2007. Annual Fisheries Statistics, 2007. Department of Fisheries Malaysia Malaysia, Ministry of Agriculture Malaysia, Kuala Lumpur, Malaysia.

Anonymous. 2009. Annual Fisheries Statistics, 2008. Department of Fisheries Sabah, Ministry of Agriculture Sabah, Malaysia.

Biusing, E.R. 2001 Assessment of Coastal Fisheries in the Malaysian-Sabah portion of the Sulu-Sulawesi Marine Ec oregion. WWF Malaysia.

Biusing, E.R.; Gambang, A.C.; Jumin, R.; Manjaji, M. 1995. Demersal fisheries resources along the west coast of S abah. Jabatan Perikanan Malaysia. (Mimeo.)

FAO. 2006. Food Balance Sheets 2003. FAO. Rome.

Garcia, S, P. Sparre and J. Csirke, 1989. Estimating surplu s production and maximum sustainable yiel d from biomass data when catch and effort time series data are not available. Fish. Res. 8: 13-23.

Hadil, R. and R. Richard. 1991. Distribution and biological status of the pelagic resources off Sarawak Malaysia. Fisheries Bulletin No.68. Department of Fisheries Malaysia.

Hadil, R., Gambang, A.C., Rumpet, R.,Nurridan, A.H., Daud, A. & Jamil, M. 2008. The status of th e demersal fish resource beyond 30 nautical miles off Sarawak. Malaysian Fisheries Journal 7(1): 1-18.

Demersal Fish Stock Assessment of EEZ East Coast Sabah 47

Mackett, D.J. 1973. Manual of Methods for Fisheries Resource Survey and Appraisal. Part 3 – Standard

Methods and Techniques for Demersal Fisheries Resource Surveys. FAO Fisheries Technical Paper No. 124, FAO, Rome, Italy .

Miclat, R. I.; F. Guarin and A. R. F. Montebon. 2003. Marine fishery resources of neritic ecosystems . In: A Biophysical Assessment of the Philippine Territory of the Sulu -Sulawesi M arine Ecoregion. Sulu- Sulawesi Marine Ecoregion Program. WWF-Philippines. May 2003.

Mohd. Shaari S.A.L., Chong B. J. and Pathansali, D. 1976. Assessment of Marine Fisheries Resources of Malaysia Fish. Bull. No. 15. Ministry of Agriculture, Malaysia.

Pauly D. 1980. On the interrelationships between natural mortality, growth parameters, and mean environmental temperature in 175 fish stocks. J. Cons. Int. Exploit. Mer. 39(2): 175-192.

Sparre, P. and S. C. Venema 1992. Introduction to Tropical Fish Stock A ssessment. Part 1 – M anual. FAO Fisheries Technical Paper No. 306/1 Rev. 1, FAO, Rome, Italy. The World Bank, 2005. Little Data Book. International Bank for Reconstruction and Development/World Bank.Washington, DC.

Wyrtki, K. 1961. Scientific results of marine investigations of the South China Sea and the Gulf of Thailand, 1959-1961. NAGA Report 2. Scripps Institute of Oceanography, La Jolla, CA.

Hadil et al. 48

Appendix 1 : KK MANCHONG trawl log for th e 40 stations carried out from 15th July to 31st July 2009 in east coast Sabah, the Sulu-Sulawesi seas Malaysian EEZ waters

Date Sta tio SSME Net Trawling Speed Heading Hauling Net n No. release (knot) haul- Time De pth Position Log Time Dep th Position Log (hr ) up (hr) (m) (Lat/Long) (min.) (m) (Lat/Long) (hr) 07° 00 900 06° 59 200 1 0815 0820 21.6 2 3.0 135 60 21.9 2 0935 116° 50 700 116° 53 100

15/7 07° 09 000 07° 10 800 2 1125 1133 32.3 2 3.0 220 40 39.1 116° 57 2 1215 116° 57 200 000

07° 06 106 07° 05 500 3 1 0905 0923 31.6 2 2.8 120 60 32 2 1023 117° 21 636 117° 24 100 16/7 06° 48 000 06° 48 478 4 1442 1452 20.5 1 2.8 080 45 24 1 1537 117° 38 450 117° 40 200

06° 22 500 06° 24 397 5 0655 0704 27.1 1 2.8 100 60 27.5 1 0804 117° 54 900 117° 56 856

06° 08 000 06° 05 600 17/7 6 1140 1146 26.9 1 2.8 206 60 1 5.3 1 1246 118° 09 100 118° 07 900 06° 01 700 06° 02 000 7 1440 1444 36 2 2.8 ;071 60 40 1 1544 118° 16 300 118° 19 200

05° 51 595 05° 50 173 8 1445 1452 34 2 2.8 130 60 33.6 2 1552 118° 28 312 118° 30 828 19/7 05° 49 400 05° 48 300 11 1655 1703 40 3 3.0 108 60 43.8 3 1805 118° 34 700 118° 37 500

05° 46 300 05° 44 900 10 07 00 0707 26.6 2 3.0 145 60 3 1.5 2 0807 118° 34 600 118° 37 200 2 05° 43 480 05° 43 100 9 08 57 0905 20.7 1 2.8 111 40 1 0 1 0945 118° 37 520 118° 39 400 05° 40 600 05° 48 300 20/7 13 1130 1140 39 3 2.8 038 60 50.7 3 1240 118° 44 630 118° 37 503

60 05° 41 950 05° 40 500 14 1340 1347 54.6 4 3.0 116 62.1 4 1505 118° 50 050 118° 52 750 60 05° 36 700 05° 34 900 12 1630 1640 34.2 2 2.8 141 29.1 2 1752 118° 49 100 118° 51 250 60 05° 33 900 05° 35 800 21/7 15 06 15 0625 40.5 3 2.8 042 6 2.5 4 0738 118° 53 600 118° 55 700 60 04° 09 600 04° 10 600 36 1430 1440 27.3 2 2.8 070 36.2 2 1555 118° 10 600 118° 13 200

25/7 04° 12 400 04° 14 700 35 1639 1650 29.0 2 2.8 034 60 19.5 2 1752 118° 17 800 118° 18 750

37-40 Aborted-water too deep 33 3 Aborted-very rough bottom

04° 18 300 04° 18 900 32 0730 0740 21.1 1 3.2 075 60 22.8 1 0845 118° 43 400 118° 46 400 26/7

31 Aborted-very rough bottom

30 Aborted-very strong current

Demersal Fish Stock Assessment of EEZ East Coa st Sabah 49

04° 16 600 04° 17 700 34 1525 1535 19.5 1 2.8 074 60 20.9 1 1647 118° 27 650 118° 30 350

04° 42 500 04° 43 800 26 1650 1703 78 5 2.9 297 60 76.4 5 1820 118° 41 600 118° 38 790 29/7

04° 46 980 04° 48 400 29 1840 1850 78.4 5 2.9 335 45 75.3 5 1950 118° 36 100 118° 35 100

04° 51 850 04° 50 900 28 0630 0640 51.1 3 3.0 108 60 61 3 0755 118° 28 000 118° 31 000

04° 52 200 04° 53 000 2 5 082 0 0830 69.3 4 3.0 075 60 71.4 4 0940 118° 34 900 118° 38 050

60 04° 54 900 04° 55 450 2 4 101 0 1020 70 4 3.0 087 52.9 4 1130 118° 40 550 118° 43 800 60 04° 45 900 04° 45 450 27 1240 1255 100.0 6 3.0 100 118 6 1410 30/7 118 ° 47 950 118° 50 874

60 04° 41 750 04° 54 770 23 1455 1510 95.0 6 3.0 017 78 6 1625 118° 54 250 118° 55 796

60 04° 56 400 04° 56 950 22 1700 1710 64.0 4 3.0 089 67.5 4 1820 118° 52 600 118° 55 550 60

04° 56 700 04° 51 100 21 1835 1845 71.4 4 3.0 100 76.1 4 2000 118° 57 509 119° 00 700

60 05° 29 606 05° 30 900 20 1000 1007 34.2 2 3.0 299 43.2 3 1117 119° 03 800 119° 01 200

60 05° 33 650 05° 35 900 1 9 1140 1150 66.4 4 3.0 309 66.8 4 1303 119° 02 650 119° 00 400 60 05° 38 400 05° 36 900 31/7 17 2 1325 1337 69.3 4 3.0 245 66.4 4 1450 119° 00 700 118° 57 750

60 05° 35 100 05° 38 200 16 1520 1530 60.0 4 3.0 356 67.1 4 1640 118° 56 200 118° 56 500 60 05° 40 300 05° 41 450 18 1710 1720 76.0 4 3.0 286 72.5 4 1838 118° 59 000 118° 56 100

H adi l et al. 50

Appendix 2a: Catch rates (Wt-kg & N-number per hour) of species caught by KK Manchong trawl for 33 stations in east coast of Sabah, the Sulu-Sulawesi seas EEZ of Malaysia in 2009

Station no. 1 2 3 4 5

Date 15/07 15/07 16/07 16/07 17/07

Depth (m) : start -finish 21.6 - 21.9 32.3 - 39.1 31.6 - 32.0 20.5 - 24.0 27.1-27.5

Species Wt N Wt N Wt N Wt N Wt N 1 Abalistes stellaris 0.2 4 0 .19 8 2 Acanthu rus mata 3 Aesop ia cornuta 4 Alecti s ciliaris 0.86 4 5 Alectis indica 0.16 1

6 Alepes vari 25.5 153

7 Alutera monoceros

8 Alutera sp. 0.67 20 9 Amblyg aster sirm 10 Amusium pleuronectes 1.7 69 0.95 35 11 Anodo ntostoma chacunda 0.35 7 12 Antennarius striatus 13 Antigonia capro s 14 Apogon a ureus 15 Apogon ellioti 0.07 13 0.07 1

16 Apogon lineatus

17 Ariomma indica

18 Arius thalassinus 19 Aroth ron immaculatus 20 Aroth ron manillensis 21 Arothr on stellatus 22 Atule mate 0.4 2 1.65 36 0.1 2 0.1 1 23 Calappa lo phos 24 Calapp a philargius 25 Canthigaster compresso

26 Carangoides armatus 0.27 5 0.33 20

27 Carangoides chrysophrys 1.8 12 0.4 4

28 Carangoides chrysophrys 1.8 12 0.4 4 29 Carangoides fu lvoguttatus 30 C arangoides hedlandensis 31 Carangoides m alabaricus 0.45 11 1 .16 7 0.2 1 32 Carangoides sp . 33 Caranx ignobilis 34 Caranx sexfasciatu s 20.5 123 0.2 1 35 Carcharhinus sorrah 1.5 1

36 Champsodon longispinis

Demersal Fish Stock Assessment of EEZ East Coast Sabah 51

37 Charybdis feriatus 0.8 4 1. 3 8 0.15 1 38 Charybdis natato r 0.5 4 0.1 1 0.7 2 0.35 1 39 Chiloscylliu m plagiosum 40 Chirocentrus dorab 0.2 1

41 Choerodon schoenleinii 0.11 5

42 Choerodon sp.

43 Cynoglossus bilineatus 44 Dactyloptena or ientalis 45 Dactylopus dac tylopus 46 Dasya tis kuhlii 47 Decapterus russelli 0.3 5 0.05 1 48 Diagramma pictum 0.13 3 49 Diodon holocanthus 0.27 3

50 Diodon hystrix

51 Dipterygonotus balteatus

52 Dussumieria acuta 0.67 11 4.5 149 53 Echeneis n aucrates 0.9 2 3.72 3 54 Elates rans onneti 55 Engyropr osopon sp. 56 Epinephelus areolatus 57 Epinephelus ble ekeri 58 Epinephelus caeruleopunctatus

59 Epinephelus coioides

60 Epinephelus heniochus

61 Epinephelus sexfasciatus 0.15 2 0.6 9 62 Epinephelus sp . 63 Fistularia comme rson 64 Fistula ria petimba 0.67 33 65 Gazza minuta 32.0 1600 66 Gerres abb reviatus 67 Gerres oyena 0.7 14

68 Gnathonodon speciosus 0.8 6

69 Grammatobothus polyophthalmus 0.2 20

70 Gymnocranius elongatus 71 Halieutaea sp. 72 Harpiosquilla harpax 0.2 2 73 Heterocarpus spp . 74 Jellyfi sh 10 5 87 66 0.7 5 75 Lactoria corn uta 76 Lactoria fornasini 0.07 3

77 Lagocephalus inermis

78 Lagocephalus lunaris

Ha dil et al. 52

79 Lagocephalus sceleratus 0.06 20 0.13 5 0.8 8

80 Lagocephalus spadiceus 0.15 2

81 Leiognathus bindus 0.45 44

82 Leiognathus equulus

83 Leiognathus leuciscus 84 Leiognathus longispinis 85 Leiognathus smit hursti 86 Leiognathus s plendens 80 6560 87 Leiognathus spp. 46.6 6993 40 5760 88 Leiogn athus stercorarius 7.0 350 0.07 48 89 Lepturacanthus savala 90 Lethrinus nebulosus 0.13 5

91 Lethrinus sp

92 Loligo edulis

93 Loligo spp. 2 47 6.3 108 5.7 124 0.15 4 0.26 16

94 Loxodon macrohinus 95 L utjanus lutjanus 96 Lutjanus ma labaricus 0.4 8 97 Lutjanu s vitta 98 Megalaspis cordyla 2 1 1 99 Mene maculata 100 Metapena eus sp. 101 Monacanthus chinensis 0.2 3

102 Monodactylus argenteus

103 Nemipterus aurora

104 Nemipterus balinensis

105 Nemipterus bathybius 106 Nemipter us furcosus 1.1 26 0.15 2 9.37 332 9.31 226 0.2 4 107 Nemipterus h exodon 0.2 1 0.38 2 0.06 1 2.5 38 108 Nemipterus isacanthus 109 Nemipterus japonicus 110 Nemipterus marginatus 0.9 11 3. 3 14 6 111 Nemipterus n ematophorus 112 Nemipterus nematophus

113 Nemipterus nemurus 0.1 1 1.03 14 0.4 8

114 Nemipterus peronii 0.1 1 0.6 13

115 Nemipterus virgatus

116 Octopus 117 Odonus niger 118 Ophichth us sp. 119 Ostracion nasus 0.13 1 120 Panulirus polyphagus

Demersal Fish Stock Assessment of EEZ East Coast Sab ah 53

121 Parachaetodon oc ellatus 122 Paramonacanthus sp. 0.15 2 0.13 3

123 Parapercis alboguttata

124 Paraplagusia bilineata

125 Parascolopsis tanyactis

126 Parastromateus niger 1.5 11 127 Pardachirus pavo ninus 0.05 1 128 Parupeneus he ptacanthus 0.2 9 3 129 Penaeus indicus 130 Penaeu s japonicus 131 Penaeus lo ngistylus 132 Penaeus mo nodon 133 Penaeus p enicillatus 0.15 5 134 Penaeus semisulcatus 0.4 13

135 Penaeus sp.

136 Pennahia anea

137 Pentapodus setosus 0.1 2 1.1 38 2.93 92

138 Pentaprion longimanus 0.15 3 10.79 879 0.8 88

139 Pinjalo pinjalo 140 Platax batavian us 141 Platyc ephalus indicus 142 Plectranthia s sp. 143 Plotosus linea tus 89 405 144 Podoph thalmus vigil 145 Portunu s pelagicus 0.4 1 0.25 2 146 Portunus sa nguinolentus 0.05 1 0.1 1 147 Priacanthus blochii

148 Priacanthus macracanthus 0.3 5

149 Priacanthus tayenus 0.7 4 0.9 18 1.43 41 2.85 154

150 Pristigenys niphonia

151 Pristipomoides typus 152 Pristotis jerd oni 0 .67 40 153 Psettodes er umei 154 Pseudorhom bus arsius 155 Pseudo rhombus quinquocellatus 0.2 13 156 Pseudor hombus sp 157 Pseudotriacan thus strigilifer 158 Pterois sp. 159 Pterygotrigla sp.

160 Rachycentron canadum 58 98

161 Raja (Okamejei) bosemani

162 Raja (Okamejei) sp.

H adi l et al. 54

163 Rastrelliger brachysoma 0.6 6

164 Rastrelliger faughni 0.1 1

165 Rastrelliger kanagurta 1.5 9

166 Rhinobatus sp.

167 Samaris cristatus 168 Sardin ella sp. 169 Sa rdinella gibbosa 0.53 5 0.34 11 170 Saurida gracilis 171 Saur ida longimanus 0.15 3 172 Saurida t umbil 0.1 5 2 0.8 9 173 Saurida undosquamis 3.36 199 0.24 16

174 Saurida wanieso 0.24 2

175 Scolopsis monogramma

176 Scolopsis taeniopterus 1.05 22 0.3 5 13.05 521 2.79 59 2.24 80 177 Scomberoides tala 178 Scomberomor us commerson 1.8 5 179 Scombe romorus guttatus 3.0 8 180 Secutor insidiator 181 Secutor rucon is 182 Selar b oops 0.2 1 183 Selar crumenophthalmus 0.1 1

184 Selaroides leptolepis 0.8 26 0.7 15

185 Sepia pharaonis 1.1 2 0.8 8

186 Sepia spp. 2.9 16 0.3 3 0.1 3 0.4 10 0.16 1 187 Seriolina nigrofasciata 0.1 1 188 Siga nus canaliculatus 0.4 59.9 0.44 8 0.4 8 189 Sirembo imberis 190 Sirembo jerd oni 191 Solenocera choprai 192 Solenocera spp

193 Sphyraena forsteri 0.45 7

194 Sphyraena obtusata 3.13 67.9 0.2 5

195 Sphyraena putnamae 0.1 1 196 Sph yrna lewini 0.85 1 197 Stoleph orus indicus 12.7 100 0.07 4 0.8 1 36 198 Synodus hoshinonis 199 Tachypleu s sp. 200 Ten toriceps cristatus 201 Terapon jarbua 0. 0 202 Tetrosomus gibbosus

203 Thenus orientalis 0.4 3 0.35 4 0.2 2

204 Thryssa hamiltonii 0.0

55 Demersal Fish Stock Assessment of EEZ East Coast Sabah

205 Trachynocephalus myop s 0.1 1 0.15 2 0.33 13.3 0.05 3 206 Trichiurus leptur us 2.2 4 207 Upeneus japonic us 0.15 3 2 153 208 Upeneus moluccens is 209 Upeneus sp 210 Upeneus sulphureu s 0.05 2 211 Upeneus tragu la 0.7 44 5.3 452 0.6 35 4 224 212 Upeneus vittatu s 213 Uraspis urasp is

H ad il et al. 56

Appendix 2b: Catch rates (Wt-kg & N-number per hour) of species caught by KK Manchong trawl for 33 stations in east coast of Sabah, the Sulu-Sulawesi seas EEZ of Malaysia in 2009.

