Investigating Patterns of Variation in Reproductive Dispersal and Wolbachia Infection in Malagasy Ants (Hymenoptera: Formicidae)

Fiona J. Tsoi

A Thesis presented to The University of Guelph

In partial fulfilment of requirements for the degree of Master of Science in Integrative Biology

Guelph, Ontario, Canada

ABSTRACT

INVESTIGATING PATTERNS OF VARIATION IN REPRODUCTIVE DISPERSAL AND WOLBACHIA INFECTION IN MALAGASY ANTS (HYMENOPTERA: FORMICIDAE)

Fiona J. Tsoi Advisor: University of Guelph, 2013 Professor M. A. Smith

I examined patterns of variation in queen dispersal state and Wolbachia infection in

Malagasy ants. My first study compared intraspecific genetic divergence between reproductive dispersal states. Using calculations of isolation by distance (IBD), all species with ergatoid

(wingless) queens exhibited IBD as a result of short distance dispersal. The majority of species possessing alate (winged) queens also exhibited IBD despite their ability to travel farther distances. Alate body size was hypothesized to influence IBD, but this was not supported and requires further investigation. My second study investigated the prevalence of Wolbachia, a genus of endosymbiotic bacteria, in ants. Overall, 61.67% of species were infected and no correlation was observed between infection and ant queen dispersal state. Furthermore, DNA extracted from somatic tissue did not underestimate Wolbachia detection as was previously thought. Dispersal and Wolbachia infection influence reproductive outcomes in ants and are important factors for future investigations of genetic diversity.

Acknowledgements

Firstly, I would like to thank my advisor Dr. Alex Smith for his patience, guidance and encouragement throughout this entire process. Thank you for opening the world of ants and Wolbachia to me. I truly appreciate the last minute meetings, rapid feedback and for always providing a different perspective to my ideas. I would also like to thank my committee members Dr. Teresa Crease and Dr. Brian Fisher for their support and expert advice. Dr. Crease, thank you for your insightful ideas and for your valuable administrative advice for completing graduate school. Brian, thank you for sharing your knowledge and passion for ants with me. As well, I would like to thank Brian and other members of the California Academy of Sciences for hosting me during my visit and for allowing me to access their extensive Madagascar ant collection. I would like to thank the Biodiversity Institute of Ontario (BIO) for their assistance with retrieving archived DNA extracts, hitpicking and sequencing. Additionally, I would like to thank the Genomics Facility for their assistance with sequencing and for their patience and efficiency with high volume submissions. A special thanks to all past and present members of the Adamowicz, Crease, Hajibabaei, Smith and Gregory labs for their advice and reassurance that everything out of the ordinary was really quite ordinary in graduate school. I appreciate the breaks and distractions from hectic life in the lab and the office. Most importantly to my family, thank you so much for your unwavering emotional support and patience throughout this time. To Bradley, thank you for your continuous optimism and encouragement. I am extremely grateful for your support. Field work in this project was supported by a National Geographic grant (no. 8429-08) and a National Science Foundation grant (no. DEB-0072713, DEB-0344731 to BLF and DEB- 0842395 to BLF and MAS). Research was supported by the Natural Sciences and Engineering Research Council of Canada (NSERC) Discovery and Research Tools and Instruments Grants and a Leaders Opportunity Fund (LOR) from the Canada Foundation for Innovation (CFI) to MAS.

iii

Table of Contents Abstract ...... ii Acknowledgements ...... iii List of Tables ...... vi List of Figures ...... vii Chapter 1: Introduction ...... 1 Overview of Ants ...... 1 Overview of Madagascar ...... 2 The Role of DNA Barcoding ...... 2 Genetic Variation and Dispersal ...... 3 Wolbachia and Ants ...... 4 Chapter 2: Patterns of Intraspecific Variation as Influenced by Dispersal in Malagasy Ants ...... 6 Abstract ...... 6 Introduction ...... 7 Female Reproductive Dispersal and Nest Establishment ...... 8 Characterizing Ant Reproduction: From Morphology to Markers ...... 10 Objective of Study ...... 13 Methods ...... 14 Taxon Sampling ...... 14 Molecular Analyses ...... 15 Isolation-By-Distance...... 16 Alate Body Measurements ...... 18 Results ...... 18 Among-Genera Comparisons of IBD ...... 18 Species-Specific Comparisons of IBD ...... 19 Alate Body Size Measurements ...... 22 Discussion ...... 22 Ergatoid vs. Alate Comparisons ...... 23 Unusual Relationships of Geographic vs. Genetic Distance ...... 23 Environmental Factors Affecting Variation ...... 25 The Effects of Body Size on Dispersal ...... 25 Conclusions ...... 26 Chapter 3: A Survey of Wolbachia Infection in Malagasy Ants ...... 58 Abstract ...... 58 Introduction ...... 59 What are Wolbachia? ...... 59 Methods of Transmission ...... 59 Endosymbiotic Relationships: Parasitism and Mutualism ...... 61 The Effects of Wolbachia Infection on Host Evolution ...... 62 Detecting Wolbachia ...... 63 Prevalence in Ants ...... 64 Objective of Study ...... 65 Methods ...... 66 Taxon Sampling and Molecular Analyses...... 66 Objective 1: Assessing Wolbachia Infection in Ants ...... 68

Objective 2: Dispersal Strategy and Wolbachia Infection ...... 68 Objective 3: Wolbachia Infection Using Somatic vs. Reproductive Tissue...... 69 Results ...... 69 Objective 1: Assessing Wolbachia Infection in Ants ...... 69 Objective 2: Dispersal Strategy and Wolbachia Infection ...... 71 Objective 3: Wolbachia Infection Using Somatic vs. Reproductive Tissue...... 71 Discussion ...... 71 Estimating the Frequency of Wolbachia Infection in Ants ...... 72 The Diversity of Wolbachia within the Ants ...... 74 Infection is Not Correlated with Dispersal State ...... 74 Wolbachia Detection: A Biological or Methodological Problem? ...... 75 Conclusions ...... 76 Chapter 4: Conclusions and Future Directions...... 92 References ...... 95 Appendix S1: Chapter 2- BOLD Process IDs and Genbank Accession No...... 115 Appendix S2: Chapter 2- Analyses of Isolation by Distance with Disjunct Trends Excluded ...... 171 Appendix S3: Chapter 2- Reexamining Isolation by Distance in Azteca pittieri ...... 178 Appendix S4: Chapter 3- coxA and hcpA BOLD process IDs and Genbank accessions .... 180 Appendix S5: Chapter 3- Wolbachia Prevalence in Formicidae ...... 237 Appendix S6: Chapter 3- Comparison of “PCR” and “Sequence” Rules for Detection of Wolbachia Infection ...... 268 Appendix S7: Chapter 3- coxA and hcpA Allele Identifications ...... 280 Appendix S8: Chapter 3- Investigating Dispersal State and Wolbachia Infection ...... 301

List of Tables

Table 2.1- Ant species with ergatoid and alate female reproductives analyzed for isolation by distance...... 28 Table 2.2- Primers used to amplify the COI gene for the analysis of isolation by distance in ant species...... 32 Table 2.3- Mantel correlations (r) of geographic vs. genetic distance of COI in ant species...... 33 Table 2.4- List of ant species that showed disjunct geographic or disjunct genetic trends...... 36 Table 2.5- List of alate ant queen specimens measured for Weber’s length (mm)...... 37 Table 3.1- Primers used to amplify Wolbachia coxA and hcpA genes in ants...... 78 Table 3.2- Comparing the reliability of ant somatic tissue (leg) vs. reproductive tissue (abdomen) for PCR detection of Wolbachia...... 79

Table S1.1- BOLD process IDs and Genbank accessions for all ants used in Chapter 2...... 115 Table S2.1- Comparison of isolation by distance values between all analyzed ant species (grey) and excluding disjunct trends (white)...... 172 Table S2.2- Comparison of lowest and highest isolation by distance values for each ant genus...... 173 Table S2.3- Welch’s two sample t-test results between mean Mantel correlations (r) in ergatoid and alate species...... 174 Table S4.1- BOLD process IDs and Genbank accessions for sequenced coxA in ants infected with Wolbachia...... 180 Table S4.2- BOLD process IDs and Genbank accessions for sequenced hcpA in ants infected with Wolbachia...... 210 Table S4.3- BOLD process IDs and Genbank accessions for coxA and hcpA in ants infected with Wolbachia...... 236 Table S5.1- A survey of Wolbachia infection in 8 ant subfamilies following the “PCR” rule.. 237 Table S5.2- A survey of Wolbachia infection in 61 ant genera following the “PCR” rule...... 238 Table S5.3- A survey of Wolbachia infection in 1,155 ant species following the “PCR” rule. 240 Table S6.1- Comparison of Wolbachia infection frequency in subfamilies using “PCR” (PCR) and “sequence” (SEQ) rules...... 268 Table S6.2- Comparison of Wolbachia infection frequency in genera using “PCR” (PCR) and “sequence” (SEQ) rules...... 269 Table S6.3- Comparison of Wolbachia infection frequency in species using “PCR” (PCR) and “sequence” (SEQ) rules...... 271 Table S7.1- List of identified coxA and hcpA alleles for species infected with Wolbachia...... 280 Table S8.1- Analyzing if queen dispersal state (alate/ergatoid) corresponds with Wolbachia infection...... 301

List of Figures

Fig. 2.1- A complete ant phylogeny with a summary of general trends of ant reproductive dispersal and colony founding within formicoids and poneroids (phylogeny adapted from Moreau et al. (2006))...... 39 Fig. 2.2- Outlining size dimorphism in thoracic volume between alate and ergatoid queens and their workers...... 40 Fig. 2.3- A summary of ant reproductive dispersal traits and modes of colony foundation...... 41 Fig. 2.4- Predicted relationship between genetic variation and geographic distance between populations having ergatoid and alate reproductive dispersal...... 42 Fig. 2.5- Alate body size is hypothesized to be associated with the strength of correlation between geographic distance and genetic distance (IBD)...... 43 Fig. 2.6- Plots of geographic vs. genetic distance of COI analyzed for isolation by distance in four species of Anochetus...... 44 Fig. 2.7- Plots of geographic vs. genetic distance of COI analyzed for isolation by distance in 19 species of Camponotus...... 45 Fig. 2.8- Plots of geographic vs. genetic distance of COI analyzed for isolation by distance in 7 species of Hypoponera...... 46 Fig. 2.9- Plots of geographic vs. genetic distance of COI analyzed for isolation by distance in 11 species of Leptogenys...... 47 Fig. 2.10- Plot of geographic vs. genetic distance of COI analyzed for isolation by distance in Odontomachus coquereli...... 48 Fig. 2.11- Plots of geographic vs. genetic distance of COI analyzed for isolation by distance in 9 species of Pheidole...... 49 Fig. 2.12- Plots of geographic vs. genetic distance of COI analyzed for isolation by distance in 10 species of Strumigenys...... 50 Fig. 2.13- Plots of geographic vs. genetic distance of COI analyzed for isolation by distance in 10 species of Terataner...... 51 Fig. 2.14- Plots of geographic vs. genetic distance of COI analyzed for isolation by distance in 16 species of Tetramorium...... 52 Fig. 2.15- Significant Mantel correlations (r value) between geographic and genetic distance (isolation by distance) in ant genera...... 53 Fig. 2.16- Comparisons of alate queen body size (assessed with Weber’s length) between analyzed genera...... 54 Fig. 2.17- Weber’s length of ant alate queens (from the genera Anochetus, Camponotus, Hypoponera, Pheidole, Strumigenys, Tetramorium) and r values from significant Mantel correlations of geographic and genetic distance (isolation by distance)...... 55 Fig. 2.18- Weber’s length of alate queens in the ant genus Camponotus and r values from significant Mantel correlations of geographic and genetic distance (isolation by distance)...... 56 Fig. 2.19- Size categories of Weber’s length (mm) in alate queens of ant species (from the genera Anochetus, Camponotus, Hypoponera, Pheidole, Strumigenys, Tetramorium) compared to r values from significant Mantel correlations of geographic and genetic distance (isolation by distance)...... 57 Fig. 3.1- A survey of Wolbachia infection in 8 ant subfamilies...... 80 Fig. 3.2- Ant genera with the three highest and three lowest levels of Wolbachia infection...... 81

vii

Fig. 3.3- Ant species with the three highest and three lowest levels of Wolbachia infection. . .. 82 Fig. 3.4- The distribution of Wolbachia infection in ant species represented by at least 20 individuals...... 83 Fig. 3.5- Comparison of “PCR” and “sequence” rules of Wolbachia infection in surveyed ant subfamilies...... 84 Fig. 3.6- Comparison of “PCR” and “sequence” rules of Wolbachia infection in ant genera with the ten highest infection frequencies (for genera with fewer than 20 individuals)...... 85 Fig. 3.7- Comparison of “PCR” and “sequence” rules of Wolbachia infection in ant species with the ten highest infection frequencies (for species with fewer than 20 individuals)...... 86 Fig. 3.8- Allele distributions for coxA (left) and hcpA (right) in infected ants...... 87 Fig. 3.9- A subset of the COI phylogeny used to calculate NTI (nearest taxon index) in ants surveyed for Wolbachia infection...... 88 Fig. 3.10- The relationship between ant queen dispersal state (alate/ergatoid) and Wolbachia infection...... 89 Fig. 3.11- Individual-level comparisons of Wolbachia detection using DNA from host reproductive tissue (abdomen) and somatic tissue (leg)...... 90 Fig. 3.12- Species-level comparisons of Wolbachia detection using DNA from host reproductive tissue (abdomen) and somatic tissue (leg) within species...... 91

Fig. S2.1- Weber’s length and Mantel correlations of geographic and genetic distance (r value) of ant species with disjunct cases removed...... 175 Fig. S2.2- Camponotus Weber’s length and Mantel correlations of geographic and genetic distance (r value) with disjunct cases removed...... 176 Fig. S2.3- Alate ant queen size categories and Mantel correlations of geographic and genetic distance (r values) with disjunct trends removed...... 177 Fig. S3.1- Plot of COI genetic distance vs. geographic distance in the ant Azteca pittieri...... 179

viii

Chapter 1 Introduction Overview of Ants The ants (Hymenoptera: Formicidae) are a hyperdiverse family of eusocial insects. They comprise 26 extant subfamilies, 429 genera and more than 12,000 described species, which is estimated to be about half the number of ant species in existence (Agosti & Johnson 2005b). Ants form a monophyletic family divided into two major clades: poneroids and formicoids. The poneroids encompass the subfamilies Ponerinae, Amblyponinae, Paraponerinae, Agroecomyrmecinae and Proceratiinae (Brady et al. 2006). The formicoid clade makes up the remaining ant subfamilies that include Myrmicinae and Formicinae (Brady et al. 2006). All ants are descendants of a solitary Vespoid wasp ancestor (Hölldobler & Wilson 1990; Wilson 1987). Ants are a dominant ecological force (Hölldobler & Wilson 1990), ubiquitous in space (Seigo & Katsusuke 1979; Taylor & Wilson 1961; Wilson 1959; Wilson 1976), and abundant in numbers, making up the majority of dry insect biomass in tropical forests (Adis 1988; Fittkau & Klinge 1973). They occupy a diverse range of functional niches as specialist and generalist predators (Risch & Carroll 1982), granivores (Díaz 1992), herbivores (Kelly 1986), parasites (Buschinger 1986) and scavengers (Cerdá et al. 1998). They are involved in large-scale manipulations of their environment through soil turning (Wagner et al. 2004), seed dispersal (Gómez & Espadaler 2013; Hanzawa et al. 1988) and the movement of vegetation (Handel et al. 1981). As well, they have formed mutualistic relationships with a variety of organisms, such as plants, fungi, and other arthropods (Bronstein 1998; Mueller et al. 2001; Way 1963). As one of the most species-rich social insects, ants are the subject of intensive sociobiology studies involving eusociality, altruism and colony and kin selection (Hölldobler & Wilson 1990; Wilson 1985). Ants are also useful for biomonitoring, biological control and conservation studies due to their abundance, ease of collecting and predictability in response to environmental change (Fisher 2005a; Oliver & Beattie 1996; Underwood & Fisher 2006). High species-richness and ecological importance make ants highly valued in conservation management. On the hyperdiverse island of Madagascar, intensive research and documentation of ant fauna has been a priority for many years (Fisher 1996; Fisher 1997, 2003, 2005a; Fisher & Girman 2000; Smith et al. 2005). To date, there are 418 described ant species in Madagascar, of which 379 are endemic

to the island, 14 are native to the island but found elsewhere, and 25 species have been introduced by humans (Fisher 1997, 2003, 2013). However, this inventory is estimated to only be one-third complete. Dominant species-rich ant genera on the island include Pheidole, Crematogaster, Tetramorium, Camponotus and Strumigenys (Fisher 1997).

Overview of Madagascar Madagascar is an internationally recognized biodiversity hotspot containing high numbers of species endemism (Fisher 2005a; Randrianandianina et al. 2003). The first legalized protected area was established in 1927 and the number of areas has since grown to 46 sites (Randrianandianina et al. 2003). Deforestation has decimated the primary forest that was once widespread across the island, affecting 90 % of the total endemic species depending on these habitats of evergreen, dry and mangrove forests (Dufils 2003). Socioeconomic factors such as urban growth and agriculture have resulted in a deforestation rate of 100,000 ha/year (Durbin et al. 2003). Extreme deforestation and habitat destruction has left only remnants of the original landscape that existed prior to human settlement around 1,500-2,000 years ago (Fisher 2005a; Sussman et al. 1996). Up to one-third of Madagascar is burned annually due to cultivation practices, resulting in an increased occurrence of deforestation, soil erosion and habitat fragmentation (Holloway 2003; Kull 2003). As a result of these practices, much of the island is comprised of secondary grassland that has replaced lush, species-rich tropical forest. Prior to 2009, the Malagasy government had implemented long-term conservation plans in Madagascar that included the establishment of a wider range of protected areas. However, political conflict and turmoil in 2009 resulted in a coup d’état and the establishment of a new government (Ranriambololona & Bohannon 2009). Consequently, decrees were passed that legalized the logging of highly endangered rosewood in declared protected areas, particularly in the Marojejy, Masoala and Makira National Parks (Schuurman 2009; Schuurman & Lowry II 2009). Unmanaged, high-volume logging, as well as other illegal activities including the capture of exotic animals for the pet trade, have destroyed the biodiversity that was once protected in those areas (Schuurman & Lowry II 2009).

The Role of DNA Barcoding Given the increasing rate of biodiversity loss, documenting the remaining biodiversity requires a rapid “collaborative taxonomy” that incorporates morphological and molecular-based

approaches (Fisher & Smith 2008). DNA barcoding, which uses a standardized short fragment of a mitochondrial gene (cytochrome c oxidase I (COI)) for species identification and discovery, is a useful molecular tool for taxonomic assessment and analysis (Hebert et al. 2003). To date, DNA barcoding has improved assessments of ant biodiversity in the Malagasy region (e.g. Madagascar (Smith et al. 2005) and Mauritius (Smith & Fisher 2009)), and future efforts to document biodiversity must include this collaborative style of taxonomy to adequately understand these organisms. Linking life history data to taxonomy in this collaborative style can greatly increase the efficiency and value of these assessments. For example, DNA barcoding that complements analyses of morphological and ecological traits have been valuable in identifying cryptic species (Burns et al. 2008; Hebert et al. 2004; Janzen et al. 2009; Smith et al. 2008; Smith et al. 2006). The Barcode of Life Data System (BOLD, www.barcodinglife.org) (Ratnasingham & Hebert 2007) provides a resource of DNA barcodes that facilitates other applications outside of species identification and discovery, such as population genetics, phylogenetics and ecology (Hajibabaei et al. 2007; Valentini et al. 2009). Chapter 2 of my thesis employs DNA barcodes to test patterns of queen dispersal inferred from genetic patterns of variation.

Genetic Variation and Dispersal Reproductive strategies in ants are unique from other eusocial insects in that they can vary across species due to a combination of genetics and environmental factors (e.g. habitat and resource availability) (DeHeer et al. 1999; DeHeer & Tschinkel 1998; Heinze & Buschinger 1989; Heinze & Tsuji 1995; Johnson 2010; Molet et al. 2012; Villet 1989). Variations of reproductive traits and behaviours include independent colony founding/dependent colony founding, alate (winged)/ergatoid (wingless) reproductives, female-calling syndrome/male- aggregation syndrome, polygyny/monogyny, polydomy/monodomy and the presence of intercastes (reproductive workers) (Peeters & Ito 2001). Some reproductive behaviours are associated with others, for example, species with alate males and alate females generally exhibit the male-aggregation mating behaviour. Ecologically similar species also have similar reproductive characteristics. Invasive ant species generally exhibit polydomy (multiple colonies headed by more than one queen), ergatoid queens and dependent colony founding behaviour (Aron 2001; Debout et al. 2007; Holway et al. 2002; Yamaucm & Ogata 1995). As colony success and ultimately, the species’ success, rely on the outcomes of reproduction, the first part

of my thesis (Chapter 2) explores the evolutionary consequences of a major characteristic of ant reproduction: dispersal strategy. Specifically, I asked if genetic patterns of female reproductive dispersal differ between species with alate and ergatoid queens. Differing genetic patterns could potentially be utilized as a tool to classify dispersal state in a species. I used the maternally inherited, mitochondrial COI gene to compare intraspecific variation between ant species using calculations of isolation by distance (IBD). I hypothesized that alate queens travel farther distances than ergatoid queens and are thus expected to show weaker patterns of COI variation. I also investigated if body size facilitates dispersal distance in species with alate queens, where larger body size was predicted to allow farther travel across natural barriers and smaller body size was predicted to impede dispersal across large barriers such as rivers or mountains.

Wolbachia and Ants Chapter 3 of my thesis focuses on Wolbachia, another potential influence on genetic variation in ants. Wolbachia are endosymbiotic bacteria found in high prevalence across arthropods and nematodes. In general, they have relationships that range from mutualistic in nematodes to parasitic in arthropods (Fenn & Blaxter 2004; Saridaki & Bourtzis 2010). In arthropods, Wolbachia are capable of distorting sex ratios and causing mating incompatibility between strains (Stouthamer et al. 1999; Werren 1997). Possible evolutionary outcomes associated with this relationship include confounding host mitochondrial DNA differentiation (Hurst & Jiggins 2005), speciation, and extinction of the host (Charlat et al. 2003; Telschow et al. 2007). Knowing the extent of Wolbachia prevalence in ants is a first requirement necessary to comprehend the evolutionary patterns related to Wolbachia infection. In Chapter 3, I estimated Wolbachia infection frequency in Malagasy ants and compared it to a previous meta-analysis conducted by Russell (2012). I expected to see similar Wolbachia prevalence in my estimate and the meta-analysis. Secondly, I related the prevalence of Wolbachia infection to ant reproductive dispersal strategies. I hypothesized that ergatoids would have a higher prevalence of Wolbachia compared to alates due to decreased dispersal capacity and therefore, a decreased likelihood of mating incompatibility in a localized area. I also assessed a method of Wolbachia detection by testing the expectation that Wolbachia prevalence is more accurately detected in host reproductive tissues, rather than somatic tissues. Since Wolbachia is distributed among both host somatic and reproductive tissue (Cheng et al. 2000; Dobson et al. 1999; Min & Benzer 1997; Saridaki & Bourtzis 2010; Shoemaker et al. 2000; Van

Borm et al. 2001), I predicted that using somatic tissue to detect Wolbachia would be equally reliable to using reproductive tissue.

Chapter 2 Patterns of Intraspecific Variation as Influenced by Dispersal in Malagasy Ants

Abstract In the ants (Hymenoptera: Formicidae), the female reproductive caste is generally winged (alate) or wingless (ergatoid). Dispersal can influence the genetic divergence within species that produce alate queens vs. species that produce ergatoid queens. In this study, I investigated the relationship between genetic divergence and female reproductive dispersal in nine genera of Madagascar ants. My objectives were to compare estimates of isolation by distance (IBD) between species with alate and ergatoid dispersal, and to determine if IBD can be effective in classifying reproductive dispersal strategy. Since ergatoid reproductives disperse terrestrially, they will have lower dispersal ability than alate queens that disperse by flying. Therefore, I predicted that ergatoids will exhibit IBD, while alates will exhibit no, or weaker, patterns of IBD. I further hypothesized that increasing body size in alates could positively influence dispersal distance. While species with ergatoid reproductives exhibited significant, positive IBD, species with alate reproductives also exhibited significant IBD in the majority of cases, a finding perhaps influenced by comparing populations spread over hundreds of kilometers. Due to a large overlap of IBD values between alates and ergatoids, my measure of IBD cannot be effective for classifying dispersal state in ants. Body size of alates and IBD values were negatively related, but this relationship was not significant. This work provided a foundation for future studies on ant reproductive dispersal and also raises questions of potential cryptic diversity and microendemism in analyzed species.

Introduction Ant reproduction is commonly pictured as a simple process that holds constant across all species (Heinze 2008), but this generalization conceals much variation. Reproduction begins when an alate (winged) queen ant independently establishes a new colony following aerial dispersal and an encounter with an alate male. Although this generalization is representative of a large proportion of species included in ant lineages such as Myrmicinae and Formicinae (Hölldobler & Wilson 1990; Peeters & Ito 2001), ant reproduction is far more variable and complex. In truth, our understanding of reproduction in ants is limited in scope (Heinze & Tsuji 1995; Hölldobler & Wilson 1990; Peeters & Ito 2001). Despite ants being one of the more widely researched families of insects, ant reproductive behaviours remain unknown for most of the 12,000 species that are currently described (Agosti & Johnson 2005a). The variability of reproductive traits and dispersal strategies in ants can produce a multitude of consequences for the colony. Given the small effective population size where mating is restricted to a particular set of individuals (queens and males), any small changes in gene frequencies can lead to large consequences (Crozier & Page 1985; Wright 1931). Therefore, the outcomes of reproduction weigh heavily on the overall success of the colony and on the population as a whole. Reproductive dispersal and colony founding are two major components of ant biology. Dispersal in ants occurs when a reproductive successfully leaves their natal nest prior to/after mating (Peeters & Ito 2001). Dispersal provides opportunities for finding new habitats, escape from local competition and predators, avoidance of inbreeding and the spread of genes (Cronin et al. 2013). Dispersal influences evolution, life histories and populations, thereby affecting a species’ overall distribution, abundance and population structure (Bennetts et al. 2001; DeHeer et al. 1999; Slatkin 1985; Zera & Denno 1997). Consequently, there is a close relationship between dispersal, gene flow and genetic diversity across populations (Slatkin 1985). In ants, dispersal strategies can range from fully winged forms (alates), intermediate winged forms incapable of flight (brachypters) and permanently wingless forms (ergatoids) (Zera & Denno 1997). Tradeoffs between various strategies correspond with an organism’s reproductive success. For example, the possession of wings negatively correlates with fecundity and development as a result of the energetic costs involved in the maintenance of flight and flight structures (Zera & Denno 1997). Wings are costly, but essential for locating distant new habitats and expanding a

population’s distribution especially if resources are limited (Slatkin 1985; Zera & Denno 1997). Selective pressures from ecological dynamics (e.g. habitat patchiness, competition) influence dispersal distance (Murrell et al. 2002). In general, most organisms will disperse over much shorter distances than they are capable and only a small proportion of individuals will disperse over farther distances (Nathan 2006; Slatkin 1985; Slatkin 1987). However, it is this small proportion that maintains the genetic cohesion that bind a species together despite geographic separation (Nathan 2006; Slatkin 1987).

Female Reproductive Dispersal and Nest Establishment Ant reproductives consist of both alate and ergatoid males and females, however, most studies on ant reproduction have placed a greater emphasis on female reproductives than on males (Boomsma et al. 2005; Heinze & Tsuji 1995). This is a classic example of a taxonomic impediment related to the difficult task of assigning morphologically distinct males to a species (Yoshimura & Fisher 2007). Female reproductives exhibit a wide range of morphological and physiological traits specialized to mating behaviour and dispersal strategy (Heinze 2008; Heinze & Tsuji 1995; Hölldobler & Wilson 1990; Peeters & Ito 2001). These traits are in turn associated with colony founding characteristics and colony structure (Heinze & Tsuji 1995; Peeters & Ito 2001). The standard queen caste is morphologically distinct from worker castes in characters such as size and ovariole number (Heinze 2008; Molet et al. 2009; Molet & Peeters 2006; Molet et al. 2007a, b; Molet et al. 2012; Peeters 2012; Peeters et al. 2012; Peeters & Molet 2010a). Typically there is dimorphism in the thoracic volume between queens and workers within the formicoids and reduced dimorphism in the poneroids, which relates to differences in reproductive behaviour (Fig. 2.1).

Dispersal Reproductive dispersal can occur before or after mating, depending on the species and the dispersal strategy involved. Alate females are generally much larger than workers as a result of the enlarged thoracic muscles that power their wings (Hölldobler & Wilson 1990; Peeters & Ito 2001) (Fig. 2.2). Wings enable individuals to disperse much farther distances, sometimes as far as hundreds of kilometers away from their natal nest (Zera & Denno 1997). It is hypothesized that wind provides an advantage that allows alates to fly much farther distances (Vogt et al.

2000). For example, female alates of Solenopsis invicta are only energetically capable of flying under 5 km (Vogt et al. 2000), but individuals have been observed to disperse more than twice as far (Markin et al. 1972). Ergatoid reproductives have reduced thoraces and are more morphologically similar to workers (Hölldobler & Wilson 1990; Peeters & Ito 2001) (Fig. 2.2). Ergatoid dispersal is limited to movement on the ground, which is generally more time-consuming and slower than movement by air (Peeters & Molet 2010b), particularly when there are barriers (e.g. rivers, mountains) present (Peeters & Molet 2010b). Reported dispersal distances in ground travelling species have been recorded to be 0.15 km/year in the invasive Argentine ant Linepithema humile (Suarez et al. 2001), 0.5 km/month in the army ant Eciton burchelli (Franks 1982), and 0.9-31.2 m in Cataglyphis species (Amor et al. 2011; Chéron et al. 2011; Lenoir et al. 1988). While ergatoid female reproductives are most common among poneroids, they have been found in almost every ant subfamily (Peeters 2012) (Fig. 2.1).

Colony Foundation Colony foundation is strongly linked to dispersal strategy and can occur independently or dependently (Fig. 2.3). Independent colony foundation (ICF) occurs when a single, newly-mated queen establishes a nest site and rears her first generation of brood without the help of workers (Cronin et al. 2013; Hölldobler & Wilson 1990; Peeters & Ito 2001). The variations of ICF are claustral founding and semi-claustral founding. Generally speaking, claustral founding is exhibited among the more phylogenetically recent lineages, and semi-claustral founding is more common in basal lineages (Cronin et al. 2013; Hölldobler & Wilson 1990; Peeters 2012; Peeters & Ito 2001) (Fig. 2.1). In claustral founding, the queen seals herself in her nest, never leaves it to forage and raises her first generation of offspring entirely with stored body reserves (Cronin et al. 2013; Hölldobler & Wilson 1990). As wings only serve to disperse individuals and are no longer required after mating, alate females always shed their wings after dispersal and undergo metabolic histolysis of their flight muscles (Peeters & Ito 2001). Metabolic histolysis is thought to have arisen before claustral founding (Haskins 1941; Wheeler & Martínez 1995). In semi-claustral founding, queens are typically smaller in size and do not possess specialized thoracic flight muscles that would act as energy storage (Brown & Bonhoeffer 2003; Peeters & Ito 2001). Queens are forced to venture outside to forage as a consequence and experience much higher mortality rates compared to claustral founding queens (Cronin et al.

2013; Hölldobler & Wilson 1990; Peeters & Ito 2001). Semi-claustral founding is thought to be the ancestral character state in ants (Peeters & Ito 2001) (Fig. 2.1). Dependent colony founding (DCF) encompasses variations called fission and budding and occurs when the queen disperses to a new nest site accompanied by a band of workers (Fig. 2.3). Both methods of dispersal are very distance-limited because queens (winged or wingless) must travel terrestrially with workers (Peeters & Ito 2001; Peeters & Molet 2010b). DCF occurs in all ant subfamilies and has independently evolved multiple times from ICF (Peeters 2012; Peeters & Molet 2010b). Initial help with foraging and brood care by workers greatly lowers mortality rate for queens (Heinze & Tsuji 1995; Peeters & Ito 2001; Peeters & Molet 2010b). DCF is best exemplified among the invasive ant species, such as Pheidole megacephala (big head ant), Solenopsis invicta (fire ant) and Linepithema humile (Argentine ant) (Hölldobler & Wilson 1990; Peeters & Ito 2001). For comprehensive reviews on ant reproductive strategies, refer to Heinze & Tsuji (1995) and Peeters & Ito (2001).

Characterizing Ant Reproduction: From Morphology to Markers A comprehensive assessment of ant reproduction ideally amalgamates more than one form of measurement (Bennetts et al. 2001). Using morphology, physiological and/or molecular methods can allow detailed analyses of historical and present features of all forms of ant reproduction.

Morphology Morphological descriptions of specimens are one way to characterize ant reproduction. Reproductive traits have been documented primarily through collection records and taxonomy reports. Long-term studies in the field and laboratory involving direct observations in species- specific mating behaviours and traits are another way to characterize reproduction and dispersal strategies (e.g. Chéron et al. 2011; Lenoir et al. 1988; Robertson & Villet 1989). These are often descriptive, detailed and supplemented with diagrams or photographs. Mark-recapture methods are common in assessing dispersal distance to allow inference of dispersal behaviour (Lenoir et al. 1988), however, this may be more practical in certain organisms over others (e.g. size constraints) (Bennetts et al. 2001; Bohonak 1999). Inference of dependent colony founding behaviour observed from colony emigration has been proposed as a way to overcome the

difficulties involved with direct observation of rare colony founding events (Bouchet et al. 2013). Direct observations and mark-recapture are reliable methods in determining a species’ reproductive traits and behaviours, but is a difficult approach that is limiting in space and time (Bohonak 1999; Slatkin 1987).

Physiology Physiological measurements are also useful in characterizing ant reproduction and can be an alternative or supplement to long-term field and lab observations. Biochemical analyses of ant cuticular profiles have been used to assess local colony structure in Petalomyrmex phylax (Dalecky et al. 2007). Petalomyrmex phylax is a facultatively polygynous ant capable of exhibiting polygynous (multiple-queen) and monogynous (single-queen) colonies. Varying cuticular signatures among ant populations are associated with nestmate recognition abilities, where workers of polgynous colonies presented lower nestmate recognition abilities compared to those in monogynous colonies (Dalecky et al. 2007). Another method used to assess colony structure is sperm typing, where sperm stored in queen spermatheca is used to measure polygyny, monogyny and kin relatedness within colonies (Fournier et al. 2002; Hardy et al. 2008). Levels of carbohydrates, protein and fat storage in reproductives have also been used as a tool to predict dispersal and colony founding method among species (Keller & Passera 1989; Passera & Keller 1990; Peeters et al. 2012). Nutrient storage patterns differ between species that disperse by air compared to those that travel by ground. High carbohydrate levels in reproductives are required for long-distance dispersal, whereas low levels are associated with ground dispersal (Passera & Keller 1990; Wheeler & Martínez 1995). Males generally have higher carbohydrate levels than female reproductives that are likely due to an earlier dispersal from the nest, resulting in higher fuel requirements (Passera & Keller 1990). Fat storage is only relevant to females exhibiting claustral colony founding and is found at low levels in dependent colony founding females as well as males (Keller & Passera 1989; Peeters et al. 2012). Interestingly, female reproductives that exhibit semi-claustral founding have levels of fat intermediate to those of females establishing claustral and DCF colonies (Keller & Passera 1989). Lastly, storage proteins are thought to be the second major source of amino acids used by claustral colony founding females while histolysis of the wing muscles are the primary source

(Wheeler & Martínez 1995). This is in contrast to semi-claustral species that possess much lower levels of storage proteins (Wheeler & Martínez 1995).

Molecular Methods Population-based studies of gene flow and genetic differentiation using molecular markers have allowed the inference of reproductive characteristics such as dispersal, colony structure, and mating system. A majority of population genetics studies have focused on species of Formica in Europe (Sundström et al. 2005) and have resulted in an extensive knowledge of their varying dispersal patterns and social structure. Genetic differentiation studies among ecologically important species such as the army ant Eciton (Berghoff et al. 2008) and invasive and native populations of Solenopsis invicta (DeHeer et al. 1999; Ross et al. 1997) have provided information on the extent of their sex-biased dispersal and gene flow patterns. Population genetics studies are advantageous as they allow inference of population characteristics such as dispersal distance, gene flow and population structure (Bohonak 1999). They are also particularly useful for species (e.g. invasive species) that have a heavy influence on neighbouring ant populations (and surrounding organisms). Historical population expansions can also be inferred using molecular data (Bohonak 1999; Sundström et al. 2005). Patterns of mitochondrial and nuclear DNA variation are frequently used to assess levels of gene flow in female and male reproductives. Comparisons between uniparental and biparental markers can potentially reveal sex differences in dispersal. Phylogenetic analysis of DNA sequences can also reveal the matrilineal and patrilineal history of populations, which are useful in tracking past colonization events. Distinctions among mitochondrial haplotypes also allow differentiation between monogynous and polygynous colonies within species (Liautard & Keller 2001). For example, in a monogynous colony containing one queen, one mitochondrial haplotype is expected, but in a polygynous colony with multiple unrelated queens, several haplotypes may be present among the workers. A combination of mitochondrial and nuclear sequences can thus create an overall picture of population structure and colonization history (Avise et al. 1987; Pamilo et al. 1997). Microsatellites and minisatellites (short regions of highly variable DNA) and restriction fragment length polymorphisms (RFLPs) (using restriction enzymes to cut DNA at a target sequence) are used commonly in population genetics studies to assess dispersal traits in ants (e.g. Berghoff et al. 2008; Giraud et al. 2000; Ross et al. 1997; Stille & Stille 1993). Genetic

differentiation among species can also be examined using variable DNA sequence markers to measure genetic distance across geographic localities (e.g. Berghoff et al. 2008; Clémencet et al. 2005; Doums et al. 2002; Foitzik et al. 2009; Pringle et al. 2012; Sanetra & Crozier 2003). A molecular marker such as the cytochrome c oxidase I (COI) gene has the potential for easy and efficient assessments of genetic variation as caused by dispersal (Pamilo et al. 1997).

Objective of Study [For the sake of clarity, I have referred to species that produce female ergatoid reproductives as “ergatoid species”, and species that produce female alate reproductives as “alate species”.] As collection efforts increase to document our fragile biodiversity, there is an increasingly large proportion of species for which reproductive traits are still unknown. Breeding system can have a major influence on genetic divergence, and understanding this relationship can provide further insight into the complexities of ant reproduction (Pamilo et al. 1997; Ross 2001). Using the vast resource of COI sequences available for Madagascar ants on the Barcode of Life Data System (BOLD) (Ratnasingham & Hebert 2007), I focused my study on female reproductive dispersal in multiple genera. I asked how female reproductive dispersal influences the geographic spread of a maternally inherited, mitochondrial gene in species with ergatoid reproductives versus species with alate reproductives. My objective was to compare intraspecific COI variation in species with different dispersal states using measurements of isolation by distance (IBD), and to determine if IBD is effective in classifying reproductive dispersal. IBD is defined as increasing genetic differentiation between populations as a result of increasing geographic distance (Wright 1943). Ergatoid reproductives disperse terrestrially, whereas alates are more efficient aerial dispersers over space and time. Dispersal methods will result in differing levels of intraspecific variation, especially at a large geographic scale. If species with ergatoid queens have lower dispersal capacity than species with alate queens, then ergatoid species are expected to exhibit significant IBD, meaning higher genetic variation is seen between isolated populations (Fig. 2.4). If species with alate queens have a higher dispersal capacity than ergatoids, then alate species are expected to exhibit no pattern or significantly weak patterns of IBD as a result of increased frequency of gene flow between physically disjunct, but apparently connected populations (Fig. 2.4). In addition, despite farther dispersal in alates, varying strengths of significant IBD may be reflected by body size, which may correspond with the ability to navigate through natural

barriers. In alate species that exhibit significant IBD, if larger body size permits greater successful dispersal, then species with larger body sizes will exhibit weaker patterns of IBD, but species with smaller body sizes will exhibit relatively stronger patterns of IBD similar to ergatoid reproductives (Fig. 2.5). This is the first large-scale study of female reproductive dispersal that compares COI variation over multiple ant species and genera.

Methods Taxon Sampling A total of 86 species (intraspecific n=9-172) from 9 genera (Anochetus, Camponotus, Hypoponera, Odontomachus, Pheidole, Leptogenys, Strumigenys, Terataner and Tetramorium) were chosen after careful consideration of the available ant collections from which DNA had previously been extracted (Smith & Fisher unpublished) (Table 2.1). Invasive and tramp species were excluded to avoid genetic patterns influenced by human-mediated dispersal (Fisher 2003), and while human activity is also likely to occur with native species, collection events were focused on less disturbed areas of Madagascar and so this variable should be minimized (Fisher 2009). All individual specimens were members of the worker caste. Specimens were selected from many populations over a large geographic range to avoid the pseudoreplication inherent in sequencing multiple individuals from the same colony. The initial categorization of female reproductive state (ergatoid/alate) was made by Brian L. Fisher (California Academy of Sciences, San Francisco, California), based on expert knowledge of the general patterns of species- and genus-specific reproductive morphology and behaviour (personal communications, 2011). These assessments were supplemented with general findings in the literature and morphological evidence of collected reproductives (Table 2.1). A rapid approach to specimen collecting and preliminary taxonomic assessments implemented in Madagascar (Fisher 2005a) has enabled the creation of a large inventory of previously unknown endemic ant species (Fisher 1997; Fisher & Girman 2000). While these inventories have resulted in an increasing number of generic revisions (e.g. Bolton 2000; Bolton & Fisher 2011; Fisher & Smith 2008; Hita Garcia et al. 2010; Yoshimura & Fisher 2007), there remains a paucity of life history information regarding many of these newly discovered species.

Thus, the breeding system classification for species analyzed in this study ought to be seen only as an educated hypothesis.

Molecular Analyses Specimens were derived from collections made by Fisher and colleagues between 1992- 2010 from 313 localities across Madagascar. Ants were identified morphologically to species and assigned accession numbers at the California Academy of Sciences before being point- mounted, tissue sampled and barcoded with the COI gene (Hebert et al. 2003). Total DNA was extracted from a single leg using the NucleoSpin® 96 Tissue kit (Macherey–Nagel Duren, Germany) following the recommended manufacturer’s protocol or Ivanova et al. (2006). DNA extracts were eluted in 30-40 μL dH2O and amplified with the primers LepF1/LepR1 (Table 2.2) to generate a 658 bp amplicon. Specimens that were not successfully amplified using LepF1/R1 were alternatively amplified using the internal primers RonMWASPdeg_t1/LepR1 (Smith et al. 2009) and LepF1/C_ANTMR1D (modified from Smith et al. 2005) (Table 2.2). PCR reactions were carried out in 12.5 μL reaction volumes using 96-well plates containing 0.625 μL of 50 mM

MgCl2, 0.125 μL of 10 μM for each primer, 0.0625 μL of 10 mM dNTPs, 6.25 μL of 10% trehalose, 2 μL of genomic DNA, and 0.06 μL of Platinum® Taq Polymerase polymerase (Invitrogen). The PCR profile was 2 min at 94 °C, five cycles of 40 sec at 94 °C, 40 sec at 45 °C, and 1 min at 72 °C, followed by 36 cycles of 40 sec at 94 °C, 40 sec at 51 °C, and 1 min at 72 °C, with a final step of 5 min at 72 °C. PCR products were visualized using a 2 % agarose E-Gel® 96-well system (Invitrogen). Successfully amplified samples showing clean bands were subsequently sequenced using BigDye v3.1 and resolved on an ABI 3730xl DNA Analyzer (Applied Biosystems) at the Biodiversity Institute of Ontario (Guelph, Ontario). Sequences were edited and assembled using CodonCode Aligner 3.7.1.1 (CodonCode Corporation, Dedham, MA) and aligned using ClustalW (Thompson et al. 1994). Alignments were then checked by eye using BioEdit Alignment Editor 7.0.9.0 (Hall 1999). A neighbor-joining tree (Saitou & Nei 1987) was built using sequence divergence values estimated with the Kimura-2-parameter model (Kimura 1980) to assess potential misidentifications. Individuals that fell outside their species groupings were removed from the rest of the analyses as representing a misidentified or PCR contaminated individual. Sequences were then uploaded onto the Barcode of Life Data System (BOLD) (Ratnasingham & Hebert 2007). For specific specimen and collection details, refer to BOLD process IDs and Genbank accessions in Appendix S1, Table S1.1.

Isolation-By-Distance To test for isolation-by-distance (IBD), Mantel tests (Mantel 1967) were performed to assess the correlation between mitochondrial genetic distance and geographic distance across the island of Madagascar. The Mantel test evaluates the degree of a relationship between two matrices, in this case, genetic distance and geographic distance and produces a correlation (r) between -1 and 1. A significant correlation (r≠0) indicates a non-random association between the variables. When a correlation (r) equals 0, this indicates that the variables are randomly associated. A negative relationship (e.g. increasing geographic distance with decreasing genetic distance) will produce a negative r value, and a positive relationship will produce a positive r value (e.g. increasing geographic distance with increasing genetic distance). The absolute value of r implies the strength of the relationship. Values close to ±1 indicate a strong relationship, while values close to 0 indicate a weak relationship. Only positive correlations indicate IBD. The Mantel test has been commonly used to assess IBD in many ant population genetics studies (Chapuisat et al. 2004; Chapuisat & Crozier 2001; Clémencet et al. 2005; Foitzik et al. 2009; Liautard & Keller 2001; Pringle et al. 2012; Seppa et al. 2006; Seppa et al. 2004; Shoemaker et al. 2006), as well as a diverse range of other organisms including fish (Pogson et al. 2001), snails (Pfenninger et al. 1996) and corals (Maier et al. 2005). Although widely used, the Mantel test has been criticized in the past for its bias towards spatial structure and low statistical power (Guillot & Rousset 2013; Legendre 2000; Legendre & Fortin 2010). Alternative methods, such as nested clade analysis (NCA), which tests for the association between haplotype network distributions and geography (Templeton 2008), or several strategies suggested by Guillot (2013) have been recommended as more appropriate. The specific use of Mantel tests in estimating IBD still needs to be determined, but they can be used to test hypotheses specific to distance (Legendre & Fortin 2010). The Mantel test was chosen for this study because it was an efficient method for broadly comparing correlations of geographic and genetic distance over a large number of species. For measurements of genetic distance, pairwise estimates of base substitutions per nucleotide site for the COI gene were computed with MEGA 5.0 (Tamura et al. 2011) using the K2P model (Kimura 1980). Pairwise geographic distances were estimated using Geographic Distance Matrix Generator v1.2.3 (Ersts). To determine if there is a significant correlation between increasing genetic distance and geographic distance, a simple Mantel test was

performed with 1,000 permutations using the ncf package (Bjornstad 2012) in R v2.15.1 (R Development Core Team 2012). Given the large geographic range considered for each species (e.g. 0-1,400 km in Camponotus christi), it was expected that there would be some positive value of IBD irrespective of reproductive strategy. Therefore, in addition to the presence or absence of a relationship, the strength of the significant IBD correlations was compared between alate and ergatoid reproductive states (Taylor 1990). Ergatoid species were expected to have stronger relationships closer to r=1 and alate species were expected to have weaker relationships closer to r=0. Plots of genetic distance and geographic distance for each species were compared with calculated correlation coefficients to ensure trends were representative of adequate sampling that covered the species’ geographic range. This visualization was a basic method to pinpoint problematic cases where sampling may have resulted in unusually strong correlations. For example, a very strong linear correlation as a result of sampling from only two populations would be an unlikely representation of the species’ true range and more likely to be a methodological sampling error (although we cannot rule out the possibility of truly restricted distributions). Plots of genetic distance and geographic distance were examined to identify cases of discontinuous or “disjunct”, geographic or genetic diversity within a species. A “disjunct” trend is defined as a lack of continuous variability over a genetic or geographic distribution. In other words, there is the presence of a visible gap among genetic distance (x axis) or geographic distance (y axis) measurements. These gaps do not have a specific threshold. Results of geographic vs. genetic distance in Anochetus species (Fig. 2.6) show great examples of a disjunct genetic trend (A. madagascarensis), disjunct geographic distance (A. goodmani) and the absence of a disjunct trend (A. grandidieri). Mean Mantel correlations and standard deviations were compared between alate and ergatoid species. Nonsignificant Mantel correlations, indicating zero correlation between genetic and geographic distance (r=0), were included with significant correlations. Mean Mantel correlations and standard deviations were also compared between genera, and the number of significant correlations of geographic and genetic distance was noted in each. Welch’s two sample t-tests (Welch 1938) were performed using the stats package in R v2.15.1 (R Development Core Team 2012) to determine if there were significant differences in the mean correlations of geographic and genetic distances between alate and ergatoid species. Welch’s t-test is a specific form of the Student’s t-test that does not assume equal variance. In the

presence of unequal or equal variances, the Welch’s t-test is less prone to Type I and Type II error compared to the Student’s t-test (Ruxton 2006). Both Welch’s t-test and Student’s t-test assume a normal distribution of values.

Alate Body Measurements Body size in alate queens was assessed by measuring Weber’s length (the anterior edge of the pronotum to the posterior end of the propodeum) (Weber 1938), using available images of queen specimens from Antweb (www.antweb.org) (Fisher 2013). Weber’s length was measured in profile view using Image J (Schneider et al. 2012), and is considered an appropriate estimate of body size (Geraghty et al. 2007; Weiser & Kaspari 2006). . Species were categorized by size (< 1 mm, < 2 mm, < 3 mm, < 4 mm, < 5 mm, > 5 mm) and matched with their respective Mantel correlation (geographic vs. genetic distance). Pearson’s correlation coefficient was calculated between the Mantel correlation coefficient and body size using R v2.15.1 (R Development Core Team 2012). One-Way ANOVA tests between the Mantel correlation and body size, as well as the Mantel correlation and genus were also calculated in R v2.15.1.

Results Among-Genera Comparisons of IBD As expected, genetic distances over large geographic ranges almost always showed a significant positive correlation indicating IBD (Table 2.3, Fig. 2.6-2.14). See Appendix S2 for matrices of genetic and geographic distance (attached in a separate file). All species with alate reproductives showed cases of nonsignificant and significant relationships of geographic and genetic distance, while all ergatoid species showed significant patterns. Camponotus christi (alate) had the weakest significant correlation of r=0.068 (n=86, p < 0.05), and the strongest correlation was r=0.999 in the ergatoid Anochetus boltoni (n=12, p < 0.05). The majority of cases showed a positive correlation of increasing geographic distance with increasing genetic distance. Mantel correlations ranged greatly within each genus (Fig. 2.15) and mean Mantel correlations between analyzed genera were significantly different from each other (F=3.698, df=8, p < 0.05). Anochetus, Camponotus, Hypoponera, Pheidole, Strumigenys and Tetramorium were classified as having alate female reproductives. Overall, alate species had significant correlations

ranging from r=0.068 in Camponotus christi (n= 86, p < 0.05) to r=0.962 in Pheidole MG145 (n=19, p < 0.05). Species with alate reproductives showed significant IBD in 50/63 taxa (79%) (mean r=0.493 ± 0.236). Alate species without significant IBD were found in 13/63 taxa (21%). Mean Mantel correlations in alate species (with nonsignificant species included) was r=0.374 ± 0.268. The genera Anochetus, Odontmachus, Leptogenys and Terataner were classified as having ergatoid female reproductives (although the Strumigenys classification was intermediate as they are suspected to also include species with functionally ergatoid queens (Fisher, personal communications, 2011)). Ergatoid species had correlations ranging from r=0.336 in Leptogenys JCR25 (n=28, p < 0.05) to r=0.999 in Anochetus boltoni (n=12, p < 0.05) and all showed significant, patterns of IBD (100%) (mean r=0.630 ± 0.192). Welch’s two sample t-tests confirmed significant differences between mean Mantel correlations of ergatoid and alate species (t=4.066, df=34.059, p<0.05). For some plots of genetic distance and geographic distance (Fig. 2.6-2.14), several species with very strong Mantel correlations showed trends characterized by either disjunct geographic (Fig. 2.6, Anochetus goodmani) or genetic distances (Fig. 2.6, Anochetus madagascarensis). These species were suspected to have inaccurate or biased correlations from sparse sampling or a restricted distribution (geographic distance), or evidence of potential cryptic species as a result of high genetic variability (genetic distance). All sampled genera had at least one species with disjunct trends except for Odontomachus (Table 2.4, also see next section). However, it is unknown whether or not these correlations represent true patterns of a species’ distribution, or if it is reflective of sampling efforts. I have included all disjunct cases in my analyses, but see Appendix S2 for results with these cases removed. Results when disjunct cases were excluded were not different from those generated using the full dataset, discussed below.

Species-Specific Comparisons of IBD Anochetus (Ergatoid and Alate) There were four species of Anochetus analyzed (n=12-172 individuals per species) (Fig. 2.6). Distributions were widespread in the alate species A. grandidieri and A. madagascarensis, but limited to the north and/or west side of Madagascar in the ergatoid A. boltoni and A. goodmani. All four species showed significant relationships between geographic distance and genetic distance. Mean Mantel correlation was 0.234 for alate species. Mean Mantel correlation

was 0.850 for ergatoid species. A. madagascarensis had the weakest correlation (r=0.176, p < 0.05), and A. boltoni had the strongest correlation (r=0.999, p < 0.05). Plots of geographic vs. genetic distance for A. boltoni and A. goodmani exhibited disjunct trends reflective of a restricted distribution in ergatoid species. The alate A. madagascarensis showed a genetic disjunct trend that may indicate the occurrence of cryptic species (Fisher & Smith 2008). Camponotus (Alate) Camponotus was the largest genus with 19 species analyzed (n=11-86 individuals per species) (Fig. 2.7). Distributions varied, but mostly occurred along eastern Madagascar. Mean Mantel correlation for all cases was 0.368 ± 0.193. C. christi had the weakest significant relationship (r=0.0685, p < 0.05) and C. hagensii had the strongest relationship (r=0.906, p < 0.05). Seventeen species showed significant relationships between increasing geographic distance and genetic distance and two species showed no IBD. Plots of geographic vs. genetic distance for C. hagensii, C. MG047 and C. mocquerysi exhibited disjunct geographic trends, whereas C. MG005, C. MG053, C. MG054 and C. repens exhibited disjunct genetic trends that likely indicate the presence of cryptic species. Hypoponera (Alate) Seven species of Hypoponera were analyzed (n=11-34 individuals per species) (Fig. 2.8). The majority of species were distributed in eastern Madagascar. Mean Mantel correlation for all significant cases was 0.437 ± 0.194. Significant correlations ranged from 0.348 in H. MG043 (p < 0.05) to 0.884 in H. MG071 (p < 0.05). Six species showed significant correlations between increasing geographic distance and genetic distance and one species showed no evidence of IBD. H. MG067 and H. MG071 exhibit disjunct geographic distributions. Leptogenys (Ergatoid) Eleven species of Leptogenys were analyzed (n=11-46 individuals per species) (Fig. 2.9). Distributions varied, but the majority of species were confined to the north side of Madagascar (northeast, northwest). The mean Mantel correlation was 0.609 ± 0.245 for all cases. L. JCR25 had the weakest correlation (r=0.336, p < 0.05), and L. JCR29 had the strongest correlation (r=0.853, p < 0.05). All 11 species showed significant relationships between geographic distance and genetic distance. The disjunct trend observed in the geographic vs. genetic distance plot for L. JCR21 is likely explained by its restricted distribution in the north, where mountainous terrain

may isolate populations. In L. ridens, a disjunct genetic trend may indicate the presence of cryptic species. Odontomachus (Ergatoid) Only one species of Odontomachus (O. coquereli) was analyzed (n=110 individuals) (Fig. 2.10). The majority of individuals were distributed in the northeast side of Madagascar. There was a significant correlation between geographic distance and genetic distance in O. coquereli (r=0.408, p < 0.05). Pheidole (Alate) Nine species of Pheidole were analyzed (n=10-22 individuals per species) (Fig. 2.11). Distributions were mostly in eastern Madagascar. The mean Mantel correlation was 0.562 ± 0.315 across all cases. P. grallatrix showed the weakest significant correlation (r=0.182, p < 0.05) and P. MG145 had the strongest correlation (r= 0.962, p < 0.05). Eight species showed significant positive relationships between geographic and genetic distance, and one species showed no evidence of IBD. Plots of geographic vs. genetic distance for P. MG145 and P.voeltzkowii are reflective of a limited distribution of only 2-4 populations. Strumigenys (Alate, possibly ergatoid in 1-2 species) Ten species of Strumigenys were analyzed (n=9-23 individuals per species) (Fig. 2.12). The majority of species were distributed in eastern Madagascar. Mean Mantel correlation for all cases was 0.644 ± 0.308. Strumigenys scotti had the weakest significant correlation between genetic distance and geographic distance (r=0.405, p < 0.05) and S. labaris had the strongest relationship (r=0.955, p < 0.05). Nine species showed significant IBD and one species showed no evidence of IBD. Plots of geographic vs. genetic distance for S. grandidieri, S. labaris and S. scotti are representative of scarce sampling or limited distributions. Terataner (Ergatoid) Nine species of Terataner were analyzed (n=10-62 individuals per species) (Fig. 2.13). Distributions were mostly in the north and limited in range relative to other genera. Mean Mantel correlation was 0.754 ± 0.281 for all cases. T. MG19 showed the weakest correlation (r=0.560, p < 0.05), and T. xaltus had the strongest correlation (r=0.996, p < 0.05). All nine species showed evidence of significant IBD. T. MG01, T. MG12, T. MG26 and T. xaltus all had very sparse and limited distributions, however, despite having small geographic ranges (e.g. 2.5 km in T. MG01), patterns of IBD in these cases were very strong.

Tetramorium (Alate) Sixteen species of Tetramorium were analyzed (n=10-59 individuals per species) (Fig. 2.14). Distributions varied, with the majority being widespread across Madagascar or distributed along the east side. Mean Mantel correlation was 0.261 ± 0.265 for all cases. T. MG095 had the weakest significant Mantel correlation (r= 0.249, p<0.05), and T. plesiarum had the strongest correlation (r=0.706, p<0.05). Nine species showed significant IBD, while seven species showed no evidence of IBD. The T. ibycterum plots of geographic vs. genetic distance exhibit a north and south disjunct trend, while T. delagoense, T. electrum and T. sericeiventre exhibit disjunct genetic trends that may indicate potential cryptic species.

Alate Body Size Measurements Camponotus species had the greatest range in body size (C. grandidieri: 1.644 mm to C. gouldi: 8.301 mm) whereas Tetramorium species had the smallest range in body size (T. ibycterum: 0.816 mm to T. sericeiventre: 1.462 mm) (Table 2.5, Fig. 2.16). Camponotus gouldi had the largest overall body size (8.301 mm) and Strumigenys origo had the smallest overall body size (0.591 mm). Weber’s length could not be measured for one specimen of Pheidole oswaldi because the thorax was partially obscured in the single specimen image. While there was a negative relationship between Weber’s length and Mantel correlations (Pearson’s correlation= - 0.134), this was not significant (t =-1.001, df =55, p=0.321) (Fig. 2.17). A positive trend between Camponotus Mantel correlations and Weber’s length was observed (Pearson’s correlation=0.387), but this was also not significant (t=1.921, df=21, p=0.068) (Fig. 2.18). All body size categories (< 1 mm, < 2 mm, < 3 mm, < 4 mm, < 5 mm, > 5mm) had wide ranging Mantel correlations except for < 3 mm and <5 mm. Mean Mantel correlations between size categories were not significantly different (F=2.384, df=5, p=0.051) (Fig. 2.19).

Discussion Female reproductive dispersal can influence the geographic spread of genes between populations. This study aimed to estimate IBD in different dispersal states by comparing correlations of genetic distance and geographic distance. Estimating IBD is a rapid method to compare intraspecific divergence between dispersal states, but the differences found between ergatoid vs. alate dispersal are potentially influenced by a multitude of factors (discussed further

below). However, IBD is useful as a stepping-stone towards future studies on the outcomes of ant reproductive dispersal and for analyses of species whose reproduction characteristics are still unknown.

Ergatoid vs. Alate Comparisons All ergatoid species exhibited significant, IBD, which is higher genetic variation between distant populations, perhaps largely attributable to a limited dispersal capacity. There was still IBD in the majority of cases in alate species, however, this may be caused by comparing populations spread over large geographic ranges. Therefore, ergatoid species exhibit significantly stronger IBD than alates and alate species exhibit little or not IBD was not supported. When comparing differences between mean Mantel correlations in ergatoid vs. alate species, a significant pattern is revealed between differing degrees of COI divergence and dispersal state. However, both alate and ergatoid species have large overlapping ranges of Mantel correlations, and therefore a threshold for categorizing ergatoid or alate states could not be determined. Categorizing dispersal state is complicated by the occurrence of shifts in dispersal state and colony founding mode in some species of ants (Peeters 2012). Fairly recent shifts as a result of selective pressures will not show expected patterns of genetic variation if insufficient time has passed. Dispersal polymorphisms within ant species will also display weaker patterns of divergence compared to trends observed in strict alate or ergatoid species. IBD should serve as a preliminary test for investigating patterns of variation while keeping in mind that exceptions to the rules of reproduction are always possible.

Unusual Relationships of Geographic vs. Genetic Distance Plots of genetic distance and geographic distance were useful in assessing IBD and should always be compared with their Mantel correlations. Plots provided a visual aid that allowed easy discrimination of disjunct geographic or genetic trends. A disjunct trend may be caused by sparse sampling (geographic) or high genetic variation between populations (genetic). Although my definition of “disjunct” is ambiguous without the mention of an objective threshold, my comparison of IBD between dispersal states was not drastically affected by the presence of these trends. Identifying disjunct trends can be useful for exploring further questions of cryptic diversity or endemic distributions in these species.

Cryptic species may also be a contributing factor that would explain the high genetic variation seen in many species, although high variation was not exclusive to cases with disjunct trends (Fisher & Smith 2008). Thirty-two species in this study are provisionally named and so further work is required to determine if these provisional groups represent one species. As these species were sampled over such a large geographic scale, it is also just as likely that cryptic species have yet to be discovered within validated species. It is unknown whether or not sparse sampling resulted in geographically disjunct trends, or if these truly represent the real distribution of a species (Fisher & Smith 2008). Madagascar is known for its high microendemism and high species turnover, where species diversity is highest in the wet tropical forest along eastern Madagascar and lowest in the grasslands that cover the center of the island. (Vences et al. 2009; Wilmé et al. 2006). Numerous cases of ant species endemism occur within Madagascar, where distributions are restricted to specific habitats such as forest type or mountaintops (Alpert 1992; Fisher 2005b, 2009; Fisher & Smith 2008). Microendemism in Madagascar may be caused by IBD as a result of restricted dispersal exhibited by both dispersal states. However, future work is needed to first determine distribution ranges in my analyzed species to separate cases of sparse sampling from true cases of microendemism. If microendemism in Madagascar is high as a result of IBD, places with less microendemism will exhibit lower IBD. In a study by Pringle et al. (2012), IBD was not found among populations of the ant Azteca pittieri distributed along Mexico and Central America using mitochondrial or nuclear gene markers. However, I reanalyzed their COI data at the individual level instead of the population level and found significant IBD (r=0.539, p=0.002) (Appendix S3, Fig. S3.1). As hierarchical population structure can obscure IBD (Meirmans 2012), reanalyzing the data at the individual level instead of the population level minimizes the information lost with population groupings (e.g. minimum and maximum genetic and geographic spread). Caution is also required when interpreting results to ensure that environmental variables (e.g. geographic barriers) are not confounding observed correlations (Meirmans 2012). Although microendemism in Central America is low compared to Madagascar, the patterns I see with A. pittieri, such as widespread geographic distribution and high genetic variation, are also observed in my Madagascar analyses. Future work analyzing areas outside of Madagascar will shed more light on microendemism and IBD.

Environmental Factors Affecting Variation Current and historical biotic and abiotic factors can drive variation between populations and create barriers to gene flow (Pringle et al. 2012; Sobel et al. 2010; Vences et al. 2009). Madagascar has several ecological zones, each with its own specific climate and vegetation. Rivers and mountain massifs in the north, center, and south of the island form physical barriers that can impede dispersal and isolate populations (Vences et al. 2009). For example, north-south population splits in species of Odontomachus and Anochetus are reflective of mountain barriers and these populations are speculated to represent more than one species (Fisher & Smith 2008). Distributions of many ant species, including those from this study, are not typically widespread across Madagascar, although there are some generalists that are capable of adapting to a variety of environments (Fisher 2009). Environmental variables such as habitat fragmentation, high energetic costs of flight due to non-ideal weather conditions (e.g. wind and cold), resource availability and nest site instability can greatly influence dispersal success (Heinze & Tsuji 1995; Johnson 2010). Habitat fragmentation in particular is problematic in Madagascar due to human activity, and can confound our observation of genetic patterns in ants. Invasive and tramp species were excluded from this study for this reason, but human-mediated dispersal can also affect native species and not all observed patterns are necessarily the result of reproductive dispersal. Since Madagascar is particularly impacted by human activity through deforestation and cultivation practices (Dufils 2003; Durbin et al. 2003; Holloway 2003; Kull 2003), it is likely that habitat fragmentation and human transport may have had an influence on observed patterns in this study (Buczkowski 2010; Holway et al. 2002). However, it is important to note that collection events were focused on less disturbed areas of Madagascar (Fisher 2009).

The Effects of Body Size on Dispersal Results indicate that small alates do not disperse like ergatoids and large alates do not have significantly greater dispersal ability than small alates. There were a limited number of queens imaged on Antweb, with only an average of 1 or 2 representatives per species. A limited sample size may have contributed to errors in estimating an accurate average body size, especially if there is geographic variation in body size for widely distributed species. This, compounded with measuring specimen images instead of directly measuring the specimens themselves, may lead to inaccurate estimates of size.

The relationship between body size, dispersal and distribution in insects is not uniform (Gaston & Lawton 1988). Body size does not influence dispersal ability in alate carabid beetles, but flightless beetles did show significantly smaller distribution ranges compared to alate species (Gutiérrez & Menéndez 1997; Juliano 1983). This is contrary to milkweed bugs, where larger body size corresponded with larger flight distance (Dingle et al. 1980). Body size in ants influences the dispersal distance of seeds, where smaller ants disperse seeds shorter distances than larger ants (Gómez & Espadaler 2013). There may be tradeoffs associated between dispersal ability and habitat establishment (Gutiérrez & Menéndez 1997), but it has also been suggested that a combination of behaviour, ecological and physiological traits influences dispersal and species distributions (Dingle et al. 1980; Juliano 1983). As such, knowledge of life history traits is important for further facilitating our understanding of observed IBD trends in ants. For example, Strumigenys is part of the Dacetini tribe that has repeatedly evolved a trap jaw mechanism (Brown & Wilson 1959) and their small body size is a result a feeding specialization on smaller collembolan prey (Brown & Wilson 1959; Gronenberg 1996). Although most Strumigenys species produce alate reproductives, their Mantel correlations were much stronger than those of alates from other species, even surpassing values observed in ergatoid species. The fully ergatoid genus, Leptogenys, are specialized isopod predators with relatively large body sizes (Bolton 1975; Dejean & Evraerts 1997). Despite small distribution ranges, Leptogenys exhibited strong patterns of IBD, especially in mountainous areas in the north (e.g. L. JCR21), where ergatoid reproductives would likely have difficulty travelling. Additional study into specific behaviour, ecological and physiological traits for each of the studied ant species will further clarify the patterns of ant dispersal and IBD that were observed.

Conclusions This study provides a foundation for future work on dispersal and reproductive behaviour in ants (e.g. Fournier et al. 2002; Molet et al. 2009; Ross et al. 1997; Seppa et al. 2004 and others). Studying patterns of intraspecific variation also raises interesting questions about these recently discovered and endemic Madagascar species that are still relatively unknown, for example, the presence of potential cryptic species and if microendemism in Madagascar is a result of restricted dispersal. Explaining the distribution of genetic variation between ergatoid and alate species is complicated, but this is the first large-scale study that compares dispersal

states over multiple species and genera. The objective of this study was to compare the patterns of COI variation between ergatoid and alate species and determine if IBD can effectively classify reproductive dispersal. Patterns of variation observed within species are likely associated with environmental factors such as geographic barriers and ecological traits. Thus, current estimates of IBD are not appropriate in categorizing dispersal state, as the ranges of Mantel correlations for alate and ergatoid species overlap. However, IBD was a basic and rapid test for initial assessments of dispersal in many species and will aid in future ant research. Dispersal, in addition to colony founding, is a major component of ant reproduction. Although dispersal is a short event in a reproductive’s life, the outcomes can have lasting evolutionary consequences.

Table 2.1- Ant species with ergatoid and alate female reproductives analyzed for isolation by distance. Categorization of female reproductive state (alate/ergatoid) was determined by Brian L. Fisher (California Academy of Sciences, San Francisco, California), with additional confirmation from the literature and morphological assessments on Antweb, if available (www.antweb.org) (Fisher 2013).

Specimen Image Subfamily Species n Dispersal State Literature Reference on Antweb Ponerinae Anochetus boltoni 12 Ergatoid (Fisher & Smith 2008; Peeters 2012) Yes Ponerinae Anochetus goodmani 50 Ergatoid (Fisher & Smith 2008; Peeters 2012) Yes Ponerinae Anochetus grandidieri 172 Alate (Fisher & Smith 2008; Peeters 2012) Yes Ponerinae Anochetus madagascarensis 143 Alate (Fisher & Smith 2008; Peeters 2012) Yes Formicinae Camponotus christi 110 Alate (Peeters 2012) Yes Formicinae Camponotus dufouri 86 Alate (Peeters 2012) Yes Formicinae Camponotus echinoploides 40 Alate (Peeters 2012) Yes Formicinae Camponotus gouldi 20 Alate (Peeters 2012) Yes Formicinae Camponotus grandidieri 12 Alate (Peeters 2012) Yes Formicinae Camponotus hagensii 51 Alate (Peeters 2012) Yes Formicinae Camponotus heteroclitus 12 Alate (Peeters 2012) Yes Formicinae Camponotus imitator 29 Alate (Peeters 2012) No Formicinae Camponotus MG002 11 Alate (Peeters 2012) Yes Formicinae Camponotus MG005 35 Alate (Peeters 2012) Yes Formicinae Camponotus MG039 61 Alate (Peeters 2012) Yes Formicinae Camponotus MG047 20 Alate (Peeters 2012) Yes Formicinae Camponotus MG053 15 Alate (Peeters 2012) Yes Formicinae Camponotus MG054 28 Alate (Peeters 2012) Yes Formicinae Camponotus MG059 19 Alate (Peeters 2012) Yes Formicinae Camponotus MG096 12 Alate (Peeters 2012) Yes Formicinae Camponotus mocquerysi 12 Alate (Peeters 2012) Yes Formicinae Camponotus quadrimaculatus 16 Alate (Peeters 2012) Yes Formicinae Camponotus repens 14 Alate (Peeters 2012) Yes Ponerinae Hypoponera MG025 12 Alate (Heinze & Tsuji 1995; Peeters 2012) Yes Ponerinae Hypoponera MG026 17 Alate (Heinze & Tsuji 1995; Peeters 2012) Yes

Specimen Image Subfamily Species n Dispersal State Literature Reference on Antweb Ponerinae Hypoponera MG038 13 Alate (Heinze & Tsuji 1995; Peeters 2012) Yes Ponerinae Hypoponera MG043 34 Alate (Heinze & Tsuji 1995; Peeters 2012) No Ponerinae Hypoponera MG067 14 Alate (Heinze & Tsuji 1995; Peeters 2012) Yes Ponerinae Hypoponera MG071 11 Alate (Heinze & Tsuji 1995; Peeters 2012) Yes Ponerinae Hypoponera MG088 32 Alate (Heinze & Tsuji 1995; Peeters 2012) Yes Ponerinae Leptogenys angusta 30 Ergatoid (Heinze & Tsuji 1995; Peeters 2012) Yes Ponerinae Leptogenys arcirostris 46 Ergatoid (Heinze & Tsuji 1995; Peeters 2012) Yes Ponerinae Leptogenys JCR21 15 Ergatoid (Heinze & Tsuji 1995; Peeters 2012) Yes Ponerinae Leptogenys JCR23 17 Ergatoid (Heinze & Tsuji 1995; Peeters 2012) Yes Ponerinae Leptogenys JCR24 39 Ergatoid (Heinze & Tsuji 1995; Peeters 2012) Yes Ponerinae Leptogenys JCR25 21 Ergatoid (Heinze & Tsuji 1995; Peeters 2012) Yes Ponerinae Leptogenys JCR29 28 Ergatoid (Heinze & Tsuji 1995; Peeters 2012) Yes Ponerinae Leptogenys JCR31 23 Ergatoid (Heinze & Tsuji 1995; Peeters 2012) Yes Ponerinae Leptogenys oswaldi 12 Ergatoid (Heinze & Tsuji 1995; Peeters 2012) No Ponerinae Leptogenys ridens 18 Ergatoid (Heinze & Tsuji 1995; Peeters 2012) No Ponerinae Leptogenys truncatirostris 11 Ergatoid (Heinze & Tsuji 1995; Peeters 2012) No Ponerinae Odontomachus coquereli 27 Ergatoid (Molet et al. 2007a) Yes Myrmicinae Pheidole bessonii 15 Alate (Peeters 2012) Yes Myrmicinae Pheidole grallatrix 20 Alate (Peeters 2012) Yes Myrmicinae Pheidole longispinosa 20 Alate (Peeters 2012) Yes Myrmicinae Pheidole MG126 19 Alate (Peeters 2012) Yes Myrmicinae Pheidole MG145 19 Alate (Peeters 2012) Yes Myrmicinae Pheidole MG154 10 Alate (Peeters 2012) No Myrmicinae Pheidole nemoralis 22 Alate (Peeters 2012) Yes Myrmicinae Pheidole oswaldi 18 Alate (Peeters 2012) Yes Myrmicinae Pheidole voeltzkowii 12 Alate (Peeters 2012) Yes Myrmicinae Strumigenys ampyx 10 Alate (1-2 ergatoid species) (Kaufmann et al. 2003; Peeters 2012) Yes Myrmicinae Strumigenys chilo 17 Alate (1-2 ergatoid species) (Kaufmann et al. 2003; Peeters 2012) Yes Myrmicinae Strumigenys dicomas 19 Alate (1-2 ergatoid species) (Kaufmann et al. 2003; Peeters 2012) Yes

Specimen Image Subfamily Species n Dispersal State Literature Reference on Antweb Myrmicinae Strumigenys grandidieri 23 Alate (1-2 ergatoid species) (Kaufmann et al. 2003; Peeters 2012) Yes Myrmicinae Strumigenys inatos 14 Alate (1-2 ergatoid species) (Kaufmann et al. 2003; Peeters 2012) Yes Myrmicinae Strumigenys labaris 10 Alate (1-2 ergatoid species) (Kaufmann et al. 2003; Peeters 2012) Yes Myrmicinae Strumigenys luca 14 Alate (1-2 ergatoid species) (Kaufmann et al. 2003; Peeters 2012) Yes Myrmicinae Strumigenys origo 14 Alate (1-2 ergatoid species) (Kaufmann et al. 2003; Peeters 2012) Yes Myrmicinae Strumigenys scotti 9 Alate (1-2 ergatoid species) (Kaufmann et al. 2003; Peeters 2012) Yes Myrmicinae Strumigenys vazimba 19 Alate (1-2 ergatoid species) (Kaufmann et al. 2003; Peeters 2012) Yes Myrmicinae Terataner acanthus 17 Ergatoid (Alpert 1992; Peeters 2012) Yes Myrmicinae Terataner alluaudi 62 Ergatoid (Alpert 1992; Peeters 2012) Yes Myrmicinae Terataner MG01 16 Ergatoid (Alpert 1992; Peeters 2012) Yes Myrmicinae Terataner MG12 20 Ergatoid (Alpert 1992; Peeters 2012) Yes Myrmicinae Terataner MG13 26 Ergatoid (Alpert 1992; Peeters 2012) Yes Myrmicinae Terataner MG19 19 Ergatoid (Alpert 1992; Peeters 2012) Yes Myrmicinae Terataner MG24 38 Ergatoid (Alpert 1992; Peeters 2012) Yes Myrmicinae Terataner MG26 10 Ergatoid (Alpert 1992; Peeters 2012) Yes Myrmicinae Terataner xaltus 10 Ergatoid (Alpert 1992; Peeters 2012) Yes Myrmicinae Tetramorium anodontion 13 Alate (Peeters 2012; Schlick-Steiner et al. 2005) Yes Myrmicinae Tetramorium bessonii 25 Alate (Peeters 2012; Schlick-Steiner et al. 2005) Yes Myrmicinae Tetramorium cognatum 10 Alate (Peeters 2012; Schlick-Steiner et al. 2005) Yes Myrmicinae Tetramorium degener 14 Alate (Peeters 2012; Schlick-Steiner et al. 2005) Yes Myrmicinae Tetramorium delagoense 17 Alate (Peeters 2012; Schlick-Steiner et al. 2005) Yes Myrmicinae Tetramorium electrum 13 Alate (Peeters 2012; Schlick-Steiner et al. 2005) Yes Myrmicinae Tetramorium ibycterum 12 Alate (Peeters 2012; Schlick-Steiner et al. 2005) Yes Myrmicinae Tetramorium kelleri 13 Alate (Peeters 2012; Schlick-Steiner et al. 2005) Yes Myrmicinae Tetramorium MG095 15 Alate (Peeters 2012; Schlick-Steiner et al. 2005) Yes Myrmicinae Tetramorium norvigi 19 Alate (Peeters 2012; Schlick-Steiner et al. 2005) Yes Myrmicinae Tetramorium plesiarum 15 Alate (Peeters 2012; Schlick-Steiner et al. 2005) Yes Myrmicinae Tetramorium proximum 18 Alate (Peeters 2012; Schlick-Steiner et al. 2005) Yes Myrmicinae Tetramorium sericeiventre 59 Alate (Peeters 2012; Schlick-Steiner et al. 2005) Yes

Specimen Image Subfamily Species n Dispersal State Literature Reference on Antweb Myrmicinae Tetramorium tosii 14 Alate (Peeters 2012; Schlick-Steiner et al. 2005) Yes Myrmicinae Tetramorium valky 16 Alate (Peeters 2012; Schlick-Steiner et al. 2005) Yes Myrmicinae Tetramorium zenatum 10 Alate (Peeters 2012; Schlick-Steiner et al. 2005) Yes

Table 2.2- Primers used to amplify the COI gene for the analysis of isolation by distance in ant species.