Station no. 6 7 8 11 10

Date 17/08 17/09 19/07 19/07 20/07

Depth (m) : start -finish 26.9-15.3 36-40 33.6-34 40-43.8 26.6-31.5

Species Wt N Wt N Wt N Wt N Wt N 1 Abalistes stellaris 2 Acan thurus mata 3 Aeso pia cornuta 4 Alectis ciliaris 0.2 2

5 Alectis indica

6 Alepes vari 0.1 1

7 Alutera monoceros 8 Alutera sp. 0.05 1 9 Amblyg aster sirm 10 Amusium pleuronectes 0.11 1 11 Anod ontostoma chacunda 0.17 2 12 Antennariu s striatus 13 Antigonia capros

14 Apogon aureus

15 Apogon ellioti 0.4 4 0.22 66 0.83 66

16 Apogon lineatus 0.23 46 17 Ar iomma indica 18 A rius thalassinus 0.75 1 0 .5 1 19 Aro thron immaculatus 20 Aro thron manillensis 21 Aroth ron stellatus 22 Atule mate 0.15 2 0.35 5

23 Calappa lophos

24 Calappa philargius

25 Canthigaster compresso 26 Carangoides armatus 0.4 4 2.6 4 2 47 27 Ca rangoides chrysophrys 28 Carang oides chrysophrys 29 Carangoides fulvoguttatus 30 Carangoides hedlandensis 0.1 1 31 Carangoides malabaricus 0.36 8 0.95 6 0.16 3 0.6 13 0.5 14

32 Carangoides sp.

33 Caranx ignobilis

34 Caranx sexfasciatus 0.2 2 35 Carcharhinus s orrah 36 Champsodon lo ngispinis

Demersal Fish Stock Assessment of EEZ East Coast Sab ah 57

37 Charybdis feriatus 0.35 2 0 .2 1 38 Charybdis natator

39 Chiloscyllium plagiosum

40 Chirocentrus dorab 0.39 1 0.6 2

41 Choerodon schoenleinii 1.1 22

42 Choerodon sp.

43 Cynoglossus bilineatus 44 Dactyloptena o rientalis 45 Dactylopus dac tylopus 46 Dasyatis kuhlii 47 Decap terus russelli 48 Diagramma pictum 49 Diodon holo canthus 50 Diodon hyst rix 6.6 44 51 Dipterygonotus balteatus

52 Dussumieria acuta 0.55 18 2.9 89 0.3 3 4 112

53 Echeneis naucrates

54 Elates ransonneti 0.22 198

55 Engyroprosopon sp.

56 Epinephelus areolatus 57 Epinephelus bleekeri 58 Epinephelus ca eruleopunctatus 59 Epinephelus coioides 0.9 1 60 Epinephelus heniochus 61 Epinephelus s exfasciatus 0.07 1 0.25 1 1 .4 9 62 Epinephelus sp . 63 Fistularia comme rson 64 Fistularia petimba 0.66 22

65 Gazza minuta 0.05 1

66 Gerres abbreviatus 0.08 1

67 Gerres oyena

68 Gnathonodon speciosus

69 Grammatobothus polyophthalmus 70 Gymn ocranius elongatus 71 Halieutaea sp. 72 Harpiosquilla harpax 0.4 3 73 Heterocarpus spp . 74 Jellyfi sh 75 Lactoria corn uta 76 Lactoria fo rnasini 77 Lagocephalus inermis

78 Lagocephalus lunaris 0.04 4

Hadil et al. 58

79 Lagocephalus sce leratus 4.6 46 1.1 22 80 Lagocephalu s spadiceus 2.3 23 0.05 1 1.1 22 0.6 9 81 Leiognathus b indus 82 Leiognathus equulus 0.81 26 0.18 1 0.4 10 0.23 3

83 Leiognathus leuciscus

84 Leiognathus longispinis

85 Leiognathus smithursti 0.05 1 86 Leiognathus sple ndens 0.69 23 87 Leiognath us spp. 20.7 37 26 2. 15 38 7 1.0 285 22.0 4400 26.4 5280 88 Leiognathus sterco rarius 89 Lepturacanthus savala 90 Lethrinus ne bulosus 91 Lethri nus sp 92 Loligo edulis

93 Loligo spp. 2.5 175 1.3 82 1.4 147 1.3 4 1 90

94 Loxodon macrohinus

95 Lutjanus lutjanus 0.1 1 96 Lutjanus m alabaricus 97 Lutjanus vitta 0.2 2 98 Mega laspis cordyla 0.11 2 0.7 3 0.2 1 0.38 6 99 Mene macul ata 100 Metape naeus sp. 101 Monacanthus chinensis

102 Monodactylus argenteus

103 Nemipterus aurora

104 Nemipterus balinensis 105 Nemipterus bathybius 106 Nemipterus fur cosus 0.1 1 107 Nemipterus he xodon 0.6 22 0.25 2 0.3 2 108 Nemipterus is acanthus 109 Nemipterus ja ponicus 0.26 22 0.13 1 1.2 3 2 0.6 6 0.27 11 110 Nemipterus marginatus 0.15 5 0.12 3 2.1 87 0.8 23 0.3 10

111 Nemipterus nematophorus 0.4 22 2.48 62 0.35 12

112 Nemipterus nematophus

113 Nemipterus nemurus

114 Nemipterus peronii 115 Nemipterus virga tus 116 Octopus 117 Odonus niger 118 Ophichthus sp . 119 Ostracion nasus 120 Panulirus polyphagus 0.38 1

Demersal Fish Stock Assessment of EEZ East Coast Sabah 59

121 Parachaetodo n ocellatus 122 Paramonacanth us sp. 123 Parapercis albo guttata 124 Paraplagusia bilineata

125 Parascolopsis tanyactis

126 Parastromateus niger 0.05 1 0.1 2

127 Pardachirus pavoninus 128 Parupeneus heptaca nthus 129 Penaeu s indicus 130 Penaeus ja ponicus 131 Penaeus lon gistylus 132 Penaeus m onodon 0.08 1 133 Penaeus penicillatus

134 Penaeus semisulcatus 0.2 1

135 Penaeus sp. 0.03 1 0.2 1

136 Pennahia anea 0.07 1 137 Pentap odus setosus 138 Pentaprion longimanus 0.15 7 0.25 30 1.1 88 0 139 Pinjalo pinjalo 0.1 1 140 Platax batavianus 141 Platyceph alus indicus 2.55 74 142 Plectranthias sp.

143 Plotosus lineatus

144 Podophthalmus vigil

145 Portunus pelagicus 0.8 1 146 Portunus san guinolentus 0.75 9 147 Priacanthus blochii 148 Priacanthus macr acanthus 149 Priacanthus tayenus 3.1 7 0.3 4 1.9 32 1.05 19 0.42 9 150 Pristigenys niphonia 151 Pristipomoides typus

152 Pristotis jerdoni

153 Psettodes erumei

154 Pseudorhombus arsius 0.08 1 155 Pseudor hombus quinquocellatus 156 Pseudorh ombus sp 157 Pseudotriacanth us strigilifer 158 Pterois sp. 159 Pterygotrig la sp. 160 Rachycentron canadum

161 Raja (Okamejei) bosemani

162 Raja (Okamejei) sp.

Hadil et al. 60

163 Rastrelliger b rachysoma 0.3 4 164 Rastrelliger faug hni 0.08 1 165 Rastrell iger kanagurta 0.1 1 166 Rhinobatu s sp. 167 Samaris cristatus

168 Sardinella sp. 0.14 4

169 Sardinella gibbosa 0.2 3

170 Saurida gracilis 171 Saurida longima nus 0 .46 69 0.0 8 9 0.15 13 3.08 418 2.97 149 172 Saurida tumbil 0.5 6 0.1 1 2.5 39 1 17 173 Saurida undosq uamis 0.0 5 2 0.9 22 174 Saurida w anieso 175 Scolopsis monogr amma 176 Scolopsis taenio pterus 0 .09 4 0.08 1 177 Scomberoides tala 0.15 1

178 Scomberomorus commerson 0.3 1 0.75 2 0.4 1

179 Scomberomorus guttatus

180 Secutor insidiator 0.46 23 181 Secutor ruc onis 182 Selar bo ops 0.2 1 183 Sela r crumenophthalmus 0.1 1 4 . 5 24 184 Selaroides leptolep is 0.27 44 185 Sepia pharaon is 186 Sepia spp . 0.3 1 187 Seriolina nigrofasciata

188 Siganus canaliculatus

189 Sirembo imberis

190 Sirembo jerdoni 191 Solenocer a choprai 192 Solenoce ra spp 193 Sphyraena fo rsteri 0.26 3 0.6 1 194 Sphyrae na obtusata 0.14 4 1 14 0.11 2 195 Sphyraena p utnamae 0.48 3 0.3 6 3 0.2 4 2 196 Sphyrna lewini

197 Stolephorus indicus 0.45 82 0.12 33 2.3 92 1.65 231

198 Synodus hoshinonis

199 Tachypleus sp.

200 Tentoriceps cristatus 201 Terapon jarb ua 0.3 1 202 Tetrosom us gibbosus 203 Thenus orienta lis 0.8 1 204 Thryssa hamiltonii 0.25 1

Demersal Fish Stock Assessment of EEZ East Coast Sabah 61

205 Trachynocephalus myop s 206 Trichiurus leptur us 0.6 1 0.08 2 207 Upeneus japonic us 208 Upeneus moluccens is 209 Upeneus sp 0.05 1 210 Upeneus sulphureu s 0.35 15 0.1 4 0.2 7 0.37 19 211 Upeneus tragu la 212 Upeneus vittatus 213 Uraspis urasp is 0.1 1

Hadil et al. 62

Appendix 2c: Catch rates (Wt-kg & N-number per hour) of species caught by KK Manchong trawl for 33 stations in east coast of Sabah, the Sulu-Sulawesi seas EEZ of Malaysia in 2009.

9 13 14 12 15 Station no. Date 20/07 20/07 20/07 20/07 21/07

Depth (m) : start -finish 20.7-10.0 39.0-50.7 54.6-62.1 34.2-29.1 40.5-62.5

Species Wt N Wt N Wt N Wt N Wt N

1 Abalistes stellaris 2 Acanthur us mata 3 Aesopia cornuta 4 Alectis ciliaris 5 Alecti s indica 6 Ale pes vari 7 Alutera mon oceros 8 Alutera sp.

9 Amblygaster sirm

10 Amusium pleuronectes

11 Anodontostoma chacunda 0.2 2 1.0 17 12 Antennarius striatu s 13 Antigonia ca pros 14 Apogon a ureus 15 Apogon ellioti 0.29 29 1.2 88 0.48 12 12.45 480 16 Apogo n lineatus 0.3 18 17 Ariomma indica 0.5 4

18 Arius thalassinus

19 Arothron immaculatus

20 Arothron manillensis 21 Arothron stellatus 22 Atule mate 0.45 8 0.2 1 23 Calappa lo phos 24 Ca lappa philargius 25 Canthig aster compresso 26 Carangoides armatus 0.08 5 0.91 27 0.5 7 1.5 18 0.1 1

27 Carangoides chrysophrys 0.2 1

28 Carangoides chrysophrys 0.2 1

29 Carangoides fulvoguttatus 30 Carangoides hedla ndensis 0 .1 1 31 Carangoides malab aricus 0 .16 8 1.7 3 9 0 . 4 13 32 Carangoides sp. 33 Caranx ignobilis 34 Caranx sexfasciatu s 0. 1 1 0.25 1 35 Carchar hinus sorrah 1.4 1 36 Champsodon longispinis 0.01 1

Demersal Fish Stock Assessment of EEZ East Coast Sabah 63

37 Charybdis feriatus 0.5 2 0.2 1 38 Charybdis natator 39 Chiloscyllium plagiosum 40 Chirocentrus dora b 0.2 1 2.4 3 41 Choerodon schoenleinii

42 Choerodon sp.

43 Cynoglossus bilineatus

44 Dactyloptena orientalis 45 Dactylopus dact ylopus 46 Dasyati s kuhlii 47 Decapterus r usselli 48 Diagramma pictum 49 Diodon holoc anthus 50 Diodon hystrix

51 Dipterygonotus balteatus

52 Dussumieria acuta 1.65 38 0.1 3 2.2 62

53 Echeneis naucrates

54 Elates ransonneti 55 Engyropro sopon sp. 56 Epinephelus a reolatus 57 Epinephelus ble ekeri 58 Epinephelus c aeruleopunctatus 59 Epinephelus coioides 60 Epinephelus heniochus

61 Epinephelus sexfasciatus 0.15 1

62 Epinephelus sp. 0.08 8

63 Fistularia commerson 64 Fistularia petimba 0.1 1 65 Gazza minuta 0.08 8 66 Gerres abbr eviatus 67 Gerres oyena 68 Gnathonodo n speciosus 69 Gram matobothus polyophthalmus 70 Gymnocranius elongatus

71 Halieutaea sp.

72 Harpiosquilla harpax 0.08 3

73 Heterocarpus spp. 74 Jellyfis h 4.0 75 Lactoria cornu ta 76 Lactoria for nasini 77 L agocephalus inermis 78 Lagoceph alus lunaris

Hadil et al. 64

79 Lagocephalus scele ratus 80 Lagocephalu s spadiceus 1.2 25.5 4.5 210 0.5 9 81 Leiognathus b indus 82 Leiognathus equ ulus 83 Leiognathus leuciscus

84 Leiognathus longispinis

85 Leiognathus smithursti

86 Leiognathus splendens 87 Leiognathu s spp. 1 3.9 30 74 16 .0 3320 2.4 462 88 Leiognathus stercor arius 89 Lepturacanthus sa vala 0 .8 1 3.7 9 90 Lethrinus neb ulosus 91 Lethr inus sp 92 Loligo edulis 93 Loligo spp. 0.6 35 0.08 48 1.6 320 1.4 103 0.25 18

94 Loxodon macrohinus

95 Lutjanus lutjanus

96 Lutjanus malabaricus 0.2 1 97 Lutjanus vitta 98 Megala spis cordyla 0.1 1 0.1 1 0.3 6 0.45 3 99 Mene macula ta 0 .5 4 0 0 0.35 3 1.0 8 100 Metapen aeus sp. 0.15 46 101 Monacant hus chinensis 102 Monodactylus arg enteus 0.1 2 0.45 30 103 Nemipterus aurora

104 Nemipterus balinensis

105 Nemipterus bathybius

106 Nemipterus furcosus 0.1 1 107 Nemipterus hex odon 0.27 4.5 0.4 1 0.5 1 108 Nemipterus isa canthus 109 Nemipterus jap onicus 0 .33 6 0 .8 6 0.7 6 0.6 9 0.2 1 110 Nemipterus marg inatus 0.23 6 0.13 4 0.2 3 0 . 9 45 111 Nemipterus nema tophorus 2 .9 90 2.1 12 8 112 Nemipterus nema tophus 113 Nemipterus nemurus

114 Nemipterus peronii

115 Nemipterus virgatus

116 Octopus

117 Odonus niger 118 Ophichthus sp . 119 Ost racion nasus 120 Panulir us polyphagus

Demersal Fish Stock Assessment of EEZ East Coast Sabah 65

121 Parachaetodon ocellatus 122 Paramonacanth us sp. 123 Parapercis albo guttata 124 Paraplagusia bilineata

125 Parascolopsis tanyactis

126 Parastromateus niger 1.8 10

127 Pardachirus pavoninus 128 Parupeneus heptaca nthus 129 Penaeus indicus 130 Penaeus ja ponicus 0.05 1 131 Penaeus lon gistylus 132 Penaeus m onodon 0.1 1 133 Penaeus penic illatus 0.08 2 134 Penaeus semisulcatus

135 Penaeus sp. 0.05 1

136 Pennahia anea

137 Pentapodus setosus 138 Pentaprion longimanus 0 0 3 250 0.9 36 1.2 90 0 0 139 Pinjalo pinjalo 0.3 12 0.05 1 140 Platax batavianus 141 Platycepha lus indicus 0.4 16 0.1 2 142 Plectranthias s p. 143 Plotosus lineatus

144 Podophthalmus vigil 0.2 1 0.1 1

145 Portunus pelagicus

146 Portunus sanguinolentus 0.3 3 147 Priacanthus blochii 148 Priacanthus macr acanthus 0.2 3 5.6 1 12 0.3 5 149 Priacanthus tayenus 0.75 12 0.9 20 3.15 75 0.2 2 150 Pristigenys niphonia 151 Pristipomoid es typus 152 Pristotis jerdoni

153 Psettodes erumei 0.15 1 0.1 1

154 Pseudorhombus arsius 0.18 2

155 Pseudorhombus quinquocellatus 156 Pseudorh ombus sp 157 Pseudotriacanth us strigilifer 158 Pterois sp. 159 Pterygotrig la sp. 160 Rachycentron canadum 161 Ra ja (Okamejei) bosemani 162 Raja (Okamejei) sp.

Hadil et al. 66

163 Rastrelliger brachysoma 0.23 3 11.0 94 0.25 2 1 .8 19 0.3 5 4 164 Rastrelliger fau ghni 165 Rastre lliger kanagurta 0.55 4 0.5 4 0.2 1 166 Rhinobatus sp.

167 Samaris cristatus

168 Sardinella sp. 0.08 3

169 Sardinella gibbosa 0.08 2 0.3 9 170 Saurida gracilis 0.1 3 171 Saurida long imanus 0.28 29 2.1 26 4 2.4 228 172 Saurid a tumbil 0.6 5 1. 25 1 5 0.3 2 23 5 173 Saurida undos quamis 1.4 4 6 0.1 1 174 Saurida wanieso 0.4 1 175 Scolopsis monogramma

176 Scolopsis taeniopterus 0.2 2

177 Scomberoides tala

178 Scomberomorus commerson 1 2 10.0 1 179 Scomberomorus gutta tus 2.2 2 180 Secutor insidiator 181 Secutor ru conis 182 Selar b oops 183 Sela r crumenophthalmus 1.1 12 0.5 4 0 .2 2 0.5 6 184 Selaroides leptolepis 0.05 1

185 Sepia pharaonis 0.8 2

186 Sepia spp.

187 Seriolina nigrofasciata

188 Siganus canaliculatus 189 Sirembo imberis 190 Sirembo jerdon i 191 Solenoce ra choprai 192 Solenoc era spp 193 Sphyraena f orsteri 194 Sphyraena obtusata 0.6 10 0.5 7 0.25 5 0.1 1

195 Sphyraena putnamae 0.3 2 1 5 3.3 1.1 7

196 Sphyrna lewini 197 Stolephorus indicus 1.45 203 1.1 4 1 1.5 5 4 0.75 15 198 Synodus hosh inonis 199 Tachyp leus sp. 200 Tentoriceps cristatus 0.2 2 3.3 78 1.05 19 2.8 46 201 Terapon jar bua 0.25 1 202 Tetroso mus gibbosus 203 Thenus orientalis

204 Thryssa hamiltonii

Demersal Fish Stock Assessment of EEZ East Coast Sabah 67

205 Trachynocephalus myop s 206 Trichiurus leptur us 0.15 1 0.65 3 0.2 1 2.6 9 207 Upeneus japonic us 208 Upeneus moluccens is 209 Upeneus sp 210 Upeneus sulphureu s 0.5 12 0.5 16 1.05 45 211 Upeneus tragu la 212 Upeneus vittatus 213 Uraspis urasp is 1.1 12 0.65 9 0.1 2

Hadil et al. 68

Appendix 2d: Catch rates (Wt-kg & N-number per hour) of species caught by KK Manchong trawl for 33 stations in east coast of Sabah, the Sulu -Sulawe si seas EEZ of Malaysia in 200 9.

Station no. 35 36 32 34 26 Date 25/07 25/07 26/07 26/07 29/07

Depth (m) : start -finish 19.5-29.0 27.3-36.2 21.1-22.8 19.5-20.9 76.4-78.0

Species Wt N Wt N Wt N Wt N Wt N

1 Abalistes stellaris 0.2 1 0.2 1 2 Acanth urus mata 7.5 18 3 Aesop ia cornuta 4 Ale ctis ciliaris 0.1 1 5 Alectis indic a 6 Ale pes vari 7 Alutera mo noceros 8 Alutera sp.