Primer Name Sequence (5’-3’) Gene Reference LepF1 ATTCAACCAATCATAAAGATATTGG COI (Hebert et al. 2004) LepR1 TAAACTTCTGGATGTCCAAAAAATCA COI (Hebert et al. 2004) RonMWASPdeg_t1 TGTAAAACGACGGCCAGTGGWTCWCCWGATATAKCWTTTCC COI Modified by Alex Smith (Simon et al. 1994) C_ANTMR1D (A cocktail of Ronlldeg_R and AMR1deg_R) COI Ronlldeg_R GGRGGRTARAYAGTTCATCCWGTWCC COI Modified by Alex Smith (Simon et al. 1994) AMR1deg_R CAWCCWGTWCCKRMNCCWKCAT COI Modified by Alex Smith (Smith et al. 2005)

Table 2.3- Mantel correlations (r) of geographic vs. genetic distance of COI in ant species. A significant correlation (*) indicates significant isolation by distance in the species. Species highlighted in grey were suspected to have inaccurate correlations due to sparse sampling (geographic disjuncts) or cryptic species (genetic disjuncts). However, it is likely that these represent true patterns of a species’ distribution, so I have included these in my analyses. See Appendix S2 for results with these cases removed.

Subfamily Species n Alate/Ergatoid r p Ponerinae Anochetus boltoni 12 Ergatoid 0.999 0.001* Ponerinae Anochetus goodmani 50 Ergatoid 0.7 0.001* Ponerinae Anochetus grandidieri 172 Alate 0.293 0.001* Ponerinae Anochetus madagascarensis 143 Alate 0.176 0.001* Formicinae Camponotus christi 86 Alate 0.068 0.038* Formicinae Camponotus dufouri 40 Alate 0.224 0.001* Formicinae Camponotus echinoploides 20 Alate -0.025 0.235 Formicinae Camponotus gouldi 12 Alate 0.686 0.002* Formicinae Camponotus grandidieri 51 Alate 0.344 0.001* Formicinae Camponotus hagensii 12 Alate 0.906 0.001* Formicinae Camponotus heteroclitus 29 Alate 0.492 0.001* Formicinae Camponotus imitator 11 Alate 0.592 0.002* Formicinae Camponotus MG002 35 Alate 0.451 0.001* Formicinae Camponotus MG005 61 Alate 0.36 0.001* Formicinae Camponotus MG039 20 Alate 0.307 0.011* Formicinae Camponotus MG047 15 Alate 0.443 0.002* Formicinae Camponotus MG053 28 Alate 0.384 0.001* Formicinae Camponotus MG054 19 Alate 0.455 0.002* Formicinae Camponotus MG059 12 Alate 0.324 0.026* Formicinae Camponotus MG096 12 Alate 0.367 0.027* Formicinae Camponotus mocquerysi 16 Alate 0.29 0.077 Formicinae Camponotus quadrimaculatus 14 Alate 0.595 0.001* Formicinae Camponotus repens 12 Alate -0.034 0.225 Ponerinae Hypoponera MG025 17 Alate 0.425 0.003* Ponerinae Hypoponera MG026 13 Alate 0.173 0.1 Ponerinae Hypoponera MG038 34 Alate 0.633 0.001* Ponerinae Hypoponera MG043 14 Alate 0.348 0.014* Ponerinae Hypoponera MG067 11 Alate 0.196 0.173 Ponerinae Hypoponera MG071 32 Alate 0.884 0.001* Ponerinae Hypoponera MG088 30 Alate 0.364 0.001* Ponerinae Leptogenys angusta 46 Ergatoid 0.51 0.001* Ponerinae Leptogenys arcirostris 15 Ergatoid 0.69 0.001* Ponerinae Leptogenys JCR21 17 Ergatoid 0.708 0.005* Ponerinae Leptogenys JCR23 39 Ergatoid 0.554 0.001* Ponerinae Leptogenys JCR24 21 Ergatoid 0.732 0.001* Ponerinae Leptogenys JCR25 28 Ergatoid 0.336 0.001*

Subfamily Species n Alate/Ergatoid r p Ponerinae Leptogenys JCR29 23 Ergatoid 0.853 0.001* Ponerinae Leptogenys JCR31 12 Ergatoid 0.463 0.008* Ponerinae Leptogenys oswaldi 18 Ergatoid 0.481 0.001* Ponerinae Leptogenys ridens 11 Ergatoid 0.812 0.003* Ponerinae Leptogenys truncatirostris 27 Ergatoid 0.562 0.001* Ponerinae Odontomachus coquereli 110 Ergatoid 0.408 0.001* Myrmicinae Pheidole bessonii 15 Alate 0.744 0.001* Myrmicinae Pheidole grallatrix 20 Alate 0.182 0.039* Myrmicinae Pheidole longispinosa 20 Alate 0.219 0.022* Myrmicinae Pheidole MG126 19 Alate 0.536 0.006* Myrmicinae Pheidole MG145 19 Alate 0.962 0.001* Myrmicinae Pheidole MG154 10 Alate 0.266 0.075 Myrmicinae Pheidole nemoralis 22 Alate 0.358 0.001* Myrmicinae Pheidole oswaldi 18 Alate 0.251 0.013* Myrmicinae Pheidole voeltzkowii 12 Alate 0.608 0.003* Myrmicinae Strumigenys ampyx 10 Alate (1-2 ergatoid species) 0.104 0.149 Myrmicinae Strumigenys chilo 17 Alate (1-2 ergatoid species) 0.879 0.001* Myrmicinae Strumigenys dicomas 19 Alate (1-2 ergatoid species) 0.842 0.001* Myrmicinae Strumigenys grandidieri 23 Alate (1-2 ergatoid species) 0.614 0.003* Myrmicinae Strumigenys inatos 14 Alate (1-2 ergatoid species) 0.611 0.005* Myrmicinae Strumigenys labaris 10 Alate (1-2 ergatoid species) 0.955 0.001* Myrmicinae Strumigenys luca 14 Alate (1-2 ergatoid species) 0.668 0.001* Myrmicinae Strumigenys origo 14 Alate (1-2 ergatoid species) 0.885 0.001* Myrmicinae Strumigenys scotti 9 Alate (1-2 ergatoid species) 0.405 0.038* Myrmicinae Strumigenys vazimba 19 Alate (1-2 ergatoid species) 0.624 0.002* Myrmicinae Terataner acanthus 17 Ergatoid 0.95 0.001* Myrmicinae Terataner alluaudi 62 Ergatoid 0.622 0.001* Myrmicinae Terataner MG01 16 Ergatoid 0.749 0.001* Myrmicinae Terataner MG12 20 Ergatoid 0.916 0.001* Myrmicinae Terataner MG13 26 Ergatoid 0.896 0.001* Myrmicinae Terataner MG19 19 Ergatoid 0.56 0.001* Myrmicinae Terataner MG24 38 Ergatoid 0.839 0.001* Myrmicinae Terataner MG26 10 Ergatoid 0.666 0.019* Myrmicinae Terataner xaltus 10 Ergatoid 0.996 0.002* Myrmicinae Tetramorium anodontion 13 Alate 0.297 0.036* Myrmicinae Tetramorium bessonii 25 Alate 0.303 0.002* Myrmicinae Tetramorium cognatum 10 Alate 0.588 0.008* Myrmicinae Tetramorium degener 14 Alate 0.13 0.109 Myrmicinae Tetramorium delagoense 17 Alate 0.154 0.057 Myrmicinae Tetramorium electrum 13 Alate 0.227 0.075 Myrmicinae Tetramorium ibycterum 12 Alate 0.319 0.024* Myrmicinae Tetramorium kelleri 13 Alate 0.395 0.072

Subfamily Species n Alate/Ergatoid r p Myrmicinae Tetramorium MG095 15 Alate 0.249 0.026* Myrmicinae Tetramorium norvigi 19 Alate 0.415 0.001* Myrmicinae Tetramorium plesiarum 15 Alate 0.706 0.001* Myrmicinae Tetramorium proximum 18 Alate 0.578 0.001* Myrmicinae Tetramorium sericeiventre 59 Alate 0.65 0.001* Myrmicinae Tetramorium tosii 14 Alate 0.213 0.077 Myrmicinae Tetramorium valky 16 Alate 0.055 0.174 Myrmicinae Tetramorium zenatum 10 Alate 0.298 0.063

Table 2.4- List of ant species that showed disjunct geographic or disjunct genetic trends. All genera had at least one species with disjunct trends, except for Odontomachus. Disjunct geographic trends may be due to sparse sampling or may actually represent the true distribution of a species. Disjunct genetic trends may be due to potential cryptic species. All disjunct cases were included in my analyses.

Genus n (species) No. of disjunct trends Species with limited distributions Species with potential cryptics Camponotus 19 7 hagensii, MG047, mocquerysi MG005, MG053, MG054, repens Hypoponera 7 2 MG067, MG071 Leptogenys 11 2 ridens JCR21 Pheidole 9 2 MG145, voeltzkowii Strumigenys 10 3 grandidieri, labaris, scotti Terataner 9 4 MG01, MG12, MG26, xaltus Tetramorium 16 4 delagoense, electrum, sericeiventre electrum, ibycterum Anochetus 4 3 boltoni, goodmani madagascarensis Odontomachus 1 0

Table 2.5- List of alate ant queen specimens measured for Weber’s length (mm). Measurements were taken from downloaded specimen images on Antweb (www.antweb.org) (Fisher 2013).

Species Specimen code Weber's length (mm) r Anochetus grandidieri casent0101098 0.979 0.293 Anochetus grandidieri casent0497583 1.425 0.293 Anochetus madagascarensis casent0104546 1.907 0.176 Anochetus madagascarensis casent0498419 1.925 0.176 Camponotus christi casent0496168 3.469 0.068 Camponotus christi casent0101522 3.691 0.068 Camponotus dufouri casent0121884 5.494 0.224 Camponotus dufouri casent0101679 5.536 0.224 Camponotus dufouri casent0145292 5.937 0.224 Camponotus gouldi casent0122809 5.935 0.686 Camponotus gouldi casent0101493 8.294 0.686 Camponotus gouldi casent0101810 8.301 0.686 Camponotus grandidieri casent0101372 1.644 0.344 Camponotus grandidieri casent0179457 6.403 0.344 Camponotus hagensii casent0191566 5.354 0.906 Camponotus heteroclitus casent0134275 4.365 0.492 Camponotus MG002 casent0491902 3.113 0.451 Camponotus MG002 casent0144931 3.762 0.451 Camponotus MG005 casent0499161 3.186 0.360 Camponotus MG039 casent0409926 2.336 0.307 Camponotus MG047 casent0135816 4.05 0.443 Camponotus MG047 casent0143598 4.054 0.443 Camponotus MG053 casent0499148 4.774 0.384 Camponotus MG054 casent0491675 4.437 0.455 Camponotus MG059 casent0492458 6.427 0.324 Camponotus MG096 casent0076504 4.756 0.367 Camponotus quadrimaculatus casent0102424 4.181 0.595 Hypoponera MG025 casent0136564 0.821 0.425 Hypoponera MG038 casent0127837 1.684 0.633 Hypoponera MG071 casent0145181 1.412 0.884 Hypoponera MG071 casent0060764 1.421 0.884 Hypoponera MG088 casent0144031 1.215 0.364 Pheidole bessonii casent0491664 2.367 0.744 Pheidole grallatrix casent0235112 2.296 0.182 Pheidole longispinosa casent0235139 2.312 0.219 Pheidole longispinosa casent0148995 2.614 0.219 Pheidole longispinosa casent0101420 2.761 0.219 Pheidole longispinosa casent0101657 2.823 0.219 Pheidole MG126 casent0455924 1.861 0.536

Species Specimen code Weber's length (mm) r Pheidole nemoralis casent0152344 1.32 0.358 Pheidole oswaldi casent0151903 2.251 0.251 Pheidole oswaldi casent0101808 n/a 0.251 Pheidole voeltzkowii casent0152308 2.04 0.608 Strumigenys dicomas casent0052908 1.091 0.842 Strumigenys grandidieri casent0101563 1.447 0.614 Strumigenys origo casent0006061 0.591 0.885 Strumigenys vazimba casent0148123 1.337 0.624 Tetramorium cognatum casent0149891 0.951 0.588 Tetramorium cognatum casent0107931 0.968 0.588 Tetramorium cognatum casent0119563 0.981 0.588 Tetramorium cognatum casent0121800 0.995 0.588 Tetramorium cognatum casent0496418 1.06 0.588 Tetramorium ibycterum casent0163920 0.816 0.319 Tetramorium norvigi casent0038403 1.002 0.415 Tetramorium plesiarum casent0134584 1.002 0.706 Tetramorium plesiarum casent0050040 1.324 0.706 Tetramorium sericeiventre casent0143961 1.298 0.650 Tetramorium sericeiventre casent0101997 1.462 0.650

Fig. 2.1- A complete ant phylogeny with a summary of general trends of ant reproductive dispersal and colony founding within formicoids and poneroids (phylogeny adapted from Moreau et al. (2006)). These trends represent the majority of occurrences found in the two clades, however, these are very general categorizations and are not necessarily restricted to each clade.

Fig. 2.2- Outlining size dimorphism in thoracic volume between alate and ergatoid queens and their workers. On the left (circled red), size dimorphism is typically observed between alate queens and workers. Workers have a more simplified and reduced thorax compared to alate thoraces, which are much more enlarged. Alate queen wings are omitted for clarity. On the right (circled blue), a lack of size dimorphism is typically observed between ergatoid queens and their workers. Both ergatoids and workers have simplified thoraces and workers are typically similar in morphology to ergatoid queens. Images are adapted from Peeters & Ito (2001).

Fig. 2.3- A summary of ant reproductive dispersal traits and modes of colony foundation. Alate queens (a) disperse long distances by flying and exhibit independent colony foundation (ICF). Variations of ICF include claustral founding (where queens never leave the nest to forage) and semi-claustral founding (where queens leave the nest to forage). Alternatively, ergatoid queens (b) disperse short distances and may travel alone to perform ICF (semi-claustral founding only), or are accompanied by workers through fission and budding. Fission occurs when a colony separates into two autonomous units to establish new nest sites. Budding occurs when a small proportion of workers and a queen disperse from the main colony. The result of fission or budding is dependent colony founding (DCF), where workers aid the queen in nest establishment, foraging and brood care.

(a) ERGATOID (b) ALATE

IF: Low dispersal capacity IF: High dispersal capacity

THEN: THEN:

G D

G D Geographic Distance Geographic Distance

Fig. 2.4- Predicted relationship between genetic variation and geographic distance between populations having ergatoid and alate reproductive dispersal. (a) Species with ergatoid reproductives are expected to show lower dispersal distance resulting in a significantly positive correlation between genetic and geographic distance. (b) Species with alate reproductives are expected to show higher dispersal distance resulting in little or no correlation between genetic and geographic distance.

t S

Alate body size

Fig. 2.5- Alate body size is hypothesized to be associated with the strength of correlation between geographic distance and genetic distance (IBD). Alates with small body sizes are predicted to exhibit stronger isolation by distance (similar to ergatoids), but alates with larger body sizes are predicted to exhibit weaker correlations because of an increased ability to travel longer distances

Fig. 2.6- Plots of geographic vs. genetic distance of COI analyzed for isolation by distance in four species of Anochetus. Genetic distance between COI sequences was estimated using the K2P model (Kimura 1980). A. boltoni and A. goodmani produce ergatoid queens, while A. grandidieri and A. madagascarensis produce alate queens. Analyzed distributions for each species are shown on the Madagascar map to the right of each plot (map was created using Simplemappr (Shorthouse 2010)). All four species exhibited significant, positive correlations between geographic and genetic distance.

Fig. 2.7- Plots of geographic vs. genetic distance of COI analyzed for isolation by distance in 19 species of Camponotus. Genetic distance between COI sequences was estimated using the K2P model (Kimura 1980). All Camponotus species produce alate queens. Analyzed distributions for each species are shown on the Madagascar map to the right of each plot (map was created using Simplemappr (Shorthouse 2010)). Seventeen species exhibited significant, positive correlations between geographic and genetic distance and two species showed no relationship (C. echinoploides and C. mocquerysi).

Fig. 2.8- Plots of geographic vs. genetic distance of COI analyzed for isolation by distance in 7 species of Hypoponera. COI genetic distance was assessed with the K2P model (Kimura 1980). All Hypoponera species produce alate queens. Analyzed distributions for each species are shown on the Madagascar map to the right of each plot (map was created using Simplemappr (Shorthouse 2010)). Six species exhibited significant, positive trends of geographic and genetic distance and one species showed no relationship (H. MG026).

Fig. 2.9- Plots of geographic vs. genetic distance of COI analyzed for isolation by distance in 11 species of Leptogenys. Genetic distance between COI sequences was estimated using the K2P model (Kimura 1980). All Leptogenys species produce ergatoid queens. Analyzed distributions for each species are shown on the Madagascar map to the right of each plot (map was created using Simplemappr (Shorthouse 2010)). All species exhibited significant, positive correlations of geographic and genetic distance.

Fig. 2.10- Plot of geographic vs. genetic distance of COI analyzed for isolation by distance in Odontomachus coquereli. Genetic distance between COI sequences was estimated using the K2P model (Kimura 1980). O. coquereli produces ergatoid queens. The species distribution is shown on the Madagascar map (map was created using Simplemappr (Shorthouse 2010)). O. coquereli showed a significant correlation between geographic and genetic distance.

Fig. 2.11- Plots of geographic vs. genetic distance of COI analyzed for isolation by distance in 9 species of Pheidole. Genetic distance between COI sequences was estimated using the K2P model (Kimura 1980). All species produce alate queens. Analyzed distributions for each species are shown on the Madagascar map to the right of each plot (map was created using Simplemappr (Shorthouse 2010)). Eight species exhibited significant, positive correlations of geographic and genetic distance and one species did not show a significant trend (P. MG154).

Fig. 2.12- Plots of geographic vs. genetic distance of COI analyzed for isolation by distance in 10 species of Strumigenys. Genetic distance between COI sequences was estimated using the K2P model (Kimura 1980). Strumigenys species produce alate queens, although ergatoid queens may be present in a few species. Analyzed distributions for each species are shown on the Madagascar map to the right of each plot (map was created using Simplemappr (Shorthouse 2010)). Nine species exhibited significant, positive correlations of geographic and genetic distance and one species did not show a significant trend (S. ampyx).

Fig. 2.13- Plots of geographic vs. genetic distance of COI analyzed for isolation by distance in 10 species of Terataner. Genetic distance between COI sequences was estimated using the K2P model (Kimura 1980). All Terataner species produce ergatoid queens. Analyzed distributions for each species are shown on the Madagascar map to the right of each plot (map was created using Simplemappr (Shorthouse 2010)). All species exhibited significant, positive correlations of geographic and genetic distance.

Fig. 2.14- Plots of geographic vs. genetic distance of COI analyzed for isolation by distance in 16 species of Tetramorium. Genetic distance between COI sequences was estimated using the K2P model (Kimura 1980). All Tetramorium species produce alate queens. Analyzed distributions for each species are shown on the Madagascar map to the right of each plot (map was created using Simplemappr (Shorthouse 2010)). Nine species exhibited significant, positive correlations of geographic and genetic distance while seven species showed no evidence of isolation by distance (T. degener, T. delagoense, T. electrum, T. kelleri, T. tosii, T. valky, and T. zenatum).

Fig. 2.15- Significant Mantel correlations (r value) between geographic and genetic distance (isolation by distance) in ant genera. The Mean Mantel correlations for each genus were significantly different from each other (F=3.698, df=8, p<0.05). Only one species of Odontomachus was analyzed.

Fig. 2.16- Comparisons of alate queen body size (assessed with Weber’s length) between analyzed genera. Camponotus gouldi had the largest overall body size of 8.301 mm and Strumigenys origo had the smallest overall body size of 0.591 mm.

Fig. 2.17- Weber’s length of ant alate queens (from the genera Anochetus, Camponotus, Hypoponera, Pheidole, Strumigenys, Tetramorium) and r values from significant Mantel correlations of geographic and genetic distance (isolation by distance). There is a negative relationship between body size and isolation by distance (Pearson’s correlation=-0.134), but it is not significant (t=-1.001, df=55, p=0.387).

Fig. 2.18- Weber’s length of alate queens in the ant genus Camponotus and r values from significant Mantel correlations of geographic and genetic distance (isolation by distance). There is a positive relationship between body size and isolation by distance (Pearson’s correlation=0.387), but this was not significant (t=1.921, df=21, p=0.068).

Fig. 2.19- Size categories of Weber’s length (mm) in alate queens of ant species (from the genera Anochetus, Camponotus, Hypoponera, Pheidole, Strumigenys, Tetramorium) compared to r values from significant Mantel correlations of geographic and genetic distance (isolation by distance). Mean Mantel correlations for each category was borderline significantly different (F=2.384, df=5, p=0.051). (Sample sizes for each category is as follows: < 1 mm: n=8, < 2 mm: n=19, < 3 mm: n=9, < 4 mm: n=5, < 5 mm: n=7, > 5 mm: n=9).

Chapter 3 A Survey of Wolbachia Infection in Malagasy Ants

Abstract Wolbachia are widespread endosymbiotic bacteria known to manipulate host reproduction in arthropods and nematodes. A recent meta-analysis estimated that 34 % of ant species are infected with Wolbachia. Using a more extensive dataset that covers a broad taxonomic and geographic range along with increased intraspecific sampling, this study assessed the prevalence of Wolbachia infection in Malagasy ants. Wolbachia was found in 32.38 % of all surveyed ant species. However, excluding all cases where species were represented by fewer than 20 individuals generated a higher estimate of 61.67 % of prevalence. As under-sampling may have contributed to an underestimation of prevalence in past surveys, I recommend that future studies sample no fewer than 20 individuals per species from widely distributed colonies, using multiple markers and repeated diagnostic surveys to ensure reliable detection of Wolbachia. Instead of the commonly used infected/not infected classification, I suggest describing the extent of infection in species (low, medium and high) to emphasize the various levels of infection in a species. Additionally, I explored a potential link between Wolbachia infection and dispersal state in ant reproductives (ergatoid/alate), as the limited dispersal distances that characterize ergatoids provides a greater chance of same-strain mating compatibility. There was no significant correlation observed, but this may have been due to unequal sample sizes between alates and ergatoids. Finally, there is an expectation that Wolbachia detection using somatic DNA will underestimate Wolbachia infection. However my test comparing somatic and reproductive DNA extracts did not support this. Instead, false positives or false negatives generated by PCR may be a bigger source of error in Wolbachia surveys than the type of DNA used. This study generates a clearer picture of Wolbachia infection in ants and outlines methods to improve future estimates of Wolbachia prevalence.

Introduction What are Wolbachia? Wolbachia is a genus of α-proteobacteria belonging to the order Rickettsiales (Hertig 1936; Hertig & Wolbach 1924; O'Neill et al. 1992). These intracellular bacteria have maintained intricate relationships with a diverse range of hosts including many groups of arthropods (e.g. insects, mites, isopods) and filarial nematodes (Onchocercidae). The phylogeny of Wolbachia is classified into eleven putative supergroups (identified as A-K), where the vast majority belong to the A-D supergroups (Bordenstein et al. 2009; Casiraghi et al. 2005; Lo et al. 2002; Ros et al. 2009). Supergroups A and B occur in arthropods (Werren et al. 1995b), and supergroups C and D occur in filarial nematodes (Bandi et al. 1998). The remaining supergroups are less widespread and are each confined to one insect order (Ros et al. 2009). The exception is supergroup F, which is found in a mix of insect and nematode species (Casiraghi et al. 2005) Although nematodes and Wolbachia share a fascinating mutualistic relationship essential to the hosts’ survival and parasitic lifestyle (André et al. 2002; Chirgwin et al. 2003; Fenn & Blaxter 2004), here I focus on the relationship between Wolbachia and arthropods.

Methods of Transmission Wolbachia reside in host cells and rely specifically on female hosts to propagate. Vertical transmission down a maternal lineage (by residing in the egg cytoplasm) is the primary method of infection, whereas males are considered evolutionary “dead ends”. Incongruences between Wolbachia and host lineages indicate the occurrence of horizontal transmission across phylogentically distant organisms (Frost et al. 2010; Kittayapong et al. 2003; O'Neill et al. 1992; Sintupachee et al. 2006; Werren et al. 1995b). Horizontal transmission is expected to be common between organisms with close ecological interactions, such as predator-prey relationships (Hoy & Jeyaprakash 2005; Kittayapong et al. 2003), parasitoids and their hosts (Frost et al. 2010; Huigens et al. 2004; Kittayapong et al. 2003) and species that share food sources (Huigens et al. 2000; Mitsuhashi et al. 2002; Sintupachee et al. 2006). In order to maximize their reproductive success, Wolbachia are known to “selfishly” manipulate host reproduction. The four mechanisms of such “selfish” reproduction are parthenogenesis, feminization of males, male-killing and cytoplasmic incompatibility. Parthenogenesis occurs when unmated females produce identical female offspring. Wolbachia- induced parthenogenesis has been observed in haplodiploid species: parasitoid wasps

(Stouthamer et al. 1990), mites (Weeks & Breeuwer 2001) and thrips (Arakaki et al. 2001). The mechanism by which Wolbachia-induced parthenogenesis occurs in wasps and thrips is through gamete duplication (resulting in homozygous females) (Stouthamer & Kazmer 1994; Vavre et al. 2004), but in mites, apomictic reproduction is more likely (offspring are heterozygous, but are clones to their mother) (Weeks et al. 2003). Feminization, where males become capable of producing offspring, has been discovered in isopods (Rigaud & Juchault 1993; Rousset et al. 1992), Lepidoptera (Hiroki et al. 2002; Kageyama et al. 2002) and one species of Hemiptera (Negri et al. 2006). In isopods, it has been suggested that Wolbachia interferes with the male gene responsible for androgenic development (Rigaud et al. 1997), however, a mechanism to explain its occurrence within insects is still unknown (Kageyama et al. 2002). Male-killing, the death of all male embryos during development, is not an exclusive characteristic of Wolbachia, but is also caused by other bacteria such as Flavobacteria, Spiroplasma and other Rickettsia spp. (Hurst & Jiggins 2000). Wolbachia-induced male-killing was first reported in a butterfly and ladybird beetle (Hurst et al. 1999), but have since been found in Drosophila (Hurst & Jiggins 2000) and additional Lepidoptera and Coleoptera species (Fialho & Stevens 2000; Fujii et al. 2001; Sasaki et al. 2002). Male-killing is thought to be more phylogenetically widespread than Wolbachia-induced feminization and parthenogenesis because it is not restricted to specific sex- determination systems (Hurst et al. 1999; Hurst et al. 2000). The mechanism of male-killing is not entirely known, but it may be connected with feminization, where infected male embryos develop into females and die (Kageyama & Traut 2004). The most common form of reproductive manipulation is cytoplasmic incompatibility (CI), and it occurs in two variants. In unidirectional incompatibility, there is mating incompatibility between an uninfected female and an infected male, but infected females always produce viable offspring. Another variant of CI is bidirectional incompatibility, where different strains of Wolbachia in a mating pair prevent successful reproduction. CI is widespread across arthropods (e.g. Bourtzis et al. 1996; Breeuwer 1997; Giordano et al. 1995; O'Neill et al. 1992; Vavre et al. 2002). The exact mechanism of CI is unknown, but may involve modification of infected sperm, which is restored upon entering an infected egg (Werren 1997). Several hypotheses to explain such a modification have been proposed, such as the “slow motion” hypothesis, where Wolbachia disrupts synchrony between male and female pronuclei during embryonic development (Poinsot et al. 2003; Presgraves 2000; Tram & Sullivan 2002; Werren 1997). The “lock and key” hypothesis describes a specific “lock”

present in the paternal nucleus that requires a “key” within an infected egg to remove it (Poinsot et al. 2003; Werren 1997). The “titration-restitution” hypothesis proposes that a component of the host chromosome in sperm is removed by Wolbachia and later restored in an infected egg (Poinsot et al. 2003; Werren 1997). The “lock and key” hypothesis is suggested to be the most parsimonious, although no evidence has yet been found to support this model (Poinsot et al. 2003). These four types of reproductive manipulation (parthenogenesis, feminization, male- killing, and CI) are typically observed in infected individuals, however, phenotypic effects of infection can vary, ranging from no effect (Giordano et al. 1995; Turelli & Hoffmann 1995; Vavre et al. 2002), to altered reproductive effects between horizontally- transmitted hosts sharing the same Wolbachia strain (Fujii et al. 2001; Sasaki et al. 2002).

Endosymbiotic Relationships: Parasitism and Mutualism Wolbachia can be parasitic, beneficial and even essential to its host’s survival. In general, Wolbachia share parasitic relationships with arthropods (through reproductive manipulation as described above) and obligate mutualistic relationships with nematodes, although there are exceptions to this rule. In arthropods, any beneficial outcomes from Wolbachia infection are a direct result of host reproductive manipulation. For example, in the flour beetle (Tribolium confusum), male fecundity is higher in infected males than uninfected males, however, this is at the cost of lowered fecundity in infected females compared to uninfected females (Wade & Chang 1995). In populations of Drosophila, infected females show about 10 % higher fecundity than uninfected females (Weeks et al. 2007). Wolbachia have also been found to increase resistance to harmful RNA viruses in Drosophila (Hedges et al. 2008; Teixeira et al. 2008). There is evidence that Wolbachia may also confer nutritional benefits to its host, specifically, by positively influencing iron homeostasis. In Drosophila, low iron diets are compensated by Wolbachia and result in higher female fecundity (Brownlie et al. 2009). High iron diets cause inoxidative stress, but infected females are affected less than uninfected females (Brownlie et al. 2009). Most of these mutual relationships are facultative, therefore no harmful effects to the host are observed after removal of Wolbachia. An unusual case of an obligate relationship occurs in a species of parasitic wasp, Asobara tabida (Hymenoptera: Bracondiae). When Wolbachia infection was cured in infected individuals, females lost the ability to produce eggs, however, the same treatment did not affect reproduction in a closely related species, A. citri (Dedeine et al.

2001). This is indicative of a very specific obligate relationship where the A. tabida females rely on Wolbachia to maintain proper oogenesis (Dedeine et al. 2001; Pannebakker et al. 2007). Wolbachia pipientis is the commonly studied, nonvirulent species that is maternally transmitted in insects, but an extreme case of Wolbachia infection is caused by W. popcorn, a more virulent species that causes death in all infected Drosophila (Min & Benzer 1997). Wolbachia in arthropods are thought to contain ankyrin-repeat motifs (ANK) within their genome that may play a role in manipulating host reproduction, however, in Wolbachia strains associated with nematodes, these ANK genes are absent (Fenn & Blaxter 2006). ANK genes may be characteristic of all parasitic Wolbachia and could explain how Wolbachia can develop variable relationships with their hosts (Fenn & Blaxter 2006).

The Effects of Wolbachia Infection on Host Evolution Wolbachia effects in social Hymenoptera tend to be more pronounced as a result of a smaller effective population size from unequal sex ratios of reproductive males and females (Reuter & Keller 2003; Wenseleers 1998). In ants, cytoplasmic incompatibility is postulated as the major form of host manipulation induced by Wolbachia (Russell 2012; Wenseleers 1998). Wolbachia are capable of providing the host with the slight advantage of higher fecundity and reproductive rates (Bouwma & Shoemaker 2011). Improved host reproduction leads to higher infection frequencies (Russell 2012; Stouthamer et al. 1999). The effects exerted by Wolbachia on its hosts’ reproductive capabilities have profound consequences for host populations. As a result of host maternal transmission, Wolbachia are intimately linked to host mtDNA and can strongly confound assumed neutral patterns of host mitochondrial variation (Hurst & Jiggins 2005; Jiggins 2003). This linkage disequilibrium generates indirect selection of host mtDNA as a result of selection on Wolbachia (Hurst & Jiggins 2005; Jiggins 2003). Often, selective sweeps of Wolbachia entering new uninfected populations result in significantly lowered mtDNA divergence (Armbruster et al. 2003; Charlat et al. 2009; Hurst & Jiggins 2005; Jiggins 2003; Turelli & Hoffmann 1995; Xiao et al. 2012). Wolbachia can also increase mtDNA differentiation among populations as a result of mating incompatibility between strains (Hurst & Jiggins 2005). Interspecific introgression of mtDNA, where mtDNA from one species enters another after hybridization and subsequent transfer of Wolbachia, is another documented method of mtDNA spread that has been observed in the butterflies Acraea encedon and A. encedana (Lepidoptera: Nymphalidae), Nasonia wasps (Hymenoptera: Pteromalidae) and Ceratosolen

solmsi fig wasps (Hymenoptera: Agonidae) (Jiggins 2003; Raychoudhury et al. 2009; Xiao et al. 2012). In Solenopsis ants, low mtDNA divergence associated with Wolbachia infection was not consistent across all tested populations, although it was suggested that a large period of time had passed since a sweep occurred and new mutations have since accumulated (Shoemaker et al. 2003a).

Detecting Wolbachia Wolbachia are incapable of thriving outside a host cell and are thus difficult to grow in cultures (but see Fenollar et al. (2003)). The method most commonly used to detect Wolbachia is the polymerase chain reaction (PCR) of genes such as the 16S ribsosomal RNA gene (16S rDNA) (Arakaki et al. 2001; Bandi et al. 1998; Bourtzis et al. 1996; Cheng et al. 2000; Fujii et al. 2001; Giordano et al. 1995; Hurst et al. 2000; Mitsuhashi et al. 2002), a gene for cell division protein (ftsZ) (Arakaki et al. 2001; Bandi et al. 1998; Breeuwer 1997; Casiraghi et al. 2005; Cheng et al. 2000; Dedeine et al. 2001; Fujii et al. 2001; Hiroki et al. 2002) and/or a gene for outer surface protein (wsp) (Arakaki et al. 2001; Arthofer et al. 2009; Cheng et al. 2000; Frost et al. 2010; Hoy & Jeyaprakash 2005; Jiggins et al. 2001; Mitsuhashi et al. 2002). PCR-RFLP (restriction fragment length polymorphism) and qPCR (quantitative PCR) have been used as additional evidence to confirm infection, identify strains or to detect distribution or density of Wolbachia in tissues (Mitsuhashi et al. 2002; Reuter & Keller 2003; Unckless et al. 2009). Long PCR (Jeyaprakash & Hoy 2000) and High-Resolution Melting (HMR) (Henri & Mouton 2012) are alternative methods of detection that are more sensitive than standard PCR. Microscopy allows direct observation of Wolbachia in host tissues (Casper-Lindley et al. 2011; Hertig & Wolbach 1924; Min & Benzer 1997; Mitsuhashi et al. 2002). The Multilocus Sequence Typing protocol (MLST) was developed by Baldo et al. (2006) as a way to standardize Wolbachia strain identification. MLST uses five housekeeping genes: cytochrome c oxidase I (coxA), conserved hypothetical protein (hcpA), glutamyl-tRNA amidotransferase B (gatB), fructose-bisphosphate aldolase (fbpA) and cell division protein (ftsZ). These five genes are single-copy, spread over the genome, consistently found in Wolbachia, and under strong stabilizing selection (Baldo et al. 2006). Additionally, the wsp gene is included because it had been widely used in Wolbachia strain typing studies before MLST was developed. However, wsp has been shown to undergo strong directional selection and high recombination (Baldo & Werren 2007). The establishment of a public MLST database

(http://pubmlst.org/Wolbachia/) has enabled sequence uploads and downloads by researchers for future analysis. MLST markers provide multiple lines of evidence for Wolbachia detection and strain typing using PCR (Baldo et al. 2006). The MLST approach shares many similarities to the DNA barcoding initiative for eukaryotes (Hebert et al. 2003). For instance, coxA and COI are synonyms for the cytochrome c oxidase I gene. This gene is used for the purposes of identification in both initiatives because it is robust to amplification from taxonomically widely separated groups using standardized primers. The gene is more G-C rich in bacteria and more A-T biased in the mitochondrial DNA of insects. Each initiative has selected a standardized region at alternate ends of the gene – and both genes only share an minimal overlap of 194 bp in the 3’ region of insect COI (Smith et al. 2012). Conserved priming regions can result in unintentional amplifications of bacterial rather than insect mitochondrial COI. However, such contamination is easily identifiable with sequence checks on large databases like BOLD or GenBank, due to the sequence characteristics described above (Smith et al. 2012).

Prevalence in Ants

Although Wolbachia was first described in the mosquito Culex pipiens (Diptera: Culicidae) (Hertig 1936; Hertig & Wolbach 1924), it was not documented in ants until much later. Werren et al. (1995a) found the first case of Wolbachia infection in ants in an arthropod- wide survey that included two ant individuals. The first ant survey was completed by Wenseleers (1998), who screened 50 Indonesian ant species and found that 50 % were infected with Wolbachia. A recent meta-analysis by Russell (2012) provided an overview of Wolbachia among insect groups. Russell (2012) collected data for 3,054 species from 91 studies that used diagnostic PCR to assess infection. He only included species with confirmed infection from more than one study and defined infection in a species as having a minimum of one infected individual. Overall, he found that infection ranged from 0- 91 % in insect species, with Coleoptera and Odonata having low prevalence (under 30 % of species) and Isoptera and Thysanoptera with highest infection prevalence. In ants, 34 % of species were infected with Wolbachia (based on 455 species from 15 studies). The level of infection within species was considered low compared to other arthropods, but levels of infection in ants were comparable to overall levels of infection

in Hymenoptera (34.8 % of species) (Russell 2012). About 66 % of insect species are estimated to be infected with Wolbachia (Hilgenboecker et al. 2008). It has been suggested that specific reproductive strategies are correlated with infection in ants. Colony structure (e.g. single queen vs. multiple queen colonies) was not linked with infection in Formica ants (Viljakainen et al. 2008), but is correlated in monogyne (single queen) populations of Solenopsis invicta (Shoemaker et al. 2003b; Shoemaker et al. 2000). Wolbachia spread is thought to be more effective in monogyne over polygyne (multiple queen) S. invicta colonies due to the restrictions of cytoplasmic incompatibility (uninfected females cannot produce viable offspring and an adequate colony size if they mate with an infected male), allowing Wolbachia to establish quickly over infected monogyne populations (Shoemaker et al. 2003b). Polygynous colonies have many queens to maintain a successful colony regardless if one queen is infected; therefore the effect of Wolbachia infection is lower in those populations. Independent colony founding (ICF) in ant species has been linked to lower infection prevalence compared to dependent colony founders (DCF) that consistently exhibit ground travel (Russell 2012; Wenseleers 1998). However, it is important to note that this trend was marginally not significant and therefore, still unclear.

Objective of Study To improve our understanding of Wolbachia infection in ants, this study had three objectives. My first objective was to assess the prevalence of Wolbachia infection within Malagasy ant species and compare results with the recent estimate by Russell (2012). If the Russell (2012) estimate of 34 % Wolbachia infection is a general estimate for Formicidae, then 34 % of surveyed Malagasy species will also be infected with Wolbachia. My assessment was based on both a larger sample of individuals per species and of species in total. Therefore, the increased depth may result in an altered understanding of infection estimates. The MLST markers coxA and hcpA were chosen to detect the presence/absence of Wolbachia in individuals (Baldo et al. 2006). hcpA is the most diverse MLST marker, whereas coxA is less variable and is homologous to the COI barcode gene (Baldo et al. 2006). As there are many types of ant reproduction (Peeters & Ito 2001), investigating the associations between reproductive traits and infection frequencies could provide insight into the role Wolbachia plays in manipulating ant reproduction. Although the correlation between colony founding mode and Wolbachia infection in ants was marginally not significant (Russell 2012;

Wenseleers 1998), it does suggest a relationship between dependent colony foundation (correlated with short distance dispersal) and higher prevalence of infection. The association implies that limited dispersal distance is a possible factor that favours infection because it could increase chances of same-strain compatibility matings between individuals (Russell 2012). A more thorough analysis of the relationships between ant taxa, reproductive traits and Wolbachia infection is required. Therefore, my second objective of this study was to investigate if Wolbachia infection correlates with dispersal state of female reproductives. If dispersal strategy influences the spread of Wolbachia, then species with ergatoid queens will have higher infection prevalence than species with alate queens. As ergatoid queens disperse shorter distances than alate queens, there may less likelihood of mating incompatibility induced by Wolbachia in a localized area (Russell 2012). Ant reproduction has a major influence on resulting colony characteristics and overall success. The relationship between dispersal strategy and Wolbachia infection can provide insight towards how various ant reproductive methods affect Wolbachia spread, genetic variation and potential consequences on host specialization. My third objective was to investigate the reliability of Wolbachia detection using different tissues. As Wolbachia propagate through the host maternal lineage, there is a common misconception that using DNA extracts of host somatic tissue (instead of reproductive tissue) can underestimate Wolbachia infection. However, while intuitively appealing, this notion has been supported by little data. Wolbachia have been found in both somatic tissue and reproductive tissue (Cheng et al. 2000; Dobson et al. 1999; Min & Benzer 1997; Saridaki & Bourtzis 2010; Shoemaker et al. 2000; Van Borm et al. 2001). I aimed to compare the reliability of Wolbachia detection using DNA extracts from somatic tissue (leg) and reproductive tissue (abdomen). If Wolbachia is distributed among both host somatic and reproductive tissue, then Wolbachia detection using somatic extracts will produce identical results to those obtained by testing reproductive extracts.

Methods Taxon Sampling and Molecular Analyses A total of 10,647 ant specimens from 8 subfamilies, 61 genera and 1,155 species were tested for Wolbachia infection. Ninety-nine percent of these specimens were collected from the Malagasy region. The remaining 1 % was collected from miscellaneous regions: Africa (4),

Japan (9), French Polynesia (6), United States (101), Mexico (2), India (8), Brazil (4), Argentina (6) and Thailand (2). Specimens were collected by Brian Fisher and the Malagasy Arthropod Team between 1996 and 2009. Authorizations for the capture, collection and exportation of insects from Madagascar were provided by the Ministère de l'Environnement et des Forêts and the Madagascar National Parks. Specimens were identified morphologically to species and accessioned at the California Academy of Sciences (San Francisco, California) before being point-mounted and tissue sampled at the Biodiversity Institute of Ontario (Guelph, Ontario). Total DNA was extracted from a single leg using the NucleoSpin® 96 Tissue kit (Macherey– Nagel Duren, Germany) following the recommended manufacturer’s protocol or using Ivanova et al. (2006). DNA extracts were eluted in 30-40 μL dH2O. To detect the presence of Wolbachia, the diagnostic Multilocus Sequence Typing (MLST) PCR protocol was followed (Baldo et al. 2006). DNA was amplified using the Wolbachia primers coxA_F1/coxA_R1 to generate a 402 bp amplicon of the coxA gene (Table 3.1). PCR reactions were carried out in 12.5 μL reaction volumes using 96-well plates containing

0.625 μL of 50 mM MgCl2, 0.125 μL of 10 μM for each primer, 0.0625 μL of 10 mM dNTPs, 6.25 μL of 10% trehalose, 2 μL of genomic DNA, and 0.06 μL of Platinum® Taq Polymerase polymerase (Invitrogen). The PCR reaction profile was 2 min at 94 °C, followed by 37 cycles of 30 sec at 94 °C, 45 sec at 54 °C, and 1.5 min at 72 °C, with a final step of 10 min at 72 °C. PCR products were visualized using a 2 % agarose E-Gel® 96-well system (Invitrogen). As in Baldo et al. (2006), the presence of a clean band was interpreted as indicating the presence of Wolbachia. These bands were subsequently sequenced using BigDye v3.1 on an ABI 3730 DNA Analyzer (Applied Biosystems) at the Genomics Facility at the University of Guelph (Guelph, Ontario). DNA from Wolbachia infected individuals was also amplified with a second set of Wolbachia primers, hcpA_F1/hcpA_R1, to generate a 444 bp amplicon of the hcpA gene (Table 3.1). PCR conditions were as above, except that an annealing temperature of 53 °C was used. Sequences were edited and contiged using CodonCode Aligner 3.7.1.1 (CodonCode Corporation, Dedham, MA) and aligned using ClustalW (Thompson et al. 1994). Alignments were then checked by eye using BioEdit Alignment Editor 7.0.9.0 (Hall 1999). All coxA and hcpA sequences were uploaded onto BOLD (Ratnasingham & Hebert 2007). Refer to BOLD

process IDs and Genbank accessions in Appendix S4, Table S4.1-S4.2. Species designations of ants are ongoing – those reported here were updated up to December 2012.

Objective 1: Assessing Wolbachia Infection in Ants I used two rule sets to categorize the presence or absence of Wolbachia in an insect DNA extract. In the first, (“PCR”) I considered a species to be infected if there was a minimum of one individual that displayed a single band in the coxA PCR. In the second, more stringent rule set (“sequence”), an individual was categorized as infected only if the coxA or hcpA gel band was successfully sequenced. Wolbachia infection was analyzed at the subfamily, genus and species levels. Infection estimates were compared between “PCR” and “sequence” methods. Individuals not identified to species level were removed from the species-level analysis, but were kept for higher-level analyses. Full-length coxA and hcpA alleles without ambiguous base pairs were identified using the Wolbachia MLST database (http://pubmlst.org/Wolbachia/) (Baldo et al. 2006; Jolley et al. 2004). The distribution of coxA and hcpA alleles was compared within genera. The nearest taxon index (NTI) (Webb et al. 2002) was calculated to determine if Wolbachia infection is clustered over a host phylogeny generated from sequences of the cytochrome c oxidase I (COI) gene. NTI measures the mean phylogenetic distance to the closest relative in each sample and calculates the extent of terminal clustering or dispersion of a particular trait throughout the overall phylogeny (Webb et al. 2002). NTI increases with increased clustering and becomes negative with overdispersion. Host COI sequences were obtained from the Barcode of Life Data System (BOLD) (Ratnasingham & Hebert 2007) and a phylogeny was created using the Kimura-2-parameter method (Kimura 1980) in MEGA 5.0 (Tamura et al. 2011). NTI was calculated with 1000 randomizations, 1000 iterations and the independent swap algorithm using the picante package (Kembel et al. 2010) in R v2.15.1 (R Development Core Team 2012).

Objective 2: Dispersal Strategy and Wolbachia Infection Dispersal strategy (alate/ergatoid) for surveyed species was identified with searches for descriptions of female reproductive specimens on Antweb (www.antweb.org) (Fisher 2013) and with subsequent confirmation by Brian L. Fisher (personal communications, 2013). Only species in which 10 or more individuals were surveyed for Wolbachia infection were included and the

“PCR” rule of infection was used. The proportion of infected species and dispersal state was compared using a Fisher’s exact test.

Objective 3: Wolbachia Infection Using Somatic vs. Reproductive Tissue Wolbachia infection was tested in 95 specimens belonging to five Camponotus species. Specimens were point-mounted, imaged and tissue sampled at the University of Guelph. Somatic tissue (leg) and reproductive tissue (abdomen) was subsampled from each individual using microscissors. The Wolbachia coxA gene (coxA_F1/coxA_R1) was amplified two times using DNA extracted from somatic tissue and two times using reproductive tissue. Additionally, individuals that showed at least one positive result were hitpicked and amplified with the hcpA gene (hcpA_F1/hcpA_R1). Both coxA and hcpA genes were subsequently sequenced. Specimen details and molecular protocols are the same as outlined above. Refer to BOLD process IDs and Genbank accessions in Appendix S4, Table S4.3. Wolbachia infection results were compared at the individual level and the species level. At the individual level, a chi-square (χ2) test was performed to compare infection results between somatic and reproductive amplifications. A Fisher’s exact test was performed within each species to determine if there were differences in detecting infection in somatic and reproductive tissue. The number of cases detected between somatic and reproductive tissue was also compared with a paired t-test.

Results Objective 1: Assessing Wolbachia Infection in Ants The following infection estimates and analyses used the “PCR” rule, unless mentioned otherwise. Overall, Wolbachia infection varied greatly across all surveyed ant taxa. Of the 8 subfamilies surveyed, all were infected (100 %) (Fig. 3.1). Infection ranged from 41.45 % in Cerapachyinae (63/152 individuals) to 2.43 % in Amblyoponinae (14/575 individuals). At the genus level, Wolbachia was found in 47/61 genera (77.05 %) (Fig. 3.2). Cataulacus had the highest level of infection (65/93 species = 69.89 %) and Mystrium had the lowest level (1/333 species = 0.30 %). No individuals from fourteen genera were infected with Wolbachia. Wolbachia was found in 374/1,155 species overall (32.38%) (Fig. 3.3). Cataulacus porcatus had the highest infection level (51/63 individuals = 80.95 %) and Pheidole megacephala had the

lowest level (1/65 individuals = 1.54 %). A minimum of 20 individuals was surveyed in all the taxa reported above. Appendix S5, Table S5.1-S5.3 reports infection levels for all taxa surveyed. Estimates reported here may be higher than the “true” infection prevalence as the result of more permissive PCR positive passes. Due to the great diversity of ants collected within Madagascar, 1,035 surveyed species were represented by fewer than 20 individuals. If these species were removed, all surveyed species with more than 20 individuals resulted in an infection level of 61.67 % (74/120 species). At the genus level, 34/38 taxa (containing at least 20 individuals) were infected with Wolbachia (89.47 %). All surveyed subfamilies had a minimum of 20 individuals and so the level of infection did not change. Overall, 61% of species had an intraspecific infection level of 0-10%. Less than 50 % of the individuals were infected in the majority of infected species (113/120 species represented by n > 20 individuals) (Fig. 3.4). Under the “sequence” rule, where an individual is considered infected if coxA or hcpA was successfully sequenced, 1,176 coxA sequences and 1,037 hcpA sequences from a total of 1,390 individuals were recovered. The remaining sequences “failed” as a result of methodological error, not unintentional amplification of a different sequence. “Sequence” rule infection prevalence was lower or equal to the “PCR” rule due to unrecovered sequences (Fig. 3.5-3.7, also see Appendix S6, Table S6.1-S6.3). On average, infection estimates under the “PCR” rule were 2.71 %, 2.68 % and 18.01 % higher than the “sequence” rule for subfamilies, genera and species, respectively. A total of 21 alleles were identified from 572 coxA sequences through the MLST database (Appendix S7, Table S7.1). The most common alleles were allele 2 at 54.8% and allele 6 at 24.43 %, while the remaining alleles were present in frequencies of less than 4 % (Fig. 3.8). A total of 23 alleles were identified from 432 hcpA sequences (Appendix S7, Table S7.1). Allele 127 was the most common (49.54 %), followed by allele 47 (17.36 %) and allele 7 (9.26 %). The remaining hcpA alleles were each present at frequencies of less than 5 % (Fig. 3.8). The nearest taxon index (NTI) analysis showed significant terminal clustering of Wolbachia infection relative to host phylogeny (NTI=15.19, p<<0.05) (Fig. 3.9). This suggests that Wolbachia infection is not random but tends to occur in groups of closely related species. No geographic pattern of infection was observed.

Objective 2: Dispersal Strategy and Wolbachia Infection Searches on Antweb for female reproductive descriptions yielded a total of 317 species: 300 alates and 17 ergatoids (Appendix S8, Table S8.1). Wolbachia infection was found in 43 % (130/300) of alate species and in 53 % (9/17) of ergatoid species (Fig. 3.10). A Fisher’s exact test found no significant differences in Wolbachia infection between species with alate queens vs. ergatoid queens (p=0.203).

Objective 3: Wolbachia Infection Using Somatic vs. Reproductive Tissue After testing for the presence of Wolbachia two times with somatic DNA extracts and two times with reproductive DNA extracts, 27 out of 95 individuals were detected with Wolbachia at least once (Table 3.2). Eighteen specimens consistently tested positive for infection over the 4 tests. Infection was detected in only 3 of the 4 tests on two individuals. Infection was detected in 2 of the 4 tests on four individuals (in reproductive DNA, but not somatic DNA). Infection was only detected in 1 of the 4 tests on three individuals, and PCR bands were faint for all three. None of these individuals yielded hcpA sequences (although coxA was successfully sequenced). For these reasons, these three positive amplifications are suspected to be contaminants. All other positives yielded both coxA and hcpA sequences. Overall, infection was detected in somatic DNA in 21.05 % and 22.11 % of specimens, and infection was detected in reproductive DNA from 24.21 % and 26.3 % of specimens (Fig. 3.11). Differences in infection estimates over four tests were not significant with a χ2 test (χ2=0, df=1, p=1). Wolbachia was detected more often using reproductive DNA than somatic DNA, however, a paired t-test showed that this difference was not significant (t=7, df=1, p=0.09). The level of infection varied across species (Fig. 3.12), but differences in the number of positives detected over the four tests were not significant in Fisher’s exact tests (p=1, in all 5 species).

Discussion This study investigated the prevalence of Wolbachia infection in ants, tested for the association between reproductive dispersal and infection in ant species and examined the reliability of using DNA extracts from somatic and reproductive tissue for Wolbachia detection. Overall, 32.38 % of species were infected with Wolbachia, but excluding all species represented

by fewer than 20 individuals produced an estimate of 61.67%. With more extensive sampling that included multiple individuals per species, a clearer picture of Wolbachia infection was produced and analyzed over various taxonomic levels. My data also provided the opportunity to examine patterns of infection, such as the potential link between dispersal state and Wolbachia, however, no significant correlation was found. Lastly, clarifying discrepancies between somatic and reproductive DNA extracts used for Wolbachia detection promotes confidence in past, present and future surveys. Although infection was detected using somatic DNA in fewer specimens than with reproductive DNA, this difference was not significant over 4 tests.

Estimating the Frequency of Wolbachia Infection in Ants The frequency of Wolbachia infection varies greatly among taxa and thus it is essential to study it at multiple levels. Most surveys of infection undersample at the individual level, especially large-scale studies that span multiple orders (Kittayapong et al. 2003; Sintupachee et al. 2006; Weeks et al. 2003; Werren et al. 1995a; Werren & Windsor 2000; Zchori-Fein & Perlman 2004). Ant-specific studies of Wolbachia routinely sample less than 10 representatives per species (Russell et al. 2009; Shoemaker et al. 2000; Wenseleers 1998; Wenseleers & Billen 2000). My in-depth Wolbachia survey sampled more intensely at the individual, species, genus and subfamily levels to clarify the extent of infection in ants. I found a wider range of infection frequencies and a higher diversity of Wolbachia alleles than was observed in previous ant studies. Having a vast collection of Malagasy ants available provided the opportunity to overcome any chance of biased sampling from prior knowledge of infection (Hilgenboecker et al. 2008; Werren & Windsor 2000). Robust MLST markers (Baldo et al. 2006) and a rapid diagnostic PCR protocol (aligned in parallel with a comprehensive DNA barcoding initiative on this insect group (Smith et al. 2005)) made this large-scale study feasible. I documented Wolbachia in 32.38 % of all surveyed ant species, a value very close to Russell’s (2012) 34% in a meta-analysis of ants. However, excluding species with fewer than 20 individuals results in much higher infection estimate of 61.67 %. Inadequate intraspecific sampling may have contributed to an underestimation of Wolbachia infection in previous ant surveys and is likely a major source of error in estimating infection in other arthropods (Arthofer et al. 2009; Hilgenboecker et al. 2008; Jeyaprakash & Hoy 2000; Jiggins et al. 2001; Kittayapong et al. 2003; Russell 2012; Sintupachee et al. 2006; Weeks et al. 2003; Werren & Windsor 2000). Under-sampling could result in incorrectly concluding that a species is free of

Wolbachia (a false negative) (Jeyaprakash & Hoy 2000). Comparing validated species with unidentified or provisional species could create potential redundancy and inflate infection estimates (Russell 2012). As well, diagnostic PCR may underestimate infection prevalence due to low DNA concentration and/or PCR inhibitors (Jeyaprakash & Hoy 2000; Weeks et al. 2003), or alternatively overestimate infection due to nonspecific amplification related to contamination or numts (Blaxter 2007; Hotopp et al. 2007; Jeyaprakash & Hoy 2000; Russell 2012). Given these limitations, is the “sequence” rule— where an individual is considered infected after a sequence is successfully obtained— necessary? Instead of relying principally on PCR results, generating sequences from gel positives can help to pinpoint problems of nonspecific amplification. However, MLST markers were robust and unrecovered/failed sequences were due to experimental error rather than unintentional amplification of a different sequence. “Sequence” estimates were equal to or lower than the more conservative “PCR” estimates, with averages of 2.71 % for subfamilies, 2.68 % for genera and 18.01 % for species. While a protocol that does not include sequencing gel positives can still provide a similar pattern of infection given an appropriate sampling of individuals, multiple lines of evidence (e.g. multiple Wolbachia primers) are nevertheless suggested to ensure reliable detection. To ensure an appropriate sampling of individuals and a reliable estimate of infection within a species, I recommend increasing the amount of intraspecific sampling than was used in past surveys (10 individuals or less per species). Higher sample sizes can mitigate PCR or sequencing errors that could distort infection estimates. Surveying more individuals per species will increase sampling size and statistical power as well as allow for analyses at a deeper, individual level. Sampling widely across a species’ geographic distribution and including individuals from a variety of colonies is also recommended to ensure adequate representation of the species. According to Hilgenboecker et al. (2008), Wolbachia infection frequency within a species is either very low (0-10 %) or very high (90-100 %). My data indicated that most intraspecific infection frequency in ants was very low (0-10 %) and very high infection frequency (over 90 %) was quite rare. Most levels of intraspecific Wolbachia infection fell under 50 %. As such, thresholds of infection should be established instead of the commonly used infected/not infected classification where the minimum cutoff is one infected individual. I recommend high, medium and low categories of infection to emphasize the variance of infection among taxa. Species with fewer than 33 % of infected individuals will be described as “low

infection” species, species with greater than 66 % of infected individuals will be considered “high infection” species and species with 33-66 % of infected individuals will be considered “medium infected”. Increased intraspecific sampling and thresholds of infection will improve future Wolbachia assessments and highlight infection differences among taxa.

The Diversity of Wolbachia within the Ants In the MLST database (as of June 2013), there are 41 ant records contributed by 2 authors (Baldo et al. 2006; Russell et al. 2009), making it the most abundant insect family represented in the database (13.9 % of sequences belong to Formicidae). Of the 17 unique coxA alleles and 29 unique hcpA alleles recorded in the database, coxA allele 20 and hcpA allele 7 are the most abundant. My dataset provides a clearer picture of diversity in Malagasy ants, where coxA allele 2 in and hcpA allele 127 are the most common, each making up about 50 % of the total identified alleles. A significantly positive NTI value suggests that Wolbachia infection is not random. Significant clustering of infected individuals on the ant phylogeny indicates that Wolbachia is likely to spread by infection of closely related hosts, perhaps as a result of host specialization (Russell et al. 2009). Most strain variation in ants is found between Old and New World populations, but this pattern has not been observed outside of the ants (Russell et al. 2009; Smith et al. 2012). As well, there is not yet any evidence to indicate localized geographic isolation within Old and New World populations (Russell et al. 2009). Future work to sequence the remaining MLST markers will enable comparisons with existing strains in the database and reveal additional strain diversity. Increased knowledge regarding Wolbachia strain diversity will be able to clarify many questions, such as the ecological and evolutionary influences of strain transmission patterns (Baldo et al. 2006).

Infection is Not Correlated with Dispersal State My survey provided the opportunity to answer questions regarding infection differences among ant species. High infection prevalence in some taxa could be linked to certain life history traits, but these correlations are still unsupported and could be due to a combination of unknown ecological factors (Russell 2012). As mentioned in the introduction, reproductive strategies could potentially explain varying infection prevalence in ants (Wenseleers 1998), but quantitative support for this hypothesis is limited (Russell 2012; Shoemaker et al. 2003b; Shoemaker et al.

2000; Viljakainen et al. 2008; Wenseleers 1998). Although no significant difference in infection frequency was observed between ants using different dispersal methods, additional work is needed to balance alate and ergatoid sampling. The availability of reliable ergatoid specimen descriptions on Antweb may have been the limiting factor in my analysis as I was only able to survey 17 ergatoid species. Additionally, it would be valuable to reexplore associations between other reproductive characteristics and Wolbachia infection, as was first analyzed by Wenseleers (1998). My extensive dataset could reveal previously unobserved patterns of infection associated with social structure (monogyny vs. polygyny), nest type (arboreal vs. soil) or species that have reproductive workers (intercastes). Ant reproductive strategies are uniquely variable within Hymenoptera and could provide new perspectives into the patterns of Wolbachia infection. Outside of ant reproduction, future areas of exploration to consider can include the association with symbiotic organisms (e.g. aphids, fungi, parasitism by other organisms), ecological strategies (e.g. slave-making ants, invasive species) and geographic distribution (e.g. endemic, worldwide).

Wolbachia Detection: A Biological or Methodological Problem? The occurrence of Wolbachia in insects has been scrutinized among caste systems (Frost et al. 2010; Shoemaker et al. 2000; Tsutsui et al. 2003; Van Borm et al. 2001; Wenseleers et al. 2002), life stages (Shoemaker et al. 2000; Wenseleers et al. 2002), sex (Van Borm et al. 2001), age (Unckless et al. 2009) and tissues (Cheng et al. 2000; Dobson et al. 1999; Shoemaker et al. 2000; Van Borm et al. 2001). Wolbachia detection was not found to be significantly influenced by the type of DNA extract in surveyed ants, however, this conclusion cannot necessarily be extrapolated to other insects. Wolbachia infection was compared between somatic and reproductive tissue of workers, who (in most species) do not reproduce (and if they do can only produce females). Therefore, the lack of significance observed between tissue types may have occured because the reproductive tissue in workers may have been more similar to somatic tissue. Although Wolbachia have been found in the worker caste, infection levels in reproductives were found to be comparatively higher than the worker caste (Van Borm et al. 2001; Wenseleers et al. 2002). It would be inefficient for Wolbachia to reside in workers, simply because they would be unable to reproduce (Russell 2012). Further study comparing tissue types between reproductives

will provide a more definitive answer to the reliability of Wolbachia detection using somatic vs. reproductive host tissue. Perhaps the problem in detecting Wolbachia has more to do with the assay used, rather than the source of the DNA extract, although the problems of PCR assays, PCR inhibitors, DNA concentration and contamination are not exclusive to Wolbachia detection. For example, using the abdomen to detect for the presence of Wolbachia could unintentionally amplify other bacterial symbionts in the gut (Kautz et al. 2013a; Kautz et al. 2013b), or Wolbachia from other insect prey contained within the gut. As mentioned above, caution is needed to avoid false positives by adding multiple lines of evidence such as sequencing, using several markers and repeated diagnostic surveys. It is also important to note that the Camponotus specimens used here are relatively large ants (3-8mm), and the resultant higher DNA concentration may have been advantageous for detecting Wolbachia, especially for individuals with low infection levels. Comparing DNA extracts from smaller specimens may produce a different outcome, although Wolbachia was detectable in both somatic and reproductive tissue of the smaller-sized Drosophila (Dobson et al. 1999). If somatic tissue is as reliable as reproductive tissue for detecting Wolbachia in insects, vast collections (e.g. in museums, academic institutions, private collections) will be valuable for large scale surveys. Most insect DNA extracts derived from DNA barcoding protocols originate from leg tissue, and removing a leg is less detrimental to the specimen than subsampling its abdomen. Using available collections provides the opportunity to screen for Wolbachia without the need for further collecting, and larger collections also allow for large-scale surveys that can ensure adequate intraspecific sampling.

Conclusions There is now a clearer understanding of the prevalence of Wolbachia infection in ants. Previous ant surveys have estimated a 30-50 % infection frequency across species, but my survey of Malagasy ants estimates that 61.67 % of species are infected with Wolbachia. I suggest describing species as “low infected”, “medium infected” and “high infected” to emphasize varying levels of Wolbachia infection across taxa. As well, increasing the number of individuals sampled per species (compared to previous studies) may provide increased statistical power when estimating infection frequencies and allow for analyses of infection at the individual level.

Extensive sampling over a broad taxonomic and geographic range does not only show the diversity of infection frequencies, but can also reveal ecological patterns of infection such as the association of dispersal state and infection. Although dispersal strategy was not correlated with Wolbachia infection, ant reproductive strategies are tightly linked with colony success and can potentially facilitate Wolbachia spread into other populations. As well, the reliability of Wolbachia detection between tissue types is still unclear and further comparisons using reproductives are required. Nevertheless, sampling more individuals per species, using multiple markers and repeating diagnostic surveys will always ensure a more accurate estimate of infection frequency in a species. This large-scale study has increased our knowledge of Wolbachia prevalence in Malagasy ants and suggests ways to improve future assessments of infection in other insects. Wolbachia is a widespread endosymbiont and can play an essential role in the evolution of its host, for example, by increasing or decreasing mitochondrial diversity or providing slightly higher fecundity. Thus, it is important to fully understand the extent of its relationship with other organisms.

Table 3.1- Primers used to amplify Wolbachia coxA and hcpA genes in ants.

Primer Name Sequence (5’-3’) Gene Reference coxA_F1 TTGGRGCRATYAACTTTATAG coxA (Baldo et al. 2006) coxA_R1 CTAAAGACTTTKACRCCAGT coxA (Baldo et al. 2006) hcpA_F1 GAAATARCAGTTGCTGCAAA hcpA (Baldo et al. 2006) hcpA_R1 GAAAGTYRAGCAAGYTCTG hcpA (Baldo et al. 2006)

Table 3.2- Comparing the reliability of ant somatic tissue (leg) vs. reproductive tissue (abdomen) for PCR detection of Wolbachia. Tests were conducted twice for each tissue type using the coxA gene. “✔ ” indicates infection, grey cells indicate Wolbachia was not detected and “(✔)” indicates weak detection with faint PCR bands.

Reproductive Reproductive Somatic Somatic Process ID Species #1 #2 #1 #2 Camponotus christi MCAMP008-12 ✔ ✔ foersteri Camponotus christi MCAMP009-12 ✔ ✔ (✔) ✔ foersteri Camponotus christi MCAMP043-12 ✔ ✔ ✔ foersteri Camponotus christi MCAMP044-12 ✔ ✔ ✔ ✔ foersteri Camponotus christi MCAMP086-12 ✔ ✔ ✔ foersteri Camponotus christi MCAMP087-12 ✔ ✔ ✔ ✔ foersteri Camponotus christi MCAMP088-12 ✔ ✔ ✔ ✔ foersteri Camponotus christi MCAMP089-12 ✔ ✔ ✔ ✔ foersteri MCAMP069-12 Camponotus grandidieri (✔)

MCAMP045-12 Camponotus heteroclitus ✔ ✔ ✔ ✔ MCAMP046-12 Camponotus heteroclitus ✔ ✔ ✔ ✔ MCAMP047-12 Camponotus heteroclitus ✔ ✔ ✔ ✔ MCAMP048-12 Camponotus heteroclitus ✔ ✔ ✔ ✔ MCAMP049-12 Camponotus heteroclitus ✔ ✔ ✔ ✔ MCAMP064-12 Camponotus heteroclitus ✔ ✔ ✔ ✔ MCAMP065-12 Camponotus heteroclitus ✔ ✔ ✔ ✔ MCAMP066-12 Camponotus heteroclitus ✔ ✔ ✔ ✔ MCAMP012-12 Camponotus MG005 ✔ ✔

MCAMP016-12 Camponotus MG005 ✔ ✔

MCAMP017-12 Camponotus MG005 ✔ ✔ ✔ ✔ MCAMP018-12 Camponotus MG005 ✔ ✔ (✔) ✔ MCAMP068-12 Camponotus MG005 ✔ ✔ ✔ ✔ MCAMP036-12 Camponotus MG053 (✔)

MCAMP037-12 Camponotus MG053 ✔ ✔ ✔ ✔ MCAMP060-12 Camponotus MG053 ✔ (✔) ✔ ✔ MCAMP091-12 Camponotus MG053 ✔ ✔

MCAMP093-12 Camponotus MG053 (✔)

(152) 45 41.45 40 (287)

Infection

30 28.57 (195) (1796) (22) 25 22.05

20.71 Wolbachia 20 18.18 (5581) (1990) 15 13.01 10.60 10 (575)

5 2.43

% % Individuals with 0

Subfamily

Fig. 3.1- A survey of Wolbachia infection in 8 ant subfamilies. All subfamilies were infected with Wolbachia, but infection varied across taxa. Bolded numbers indicate the percentage of infected individuals. Bracketed numbers indicate the total number of individuals surveyed for each species.

(93)

69.89 (44) (78) 70 59.09 57.69

Infection 60

40 Wolbachia 30

20 (126) (43) (333) 10 2.38 2.33 0.30

% % Indivduals with 0

Genus

Fig. 3.2- Ant genera with the three highest and three lowest levels of Wolbachia infection. Genera represented by less than 20 specimens and showing 0% infection were excluded in this graph. Bolded numbers indicate the percentage of infected individuals. Bracketed numbers indicate the total number of individuals surveyed for each species.

(63) (20) 90 (36) 80.95 80 75.00 69.44 70

20 (47) (59) (65) 10 2.13 1.69 1.54

% % Individuals withWolbachia Infection 0 Cataulacus Odontomachus Crematogaster Pachycondyla Camponotus Pheidole porcatus troglodytes BBB55 cambouei grandidieri megacephala

Species

Fig. 3.3- Ant species with the three highest and three lowest levels of Wolbachia infection. Species represented by less than 20 specimens and showing 0% infection were excluded in this graph. Bolded numbers indicate the percentage of infected individuals. Bracketed numbers indicate the total number of individuals surveyed for each species.

80 73 70

30 No.of Species 20 12 8 10 10 10 4 1 1 1 0 0 0-10 10-20 20-30 30-40 40-50 50-60 60-70 70-80 80-90 90-100

% Infection within Species

Fig. 3.4- The distribution of Wolbachia infection in ant species represented by at least 20 individuals. Intraspecific infection frequency is under 50 % in most cases (113/120 species), with 61 % of species showing 0-10 %. Bolded numbers indicate the number of species within each infection range.

30 PCR 25

Sequence Wolbachia Wolbachia Infection 20

5 % % Individuals with 0

Subfamily

Fig. 3.5- Comparison of “PCR” and “sequence” rules of Wolbachia infection in surveyed ant subfamilies. Infection estimates using the “PCR” rule were 2.71 % higher, on average than estimates based on the “sequence” rule.

infection 60 PCR

50 Sequence

Wolbachia Wolbachia 40

10 % % Individuals with 0

Genus

Fig. 3.6- Comparison of “PCR” and “sequence” rules of Wolbachia infection in ant genera with the ten highest infection frequencies (for genera with fewer than 20 individuals). Infection estimates under the “PCR” rule was on average 2.68 % higher, or equal to the “sequence” rule in 18/42 genera.

80 PCR Sequence infection 70

50 Wolbachia Wolbachia 40

% % Individuals with 0

Species

Fig. 3.7- Comparison of “PCR” and “sequence” rules of Wolbachia infection in ant species with the ten highest infection frequencies (for species with fewer than 20 individuals). In the majority of cases, infection estimates under the “PCR” rule was equal to the “sequence” rule (299/346 species) or on average 18.01 % higher.

coxA hcpA

Other Other 22% 25% Allele Allele 2 127 Allele 6 54% Allele 47 24% 17% 49% Allele 7 9%

Fig. 3.8- Allele distributions for coxA (left) and hcpA (right) in infected ants.

Fig. 3.9- A subset of the COI phylogeny used to calculate NTI (nearest taxon index) in ants surveyed for Wolbachia infection. This neighbour-joining tree was built using the K2P model and only shows Camponotus species (n=1070 individuals, 133 species). Eighteen percent of Camponotus individuals were infected with Wolbachia. Infected individuals are highlighted in red.

60 57 53

50 47

43 Wolbachia 40

30 Infected

Not infected 20

10 % % Individuals Infeced with

0 Alate Ergatoid Dispersal State

Fig. 3.10- The relationship between ant queen dispersal state (alate/ergatoid) and Wolbachia infection. Wolbachia infection was surveyed in 300 alate species, and 17 ergatoid species. A Fisher’s exact test did not confirm a significant relationship between Wolbachia infection and dispersal state (p=0.203). Numbers in bold indicate the percentage of individuals infected with Wolbachia.

25 24 22 21

Wolbachia 20

5 % % Individuals Infectedwith 0 Reproductive #1 Reproductive #2 Somatic #1 Somatic #2

Fig. 3.11- Individual-level comparisons of Wolbachia detection using DNA from host reproductive tissue (abdomen) and somatic tissue (leg). Each tissue type was tested twice for a total of four tests. Differences in infection estimates over 4 tests were not significant with a χ2 test (χ2=0, df=1, p=1). Wolbachia detection was slightly higher in reproductive tissue, but this was not significant with a paired t-test (t=7, df=1, p=0.09). Bolded numbers indicate the percentage of individuals infected with Wolbachia (out of 95 individuals tested).

Reproductive #1 (10) (8) Reproductive #2 10 9 Somatic #1 9 8 8 8 8 Somatic #2 8 (15) 7 7 7 6 (40) 6 5 5 5 4 4 4 3 3 3 3 (22) 2 2 1

No.of Infected Individuals 1 0 0 0 0 Camponotus Camponotus Camponotus Camponotus Camponotus heteroclitus MG005 grandidieri christi foersteri MG053 Species

Fig. 3.12- Species-level comparisons of Wolbachia detection using DNA from host reproductive tissue (abdomen) and somatic tissue (leg) within species. Each tissue type was tested twice for a total of four tests. Bracketed numbers indicate the total number of individuals surveyed for each species. Bolded numbers indicate the number of infected individuals. The variation observed within species was not significant with Fisher’s exact tests (p=1, for all 5 species).

Chapter 4 Conclusions and Future Directions

Ants possess a highly diverse set of characteristics that has enabled them to be successful in all aspects of life (Hölldobler & Wilson 1990). These fascinating insects are ecologically important and widely studied, yet much of their diversity and biology remain unknown. This is true in the comparatively well-studied temperate region and is more accentuated in the tropics. My thesis explored two factors influencing genetic variation in Malagasy ants, particularly, patterns of genetic variation as influenced by reproductive dispersal and the complex relationship with ants and Wolbachia. Utilizing efficient protocols, thorough sampling and surveying a broad spectrum of species over a large geographical scale were common themes in both studies. In Chapter 2 of my thesis, I compared IBD between ergatoid and alate dispersal states. All ergatoid species exhibited IBD perhaps due to short dispersal distances, but the majority of alate species also exhibited IBD despite having a higher dispersal capacity. A threshold of IBD for categorizing ergatoid and alate states could not be determined as IBD values overlapped. Patterns of IBD observed within species may be influenced by several factors, such as geographical barriers and ecological traits. Estimating IBD is a rapid approach to comparing dispersal in ants and opens doors for future studies of ant reproduction. Future research will incorporate multiple markers as supplementary forms of measurement of genetic variation (Bennetts et al. 2001). Including other mitochondrial markers will not only verify the correct amplification of COI (instead of pseudogenes) (Levitsky et al. In review; Zhang & Hewitt 1996), but will also serve as additional evidence for observed genetic patterns. The utilization of nuclear markers will also provide an extra perspective on dispersal. Male dispersal also contributes towards gene flow and overall divergence between populations. Inference of biparental patterns of variation using nuclear markers, in combination with maternally inherited markers, will allow comparisons between male and female dispersal (Pamilo et al. 1997; Prugnolle & de Meeus 2002). Comparisons of biparental and uniparental markers can tease out instances of sex-biased dispersal (Prugnolle & de Meeus 2002; Seppä et al. 2006; Seppä et al. 2004). In Chapter 3, I estimated the prevalence of Wolbachia infection in ant species, examined the correlation between reproductive dispersal state and infection frequency, and compared the

reliability of using DNA extracts from somatic vs. reproductive tissue to test for the presence of Wolbachia. Overall, 32.38% of surveyed ant species were infected with Wolbachia, but excluding all species represented by fewer than 20 individuals generated a higher estimate of 61.67%. I found that dispersal strategy was not correlated with Wolbachia infection, although links with infection and reproductive traits require further exploration. Furthermore, the data did not support the common presumption that DNA generated from somatic tissue is an unreliable method to estimate Wolbachia infection of the insect host. However, these comparisons were tested using workers (instead of reproductives) and this pattern will not necessarily be observed in other insects. Caution should be also be taken to avoid methodological errors generated by PCR assays. Use of somatic tissue will allow the opportunity to screen existing collections without significantly damaging specimens as well as enabling rapid screening of Wolbachia at a greater scale without the fieldwork prerequisite for collecting. Overall, this study has increased our understanding of the frequency of Wolbachia infection in ants and suggests several protocols for more accurate assessments of Wolbachia. Improvements in future estimates of infection should include increased intraspecific sampling over a widely sampled area, using infection categories (low, medium and high) to emphasize the level of infection among species, multiple markers for additional lines of evidence and repeated diagnostic surveys to ensure consistent detection. Future work should include ants outside of Madagascar to determine how Wolbachia infection prevalence compares to the rates I have shown here for Malagasy species. Amplifying the remaining MLST markers in the ants surveyed here would also provide additional information on strain diversity that would be valuable in determining strain-specific patterns of transmission (Baldo et al. 2006). Further investigation into ant reproductive strategies and infection, including improving sample sizes for my dispersal analysis, will provide further insight into the patterns of Wolbachia infection in ants. Finally, it will be useful to test the reliability of somatic DNA extracts in ant reproductives and other insect species to see if Wolbachia are consistently detected. My thesis sheds light on two aspects of ant biology. Although they are seemingly at opposite ends of the spectrum, dispersal and Wolbachia infection greatly influence the outcomes of ant reproduction. They each play a critical role in gene flow, genetic diversity and population structure. Variable characteristics of reproduction in ants (e.g. colony founding modes, dispersal

states and monogynous/polygynous colonies) and reproductive manipulation exerted by Wolbachia are factors that influence genetic patterns. Evolutionary consequences such as speciation or extinction can be accelerated in ants because of small effective population size as a result of reproductive division of labour. Further research on ant reproduction and Wolbachia will increase our understanding of ants, their diversity and perhaps provide greater insight into their evolutionary success.