9 Amblygaster sirm 0.5 10

10 Amusium pleuronectes 1.2 61

11 Anodontostoma chacunda 12 Antennari us striatus 0.01 1 0.1 1 13 Antigonia capros 14 Apogo n aureus 0.2 28 0.09 90 15 Apogon ellioti 0.05 2 2.92 59 16 Apogon lineatus 17 Ariomma indica

18 Arius thalassinus

19 Arothron immaculatus 0.1 1 0.1 1

20 Arothron manillensis 1.0 4

21 Arothron stellatus 0.2 1 22 Atu le mate 0 .6 2 23 Calappa lophos 24 Calappa phi largius 0.2 2 0. 15 1 25 Canthigaster com presso 0.25 18 26 Carangoides a rmatus 0.8 14 27 Carangoides chrysophrys 0.3 1

28 Carangoides chrysophrys 0.3 1

29 Carangoides fulvoguttatus

30 Carangoides hedlandensis 0.2 1 31 Carangoides malaba ricus 0.3 3 3.9 38 32 Carangoides sp. 0.1 1 33 Caranx ig nobilis 0.3 1 34 Caranx se xfasciatus 0.15 1 0.3 1 0.3 1 35 Carcharhinu s sorrah 36 Champsodon longispinis 0.09 9 0.05 1 0.01 1

Demersal Fish Stock Assessment of EEZ East Coast Sabah 69

37 Charybdis feriatus 0.9 5 0.15 2 38 Charybdis natator 39 Chiloscyllium plagiosum 40 Chirocentrus dorab 0.7 1 41 Choerodon schoenleinii

42 Choerodon sp.

43 Cynoglossus bilineatus

44 Dactyloptena orientalis 45 Dactylopus dactylo pus 0.05 1 46 Dasyatis kuhlii 3.95 5 47 Decapterus russelli 0.6 8 48 Diagramma p ictum 0.2 2 49 Diodon holocanthus 7.1 12 50 Diodon hystrix 6.35 5 51 Dipterygonotus balteatus

52 Dussumieria acuta 0.2 13

53 Echeneis naucrates

54 Elates ransonneti 55 Engyroprosopon sp. 56 Epinephelus areolatu s 0.2 3 0.3 1 57 Epinephelus bleekeri 58 Epinephelus caeruleo punctatus 0.0 59 Epinephelus coioides 4.3 1 60 Epinephelus heniochus 1.8 3

61 Epinephelus sexfasciatus 0.65 7

62 Epinephelus sp.

63 Fistularia commerson 64 Fistularia petimba 0.3 16 0.01 1 0.2 11 65 Gazza minut a 66 Gerres abbreviatus 67 Gerres oyen a 0.2 2 1.0 16 68 Gnathonodon speciosus 69 Grammatobothus polyophthalmus 0.05 1 2.92 59

70 Gymnocranius elongatus 0.08 1 1.1 13

71 Halieutaea sp.

72 Harpiosquilla harpax 73 Heterocarpus spp. 74 Jellyfish 75 Lactor ia cornuta 0.5 2 76 Lactoria fornasin i 77 Lagocephalus ine rmis 0.05 2 0.1 2 78 Lagocephalus lunaris

Hadil et al. 70

79 Lagocephalu s sceleratus 1.7 18 80 Lagocephalus spadiceus 2.2 38 0.2 2

81 Leiognathus bindus 1.0 40

82 Leiognathus equulus 0.2 2 1.1 13 83 Leiognathus l euciscus 3.05 118

84 Leiognathus longispinis 0.3 3 85 Leiogna thus smithursti 2.0 40 86 Leiognathus sple ndens 0.2 5

22,52 87 Leiognathus spp. 1.8 450 105.3 2

88 Leiognathus stercorarius

89 Lepturacanthus savala

90 Lethrinus nebulosus 91 L ethrinus sp 1. 5 4 5 92 Loligo eduli s 93 Loligo s pp. 0.3 3 0.8 68 0.2 4 0.3 12 0.65 34 94 Loxodon ma crohinus 95 Lutjanus lutjanus

96 Lutjanus malabaricus

97 Lutjanus vitta

98 Megalaspis cordyla 0.4 1 99 Mene m aculata 100 Metapenaeus s p. 101 Monacanthus ch inensis 102 Monodac tylus argenteus 103 Nemipterus aurora

104 Nemipterus balinensis

105 Nemipterus bathybius

106 Nemipterus furcosus 2 29 0.3 8 0.1 1 107 Nemipterus hexodon 1.4 14 1 .65 24 0.9 9 108 Nemipterus is acanthus 0.2 1 109 Nemipterus ja ponicus 0.4 7 110 Nemipterus ma rginatus 1.8 45 1.2 34 1.6 38 111 Nemipterus nematophorus 1.75 17

112 Nemipterus nematophus 0.8 23 1.05 25 0.2 1

113 Nemipterus nemurus 0.2 2

114 Nemipterus peronii 0.2 2 115 Nemipteru s virgatus 116 Octopus 117 Odonus niger 0.8 2 118 Ophic hthus sp. 119 Ostra cion nasus

Demersal Fish Stock Assessment of EEZ East Coast Sabah 71

120 Panulirus polyph agus 0.5 5 121 Parachaetodon oc ellatus 0.2 2 122 Paramonacanthus sp.

123 Parapercis alboguttata 0.01 3

124 Paraplagusia bilineata

125 Parascolopsis tanyactis 126 Parastromateus nig er 127 Pardachir us pavoninus 0.1 1 128 Parupeneus heptacanthus 0.8 10 129 Penaeus indic us 0.2 1 130 Penaeus jap onicus 0.2 2 131 Penaeus longi stylus 132 Penaeus monodon 0.1 3

133 Penaeus penicillatus

134 Penaeus semisulcatus 0.2 2 0.55 9

135 Penaeus sp. 0.3 7 0.1 4 136 Pennahia an ea 137 Pentapodus setos us 3 103 138 Pentapr ion longimanus 2 193 4 300 8.77 293 139 Pinjalo pinj alo 140 Platax batavian us 1.5 2 0.15 1 141 Platyceph alus indicus 0.1 2 142 Plectranthias sp. 0.05 1

143 Plotosus lineatus

144 Podophthalmus vigil 0.05 1

145 Portunus pelagicus 0.7 3 0.15 1 0.5 2 146 Portunus sanguinol entus 147 Priacanthus blochii 148 Priacanthus macraca nthus 1 .3 1 2 149 Priacanthus ta yenus 1.2 28 1.95 34 1.4 10 150 Pristigenys ni phonia 151 Pristipomoide s typus 152 Pristotis jerdoni 0.1 3

153 Psettodes erumei

154 Pseudorhombus arsius 0.3 4

155 Pseudorhombus quinquocellatus 0.3 3 156 Pseudorhombus sp 157 Pseudotriaca nthus strigilifer 158 Pterois sp. 0.2 4 159 Pte rygotrigla sp. 160 Rachycen tron canadum 161 Raja (Okamejei) bosemani

Had il et al. 72

162 Raja (Okamejei) sp. 163 Rastrell iger brachysoma 164 Ras trelliger faughni 0.8 5 0.55 20 0.1 1 165 Rastrelliger kanagurta 0.4 4 0.2 2 0.2 1

166 Rhinobatus sp.

167 Samaris cristatus 168 Sardinella sp. 169 Sard inella gibbosa 170 Saurida gra cilis 171 Saurid a longimanus 0.91 64 172 Saurida tumbi l 2.5 30 1.42 28 1.9 22 0.5 8 173 Saurida undosquamis 0.2 4 0.3 4

174 Saurida wanieso 1.7 15 0.2 1 0.95 33 1.3 4

175 Scolopsis monogramma 176 Scolopsis taeniopte rus 7.5 71 0.1 2 2 50 177 Scomberoides ta la 178 Scombe romorus commerson 0.4 1 179 Scomb eromorus guttatus 0.4 1 180 S ecutor insidiator 181 Secutor ruconis

182 Selar boops

183 Selar crumenophthalmus 1.6 14 0.7 7 0.8 5 184 Selar oides leptolepis 0 .5 14 0.25 6 185 Sepia pharaonis 0 .5 2 186 Sepia spp. 0.4 7 0.2 1 187 Seriolina nig rofasciata 188 Siganus canaliculatus

189 Sirembo imberis

190 Sirembo jerdoni

191 Solenocera choprai 192 Sole nocera spp 193 Sphyrae na forsteri 194 Sphyraen a obtusata 0.3 4 0.7 20 0.6 10 0.4 8 195 Sphyraena putnamae 0.2 1 196 Sphyrna lewini

197 Stolephorus indicus 3 118

198 Synodus hoshinonis 0.05 1 199 Tachypleu s sp. 3.5 1 200 Ten toriceps cristatus 201 Terapon ja rbua 202 Tetro somus gibbosus 203 Thenus orie ntalis 0.05 1

73 Demersal Fish Stock Assessment of EEZ East Coast Sabah

204 Thryssa hamilton ii 205 Trachynocephalus myop s 206 Trichiurus leptur us 0.3 2 1 3 207 Upeneus japonic us 208 Upeneus moluccens is 209 Upeneus sp 210 Upeneus sulphureu s 0.2 4 0.8 40 2.92 176 211 Upeneus tragu la 212 Upeneus vittatus 0.7 7 0.1 1 213 Uraspis urasp is

Hadil et al. 74

Appendix 2e: Catch rates (Wt-kg & N-number per hour) of species caught by KK Manchong trawl for 33 stations in east coast of Sabah, the Su lu-Su lawesi seas EEZ of Malaysia in 20 09.

Station 29 28 25 24 Date 29/07 30/07 30/07 30/07

Depth (m) : start -finish 75.3-78.4 51.1-61.0 61.3-79.4 52.9-70.0

Species Wt N Wt N Wt N Wt N

1 Abalistes stellaris

2 Acanthurus mata

3 Aesopia cornuta 4 Alec tis ciliaris 0.13 2 0.2 1 0.15 1 2.2 5 5 Alectis indic a 6 Ale pes vari 7 Alutera mo noceros 0.4 1 8 Alutera sp. 9 Amblygaster sirm 10 Amusium ple uronectes 11 Anodonto stoma chacunda 12 Antennarius striatus

13 Antigonia capros

14 Apogon aureus 1.3 104

15 Apogon ellioti 5.98 778 0.88 82 0.91 73

16 Apogon lineatus 0.13 13

17 Ariomma indica 18 Arius thalassinu s 19 Arothron imm aculatus 20 Arothron m anillensis 21 Aro thron stellatus 22 Atule ma te 3.14 102 0.2 1 23 Calappa lop hos 24 Calappa philargiu s 25 Canthigaster co mpresso 26 Carangoides armatus 0.3 8 0.4 6

27 Carangoides chrysophrys 0.2 5

28 Carangoides chrysophrys 0.2 5

29 Carangoides fulvoguttatus 0.5 2

30 Carangoides hedlandensis 0.1 1 0.2 4 0.8 2

31 Carangoides malabaricus 0.1 1 1.2 16

32 Carangoides sp. 33 Caranx ig nobilis 1 .1 1 34 Caranx sexfasc iatus 0. 6 1 35 Carcharhinus sorrah 36 Champsodon long ispinis 1.06 43 0. 02 1 8 0.18 72

Demersal Fish Stock Assessment of EEZ East Coast Sabah 75

37 Charybdis feriatus

38 Charybdis natator

39 Chiloscyllium plagiosum 1.46 2

40 Chirocentrus dorab 3.0 5

41 Choerodon schoenleinii 42 Choerodon sp . 0.18 18 43 Cyno glossus bilineatus 44 Dactylopt ena orientalis 0.67 7 45 Dactylopu s dactylopus 46 Dasyatis ku hlii 47 Deca pterus russelli 0.1 4 48 Diagramma pictu m 49 Diodon holocanthus

50 Diodon hystrix

51 Dipterygonotus balteatus

52 Dussumieria acuta 53 Echeneis n aucrates 54 Elates ranson neti 55 Engyropros opon sp. 56 Epinephelus areolatus 57 Epinephelus bleekeri 58 Epinephelus c aeruleopunctatus 59 Epinephelus coi oides 0.3 1 1.3 1 60 Epinephelus heniochus 0.67 4

61 Epinephelus sexfasciatus 0.3 3

62 Epinephelus sp.

63 Fistularia commerson 64 Fist ularia petimba 0.27 8 1.8 45 65 Gazza min uta 0.1 1 66 Ger res abbreviatus 67 Gerres oyena 68 Gnathonodon speciosus 69 Grammatobothu s polyophthalmus 70 Gymn ocranius elongatus 71 Halieutaea sp. 0.3 1

72 Harpiosquilla harpax

73 Heterocarpus spp. 0.18 72

74 Jellyfish

75 Lactoria cornuta 76 Lactoria fornasini 77 Lagocephalu s inermis 78 Lagocephalu s lunaris

H a dil et al. 76

79 Lagocephalus sceleratus

80 Lagocephalus spadiceus 0.13 3

81 Leiognathus bindus

82 Leiognathus equulus 0.1 1 6 66

83 Leiognathus leuciscus 84 Leiogna thus longispinis 0.2 3 0.6 10 85 Leiognathus smit hursti 86 Leiognathus s plendens 87 Leiognathu s spp. 88 Leiognathus stercorarius 2.0 519

89 Lepturacanthus savala

90 Lethrinus nebulosus 22 5 91 Lethrinus sp 9.0 0

92 Loligo edulis

93 Loligo spp. 1.55 99 1.44 450 0.9 36

94 Loxodon macrohinus 1.4 2 95 Lutj anus lutjanus 96 Lutjanus m alabaricus 97 Lutja nus vitta 98 Megala spis cordyla 6.04 255 2 5 99 Mene maculat a 3.35 16 100 Metapenaeus sp . 101 Monacan thus chinensis 102 Monodactylus argenteus

103 Nemipterus aurora

104 Nemipterus balinensis

105 Nemipterus bathybius

106 Nemipterus furcosus 0.6 3 107 Nemipterus h exodon 108 Nemipterus is acanthus 109 Nemipterus jap onicus 0.2 1 110 Nemipterus marg inatus 111 Nemipterus nema tophorus 1.69 8 2.2 56 0.1 1 112 Nemipterus nematophus 4.78 108 1.1 0.4 6 113 Nemipterus nemurus 13 130

114 Nemipterus peronii

115 Nemipterus virgatus 0.67 2 0.2 1 0.7 3

116 Octopus

117 Odonus niger 118 Ophic hthus sp. 119 Ostrac ion nasus 120 Panulirus po lyphagus

Demersal F ish Stock Assessment of EEZ East Coast Sabah 77

121 Parachaetodon ocellatus 0.2 2

122 Paramonacanthus sp. 0.2 40 123 Parapercis al boguttata 124 Paraplagusia b ilineata 125 Parascolopsis tan yactis 126 Parastr omateus niger 127 Pardachirus pavoninus

128 Parupeneus heptacanthus

129 Penaeus indicus

130 Penaeus japonicus 131 Penaeus long istylus 132 Penaeus mono don 0.67 3 133 Pe naeus penicillatus 134 Penae us semisulcatus 135 Penaeus sp . 2.36 777 136 Pennahia anea

137 Pentapodus setosus

138 Pentaprion longimanus 0.39 40 1.95 299 1.45 96 0.72 270

139 Pinjalo pinjalo 140 Platax batavia nus 141 Platycep halus indicus 0.2 20 142 Plectran thias sp. 0.9 18 143 Plotosus line atus 144 Podophthalm us vigil 145 Portunus pelagicus

146 Portunus sanguinolentus

147 Priacanthus blochii

148 Priacanthus macracanthus 149 Priacanthus tayenus 0.67 8 0.4 3 0.1 1 150 Pristigenys n iphonia 151 Pristipomoid es typus 152 Pristoti s jerdoni 153 Psettode s erumei 1.2 2 154 Pseudorhombus arsius

155 Pseudorhombus quinquocellatus

156 Pseudorhombus sp 4.0 479 0.65 26 0.18 36 0.18 36

157 Pseudotriacanthus strigilifer 158 Pterois sp. 0.2 4 159 P terygotrigla sp. 160 Rach yce ntron canadum 161 Raja (Okamejei) bosemani 162 Raja (Okamejei) sp .

Hadil et al. 78

163 Rastrelliger brachysoma

164 Rastrelliger faughni 0.4 5

165 Rastrelliger kanagurta 0.2 1

166 Rhinobatus sp.

167 Samaris cristatus

168 Sardinella sp.

169 Sardinella gibbosa 170 Saurida gracilis 171 Saurida longima nus 0.13 91 0.9 1 62 9 99 0 172 Saurida tu mbil 0.7 6 0 .9 5 10 6 5 173 Saurida undosqua mis 6.64 104 0.2 3 2 23 5 39 174 Saurida wanieso 1.2 6 1.8 5 5.0 9 175 Scolopsis m onogramma 176 Scolopsis taeniopterus 177 Scomberoides tala 178 Scomberomorus commerson

179 Scomberomorus guttatus

180 Secutor insidiator

181 Secutor ruconis 4.55 1,001

182 Selar boops

183 Selar crumenophthalmus 0.5 4 1 6

184 Selaroides leptolepis 185 Sep ia pharaonis 0.4 1 186 Sepia spp. 1 38 187 Seriolina nigrofasc iata 188 Siganus c analiculatus 189 Sirembo i mberis 0.47 27 190 Sirembo jerd oni 191 Solenoce ra choprai 192 Solenocera spp 0.07 4 193 Sphyraena fo rsteri 194 Sphyraena obtusata 0.2 3 0.4 3

195 Sphyraena putnamae

196 Sphyrna lewini

197 Stolephorus indicus 1.1 42 0.25 9

198 Synodus hoshinonis 0.39 13

199 Tachypleus sp.

200 Tentoriceps cristatus 0.9 12 0.25 4 201 Terapon jarbua 202 Tetrosomus gib bosus 203 Thenus orie ntalis 204 Thryssa ham iltonii Demersal Fish Stock Assessment of EEZ East Coast Sabah 79

205 Trachynocephalus myops 206 Trichiurus lepturus 1.5 17 0.15 2 3.2 35 207 Upeneus japonicus 208 Upeneus moluccensis 209 Upeneus sp 210 Upeneus sulphureus 8.24 519 1.24 43 0.1 4 0.55 10 211 Upeneus tragula 212 Upeneus vittatus 213 Uraspis uraspis 0.2 1

Hadil et al. 80

Appendix 2f: Catch rates (Wt-kg & N-nu mber p er hou r) of sp ecies caught b y KK Manchon g trawl for 33 stations in east coast of Sabah, the Sulu-Sulawesi seas EEZ of Malaysia in 2009.

Station 23 2 2 21 27 20 Date 30/07 3 0/07 3 0/07 30/07 31/07 78.0-95.0 64.0-67.5 71.4-76.1 100.0-118.0 34-43 Depth : start -fin ish Species Wt N Wt N Wt N Wt N Wt N

1 Abalistes stellaris 0.73 15 0.7 8

2 Acanthurus mata

3 Aesopia cornuta 4 Ale ctis ciliaris 5 Alectis indic a 6 Al epes vari 7 Alutera m onoceros 0.05 1 8 Alutera sp. 9 Amblygaster sirm

10 Amusium pleuronectes

11 Anodontostoma chacunda

12 Antennarius striatus 13 Antigonia capros 0.05 2 14 Apogo n aureus 3.3 247 15 Apogon ellioti 0.15 29 16 Apogon lineatus 17 Ariomma indica 18 Arius thalassinus

19 Arothron immaculatus

20 Arothron manillensis

21 Arothron stellatus 22 At ule mate 23 Calapp a lophos 24 Calappa ph ilargius 25 Canthigaster com presso 26 Carangoides a rmatus 0.55 33 0.3 31 0. 2 3 27 Carangoides chrysophrys 0.2 2

28 Carangoides chrysophrys 0.2 2

29 Carangoides fulvoguttatus

30 Carangoides hedlandensis 31 Carangoides malab aricus 4.5 69 32 Carangoides sp. 33 Caranx ignobilis 34 Caranx se xfasciatus 0.1 1 35 Carcharhinu s sorrah 36 Champsodon longispinis 0.01 1

Demersal Fish Stock Assessment of EEZ East Coast Sab ah 81

37 Charybdis feriatus 0.4 3 38 Charybdis natato r 39 Chilos cyllium plagiosum 40 Chirocentrus do rab 41 Choerodon scho enleinii 42 Choerodon sp. 0.05 1 43 Cynoglossus bilineatus

44 Dactyloptena orientalis 0.1 1 1.9 15

45 Dactylopus dactylopus

46 Dasyatis kuhlii 47 Decapterus russelli 3.6 63 3 .6 91 48 Diagra mma pictum 49 Diodon holocanth us 0.05 1 1.76 22 50 Diodon hyst rix 51 Dipterygon otus balteatus 52 Dussumieria acuta 0.1 3

53 Echeneis naucrates

54 Elates ransonneti

55 Engyroprosopon sp. 2.8 64 0.35 16 56 Epinephelus areolatus 0.5 1 57 Epinephelus bleekeri 58 Epinephelus c aeruleopunctatus 0.1 1 59 Epinephelus co ioides 60 Epinephelus henio chus 61 Epinephelus sexfasciatus

62 Epinephelus sp. 13 1

63 Fistularia commerson 0.7 1 0.15 29

64 Fistularia petimba 0.1 6 1.16 29 0.1 5 65 Gazz a minuta 66 Gerres abb reviatus 67 Gerr es oyena 68 Gnathonodon sp eciosus 69 Grammatobothus polyophth almus 70 Gymnocranius elongatus

71 Halieutaea sp. 0.5 2

72 Harpiosquilla harpax 0.2 3

73 Heterocarpus spp. 8.8 1298 74 Jellyfish 75 Lactoria cornuta 76 Lactoria fornasini 77 Lagoceph alus inermis 78 Lagocephalus lunaris

Hadil et al. 82

79 Lagocephalus sceleratus 80 Lagocephalus sp adiceus 0.8 5 81 Leiognathus bindus

82 Leiognathus equulus

83 Leiognathus leuciscus

84 Leiognathus longispinis

85 Leiognathus smithursti 86 Leiognathus splend ens 87 Leiognathus spp . 20.7 3726 88 Leiognathus s tercorarius 89 Lept uracanthus savala 0.9 2 90 Lethri nus nebulosus 91 Lethrinus sp

92 Loligo edulis

93 Loligo spp. 2.5 70 0.5 3 1.03 140

94 Loxodon macrohinus

95 Lutjanus lutjanus 0.3 6 96 Lutjan us malabaricus 97 Lutjanus vitta 98 Megalas pis cordyla 0.2 2 99 Mene mac ulata 100 Metapenaeus sp. 101 Monacanthus chinensis

102 Monodactylus argenteus

103 Nemipterus aurora 2.9 49 7.5 104 0.5 5

104 Nemipterus balinensis 105 Nemipterus bath ybius 7. 45 19 0 3 48 106 Nemipterus fu rcosus 0 .9 8 3 18 107 Nemipterus he xodon 108 Nemipterus isac anthus 109 Nemipterus jap onicus 0.15 2 110 Nemipterus marg inatus 111 Nemipterus nematophorus

112 Nemipterus nematophus 1.2 15 0.2 2 0.1 2

113 Nemipterus nemurus 0.15 3 2.1 44 7 105 1.9 36

114 Nemipterus peronii 115 Nemipterus virgatus 0.1 2 116 Octopus 0.2 4 0 .9 1 9 117 Odonus niger 118 Ophic hthus sp. 0.05 1 119 Ostracio n nasus 0.4 1 120 Panuliru s polyphagus