References Adis J (1988) On the abundance and density of terrestrial arthropods in central Amazonian dryland forests. Journal of Tropical Ecology 4, 19-24.

Agosti D, Johnson NF (2005a) Antbase.org. antbase.org

Agosti D, Johnson NF (2005b) Antbase. antbase.org

Alpert GD (1992) Observations on the genus Terataner in Madagascar (Hymenoptera: Formicidae). Psyche 99, 117-128.

Amor F, Ortega P, Jowers MJ, et al. (2011) The evolution of worker–queen polymorphism in Cataglyphis ants: interplay between individual-and colony-level selections. Behavioral Ecology and Sociobiology 65, 1473-1482.

André AvS, Blackwell NM, Hall LR, et al. (2002) The role of endosymbiotic Wolbachia bacteria in the pathogenesis of river blindness. Science 295, 1892-1895.

Arakaki N, Miyoshi T, Noda H (2001) Wolbachia–mediated parthenogenesis in the predatory thrips Franklinothrips vespiformis (Thysanoptera: Insecta). Proceedings of the Royal Society of London. Series B: Biological Sciences 268, 1011-1016.

Armbruster P, Damsky Jr WE, Giordano R, et al. (2003) Infection of New-and Old-World Aedes albopictus (Diptera: Culicidae) by the intracellular parasite Wolbachia: implications for host mitochondrial DNA evolution. Journal of Medical Entomology 40, 356-360.

Aron S (2001) Reproductive strategy: an essential component in the success of incipient colonies of the invasive Argentine ant. Insectes Sociaux 48, 25-27.

Arthofer W, Riegler M, Schneider D, et al. (2009) Hidden Wolbachia diversity in field populations of the European cherry fruit fly, Rhagoletis cerasi (Diptera, Tephritidae). Molecular ecology 18, 3816-3830.

Avise JC, Arnold J, Ball RM, et al. (1987) Intraspecific Phylogeography: The Mitochondrial DNA Bridge Between Population Genetics and Systematics. Annual Review of Ecology and Systematics 18, 489-522.

Baldo L, Dunning Hotopp JC, Jolley KA, et al. (2006) Multilocus sequence typing system for the endosymbiont Wolbachia pipientis. Applied and Environmental Microbiology 72, 7098-7110.

Baldo L, Werren JH (2007) Revisiting Wolbachia supergroup typing based on WSP: spurious lineages and discordance with MLST. Current Microbiology 55, 81-87.

Bandi C, Anderson TJC, Genchi C, Blaxter ML (1998) Phylogeny of Wolbachia in filarial nematodes. Proceedings: Biological Sciences 265, 2407-2413.

Bennetts RE, Nichols JD, Lebreton J-D, et al. (2001) Methods for estimating dispersal probabilities and related parameters using marked animals. In: Dispersal (eds. Clobert J, Danchin E, Dhondt AA, Nichols JD), pp. 3-17. Oxford University Press, New York.

Berghoff SM, Kronauer DJC, Edwards KJ, Franks NR (2008) Dispersal and population structure of a New World predator, the army ant Eciton burchellii. Journal of Evolutionary Biology 21, 1125-1132.

Bjornstad ON (2012) ncf: spatial nonparametric covariance functions. R package version 1.1-4.

Blaxter M (2007) Symbiont genes in host genomes: fragments with a future? Cell Host & Microbe 2, 211-213.

Bohonak AJ (1999) Dispersal, gene flow, and population structure. The Quarterly Review of Biology 74, 21-45.

Bolton B (1975) A Revision of the Ant Genus Leptogenys Roger Hymenoptera: Formicidae in the Ethiopian Region British Museum Natural History.

Bolton B (2000) The ant tribe Dacetini. With a revision of the Strumigenys species of the Malgasy Region by Brian L. Fisher, and a revision of the Austral epopostrumiform genera by Steven O. Shattuck. Memoirs of the American Entomological Institute 65, 1- 1028.

Bolton B, Fisher BL (2011) Taxonomy of Afrotropical and West Palaearctic ants of the ponerine genus Hypoponera Santschi (Hymenoptera: Formicidae). Zootaxa 2843, 1-118.

Boomsma JJ, Baer B, Heinze J (2005) The evolution of male traits in social insects. Annual Review of Entomology 50, 395-420.

Bordenstein SR, Paraskevopoulos C, Dunning Hotopp JC, et al. (2009) Parasitism and mutualism in Wolbachia: what the phylogenomic trees can and cannot say. Molecular Biology and Evolution 26, 231-241.

Bouchet DC, Peeters C, Fisher BL, Molet M (2013) Both female castes contribute to colony emigration in the polygynous ant Mystrium oberthueri. Ecological Entomology.

Bourtzis K, Nirgianaki A, Markakis G, Savakis C (1996) Wolbachia infection and cytoplasmic incompatibility in Drosophila species. Genetics 144, 1063-1073.

Bouwma AM, Shoemaker D (2011) Wolbachia wSinvictaA infections in natural populations of the fire ant Solenopsis invicta: testing for phenotypic effects. Journal of Insect Science 11, 1-19.

Brady SG, Schultz TR, Fisher BL, Ward PS (2006) Evaluating alternative hypotheses for the early evolution and diversification of ants. Proceedings of the National Academy of Sciences of the United States of America 103, 18172-18177.

Breeuwer JA (1997) Wolbachia and cytoplasmic incompatibility in the spider mites Tetranychus urticae and T. turkestani. Heredity 79, 41-47.

Bronstein JL (1998) The contribution of ant-plant protection studies to our understanding of mutualism. Biotropica 30, 150-161.

Brown MJF, Bonhoeffer S (2003) On the evolution of claustral colony founding in ants. Evolutionary Ecology Research 5, 305-313.

Brown WL, Jr., Wilson EO (1959) The Evolution of the Dacetine Ants. The Quarterly Review of Biology 34, 278-294.

Brownlie JC, Cass BN, Riegler M, et al. (2009) Evidence for metabolic provisioning by a common invertebrate endosymbiont, Wolbachia pipientis, during periods of nutritional stress. PLoS pathogens 5, e1000368.

Buczkowski G (2010) Extreme life history plasticity and the evolution of invasive characteristics in a native ant. Biological Invasions 12.

Burns JM, Janzen DH, Hajibabaei M, Hallwachs W, Hebert PDN (2008) DNA barcodes and cryptic species of skipper butterflies in the genus Perichares in Area de Conservación Guanacaste, Costa Rica. Proceedings of the National Academy of Sciences 105, 6350- 6355.

Buschinger A (1986) Evolution of social parasitism in ants. Trends in Ecology and Evolution 1, 155-160.

Casiraghi M, Bordenstein SR, Baldo L, et al. (2005) Phylogeny of Wolbachia pipientis based on gltA, groEL and ftsZ gene sequences: clustering of arthropod and nematode symbionts in the F supergroup, and evidence for further diversity in the Wolbachia tree. Microbiology 151, 4015-4022.

Casper-Lindley C, Kimura S, Saxton DS, et al. (2011) A fluorescent-based method for rapid Wolbachia detection in the Drosophila germline and somatic tissues. Applied and Environmental Microbiology.

Cerdá X, Retana J, Cros S (1998) Prey size reverses the outcome of interference interactions of scavenger ants. Oikos 82, 99-110.

Chapuisat M, Bocherens S, Rosset H (2004) Variable queen number in ant colonies: No impact on queen turnover, inbreeding, and population genetic differentiation in the ant Formica selysi. Evolution 58, 1064-1072.

Chapuisat M, Crozier R (2001) Low relatedness among cooperatively breeding workers of the greenhead ant Rhytidoponera metallica. Journal of Evolutionary Biology 14, 564-573.

Charlat S, Duplouy A, Hornett E, et al. (2009) The joint evolutionary histories of Wolbachia and mitochondria in Hypolimnas bolina. BMC Evolutionary Biology 9, 64.

Charlat S, Hurst GDD, Merçot H (2003) Evolutionary consequences of Wolbachia infections. Trends in Genetics 19, 217-223.

Cheng Q, Ruel TD, Zhou W, et al. (2000) Tissue distribution and prevalence of Wolbachia infections in tsetse flies, Glossina spp. Medical and Veterinary Entomology 14, 44-50.

Chirgwin SR, Coleman SU, Porthouse KH, et al. (2003) Removal of Wolbachia from Brugia pahangi is closely linked to worm death and fecundity but does not result in altered lymphatic lesion formation in Mongolian gerbils (Meriones unguiculatus). Infection and Immunity 71, 6986-6994.

Chéron B, Cronin AL, Doums C, et al. (2011) Unequal resource allocation among colonies produced by fission in the ant Cataglyphis cursor. Ecology 92, 1448-1458.

Clémencet J, Viginier B, Doums C (2005) Hierarchical analysis of population genetic structure in the monogynous ant Cataglyphis cursor using microsatellite and mitochondrial DNA markers. Molecular ecology 14, 3735-3744.

Cronin AL, Molet M, Doums C, Monnin T, Peeters C (2013) Recurrent evolution of dependent colony foundation across eusocial insects. Annual Review of Entomology 58, 37.

Crozier RH, Page RE (1985) On being the right size: male contributions and multiple mating in social Hymenoptera. Behavioral Ecology and Sociobiology 18, 105-115.

Dalecky A, Renucci M, Tirard A, et al. (2007) Changes in composition of cuticular biochemicals of the facultatively polygynous ant Petalomyrmex phylax during range expansion in Cameroon with respect to social, spatial and genetic variation. Molecular Ecology 16, 3778-3791.

Debout G, Schatz B, Elias M, McKey D (2007) Polydomy in ants: what we know, what we think we know, and what remains to be done. Biological Journal of the Linnean Society 90, 319-348.

Dedeine F, Vavre F, Fleury F, et al. (2001) Removing symbiotic Wolbachia bacteria specifically inhibits oogenesis in a parasitic wasp. Proceedings of the National Academy of Sciences 98, 6247-6252.

DeHeer CJ, Goodisman MAD, Ross KG (1999) Queen dispersal strategies in the multiple-queen form of the fire ant Solenopsis invicta. The American Naturalist 153, 660-675.

DeHeer CJ, Tschinkel WR (1998) The success of alternative reproductive tactics in monogyne populations of the ant Solenopsis invicta: significance for transitions in social organization. Behavioral Ecology 9, 130-135.

Dejean A, Evraerts C (1997) Predatory behavior in the genus Leptogenys: A comparative study. Journal of Insect Behavior 10, 177-191.

Dingle H, Blakley NR, Miller ER (1980) Variation in body size and flight performance in milkweed bugs (Oncopeltus). Evolution 34, 371-385.

Dobson SL, Bourtzis K, Braig HR, et al. (1999) Wolbachia infections are distributed throughout insect somatic and germ line tissues. Insect Biochemistry and Molecular Biology 29, 153- 160.

Doums C, Cabrera H, Peeters C (2002) Population genetic structure and male-biased dispersal in the queenless ant Diacamma cyaneiventre. Molecular ecology 11, 2251-2264.

Dufils JM (2003) Remaining forest cover. In: The Natural History of Madagascar (eds. Goodman SM, Benstead JP), pp. 88-96. The University of Chicago Press, Chicago.

Durbin J, Bernard K, Fenn M (2003) The role of socioeconomic factors in loss of Malagasy biodiversity. In: The Natural History of Madagascar (eds. Goodman SM, Benstead JP), pp. 142-146. The University of Chicago Press, Chicago.

Díaz M (1992) Spatial and temporal patterns of granivorous ant seed predation in patchy cereal crop areas of central Spain. Oecologia 91, 561-568.

Ersts PJ Geographic Distance Matrix Generator(version 1.2.3). American Museum of Natural History, Center for Biodiversity and Conservation, http://biodiversityinformatics.amnh.org/open_source/gdmg

Fenn K, Blaxter M (2004) Are filarial nematode Wolbachia obligate mutualist symbionts? Trends in Ecology and Evolution 19, 163-166.

Fenn K, Blaxter M (2006) Wolbachia genomes: revealing the biology of parasitism and mutualism. Trends in Parasitology 22, 60-65.

Fenollar F, La Scola B, Inokuma H, et al. (2003) Culture and phenotypic characterization of a Wolbachia pipientis isolate. Journal of Clinical Microbiology 41, 5434-5441.

Fialho RF, Stevens L (2000) Male-killing Wolbachia in a flour beetle. Proceedings of the Royal Society of London. Series B: Biological Sciences 267, 1469-1473.

Fisher BL (1996) Origins and affinities of the ant fauna of Madagascar. Biogeographie de Madagascar, 457-465.

Fisher BL (1997) Biogeography and ecology of the ant fauna of Madagascar (Hymenoptera: Formicidae). Journal of Natural History 31, 269-302.

Fisher BL (2003) Formicidae, Ants. In: The Natural History of Madagascar (eds. Goodman SM, Benstead JP), pp. 811-819. The University of Chicago Press, Chicago.

Fisher BL (2005a) A model for a global inventory of ants: a case study in Madagascar. Proceedings of the California Academy of Sciences 56, 86-97.

Fisher BL (2005b) A new species of Discothyrea Roger from Mauritius and a new species of Proceratium Roger from Madagascar (Hymenoptera: Formicidae). Proceedings of the California Academy of Sciences 56, 657-667.

Fisher BL (2009) Two new dolichoderine ant genera from Madagascar: Aptinoma gen. n. and Ravavy gen. n. (Hymenoptera: Formicidae) Zootaxa 52, 37-52.

Fisher BL (2013) Antweb. Madagascar Ants. http://www.antweb.org

Fisher BL, Girman DJ (2000) Biogeography of ants in eastern Madagascar. Mémoires de la Société de Biogéographie, Paris, 331-344.

Fisher BL, Smith MA (2008) A revision of Malagasy species of Anochetus mayr and Odontomachus latreille (Hymenoptera: Formicidae). PloS one 3, e1787-e1787.

Fittkau EJ, Klinge H (1973) On biomass and trophic structure of the central Amazonian rain forest ecosystem. Biotropica 5, 2-14.

Foitzik S, Bauer S, Laurent S, Pennings PS (2009) Genetic diversity, population structure and sex-biased dispersal in three co-evolving species. Journal of Evolutionary Biology 22, 2470-2480.

Fournier D, Aron S, Milinkovitch MC (2002) Investigation of the population genetic structure and mating system in the ant Pheidole pallidula. Molecular Ecology 11, 1805-1814.

Franks NR (1982) Ecology and population regulation in the army ant Eciton burchelli Smithsonian Institution Press, WaWashington, DC.

Frost CL, Fernández-Marín H, Smith JE, Hughes WOH (2010) Multiple gains and losses of Wolbachia symbionts across a tribe of fungus-growing ants. Molecular Ecology 19, 4077-4085.

Fujii Y, Kageyama D, Hoshizaki S, Ishikawa H, Sasaki T (2001) Transfection of Wolbachia in Lepidoptera: the feminizer of the adzuki bean borer Ostrinia scapulalis causes male killing in the Mediterranean flour moth Ephestia kuehniella. Proceedings of the Royal Society of London. Series B: Biological Sciences 268, 855-859.

Gaston KJ, Lawton JH (1988) Patterns in the distribution and abundance of insect populations. Nature 331, 709-712.

Geraghty MJ, Dunn RR, Sanders NJ (2007) Body size, colony size, and range size in ants (Hymenoptera: Formicidae): are patterns along elevational and latitudinal gradients consistent with Bergmann’s Rule? Myrmecological News 10, 51-58.

Giordano R, O'Neill SL, Robertson HM (1995) Wolbachia infections and the expression of cytoplasmic incompatibility in Drosophila sechellia and D. mauritiana. Genetics 140, 1307-1317.

100

Giraud T, Blatrix R, Poteaux C, Solignac M, Jaisson P (2000) Population structure and mating biology of the polygynous ponerine ant Gnamptogenys striatula in Brazil. Molecular Ecology 9, 1835-1841.

Gronenberg W (1996) The trap-jaw mechanism in the dacetine ants Daceton armigerum and Strumigenys sp. Journal of experimental biology 199, 2021-2033.

Guillot G, Rousset F (2013) Dismantling the Mantel tests. Methods in Ecology and Evolution.

Gutiérrez D, Menéndez R (1997) Patterns in the distribution, abundance and body size of carabid beetles (Coleoptera: Caraboidea) in relation to dispersal ability. Journal of Biogeography 24, 903-914.

Gómez C, Espadaler X (2013) An update of the world survey of myrmecochorous dispersal distances. Ecography.

Hajibabaei M, Singer GAC, Hebert PDN, Hickey DA (2007) DNA barcoding: how it complements taxonomy, molecular phylogenetics and population genetics. Trends in Genetics 23, 167-172.

Hall TA (1999) Bioedit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41, 95-98.

Handel SN, Fisch SB, Schatz GE (1981) Ants disperse a majority of herbs in a mesic forest community in New York State. Bulletin of the Torrey Botanical Club 108, 430-437.

Hanzawa FM, Beattie AJ, Culver DC (1988) Directed dispersal: demographic analysis of an ant- seed mutualism. The American Naturalist 131, 1-13.

Hardy OJ, Pearcy M, Aron S (2008) Small-scale spatial genetic structure in an ant species with sex-biased dispersal. Biological Journal of the Linnean Society 93, 465-473.

Haskins CP (1941) Note on the Method of Colony Foundation of the Ponerine Ant Bothroponera Soror Emery. Journal of the New York Entomological Society 49, 211-216.

Hebert PDN, Cywinska A, Ball SL, deWaard JR (2003) Biological identifications through DNA barcodes. Proceedings of the Royal Society of London. Series B: Biological Sciences 270, 313-321.

Hebert PDN, Penton EH, Burns JM, Janzen DH, Hallwachs W (2004) Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proceedings of the National Academy of Sciences of the United States of America 101, 14812-14817.

Hedges LM, Brownlie JC, O'Neill SL, Johnson KN (2008) Wolbachia and virus protection in insects. Science 322, 702-702.

101

Heinze J (2008) The demise of the standard ant (Hymenoptera: Formicidae ). Myrmecological News 11, 9-20.

Heinze J, Buschinger A (1989) Queen polymorphism in Leptothorax spec. A: its genetic and ecological background (Hymenoptera: Formicidae). Insectes Sociaux 36, 139-155.

Heinze J, Tsuji K (1995) Ant reproductive strategies. Researches on Population Ecology 37, 135-149.

Henri H, Mouton L (2012) High-Resolution Melting technology: a new tool for studying the Wolbachia endosymbiont diversity in the field. Molecular Ecology Resources 12, 75-81.

Hertig M (1936) The rickettsia, Wolbachia pipientis (gen. et sp. n.) and associated inclusions of the mosquito, Culex pipiens. Parasitology 28, 453-486.

Hertig M, Wolbach SB (1924) Studies on rickettsia-like micro-organisms in insects. The Journal of Medical Research 44, 329.

Hilgenboecker K, Hammerstein P, Schlattmann P, Telschow A, Werren JH (2008) How many species are infected with Wolbachia? – a statistical analysis of current data. FEMS Microbiology Letters 281, 215-220.

Hiroki M, Kato Y, Kamito T, Miura K (2002) Feminization of genetic males by a symbiotic bacterium in a butterfly, Eurema hecabe (Lepidoptera: Pieridae). Naturwissenschaften 89, 167-170.

Hita Garcia F, Fischer G, Peters MK (2010) Taxonomy of the Tetramorium weitzeckeri species group (Hymenoptera: Formicidae) in the Afrotropical zoogeographical region. Zootaxa 2704, 1-90.

Holloway L (2003) Ecosystem restoration and rehabilitation in Madagascar. In: The Natural History of Madagascar (eds. Goodman SM, Benstead JP), pp. 1444-1451. The University of Chicago Press, Chicago.

Holway DA, Lach L, Suarez AV, Tsutsui ND, Case TJ (2002) The causes and consequences of ant invasions. Annual Review of Ecology and Systematics 33, 181-233.

Hotopp JCD, Clark ME, Oliveira DCSG, et al. (2007) Widespread lateral gene transfer from intracellular bacteria to multicellular eukaryotes. Science 317, 1753-1756.

Hoy MA, Jeyaprakash A (2005) Microbial diversity in the predatory mite Metaseiulus occidentalis (Acari: Phytoseiidae) and its prey, Tetranychus urticae (Acari: Tetranychidae). Biological Control 32, 427-441.

Huigens ME, De Almeida RP, Boons PAH, Luck RF, Stouthamer R (2004) Natural interspecific and intraspecific horizontal transfer of parthenogenesis–inducing Wolbachia in Trichogramma wasps. Proceedings of the Royal Society of London. Series B: Biological Sciences 271, 509-515.

102

Huigens ME, Luck RF, Klaassen RHG, et al. (2000) Infectious parthenogenesis. Nature 405, 178-179.

Hurst GD, Jiggins FM (2000) Male-killing bacteria in insects: mechanisms, incidence, and implications. Emerging Infectious Diseases 6, 329.

Hurst GDD, Jiggins FM (2005) Problems with mitochondrial DNA as a marker in population, phylogeographic and phylogenetic studies: the effects of inherited symbionts. Proceedings of the Royal Society B: Biological Sciences 272, 1525-1534.

Hurst GDD, Jiggins FM, Hinrich Graf von der Schulenburg J, et al. (1999) Male–killing Wolbachia in two species of insect. Proceedings of the Royal Society B: Biological Sciences 266, 735-740.

Hurst GDD, Johnson AP, vd Schulenburg JHG, Fuyama Y (2000) Male-killing Wolbachia in Drosophila: a temperature-sensitive trait with a threshold bacterial density. Genetics 156, 699-709.

Hölldobler B, Wilson EO (1990) The Ants Harvard University Press, Cambridge, Massachusetts.

Ivanova NV, Dewaard JR, Hebert PDN (2006) An inexpensive, automation-friendly protocol for recovering high-quality DNA. Molecular Ecology Notes 6, 998-1002.

Janzen DH, Hallwachs W, Blandin P, et al. (2009) Integration of DNA barcoding into an ongoing inventory of complex tropical biodiversity. Molecular Ecology Resources 9, 1- 26.

Jeyaprakash A, Hoy MA (2000) Long PCR improves Wolbachia DNA amplification: wsp sequences found in 76% of sixty-three arthropod species. Insect Molecular Biology 9, 393-405.

Jiggins FM (2003) Male-killing Wolbachia and mitochondrial DNA: selective sweeps, hybrid introgression and parasite population dynamics. Genetics 164, 5-12.

Jiggins FM, Bentley JK, Majerus MEN, Hurst GDD (2001) How many species are infected with Wolbachia? Cryptic sex ratio distorters revealed to be common by intensive sampling. Proceedings of the Royal Society of London. Series B: Biological Sciences 268, 1123- 1126.

Johnson R (2010) Independent colony founding by ergatoid queens in the ant genus Pogonomyrmex: queen foraging provides an alternative to dependent colony founding. Insectes Sociaux 57, 169-176.

Jolley K, Chan M-S, Maiden M (2004) mlstdbNet–distributed multi-locus sequence typing (MLST) databases. BMC Bioinformatics 5, 86-93.

Juliano SA (1983) Body size, dispersal ability, and range size in North American species of Brachinus (Coleoptera: Carabidae). The Coleopterists' Bulletin 37, 232-238.

103

Kageyama D, Nishimura G, Hoshizaki S, Ishikawa Y (2002) Feminizing Wolbachia in an insect, Ostrinia furnacalis (Lepidoptera: Crambidae). Heredity 88, 444-449.

Kageyama D, Traut W (2004) Opposite sex–specific effects of Wolbachia and interference with the sex determination of its host Ostrinia scapulalis. Proceedings of the Royal Society of London. Series B: Biological Sciences 271, 251-258.

Kaufmann E, Malsch AKF, Erle M, Maschwitz U (2003) Compound nesting of Strumigenys sp. (Myrmicinae) and Diacamma sp. (Ponerinae), and other nesting symbioses of myrmicine and ponerine ants in Southeast Asia. Insectes Sociaux 50, 88-97.

Kautz S, Rubin BER, Moreau CS (2013a) Bacterial Infections across the Ants: Frequency and Prevalence of Wolbachia, Spiroplasma, and Asaia. Psyche: A Journal of Entomology 2013.

Kautz S, Rubin BER, Russell JA, Moreau CS (2013b) Surveying the microbiome of ants: Comparing 454 pyrosequencing with traditional methods to uncover bacterial diversity. Applied and environmental microbiology 79, 525-534.

Keller L, Passera L (1989) Size and fat content of gynes in relation to the mode of colony founding in ants (Hymenoptera; Formicidae). Oecologia 80, 236-240.

Kelly CA (1986) Extrafloral nectaries: ants, herbivores and fecundity in Cassia fasciculata. Oecologia 69, 600-605.

Kembel SW, Cowan PD, Helmus MR, et al. (2010) Picante: R tools for integrating phylogenies and ecology. Bioinformatics 26, 1463-1464.

Kimura M (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16, 111-120.

Kittayapong P, Jamnongluk W, Thipaksorn A, Milne JR, Sindhusake C (2003) Wolbachia infection complexity among insects in the tropical rice-field community. Molecular Ecology 12, 1049-1060.

Kull CA (2003) Fire and management of highland vegetation. In: The Natural History of Madagascar (eds. Goodman SM, Benstead JP), pp. 153-157. The University of Chicago Press, Chicago.

Legendre P (2000) Comparison of permutation methods for the partial correlation and partial Mantel tests. Journal of Statistical Computation and Simulation 67, 37-73.

Legendre P, Fortin M-J (2010) Comparison of the Mantel test and alternative approaches for detecting complex multivariate relationships in the spatial analysis of genetic data. Molecular Ecology Resources 10, 831-844.

104

Lenoir A, Querard L, Pondicq N, Berton F (1988) Reproduction and dispersal in the ant Cataglyphis cursor (Hymenoptera: Formicidae). Psyche 95, 21-44.

Levitsky A, Fisher BL, Smith MA (In review) The Utility of Standardized DNA Markers in the Species Delineation of the Malagasy Ant Melissotarsus insularis (Santschi, 1911). PLoS ONE.

Liautard C, Keller L (2001) Restricted effective queen dispersal at a microgeographic scale in polygynous populations of the ant Formica exsecta. Evolution 55, 2484-2492.

Lo N, Casiraghi M, Salati E, Bazzocchi C, Bandi C (2002) How many Wolbachia supergroups exist? Molecular Biology and Evolution 19, 341-346.

Maier E, Tollrian R, Rinkevich B, Nürnberger B (2005) Isolation by distance in the scleractinian coral Seriatopora hystrix from the Red Sea. Marine Biology 147, 1109-1120.

Mantel N (1967) The detection of disease clustering and a generalized regression approach. Cancer Research 27, 209-220.

Markin GP, Collins HL, Dillier JH (1972) Colony founding by queens of the red imported fire ant, Solenopsis invicta. Annals of the Entomological Society of America 65, 1053-1058.

Meirmans PG (2012) The trouble with isolation by distance. Molecular Ecology 21, 2839-2846.

Min K-T, Benzer S (1997) Wolbachia, normally a symbiont of Drosophila, can be virulent, causing degeneration and early death. Proceedings of the National Academy of Sciences 94, 10792-10796.

Mitsuhashi W, Saiki T, Wei W, Kawakita H, Sato M (2002) Two novel strains of Wolbachia coexisting in both species of mulberry leafhoppers. Insect Molecular Biology 11, 577-584.

Molet M, Fisher BL, Ito F, Peeters C (2009) Shift from independent to dependent colony foundation and evolution of "multi-purpose" ergatoid queens in Mystrium ants (subfamily Amblyoponinae). Biological Journal of the Linnean Society 98, 198-207.

Molet M, Peeters C (2006) Evolution of wingless reproductives in ants: weakly specialized ergatoid queen instead of gamergates in Platythyrea conradti. Insectes Sociaux 53, 177- 182.

Molet M, Peeters C, Fisher BL (2007a) Permanent loss of wings in queens of the ant Odontomachus coquereli from Madagascar. Insectes Sociaux 54, 183-188.

Molet M, Peeters C, Fisher BL (2007b) Winged queens replaced by reproductives smaller than workers in Mystrium ants. Naturwissenschaften 94, 280-287.

Molet M, Wheeler DE, Peeters C (2012) Evolution of novel mosaic castes in ants: modularity, phenotypic plasticity, and colonial buffering. The American Naturalist 180, 328-341.

105

Moreau CS, Bell CD, Vila R, Archibald SB, Pierce NE (2006) Phylogeny of the ants: diversification in the age of angiosperms. Science 312, 101-104.

Mueller UG, Schultz TR, Cameron R. Currie, Adams RMM, Malloch D (2001) The origin of the Attine ant-fungus mutualism. The Quarterly Review of Biology 76, 169-197.

Murrell DJ, Travis JMJ, Dytham C (2002) The evolution of dispersal distance in spatially‐ structured populations. Oikos 97, 229-236.

Nathan R (2006) Long-Distance Dispersal of Plants. Science 313, 786-788.

Negri I, Pellecchia M, Mazzoglio PJ, Patetta A, Alma A (2006) Feminizing Wolbachia in Zyginidia pullula (Insecta, Hemiptera), a leafhopper with an XX/X0 sex-determination system. Proceedings of the Royal Society B: Biological Sciences 273, 2409-2416.

O'Neill SL, Giordano R, Colbert AM, Karr TL, Robertson HM (1992) 16S rRNA phylogenetic analysis of the bacterial endosymbionts associated with cytoplasmic incompatibility in insects. Proceedings of the National Academy of Sciences 89, 2699-2702.

Oliver I, Beattie AJ (1996) Designing a cost-effective invertebrate survey: a test of methods for rapid assessment of biodiversity. Ecological Applications 6, 594-607.

Pamilo P, Gertsch P, Thoren P, Seppa P (1997) Molecular population genetics of social insects. Annual Review of Ecology and Systematics 28, 1-25.

Pannebakker BA, Loppin B, Elemans CPH, Humblot L, Vavre F (2007) Parasitic inhibition of cell death facilitates symbiosis. Proceedings of the National Academy of Sciences 104, 213-215.

Passera L, Keller L (1990) Loss of mating flight and shift in the pattern of carbohydrate storage in sexuals of ants (Hymenoptera; Formicidae). Journal of Comparative Physiology B 160, 207-211.

Peeters C (2012) Convergent evolution of wingless reproductives across all subfamilies of ants, and sporadic loss of winged queens (Hymenoptera: Formicidae). Myrmecological News 16, 75-91.

Peeters C, Ito F (2001) Colony dispersal and the evolution of queen morphology in social Hymenoptera. Annual Review of Entomology 46, 601-630.

Peeters C, Keller RA, Johnson RA (2012) Selection against aerial dispersal in ants: two non- flying queen phenotypes in Pogonomyrmex laticeps. PLoS ONE 7, e47727.

Peeters C, Molet M (2010a) Evolution of advanced social traits in phylogenetically basal ants: striking worker polymorphism and large queens in Amblyopone australis. Insectes Sociaux 57, 177-183.

106

Peeters I, Molet M (2010b) Colonial reproduction and life histories. In: Ant Ecology (eds. Lach L, Parr CL, Abbott KL), pp. 159-176. Oxford University Press, New York.

Pfenninger M, Bahl A, Streit B (1996) Isolation by distance in a population of a small land snail Trochoidea geyeri: evidence from direct and indirect methods. Proceedings of the Royal Society of London. Series B: Biological Sciences 263, 1211-1217.

Pogson GH, Taggart CT, Mesa KA, Boutilier RG (2001) Isolation by distance in the Atlantic cod, Gadus morhua, at large and small geographic scales. Evolution 55, 131-146.

Poinsot D, Charlat S, Mercot H (2003) On the mechanism of Wolbachia‐induced cytoplasmic incompatibility: confronting the models with the facts. Bioessays 25, 259-265.

Presgraves DC (2000) A genetic test of the mechanism of Wolbachia-induced cytoplasmic incompatibility in Drosophila. Genetics 154, 771-776.

Pringle EG, RamÍRez SR, Bonebrake TC, Gordon DM, Dirzo R (2012) Diversification and phylogeographic structure in widespread Azteca plant-ants from the northern Neotropics. Molecular Ecology 21, 3576-3592.

Prugnolle F, de Meeus T (2002) Inferring sex-biased dispersal from population genetic tools: a review. Heredity 88, 161-165.

R Development Core Team (2012) R: A Language and Environment for Statistical Computing, Version 2.15.1. The R Foundation for Statistical Computing, Vienna, Austria.

Randrianandianina B, Andriamahaly LR, Harisoa FM, Nicoll ME (2003) The role of the protected areas in the management of the island's biodiversity. In: The Natural History of Madagascar (eds. Goodman SM, Benstead JP), pp. 1423-1432. The University of Chicago Press, Chicago.

Ranriambololona YN, Bohannon J (2009) Madagascar’s Coup Endangers Science and Scientists. Science 323, 1654-1655.

Ratnasingham S, Hebert PDN (2007) BOLD: The Barcode of Life Data System (http://www.barcodinglife.org). Molecular Ecology Notes 7, 355-364.

Raychoudhury R, Baldo L, Oliveira DCSG, Werren JH (2009) Modes of acquisition of Wolbachia: horizontal transfer, hybrid introgression, and codivergence in the Nasonia species complex. Evolution 63, 165-183.

Reuter M, Keller L (2003) High levels of multiple Wolbachia infection and recombination in the ant Formica exsecta. Molecular Biology, 748-753.

Rigaud T, Juchault P (1993) Conflict between feminizing sex ratio distorters and an autosomal masculinizing gene in the terrestrial isopod Armadillidium vulgare Latr. Genetics 133, 247-252.

107

Rigaud T, Juchault P, Mocquard JP (1997) The evolution of sex determination in isopod crustaceans. Bioessays 19, 409-416.

Risch SJ, Carroll CR (1982) Effect of a keystone predaceous ant, Solenopsis geminata, on arthropods in a tropical agroecosystem. Ecology 63, 1979-1983.

Robertson HG, Villet M (1989) Mating behaviour in three species of myrmicine ants. Journal of Natural History 23, 767-773.

Ros VID, Fleming VM, Feil EJ, Breeuwer JAJ (2009) How diverse is the genus Wolbachia? Multiple-gene sequencing reveals a putatively new Wolbachia supergroup recovered from spider mites (Acari: Tetranychidae). Applied and Environmental Microbiology 75, 1036-1043.

Ross KG (2001) Molecular ecology of social behaviour: analyses of breeding systems and genetic structure. Molecular Ecology 10, 265-284.

Ross KG, Krieger MJB, Shoemaker DD, Vargo EL, Keller L (1997) Hierarchical analysis of genetic structure in native fire ant populations: results from three classes of molecular markers. Genetics 147, 643-655.

Rousset F, Bouchon D, Pintureau B, Juchault P, Solignac M (1992) Wolbachia endosymbionts responsible for various alterations of sexuality in arthropods. Proceedings of the Royal Society B: Biological Sciences 250, 91-98.

Russell JA (2012) The ants (Hymenoptera: Formicidae ) are unique and enigmatic hosts of prevalent Wolbachia (Alphaproteobacteria) symbionts. Myrmecological News 16, 7-23.

Russell JA, Goldman-Huertas B, Moreau CS, et al. (2009) Specialization and geographic isolation among Wolbachia symbionts from ants and lycaenid butterflies. Evolution 63, 624-640.

Ruxton GD (2006) The unequal variance t-test is an underused alternative to Student's t-test and the Mann–Whitney U test. Behavioral Ecology 17, 688-690.

Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4, 406-425.

Sanetra M, Crozier RH (2003) Patterns of population subdivision and gene flow in the ant Nothomyrmecia macrops reflected in microsatellite and mitochondrial DNA markers. Molecular Ecology 12, 2281-2295.

Saridaki A, Bourtzis K (2010) Wolbachia: more than just a bug in insects genitals. Current Opinion in Microbiology 13, 67-72.

Sasaki T, Kubo T, Ishikawa H (2002) Interspecific transfer of Wolbachia between two lepidopteran insects expressing cytoplasmic incompatibility: a Wolbachia variant

108

naturally infecting Cadra cautella causes male killing in Ephestia kuehniella. Genetics 162, 1313-1319.

Schlick-Steiner BC, Steiner FM, Sanetra M, et al. (2005) Queen size dimorphism in the ant Tetramorium moravicum (Hymenoptera, Formicidae): Morphometric, molecular genetic and experimental evidence. Insectes Sociaux 52, 186-193.

Schneider CA, Rasband WS, Eliceiri KW (2012) NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9, 671-675.

Schuurman D (2009) Illegal logging of rosewood in the rainforests of northeast Madagascar. TRAFFIC Bulletin 22, 49.

Schuurman D, Lowry II PP (2009) The Madagascar rosewood massacre.

Seigo H, Katsusuke Y (1979) Influence of a supercolonial ant Formica (Formica) yessensis Forel on the distribution of other ants in Ishikari Coast. Japanese Journal of Ecology 29, 257-264.

Seppa P, Fernandez-Escudero I, Gyllenstrand N, Pamilo P (2006) Obligatory female philopatry affects genetic population structure in the ant Proformica longiseta. Insectes Sociaux 53, 362-368.

Seppa P, Gyllenstrand M, Corander J, Pamilo P (2004) Coexistence of the social types: Genetic population structure in the ant Formica exsecta. Evolution 58, 2462-2471.

Seppä P, Fernández-Escudero I, Gyllenstrand N, Pamilo P (2006) Obligatory female philopatry affects genetic population structure in the ant Proformica longiseta. Insectes Sociaux 53, 362-368.

Seppä P, Gyllenstrand N, Corander J, Pamilo P (2004) Coexistence of the social types: genetic population structure in the ant Formica exsecta. Evolution 58, 2462-2471.

Shoemaker D, Keller G, Ross KG (2003a) Effects of Wolbachia on mtDNA variation in two fire ant species. Molecular Ecology 12, 1757-1771.

Shoemaker DD, Ahrens M, Sheill L, et al. (2003b) Distribution and prevalence of Wolbachia infections in native populations of the fire ant Solenopsis invicta (Hymenoptera: Formicidae). Environmental Entomology 32, 1329-1336.

Shoemaker DD, DeHeer CJ, Krieger MJB, Ross KG (2006) Population genetics of the invasive fire ant Solenopsis invicta (Hymenoptera : Formicidae) in the United States. Annals of the Entomological Society of America 99, 1213-1233.

Shoemaker DD, Ross KG, Keller L, Vargo EL, Werren JH (2000) Wolbachia infections in native and introduced populations of fire ants (Solenopsis spp.). Insect Molecular Biology 9, 661-673.

109

Shorthouse DP (2010) SimpleMappr, an online tool to produce publication-quality point maps. http://www.simplemappr.net.

Simon C, Frati F, Beckenbach A, et al. (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. 87, 651-701.