Demersal Fish Stock Assessment of EEZ E ast Coas t Sab ah 83

121 Parachaetodon ocellatus

122 Paramonacanthus sp. 3.3 737 123 Parapercis al boguttata 1.7 19 1.1 23 124 Paraplagusia b ilineata 125 Parascolopsis tan yactis 0.1 1 0.6 18 126 Parastr omateus niger 127 Pardachir us pavoninus 128 Parupeneus heptacanthus 0.1 2 0 0.1 1

129 Penaeus indicus

130 Penaeus japonicus 0.4 12

131 Penaeus longistylus 0.65 2 132 Penaeus mon odon 133 Pe naeus penicillatus 134 Penae us semisulcatus 135 Penaeus sp . 136 Pennahia anea 137 Pentapodus setosus 1.55 16

138 Pentaprion longimanus 1.57 61

139 Pinjalo pinjalo

140 Platax batavianus 0.2 1 141 Platycep halus indicus 0.15 15 3.3 154 142 Plectran thias sp. 143 Plotosus line atus 144 Podophthalm us vigil 145 Portunus pelagicus 0.4 2 0.66 132

146 Portunus sanguinolentus

147 Priacanthus blochii 0.15 1

148 Priacanthus macracanthus 5.8 58 1 10 0.3 1 149 Priacanthus tayenus 0.5 2 150 Pristigenys n iphonia 0.1 2 151 Pristipomoid es typus 0.1 1 152 Pristoti s jerdoni 153 Psettode s erumei 154 Pseudorhombus arsius

155 Pseudorhombus quinquocellatus 0.73 15 1.1 22 0.45 5

156 Pseudorhombus sp 0.15 15 0.2 10

157 Pseudotriacanthus strigilifer 2.2 44 158 Pterois sp. 0.2 4 159 P terygotrigla sp. 0.1 2 160 Rachyce ntron canadum 161 Raja (Okamejei) bosemani 162 Raja (Okamejei) sp . 0.8 1

Hadil et al. 84

163 Rastrelliger brachysoma 0.15 1 164 Rastrelliger faughni 0.2 6 165 Rastre lliger kanagurta 6 44 166 Rhinobatu s sp. 1.1 1 167 Samaris cristatus 0.4 8 168 Sardinella sp. 169 Sardin ella gibbosa 170 Saurida gracil is 171 Saurida longimanus 1.15 23

172 Saurida tumbil 1.2 12

173 Saurida undosquamis 2.9 63 13.2 873 9.4 150 12 105

174 Saurida wanieso 0.3 1

175 Scolopsis monogramma 0.73 15 176 Scolopsis taeniopteru s 0.25 3 0.08 1 177 Scomberoides tal a 178 Scombero morus commerson 2.3 5 179 Scomb eromorus guttatus 180 Sec utor insidiator 181 Secutor ruconis 182 Selar boops 183 Selar crumenophthalmus 3.79 65 1.6 30

184 Selaroides leptolepis

185 Sepia pharaonis 0.1 7 0.4 4 0.1 1

186 Sepia spp. 0.8 8 0.3 2

187 Seriolina nigrofasciata 0.05 1

188 Siganus canaliculatus 189 Sirembo imberis 190 Sirembo jer doni 0.05 1 191 Soleno cera choprai 0.3 8 192 Solenocera spp 0.5 10 193 Sphyraena forsteri 194 Sphyraena obt usata 195 Sphyra ena putnamae 2.6 19 196 Sphyrna lewini

197 Stolephorus indicus

198 Synodus hoshinonis 0.05 1 0.2 9

199 Tachypleus sp.

200 Tentoriceps cristatus 0 201 Terapo n jarbua 202 Tetrosomus g ibbosus 0 .1 1 203 Thenus o rientalis 204 Thryssa ha miltonii

85 Demersal Fish Stock Assessment of EEZ East Coast Sabah

2 05 Trachynocephalus myop s 0.9 13 3.95 30 2 06 Trichiurus leptur us 0.2 3 2 07 Upeneus japonic us 3.8 111 2.5 60 1.3 47 2 08 Upeneus moluccens is 0.2 5 2 09 Upeneus sp 2 10 Upeneus sulphureu s 4.35 145 5.5 242 0.1 2 2 11 Upeneus tragu la 0.1 7 2 12 Upeneus vittatus 0.5 6 2 13 Uraspis urasp is

Hadil et al. 86

Appendix 2g: Catch rates (Wt-kg & N -number per hour) o f specie s caugh t by KK Manchong trawl for 33 stations in east coast of Sabah, the Sulu-Sulawesi seas EEZ of Malaysia in 2009.

Station 17 1 6 18 19 Date 31/ 07 31/07 3 1/07 31/07 Depth : start -f inish 66-69 60-67 73-76 66-67 Species Wt N Wt N Wt N Wt N 1 Abali stes stellaris 0.1 1 0.1 1 2 Acanthurus mata

3 Aesopia cornuta 0 0 0.04 1

4 Alectis ciliaris 0.2 2 0.2 3 5 Alectis ind ica 6 A lepes vari 7 Alutera m onoceros 8 Alutera sp. 9 Amblygaster sirm 10 Amusium pleuronectes

11 Anodontostoma chacunda

12 Antennarius striatus

13 Antigonia capros 14 Apog on aureus 15 Apogon ellioti 0.08 2 0.53 21 16 Apogon lineatus 17 Ariomma indica 18 Arius thalassin us 1.3 1 19 Arothron immaculatus

20 Arothron manillensis

21 Arothron stellatus

22 Atule mate 23 Calapp a lophos 0 .3 1 24 Calappa ph ilargius 0 .3 1 25 Canthigaster com presso 0.11 11 26 Carangoides armatus 0.2 5 0.3 1 2 2 27 Carangoides chry sophrys 0.15 1 28 Carangoides chrysophrys 0.15 1

29 Carangoides fulvoguttatus

30 Carangoides hedlandensis

31 Carangoides malabaricus 32 Carangoides sp. 33 Caranx ignobilis 34 Caranx sexfasciatus 35 Carcharhinu s sorrah 36 Champsodon longispinis 0.53 210 0.14 125

Demersal Fish Stock Assessment of EEZ East Coast Sabah 87

37 Charybdis feriatus 0.5 3 0.65 5

38 Charybdis natator 0 39 Chilo scyllium plagiosum 40 Chirocentrus d orab 1.2 1 41 Choerodon scho enleinii 42 Choerodon sp. 43 Cynoglossus bilineatus 0.1 2 0.27 14

44 Dactyloptena orientalis

45 Dactylopus dactylopus

46 Dasyatis kuhlii 0.25 1 47 Decapterus russelli 0.63 33 0.1 1 0.91 40 48 Diagr amma pictum 49 Diodon holocanth us 50 Diodon hy strix 51 Dipterygon otus balteatus 1.34 17 9 52 Dussumieria acuta

53 Echeneis naucrates

54 Elates ransonneti

55 Engyroprosopon sp. 0.53 32 0.11 21 0.68 81 56 Epinephelus areolatus 0.4 2 57 Epinephelus bleekeri 0.25 1 58 Epinephelus caeruleopunctatus 59 Epinephelus co ioides 60 Epinephelus henio chus 0.5 1 61 Epinephelus sexfasciatus

62 Epinephelus sp.

63 Fistularia commerson

64 Fistularia petimba 2.1 32 0.41 38 0.68 53 65 Gazz a minuta 0.1 3 66 Gerres abb reviatus 67 Gerr es oyena 68 Gnathonodon sp eciosus 69 Grammatobothus polyophth almus 70 Gymnocranius elongatus

71 Halieutaea sp.

72 Harpiosquilla harpax

73 Heterocarpus spp. 1.05 32 74 Jellyfish 23 81 75 Lactoria cornuta 76 Lactoria fornasini 77 Lagoceph alus inermis 78 Lagocephalus lunaris

H adil et a l. 88

79 Lagocephalu s sceleratus 80 Lagocephalus spadiceus 81 Leiognathus bin dus 82 Leiognathus eq uulus 83 Leiognathus le uciscus 84 Leiognat hus longispinis 85 Leiognathus smith ursti 86 Leiognathus splendens

87 Leiognathus spp. 3.15 462 1.35 41

88 Leiognathus stercorarius

89 Lepturacanthus savala 7.8 20

90 Lethrinus nebulosus 91 Le thrinus sp 92 Loligo edulis 1.8 12 2.1 10 93 Loligo sp p. 0.5 46 0.05 2 3.05 391 94 Loxodon macr ohinus 95 Lutja nus lutjanus 0.1 1 0.2 2 96 Lutjanus ma labaricus 97 Lutjanu s vitta 98 Megalas pis cordyla 99 Mene maculata 0.45 5 4.2 33 0.1 1

100 Metapenaeus sp.

101 Monacanthus chinensis

102 Monodactylus argenteus

103 Nemipterus aurora 0.2 2 1.8 31 104 Nemipterus baline nsis 2.05 113 0.2 2 4.84 1 88 105 Nemipterus bath ybius 1.5 21 8.9 106 2. 94 7 4 106 Nemipterus fu rcosus 0.7 4 0.87 19 107 Nemipterus hex odon 0.1 2 108 Nemipterus is acanthus 109 Nemipterus japo nicus 0.8 7 110 Nemipterus margin atus 0.1 1 111 Nemipterus nema tophorus 2.5 76 112 Nemipterus nematophus

113 Nemipterus nemurus 1.13 19 3.55 62 1.1 14

114 Nemipterus peronii 0.1 1

115 Nemipterus virgatus

116 Octopus 0.2 1 117 Odon us niger 118 Ophich thus sp. 119 Ostracio n nasus 3.68 2 1 120 Panulirus poly phagus

Demersal Fish Stock Assessm ent of EEZ East C oast Sabah 89

121 Parachaetodon ocellatus 122 Paramonacanth us sp. 0.1 1 42 123 Parapercis alb oguttata 0.1 2 0.84 42 124 Paraplagusia bil ineata 0.2 1 125 Parascolopsis tany actis 1 .85 39 126 Parastr omateus niger 127 Pardachirus pavoninus

128 Parupeneus heptacanthus 0.1 1 0.1 1

129 Penaeus indicus

130 Penaeus japonicus 0.2 1 131 Penaeus long istylus 132 Penaeus mono don 133 Pen aeus penicillatus 134 Penae us semisulcatus 135 Penaeus sp . 136 Pennahia anea

137 Pentapodus setosus 0.15 1 0.6 3

138 Pentaprion longimanus 0.5 2

139 Pinjalo pinjalo 140 Platax batavia nus 141 Platycep halus indicus 5.25 420 0.41 14 142 Plectran thias sp. 143 Plotosus line atus 144 Podophthalm us vigil 145 Portunus pelagicus

146 Portunus sanguinolentus

147 Priacanthus blochii 0.3 5

148 Priacanthus macracanthus 4.9 36 2.1 28 7 61 2 15 149 Priacanthus tayenus 0.7 12 1 10 5 59 150 Pristigenys n iphonia 151 Pristipomoid es typus 152 Pristotis jerdoni 153 Psettodes erumei 0.5 4 154 Pseudorhombus arsius

155 Pseudorhombus quinquocellatus 0.05 1

156 Pseudorhombus sp

157 Pseudotriacanthus strigilifer 0.12 54 158 Pterois sp. 159 P terygotrigla sp. 0.53 21 160 Rachyce ntron canadum 161 Raja (Okamejei) bosemani 0.2 1 162 Raja (Okamejei) sp .

Hadil et al. 90

163 Rastrell iger brachysoma 164 Rastrelliger faughni 165 Rastrell iger kanagurta 0.11 1 0.4 2 0.5 3 0.6 4 166 Rhinobatus sp. 167 Samaris cristatus

168 Sardinella sp.

169 Sardinella gibbosa

170 Saurida gracilis 171 Saurida longima nus 1. 68 21 0 4.05 162 172 Saurida t umbil 0.3 2 0.3 3 0.21 63 173 Saurida undosqua mis 4.9 164 2.1 20 0.8 19 10.8 986 174 Saurida wanies o 175 Scolopsis m onogramma 176 Scolopsis taeniopterus 0.4 8 0.1 2 0.6 14 0.87 26

177 Scomberoides tala

178 Scomberomorus commerson

179 Scomberomorus guttatus 1.3 3 180 Secutor insidiator 181 Secu tor ruconis 182 Selar boops 183 Selar crumeno phthalmus 0.8 20 0.3 2 0.8 7 2.37 31 184 Selaroid es leptolepis 185 Sepia pharaonis 0.4 2

186 Sepia spp. 0.51 115 3 42 0.1 1

187 Seriolina nigrofasciata 1.8 4 0.5 2

188 Siganus canaliculatus 1.08 14

189 Sirembo imberis 190 Sirembo jerdoni 191 Solenocera chopra i 192 Solenoc era spp 193 Sphyraena forsteri 194 Sphyraena obt usata 0.1 1 195 Sphyraena putnamae

196 Sphyrna lewini

197 Stolephorus indicus 2.07 44

198 Synodus hoshinonis 199 Tachypleus s p. 7.3 2 200 Tentori ceps cristatus 4.8 109 4.68 43 201 Terapon jarbu a 202 Tetrosom us gibbosus 203 Thenus orienta lis 204 Thryssa h amiltonii 0.2 3

Demersal Fish Stock Assessment of EEZ East Coast Sabah 91

205 Trachynoce phalus myops 206 Trichiurus lepturus 0.3 4

207 Upeneus japonicus 2.2 129 7.95 313 0.08 3

208 Upeneus moluccensis 4.2 336 0.41 89 1.86 136

209 Upeneus sp 210 Upeneus sulp hureus 0.2 6 211 Upeneus tragula 212 Upeneus vittatus 213 Uraspis uraspis 1.45 18 0 .75 7 0.7 5 6 0.65 7

Hadil et al. 92

Appendix 3: List o f p e rsonnel involve d in the demersal fish stock assessment study of Sulu-Sulawesi seas, east coast Sabah 7th July- 4th August 2009

No. NAME POSITION 1 Hadil bin Raja li Coordinator cum Chief Scientist 2 Jamil bin Musel Chief Researcher cum Cruise Leader 3 Abd. Haris Hilmi Bin A hmad Arsad Fish larvae scientist, FRI Kpg.Acheh 4 Mohd.Affendi Bin Ngah Research Assistant, FRI Rantau Abang 5 Wan Mohd. Jamel Bin Hussein Research Assistant, FRI Rantau Abang

6 Mohd. Nazir Bin Taib Research Assistant, FRI Kpg. Aceh

7 Mohd.Zakaria Bin Morshidi Officer in-charge 8 Annie Lim Pek Khio k Taxonomist 9 Harun Duin Research Officer , S abah 10 Kamal Salleh Research Assistant, Sabah 11 Amjah Hj. Kadis Captain, Sabah 12 Arabi bin Materan g Captain in chief 13 Afandi Bin Abg. Hashim Captain 14 Mohd. Adnan Bin Salm a Captain 15 Edwin Ak. Linggan g Chief engine-man 16 Wan Yusup Bin Wan Alla Engine-man 17 Azizan Bin Amid Engine-man 18 Alek Bin Kip Deck-hand 19 Denis Bin Salu s Deck-hand 20 Yusup Bin Sapon g Deck-hand 21 Hassan Bin Arsha d Deck-hand 22 Muriatter George Gantung Lapu Deck-hand

23 Adnan Bin Pata Crew

24 Faizal Bin Udai Crew 25 Shahrani Bin J ubli Crew 26 Mohd. Nazri Bin Jamari Crew 27 Abdul Karim Bin Faiz Crew 28 John Ak Chandang Grease r 29 Nazrul Bin Ahma d Zaidi Greaser 30 Mohd. Iswandi Bin Abd . Manan Greaser 31 Othman Bin Mahon Net mak er 32 Hady Bin Asek Camera-ma n

Malaysian Fisheries Journal 10: 93 - 104 (December 2011)

Induced in vitro Mutagenesis of Aquatic Plant Cryptocoryne willisii Engler ex Baum Using Gamma Irradiation to Develop New Varieties

NORHANIZAN SAHIDIN1/,3/, NURAINI ABD WAHID3/, ROFINA YASMIN OTHMAN2/.3/ & NORZULAANI KHALID2/,3/

1/Freshwater Fisheries Research Division, FRI Glami Lemi, Department of Fisheries, Jelebu, 71650 Negeri Sembilan, Malaysia 2/Centre for Research in Biotechnology for Agriculture (CEBAR), University of Malaya, 50603 Kuala Lumpur 3/Institute of Biological Sciences, Faculty of Science, University of Malaya, 50603 Kuala Lumpur

Abstract: Two new varieties of Cryptocoryne willisii were developed through mutagenesis in this work, where shoot-tip explants of C. willisii were subjected to a range of 60Co gamma ray irradiations: (0, 100, 200, 300, 400,

500, 600, 700 and 800 Gray). The LD50 for the tissue culture plants of C. willisii was at 25 Gy, which was considered as an appropriate dosage to induced mutations in this plant. About two thousand shoot-tip explants were irradiated at 25 Gy

and variants from the M1, M2, M3 and M4 generations were screened for morphological differences. The shoots were th subcultured repeatedly until the 4 generation (M4) to ensure stability of mutants. Although initially many regenerants with different morphological traits were produced, only two mutants remained stable. The mutants obtained were dwarf plants (D1) and plants of taller stature with pigmented leaves (G1) in comparison to control cultures. This was verified from the significant F value from the ANOVA test, where P<0.05. The Inter-Retrotransposon Amplified Polymorphism (IRAP) markers were used to distinguish the D1 and G1 genomes from normal C. willisii genomes. The analysis revealed two specific bands 325 bp and 420 bp using Nikita primer for the D1 mutant and 240 bp and 300 bp using combination of 3'LTR primer and LTR 6149 primer for the G1 mutant.

Keywords: Cryptocoryne willisii, gamma irradiation, mutagenesis, Inter-Retrotransposon Analysis Polymorphism analysis

Abstrak: Dua variasi baru Cryptocoryne willisii teleh dibangunkan melalui mutagenesis dalam kajian ini, di mana eksplan pucuk C. Willisii telah didedahkankepadasinaran gamma 60Co yang berbeza: (0, 100, 200, 300, 400, 500, 600, 700 and 800 Gray). Dos kematian 50% (LD50) untuktumbuhan tisu kultur C. xwillisii ialah pada dos 25 Gray. Dan oleh itu, nilai dos tersebut telah digunakan untuk mengakibatkan mutasi pada tumbuhan. Lebih kurang dua ribu eksplan

pucuk telah diradiasi pada 25 Gy dan varian-varian dari generasi M1, M2, M3 and M4 telah ditapis untuk perubahan

morfologi. Pucuk-pucuk tersebut telah disubkultur berulang kali sehingga generasi ke-4 (M4) bagi memastikan kestabilan mutan.Walaupun pada peringkat awal banyak regeneran dengansifat-sifat morfologi yang berbeza terhasil, namun hanya dua sahaja mutan yang stabil. Mutan yang terhasil adalah tumbuhan kerdil (D1) dan tumbuhan tinggi dengan daun berpigmentasi (G1) berbanding dengan kultur kawalan. Ini disahkan oleh nilai F signifikan dari ujian ANOVA, dimanaP<0.05. Penanda Inter-Retrotransposon Amplified Polymorphism (IRAP) telah digunakan untuk pengesahan genom D1 dan G1 dari normal genom C. willisii. Analisis tersebut telah dapat menunjukkan dua jalur spesifik 325 bp dan 420 bp dengan menggunakan primer Nikita untuk mutan D1 dan untuk G1, dua jalur spesifik adalah 240 bp dan 300 bp dengan menggunakan primer 3'LTR primer dan LTR 6149.

93 Induced Mutagenesis of Cryptocoryne willisii Using Gamma Irradiation 94

Introduction

Cryptocoryne willisii Engler ex Baum belongs to the family Araceae, genus Cryptocoryne Fischer ex Wydl is commonly distributed in Sri Lanka. Its synonyms are C. pseudo-beckettii (De Wit, 1964), C. axelrodii Rataj (Rataj, 1977) and C. undulata Wendt (Rataj, 1977).

C. willisii is a small aquatic plant, originated from Sri Lanka. In nature, this plant propagates through runners. The substrate for planting in aquarium is plain washed gravel, with lighting from moderate to bright white light, at pH 6.8-7.2 (aquarium water), and water hardness at 3-8ºdH. The ideal water temperature for the growth of Cryptocoryne is around 20-26ºC. In aquarium, C. willisii can grow up to 20 cm height. The morphology of the stemmed leaves is oblong-oval to lanceolate and green in colour with brownish to green stems.

C. willisii seldom flowers and during seasonal flowering it produces non viable seeds when grown in natural habitat. (Rataj, 1977; Windelov, 1987; Cook, 1996). Thus, production of new plant variety through cross breeding between species is not possible. However, C. willisii is one of the most popular aquarium plants in the world and a novel variety is very much sought for in order to be competitive in this aquarium business (Hiscock, 2005). In this paper, novel mutants of C. willisii were obtained through gamma irradiation.

Mutants were distinguished by the morphological differences from normal plants. Besides that, mutants were also distinguished by using molecular marker technique. Recently, more advance molecular marker techniques are used in mutation study. Advance molecular marker techniques are the combination of several advantages of basic techniques and incorporated with modification in the methodology to gain better result of the genetic material. The among advance techniques are the transposable elements-based molecular marker andretrotransposon-based molecular marker including (1) Inter-retrotransposon amplified polymorphism (IRAP) and Retrotransposon-microsatellite amplified polymorphism (REMAP), Norhanizan et al. 95

(2) sequence-specific amplification polymorphism (S-SAP), (3) Retrotransposon-based insertion polymorphism (RBIP).

IRAP analysis was firstly described by Kalendar et al. (1999). IRAP is based on the PCR amplification of genomic DNA fragments, which lie between two-retrotransposon insertion sites.

Polymorphism is detected by the presence or absence of the PCR product. Lack of amplification indicates the absence of the retrotransposon at the particular locus. The technique was originally developed using the

BARE-1 retrotransposon, which is present in the barley genome in numerous copies. About thirty bands were visualized by a single PCR reaction (Kalendar et al., 1999). IRAP markers were extremely polymorphic, which made them useful for evaluating intraspecific relationships, investigating linkage, evolution, determination of varieties and mutants and genetics diversity in plants (Dariusz, 2006).

The objective of this study is to develop new variety of C.willisii by using gamma irradiation.

Materials and Methods

Plant material and growth conditions

Plants of C. willisii, were received from Freshwater Fisheries Research Centre (Titi, Jelebu,

Negeri Sembilan, Malaysia) were used as starting material. The shoots were cut from rhizome and were used as explants for micropropagation. The shoots were excised at 1.5 cm from runners and washed under running tap water, 1 h. The shoots were then agitated and soaked in warm soapy water (added 2-3 drops of tween 20) for 1 min. Then the shoots were rinse again under tap water for 15 min.

Under aseptic conditions (in laminar flow cabinet), the shoots were surface sterilized with 30% chlorox for 30 s and rinsed three times in sterile distilled water. The shoots were then blot-dried on sterile filter paper and cut into appropriate size on sterile petri dish. The sterile explants were cut into small pieces about 1.0 cm length each.

The clean explants were then cultured on Murashige and Skoog (MS) medium (Murashige and

Skoog, 1962) supplemented with 3% (30g/L) sucrose with 20 l BA (N6-benzyladenine) and 0.5 l NAA (1- Induced Mutagenesis of Cryptocoryne willisii Using Gamma Irradiation 96

napthaleneacetic acid). The media pH was adjusted to 5.8 with 1N NaOH plus to the adding 2 g of Phytagel as the gelling agent.

The cultures were maintained in the growth room at 25 ± 2°C with 60-70% relative humidity in a 16 hour light cycle with fluorescence light of 1000-3000 lux. The plants were subcultured every 60 days until sufficient numbers of regenerants were available for mutagenesis. For this study, more than 2000 regenerants were used.

Gamma irradiation

LD50 experiment

Gamma irradiation was carried out using 60Co source (Gamma cell 220, Physic Department,

Faculty of Science, University Malaya, Kuala Lumpur, Malaysia). Regenerants were excised and transferred to 30 ml universal container with growth regulator-free semi-solid MS medium. One universal container consists of ten regenerants. The regenerants were cultured for 7 days in the medium before being subjected to mutagenesis experiment.

LD50 experiment was done for optimizing the suitable dose to induce mutation. For the LD50 experiment, regenerants were exposed to different doses 0-800 Gray (Gy). After one-day treatment, the irradiated plants were transferred into fresh MS medium with 20 l BA and 0.5 l NAA individually in 30 ml universal container. Observations to access plant survival following treatment with different high dosages of gamma ray were made after 30, 40 and 60 days in culture; however these subjected to high dosages were only occurred after 60 days.

Mutagenesis experiment

For the mutagenesis experiment, optimum dosage of the LD50 that was 25 Gy was used as the treatment dosage. More than 2000 regenerants of C. willisii were exposed to acute irradiation of 60Co at treatment dosage. After one-day following treatment, the irradiated individual shoots were transferred into fresh MS medium supplemented with 20 l BA and 0.5 l NAA in 30 ml universal container each. Norhanizan et al. 97

After 60 days in culture, new shoots were seen had developed. The 0 Gy plants served as the control plants. A few variants were observed from irradiated plants in some of the containers, some irradiated plants produce normal shoots, but some did not survive. Shoots from control and selected variant

were subcultured onto fresh medium. This is now the M1 generation. The variant shoots were selected again

th and subcultured repeatedly until the 4 generation (M4) to ensure stability of mutants. Control plants were

also subcultured to the M4 generation.

DNA extraction and Inter-Retrotransposon Amplified Polymorphism (IRAP) Analysis

In most of the plant genomes, retrotransposon are highly abundant and dispersed. The characters of ubiquitous distribution, high copy number and widespread chromosomal dispersion of the retrotransposon have the potential to be used as DNA-based marker system (Kalendar et al., 1999;

Kalendar, 2005; Teo, 2005). The IRAP markers were successfully used in phylogenetic analysis such as in

Spartina sp. (Baumel, 2002), banana (Teo, 2005), Brassica sp. (Karine, 2004) and apple (Kristiina, 2006).

Genomic DNA of D1 mutant, G1 mutant and Control (C) of the Cryptocorynes was extracted from young fresh leaves as previously described in Doyle and Doyle (1990). Following extraction, genomic

DNA samples were diluted with sterile distilled water to 50 ng/l. The IRAP-PCR was performed in a 20 l reaction mixture (rxn) containing 2 l DNA samples, 1 l (5 pmol) primer A and 1l (5 pmol) primer B, 16 l sterile distilled water and Maxime PCR Premix (i-Taq; for 20 l rxn). Component in 20 l reaction Premix:

2.5 U i-TaqTM DNA Polymerase, 2.5 mM each dNTPs, 1X reaction buffer and 1X gel loading buffer).

Amplification was performed using Biometra, T. personal Thermocycler. The PCR reaction parameters consists of: 95C, 2 min; 40 cycles of 95C, 1 min; annealing at 36.3C, 1 min; 72C, a final extension at 72C, 10 min. PCR products were analyzed by electrophoresis on 1% (w/v) agarose gel and detected by ethidium bromide staining. The IRAP banding pattern was scored using Gel-Pro Imager (The

Integrated Solution). Induced Mutagenesis of Cryptocoryne willisii Using Gamma Irradiation 98

Table 1: Primers for IRAP Retrotransposon Accession, Name Sequence source position Z17327 LTR6149 BARE-1® CTCGCTCGCCCACTACATCAACCGCGT TTATT 1993-2012 CTGGTTCGGCCCATGTCTATGTATCCACACATGT Z1 7327 LTR6150 BARE-1¬ A 418-439 Z17327 5’LTR1 BARE-1¬ TTGCCTCTAGGGCATATTTCCAACA 1-26 Z17327 5’LTR2 BARE-1¬ ATCATTCCCTCTAGGGCATAATTC 314-338 Z17327 3’LTR BARE-1® TGTTTCCCATGCGACGTTCCCCAACA 2112-2138 AY054376 Sukkula Sukkula® GATAGGGTCGCATCTTGGGCGTGAC 4301-4326 AY078073 AY078074 Nikita Nikita ® CGCATTTGTTCAAGCCTAAACC AY078075 1-22

Results and Discussion

Gamma irradiation

LD50 experiment

The results of gamma irradiation for the LD50 experiments are shown in Fig. 1 and Fig. 2. At high

dosage experiments (600, 700 and 800 Gy), more than 50% of the irradiated plants survived after 30 days of

incubation. After 40 days incubation, the 0, 100, 150, and 200 Gy irradiated explants still showed more than

50% survival rates. The 250 and 300 Gy irradiated explants showed less than 50% survival rates. All

explants unfortunately died when exposed to dosage higher than 400 Gy.

After 60 days incubation, all explants died when exposed to gamma irradiation at or more than 100

Gy. The results showing that the LD50 can only be achieved if the explants were exposed to dosage lower

than 100 Gy.

At lower dosage experiment (Fig. 2), the 40 to 100 Gy irradiated plants were totally dead after 60 days of

irradiation. From the experiment, the LD50 is between 0 to 35 Gy. And from best linear graph (Fig. 3), the

LD50 is 25 Gy. Norhanizan et al. 99

Figure 1: Percentage of survival of Cryptocoryne willisii on different high dosages of gamma irradiation after 30, 40 and 60 days incubations

Figure 2: Percentage of survival of C. willisii on different low dosages of gamma irradiation after 60 days incubations Induced Mutagenesis of Cryptocoryne willisii Using Gamma Irradiation 100

Figure 3: The graft showed LD50 for C. willisii is 25 Gray

Mutagenesis experiment

th The shoots were subcultured repeatedly until the 4 generation (M4) to ensure stability of the mutants. Although initially many variants were produced, only two mutants remain morphologically stable.

The significant value of the F test in the ANOVA table is 0.000. Reject the hypothesis that means length of the plants are equal across different groups.

The means lengths of the plants are significantly different between the groups. Mean length of normal plants (Picture 1) is 5.18 ± 1.57 cm, mean length for D1 plants (Picture 2) is 3.53 ± 0.89 cm and mean length for G1 plants (Picture 3) is 6.92 ± 1.79 cm.

A total of 36 combinations of primers were screened for marker of the mutant in the present experiment. Out of these combinations, two of the primers were sensitive enough to distinguished the D1 mutant and the G1 mutant from control plants. Norhanizan et al. 101

Picture 1: Normal plants of C. willisii (C)

1cm

Picture 2: Mutant D1, plants showing dwarfness compare to control plants

1cm Picture 3: Mutant G1, plants colours are brownish and taller than control plants Induced Mutagenesis of Cryptocoryne willisii Using Gamma Irradiation 102

The analysis revealed two polymorphic bands (225 bp and 320 bp) using Nikita primer for the D1 mutant (Fig. 4) and revealed two polymorphic bands (240 bp and 300 bp) using combination of 3'LTR primer and LTR 6149 primer for the G1 mutant (Fig. 5). G1 mutant can only be distinguished when the combination primers of 3'LTR primer and LTR 6149 were used.

Figure 4: IRAP profile of the D1 mutant, G1 mutants and C (control) plant of C. willisii obtained with primer Nikita showing two polymorphic bands (arrows). L: 100 bp plus DNA ladder

Figure 5: IRAP profile of the D1 mutant, G1 mutants and C (control) plant of C. willisii obtained with primer 3'LTR x LTR6149 showing two polymorphic bands (arrows). L: 100 bp plus DNA ladder Norhanizan et al. 103

Among the main advantages of in vitro mutagenesis is the ability to uniformly treat large number of cells with mutagen and the cells are able to grow in uniformly under control environment. Multiplication of the mutant clones is possible via micropropagation.

In this study, all regenerants were showing necrosis when exposed to high dosage of gamma

irradiation. Only when the regenerant were subject to lower dose of the gamma ray, the LD50 can be

achieved. The LD50 in the study is 25 Gy and the treatments for mutagenesis are between 0 to 30 Gy. After treatment with gamma irradiation, some of the new shoots showed differences in their morphology, where some showed necrosis and others did not show any changes. These morphologically different progenies are often called variants.

In the present study, many variants were established after irradiation, such as variants with curly

leaves, pink petiole, albino plants, dwarf plants and taller plants were developed at M1 generation. These

variants were selected and subcultured until M4 generation to confirm stability.

All the variants were reverted to normal plants (control) after the second subculture (M2) except for

variants with two characters, the dwarf and the taller plants. At this M4 generation, the two variants were stable and were called mutants. The first mutant, D1 is smaller in sizes compare to normal plants (C), particularly its leaf size and light green leaves. The second mutant, G1 had bigger and larger leaves compared to normal plants (C), with brownish leaf colour.

Beside the differences in morphology of the mutant plants, conformations of the mutants were also done using molecular markers. In this study, the IRAP markers were used to distinguish the D1 and G1 genomes from normal C. willisii genomes. The analysis revealed two polymorphic bands (225 bp and 320 bp) using Nikita primer for the D1 mutant and two polymorphic bands (240 bp and 300 bp) using combination of 3'LTR primer and LTR 6149 primer for the G1 mutant. From this study, it is clear that in vitro mutagenesis proves to be a very promising way to produce new variety for C. willisii and other aquatic plants. Induced Mutagenesis of Cryptocoryne willisii Using Gamma Irradiation 104

Acknowledgements

The authors would like to acknowledge Plant Biotechnology Incubator Unit, Institute of Science, Faculty of

Science, University Malaya and Freshwater Fisheries Research Division, FRI Glami Lemi, Department of

Fisheries for their providing the facilities and financial support of the project.

References

Baumel, A., Ainouche, M, Kalendar, R. and Schulman, A.H. 2002. Inter-Retrotransposon Amplified Polymorphsm (IRAP) and retrotrasposon microsatellite amplified polymorphism (REMAP) in population of the youngallopolyploid species Spartina angelica Hubbard (Poaceae). Molecular Biology Evolution, 19: 1218-1227.

Cook, Christopher D.K. 1996. Aquatic and Wetland Plants of India. Oxford University Press Inc. New York.

Dariusz, Grzebelus, 2006. Transposon insertion polymorphismas a new source of molecular markers. Journal of Fruit and Ornamental Plant Research. Vol. 14 (Suppl. 1): 21-29.

De Wit, H. C. D. 1964. Aquarium Plants. London Blandford Press Ltd.

Doyle, J.J. and J.L. Doyle. 1990. A rapid total DNA preparation procedure for fresh plant tissue. Focus, 12: 13-15.

Hiscock, P. 2005. Mini Encyclopedia. Aquarium Plant: Comprehensive coverage, from growing them to perfection to choosing the best varieties. Barron's Educational Series, Inc.

Kalendar, R., Grab, T., Regina M., Suoniemi A. and Schulman A.H. 1999. IRAP and REMAP: Two new retrotransposon-based DNA fingerprinting techniques. Theoretical and Applied Genetics, 98:704-711.

Karine Alix and J. S. (Pat) Heslop-Harrison 2004. The diversity of retroelements in diploid and allotetraploid Brassica species. Plant Molecular Biology, 54: 895–909.

Kristiina Antonius-Klemola, Ruslan Kalendar and Alan H. Schulman 2006. TRIM retrotransposons occur in apple and are polymorphic between varieties but not sports. Theoretical and Applied Genetics.

Murashige, T. and Skoog, F. 1962. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiology Plant, 15: 431-497.

Rataj, K. and Horeman,T.J. 1977. Aquarium Plants: their identification, cultivation and ecology. T.F.H. Publications, Inc. Ltd.

Teo, C.H., Tan, S.H., Ho, C.L., Qamaruz, F.Z., Othman, R.Y., Heslop-Harrison, J.S., Kalendar R. and Schulman A.H. 2005. Genome constitution and classification using retrotransposon-based markers in the orphan crop banana. Journal of Plant Biology, 48(1):96-105.

Windelov, H. 1987. Aquarium Plants. T.F.H. Neptune City, N.J. Malaysian Fisheries Journal 10: 105 - 123 (December 2011)

Disease prevalence of tiger grouper, Epinephelus fuscoguttatus cultured in nursery cages in Sabah, Malaysia

KUA BENC CHU1/, AZILA ABDULLAH1/, IFTIKHAR AHMAD1/ & NIK NAZLI EFFENDY2/

1/National Fish Health Research Centre, Fisheries Research Institute, 11960 Batu Maung, Penang 2/Pejabat projek Akuakultur Pulau Laying-Layang, Pusat Pembenihan Perikanan Sabah, Tanjung Badak, Peti Surat 699, 89608 Tuaran, Sabah

Abstract: A survey of fish diseases in tiger grouper Epinephelus fuscoguttatus at two sites of nursery cages in Sabah was conducted during June-December 2009. From the examination of 90 and 60 juvenile tiger grouper from Tanjung Badak and Pulau Layang-Layang nursery cages respectively, 5 taxa of parasites (Trichodina, Benedenia, Caligus, Pseudorhabdosynochus and unidentified metacercariae); 2 viruses (VNN and iridovirus) and 10 bacterial groups (Staphylococcus, Vibrio, Photobacterium, Non-fermentor, Micrococcus, Pseudomonas, Gemella, Erwinia, Cedecia and Aerococcus) were recorded. This study highlighted the prevalence of pathogen in nursery cages of tiger grouper cultured in Sabah waters.

Keywords: Disease, tiger grouper, Epinephelus fuscoguttatus, nursery cages, Sabah

Abstrak: Kajian mengenai penyakit ikan kerapu harimau Epinephelus fuscoguttatus di dua tapak nurseri sangkar, Sabah telah dijalankan pada Jun-Disember 2009. Pemeriksaan keatas 90 dan 60 juvenil ikan kerapu harimau dari sangkar nurseri Tanjung Badak dan Pulau Layang-Layang menunjukkan terdapat 5 taxa parasit (Trichodina, Benedenia, Caligus, Pseudorhabdosynochus dan metaserkariae); 2 virus (VNN dan iridovirus) dan 10 kumpulan bakteria (Staphylococcus, Vibrio, Photobacterium, Non-fermentor, Micrococcus, Pseudomonas, Gemella, Erwinia, Cedecia and Aerococcus). Kajian ini menekankan prevalen patogen pada ikan kerapu harimau yang diternak dalam nurseri sangkar di perairan Sabah.

Introduction

Grouper farming is one of the most popular mariculture activities worldwide, especially in Asian countries. The main species farmed are Epinephelus coioides, E. tauvina, E. fuscoguttatus, E. lanceolatus,

Plectropomus leopardus and Cromleptes altivelis. In Malaysia, the supply of grouper for local market comes mainly from aquaculture. Its export increased from only 2572 metric tons in 2005 to 4400 metric tons in 2008 with estimated wholesale value of UDS$5 million in 2008 (Department of Fisheries, Annual

105 Disease Prevalence of Tiger Grouper in Nursery Cages 106

Statistics, 2005 and 2008). Tiger grouper (E. fucsoguttatus) is among the top three most cultured species in

Malaysia and it is a species with great potential for aquaculture in Southeast Asia. In Malaysia, this high- value food fish is cultured in floating net cages placed in coastal pondor open sea cages. The local price for live tiger grouper ranges between US$10 - 13.00 per kilogram and fetched up to USD$16-20 per kilogram in export market in 2009. Sadovy (2000) reported that the production of cultured groupers was influenced by factors such as cannibalism, poor water quality and disease outbreaks. Arthur and Ogawa (1996) identified the principal diseases in grouper (primarily Epinephelus spp.) cultured in Southeast Asia were mainly due to the pathogen virus, bacteria and parasite. Viral diseases such as viral nervous necrosis (VNN); golden eye disease; spinning grouper disease (picorna-like virus); sleepy grouper disease (iridovirus) and red grouper reovirus have been reported since 1995 (Chew-Lim et al., 1992). A range of bacterial diseases of grouper has also been reported, including Vibrio sp., Pseudomonas sp., Pasteurella piscicida and Flexibacter sp. (Melba et al., 2000) Bacteriosis caused by Pseudomonas sp. among E. tauvina cultured in Malaysia was first reported by Nash et al. (1987), where all age groups were affected with mortalities ranged from 20-60% during an outbreak in 1982-1986. Affected fish showed extensive haemorrhagic erosions and ulcerations of the skin, fins and tail. Vibriosis was reported among E. malabaricus and Epinephelus sp. in Malaysia (Wong and Leong, 1990; Palanisamy et al., 1999). Grouper also suffered parasitic diseases such as protozoan infection (Amyloodinium, sp., Brooklynella sp., Cryptocaryon irritans, Trichodina sp.) and monogenea group such as Benedenia sp., Megalocotyloides epinepheli and Pseudorhabdosynochus epinepheli

(Koesharyani et al., 1999)

The increasing disease problems and its impact to the fish farming industry have showcased the relevance of disease monitoring and surveillance program in the country, as they are considered to be of socioeconomic importance (Hastein, 1995., Hastein et al., 1999, 2001). The term "disease surveillance" is used to describe a more active system and implies that some form of directed action will be taken if the data indicate a disease level above a certain threshold (Martin et al., 1987). Hence as we introduce culture of tiger Kua et al. 107

grouper in submerged cages at Pulau Layang-Layang, Sabah, a disease surveillance program at the nursery level is needed to document the status of disease, to eradicate a disease or to keep a disease under control within certain conditions. For some viral diseases caused by Viral Nervous Necrosis (VNN) diseases or iridovirus, the ultimate aim will probably be prevention of their occurrence or keep the disease level at a minimum. During the culture period percentage weight gain was used as an indicator for fish health. This paper reports the findings of the study conducted on the disease surveillance particularly on the prevalence of pathogens at two sites of nursery cages in Sabah waters.