Sintupachee S, Milne JR, Poonchaisri S, Baimai V, Kittayapong P (2006) Closely related Wolbachia strains within the pumpkin arthropod community and the potential for horizontal transmission via the plant. Microbial Ecology 51, 294-301.

Slatkin M (1985) Gene flow in natural populations. Annual Review of Ecology and Systematics 16, 393-430.

Slatkin M (1987) Gene flow and the geographic structure of natural populations. Science 236, 787-792.

Smith MA, Bertrand C, Crosby K, et al. (2012) Wolbachia and DNA barcoding insects: patterns, potential, and problems. PLoS One 7, e36514.

Smith MA, Fernandez-Triana J, Roughley ROB, Hebert PDN (2009) DNA barcode accumulation curves for understudied taxa and areas. Molecular Ecology Resources 9, 208-216.

Smith MA, Fisher BL (2009) Invasions, DNA barcodes, and rapid biodiversity assessment using ants of Mauritius. Frontiers in zoology 6, 31-31.

Smith MA, Fisher BL, Hebert PDN (2005) DNA barcoding for effective biodiversity assessment of a hyperdiverse arthropod group: the ants of Madagascar. Philosophical transactions of the Royal Society of London.Series B, Biological sciences 360, 1825-1834.

Smith MA, Rodriguez JJ, Whitfield JB, et al. (2008) Extreme diversity of tropical parasitoid wasps exposed by iterative integration of natural history, DNA barcoding, morphology, and collections. Proceedings of the National Academy of Sciences 105, 12359-12364.

Smith MA, Woodley NE, Janzen DH, Hallwachs W, Hebert PDN (2006) DNA barcodes reveal cryptic host-specificity within the presumed polyphagous members of a genus of parasitoid flies (Diptera: Tachinidae). Proceedings of the National Academy of Sciences of the United States of America 103, 3657-3662.

Sobel JM, Chen GF, Watt LR, Schemske DW (2010) The biology of speciation. Evolution 64, 295-315.

Stille M, Stille B (1993) Intrapopulation nestclusters of maternal mtDNA lineages in the polygynous ant Leptothorax acervorum (Hymenoptera: Formicidae). Insect Molecular Biology 1, 117-121.

110

Stouthamer R, Breeuwer JAJ, Hurst GDD (1999) Wolbachia pipientis: microbial manipulator of arthropod reproduction. Annual Reviews in Microbiology 53, 71-102.

Stouthamer R, Kazmer DJ (1994) Cytogenetics of microbe-associated parthenogenesis and its consequences for gene flow in Trichogramma wasps. Heredity 73, 317-327.

Stouthamer R, Luck RF, Hamilton WD (1990) Antibiotics cause parthenogenetic Trichogramma (Hymenoptera/Trichogrammatidae) to revert to sex. Proceedings of the National Academy of Sciences 87, 2424-2427.

Suarez AV, Holway DA, Case TJ (2001) Patterns of spread in biological invasions dominated by long-distance jump dispersal: insights from Argentine ants. Proceedings of the National Academy of Sciences 98, 1095-1100.

Sundström L, Seppä P, Pamilo P (2005) Genetic population structure and dispersal patterns in Formica ants- a review. Annales Zoologici Fennici 42, 163-177.

Sussman LK, Green GM, Sussman RW (1996) The use of satellite imagery and anthropology to assess the causes of deforestation in Madagascar. In: Tropical Deforestation: The Human Dimension (eds. E. SL, N. HT, C. BR), pp. 315-315. Columbia University Press, New York.

Tamura K, Peterson D, Peterson N, et al. (2011) MEGA 5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28, 2731-2739.

Taylor R (1990) Interpretation of the correlation coefficient: a basic review. Journal of Diagnostic Medical Sonography 6, 35-39.

Taylor RW, Wilson EO (1961) Ants from three remote oceanic islands. Psyche 68, 137-144.

Teixeira L, Ferreira Á, Ashburner M (2008) The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. PLoS Biology 6, e1000002.

Telschow A, Flor M, Kobayashi Y, Hammerstein P, Werren JH (2007) Wolbachia-induced unidirectional cytoplasmic incompatibility and speciation: mainland-island model. PLoS ONE 2, e701.

Templeton AR (2008) Nested clade analysis: an extensively validated method for strong phylogeographic inference. Molecular Ecology 17, 1877-1880.

Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-4680.

Tram U, Sullivan W (2002) Role of delayed nuclear envelope breakdown and mitosis in Wolbachia-induced cytoplasmic incompatibility. Science 296, 1124-1126.

111

Tsutsui ND, Kauppinen SN, Oyafuso AF, Grosberg RK (2003) The distribution and evolutionary history of Wolbachia infection in native and introduced populations of the invasive Argentine ant (Linepithema humile). Molecular Ecology 12, 3057-3068.

Turelli M, Hoffmann AA (1995) Cytoplasmic incompatibility in Drosophila simulans: dynamics and parameter estimates from natural populations. Genetics 140, 1319-1338.

Unckless RL, Boelio LM, Herren JK, Jaenike J (2009) Wolbachia as populations within individual insects: causes and consequences of density variation in natural populations. Proceedings of the Royal Society B: Biological Sciences 276, 2805-2811.

Underwood EC, Fisher BL (2006) The role of ants in conservation monitoring: if, when, and how. Biological Conservation 132, 166-182.

Valentini A, Pompanon F, Taberlet P (2009) DNA barcoding for ecologists. Trends in Ecology & Evolution 24, 110-117.

Van Borm S, Wenseleers T, Billen J, Boomsma JJ (2001) Wolbachia in leafcutter ants: a widespread symbiont that may induce male killing or incompatible matings. Journal of Evolutionary Biology 14, 805-814.

Vavre F, De Jong JH, Stouthamer R (2004) Cytogenetic mechanism and genetic consequences of thelytoky in the wasp Trichogramma cacoeciae. Heredity 93, 592-596.

Vavre F, Fleury F, Varaldi J, Fouillet P, Bouletreau M (2002) Infection polymorphism and cytoplasmic incompatibility in Hymenoptera-Wolbachia associations. Heredity 88, 361- 365.

Vences M, Wollenberg KC, Vieites DR, Lees DC (2009) Madagascar as a model region of species diversification. Trends in Ecology and Evolution 24, 456-465.

Viljakainen L, Reuter M, Pamilo P (2008) Wolbachia transmission dynamics in Formica wood ants. BMC Evolutionary Biology 8, 55.

Villet M (1989) A syndrome leading to ergatoid queens in ponerine ants. Journal of Natural History 23, 825-832.

Vogt JT, Appel AG, S. West M (2000) Flight energetics and dispersal capability of the fire ant, Solenopsis invicta Buren. Journal of Insect Physiology 46, 697-707.

Wade MJ, Chang NW (1995) Increased male fertility in Tribolium confusum beetles after infection with the intracellular parasite Wolbachia. Nature 373, 72-74.

Wagner D, Jones JB, Gordon DM (2004) Development of harvester ant colonies alters soil chemistry. Soil Biology and Biochemistry 36, 797-804.

Way MJ (1963) Mutualism between ants and honeydew-producing Homoptera. Annual Review of Entomology 8, 307-344.

112

Webb CO, Ackerly DD, McPeek MA, Donoghue MJ (2002) Phylogenies and community ecology. Annual Review of Ecology and Systematics, 475-505.

Weber NA (1938) The biology of the fungus-growing ants. Part IV. Additional new forms. Part V. The Attini of Bolivia. Revista de Entomologia 9, 154-206.

Weeks AR, Breeuwer JAJ (2001) Wolbachia–induced parthenogenesis in a genus of phytophagous mites. Proceedings of the Royal Society of London. Series B: Biological Sciences 268, 2245-2251.

Weeks AR, Turelli M, Harcombe WR, Reynolds KT, Hoffmann AA (2007) From parasite to mutualist: rapid evolution of Wolbachia in natural populations of Drosophila. PLoS biology 5, e114.

Weeks AR, Velten R, Stouthamer R (2003) Incidence of a new sex–ratio–distorting endosymbiotic bacterium among arthropods. Proceedings of the Royal Society of London. Series B: Biological Sciences 270, 1857-1865.

Weiser MD, Kaspari M (2006) Ecological morphospace of New World ants. Ecological Entomology 31, 131-142.

Welch BL (1938) The significance of the difference between two means when the population variances are unequal. Biometrika 29, 350-362.

Wenseleers F (1998) Widespread occurrence of the micro-organism Wolbachia in ants. Proceedings of the Royal Society B: Biological Sciences 265, 1447-1452.

Wenseleers T, Billen J (2000) No evidence for Wolbachia-induced parthenogenesis in the social Hymenoptera. Journal of Evolutionary Biology 13, 277-280.

Wenseleers T, Sundström L, Billen J (2002) Deleterious Wolbachia in the ant Formica truncorum. Proceedings of the Royal Society of London. Series B: Biological Sciences 269, 623-629.

Werren JH (1997) Biology of Wolbachia. Annual Review of Entomology 42, 587-609.

Werren JH, Windsor D, Guo L (1995a) Distribution of Wolbachia among neotropical arthropods. Proceedings of the Royal Society of London. Series B: Biological Sciences 262, 197-204.

Werren JH, Windsor DM (2000) Wolbachia infection frequencies in insects: evidence of a global equilibrium? Proceedings of the Royal Society of London. Series B: Biological Sciences 267, 1277-1285.

Werren JH, Zhang W, Guo LR (1995b) Evolution and phylogeny of Wolbachia: reproductive parasites of arthropods. Proceedings of the Royal Society of London. Series B: Biological Sciences 261, 55-63.

113

Wheeler DE, Martínez T (1995) Storage proteins in ants (Hymenoptera:Formicidae). Comparative Biochemistry and Physiology - Part B: Biochemistry & Molecular Biology 112, 15-19.

Wilmé L, Goodman SM, Ganzhorn JU (2006) Biogeographic evolution of Madagascar's microendemic biota. Science 312, 1063-1065.

Wilson EO (1959) Some ecological characteristics of ants in New Guinea rain forests. Ecology 40, 437-447.

Wilson EO (1976) Which are the most prevalent ant genera? Studia Entomologica 19, 187-200.

Wilson EO (1985) The sociogenesis of insect colonies. Science 228, 1489-1495.

Wilson EO (1987) The earliest known ants: an analysis of the Cretaceous species and an inference concerning their social organization. Paleobiology, 44-53.

Wright S (1931) Evolution in Mendelian populations. Genetics 16, 97-159.

Wright S (1943) Isolation by distance. Genetics 28, 114.

Xiao JH, Wang NX, Murphy RW, et al. (2012) Wolbachia infection and dramatic intraspecific mitochondrial DNA divergence in a fig wasp. Evolution 66, 1907-1916.

Yamaucm K, Ogata K (1995) Social Structure and Reproductive Systems of Tramp Versus Endemic Ants (Hymenoptera: Formicidae) of the Ryukyu Islands! Pacific Science 49, 55- 68.

Yoshimura M, Fisher BL (2007) A revision of male ants of the Malagasy region (Hymenoptera: Formicidae): Key to subfamilies and treatment of the genera of Ponerinae. Zootaxa 1654, 21-40.

Zchori-Fein E, Perlman SJ (2004) Distribution of the bacterial symbiont Cardinium in arthropods. Molecular Ecology 13, 2009-2016.

Zera AJ, Denno RF (1997) Physiology and ecology of dispersal polymorphism in insects. Annual Review of Entomology 42, 207-230.

Zhang D-X, Hewitt GM (1996) Nuclear integrations: challenges for mitochondrial DNA markers. Trends in Ecology and Evolution 11, 247-251.

114

Appendix S1 Chapter 2- BOLD Process IDs and Genbank Accession No.

Table S5.1- BOLD process IDs and Genbank accessions for all ants used in Chapter 2.

Species BOLD Process ID Genback Accession No. Anochetus boltoni ASAM042-05 EF610885 Anochetus boltoni ASAM043-05 EF610886 Anochetus boltoni ASAM044-05 EF610887 Anochetus boltoni ASAM045-05 EF610888 Anochetus boltoni ASAM046-05 EF610889 Anochetus boltoni ASAM037-05 EF610890 Anochetus boltoni ASAM038-05 EF610891 Anochetus boltoni ASAM039-05 EF610892 Anochetus boltoni ASAM040-05 EF610893 Anochetus boltoni ASAM041-05 EF610894 Anochetus boltoni ASAMX291-06 EF610895 Anochetus boltoni JDWAM849-05 EF610896 Anochetus goodmani JDWAM377-05 DQ176184 Anochetus goodmani JDWAM328-05 DQ176221 Anochetus goodmani JDWAM306-05 DQ176248 Anochetus goodmani ASAM012-05 EF610840 Anochetus goodmani ASAM027-05 EF610841 Anochetus goodmani ASAM013-05 EF610842 Anochetus goodmani ASAM028-05 EF610843 Anochetus goodmani ASAM029-05 EF610844 Anochetus goodmani ASAM014-05 EF610845 Anochetus goodmani ASAM030-05 EF610846 Anochetus goodmani ASAM015-05 EF610847 Anochetus goodmani ASAM031-05 EF610848 Anochetus goodmani ASAM001-05 EF610849 Anochetus goodmani ASAM016-05 EF610850 Anochetus goodmani ASAM017-05 EF610851 Anochetus goodmani ASAM032-05 EF610852 Anochetus goodmani ASAM002-05 EF610853 Anochetus goodmani ASAM018-05 EF610854 Anochetus goodmani ASAM033-05 EF610855 Anochetus goodmani ASAM003-05 EF610856 Anochetus goodmani ASAM019-05 EF610857 Anochetus goodmani ASAM034-05 EF610858 Anochetus goodmani ASAM004-05 EF610859

115

Species BOLD Process ID Genback Accession No. Anochetus goodmani ASAM035-05 EF610860 Anochetus goodmani ASAM005-05 EF610861 Anochetus goodmani ASAM020-05 EF610862 Anochetus goodmani ASAM036-05 EF610863 Anochetus goodmani ASAM006-05 EF610864 Anochetus goodmani ASAM021-05 EF610865 Anochetus goodmani ASAM007-05 EF610866 Anochetus goodmani ASAM022-05 EF610867 Anochetus goodmani ASAM023-05 EF610868 Anochetus goodmani ASAM008-05 EF610869 Anochetus goodmani ASAM024-05 EF610870 Anochetus goodmani ASAM009-05 EF610871 Anochetus goodmani ASAM025-05 EF610872 Anochetus goodmani ASAM010-05 EF610873 Anochetus goodmani ASAM011-05 EF610874 Anochetus goodmani ASAM026-05 EF610875 Anochetus goodmani JDWAM841-05 EF610876 Anochetus goodmani JDWAM842-05 EF610877 Anochetus goodmani JDWAM843-05 EF610878 Anochetus goodmani JDWAM844-05 EF610879 Anochetus goodmani JDWAM845-05 EF610880 Anochetus goodmani JDWAM846-05 EF610881 Anochetus goodmani JDWAM847-05 EF610882 Anochetus goodmani JDWAM848-05 EF610883 Anochetus goodmani JDWAM020-04 EF610884 Anochetus goodmani ASNAU856-09 KF200330 Anochetus goodmani ASNAU863-09 KF200768 Anochetus grandidieri JDWAM391-05 DQ176183 Anochetus grandidieri JDWAM370-05 DQ176193 Anochetus grandidieri JDWAM298-05 DQ176256 Anochetus grandidieri JDWAM284-05 DQ176258 Anochetus grandidieri JDWAM258-05 DQ176278 Anochetus grandidieri ASAM3049-05 EF610629 Anochetus grandidieri ASAMF748-06 EF610630 Anochetus grandidieri ASAMF733-06 EF610631 Anochetus grandidieri ASAMF808-06 EF610632 Anochetus grandidieri ASAMF763-06 EF610633 Anochetus grandidieri ASAMF734-06 EF610634 Anochetus grandidieri ASAMF794-06 EF610635 Anochetus grandidieri ASAMF779-06 EF610636

116

Species BOLD Process ID Genback Accession No. Anochetus grandidieri ASAMF764-06 EF610637 Anochetus grandidieri ASAMF735-06 EF610638 Anochetus grandidieri ASAMF795-06 EF610639 Anochetus grandidieri ASAMF780-06 EF610640 Anochetus grandidieri ASAMF736-06 EF610641 Anochetus grandidieri ASAMF796-06 EF610642 Anochetus grandidieri ASAMF751-06 EF610643 Anochetus grandidieri ASAMF737-06 EF610644 Anochetus grandidieri ASAMF752-06 EF610645 Anochetus grandidieri ASAMF738-06 EF610646 Anochetus grandidieri ASAMF739-06 EF610647 Anochetus grandidieri ASAMF754-06 EF610648 Anochetus grandidieri ASAMF740-06 EF610649 Anochetus grandidieri ASAMF755-06 EF610650 Anochetus grandidieri ASAMF741-06 EF610651 Anochetus grandidieri ASAMF756-06 EF610652 Anochetus grandidieri ASAMF742-06 EF610653 Anochetus grandidieri ASAMF787-06 EF610654 Anochetus grandidieri ASAMF743-06 EF610655 Anochetus grandidieri ASAMF788-06 EF610656 Anochetus grandidieri ASAMF758-06 EF610657 Anochetus grandidieri ASAMF744-06 EF610658 Anochetus grandidieri ASAMF759-06 EF610659 Anochetus grandidieri ASAMF745-06 EF610660 Anochetus grandidieri ASAMF760-06 EF610661 Anochetus grandidieri ASAMF746-06 EF610662 Anochetus grandidieri ASAMF761-06 EF610663 Anochetus grandidieri ASAMF747-06 EF610664 Anochetus grandidieri ASAMF807-06 EF610665 Anochetus grandidieri ASAMF762-06 EF610666 Anochetus grandidieri ASAMX717-06 EF610667 Anochetus grandidieri ASAMX687-06 EF610668 Anochetus grandidieri ASAMX747-06 EF610669 Anochetus grandidieri ASAMX688-06 EF610670 Anochetus grandidieri ASAMX719-06 EF610671 Anochetus grandidieri ASAMX689-06 EF610672 Anochetus grandidieri ASAMX705-06 EF610673 Anochetus grandidieri ASAMX676-06 EF610674 Anochetus grandidieri ASAMX722-06 EF610675 Anochetus grandidieri ASAMX692-06 EF610676

117

Species BOLD Process ID Genback Accession No. Anochetus grandidieri ASAMX693-06 EF610677 Anochetus grandidieri ASAMX694-06 EF610678 Anochetus grandidieri ASAMX711-06 EF610679 Anochetus grandidieri ASAMX712-06 EF610680 Anochetus grandidieri ASAMX683-06 EF610681 Anochetus grandidieri ASAMX773-06 EF610682 Anochetus grandidieri ASAMX684-06 EF610683 Anochetus grandidieri ASAMV298-06 EF610684 Anochetus grandidieri ASAMV343-06 EF610685 Anochetus grandidieri ASAMV299-06 EF610686 Anochetus grandidieri ASAMV344-06 EF610687 Anochetus grandidieri ASAMV345-06 EF610688 Anochetus grandidieri ASAMV346-06 EF610689 Anochetus grandidieri ASAMV245-06 EF610690 Anochetus grandidieri ASAMV336-06 EF610691 Anochetus grandidieri ASAMV006-06 EF610692 Anochetus grandidieri ASAMV337-06 EF610693 Anochetus grandidieri ASAMV339-06 EF610694 Anochetus grandidieri ASAMV340-06 EF610695 Anochetus grandidieri ASAMV280-06 EF610696 Anochetus grandidieri ASAMV341-06 EF610697 Anochetus grandidieri JDWAM811-05 EF610698 Anochetus grandidieri JDWAM781-05 EF610699 Anochetus grandidieri JDWAM796-05 EF610700 Anochetus grandidieri JDWAM782-05 EF610701 Anochetus grandidieri JDWAM797-05 EF610702 Anochetus grandidieri JDWAM813-05 EF610703 Anochetus grandidieri JDWAM783-05 EF610704 Anochetus grandidieri JDWAM798-05 EF610705 Anochetus grandidieri JDWAM814-05 EF610706 Anochetus grandidieri JDWAM784-05 EF610707 Anochetus grandidieri JDWAM799-05 EF610708 Anochetus grandidieri JDWAM815-05 EF610709 Anochetus grandidieri JDWAM785-05 EF610710 Anochetus grandidieri JDWAM800-05 EF610711 Anochetus grandidieri JDWAM801-05 EF610712 Anochetus grandidieri JDWAM021-04 EF610713 Anochetus grandidieri JDWAM816-05 EF610714 Anochetus grandidieri JDWAM802-05 EF610715 Anochetus grandidieri JDWAM817-05 EF610716

118

Species BOLD Process ID Genback Accession No. Anochetus grandidieri JDWAM803-05 EF610717 Anochetus grandidieri JDWAM818-05 EF610718 Anochetus grandidieri JDWAM804-05 EF610719 Anochetus grandidieri JDWAM774-05 EF610720 Anochetus grandidieri JDWAM819-05 EF610721 Anochetus grandidieri JDWAM805-05 EF610722 Anochetus grandidieri JDWAM775-05 EF610723 Anochetus grandidieri JDWAM790-05 EF610724 Anochetus grandidieri JDWAM791-05 EF610725 Anochetus grandidieri JDWAM806-05 EF610726 Anochetus grandidieri JDWAM776-05 EF610727 Anochetus grandidieri JDWAM792-05 EF610728 Anochetus grandidieri JDWAM807-05 EF610729 Anochetus grandidieri JDWAM777-05 EF610730 Anochetus grandidieri JDWAM793-05 EF610731 Anochetus grandidieri JDWAM778-05 EF610732 Anochetus grandidieri JDWAM794-05 EF610733 Anochetus grandidieri JDWAM795-05 EF610734 Anochetus grandidieri JDWAM810-05 EF610735 Anochetus grandidieri JDWAM780-05 EF610736 Anochetus grandidieri ASAMY196-07 EU119679 Anochetus grandidieri ASAMY139-07 EU119680 Anochetus grandidieri ASAMY197-07 EU119681 Anochetus grandidieri ASAMY368-07 EU119682 Anochetus grandidieri ASAMY140-07 EU119683 Anochetus grandidieri ASAMY369-07 EU119684 Anochetus grandidieri ASAMY426-07 EU119685 Anochetus grandidieri ASAMY141-07 EU119686 Anochetus grandidieri ASAMY142-07 EU119687 Anochetus grandidieri ASAMY428-07 EU119688 Anochetus grandidieri ASAMY429-07 EU119689 Anochetus grandidieri ASAMY144-07 EU119690 Anochetus grandidieri ASAMY145-07 EU119691 Anochetus grandidieri ASAMY146-07 EU119692 Anochetus grandidieri ASAMY374-07 EU119693 Anochetus grandidieri ASAMY375-07 EU119694 Anochetus grandidieri ASAMY376-07 EU119695 Anochetus grandidieri ASAMY283-07 EU119696 Anochetus grandidieri ASAMY417-07 EU119697 Anochetus grandidieri ASAMY132-07 EU119698

119

Species BOLD Process ID Genback Accession No. Anochetus grandidieri ASAMY134-07 EU119699 Anochetus grandidieri ASAMY200-07 EU119700 Anochetus grandidieri ASAMY224-07 EU119701 Anochetus grandidieri ASAMY137-07 EU119702 Anochetus grandidieri ASAMY133-07 EU119703 Anochetus grandidieri ASAMY218-07 EU119704 Anochetus grandidieri ASAMY404-07 EU119705 Anochetus grandidieri ASAMY424-07 EU119706 Anochetus grandidieri ASAMY143-07 EU119707 Anochetus grandidieri ASAMY284-07 EU119708 Anochetus grandidieri ASAMY136-07 EU119709 Anochetus grandidieri ASAMY418-07 EU119710 Anochetus grandidieri ASAMY135-07 EU119711 Anochetus grandidieri ASAMY370-07 EU119712 Anochetus grandidieri ASANH080-10 JN287711 Anochetus grandidieri ASANH152-10 JN287725 Anochetus grandidieri ASANH218-10 JN287741 Anochetus grandidieri ASANH219-10 JN287742 Anochetus grandidieri ASANH220-10 JN287743 Anochetus grandidieri ASANH378-10 JN287781 Anochetus grandidieri ASANH477-10 JN287805 Anochetus grandidieri ASANH478-10 JN287806 Anochetus grandidieri ASANH830-10 JN287904 Anochetus grandidieri ASANH868-10 JN287918 Anochetus grandidieri ASNAU803-09 KF200215 Anochetus grandidieri ASNAU839-09 KF200348 Anochetus grandidieri ASNAU478-09 KF200352 Anochetus grandidieri ASNAU217-09 KF200398 Anochetus grandidieri ASNAU877-09 KF200491 Anochetus grandidieri ASANI574-11 KF200672 Anochetus grandidieri ASNAU474-09 KF200765 Anochetus grandidieri ASNAU876-09 KF200866 Anochetus grandidieri ASNAU206-09 KF200965 Anochetus grandidieri ASANI444-11 KF201008 Anochetus grandidieri ASANI448-11 KF201020 Anochetus grandidieri ASANI453-11 KF201027 Anochetus grandidieri ASNAU477-09 KF201041 Anochetus grandidieri ASNAU476-09 KF201044 Anochetus grandidieri ASANI660-11 KF201083 Anochetus madagascarensis JDWAM656-05 DQ176077

120

Species BOLD Process ID Genback Accession No. Anochetus madagascarensis JDWAM659-05 DQ176079 Anochetus madagascarensis JDWAM537-05 DQ176105 Anochetus madagascarensis JDWAM443-05 DQ176139 Anochetus madagascarensis JDWAM381-05 DQ176188 Anochetus madagascarensis JDWAM376-05 DQ176197 Anochetus madagascarensis JDWAM350-05 DQ176211 Anochetus madagascarensis JDWAM312-05 DQ176237 Anochetus madagascarensis JDWAM313-05 DQ176238 Anochetus madagascarensis JDWAM315-05 DQ176240 Anochetus madagascarensis JDWAM266-05 DQ176284 Anochetus madagascarensis JDWAM249-05 DQ176285 Anochetus madagascarensis JDWAM539-05 DQ176311 Anochetus madagascarensis ASAM3044-05 EF610749 Anochetus madagascarensis ASAM3014-05 EF610750 Anochetus madagascarensis ASAM3045-05 EF610751 Anochetus madagascarensis ASAM3076-05 EF610752 Anochetus madagascarensis ASAM3016-05 EF610753 Anochetus madagascarensis ASAM3047-05 EF610754 Anochetus madagascarensis ASAM3017-05 EF610755 Anochetus madagascarensis ASAM3018-05 EF610756 Anochetus madagascarensis ASAM3019-05 EF610757 Anochetus madagascarensis ASAM3020-05 EF610758 Anochetus madagascarensis ASAM3037-05 EF610759 Anochetus madagascarensis ASAM3053-05 EF610760 Anochetus madagascarensis ASAM3011-05 EF610761 Anochetus madagascarensis ASAMF749-06 EF610762 Anochetus madagascarensis ASAMF825-06 EF610763 Anochetus madagascarensis ASAMF750-06 EF610764 Anochetus madagascarensis ASAMF826-06 EF610765 Anochetus madagascarensis ASAMF722-06 EF610766 Anochetus madagascarensis ASAMF827-06 EF610767 Anochetus madagascarensis ASAMF753-06 EF610768 Anochetus madagascarensis ASAMF724-06 EF610769 Anochetus madagascarensis ASAMF730-06 EF610770 Anochetus madagascarensis ASAMF790-06 EF610771 Anochetus madagascarensis ASAMF731-06 EF610772 Anochetus madagascarensis ASAMF732-06 EF610773 Anochetus madagascarensis ASAMX716-06 EF610774 Anochetus madagascarensis ASAMX836-06 EF610775 Anochetus madagascarensis ASAMX746-06 EF610776

121

Species BOLD Process ID Genback Accession No. Anochetus madagascarensis ASAMX837-06 EF610777 Anochetus madagascarensis ASAMX793-06 EF610778 Anochetus madagascarensis ASAMX779-06 EF610779 Anochetus madagascarensis ASAMX780-06 EF610780 Anochetus madagascarensis ASAMX781-06 EF610781 Anochetus madagascarensis ASAMX826-06 EF610782 Anochetus madagascarensis ASAMX796-06 EF610783 Anochetus madagascarensis ASAMX736-06 EF610784 Anochetus madagascarensis ASAMX827-06 EF610785 Anochetus madagascarensis ASAMX737-06 EF610786 Anochetus madagascarensis ASAMX782-06 EF610787 Anochetus madagascarensis ASAMX708-06 EF610788 Anochetus madagascarensis ASAMX828-06 EF610789 Anochetus madagascarensis ASAMX798-06 EF610790 Anochetus madagascarensis ASAMX738-06 EF610791 Anochetus madagascarensis ASAMX783-06 EF610792 Anochetus madagascarensis ASAMX739-06 EF610793 Anochetus madagascarensis ASAMX785-06 EF610794 Anochetus madagascarensis ASAMX740-06 EF610795 Anochetus madagascarensis ASAMX741-06 EF610796 Anochetus madagascarensis ASAMX817-06 EF610797 Anochetus madagascarensis ASAMX742-06 EF610798 Anochetus madagascarensis ASAMX743-06 EF610799 Anochetus madagascarensis ASAMX804-06 EF610800 Anochetus madagascarensis ASAMX744-06 EF610801 Anochetus madagascarensis ASAMX729-06 EF610802 Anochetus madagascarensis ASAMX745-06 EF610803 Anochetus madagascarensis ASAMX700-06 EF610804 Anochetus madagascarensis ASAMV024-06 EF610805 Anochetus madagascarensis ASAMV025-06 EF610806 Anochetus madagascarensis ASAMV026-06 EF610807 Anochetus madagascarensis JDWAM826-05 EF610808 Anochetus madagascarensis JDWAM827-05 EF610809 Anochetus madagascarensis JDWAM017-04 EF610810 Anochetus madagascarensis JDWAM728-05 EF610811 Anochetus madagascarensis JDWAM828-05 EF610812 Anochetus madagascarensis JDWAM018-04 EF610813 Anochetus madagascarensis JDWAM829-05 EF610814 Anochetus madagascarensis JDWAM019-04 EF610815 Anochetus madagascarensis JDWAM830-05 EF610816

122

Species BOLD Process ID Genback Accession No. Anochetus madagascarensis JDWAM831-05 EF610817 Anochetus madagascarensis JDWAM786-05 EF610818 Anochetus madagascarensis JDWAM832-05 EF610819 Anochetus madagascarensis JDWAM787-05 EF610820 Anochetus madagascarensis JDWAM833-05 EF610821 Anochetus madagascarensis JDWAM788-05 EF610822 Anochetus madagascarensis JDWAM834-05 EF610823 Anochetus madagascarensis JDWAM789-05 EF610824 Anochetus madagascarensis JDWAM835-05 EF610825 Anochetus madagascarensis JDWAM821-05 EF610826 Anochetus madagascarensis JDWAM226-05 EF610827 Anochetus madagascarensis JDWAM836-05 EF610828 Anochetus madagascarensis JDWAM822-05 EF610829 Anochetus madagascarensis JDWAM837-05 EF610830 Anochetus madagascarensis JDWAM823-05 EF610831 Anochetus madagascarensis JDWAM838-05 EF610832 Anochetus madagascarensis JDWAM824-05 EF610833 Anochetus madagascarensis JDWAM839-05 EF610834 Anochetus madagascarensis JDWAM825-05 EF610835 Anochetus madagascarensis JDWAM840-05 EF610836 Anochetus madagascarensis ASAMI504-07 EF999925 Anochetus madagascarensis ASAMI511-07 EF999926 Anochetus madagascarensis ASAMY403-07 EU119713 Anochetus madagascarensis ASAMY423-07 EU119714 Anochetus madagascarensis ASAMY425-07 EU119715 Anochetus madagascarensis ASAMY401-07 EU119716 Anochetus madagascarensis ASAMY427-07 EU119717 Anochetus madagascarensis ASAMY430-07 EU119718 Anochetus madagascarensis ASAMY393-07 EU119719 Anochetus madagascarensis ASAMY394-07 EU119720 Anochetus madagascarensis ASAMY395-07 EU119721 Anochetus madagascarensis ASAMY396-07 EU119722 Anochetus madagascarensis ASAMY416-07 EU119723 Anochetus madagascarensis ASAMY421-07 EU119724 Anochetus madagascarensis ASAMY398-07 EU119725 Anochetus madagascarensis ASAMY399-07 EU119726 Anochetus madagascarensis ASAMY419-07 EU119727 Anochetus madagascarensis ASAMY400-07 EU119728 Anochetus madagascarensis ASAMY420-07 EU119729 Anochetus madagascarensis ASAMY422-07 EU119730

123

Species BOLD Process ID Genback Accession No. Anochetus madagascarensis ASAMY397-07 EU119731 Anochetus madagascarensis ASAMY402-07 EU119732 Anochetus madagascarensis ASAMY392-07 EU119733 Anochetus madagascarensis ASANG954-10 JN287690 Anochetus madagascarensis ASANH357-10 JN287772 Anochetus madagascarensis ASANH557-10 JN287826 Anochetus madagascarensis ASANH565-10 JN287829 Anochetus madagascarensis ASANH580-10 JN287831 Anochetus madagascarensis ASANH745-10 JN287879 Anochetus madagascarensis ASNAU591-09 KF200190 Anochetus madagascarensis ASANI701-11 KF200332 Anochetus madagascarensis ASNAU354-09 KF200341 Anochetus madagascarensis ASNAU757-09 KF200375 Anochetus madagascarensis ASANH030-10 KF200454 Anochetus madagascarensis ASNAU816-09 KF200612 Anochetus madagascarensis ASNAU201-09 KF200772 Anochetus madagascarensis ASNAU781-09 KF200801 Anochetus madagascarensis ASNAU389-09 KF200820 Anochetus madagascarensis ASNAU226-09 KF200874 Anochetus madagascarensis ASNAU184-09 KF200913 Anochetus madagascarensis ASANI505-11 KF201010 Anochetus madagascarensis ASNAU318-09 KF201046 Camponotus christi ASANO303-09 GU709976 Camponotus christi ASANO308-09 GU709977 Camponotus christi ASANO311-09 GU709978 Camponotus christi ASANO307-09 GU709980 Camponotus christi ASANO310-09 HQ925380 Camponotus christi ASANE616-10 JN270423 Camponotus christi ASANG769-10 JN270429 Camponotus christi ASANG771-10 JN270430 Camponotus christi ASANG796-10 JN270440 Camponotus christi ASANH306-10 JN270546 Camponotus christi ASANH387-10 JN270570 Camponotus christi ASANH527-10 JN270590 Camponotus christi ASANO309-09 KF200244 Camponotus christi ASANO163-09 KF200432 Camponotus christi ASANO289-09 KF200447 Camponotus christi ASANO252-09 KF200579 Camponotus christi ASANO019-09 KF200682 Camponotus christi ASANO298-09 KF200741

124

Species BOLD Process ID Genback Accession No. Camponotus christi ASANH1039-10 KF200755 Camponotus christi ASANO253-09 KF200884 Camponotus christi ASANO086-09 KF201064 Camponotus christi ambustus ASANG767-10 JN270428 Camponotus christi ambustus ASAM3026-05 KF201081 Camponotus christi ferrugineus ASANO154-09 GU709973 Camponotus christi ferrugineus ASANO094-09 GU710010 Camponotus christi ferrugineus ASANO097-09 GU710012 Camponotus christi ferrugineus ASANO066-09 GU710014 Camponotus christi ferrugineus ASANO096-09 GU710015 Camponotus christi ferrugineus ASANO052-09 GU710017 Camponotus christi ferrugineus ASANO054-09 GU710019 Camponotus christi ferrugineus ASANO053-09 HM373063 Camponotus christi ferrugineus ASANO093-09 KF200643 Camponotus christi ferrugineus ASANO304-09 KF200907 Camponotus christi foersteri JDWAM771-05 DQ176049 Camponotus christi foersteri ASANO162-09 GU709969 Camponotus christi foersteri ASANO291-09 GU709970 Camponotus christi foersteri ASANO105-09 GU709974 Camponotus christi foersteri ASANO391-09 GU710016 Camponotus christi foersteri ASANO472-09 GU710018 Camponotus christi foersteri ASANO205-09 GU710020 Camponotus christi foersteri ASANO385-09 GU710021 Camponotus christi foersteri ASANO384-09 GU710022 Camponotus christi foersteri ASANO471-09 GU710023 Camponotus christi foersteri ASANO073-09 GU710024 Camponotus christi foersteri ASANO072-09 GU710025 Camponotus christi foersteri ASANO251-09 GU710026 Camponotus christi foersteri ASANO049-09 GU710054 Camponotus christi foersteri ASANO047-09 HM373062 Camponotus christi foersteri ASANO216-09 HM373068 Camponotus christi foersteri ASANO459-09 HM373073 Camponotus christi foersteri ASANH1019-10 JN270502 Camponotus christi foersteri ASANH1031-10 JN270512 Camponotus christi foersteri ASANO473-09 KF200221 Camponotus christi foersteri MCAMP008-12 KF200274 Camponotus christi foersteri ASANO060-09 KF200276 Camponotus christi foersteri ASANO386-09 KF200382 Camponotus christi foersteri MCAMP009-12 KF200408 Camponotus christi foersteri MCAMP088-12 KF200446

125

Species BOLD Process ID Genback Accession No. Camponotus christi foersteri ASAMI496-07 KF200462 Camponotus christi foersteri MCAMP089-12 KF200463 Camponotus christi foersteri ASANO392-09 KF200664 Camponotus christi foersteri MCAMP044-12 KF200665 Camponotus christi foersteri ASANO387-09 KF200688 Camponotus christi foersteri ASANO166-09 KF200751 Camponotus christi foersteri MCAMP003-12 KF200824 Camponotus christi foersteri ASANO055-09 KF200900 Camponotus christi foersteri MCAMP001-12 KF200918 Camponotus christi foersteri MCAMP043-12 KF201001 Camponotus christi foersteri MCAMP087-12 KF201019 Camponotus christi maculiventr ASANO400-09 GU709930 Camponotus christi maculiventr ASANO121-09 GU709933 Camponotus christi maculiventr ASANO204-09 GU709934 Camponotus christi maculiventr ASANO402-09 GU709935 Camponotus christi maculiventr ASANO065-09 GU709936 Camponotus christi maculiventr ASANO118-09 GU709937 Camponotus christi maculiventr ASANO123-09 GU709938 Camponotus christi maculiventr ASANO106-09 GU709942 Camponotus christi maculiventr ASANO120-09 HM880628 Camponotus christi maculiventr ASANO282-09 KF201009 Camponotus christi_01 ASANV335-09 KF200509 Camponotus christi_01 ASANV385-09 KF200827 Camponotus christi_01 ASANV251-09 KF200885 Camponotus christi_02 ASANV248-09 HM434282 Camponotus christi_02 ASANV440-09 HM434292 Camponotus christi_02 ASANV433-09 KF200452 Camponotus christi_02 ASANV432-09 KF200712 Camponotus dufouri JDWAM363-05 DQ176199 Camponotus dufouri JDWAM286-05 DQ176260 Camponotus dufouri JDWAM287-05 DQ176261 Camponotus dufouri ASANV384-09 HM434289 Camponotus dufouri ASANH553-10 JN270594 Camponotus dufouri ASANH554-10 JN270595 Camponotus dufouri ASANH555-10 JN270596 Camponotus dufouri ASANJ015-11 JN270635 Camponotus dufouri ASANJ055-11 JN270641 Camponotus dufouri ASANJ065-11 JN270645 Camponotus dufouri ASANJ067-11 JN270647 Camponotus dufouri ASIMA749-09 KF200204