Materials and Methods

Source of fish

The tiger grouper fry were produced locally at Tanjung Badak Hatchery, Kota Kinabalu, Sabah in

November 2008. The fry were cultured in hatchery until January 2009 before sent off to the nursery cages at

Tanjung Badak and Pulau Layang-Layang, Sabah. At 100g and above, the fish were transferred into submerged cages at Pulau Layang-Layang. The initial weight was obtained from the fish management group of Pulau Layang-Layang and Tanjung Badak in order to compare the weight after few months of culture at the site. Health monitoring program of the first batch of tiger grouper began in June 2009 and ended in October 2009. Standard diagnostic procedures and bimonthly samplings were carried out during the sampling period.

Gross observation

Approximately 30 fish were sampled from each site and a total of 90 and 60 juvenile tiger grouper from Tanjung Badak and Pulau Layang-Layang nursery cages examined respectively. We managed to obtain 3 sets of sampling data from nursery cages at Tanjung Badak (June, August and October 2009) and only 2 sets from Pulau Layang-Layang (August and October 2009). The fish were randomly scooped from the nursery cages. The fish from Pulau layang-Layang were caught on the same day of sampling at nursery Disease Prevalence of Tiger Grouper in Nursery Cages 108

cages at Tanjung Badak. The fish were air freighted to Tanjung Badak hatchery and upon arrival the tiger grouper were conditioned in the same plastic bag before undergoing necropsy procedures. The weight and length from each fish were recorded and water in the plastic bag was disinfected with 40 ppm chlorine.

Clinical signs both external and internal were recorded in database by using Epi-Info software (Centers for

Disease Control and Prevention (CDC), United State).

Parasitology

Fish ectoparasites were isolated from body and gill for examination under compound microscope.

Methods used in preparing specimens for taxonomic studies and identification of parasite were based on

Kabata (1985).

Bacteriology

Lesion and internal organs (liver and kidney) was sampled using transport media swab and brought back to NaFisH for bacterial growth and identification. Swabs were inoculated on TSA agar plates and sub-cultured several times to obtain pure bacterial isolates. Gram staining was done on pure isolates to divide them into Gram-negative and Gram-positive bacteria group. Pure cultures of Gram-negative bacteria were subjected to presumptive test using McConkey media plates (DifcoTM, France), TCBS (Merck,

Germany), OF (Merck, Germany), vibriostat 0/129 (Oxoid Ltd., England) and motility (Oxoid Ltd.,

England). API 20E (bioMerieux, France) identification strip procedure soon followed and bacterial profile determined by APIWEB software (bioMerieux, France) and Bergey's Manual of Determinative

Bacteriology Ninth Edition. Pure cultures of Gram-positive bacteria were subjected to catalase enzyme test

using H2O2 as substrate to differentiate between Staphylococcus and Streptococcus group. API 20 STAPH

(bioMerieux, France) and API 20 STREP (bioMerieux, France) identification strip procedure soon followed and bacterial profile determined by APIWEB software and Bergey's Manual of Determinative

Bacteriology Ninth Edition. Kua et al. 109

Virology

Two viral diseases, viral nervous necrosis (VNN) and iridovirus (IRIDO) were selected for disease surveillance using commercial kits (IQ2000TM VNN and IQ2000TM Iridovirus (Detection kit, Farming

IntelliGene Tech. Corp, Taiwan). Protocol for the viral RNA and DNA extraction and the polymerase chain reaction (PCR) were according to the kit's manual without any modification. Targeting organs for both viral diseases were spleen, eye, kidney and brain. First, organs were ground with mortar and pestle, homogenized and extract using RNA extraction solution and CTAB-DTAB solution for VNN and iridovirus respectively.

The resultant pellet were dried and dissolved in diethylpyrocarbonate treated water (DEPC). Two (2) µl of this extracted RNA/DNA were then used in the subsequent reverse transcription-polymerase chain reaction

(RT-PCR) for VNN and direct PCR for iridovirus. The thermal cycler program for both viruses followed the kit's instruction. At the completion of the PCR reaction, the PCR products were read using 2% electrophoresis gel prepared in LB buffer (Faster Better Media LLC, USA) and stained with ethidium bromide (Sigma-Aldrich, Inc, USA) before viewed under gel documentation equipment (Syngene, UK).

Results

Gross Observation

The tiger grouper cultured at Tanjung Badak achieved 112% in weight gain against the 22% obtained in Pulau Layang-Layang (Fig.1). Approximately 47 to 80% with average of 31.11 ± 18.36 g of tiger grouper cultured at nursery cages at Pulau Layang-Layang showed external clinical signs as compared to

10-43% with average of 63.66 ± 23.57g in tiger grouper cultured at Tanjung. Badak nursery cages (Table 1).

The external signs such as ulcer, red boil, bloated stomach, tail and fins rot were seen throughout the culture period (Fig. a and b). Most of the ulcers were seen on the abdomen, fins, operculum and jaw. The red boil signs were recorded on the abdomen areas. The internal organs showed congested kidney, enlarged spleen and swim-bladder (Table 2, Fig. 2c). Disease Prevalence of Tiger Grouper in Nursery Cages 110

Figure 1: Body weight (g) of tiger grouper obtained during the monitoring period. Weight gain (%)* = (final weight – initial weight) x 100/initial weight

Table 1: Gross observation based on the external signs of the tiger grouper cultured in the two nursery sites Tanjung Badak Pulau Layang-Layang June Clinical signs 09 August 09 October 09 August 09 October 09 Ulcer 23.33 3.33 6.67 16.67 6.67 Tail & Fin rots 20 0 0 0 36.67 Cloudy eye 0 3.33 0 0 0 Abnormal 0 3.33 0 0 0 Red boil 0 0 0 23.33 0 Blind eye 0 0 0 3.33 0 Hemorrhage 0 0 16.67 0 3.33 Bloated stomach 0 0 3.33 0 0 Blind eye & red boil 0 0 0 3.33 0 Rot & hemorrhage 0 0 6.67 0 0 Hemorrhage & ulcer 0 0 3.33 0 3.33 Hemorrhage & bloated stomach 0 0 3.33 0 3.33 Ulcer & rot 0 0 0 0 23.33 Hemorrhage & rot 0 0 0 0 3.33 Total fish with signs 43.33 9.99 40.00 46.66 79.99

Kua et al. 111

Figure 2: Clinical signs of tiger grouper. (a) ulcer at the abdomen (arrow), (b). bloated stomach (arrow) and (c). enlarged spleen (arrow) Disease Prevalence of Tiger Grouper in Nursery Cages 112

Table 2: Gross observation based on the internal signs of the tiger grouper cultured in the two nursery sites Tanjung Badak Pulau Layang-Layang Clinical signs June 09 August 09 October 09 August 09 October 09 Enlarged spleen(SP) 20 13.33 6.67 3.33 13.33 Enlarged gall bladder(GB) 13.33 3.33 10 0 3.33 Enlarged Liver(L) 0 0 0 10 0 Enlarged kidney (KID) 0 0 0 6.67 0 Pale liver 0 0 0 3.33 0 Brown patches L 0 0 0 3.33 0 Enlarged L & SP 0 0 0 10 0 Enlarged SP & KID 0 0 16.67 0 6.67 Enlarged GB & SP 53.33 10 23.33 0 16.67 Enlarged GB & KID 3.33 0 3.33 0 3.33 Enlarged GB, SP & KID 3.33 33.33 13.33 3.33 33.33 Enlarged GB, SP & L 0 0 0 3.33 0 Enlarged GB & pale liver 0 10 0 0 0 Enlarged GB,KID & L 0 0 0 3.33 0 Enlarged GB,KID,L & SP 0 0 0 6.67 0 Enlarged KID & L 0 3.33 0 0 0 Enlarged KID & SP 0 6.67 0 6.67 0 Enlarged KID, SP & L 3.33 0 26.67 0 Enlarged KID & GB, pale L 3.3 0 0 0 Enlarged KID & SP, pale liver 10 0 6.67 0 Total fish with signs 93.32 96.62 73.33 93.33 76.66

Parasitology

Similar ectoparasites were found at both nursery sites but with Tanjung Badak having more

diversity (4 taxa: Trichodina, Benedenia, Caligus and Pseudorhabdosynochus) than Pulau Layang-layang

(2 taxa: Pseudorhabdosynochus and unidentified metacercariae). However, both sites had high prevalance

of ectoparasites: 73.33 - 83.88% at Tanjung Badak and 86.66 to 96.66% at Pulau Layang-layang nursery

cages respectively (Fig. 3).

Bacteriology

At Tanjung Badak hatchery, percentage of bacterial-infected fish increased from the month of

June (7%) to August (97%) but decreased to 63% in October sampling (Fig. 4a). Ten bacterial groups were

isolated from infected fish with the highest being Staphylococcus (36%) followed by Vibrio (13%),

Photobacterium (10%), Non-fermentor (2%), Micrococcus, Pseudomonas, Gemella, Erwinia, Cedecia

and Aerococcus (1% each) (Fig. 4b).

Fish sampled from Pulau Layang-Layang showed 67% bacterial infection in August and

decreased to 40% in October 2009 (Fig. 4c). Twelve bacterial groups were isolated from infected fish with

the highest being Staphylococcus (28%) followed by Vibrio (9%), Kocuria (7%), Pseudomonas (3%), Kua et al. 113

Figure 3: Prevalence of ectoparasite in tiger grouper cultured in nursery cages

Photobacterium (2%), Enterobacter, Erwinia, Leuconostoc, Micrococcus, Non-enterobacteria, Shigella and Chrommobacterium (2% each) (Fig. 5).

Virology

Iridovirus and VNN are the most common viral diseases in cultured marine fish in Malaysia. In this study, iridovirus was detected in three of the samples from nursery cages at Tanjung Badak and two from the fish kept at nursery cages at Pulau Layang-Layang. Two positive iridovirus were detected in June 2009 while the other three were detected in August 2009. VNN was only detected from fish kept at Pulau Layang-

Layang in August 2009 and one of these positive samples was found to be concurrently infected with iridovirus (Table 3). The result showed that there was not much difference in prevalence of VNN and iridovirus based on the detection and samples taken from both sites.

Table 3: Summary results of VNN and IRIDO detected in fish organs sampled in June, August and October 2009 Location Results (positive/number of samples tested) VNN IRIDO Tanjung Badak nursery cages 2/32 (6.25%) 3/38 (7.89%) Pulau Layang-Layang nursery cages 0/24 (0%) 2/30 (6.66%) VNN – Positive at 289 bp and/or 479 bp IRIDO – Positive at 226bp and/or 450bp Disease Prevalence of Tiger Grouper in Nursery Cages 114

Figure 4: Percentage of bacteria in tiger grouper cultured at Tanjung Badak. (a).Fish infected with bacteria for each sampling month and (b) Bacteria found in June, August & October 2009 Kua et al. 115

Figure 5: Percentage of bacteria found in tiger grouper cultured at Pulau Layang-Layang Sea Cages (a). Fish infected with bacteria and (b). bacteria found in August and October 2009 Disease Prevalence of Tiger Grouper in Nursery Cages 116

Discussion

Gross Observation

In the present study, tiger grouper showed a normal rate of weight gain in 150 days fed with normal pellet in both of the nursery cages. However, the weight gain (%) by the tiger grouper at Tanjung Badak was much higher than the fish reared in Pulau Layang-Layang. A lot of factors influenced the weight gain but the concern is usually for abnormal or unanticipated weight loss. A slower than normal rate of gain may be a more sensitive indicator of sub-optimal environment or health (Morton and Griffiths, 1985).

Both internal and external clinical signs occurred in tiger grouper reared at Pulau Layang-Layang compared to those cultured at Tanjung Badak. Some of the clinical signs were asystematic symptoms for some diseases. Woo et al. (1999) reported that vibriosis normally showed skin lesions such as red boil that become ulcer and in an acute situation a blood exudates known as hemorrhage. Enlarged spleen and kidney could indicate gastroenteritis vibriosis and infection of viral diseases in some cultured groupers (Yii et al.,

1997; Lee et al., 2002). Vibriosis could also cause vasculitis and eye lesions in fish (Austin and Zhang,

2006). In our study, there were also corneal lesions followed by blindness. In acute and severe epizootics, the course of the infection will be rapid, and most of the infected fish die without showing any clinical signs. In our study, no high mortalities were recorded and we believed that it was not acute or severe epizootics.

Parasitic infection

Ectoparasites such as ciliates (Trichodina sp.) and gill monogenean (Pseudorhabdosynochus spp.) are normally harmless ectocommensals, particularly in fingerlings. However, these ectoparasites often become pathogenic to fingerlings newly introduced into cages (Table 4). They become more susceptible to parasitic infections due to handling, transportation and environmental stresses. Once infected, the control of these ectoparasites becomes difficult. Infestation of body monogenean (Benedenia sp.) and crustacean copepod (Caligus sp.) are often seen in intensive mariculture. The intensity of parasitism may increase rapidly over a short period of time. The main infection sites are the skin. According to Leong (1992), marine Kua et al. 117

Table 4: Ectoparasites in tiger grouper during the surveillance period Disease Prevalence of Tiger Grouper in Nursery Cages 118

finfishes cultured in Southeast Asia have been affected by monogenean epizootics. Usually, vibriosis occurs concurrent to monogenean infections in grouper, seabass and snapper. As for copepod infestation, it may not cause mortalities, however, infections will cause reduction in growth, anemia and subsequent consumer rejection.

Bacterial diseases

Staphylococcus bacteria were constantly found at each sampling month from the Tanjung Badak hatchery and Pulau Layang-Layang cages, suggesting its involvement in fish mortality at both sites. The staphylococcal infections comprised of infectious systemic diseases characterised by septicaemia and also lesion (Varvarigos). The disease spreads rapidly among fish population as well as to neighbouring cages holding the same or other fish species. Usually, there is good response subsequent to the administration of the appropriate therapy. However, the condition often persists and mortality gradually reappears. Field evidence suggests that it is not easy to eradicate a staphylococcal infection when established in a fish population. Apparently, it is not possible to eliminate the pathogen from the fish or the environment

(Varvarigos). Gram-negative bacteria that were isolated from these two sampling sites appeared in low percentage as secondary infection; thus it was not considered as the main cause of fish mortality in the two sampling sites. The presence of Gram negative bacteria in secondary infection usually reflects poor water quality (mostly caused by high concentration of organic matter in culture area).

Viral diseases

VNN and iridovirus are the most common viral diseases in cultured marine fish in Asean generally and in Malaysia specifically. VNN disease was first described by Chuah and Kua (2004), when they found the first outbreak of VNN in L. erythropterus in Langkawi waters. The fish was imported from another

Asean country and the detection was confirmed by histopathological changes of the brain and eye and RT-

PCR. The disease is being transmitted either horizontally or vertically and showed clinical signs of dark Kua et al. 119

body colouration and abnormal swimming behavior. It occurs mostly in the juvenile fish at hatchery at the age between 1 to 40 days old. In our study, we found that VNN could also be detected in bigger size fish.

Further epidemiological studies at different sampling sites in Malaysia (2006-2009) revealed that VNN had been detected in healthy fish of seabass (L. calcarifer) and groupers (Epinephelus sp.) whether at hatchery or grow-out stages (Azila et al., 2010). As the vaccine for VNN is still underway, a good management practice by screening of broodstocks and fish fry is essential to prevent its occurrence in the culture system.

In addition, treatment of eggs with iodine has proven effective against it in the hatchery.

On the other hand, iridovirus was first reported in cultured tiger grouper, E. fuscoguttatus in

Malaysia (Oseko et al., 2002). However, the detection confirmed that the disease was caused by a genus of iridovirus which was lymphocystis virus. This disease was known to cause a whitish nodules or growth structures on the body, fins or mouth of the fish. In our study, the positive samples did not show such clinical signs except enlarged spleen and kidney or haemorrhage of the swim bladder. These clinical signs are associated with other genus of iridovirus especially the ranavirus (Azila, unpublished data). However, genus determination was not done in the current studies.

Concurrent infection of VNN and iridovirus are quite common. At certain period, the disease might cause other unspecific clinical signs due to the lower immune status caused by both viruses (Azila et al., 2006). Furthermore, these 2 viruses can also be found in the trash fish (Kim et al., 2007). Thorough studies on the presence of these 2 viruses in trash or wild fish have been done in Malaysia but few samples did show positive results (Azila, unpublished data). Hence, the use of trash fish for feeding and the wild broodstocks should be screened from time to time to prevent horizontal transmission of both viruses. Disease Prevalence of Tiger Grouper in Nursery Cages 120

In conclusion, five different taxa of parasites (Trichodina, Benedenia, Caligus,

Pseudorhabdosynochus and unidentified metacercariae); two types of viral diseases (VNN and iridovirus) and ten bacterial groups (Staphylococcus, Vibrio, Photobacterium, Non-fermentor, Micrococcus,

Pseudomonas, Gemella, Erwinia, Cedecia and Aerococcus) were recorded at the tiger grouper cultured in nursery cages in Sabah. There is no difference between the prevalence of parasitic infection and viral diseases (VNN and IRIDO) at nursery cages at Tanjung Badak and Pulau Layang-Layang throughout the 3 sampling periods (Fig. 6). However, there are differences between the findings of bacteria where the percentage was lower in August as compared to the other months for tiger grouper reared at Tanjung Badak nursery cages. As the causes for this observation remains unknown surveillance needs to be continued with regular sampling in another batch of fish to more information as Pulau Layang-Layang has been identified as a new culture site in Malaysia.

Figure 6: Summary of diseases pathogen at nursery cages of Tanjung Badak and Pulau Layang-Layang Kua et al. 121

Acknowledgements

We would like to express our gratitude to Director of Research, YM Raja Mohd. Noordin bin Raja

Omar Ainuddin for his encouragement to document the research finding. We also wish to extend our gratitude to the management and staff of KK Manchung/Mersuji for their help in bringing the fish from Pulau

Layang-Layang to Tanjung Badak. Thanks also go to Ms. Sharon and staff of Tanjung Badak hatchery for their assistance with necropsy procedure at the laboratory. This research was funded by the development project (22502) under Department of Fisheries Malaysia.

References

Austin, B. and Zhang, X.H. 2006. Vibrio harveyi: a significant pathogen of marine vertebrates and invertebrates. Letters in Applied Microbiology 43: 119-124.

Arthur, J.R. and Ogawa, K. 1996. A brief overview of disease problems in the culture of marine finfishes in east and Southeast Asia, pp. 9-31. In: K.L, Main and C. Rosenfeld (eds): Aquaculture Health Management Strategies for Marine Fishes, Proceedings of a Workshop in Honolulu, Hawaii, October 9-13, 1995. The Oceanic Institute, Hawaii.

Azila, A., Erni F.S., Zuraidah, R., Merikan M.N., Nasriah, A. & Nasrul M.M.A. Development of PCR based diagnostic kit for the detection of fish viral diseases in cultured marine fish. Abstract and poster presentation for biotechnology seminar, 24-26 May 2010, Kuala Lumpur.

Azila A., Che Utama Che Musa ,Siti-Zahrah A., Erni F.S. and Faazaz A.L. 2006.VNN infection in Malaysia: Status and development of polymerase chain reaction (PCR) based diagnostic technique. Abstract presented at the 1st international symposium on VNN, Hiroshima, Japan.

Chuah, T.T. and Kua, B.C. 2004. First report on the occurrence of viral nervous necrosis in Lutjanus eryprotherus in Malaysia. 7th Asian Fisheries Forum, 30 Nov. – 4 Dec. 2004, Penang, Malaysia.

Martin, S.W., Meek, A.H. and Willeberg, P. 1986. Veterinary epidemiology.Principles and methods. IOWA StateUniversity Press / Ames, Iowa, USA. 1986.

McGilvray, F. and Chan, T.T.C. 2002. The trade in live reef foodfish: A Hong Kong perspective. Aquaculture Asia. Vol. VII (1): 21- 26.

Melba, G. Bondad-Reantaso, Somkiat, Kanchanakhan and Supranee, Chinabut. 2000. Review of Grouper Diseases and Health Management Strategies for Grouper and other Marine Finfish Diseases. Proceedings of Regional Workshop on Seafarming and Grouper Aquaculture, Medan, Indonesia. 17 – 20 April 2000. p61 – 92.

Morton, D.B. and Griffiths, P.H.M. (1985). Guidelines on the recognition of pain and discomfort in experimental animals and an hypothesis for assessment. Veterinary Record 116:431-436. Disease Prevalence of Tiger Grouper in Nursery Cages 122

Hastein, T. 1995. Disease problems, use of drugs, resistance problems and preventive measures in fish farming worldwide. In Sustainable FishFarming, eds. Reinertsen H & Haaland H., 183- 194 pp.

Hastein, T., Hill, B.J. and Winton, J.R. 1999. Successful aquatic animal disease emergency programmes. Rev. Sci. Tech. Off. Int. Epiz. 18 (1), 214-227.

Hastein, T., A. Hellstrom, G. Jonsson, N. J. Olesen and E.R. Parnanen. 2001. Surveillance of Fish Diseases in the Nordic Countries. Acta Vet. Scand. 94: 43-50.

Ji Hyung Kim, Dennis K. Gomez, Casiano H. Choresca Jr. and Se Chang Park 2007. Detection of major bacterial and viral pathogens in trash fish used to feed cultured flounder in Korea. Aquaculture, 272 (1-4): 105-110

Kabata, Z. 1985 Parasites and diseases of fish cultured in the tropics. Taylor and Francis Ltd., London, UK. 318 p.

Koesharyani, I., Zafran, Yuasa, K. and Hatai, K. 1999. Common ectoparasites of groupers in Indonesia, PP 41. In: “Aquatic Animal Health for Sustainability”, Book of Abstracts, OP 40, Fourth Symposium on Diseases in Asian Aquaculture, November 22-26, 1999, Cebu, Philippines.

Lavilla-Pitogo, C.R., Emata, A.C., Duray, M.N. and Toledo, J.D. 1996. Management of fish health in broodstock and larvae of milkfish, seabass and grouper, pp. 47-56. In: K.L. Main and C. Rosenfeld (eds): Aquaculture Health Management Strategies for Marine Fishes, Proceedings of a Workshop in Honolulu, Hawaii, October 9-13, 1995. The Oceanic Institute, Hawaii.

Lee, K.K., Liu, P.C. and Chuang, W.H. (2002) Pathogenesis of gastroenteritis caused by Vibrio carchariae in cultured marine fish. Mar Biotechnol. 4: 267–277.

Martin SW, Meek AH, Willeberg P 1986. Veterinary epidemiology.Principles and methods. IOWA State University Press / Ames, Iowa, USA.

Nash, G., Anderson, I.G., Shariff, M and Shamsudin, M. Nor. 1987. Bacteriosis associated with epizootic in the giant sea perch, Lates calcarifer, and the estuarine grouper, Epinephelus tauvina, cage-cultured in Malaysia. Aquaculture 67: 105-111.

Oseko, N., V. Palanisamy, B.C. Kua., C.T. Thye, 2002. Occurrence of lymphocystis disease in cultured tiger grouper Epinephelus fuscoguttatus in Malaysia. In: Diseases in Asian Aquaculture IV. C.R. Lavilla-Pitogo & E.R. Cruz-Lacierda(eds.). Fish Health Section, Asian Fisheries Society, Manila. pp 213-218.

Palanisamy, V.N., Oseko, N. Kua, B.C. Chua, T.T. and Vijayenthy, N. 2000. The pathogenic Vibrio isolates from cultured seabass (Lates calcarifer), groupers (Epinephelus spp.) and red snapper (Lutjanus argentimaculatus) in Malaysia. In: Diseases in Asian Aquaculture IV. C.R. Lavilla-Pitogo & E.R. Cruz-Lacierda(eds.). Fish Health Section, Asian Fisheries Society, Manila. pp 235-242.

Sadovy, Y., 2000. Regional survey for fry/fingerling supply and current practices for grouper mariculture. Evaluating current status and long-term prospects for grouper mariculture in Southeast Asia. Final report to the Collaborative APEC grouper research and development network (FWG 01/99).

Varvarigos, Panos. Gram positive cocco-bacteria (Micrococcaceae, Streptococcaceae) causing systemic disease to intensively farmed marine fish in the Mediterranean. A brief review. http://www.vetcare.gr/Gram_positive_cocci.htm Kua et al. 123

Wong, S.Y. and Leong, T.S. 1990. A comparative study of Vibrio infections in healthy and diseased marine finfishes cultured in floating cages near Penang, Malaysia. Asian Fisheries Science 3: 353- 359.

Woo.P.T.K, D.W. Bruno and L.H.S. Lim. 1999. Fish Diseases and Disorders Vo.3, Viral, bacterial and fungal infections. CAB international.

Yii, K.C., Yang, T.I. and Lee, K.K. (1997) Isolation and characterization of Vibrio carchariae, a causative agent of gastroenteritis in the groupers, Epinephelus coioides. Current Microbiology 35: 109–115. Malaysian Fisheries Journal 10: 124 - 141 (December 2011)

Potentially Harmful Microalgae From Cockle Culture Area in Sg. Jarum Mas, Perak

ROZIAWATI, M.R. & FAAZAZ, A.L.

Fisheries Research Institute, 11960, Batu Maung, Penang, Malaysia

Abstract: Phytoplankton study was carried out at cockle culture area in Sg. Jarum Mas, Perak, from February to October 2008. A total of 64 water samples were collected from eight sampling stations. Using an inverted microscope, a total of eight genera of potentially harmful microalgae were identified belonging to two different classes; dinoflagellates and diatoms. The potentially harmful dinoflagellates observed were Alexandrium sp., Dinopyhsis sp., Dinophysis caudata, Prorocentrum sp., Ceratium furca, Noctiluca scintillans and Akashiwo sanguinea. Meanwhile the potentially harmful diatom observed was Pseudo-nitzchia sp. The enumeration of the cell density for each of the potential harmful microalgae have also been carried out. The results show that the density of cells for each of the potential harmful microalgae is low, but, Alexandrium sp. found relatively high concentrations in April of ~ 25, 000 cells / L. However, no cases of food poisoning due to marine microalgae or red tide incidents reported during the period of this study.

Keywords: Harmful dinoflagellates, Harmful diatoms, density cells

Abstrak: Kajian phytoplankton telah dijalankan di kawasan ternakan kerang di Sg. Jarum Mas, Perak bermula dari Februari hingga Oktober 2008. Sejumlah 64 sampel air telah diambil dari lapan lokasi sekitar Sg. Jarum Mas. Dengan menggunakan ”inverted microscope”, sebanyak 8 genera mikroalga yang berpotensi bahaya telah dikenalpasti iaitu dari kelas dinoflagelat dan diatom. Dinoflagelat yang berpotensi bahaya yang ditemui adalah Alexandrium sp., Dinopyhsis sp., Dinophysis caudata, Prorocentrum sp., Ceratium furca, Noctiluca scintillans and Akashiwo sanguinea. Manakala diatom yang berpotensi bahaya ditemui adalah spesies Pseudo-nitzchia sp. Pengiraan jumlah kepadatan sel bagi setiap mikroalga yang berpotensi bahaya juga telah dilakukan. Keputusan mendapati bahawa kepadatan sel bagi setiap mikroalga yang berpotensi bahaya adalah rendah, namun begitu Alexandrium sp. didapati agak tinggi kepekatannya pada bulan April iaitu ~25, 000 sel/L. Walau bagaimanapun tiada kes keracunan makanan laut akibat mikroalga bahaya atau kejadian ledakan mikroalga dilaporkan sepanjang tempoh kajian dijalankan.

124 Potentially Harmful Microalgae From Sg. Jarum Mas 125

Introduction

Cockles are among popular seafood in Malaysia and its cultivation is a good revenue earner. In the year 2007, Malaysia produced about 49,620.16 tonnes of the cockles valued at RM 62.30 million (Annual

Fisheries Statistic, 2007). State of Perak was the top producer in Malaysia contributing about 68% of the whole production, amounting to 33,711.51 tonnes valued of RM 41 million. Sg. Jarum Mas, Perak has been identified as one of the major cockle producing areas under the Department of Fisheries (DOF), Balance of

Trade (BOT) program for mollusc. At present, the safety of the cockles harvested from Sg. Jarum Mas is monitored under the DOF Marine Sanitary and Phytosanitary (SPS) Program. The main objective of this program is to ensure that cockles are harvested from safe areas. Potential harmful microalgae are one of the parameters monitored in this program.

About 300 of the approximately 5,000 currently described microalgae species are considered to be harmful, while only 80 species have the capacity to produce potent toxins (Hallegraeff, 2003). Harmful microalgae are normally found in low numbers, but under certain condition may form extensive blooms that are capable of causing devastating effects on the environment (Moestrup and Larsen, 1992).

Harmful algal Blooms (HABs) are natural phenomena due to the increase of phytoplankton cell density in the water column (106-107 cells/L), there is a total dominance of a single species and the events are unpredictable in nature (Usup et al., 1989). However, it is still difficult to define a cell concentration that constitutes HAB; some species such as Dinophysis can be dangerous, causing poisonings at cell densities of only several hundred cells per liter (Kevin et al., 2003).

It is still a matter of debate as to the causes of Harmful Algae Blooms, the possibility of human activities such as nutrient enrichment (from industrial waste, human settlements, agricultural and aquaculture runoff and discharge), climate changes, or transport of algal species via ship ballast water

(Anderson et al., 2001; Mercedes and Esther, 2006). Some species may blooms causes by abundance nutrients sources from upwelling of water from below and river flow (Kevin et al., 2003). Roziawati, M.R. & Faazaz, A.L. 126

Harmful Algae Blooms association with human illness or damage to aquaculture operations is receiving growing attention in the newspapers, electronic media and scientific literature. As a result, more and more researchers are now surveying the local waters for the nuisance algae (Hallegraeff, 2003). The harmful species include some species of dinoflagellates, diatoms, cyanobacteria, and 'naked' flagellates.

HABs are often accompanied by shellfish toxicity events because the algae are often consumed in large numbers by filtration-feeding bivalves. Toxins eventually get transferred to humans through the food chain

(Usup et al., 2002). Table 1 summarizes the three types of HABs problem, together with examples of causative algal species.

The first HABs and shellfish toxicity even in Malaysia was reported in Sabah in 1976 which was caused by Pyrodinium bahamense var. compressum (Roy, 1977; Taylor and Fukuyo, 1989; Choo, 1994;

Anton et al., 2000). A number of 202 people were reported to suffer from Paralytic Shellfish Poisoning

(PSP) cases, with seven deaths recorded. Since then, this phenomenon has continued to occur almost annually in the state (Usup and Azanza, 1998). On the other hand, the first reported PSP case in the peninsular took place in Sebatu, Malacca in 1991, triggered by Alexandrium tamiyavanichii. Three people were taken ill after consuming green mussel (Usup et al., 2002). The latest reported cases of PSP, occurred in 2001 in Tumpat, Kelantan where a youth died and six persons were hospitalized after eating benthic bivalve 'lokan' (Polymesoda sp.) contaminated with Alexandrium minutum (Lim et al., 2004; Wan Norhana et al., 2005).

To our knowledge, there has been no report on HABs occurrence or shellfish toxicity cases in Sg.

Jarum Mas, Perak. Thus, the objective of this paper is to document the presence of potentially harmful microalgae in cockle culture areas in Sg. Jarum Mas, Perak. Potentially Harmful Microalgae From Sg. Jarum Mas 127

Table 1: Different types of harmful algal bloom (from Hallegraeff, 2003)

1. Species that produce basically harmful water discolorations; however, under exceptional conditions in sheltered bays, blooms can grow so dense that they cause indiscriminate kills of fish and invertebrates through oxygen depletion. Examples: dinoflagellates Akashiwo sanguinea, Gonyaulax, Noctiluca Scintillans, Scrippsiella trochoidea ; cynobacterium Trichodesmium erythraeum

2. Species that produce potent toxins that can find their way through the food chain to human, causing a variety of gastrointestinal and neurological illness, such as;

· Paralytic shellfish poisoning (PSP) (Examples:Dinoflagellates Alexandrium catenella, A. cohorticula, A. fundyense, A. fraterculus, A. leei, A.minutum, A. tamarese, Gymnodinium catenatum, Pyrodinium bahamense var compressum)

· Diarrthetic shellfish poisoning (DSP) (Examples: dinoflagellates Dinophysis acuta, D. acuminate, D. caudata, D. fortii, D. norvegica, D. mitra, D. rotundata, D. sacculus, Prorocentrium lima)

· Amnesic shellfish poisoning (ASP) (Examples: diatoms Pseudo-nitzschia australis, P. delicatissima, p. multiseries, P. pseudodelicatissima, P. pungens (some strain), P. seriata)

· Ciguatera fish poisoning (CFP) (Examples: donoflagellate Gambierdiscus toxicus,? Coolia spp.,? Ostreopsis spp.,? Prorocentrim spp.)

· Neurotoxic Shellfish poisoning (NSP) (Examples: dinoflagellate Karenia brevis (Florida), K. papilionacea in editus, K. selliformis in editus, K. bidigitata in editus (New Zealand)

· Cynobacterial toxin poisoning (Examples: cynobacteria Anabaena circinalis (Freshwater) Microcystis aeruginosa (Freshwater), Nodularia spumigena)

· Estuarine associated syndrome (through aerosols from dinoflagellates Pfiesteria piscicida, P. shumwayae)

3. Species that are non-toxic to human but harmful to fish and invertebrates (especiall y in intensive aquaculture systems) by damaging or clogging their gills. Examples: diatoms Cheatoceros concavicorne, C. convolutes; dinoflagellates Karenia mikimotoi, K. brevisulcata, Karlodinium micrum; prymnesiophytes Chrysochromulina polyepis, Prymnesium parvum, P. patelliferum; raphidophytes Heterosigma akashiwo, Chattonella antique, C. marina, C. verruculosa.

Materials and methods

Sampling locations

Phytoplankton sampling was carried out monthly from eight sampling stations in Sg. Jarum Mas,

Larut-Matang, Perak, (Figure 1) from February to October 2008. Jetty and Station 1 are situated in area with a large population. Stations 2 to station 6 are located in the cockle culture area. While, Station 7 is situated away from the cockle culture areas and open sea area, it was chosen as the control. Roziawati, M.R. & Faazaz, A.L. 128

Figure 1: Sampling stations in this study

Sample collection and analysis

Phytoplankton samples were collected using Van Dorn water sampler for phytoplankton identification and enumeration. For each sample, 2 L of sea water was filtered through 20 µm mesh size plankton net. Samples were taken at 2 m depths. The samples were fixed in Lugol's solution and observations of microalgae were carried out using an inverted microscope (Olympus Model IX71).

Sedgewick Rafter Counting Cell Slide was used to quantify the cells by using a Lieca Compound

Microscope (Lieca, Germany). Toxic phytoplanktons were identified based on several taxonomic manual

(Taylor 1976; Hasle and Syverstsen, 1996; Steidenger and Tangent, 1996).

Results and Discussion

A total of 41 taxa of phytoplankton were documented in this study from Sg. Jarum Mas (Tables 2 and 3). A total of eight potentially harmful microalgae were observed, belonging to two different groups; dinoflagellates (Table 2) and diatoms (Table 3). Fig. 2-9 shows the cell density of each species at eight Potentially Harmful Microalgae From Sg. Jarum Mas 129

sampling station. Alexandrium sp. (Photo 1a), Dinophysis sp. (Photo 1c) and Ceratium furca (Photo 1f) were detected at most of the sampling stations throughout the sampling period.

Alexandrium sp. was observed at each sampling station in April with density ranging from 200-25,000 cells/L and the highest density was recorded at station 2. Alexandrium sp. was not found in September in any station except at station 7 at a density of ~35 cells/L. Several species of this genus have been indicated to produce a number of neurotoxins, which lead to PSP cases in human (Backer et al., 2003). PSP toxins are fast-acting neurotoxins that inhibit transmission of nerve impulse by blocking the sodium channels. These toxins may result in death caused by respiratory arrest within a few minutes to a few hours (Hallegraeff,

2003). At present, PSP is the only HAB-related shellfish poisoning that has been documented in Malaysia.

Death due to eating bivalve 'lokan' (Polymesoda sp.) contaminated with toxic Alexandrium has been reported (Lim et al., 2004) in Tumpat, Kelantan. At least seven species of PSP toxin producers of

Alexandrium sp. are known to be present in Malaysia waters. They are A. minutum in Tumpat and A. tamiyavanichi, A. leei, A. tamarense, A. taylori, A. pervvianum and A. affine in Sebatu Melaka (Usup et al.,

2002; Lim et al., 2005).

Two species of Dinophysis were observed in study i.e. Dinophysis caudata (Figure 3b) and

Dinophysis sp. D. caudata were observed at most of the sampling stations with density ranging from 0-300

Table 2: List of dinoflagellates observed from February to October 2008 Month Species identified F M A M J A S O Stations Alexandrium sp. X X X X X X X X Jetty, 1, 2, 3, 4, 5, 6, 7 Ceratium furca X X X X X X X X Jetty, 1, 2, 3, 4, 5, 6, 7 Dinophysis caudata X X X X X X 1, 2, 3 ,4, 5, 6, 7 Dinophysis sp. X X X X X X X X Jetty, 1 ,2, 3, 4, 5, 6 Akashiwo sanguinea X X 5, 7 Noctiluca scintillans X 7 Prorocentrum sp. X X X X X X X Jetty, 1, 2, 3, 4, 5, 6, 7 Protoperidinium sp. X X X X X X X X Jetty, 1, 2, 3, 4, 5, 6, 7

Roziawati, M.R. & Faazaz, A.L. 130

Table 3: List of diatoms observed from January to October 2008 Month Species identified F M A M J O S O Stations Amphora sp. X 7 Asterionella sp. X X 1, 3, 5, 6 ,7 Bacillaria sp . X X X 1, 5, 7 Bacteriastrum sp. X X X X Jetty, 1, 2, 3, 4, 5, 6, 7 Bellerochea sp. X X 5 Chaetoceros sp. X X X X X X X X Jetty, 1, 2, 3, 5, 6, 7 Corethron sp. X 1 Cosnodiscus sp. X X X X X Jetty, 1, 2, 3, 4, 5, 6, 7 Cylindrotheca sp. X X X X X X Jetty, 1, 2, 3, 4, 5, 6, 7 Ditylum sp. X X X X X X X X Jetty, 1, 2, 3, 4, 5, 6, 7 Eucampia sp. X 5 Guinardia sp. X X X X 1, 2, 3, 4, 5, 6, 7 Gyrosigma sp. X X X X X X X X Jetty, 1, 2, 3, 4, 5, 6, 7 Helicotheca tamensis X 6, 7 Hemiaulus sp. X X X 1, 3, 4, 5, 6, 7 Hylodiscus sp. X 5 Lauderia sp. X X Jetty, 1, 3, 5, 6, 7 Leptocylindrus sp. X X X X X X 1, 2, 3, 4, 5, 6, 7 Lithodemium sp. X X X X X 1, 4, 5, 6 Navicula sp. X X X X X X Jetty, 1, 2, 3, 4, 5, 6, 7 Nitzschia sp. X X X X Jetty, 1, 2, 4, 5, 6, 7 N. longissima X X 1, 5, 6, 7 N. membranacea X X 4, 5, 6 Odontella sp. X X X X X X Jetty, 1, 2, 3, 4, 5, 6, 7 Pleurosigma sp. X X X X X X Jetty, 1, 2, 5, 6, 7 Pseudo nitzschia sp.* X X 2, 3, 5 Rhizosolenia sp. X X X X X X Jetty, 1 ,2, 3, 4, 5, 6, 7 Rhizosolenia setigera X X 1, 2 Skeletonema sp. X X X X X X X X Jetty, 1, 2, 3, 4, 5, 6, 7 Surirella sp. X X X X X X X X Jetty, 1, 2, 3, 4, 5, 7 Synedra sp. X X X Jetty, 1, 2, 4, 5, 6 Thallassionema sp. X X X X X X X X Jetty, 1, 2, 3, 4, 5, 6, 7 Thallassiosira sp. X X X X X X X X Jetty, 1, 2, 3, 4, 5, 6, 7 *Potentially harmful microalgae Potentially Harmful Microalgae From Sg. Jarum Mas 131

Figure 2: The cell density of Alexandrium sp. observed at eight sampling station

Figure 3: The cell density of Dinophysis sp. observed at eight sampling station Roziawati, M.R. & Faazaz, A.L. 132

Figure 4: The cell density of Dinophysis caudata observed at eight sampling station

Figure 5: The cell density of Ceratium furca observed at eight sampling station Potentially Harmful Microalgae From Sg. Jarum Mas 133

Figure 6: The cell density of Prorocentrum sp. observed at eight sampling station

Figure 7: The cell density of Akashiwo sanguinea observed at eight sampling station Roziawati, M.R. & Faazaz, A.L. 134

Figure 8: The cell density of Noctiluca scintillans observed at eight sampling station

Figure 9: The cell density of Pseudo-nitzchia sp. observed at eight sampling station Potentially Harmful Microalgae From Sg. Jarum Mas 135

a b c

d e f

g h

Photo 1: Potentially harmful dinoflagellates. a; Alexandrium sp. b; Dinophysis caudata, c; Dinophysis sp. d; Prorocentrum mican e; Prorocentrum gracile f; Ceratium furca g; Akashiwo sanguinea, h; Noctiluca scintillans

a b

Photo 2: Potentially harmful diatoms a; b; Pseudo-nitzchia sp. Roziawati, M.R. & Faazaz, A.L. 136

cells/L. Dinophysis sp. was observed at all sampling stations except station 7. The highest cell density of

Dinophysis sp. was recorded at station Jetty (~3,000 cells/L). D. caudata is a toxic dinoflagellates, which produce okadaic acid that causes diarrhetic shellfish poisoning (DSP) (Backer et al., 2003). Symptoms of

DSP are very similar to diarrhea caused by bacterial poisoning. In Malaysia, no incidence of DSP has yet been reported. The under reporting of DSP could be due to the difficulty in differentiating whether the poisoning caused by DSP or bacteria. This toxic species may cause harmful effects without forming dense blooms. Concentrations as low as 200 cells/L of D. fortii can cause toxification of shellfish that is enough to affect humans (Yasumoto et al., 1980). In Singapore waters, low concentration of D. caudata may cause persistent low concentrations of DSP toxin in mussels (Holmes et al., 1999).