126

Species BOLD Process ID Genback Accession No. Camponotus dufouri ASIMA636-09 KF200207 Camponotus dufouri ASIMA684-09 KF200250 Camponotus dufouri ASAM3012-05 KF200284 Camponotus dufouri ASIMA563-09 KF200306 Camponotus dufouri ASIMA560-09 KF200338 Camponotus dufouri ASIMA286-09 KF200351 Camponotus dufouri ASANV244-09 KF200366 Camponotus dufouri ASIMA274-09 KF200414 Camponotus dufouri ASAM3057-05 KF200453 Camponotus dufouri ASIMA275-09 KF200498 Camponotus dufouri ASAM3009-05 KF200570 Camponotus dufouri ASIMA273-09 KF200594 Camponotus dufouri ASIMA748-09 KF200678 Camponotus dufouri ASAM3039-05 KF200690 Camponotus dufouri ASIMA283-09 KF200728 Camponotus dufouri ASAM3038-05 KF200754 Camponotus dufouri ASIMA683-09 KF200762 Camponotus dufouri ASIMA276-09 KF200795 Camponotus dufouri ASAM3013-05 KF200800 Camponotus dufouri ASANV149-09 KF200821 Camponotus dufouri ASIMA562-09 KF200882 Camponotus dufouri ASAM815-05 KF200956 Camponotus dufouri ASIMA755-09 KF200957 Camponotus dufouri ASAM3004-05 KF200959 Camponotus dufouri ASIMA661-09 KF200981 Camponotus dufouri ASIMA687-09 KF201028 Camponotus dufouri ASAM3010-05 KF201059 Camponotus dufouri ASIMA559-09 KF201076 Camponotus echinoploides ASANO415-09 GU710063 Camponotus echinoploides ASANO441-09 GU710064 Camponotus echinoploides ASANO273-09 GU710065 Camponotus echinoploides ASANO413-09 GU710066 Camponotus echinoploides ASANO410-09 GU710067 Camponotus echinoploides ASANO470-09 GU710068 Camponotus echinoploides ASANO223-09 GU710070 Camponotus echinoploides ASANO406-09 GU710072 Camponotus echinoploides ASANO293-09 GU710110 Camponotus echinoploides ASANO292-09 GU710114 Camponotus echinoploides ASANO224-09 GU710209 Camponotus echinoploides ASANO143-09 GU710210

127

Species BOLD Process ID Genback Accession No. Camponotus echinoploides ASANO113-09 GU710211 Camponotus echinoploides ASANO404-09 HM434075 Camponotus echinoploides ASANG781-10 JN270433 Camponotus echinoploides ASANG786-10 JN270434 Camponotus echinoploides ASANG792-10 JN270438 Camponotus echinoploides ASANH1016-10 JN270501 Camponotus echinoploides ASANH552-10 JN270593 Camponotus echinoploides ASANO145-09 KF200969 Camponotus gouldi ASANV175-09 KF200200 Camponotus gouldi ASIMA311-09 KF200247 Camponotus gouldi JDWAM223-05 KF200275 Camponotus gouldi ASIMA321-09 KF200286 Camponotus gouldi JDWAM699-05 KF200319 Camponotus gouldi ASNAU707-09 KF200346 Camponotus gouldi JDWAM697-05 KF200542 Camponotus gouldi JDWAM233-05 KF200622 Camponotus gouldi ASIMA309-09 KF200812 Camponotus gouldi ASANV479-09 KF200847 Camponotus gouldi ASIMA250-09 KF200917 Camponotus gouldi ASIMA248-09 KF201084 Camponotus grandidieri MCAMP081-12 KF200179 Camponotus grandidieri MCAMP015-12 KF200197 Camponotus grandidieri ASAMI424-07 KF200212 Camponotus grandidieri ASAMV434-07 KF200239 Camponotus grandidieri ASAMI429-07 KF200253 Camponotus grandidieri ASAMZ261-07 KF200263 Camponotus grandidieri ASIMA323-09 KF200289 Camponotus grandidieri ASAMZ277-07 KF200293 Camponotus grandidieri MCAMP079-12 KF200296 Camponotus grandidieri ASANJ1049-11 KF200301 Camponotus grandidieri ASAMZ278-07 KF200310 Camponotus grandidieri ASAMI468-07 KF200317 Camponotus grandidieri MCAMP076-12 KF200322 Camponotus grandidieri MCAMP069-12 KF200328 Camponotus grandidieri MCAMP073-12 KF200349 Camponotus grandidieri ASAMZ454-07 KF200350 Camponotus grandidieri MCAMP071-12 KF200363 Camponotus grandidieri ASAMI521-07 KF200372 Camponotus grandidieri ASAMI379-07 KF200389 Camponotus grandidieri ASAMI433-07 KF200419

128

Species BOLD Process ID Genback Accession No. Camponotus grandidieri ASAMY001-07 KF200427 Camponotus grandidieri ASAMI474-07 KF200443 Camponotus grandidieri ASAMY028-07 KF200459 Camponotus grandidieri MCAMP085-12 KF200480 Camponotus grandidieri MCAMP019-12 KF200502 Camponotus grandidieri ASAMI473-07 KF200513 Camponotus grandidieri ASIMA322-09 KF200517 Camponotus grandidieri ASIMA313-09 KF200538 Camponotus grandidieri ASAMZ315-07 KF200567 Camponotus grandidieri ASAMY046-07 KF200610 Camponotus grandidieri MCAMP070-12 KF200648 Camponotus grandidieri MCAMP083-12 KF200659 Camponotus grandidieri ASAMZ478-07 KF200670 Camponotus grandidieri ASAMZ258-07 KF200677 Camponotus grandidieri MCAMP084-12 KF200719 Camponotus grandidieri MCAMP078-12 KF200723 Camponotus grandidieri MCAMP075-12 KF200745 Camponotus grandidieri MCAMP080-12 KF200746 Camponotus grandidieri MCAMP074-12 KF200766 Camponotus grandidieri ASAMZ413-07 KF200784 Camponotus grandidieri ASIMA314-09 KF200841 Camponotus grandidieri ASAMI354-07 KF200842 Camponotus grandidieri ASAMV433-07 KF200861 Camponotus grandidieri MCAMP095-12 KF200865 Camponotus grandidieri ASAMZ313-07 KF200872 Camponotus grandidieri ASAMY008-07 KF200893 Camponotus grandidieri ASAMZ461-07 KF200953 Camponotus grandidieri ASAMI423-07 KF200997 Camponotus grandidieri MCAMP082-12 KF201021 Camponotus grandidieri ASAMI460-07 KF201030 Camponotus grandidieri ASAMI434-07 KF201043 Camponotus hagensii ASANO389-09 GU709945 Camponotus hagensii ASANO246-09 GU709949 Camponotus hagensii ASANO388-09 GU709950 Camponotus hagensii ASANO245-09 GU709951 Camponotus hagensii ASANO248-09 GU709984 Camponotus hagensii ASANO237-09 GU710080 Camponotus hagensii ASANO239-09 GU710082 Camponotus hagensii ASANO236-09 GU710085 Camponotus hagensii ASANO235-09 GU710086

129

Species BOLD Process ID Genback Accession No. Camponotus hagensii ASANO234-09 GU710090 Camponotus hagensii ASANO247-09 KF200569 Camponotus hagensii ASANO238-09 KF200850 Camponotus heteroclitus ASANO167-09 GU709953 Camponotus heteroclitus ASANO418-09 GU710084 Camponotus heteroclitus ASANO417-09 GU710088 Camponotus heteroclitus ASANO222-09 GU710089 Camponotus heteroclitus ASANO085-09 GU710094 Camponotus heteroclitus ASANH307-10 JN270547 Camponotus heteroclitus ASIMA545-09 KF200223 Camponotus heteroclitus ASIMA505-09 KF200344 Camponotus heteroclitus MCAMP046-12 KF200370 Camponotus heteroclitus ASIMA289-09 KF200393 Camponotus heteroclitus MCAMP047-12 KF200421 Camponotus heteroclitus ASIMA751-09 KF200440 Camponotus heteroclitus ASIMA208-09 KF200445 Camponotus heteroclitus MCAMP065-12 KF200483 Camponotus heteroclitus ASIMA651-09 KF200541 Camponotus heteroclitus ASIMA263-09 KF200562 Camponotus heteroclitus MCAMP049-12 KF200668 Camponotus heteroclitus MCAMP064-12 KF200787 Camponotus heteroclitus ASIMA506-09 KF200799 Camponotus heteroclitus ASIMA508-09 KF200860 Camponotus heteroclitus ASIMA674-09 KF200896 Camponotus heteroclitus ASIMA507-09 KF200978 Camponotus heteroclitus ASIMA691-09 KF200995 Camponotus heteroclitus MCAMP048-12 KF201007 Camponotus heteroclitus MCAMP045-12 KF201015 Camponotus heteroclitus ASIMA511-09 KF201057 Camponotus heteroclitus ASIMA341-09 KF201060 Camponotus heteroclitus MCAMP066-12 KF201069 Camponotus heteroclitus ASIMA290-09 KF201082 Camponotus imitator ASANO358-09 GU709952 Camponotus imitator ASANO439-09 GU709954 Camponotus imitator ASANO092-09 GU709955 Camponotus imitator ASANO355-09 GU709956 Camponotus imitator ASANO347-09 GU709957 Camponotus imitator ASANO368-09 GU709958 Camponotus imitator ASANO346-09 GU709962 Camponotus imitator ASANO156-09 GU710222

130

Species BOLD Process ID Genback Accession No. Camponotus imitator ASANG937-10 JN270465 Camponotus imitator ASANJ137-11 JN270655 Camponotus imitator ASNAU740-09 KF200402 Camponotus MG002 JDWAM440-05 DQ176136 Camponotus MG002 JDWAM442-05 DQ176138 Camponotus MG002 JDWAM410-05 DQ176154 Camponotus MG002 JDWAM411-05 DQ176155 Camponotus MG002 ASIMA195-09 HM421029 Camponotus MG002 ASIMA653-09 HM421057 Camponotus MG002 ASNAU653-09 HM435045 Camponotus MG002 ASANG837-10 JN270451 Camponotus MG002 ASANG912-10 JN270462 Camponotus MG002 ASANG947-10 JN270468 Camponotus MG002 ASANG965-10 JN270472 Camponotus MG002 ASANH045-10 JN270484 Camponotus MG002 JDWAM230-05 KF200184 Camponotus MG002 ASIMA753-09 KF200214 Camponotus MG002 ASIMA620-09 KF200249 Camponotus MG002 ASIMA652-09 KF200266 Camponotus MG002 ASIMA247-09 KF200336 Camponotus MG002 ASIMA662-09 KF200413 Camponotus MG002 ASIMA582-09 KF200490 Camponotus MG002 JDWAM476-05 KF200492 Camponotus MG002 ASIMA695-09 KF200495 Camponotus MG002 ASANV409-09 KF200547 Camponotus MG002 ASIMA598-09 KF200578 Camponotus MG002 ASIMA650-09 KF200607 Camponotus MG002 ASIMA618-09 KF200733 Camponotus MG002 ASIMA586-09 KF200737 Camponotus MG002 ASIMA580-09 KF200797 Camponotus MG002 ASIMA583-09 KF200803 Camponotus MG002 ASIMA619-09 KF200846 Camponotus MG002 ASIMA520-09 KF200859 Camponotus MG002 ASIMA585-09 KF200880 Camponotus MG002 ASIMA584-09 KF200891 Camponotus MG002 ASIMA579-09 KF200968 Camponotus MG002 JDWAM475-05 KF200999 Camponotus MG002 ASIMA617-09 KF201023 Camponotus MG005 ASANO365-09 GU709996 Camponotus MG005 ASANO169-09 GU709998

131

Species BOLD Process ID Genback Accession No. Camponotus MG005 ASANO361-09 GU709999 Camponotus MG005 ASANO360-09 GU710000 Camponotus MG005 ASANO035-09 GU710003 Camponotus MG005 ASANO343-09 GU710005 Camponotus MG005 ASANO025-09 GU710042 Camponotus MG005 ASANO367-09 GU710091 Camponotus MG005 ASANO328-09 GU710096 Camponotus MG005 ASANO327-09 GU710097 Camponotus MG005 ASANO023-09 GU710098 Camponotus MG005 ASANO103-09 GU710099 Camponotus MG005 ASANO050-09 GU710100 Camponotus MG005 ASANO017-09 GU710102 Camponotus MG005 ASANO024-09 GU710104 Camponotus MG005 ASANO432-09 GU710121 Camponotus MG005 ASANO064-09 GU710123 Camponotus MG005 ASANO433-09 GU710124 Camponotus MG005 ASANO027-09 GU710125 Camponotus MG005 ASANO128-09 GU710126 Camponotus MG005 ASANO063-09 GU710128 Camponotus MG005 ASANO026-09 GU710130 Camponotus MG005 ASANO110-09 GU710154 Camponotus MG005 ASANO354-09 GU710218 Camponotus MG005 ASANO475-09 GU710219 Camponotus MG005 ASANO091-09 GU710220 Camponotus MG005 ASANO359-09 GU710221 Camponotus MG005 ASANO364-09 HM434073 Camponotus MG005 ASANG819-10 JN270449 Camponotus MG005 ASANH054-10 JN270489 Camponotus MG005 ASANH057-10 JN270490 Camponotus MG005 ASANH103-10 JN270510 Camponotus MG005 MCAMP026-12 KF200187 Camponotus MG005 ASANV491-09 KF200198 Camponotus MG005 JDWAM696-05 KF200237 Camponotus MG005 MCAMP023-12 KF200258 Camponotus MG005 MCAMP017-12 KF200295 Camponotus MG005 ASANJ296-11 KF200309 Camponotus MG005 ASANO116-09 KF200339 Camponotus MG005 MCAMP021-12 KF200359 Camponotus MG005 MCAMP012-12 KF200388 Camponotus MG005 MCAMP068-12 KF200409

132

Species BOLD Process ID Genback Accession No. Camponotus MG005 MCAMP025-12 KF200415 Camponotus MG005 MCAMP022-12 KF200549 Camponotus MG005 ASANV486-09 KF200589 Camponotus MG005 ASANO139-09 KF200592 Camponotus MG005 MCAMP014-12 KF200614 Camponotus MG005 MCAMP016-12 KF200644 Camponotus MG005 ASANJ322-11 KF200657 Camponotus MG005 ASANO130-09 KF200667 Camponotus MG005 MCAMP024-12 KF200700 Camponotus MG005 ASANV469-09 KF200726 Camponotus MG005 JDWAM707-05 KF200789 Camponotus MG005 ASANV349-09 KF200826 Camponotus MG005 ASANV474-09 KF200899 Camponotus MG005 ASANV490-09 KF200980 Camponotus MG005 MCAMP028-12 KF200987 Camponotus MG005 ASANH059-10 KF201003 Camponotus MG005 MCAMP018-12 KF201018 Camponotus MG005 ASANO147-09 KF201053 Camponotus MG005 MCAMP027-12 KF201063 Camponotus MG039 ASANO018-09 GU710216 Camponotus MG039 ASANO225-09 HM373069 Camponotus MG039 ASIMA213-09 HM434619 Camponotus MG039 ASANV247-09 HQ925528 Camponotus MG039 ASIMA227-09 KF200202 Camponotus MG039 ASIMA519-09 KF200248 Camponotus MG039 ASANV441-09 KF200272 Camponotus MG039 ASIMA518-09 KF200315 Camponotus MG039 ASANV494-09 KF200316 Camponotus MG039 ASIMA325-09 KF200386 Camponotus MG039 ASANV504-09 KF200464 Camponotus MG039 ASANO122-09 KF200505 Camponotus MG039 ASIMA279-09 KF200564 Camponotus MG039 ASIMA217-09 KF200575 Camponotus MG039 ASIMA280-09 KF200640 Camponotus MG039 ASIMA278-09 KF200653 Camponotus MG039 ASANV246-09 KF200724 Camponotus MG039 ASIMA517-09 KF200743 Camponotus MG039 ASIMA318-09 KF200970 Camponotus MG039 ASIMA552-09 KF201054 Camponotus MG047 ASANV310-09 HM434284

133

Species BOLD Process ID Genback Accession No. Camponotus MG047 ASANH388-10 JN270571 Camponotus MG047 ASANH393-10 JN270572 Camponotus MG047 ASANH469-10 JN270578 Camponotus MG047 ASANH470-10 JN270579 Camponotus MG047 ASANH472-10 JN270580 Camponotus MG047 ASANJ056-11 JN270642 Camponotus MG047 ASANJ066-11 JN270646 Camponotus MG047 ASANV157-09 KF200278 Camponotus MG047 ASAM3077-05 KF200290 Camponotus MG047 ASANV519-09 KF200433 Camponotus MG047 ASAM3031-05 KF200486 Camponotus MG047 ASAM3034-05 KF200494 Camponotus MG047 ASAM3032-05 KF200523 Camponotus MG047 ASAM3033-05 KF200944 Camponotus MG053 JDWAM324-05 DQ176218 Camponotus MG053 JDWAM325-05 DQ176219 Camponotus MG053 ASANO550-09 GU710140 Camponotus MG053 ASANO616-09 GU710142 Camponotus MG053 ASANO762-09 GU710143 Camponotus MG053 MCAMP035-12 KF200194 Camponotus MG053 MCAMP061-12 KF200208 Camponotus MG053 MCAMP062-12 KF200229 Camponotus MG053 ASAMV408-07 KF200235 Camponotus MG053 MCAMP036-12 KF200287 Camponotus MG053 MCAMP050-12 KF200313 Camponotus MG053 MCAMP067-12 KF200345 Camponotus MG053 MCAMP058-12 KF200357 Camponotus MG053 MCAMP056-12 KF200362 Camponotus MG053 MCAMP077-12 KF200449 Camponotus MG053 MCAMP059-12 KF200451 Camponotus MG053 MCAMP042-12 KF200470 Camponotus MG053 MCAMP057-12 KF200497 Camponotus MG053 MCAMP054-12 KF200524 Camponotus MG053 MCAMP051-12 KF200527 Camponotus MG053 ASAMV409-07 KF200546 Camponotus MG053 JDWAM416-05 KF200552 Camponotus MG053 MCAMP033-12 KF200713 Camponotus MG053 MCAMP063-12 KF200779 Camponotus MG053 MCAMP037-12 KF200804 Camponotus MG053 MCAMP010-12 KF200895

134

Species BOLD Process ID Genback Accession No. Camponotus MG053 MCAMP060-12 KF200988 Camponotus MG053 ASAM817-05 KF201079 Camponotus MG054 ASANO651-09 GU710147 Camponotus MG054 ASANO518-09 GU710148 Camponotus MG054 ASANO775-09 GU710153 Camponotus MG054 ASANO732-09 GU710155 Camponotus MG054 ASANO736-09 GU710156 Camponotus MG054 ASANO735-09 GU710157 Camponotus MG054 ASANO530-09 GU710158 Camponotus MG054 ASANO542-09 GU710159 Camponotus MG054 ASANO734-09 GU710160 Camponotus MG054 ASANO529-09 GU710162 Camponotus MG054 ASANO510-09 GU710163 Camponotus MG054 ASANO540-09 GU710164 Camponotus MG054 ASANP530-09 GU710591 Camponotus MG054 ASANP452-09 GU710593 Camponotus MG054 ASANP562-09 GU710596 Camponotus MG054 ASANP583-09 GU710598 Camponotus MG054 ASANP592-09 HM373106 Camponotus MG054 ASANO541-09 HM880632 Camponotus MG054 ASANP420-09 KF200871 Camponotus MG059 ASANP581-09 GU710647 Camponotus MG059 ASANG874-10 JN270458 Camponotus MG059 ASANG875-10 JN270459 Camponotus MG059 ASANG986-10 JN270476 Camponotus MG059 ASANH016-10 JN270481 Camponotus MG059 ASANH091-10 JN270492 Camponotus MG059 JDWAM700-05 KF200431 Camponotus MG059 ASNAU739-09 KF200627 Camponotus MG059 JDWAM690-05 KF200647 Camponotus MG059 ASAM825-05 KF200786 Camponotus MG059 JDWAM698-05 KF200909 Camponotus MG059 ASNAU715-09 KF200951 Camponotus MG096 ASIMA525-09 HM421049 Camponotus MG096 ASANH323-10 JN270551 Camponotus MG096 ASANH326-10 JN270553 Camponotus MG096 ASANH525-10 JN270588 Camponotus MG096 ASANH528-10 JN270591 Camponotus MG096 ASIMA207-09 KF200199 Camponotus MG096 ASIMA443-09 KF200441

135

Species BOLD Process ID Genback Accession No. Camponotus MG096 ASIMA272-09 KF200507 Camponotus MG096 ASAMV410-07 KF200833 Camponotus MG096 ASAMV411-07 KF200908 Camponotus MG096 ASIMA752-09 KF200990 Camponotus MG096 ASIMA201-09 KF201005 Camponotus mocquerysi ASIMA353-09 HQ550428 Camponotus mocquerysi ASANH373-10 JN270567 Camponotus mocquerysi ASANH540-10 JN270592 Camponotus mocquerysi ASANH570-10 JN270598 Camponotus mocquerysi ASANJ064-11 JN270644 Camponotus mocquerysi ASANJ068-11 JN270648 Camponotus mocquerysi ASIMA243-09 KF200282 Camponotus mocquerysi ASIMA258-09 KF200471 Camponotus mocquerysi ASIMA252-09 KF200493 Camponotus mocquerysi ASIMA255-09 KF200543 Camponotus mocquerysi ASIMA504-09 KF200673 Camponotus mocquerysi ASIMA690-09 KF200703 Camponotus mocquerysi ASANV207-09 KF200935 Camponotus mocquerysi ASIMA216-09 KF201034 Camponotus mocquerysi ASIMA503-09 KF201037 Camponotus mocquerysi ASIMA346-09 KF201072 Camponotus quadrimaculatus ASIMA532-09 KF200230 Camponotus quadrimaculatus ASIMA306-09 KF200325 Camponotus quadrimaculatus ASIMA694-09 KF200364 Camponotus quadrimaculatus JDWAM222-05 KF200485 Camponotus quadrimaculatus ASIMA343-09 KF200698 Camponotus quadrimaculatus ASIMA359-09 KF200775 Camponotus quadrimaculatus JDWAM231-05 KF200873 Camponotus quadrimaculatus sel JDWAM335-05 DQ176213 Camponotus quadrimaculatus sel JDWAM336-05 DQ176214 Camponotus quadrimaculatus sel JDWAM314-05 DQ176239 Camponotus quadrimaculatus sel ASIMA490-09 KF200231 Camponotus quadrimaculatus sel ASIMA202-09 KF200277 Camponotus quadrimaculatus sel ASIMA214-09 KF200429 Camponotus quadrimaculatus sel ASIMA442-09 KF200602 Camponotus repens ASANO362-09 GU709994 Camponotus repens ASANO108-09 GU710095 Camponotus repens ASANO316-09 GU710170 Camponotus repens ASANO058-09 GU710172 Camponotus repens ASANO020-09 GU710173

136

Species BOLD Process ID Genback Accession No. Camponotus repens ASANO317-09 HM373071 Camponotus repens ASANO371-09 HM434074 Camponotus repens ASANG863-10 JN270453 Camponotus repens ASANG964-10 JN270471 Camponotus repens ASANG973-10 JN270474 Camponotus repens ASANO219-09 KF200655 Camponotus repens ASANO320-09 KF200788 Hypoponera MG025 JDWAM676-05 DQ176065 Hypoponera MG025 JDWAM666-05 DQ176071 Hypoponera MG025 JDWAM398-05 DQ176173 Hypoponera MG025 JDWAM359-05 DQ176206 Hypoponera MG025 JDWAM275-05 DQ176264 Hypoponera MG025 JDWAM259-05 DQ176279 Hypoponera MG025 ASANU105-09 HM418807 Hypoponera MG025 ASANU266-09 HM418827 Hypoponera MG025 ASANW206-10 HM419123 Hypoponera MG025 ASANW931-10 HM419317 Hypoponera MG025 ASANU080-09 HQ925470 Hypoponera MG025 ASAM3070-05 KF200488 Hypoponera MG025 ASANU098-09 KF200519 Hypoponera MG025 ASNAU928-09 KF200521 Hypoponera MG025 ASAMV223-06 KF200661 Hypoponera MG025 ASNAU778-09 KF200680 Hypoponera MG025 ASAMV104-06 KF200782 Hypoponera MG026 ASANW231-10 HM419136 Hypoponera MG026 ASANW569-10 HM419234 Hypoponera MG026 ASANW575-10 HM419236 Hypoponera MG026 ASANW634-10 HM419272 Hypoponera MG026 ASANW894-10 HM419313 Hypoponera MG026 ASNAU929-09 KF200182 Hypoponera MG026 ASNAU372-09 KF200245 Hypoponera MG026 ASAMV056-06 KF200327 Hypoponera MG026 ASNAU405-09 KF200374 Hypoponera MG026 ASANW628-10 KF200573 Hypoponera MG026 ASNAU932-09 KF200634 Hypoponera MG026 ASNAU930-09 KF200735 Hypoponera MG026 ASNAU786-09 KF201031 Hypoponera MG038 JDWAM299-05 DQ176241 Hypoponera MG038 JDWAM301-05 DQ176243 Hypoponera MG038 JDWAM295-05 DQ176253

137

Species BOLD Process ID Genback Accession No. Hypoponera MG038 JDWAM280-05 DQ176269 Hypoponera MG038 ASANV769-10 HM418981 Hypoponera MG038 ASANV797-10 HM418999 Hypoponera MG038 ASANW624-10 HM419268 Hypoponera MG038 ASAMV052-06 KF200218 Hypoponera MG038 ASAMV067-06 KF200220 Hypoponera MG038 ASAM837-05 KF200299 Hypoponera MG038 ASAMV075-06 KF200311 Hypoponera MG038 ASAMV010-06 KF200320 Hypoponera MG038 ASAMV066-06 KF200347 Hypoponera MG038 ASAMV081-06 KF200412 Hypoponera MG038 ASAMV076-06 KF200458 Hypoponera MG038 ASAMV077-06 KF200478 Hypoponera MG038 ASAMV057-06 KF200479 Hypoponera MG038 ASAMV168-06 KF200522 Hypoponera MG038 ASAMV058-06 KF200577 Hypoponera MG038 ASAMV143-06 KF200625 Hypoponera MG038 ASAMV054-06 KF200642 Hypoponera MG038 ASAM836-05 KF200650 Hypoponera MG038 ASAMV055-06 KF200669 Hypoponera MG038 ASNAU327-09 KF200711 Hypoponera MG038 ASAM839-05 KF200757 Hypoponera MG038 ASAM838-05 KF200776 Hypoponera MG038 ASAMV078-06 KF200805 Hypoponera MG038 ASAMV015-06 KF200817 Hypoponera MG038 ASAMV079-06 KF200830 Hypoponera MG038 ASAMV074-06 KF200862 Hypoponera MG038 ASAMV065-06 KF200881 Hypoponera MG038 ASAMV082-06 KF200947 Hypoponera MG038 ASAMV053-06 KF200992 Hypoponera MG038 ASAMV080-06 KF201011 Hypoponera MG043 ASANW258-10 HM419138 Hypoponera MG043 ASANW307-10 HM419166 Hypoponera MG043 ASANW317-10 HM419175 Hypoponera MG043 ASANW611-10 HM419261 Hypoponera MG043 ASANW350-10 HQ925572 Hypoponera MG043 ASANW361-10 HQ925574 Hypoponera MG043 ASANW362-10 HQ925575 Hypoponera MG043 ASANW417-10 HQ925580 Hypoponera MG043 ASAMV141-06 KF200343

138

Species BOLD Process ID Genback Accession No. Hypoponera MG043 ASAMV020-06 KF200354 Hypoponera MG043 ASAMV116-06 KF200435 Hypoponera MG043 ASAMV139-06 KF200444 Hypoponera MG043 ASANW667-10 KF200457 Hypoponera MG043 ASAMV043-06 KF200954 Hypoponera MG067 ASANW121-10 HM419072 Hypoponera MG067 ASANW270-10 HM419146 Hypoponera MG067 ASANW512-10 HM419225 Hypoponera MG067 ASANW616-10 KF200714 Hypoponera MG067 ASAMV167-06 KF200729 Hypoponera MG067 ASAMV171-06 KF200819 Hypoponera MG067 ASAMV042-06 KF200840 Hypoponera MG067 ASAMV125-06 KF200856 Hypoponera MG067 ASAMV158-06 KF200915 Hypoponera MG067 ASAMV172-06 KF200926 Hypoponera MG067 ASAMV128-06 KF201068 Hypoponera MG071 ASANV438-09 HM418972 Hypoponera MG071 ASANW115-10 HM419069 Hypoponera MG071 ASANW314-10 HM419173 Hypoponera MG071 ASANW318-10 HM419176 Hypoponera MG071 ASANW609-10 HM419259 Hypoponera MG071 ASANW615-10 HM419264 Hypoponera MG071 ASAMV044-06 KF200189 Hypoponera MG071 ASAMV101-06 KF200203 Hypoponera MG071 ASAMV103-06 KF200260 Hypoponera MG071 ASAMV021-06 KF200271 Hypoponera MG071 ASAMV126-06 KF200312 Hypoponera MG071 ASAMV148-06 KF200337 Hypoponera MG071 ASAMV138-06 KF200358 Hypoponera MG071 ASNAU392-09 KF200442 Hypoponera MG071 ASAMV149-06 KF200472 Hypoponera MG071 ASNAU881-09 KF200496 Hypoponera MG071 ASAMV045-06 KF200511 Hypoponera MG071 ASAMV105-06 KF200512 Hypoponera MG071 ASAMV102-06 KF200548 Hypoponera MG071 ASNAU846-09 KF200550 Hypoponera MG071 ASAM3048-05 KF200576 Hypoponera MG071 ASNAU450-09 KF200597 Hypoponera MG071 ASNAU394-09 KF200611 Hypoponera MG071 ASNAU377-09 KF200675

139

Species BOLD Process ID Genback Accession No. Hypoponera MG071 ASANW095-10 KF200687 Hypoponera MG071 ASNAU310-09 KF200834 Hypoponera MG071 ASAMV100-06 KF200869 Hypoponera MG071 ASAMV127-06 KF200904 Hypoponera MG071 ASAMV147-06 KF200914 Hypoponera MG071 ASAMV150-06 KF200925 Hypoponera MG071 ASNAU395-09 KF200982 Hypoponera MG071 ASNAU356-09 KF201078 Hypoponera MG088 ASANV360-09 HM418969 Hypoponera MG088 ASANW093-10 HM419060 Hypoponera MG088 ASANW205-10 HM419122 Hypoponera MG088 ASANW308-10 HM419167 Hypoponera MG088 ASANW325-10 HM419178 Hypoponera MG088 ASANW613-10 HM419263 Hypoponera MG088 ASNAU300-09 KF200269 Hypoponera MG088 ASNAU308-09 KF200283 Hypoponera MG088 ASNAU829-09 KF200333 Hypoponera MG088 ASNAU279-09 KF200340 Hypoponera MG088 ASNAU891-09 KF200417 Hypoponera MG088 ASNAU311-09 KF200430 Hypoponera MG088 ASNAU346-09 KF200438 Hypoponera MG088 ASNAU361-09 KF200461 Hypoponera MG088 ASNAU265-09 KF200469 Hypoponera MG088 ASANW297-10 KF200508 Hypoponera MG088 ASNAU312-09 KF200525 Hypoponera MG088 ASNAU246-09 KF200599 Hypoponera MG088 ASNAU547-09 KF200635 Hypoponera MG088 ASNAU379-09 KF200683 Hypoponera MG088 ASNAU447-09 KF200701 Hypoponera MG088 ASNAU326-09 KF200774 Hypoponera MG088 ASNAU446-09 KF200808 Hypoponera MG088 ASANW207-10 KF200857 Hypoponera MG088 ASNAU834-09 KF200863 Hypoponera MG088 ASNAU393-09 KF200886 Hypoponera MG088 ASNAU777-09 KF200910 Hypoponera MG088 ASNAU563-09 KF200923 Hypoponera MG088 ASNAU449-09 KF200932 Hypoponera MG088 ASNAU828-09 KF201045 Leptogenys angusta JDWAM772-05 DQ176050 Leptogenys angusta JDWAM378-05 DQ176185

140

Species BOLD Process ID Genback Accession No. Leptogenys angusta JDWAM357-05 DQ176204 Leptogenys angusta JDWAM270-05 DQ176273 Leptogenys angusta JDWAM271-05 DQ176274 Leptogenys angusta JDWAM244-05 DQ176292 Leptogenys angusta ASANV775-10 HM418986 Leptogenys angusta ASANW225-10 HM419135 Leptogenys angusta ASANW273-10 HM419148 Leptogenys angusta ASANW291-10 HM419157 Leptogenys angusta ASANW299-10 HM419159 Leptogenys angusta ASANW382-10 HM419191 Leptogenys angusta ASANW383-10 HM419192 Leptogenys angusta ASANW479-10 HM419209 Leptogenys angusta ASANW585-10 HM419243 Leptogenys angusta ASANW599-10 HM419251 Leptogenys angusta ASANW603-10 HM419255 Leptogenys angusta ASANW652-10 HM419278 Leptogenys angusta ASANW653-10 HM419279 Leptogenys angusta ASANW729-10 HM419288 Leptogenys angusta ASNAU216-09 HM435021 Leptogenys angusta ASANE367-10 HQ925102 Leptogenys angusta ASANE382-10 HQ925115 Leptogenys angusta ASANE422-10 HQ925150 Leptogenys angusta ASANE425-10 HQ925153 Leptogenys angusta ASANE426-10 HQ925154 Leptogenys angusta ASANE427-10 HQ925155 Leptogenys angusta ASANE428-10 HQ925156 Leptogenys angusta ASANE442-10 HQ925165 Leptogenys angusta ASANE485-10 HQ925201 Leptogenys angusta ASANE486-10 HQ925202 Leptogenys angusta ASANE487-10 HQ925203 Leptogenys angusta ASANE490-10 HQ925206 Leptogenys angusta ASANE499-10 HQ925215 Leptogenys angusta ASANE500-10 HQ925216 Leptogenys angusta ASANE502-10 HQ925217 Leptogenys angusta ASNAU350-09 KF200407 Leptogenys angusta ASNAU414-09 KF200466 Leptogenys angusta ASNAU540-09 KF200535 Leptogenys angusta ASNAU804-09 KF200585 Leptogenys angusta ASANW443-10 KF200671 Leptogenys angusta ASNAU211-09 KF200676

141

Species BOLD Process ID Genback Accession No. Leptogenys angusta ASNAU255-09 KF200691 Leptogenys angusta ASNAU418-09 KF200854 Leptogenys angusta ASNAU403-09 KF201006 Leptogenys angusta ASNAU601-09 KF201052 Leptogenys arcirostris ASANV765-10 HM418977 Leptogenys arcirostris ASANW020-10 HM419018 Leptogenys arcirostris ASANW021-10 HM419019 Leptogenys arcirostris ASANW039-10 HM419026 Leptogenys arcirostris ASANW883-10 HM419305 Leptogenys arcirostris ASANW884-10 HM419306 Leptogenys arcirostris ASANW972-10 HM419322 Leptogenys arcirostris ASANE011-10 HQ924798 Leptogenys arcirostris ASANE012-10 HQ924799 Leptogenys arcirostris ASANE036-10 HQ924815 Leptogenys arcirostris ASANE037-10 HQ924816 Leptogenys arcirostris ASANE841-10 HQ925358 Leptogenys arcirostris ASANE842-10 HQ925359 Leptogenys arcirostris ASANE843-10 HQ925360 Leptogenys arcirostris ASANW484-10 KF200996 Leptogenys JCR21 JDWAM375-05 DQ176196 Leptogenys JCR21 JDWAM310-05 DQ176235 Leptogenys JCR21 ASANV777-10 HM418987 Leptogenys JCR21 ASANV799-10 HM419000 Leptogenys JCR21 ASANV800-10 HM419001 Leptogenys JCR21 ASANV802-10 HM419002 Leptogenys JCR21 ASANV804-10 HM419003 Leptogenys JCR21 ASANV805-10 HM419004 Leptogenys JCR21 ASANW174-10 HM419107 Leptogenys JCR21 ASANW380-10 HM419189 Leptogenys JCR21 ASANW381-10 HM419190 Leptogenys JCR21 ASANE457-10 HQ925180 Leptogenys JCR21 ASANE458-10 HQ925181 Leptogenys JCR21 ASANE460-10 HQ925183 Leptogenys JCR21 ASANE463-10 HQ925186 Leptogenys JCR21 ASANW726-10 HQ925617 Leptogenys JCR21 ASANW853-10 KF200279 Leptogenys JCR23 ASANV790-10 HM418994 Leptogenys JCR23 ASANW134-10 HM419080 Leptogenys JCR23 ASANW141-10 HM419083 Leptogenys JCR23 ASANW164-10 HM419099

142

Species BOLD Process ID Genback Accession No. Leptogenys JCR23 ASANW173-10 HM419106 Leptogenys JCR23 ASANW379-10 HM419188 Leptogenys JCR23 ASANW451-10 HM419206 Leptogenys JCR23 ASANW633-10 HM419271 Leptogenys JCR23 ASANW734-10 HM419290 Leptogenys JCR23 ASANW885-10 HM419307 Leptogenys JCR23 ASANW886-10 HM419308 Leptogenys JCR23 ASANW913-10 HM419315 Leptogenys JCR23 ASANW967-10 HM419320 Leptogenys JCR23 ASANW968-10 HM419321 Leptogenys JCR23 ASANV776-10 HM880716 Leptogenys JCR23 ASANE017-10 HQ924803 Leptogenys JCR23 ASANE043-10 HQ924822 Leptogenys JCR23 ASANE459-10 HQ925182 Leptogenys JCR23 ASANE462-10 HQ925185 Leptogenys JCR23 ASANE466-10 HQ925188 Leptogenys JCR23 ASANE491-10 HQ925207 Leptogenys JCR23 ASANE492-10 HQ925208 Leptogenys JCR23 ASANE493-10 HQ925209 Leptogenys JCR23 ASANE494-10 HQ925210 Leptogenys JCR23 ASANE497-10 HQ925213 Leptogenys JCR23 ASANE838-10 HQ925355 Leptogenys JCR23 ASANE847-10 HQ925363 Leptogenys JCR23 ASANE848-10 HQ925364 Leptogenys JCR23 ASANW916-10 HQ925637 Leptogenys JCR23 ASANW927-10 HQ925640 Leptogenys JCR23 ASANW943-10 HQ925642 Leptogenys JCR23 ASANW997-10 HQ925652 Leptogenys JCR23 ASANW860-10 KF200267 Leptogenys JCR23 ASANW869-10 KF200331 Leptogenys JCR23 ASANE832-10 KF200384 Leptogenys JCR23 ASANE025-10 KF200416 Leptogenys JCR23 ASANE827-10 KF200748 Leptogenys JCR23 ASANE846-10 KF200749 Leptogenys JCR23 ASANE829-10 KF200831 Leptogenys JCR24 ASANV795-10 HM418997 Leptogenys JCR24 ASANV796-10 HM418998 Leptogenys JCR24 ASANW265-10 HM419142 Leptogenys JCR24 ASANW271-10 HM419147 Leptogenys JCR24 ASANW638-10 HM419274