Several species of Prorocentrum are also known to be toxic. For example, Prorocentrium lima produces okadoic acid which causes DSP. In addition, P. lima has been associated with ciguatera syndrome.

In this survey, two species of Prorocentrium were observed; P. micans (Photo 1d) and P. gracile (Photo 1e).

Cells of P. micans are rounded anteriorly and taper towards the posterior. A distinct apical spine is also present. Prorocentrum gracile on the other hand, has a very robust apical spine and longer in length than P. micans. Prorocentrum micans is common in Malaysian waters and could present at high density (Usup et al., 2002). The highest cell density (~1,800 cell/L) of P. micans was recorded in April 2008 at station 7.

Although these species are known to be non-toxic, they can result in fish mortality when present at high densities. In the year 2002, reddish-brown patches caused by Prorocentrum minimum were observed in the

Straits of Johore. (Usup et al., 2003). Fortunately, no harmful effect was reported.

Ceratium furca (Photo 1f) was detected at most of the sampling stations with density ranging from

0-49,000 cells/L. C. furca are relatively harmless microalgae. They are non-toxic and are required by the aquatic organisms in their food web. However, they may cause red tide if conditions allow for excessive blooming. A high density of C. furca could cause fish and invertebrates mortality due to insufficient oxygen by damaging or clogging their gills rather than causing intoxication or poisoning (Hallegraeff, 2003). In

2007, the Department of Fisheries reported a first red tide event caused by C. furca in Lumut, Perak. Their Potentially Harmful Microalgae From Sg. Jarum Mas 137

effect on fisheries however has not been studied.

Akashiwo sanguinea (Photo 1g) was present at stations 5 and 7 in March and at station 4 in August, however at a very low density (~30-200 cells/L). A. sanguinea is among the most common red-tide dinoflagellates in many coastal waters of the world. They form extensive blooms that color the water red and are associated with shellfish and fish kills (Faust and Gulledge, 2002).

Noctiluca scintillans (Photo 1h) was not found in any station except at station 7 in May at a density of ~200 cells/L. The cells are very large (app. 250-300 µm in diameter), balloon-like and subspherical.

Although this species does not produce toxin, it accumulates ammonia in the vacuole, which may be toxic to fish (Taylor et al., 2003). It has also been reported that in the food vacuoles of Noctiluca scintillans containing toxigenic microalgae may act as a vector of phycotoxins to higher trophic levels (Escalera et al.,

2007).

Most of the microalgae species identified during this monitoring were diatoms and most diatoms are not known to be harmful. Of the 33 species of diatoms observed, only one species of potentially harmful diatom, Pseudo-nitzschia sp., was identified (Photo 2a and 2b). The Pseudo-nitzschia at stations 2 (~50 cells/L) and 5 in February (~1,000 cells/L) and at stations 2 (~ 6,000 cells/L), 3 (~400 cells/L) and 5 (~2,600 cells/L) in June. Species of Pseudo-nitszchia form colonies that are characterized by overlapping cells. The genus Pseudo-nitzschia comprises more than 30 taxa of which 11 are associated with production of domoic acid, the agent responsible for amnesic shellfish poisoning (ASP) such as P. multisiries, P. pseudodelicatissima and P. australis (Miller and Scholin, 1998; Lundholm et al., 2003). Domoic acid poisoning was first reported in 1987, where several intoxications including three persons died after eating cultured blue mussels from Prince Edward Island in Canada contaminated with P. multiseries (Bates et al.,

1989). In Malaysia, however no incidence of ASP has yet been reported.

The results from this survey suggest that Sg. Jarum Mas can be considered as potentially area for shellfish farming due to low density cell of potential harmful algae found and no HAB has been reported Roziawati, M.R. & Faazaz, A.L. 138

from this area. However, regular monitoring of phytoplankton should be continued in this area especially at stations Jetty, 1 and 2, which are situated at the narrowest part of Sg. Jarum Mas with the heaviest population on both sides of the riverbanks. Human settlements and the agriculture practices around these areas might be the sources of continuous influx of nutrient (from treated and untreated human wastes, livestock and pets) into the water environment and ultimately may stimulate harmful algae growth. Accordingly, Dinophysis sp. and Alexandrium sp. were present the highest in the stations Jetty, 1 and 2 compared to the other stations.

While in the stations 6 and 7, potentially harmful microalgae were found in low cell density and may be due to the areas which are situated away from human settlements.

Conclusion

Monitoring carried out at eight locations show that potentially toxic Alexandrium sp., Dinophysis caudata, Prorocentrum micans and Pseudo-Nitzchia sp. are quite common in Sg. Jarum Mas, Perak.

Presence of non toxic species such as red tide forms sp. Akashiwo sanguinea, Ceratium furca and Noctiluca scintillans are also noted. Although non-toxic, they may cause red tide or excessive blooming if conditions allow. In the future, identification of species by scanning or transmission electron microscopy could be carried out to confirm the identity of the species. Establishment of laboratory cultures of these potentially toxic is important in order to verify the toxicity of this species. Cockle samples should also be sampled from time to time for marine biotoxins monitoring. Regular monitoring of phytoplankton should be continued in addition with the water quality parameters to better understanding seasonal distribution of these species.

Acknowledgements

The authors would like to thank to Director of Fisheries Research Institute for his kind support.

Thanks are also due to Miss Loh Siok Lian for her assistance in the laboratory and to all supportive staffs in the institute who had helped in samples collection. Potentially Harmful Microalgae From Sg. Jarum Mas 139

References

Anderson, D.M., Andersen, P., Bricelj, V.M.. Cullen, J.J. and Rensel, J.E. 2001. Monitoring and Management Strategies for Harmful Algal Blooms in Coastal Waters, APEC #201-MR-01.1, Asia Pacific Economic Program, Singapore, and Intergovernmental Oceanographic Commission Technical Series No.59, Paris.

Annual Fisheries Statistics 2007 (Volume 1). Department of Fisheries, Ministry of Agriculture Malaysia.

Annual Report Fisheries Research Institute 2007. Fisheries Research Institute, Department of Fisheries, Ministry of Agriculture Malaysia Publishing.

Anton, A., Alexander, J. and Estim, A. 2000. Harmful Algal blooms in Malaysia: Revisiting Kimanis Bay. In: 9th International Conference on Toxic Phytoplankton, Tasmania (Abstract).

Backer, L.C., Fleming L.E., Rowan A.D. and Baden D.G. 2003. Epidemology, public health and human disease associated with harmful marine algae. In: Hallegraeff, G.M. Anderson, D.M. & Cembella, A.D. (Eds.): Manual on Harmful Marine Microalgae. Monographs on oceanic methodology 11, UNESCO Publishing, Paris, pp 723-749.

Choo, P.S. 1994. A review on red tide occurrences in Malaysia. Risalah Perikanan Bil. 60. Department of Fisheries, Ministry of Agriculture Malaysia Publishing.

Faazaz, A.L. and Othman, O. 2002. Observation on the occurrence of a red tide bloom in the Straits of Tebrau, Johor. Paper presented in Fisheries Research Seminar in Kota Bharu, Kelantan.

Hallegraeff, G.M. 2003. Harmful algal blooms: a global overview. In: Hallegraeff, G.M. Anderson, D.M. & Cembella, A.D. (Eds.): Manual on Harmful Marine Microalgae. Monographs on oceanic methodology 11, UNESCO Publishing, Paris, pp 25-45.

Hasle, G. and Syvertsen, E. 1996. Marine Diatoms. In: Identifying Marine diatoms and dinoflagellates. Carmelo R. Tomas (Ed). Academic Press, Inc. San Diego, California, pp. 5-385.

Holmes, J.M., Teo M.L.S, Lee C.F. and Khoo W.H. 1999. Persistent low concentrations of diarrhetic shellfish toxins in green mussels Perna viridis from the Johor Strait, Singapore: first record of diarrhetic shellfish toxins from South-East Asia. Marine Ecology Progress Series 180: 257-268.

Kevin, G.S., Gregory, J.D., Gary, J.K. 2003. Harmful algal blooms: causes, impacts and detection. Journal Industrial Microbiology and Biotechnology 30: 383–406.

Lim, P.T., Liew, C.P. and Usup, G., 2004. First incidence of paralytic shellfish poisoning on the east coast of Peninsular Malaysia. Marine science into the new millennium: New Perspectives & Challenges, Phang et al. (eds.)

Lundholm, N., Moestrup, J., Hasle, G.R and Hoef-Emden, K. 2003. A study of the pseudo-nitzschia pseudodelicatissima/cuspidate complex (bacillariophyceae); What is P. Pseudodelicatissima? Journal Phycology 39: 797-813.

Maria, A. Faust and Rose and A. Gulledge. 2002. Identifying Harmful Marine Dinoflagellates. Smithsonian Institution Contributions from the United States National Herbarium 42:1-144. Roziawati, M.R. & Faazaz, A.L. 140

Mercedes, M. and Esther, G. 2006. Harmful microalgae blooms (HAB); problematic and conditions that induce them. Marine Pollution Bulletin 53: 620–630. Miller, P.E. and Scholin, C.A. 1998. Identification and enumeration of cultured and wild Pseudo-nitzschia (Bacillariophyceae) using species specific LSU rRNA-targeted fluorescent probes and filter- based whole cell hybridization. Journal Phycology 34: 371-382.

Moestrup, O. and Larsen, J. 1992. Potentially toxic phytoplankton. 1. Haptophyceae (Prymnesiophyceae). ICES Identification leaflets for Plankton.

Perl, T.M., Bedard, L., Kosatsky, T., Hockin, J.C., Todd, E.C.D. and Remic, R.S. 1990. An outbreak of toxic encephalopathy caused by eating mussels contaminated with domoic acid. New England Journal of Medicine 322:1775-1780.

Steidinger, K.A. and Tangen, K. 1996. Dinoflagellates. In: C.R. Tomas (Ed). Identifying Marine Phytoplankton, Academic Press, San Diego, pp. 387–584.

Taylor, F.J.R. 1976. Dinoflagellates from the International Indian Ocean Expedition. Bibliotheca Botanica, 132, 222pp. + 46 pls. E. Schweizerbart'scheVerlagsbuchhandlung, Stuttgart.

Taylor, F.J.R and Fukuyo. 1989. Morphological fetures of the motile cell of Pyrodinium bahamense, p. 207- 217. In: G.M. Hallegraeff and J.L. Maclean (Eds). Biology, epidemiology and management of Pyrodinium red tides. ICLARM Conference Proceeding 21, 286 p. Fisheries Department, Ministry of Development, Brunei Darul Salam and International Centre for Living Aquatic Resources Management, Manila, Philippines.

Taylor, F.J.R, Fukuyo, Y., Larsen, J. and Hallegraeff, G.M. 2003. Taxonomy of harmful dinoflagellates. In: G.M. Hallegraeff, D.M. Anderson and A.D. Cembella (eds.), Manual of Harmful Marine Microalgae, Monographs on Oceanic Methodology 11, UNESCO Publishing, Paris, pp. 389- 432.

Usup, G., Asmat A. and Norhadi I. 1989. Pyrodinium bahamense var.compressum red tide studies in Sabah, Malaysia. In: Hallegraeff, G. M. & Maclean, J.L. (Eds.). Biology, Epidemiology and Management of Pyrodinium. Red Tides, pp. 97-110. ICLARM, Manila, Philippines.

Usup, G. and Azanza, R.V. 1998. Physiology and bloom dynamics of the tropical dinoflagellate Pyrodinium bahamense. In: Aderson, D.M., Cembella, A.D., Hallegraeff, G.M. (Eds.), physiological Ecology of Harmful Algal Blooms, vol G41.NATO ASI Series, Springer-Verlag, Berlin- Heidelberg, pp. 81-94.

Usup, G. and Asmat A. 2001. Current status of PSP in Malaysia. Paper presented in Second International Conference in harmful Algae Bloom Management and Mitigation (HAMM) 2001, 12-16 November, Qiangdao, China.

Usup, G., Leaw C.P. and Asmat A. 2002. Increasing important of harmful algal blooms in Malaysia. Omar, R., Ali Rahman, Z., Latiff, M.I., Lihan, I. and Adam J.H. (Eds). Proceedings of the Regional Symposium on Environment and Natural Resources 10-11th April 2002. Hotel Renaissance Kuala Lumpur. 1:144-153.

Usup, G., Leaw C.P., Asmat A. and Lim P.T. 2002. Alexandrium (Dinopyhceae) species in Malaysian waters. Harmful Algae 1:265-275.

Usup, G., Cheah, M.Y., Ng, B.K., Leaw, C.P. and Ahmad, A., 2006. Toxin Profile and Relative Toxicity of Potentially Harmful Microalgae From Sg. Jarum Mas 141

Three Paralytic Shellfish Poisoning Toxin-Producing Dinoflagellates from Malaysia. Malaysian Applied Biology 35(2):41-45.

Wan Norhana, N., Usup, G. and Ismail, I. 2005. Second Incidence of Paralytic Shellfish Poisoning in the Peninsular Malaysia. Malaysian Fisheries Journal 4(2):96-102.

Yasumoto T., Oshima Y., Sugawara W., Fukuyo Y., Pguri H., Igarashi T. and Fujita N.1980. Identification of Dinophysis fortii as Causative Organism of Diarrhetic Shellfish Poisoning. Bulletin of the Japanese Society of Scientific Fisheries 46(11):1405-1411 INSTRUCTION TO AUTHORS

MALAYSIAN FISHERIES JOURNAL

Instructions to Authors

Aims and Scope

The Malaysian Fisheries Journal is a peer-reviewed journal published by Fisheries Research Institute, Malaysia. The journal seeks to provide a forum for dissemination of research in all aspect of fisheries science. Manuscripts describing research work relevant to local communities are most welcome to aid in the advancement of sustainable fisheries.

Submission of Papers

A paper is considered for publication on the understanding that :

• It reports original unpublished work • It is approved by all named authors • It does not contain tables and figures that have been published elsewhere • All acceptable manuscripts will be reviewed by the Publication Committee • A digital copy of the text will be requested if the manuscripts has been accepted

Manuscripts should be sent to :

The Chief Editor Malaysian Fisheries Journal (MFJ) Fisheries Research Institute, 11960 Batu Maung, Penang, MALAYSIA.

Phone: +60-4-626 3925 Fax: +60-4-626 2210 +60-4-626 3926

Email: [email protected]

Different type of Submission

1. Full length paper

These should described new and carefully confirmed findings and experimental procedures should be given in sufficient detail for others to verify work. The length of a full paper should be the minimum required to describe and interpret the work clearly. The paper should comprise the following sections : (a) Abstract; (b) Instruction; (c) Materials and Methods; (d) Results; (e) Discussion: (f) Acknowledgments; (g) References; (h) Tables; (i) Legends to figures; (j) Figures. The results and discussion section may be combined.

2. Short Communication

A Short Communication is suitable for recording the results of complete small investigation or giving details of new methods, techniques or apparatus. The style of main sections need not conform to that of full length papers. Progress reports are not acceptable. 3. Short Notes

Short Notes are not printed page in length. They are suitable for reports of simple findings such as properties of an already well-described enzyme or of observations nor requiring elaboration. They should be written with a short summary, with no main sub-division, may contain one table or figure, or two if the text is brief and no more than three reference.

4. Technical Communications

These are reports of processes of procedures which may be published as an annex to a full length of paper or on their own provided that the work is of sufficient interests to other workers in the field.

References

In the text, references should be cites as: Smith (1993) or (Smith, 1993). Two authors as : Smith and Brown (1993) or (Smith and Brown, 1993). Three or more authors as: Smith et al.(1993) or (Smith et al., 1993). A series of references should be appear in chronological order, e.g. White and Black 1991; Black and White 1992. References to papers by the same authors in the same year are distinguished by letter a, b, etc., (e.g. 1989a, or 1991a,b). Publications having no obvious authors are cites as Anon. (year) in the text and bibliography. References to grey literature such as in-house reports, contract reports and non refereed papers are not appropriate and should be avoid. At the end of papers, references are listed alphabetically. References with three or more authors should be placed in chronological order after taking into account of the names of the first and second authors. The authors must ensure that reference cited in the text agree with those listed in the bibliography. Some sample reference styles as follow: a. In Journals : Sequence of citation: author's name, initials (for each author), year of publication, full title of paper, name of journal (abbreviated in acccordance with the Bibliographic Guide), volume: (bold), first page no. last page no.

Example: Saha, B.C. and Zeikus, J.G. 1989. Improve method for preparing high maltose conversion syrup. Biotechnology and Bioenginnering 34: 299-303. b. In Books: Sequence of citation: author's or editor's name, initial, year of publication, book title, publisher, place of publication. Example: Primrose, G.B. 1987. Modern biotechnology. Blackwell Scientific, Oxford. c. Composite works of serials: Sequence of citation: author's name, initials, year of publication, article title, publisher, publication title, date, place of publication, first and last page no. Example: Jantrarotai, W. and Jantrarotai, P. 1993. On-farm feed preparation and feeding strategies for catfish and snakehead. In: M.B. New, A.G.J. Tacon and Csavas (eds.). Farm- made aquafeeds proceedings of the FAO/AADCP regional expert consultation on farm-made aquafeeds, 14-18 December 1992, Bangkok, Thailand. FAO- RAPA/AADCP. Bangkok, Thailand. 101-119 pp. d. Full publication details must be given for any citation that does not fit into any of the above categories such as unpublished in-house reports, contract reports, etc. Acknowledgements

Briefs of appreciation to whom it is due.

Table

Tables should only be used for data which cannot be described in the text. Type each table double spaced on a separate page and its approximate position in the text indicated by a marginal note. Explanatory footnotes in lower case letters should be concise to enable them to stand independent of the main text. When using percentages, stage the absolute value that corresponds to 100%. Tables are numbered with Arabic numerals.

Figures

Figures should be selected to illustrate points which cannot be easily made in the text. They are numbered with Arabic numerals. Charts and diagrams should be on separate sheets each baring the author's names, short title of paper and figure number on the back. Diagrams must be drawn and lettered in black ink on good quality white paper for camera-ready use. Lettering should be parallel to the axes. Photocopies, hand- drawn diagrams and typewritten labels are not acceptable. Scale marks on charts should be within the axes. Charts should avoid as far as possible large areas of unused space.

Photographs should be well-constrasted black and white prints. For photomicrographs, the magnification should be given a scale (or marker) bar on each photograph and the length this represents given in the legend. Photographs of the original material should be submitted for the reviewers scrutiny. Legends for figures should be grouped together and typed with double-spacing on a separate page and not attached to the artwork.

5. Review Papers

These should be centered on current issues that are of interests to all.

Preparation of Manuscripts

Two copies (top copy +1) of each manuscript must be submitted. The paper must be typed with a double spacing throughout, including reference, tables, footnotes, figures legends, etc., on A4 size papers leaving margins of 25mm minimum. Digital copy of the paper should be prepared in Microsoft Words. Headings should be centered, upper case in bold type. Sub-headings should be at center, lower center and in bold type. Sub-sub-headings in italics at left margin. Use font size number 12.

Title Page : i. A concise and informative title unobscured by taxonomic detail ii. A brief running title iii. Name of author(s) iv. Address of institutions(s) where the work was done

Abstract and Keywords

Two abstracts are required : English and Bahasa Malaysia version Provide : 1. No more than 200 words summarizing the main points of the paper 2. Up to six keywords of phrases Materials and Methods

Materials and Methods should be described in sufficient detail to allow the work to be repeated. Specify and describe study site and test animals where appropriate. Sub headings are used to itemize the main parts. References should be used where appropriate to avoid repetition of established methods and techniques. The origin of materials and/ or suppliers of equipment should be named if necessary. Methods of data analysis should be included.

Results and Discussion

The sections may be separated, though authors may find it easier to combine them. Use tables or graphs as appropriate but do not repeat information in the text. The reproducibility of the finding must be clearly stated. Tthe number of times the experiment was conducted, the number of replicate samples, etc., should be stated. Statistical analysis of results must specify the procedure being used with a reference being given. If results are given as a percentage of a control value, the 100% should be given.

Discussion should bring out those essential points from the work, the implications and practical significance of the findings, their limitation and relevance to previous studies. It should not be recapitulation of the results.

Units, Abbreviations and Nomenclature

Use only recommended SI units. Use superscripts presentation (mg ml-1). The correct Latin names of organisms must be used on first mention in the text. A widely recognized and designated common name should be used for subsequent mention.

Digital (Soft Copy) Submission

When a manuscript is returned for revision after acceptance, authors are requested to return with the revised manuscript a digital copy of the text and file name which should be labeled with authors names, manuscript number, name of word processing software used.