143

Species BOLD Process ID Genback Accession No. Leptogenys JCR24 ASANW643-10 HM419276 Leptogenys JCR24 ASANW646-10 HM419277 Leptogenys JCR24 ASANW719-10 HM419282 Leptogenys JCR24 ASANE031-10 HQ924811 Leptogenys JCR24 ASANE032-10 HQ924812 Leptogenys JCR24 ASANE072-10 HQ924848 Leptogenys JCR24 ASANE073-10 HQ924849 Leptogenys JCR24 ASANE080-10 HQ924854 Leptogenys JCR24 ASANE696-10 HQ925318 Leptogenys JCR24 ASANW715-10 HQ925615 Leptogenys JCR24 ASANW718-10 HQ925616 Leptogenys JCR24 ASANE030-10 KF200205 Leptogenys JCR24 ASANW469-10 KF200557 Leptogenys JCR24 ASANW717-10 KF200654 Leptogenys JCR24 ASANE510-10 KF200718 Leptogenys JCR24 ASANE687-10 KF200816 Leptogenys JCR25 ASANW281-10 HM419150 Leptogenys JCR25 ASANW288-10 HM419154 Leptogenys JCR25 ASANW303-10 HM419163 Leptogenys JCR25 ASANE019-10 HQ924805 Leptogenys JCR25 ASANE020-10 HQ924806 Leptogenys JCR25 ASANE021-10 HQ924807 Leptogenys JCR25 ASANE022-10 HQ924808 Leptogenys JCR25 ASANE038-10 HQ924817 Leptogenys JCR25 ASANE039-10 HQ924818 Leptogenys JCR25 ASANE048-10 HQ924826 Leptogenys JCR25 ASANE052-10 HQ924829 Leptogenys JCR25 ASANE081-10 HQ924855 Leptogenys JCR25 ASANE429-10 JF862705 Leptogenys JCR25 ASANE431-10 JF862706 Leptogenys JCR25 ASANW293-10 KF200201 Leptogenys JCR25 ASANW286-10 KF200334 Leptogenys JCR25 ASANE852-10 KF200396 Leptogenys JCR25 ASANE851-10 KF200401 Leptogenys JCR25 ASANE482-10 KF200439 Leptogenys JCR25 ASANW597-10 KF200536 Leptogenys JCR25 ASANW478-10 KF200581 Leptogenys JCR25 ASANW645-10 KF200615 Leptogenys JCR25 ASANW691-10 KF200744 Leptogenys JCR25 ASANE503-10 KF200764

144

Species BOLD Process ID Genback Accession No. Leptogenys JCR25 ASANE430-10 KF200829 Leptogenys JCR25 ASANE078-10 KF200875 Leptogenys JCR25 ASANE432-10 KF200945 Leptogenys JCR25 ASANW720-10 KF201038 Leptogenys JCR29 ASANV766-10 HM418978 Leptogenys JCR29 ASANV768-10 HM418980 Leptogenys JCR29 ASANW175-10 HM419108 Leptogenys JCR29 ASANW618-10 HM419265 Leptogenys JCR29 ASANW984-10 HM419324 Leptogenys JCR29 ASANE015-10 HQ924801 Leptogenys JCR29 ASANE016-10 HQ924802 Leptogenys JCR29 ASANE018-10 HQ924804 Leptogenys JCR29 ASANE453-10 HQ925176 Leptogenys JCR29 ASANE454-10 HQ925177 Leptogenys JCR29 ASANE455-10 HQ925178 Leptogenys JCR29 ASANE456-10 HQ925179 Leptogenys JCR29 ASANE461-10 HQ925184 Leptogenys JCR29 ASANE833-10 JN277061 Leptogenys JCR29 ASANE828-10 KF200273 Leptogenys JCR29 ASANE837-10 KF200302 Leptogenys JCR29 ASANW917-10 KF200329 Leptogenys JCR29 ASANE831-10 KF200473 Leptogenys JCR29 ASANW936-10 KF200515 Leptogenys JCR29 ASANW974-10 KF200526 Leptogenys JCR29 ASANE834-10 KF200674 Leptogenys JCR29 ASANW204-10 KF200721 Leptogenys JCR29 ASANW941-10 KF200991 Leptogenys JCR31 ASANW073-10 HM419048 Leptogenys JCR31 ASANW192-10 HM419117 Leptogenys JCR31 ASNAU801-09 KF200217 Leptogenys JCR31 ASNAU409-09 KF200368 Leptogenys JCR31 ASAMY122-07 KF200460 Leptogenys JCR31 ASAMY121-07 KF200487 Leptogenys JCR31 ASANW692-10 KF200590 Leptogenys JCR31 ASANW193-10 KF200595 Leptogenys JCR31 ASANW074-10 KF200693 Leptogenys JCR31 ASANW284-10 KF200722 Leptogenys JCR31 ASNAU874-09 KF200889 Leptogenys JCR31 ASNAU415-09 KF200952 Leptogenys oswaldi ASANV772-10 HM418983

145

Species BOLD Process ID Genback Accession No. Leptogenys oswaldi ASANV786-10 HM418992 Leptogenys oswaldi ASANW283-10 HM419151 Leptogenys oswaldi ASANW292-10 HM419158 Leptogenys oswaldi ASANW385-10 HM419194 Leptogenys oswaldi ASANW598-10 HM419250 Leptogenys oswaldi ASANW843-10 HM419297 Leptogenys oswaldi ASANW868-10 HM419302 Leptogenys oswaldi ASANW985-10 HM419325 Leptogenys oswaldi ASANE383-10 HQ925116 Leptogenys oswaldi ASANE423-10 HQ925151 Leptogenys oswaldi ASANE424-10 HQ925152 Leptogenys oswaldi ASANG815-10 JN277062 Leptogenys oswaldi ASANG855-10 JN277063 Leptogenys oswaldi ASANG880-10 JN277064 Leptogenys oswaldi ASANH171-10 JN277065 Leptogenys oswaldi ASAMV226-06 KF200224 Leptogenys oswaldi ASAMV228-06 KF200796 Leptogenys ridens ASANW008-10 HM419008 Leptogenys ridens ASANW012-10 HM419010 Leptogenys ridens ASANW013-10 HM419011 Leptogenys ridens ASANW014-10 HM419012 Leptogenys ridens ASANW018-10 HM419016 Leptogenys ridens ASANW024-10 HM419021 Leptogenys ridens ASANW880-10 HM419303 Leptogenys ridens ASANE005-10 HQ924792 Leptogenys ridens ASANE009-10 HQ924796 Leptogenys ridens ASANE010-10 HQ924797 Leptogenys ridens ASANE013-10 HQ924800 Leptogenys truncatirostris ASANV767-10 HM418979 Leptogenys truncatirostris ASANV791-10 HM418995 Leptogenys truncatirostris ASANV792-10 HM418996 Leptogenys truncatirostris ASANW003-10 HM419007 Leptogenys truncatirostris ASANW019-10 HM419017 Leptogenys truncatirostris ASANW040-10 HM419027 Leptogenys truncatirostris ASANW043-10 HM419028 Leptogenys truncatirostris ASANW602-10 HM419254 Leptogenys truncatirostris ASANW721-10 HM419283 Leptogenys truncatirostris ASANW890-10 HM419310 Leptogenys truncatirostris ASANV180-09 HM434274 Leptogenys truncatirostris ASANE001-10 HQ924788

146

Species BOLD Process ID Genback Accession No. Leptogenys truncatirostris ASANE002-10 HQ924789 Leptogenys truncatirostris ASANE003-10 HQ924790 Leptogenys truncatirostris ASANE004-10 HQ924791 Leptogenys truncatirostris ASANE007-10 HQ924794 Leptogenys truncatirostris ASANE008-10 HQ924795 Leptogenys truncatirostris ASANE045-10 HQ924824 Leptogenys truncatirostris ASANE046-10 HQ924825 Leptogenys truncatirostris ASANE049-10 HQ924827 Leptogenys truncatirostris ASANE444-10 HQ925167 Leptogenys truncatirostris ASANE478-10 HQ925197 Leptogenys truncatirostris ASANE508-10 HQ925222 Leptogenys truncatirostris ASANE853-10 HQ925366 Leptogenys truncatirostris ASANW582-10 HQ925596 Leptogenys truncatirostris JDWAM688-05 KF200518 Leptogenys truncatirostris JDWAM710-05 KF201073 Odontomachus coquereli JDWAM367-05 DQ176200 Odontomachus coquereli JDWAM294-05 DQ176252 Odontomachus coquereli ASAM878-05 EF610899 Odontomachus coquereli ASAM848-05 EF610900 Odontomachus coquereli ASAM863-05 EF610901 Odontomachus coquereli ASAM864-05 EF610902 Odontomachus coquereli ASAM865-05 EF610903 Odontomachus coquereli ASAM866-05 EF610904 Odontomachus coquereli ASAM867-05 EF610905 Odontomachus coquereli ASAM868-05 EF610906 Odontomachus coquereli ASAM853-05 EF610907 Odontomachus coquereli ASAM854-05 EF610908 Odontomachus coquereli ASAM869-05 EF610909 Odontomachus coquereli ASAM659-05 EF610910 Odontomachus coquereli ASAM855-05 EF610911 Odontomachus coquereli ASAM870-05 EF610912 Odontomachus coquereli ASAM660-05 EF610913 Odontomachus coquereli ASAM856-05 EF610914 Odontomachus coquereli ASAM661-05 EF610915 Odontomachus coquereli ASAM857-05 EF610916 Odontomachus coquereli ASAM858-05 EF610917 Odontomachus coquereli ASAM859-05 EF610918 Odontomachus coquereli ASAM860-05 EF610919 Odontomachus coquereli ASAM861-05 EF610920 Odontomachus coquereli ASAM862-05 EF610921

147

Species BOLD Process ID Genback Accession No. Odontomachus coquereli ASAM847-05 EF610922 Odontomachus coquereli ASAM3735-05 EF610923 Odontomachus coquereli ASAM3705-05 EF610924 Odontomachus coquereli ASAM3405-05 EF610925 Odontomachus coquereli ASAM3720-05 EF610926 Odontomachus coquereli ASAM3736-05 EF610927 Odontomachus coquereli ASAM3406-05 EF610928 Odontomachus coquereli ASAM3737-05 EF610929 Odontomachus coquereli ASAM3677-05 EF610930 Odontomachus coquereli ASAM3542-05 EF610931 Odontomachus coquereli ASAM3723-05 EF610932 Odontomachus coquereli ASAM3663-05 EF610933 Odontomachus coquereli ASAM3273-05 EF610934 Odontomachus coquereli ASAM3738-05 EF610935 Odontomachus coquereli ASAM3678-05 EF610936 Odontomachus coquereli ASAM3288-05 EF610937 Odontomachus coquereli ASAM3724-05 EF610938 Odontomachus coquereli ASAM3664-05 EF610939 Odontomachus coquereli ASAM3574-05 EF610940 Odontomachus coquereli ASAM3739-05 EF610941 Odontomachus coquereli ASAM3319-05 EF610942 Odontomachus coquereli ASAM3725-05 EF610943 Odontomachus coquereli ASAM3665-05 EF610944 Odontomachus coquereli ASAM3740-05 EF610945 Odontomachus coquereli ASAM3680-05 EF610946 Odontomachus coquereli ASAM3410-05 EF610947 Odontomachus coquereli ASAM3681-05 EF610948 Odontomachus coquereli ASAM3682-05 EF610949 Odontomachus coquereli ASAM3683-05 EF610950 Odontomachus coquereli ASAM3308-05 EF610951 Odontomachus coquereli ASAM3669-05 EF610952 Odontomachus coquereli ASAM3579-05 EF610953 Odontomachus coquereli ASAM3309-05 EF610954 Odontomachus coquereli ASAM3744-05 EF610955 Odontomachus coquereli ASAM3684-05 EF610956 Odontomachus coquereli ASAM3144-05 EF610957 Odontomachus coquereli ASAM3670-05 EF610958 Odontomachus coquereli ASAM3745-05 EF610959 Odontomachus coquereli ASAM3685-05 EF610960 Odontomachus coquereli ASAM3265-05 EF610961

148

Species BOLD Process ID Genback Accession No. Odontomachus coquereli ASAM3731-05 EF610962 Odontomachus coquereli ASAM3671-05 EF610963 Odontomachus coquereli ASAM3281-05 EF610964 Odontomachus coquereli ASAM3746-05 EF610965 Odontomachus coquereli ASAM3686-05 EF610966 Odontomachus coquereli ASAM3747-05 EF610967 Odontomachus coquereli ASAM3687-05 EF610968 Odontomachus coquereli ASAM3732-05 EF610969 Odontomachus coquereli ASAM3702-05 EF610970 Odontomachus coquereli ASAM3672-05 EF610971 Odontomachus coquereli ASAM3688-05 EF610972 Odontomachus coquereli ASAM3733-05 EF610973 Odontomachus coquereli ASAM3703-05 EF610974 Odontomachus coquereli ASAM3734-05 EF610975 Odontomachus coquereli ASAM3704-05 EF610976 Odontomachus coquereli ASAM3284-05 EF610977 Odontomachus coquereli ASAMF809-06 EF610978 Odontomachus coquereli ASAMF810-06 EF610979 Odontomachus coquereli ASAMF811-06 EF610980 Odontomachus coquereli ASAMF812-06 EF610981 Odontomachus coquereli ASAMF813-06 EF610982 Odontomachus coquereli ASAMF798-06 EF610983 Odontomachus coquereli ASAMF814-06 EF610984 Odontomachus coquereli ASAMF799-06 EF610985 Odontomachus coquereli ASAMF815-06 EF610986 Odontomachus coquereli ASAMF816-06 EF610987 Odontomachus coquereli ASAMF817-06 EF610988 Odontomachus coquereli ASAMF802-06 EF610989 Odontomachus coquereli ASAMF818-06 EF610990 Odontomachus coquereli ASAMF819-06 EF610991 Odontomachus coquereli ASAMF820-06 EF610992 Odontomachus coquereli ASAMV342-06 EF610993 Odontomachus coquereli ASAMV364-06 EF610994 Odontomachus coquereli ASAMV234-06 EF610995 Odontomachus coquereli ASANH316-10 JN287763 Odontomachus coquereli ASANH317-10 JN287764 Odontomachus coquereli ASANH318-10 JN287765 Odontomachus coquereli ASANH360-10 JN287774 Odontomachus coquereli ASNAU496-09 KF200484 Odontomachus coquereli ASNAU497-09 KF200537

149

Species BOLD Process ID Genback Accession No. Odontomachus coquereli ASNAU195-09 KF200684 Odontomachus coquereli ASNAU251-09 KF200699 Odontomachus coquereli ASNAU209-09 KF200798 Odontomachus coquereli ASNAU883-09 KF200807 Odontomachus coquereli ASNAU188-09 KF201042 Pheidole bessonii ASANX833-10 HM419546 Pheidole bessonii ASANX840-10 HM419547 Pheidole bessonii ASANX212-10 HM880844 Pheidole bessonii ASANX837-10 HM880957 Pheidole bessonii ASANX026-10 KF200219 Pheidole bessonii ASANV422-09 KF200259 Pheidole bessonii ASANX023-10 KF200285 Pheidole bessonii ASANV353-09 KF200353 Pheidole bessonii ASANV487-09 KF200371 Pheidole bessonii ASANV485-09 KF200411 Pheidole bessonii ASANV415-09 KF200425 Pheidole bessonii ASANX095-10 KF200434 Pheidole bessonii ASANX022-10 KF200584 Pheidole bessonii JDWAM701-05 KF200598 Pheidole bessonii JDWAM240-05 KF201077 Pheidole grallatrix ASANX099-10 HM880804 Pheidole grallatrix ASANX100-10 HM880805 Pheidole grallatrix ASANX211-10 HM880843 Pheidole grallatrix ASANX300-10 HM880867 Pheidole grallatrix ASANX307-10 HM880872 Pheidole grallatrix ASANX340-10 HM880878 Pheidole grallatrix ASANX476-10 HM880905 Pheidole grallatrix ASANX480-10 HM880906 Pheidole grallatrix ASANX481-10 HM880907 Pheidole grallatrix ASANX547-10 HM880925 Pheidole grallatrix ASANH639-10 JN283334 Pheidole grallatrix ASANH704-10 JN283372 Pheidole grallatrix ASANH752-10 JN283381 Pheidole grallatrix ASANX548-10 KF200186 Pheidole grallatrix ASAMX118-06 KF200400 Pheidole grallatrix ASAMX196-06 KF200591 Pheidole grallatrix ASAM3341-05 KF200717 Pheidole grallatrix ASAMX174-06 KF200930 Pheidole grallatrix ASANX311-10 KF201040 Pheidole grallatrix ASAM3340-05 KF201048

150

Species BOLD Process ID Genback Accession No. Pheidole longispinosa ASANX625-10 HM419513 Pheidole longispinosa ASANX626-10 HM419514 Pheidole longispinosa ASANX627-10 HM419515 Pheidole longispinosa ASANX688-10 HM419531 Pheidole longispinosa ASANX886-10 HM419564 Pheidole longispinosa ASANX948-10 HM419591 Pheidole longispinosa ASANX068-10 HM880794 Pheidole longispinosa ASANX098-10 HM880803 Pheidole longispinosa ASANX277-10 HM880865 Pheidole longispinosa ASANX398-10 HM880884 Pheidole longispinosa ASANX425-10 HM880895 Pheidole longispinosa ASANX465-10 HM880903 Pheidole longispinosa ASANX549-10 HM880926 Pheidole longispinosa ASANX885-10 HM880965 Pheidole longispinosa ASANX903-10 HM880967 Pheidole longispinosa ASANX740-10 KF200586 Pheidole longispinosa ASANX874-10 KF200715 Pheidole longispinosa ASANX687-10 KF200998 Pheidole longispinosa scabrata ASANX628-10 HM419516 Pheidole longispinosa scabrata ASANX941-10 HM419587 Pheidole MG126 ASANY174-10 HQ547325 Pheidole MG126 ASANY226-10 HQ547328 Pheidole MG126 ASANY228-10 HQ547329 Pheidole MG126 ASANY622-10 HQ547411 Pheidole MG126 ASANY758-10 HQ547432 Pheidole MG126 ASANY846-10 HQ547456 Pheidole MG126 ASAMX117-06 KF200228 Pheidole MG126 ASAM3356-05 KF200298 Pheidole MG126 ASAM3333-05 KF200390 Pheidole MG126 ASAM3335-05 KF200406 Pheidole MG126 ASAM3393-05 KF200410 Pheidole MG126 ASAMX145-06 KF200420 Pheidole MG126 ASAM3357-05 KF200587 Pheidole MG126 ASAM3371-05 KF200606 Pheidole MG126 ASAM3326-05 KF200618 Pheidole MG126 ASAM3331-05 KF200810 Pheidole MG126 ASAM3336-05 KF200927 Pheidole MG126 ASAM3332-05 KF201012 Pheidole MG126 ASAM3327-05 KF201067 Pheidole MG145 ASANY555-10 HQ547384

151

Species BOLD Process ID Genback Accession No. Pheidole MG145 ASANY556-10 HQ547385 Pheidole MG145 ASANY557-10 HQ547386 Pheidole MG145 ASANY560-10 HQ547387 Pheidole MG145 ASANY561-10 HQ547388 Pheidole MG145 ASANY564-10 HQ547390 Pheidole MG145 ASANY565-10 HQ547391 Pheidole MG145 ASANY566-10 HQ547392 Pheidole MG145 ASANY567-10 HQ547393 Pheidole MG145 ASANV387-09 KF200233 Pheidole MG145 ASANV502-09 KF200437 Pheidole MG145 ASANV449-09 KF200565 Pheidole MG145 ASANV501-09 KF200658 Pheidole MG145 ASANV450-09 KF200679 Pheidole MG145 ASANV510-09 KF200901 Pheidole MG145 ASANV359-09 KF200906 Pheidole MG145 ASANV162-09 KF200933 Pheidole MG145 ASANV156-09 KF201013 Pheidole MG145 ASANV453-09 KF201080 Pheidole MG154 ASANP490-09 GU710390 Pheidole MG154 ASANP491-09 GU710393 Pheidole MG154 ASANY052-10 HQ547285 Pheidole MG154 ASANY096-10 HQ547302 Pheidole MG154 ASANY374-10 HQ547345 Pheidole MG154 ASANY813-10 HQ547446 Pheidole MG154 ASANY825-10 HQ547451 Pheidole MG154 ASANY725-10 KF200645 Pheidole MG154 ASANY753-10 KF200753 Pheidole MG154 ASANY592-10 KF200809 Pheidole nemoralis ASANX114-10 HM419384 Pheidole nemoralis ASANX171-10 HM419408 Pheidole nemoralis ASANX848-10 HM419550 Pheidole nemoralis ASANX849-10 HM419551 Pheidole nemoralis ASANX871-10 HM419557 Pheidole nemoralis ASANX884-10 HM419563 Pheidole nemoralis ASANX206-10 HM880841 Pheidole nemoralis ASANX410-10 HM880889 Pheidole nemoralis ASANH352-10 JN283256 Pheidole nemoralis ASANH454-10 JN283280 Pheidole nemoralis ASANH614-10 JN283329 Pheidole nemoralis ASANH803-10 JN283403

152

Species BOLD Process ID Genback Accession No. Pheidole nemoralis ASANH849-10 JN283421 Pheidole nemoralis ASAMI008-05 KF200209 Pheidole nemoralis ASAMI010-05 KF200236 Pheidole nemoralis ASAMI009-05 KF200568 Pheidole nemoralis ASANX265-10 KF200632 Pheidole nemoralis ASANX850-10 KF200750 Pheidole nemoralis ASAM3378-05 KF200769 Pheidole nemoralis ASAM3382-05 KF200934 Pheidole nemoralis ASANX780-10 KF200964 Pheidole nemoralis ASAM3362-05 KF201047 Pheidole oswaldi JDWAM297-05 DQ176255 Pheidole oswaldi ASANX134-10 HM419393 Pheidole oswaldi ASANX183-10 HM419412 Pheidole oswaldi ASANX189-10 HM419415 Pheidole oswaldi ASANX199-10 HM419423 Pheidole oswaldi ASANX455-10 HM419486 Pheidole oswaldi ASANX460-10 HM419490 Pheidole oswaldi ASANX064-10 HM880793 Pheidole oswaldi ASANX947-10 HQ925668 Pheidole oswaldi ASANH308-10 JN283243 Pheidole oswaldi ASANH584-10 JN283317 Pheidole oswaldi ASANH611-10 JN283326 Pheidole oswaldi ASANH617-10 JN283331 Pheidole oswaldi ASANH925-10 JN283444 Pheidole oswaldi ASAMX144-06 KF200177 Pheidole oswaldi ASANX551-10 KF200791 Pheidole oswaldi ASAMX154-06 KF200879 Pheidole oswaldi ASANX239-10 KF200950 Pheidole voeltzkowii ASANX292-10 HM419445 Pheidole voeltzkowii ASANX456-10 HM419487 Pheidole voeltzkowii ASANX936-10 HQ925667 Pheidole voeltzkowii ASANH576-10 JN283315 Pheidole voeltzkowii ASANH918-10 JN283437 Pheidole voeltzkowii ASANH930-10 JN283449 Pheidole voeltzkowii ASANH986-10 JN283481 Pheidole voeltzkowii ASNAU581-09 KF200641 Pheidole voeltzkowii ASANV152-09 KF200839 Pheidole voeltzkowii ASNAU213-09 KF200858 Pheidole voeltzkowii ASANH815-10 KF200887 Pheidole voeltzkowii ASNAU770-09 KF200971

153

Species BOLD Process ID Genback Accession No. Strumigenys ampyx ASANU239-09 HM418825 Strumigenys ampyx ASANU330-09 HM418840 Strumigenys ampyx ASANR564-09 HM434081 Strumigenys ampyx ASANH507-10 JN287814 Strumigenys ampyx ASANH604-10 JN287839 Strumigenys ampyx ASANH624-10 JN287841 Strumigenys ampyx ASANH626-10 JN287842 Strumigenys ampyx ASANH829-10 JN287903 Strumigenys ampyx ASNAU407-09 KF201002 Strumigenys ampyx ASNAU922-09 KF201024 Strumigenys chilo ASANS145-09 GU711396 Strumigenys chilo ASANS153-09 GU711397 Strumigenys chilo ASANS150-09 GU711398 Strumigenys chilo ASANU331-09 HM434158 Strumigenys chilo ASANU544-09 HM434211 Strumigenys chilo ASANU628-09 HM434248 Strumigenys chilo ASANU696-09 HM434262 Strumigenys chilo ASANU220-09 HQ925484 Strumigenys chilo ASANU360-09 HQ925489 Strumigenys chilo ASANH445-10 JN287798 Strumigenys chilo ASANH465-10 JN287804 Strumigenys chilo ASANV155-09 KF200246 Strumigenys chilo ASNAU925-09 KF200291 Strumigenys chilo ASNAU784-09 KF200391 Strumigenys chilo ASNAU824-09 KF200849 Strumigenys chilo ASAMX227-06 KF200855 Strumigenys chilo ASAMX125-06 KF200984 Strumigenys dicomas ASANU241-09 HM434128 Strumigenys dicomas ASANU322-09 HM434155 Strumigenys dicomas ASANU325-09 HM434157 Strumigenys dicomas ASANU364-09 HM434166 Strumigenys dicomas ASANU367-09 HM434167 Strumigenys dicomas ASANU681-09 HM434258 Strumigenys dicomas ASANU687-09 HM434259 Strumigenys dicomas ASANU691-09 HM434260 Strumigenys dicomas ASANU692-09 HM434261 Strumigenys dicomas ASANU372-09 HQ925491 Strumigenys dicomas ASANH586-10 JN287834 Strumigenys dicomas ASANH636-10 JN287847 Strumigenys dicomas ASANH658-10 JN287860

154

Species BOLD Process ID Genback Accession No. Strumigenys dicomas ASANH663-10 JN287863 Strumigenys dicomas ASANH798-10 JN287892 Strumigenys dicomas ASNAU369-09 KF200243 Strumigenys dicomas ASNAU926-09 KF200256 Strumigenys dicomas ASNAU760-09 KF200383 Strumigenys dicomas ASNAU400-09 KF200851 Strumigenys grandidieri ASANU378-09 HM418847 Strumigenys grandidieri ASANU379-09 HM418848 Strumigenys grandidieri ASANU380-09 HM418849 Strumigenys grandidieri ASANU387-09 HM418850 Strumigenys grandidieri ASANU389-09 HM418851 Strumigenys grandidieri ASANU536-09 HM418898 Strumigenys grandidieri ASANU545-09 HM418899 Strumigenys grandidieri ASANU651-09 HM418929 Strumigenys grandidieri ASANU606-09 HM434239 Strumigenys grandidieri ASNAU761-09 HM435049 Strumigenys grandidieri ASAMX091-06 KF200303 Strumigenys grandidieri ASAMX076-06 KF200367 Strumigenys grandidieri ASAMX071-06 KF200418 Strumigenys grandidieri ASAMX060-06 KF200424 Strumigenys grandidieri ASAMX029-06 KF200428 Strumigenys grandidieri ASAMX055-06 KF200482 Strumigenys grandidieri ASAMX090-06 KF200516 Strumigenys grandidieri ASAMX020-06 KF200617 Strumigenys grandidieri ASAMX073-06 KF200621 Strumigenys grandidieri ASAMX123-06 KF200731 Strumigenys grandidieri ASAMX074-06 KF200890 Strumigenys grandidieri ASAMX054-06 KF200940 Strumigenys grandidieri ASAMX075-06 KF201061 Strumigenys inatos ASANS105-09 HM434103 Strumigenys inatos ASANS214-09 HM434107 Strumigenys inatos ASANS216-09 HM434108 Strumigenys inatos ASANS217-09 HM434109 Strumigenys inatos ASANS535-09 HM434119 Strumigenys inatos ASANU382-09 HM434170 Strumigenys inatos ASANU386-09 HM434174 Strumigenys inatos ASANU388-09 HM434175 Strumigenys inatos ASANU390-09 HM434176 Strumigenys inatos ASANU445-09 HM434186 Strumigenys inatos ASANU447-09 HM434188

155

Species BOLD Process ID Genback Accession No. Strumigenys inatos ASANU449-09 HM434190 Strumigenys inatos ASANU451-09 HM434191 Strumigenys inatos ASANU456-09 HQ925495 Strumigenys labaris ASANU529-09 HM434205 Strumigenys labaris ASANU553-09 HM434212 Strumigenys labaris ASANU557-09 HM434214 Strumigenys labaris ASANU559-09 HM434216 Strumigenys labaris ASANU562-09 HM434218 Strumigenys labaris ASANU565-09 HM434220 Strumigenys labaris ASANU570-09 HM434224 Strumigenys labaris ASANU574-09 HM434227 Strumigenys labaris ASANU576-09 HM434229 Strumigenys labaris ASANU573-09 HM880710 Strumigenys luca ASANS054-09 HM418655 Strumigenys luca ASANS070-09 HM418657 Strumigenys luca ASANS141-09 HM418678 Strumigenys luca ASANS142-09 HM418679 Strumigenys luca ASANS155-09 HM418681 Strumigenys luca ASNAU156-09 HQ550739 Strumigenys luca ASANG998-10 JN287695 Strumigenys luca ASANG999-10 JN287696 Strumigenys luca ASANH001-10 JN287697 Strumigenys luca ASANH002-10 JN287698 Strumigenys luca ASANH003-10 JN287699 Strumigenys luca ASNAU157-09 KF200257 Strumigenys luca ASNAU696-09 KF200356 Strumigenys luca ASNAU690-09 KF200506 Strumigenys origo ASANU361-09 HM434165 Strumigenys origo ASANU564-09 HM434219 Strumigenys origo ASANU571-09 HM434225 Strumigenys origo ASANU572-09 HM434226 Strumigenys origo ASANU374-09 HQ925492 Strumigenys origo ASAMX148-06 KF200264 Strumigenys origo ASAMX166-06 KF200292 Strumigenys origo ASAMX234-06 KF200365 Strumigenys origo ASAMX165-06 KF200467 Strumigenys origo ASAMX121-06 KF200662 Strumigenys origo ASAMX124-06 KF200697 Strumigenys origo ASAMX167-06 KF200853 Strumigenys origo ASAMX229-06 KF200894

156

Species BOLD Process ID Genback Accession No. Strumigenys origo ASAMX149-06 KF201065 Strumigenys scotti ASANU339-09 HM434159 Strumigenys scotti ASANU381-09 HM434169 Strumigenys scotti ASANU384-09 HM434172 Strumigenys scotti ASANU446-09 HM434187 Strumigenys scotti ASANU448-09 HM434189 Strumigenys scotti ASANU452-09 HM434192 Strumigenys scotti ASANU453-09 HM434193 Strumigenys scotti ASANU458-09 HM434195 Strumigenys scotti ASANU460-09 HM434196 Strumigenys vazimba ASANS115-09 HM418666 Strumigenys vazimba ASANS185-09 HM418688 Strumigenys vazimba ASANU356-09 HQ925487 Strumigenys vazimba ASANH402-10 JN287785 Strumigenys vazimba ASANH654-10 JN287856 Strumigenys vazimba ASANH657-10 JN287859 Strumigenys vazimba ASANH771-10 JN287886 Strumigenys vazimba ASANH818-10 JN287895 Strumigenys vazimba ASNAU759-09 KF200225 Strumigenys vazimba ASNAU790-09 KF200380 Strumigenys vazimba ASNAU782-09 KF200397 Strumigenys vazimba ASNAU376-09 KF200476 Strumigenys vazimba ASNAU798-09 KF200477 Strumigenys vazimba ASNAU366-09 KF200534 Strumigenys vazimba ASNAU383-09 KF200559 Strumigenys vazimba ASNAU307-09 KF200666 Strumigenys vazimba ASNAU401-09 KF200681 Strumigenys vazimba JDWAM022-04 KF200738 Strumigenys vazimba ASNAU295-09 KF201058 Terataner acanthus ASANS352-09 HM418701 Terataner acanthus ASANS563-09 HM418712 Terataner acanthus ASANS564-09 HM418713 Terataner acanthus ASAMI103-06 KF200181 Terataner acanthus ASAMI118-06 KF200206 Terataner acanthus ASAMI119-06 KF200281 Terataner acanthus ASAMF899-06 KF200399 Terataner acanthus ASAMF845-06 KF200514 Terataner acanthus ASAMF849-06 KF200540 Terataner acanthus ASAMF901-06 KF200551 Terataner acanthus ASAMI126-06 KF200633

157

Species BOLD Process ID Genback Accession No. Terataner acanthus ASAMI105-06 KF200696 Terataner acanthus ASAMI106-06 KF200730 Terataner acanthus ASAMI123-06 KF200732 Terataner acanthus ASAMI104-06 KF200781 Terataner acanthus ASAMF847-06 KF200898 Terataner acanthus ASAMF846-06 KF200979 Terataner alluaudi JDWAM654-05 DQ176075 Terataner alluaudi JDWAM658-05 DQ176078 Terataner alluaudi JDWAM653-05 DQ176088 Terataner alluaudi JDWAM638-05 DQ176089 Terataner alluaudi JDWAM643-05 DQ176094 Terataner alluaudi JDWAM534-05 DQ176102 Terataner alluaudi JDWAM536-05 DQ176104 Terataner alluaudi JDWAM402-05 DQ176161 Terataner alluaudi JDWAM332-05 DQ176223 Terataner alluaudi ASAMF859-06 KF200191 Terataner alluaudi ASAMI127-06 KF200196 Terataner alluaudi ASAMY115-07 KF200211 Terataner alluaudi ASAMI111-06 KF200222 Terataner alluaudi ASAMF913-06 KF200226 Terataner alluaudi ASAMY151-07 KF200227 Terataner alluaudi ASAMF934-06 KF200262 Terataner alluaudi ASAMF911-06 KF200326 Terataner alluaudi ASAMF435-06 KF200360 Terataner alluaudi ASAMF894-06 KF200373 Terataner alluaudi ASAMI120-06 KF200377 Terataner alluaudi ASAMI122-06 KF200403 Terataner alluaudi ASAMF897-06 KF200405 Terataner alluaudi ASAMF844-06 KF200422 Terataner alluaudi ASAMF905-06 KF200448 Terataner alluaudi ASAMF832-06 KF200489 Terataner alluaudi ASAMF436-06 KF200503 Terataner alluaudi ASAMI109-06 KF200528 Terataner alluaudi ASAMI124-06 KF200539 Terataner alluaudi ASAMY117-07 KF200588 Terataner alluaudi ASAMF853-06 KF200605 Terataner alluaudi ASAMF914-06 KF200623 Terataner alluaudi ASAMI110-06 KF200626 Terataner alluaudi ASAMY152-07 KF200631 Terataner alluaudi ASAMI121-06 KF200637

158

Species BOLD Process ID Genback Accession No. Terataner alluaudi ASAMF840-06 KF200649 Terataner alluaudi ASAMF437-06 KF200685 Terataner alluaudi ASAMY116-07 KF200705 Terataner alluaudi ASAMF717-06 KF200734 Terataner alluaudi ASAMF904-06 KF200736 Terataner alluaudi ASAMF936-06 KF200739 Terataner alluaudi ASAMF855-06 KF200752 Terataner alluaudi ASAMI125-06 KF200767 Terataner alluaudi ASAMY114-07 KF200773 Terataner alluaudi ASAMY106-07 KF200792 Terataner alluaudi ASAMI112-06 KF200794 Terataner alluaudi ASAMI129-06 KF200802 Terataner alluaudi ASAMF912-06 KF200811 Terataner alluaudi ASAMF910-06 KF200822 Terataner alluaudi ASAMI117-06 KF200828 Terataner alluaudi ASAMF857-06 KF200836 Terataner alluaudi ASAMF892-06 KF200916 Terataner alluaudi ASAMF939-06 KF200942 Terataner alluaudi ASAMF805-06 KF200948 Terataner alluaudi ASAMF854-06 KF200955 Terataner alluaudi ASAMF856-06 KF200963 Terataner alluaudi ASAMY330-07 KF200985 Terataner alluaudi ASAMF933-06 KF201016 Terataner alluaudi ASAMF909-06 KF201022 Terataner alluaudi ASAMF434-06 KF201035 Terataner alluaudi ASAMF858-06 KF201050 Terataner alluaudi ASAMY118-07 KF201062 Terataner alluaudi ASAMF893-06 KF201074 Terataner MG01 ASANS024-09 HM418641 Terataner MG01 ASANS025-09 HM418642 Terataner MG01 ASANS026-09 HM418643 Terataner MG01 ASANS027-09 HM418644 Terataner MG01 ASANS028-09 HM418645 Terataner MG01 ASANS038-09 HM418652 Terataner MG01 ASANS039-09 HM418653 Terataner MG01 ASANS532-09 HM418710 Terataner MG01 ASAMF972-06 KF200193 Terataner MG01 ASAMF688-06 KF200572 Terataner MG01 ASAMF694-06 KF200652 Terataner MG01 ASAMF690-06 KF200725

159

Species BOLD Process ID Genback Accession No. Terataner MG01 ASAMF702-06 KF200815 Terataner MG01 ASAMF691-06 KF200892 Terataner MG01 ASAMF693-06 KF200903 Terataner MG01 ASAMF689-06 KF200961 Terataner MG12 ASAMF665-06 KF200213 Terataner MG12 ASANV013-09 KF200297 Terataner MG12 ASAMF663-06 KF200323 Terataner MG12 ASAMF685-06 KF200392 Terataner MG12 ASAMF671-06 KF200404 Terataner MG12 ASANV011-09 KF200450 Terataner MG12 ASAMF945-06 KF200504 Terataner MG12 ASAMF683-06 KF200560 Terataner MG12 ASANV012-09 KF200660 Terataner MG12 ASANV666-09 KF200747 Terataner MG12 ASAMF673-06 KF200868 Terataner MG12 ASANV010-09 KF200883 Terataner MG12 ASANV690-09 KF200920 Terataner MG12 ASAMF682-06 KF200921 Terataner MG12 ASANV692-09 KF200924 Terataner MG12 ASAMF684-06 KF200943 Terataner MG12 ASAMF672-06 KF200949 Terataner MG12 ASANV008-09 KF201004 Terataner MG12 ASANV691-09 KF201032 Terataner MG12 ASAMF666-06 KF201056 Terataner MG13 ASANV182-09 HM434275 Terataner MG13 ASANV183-09 HM434276 Terataner MG13 ASAMF923-06 KF200183 Terataner MG13 ASAMF874-06 KF200216 Terataner MG13 ASAMF875-06 KF200265 Terataner MG13 ASAMF878-06 KF200270 Terataner MG13 ASAMF890-06 KF200305 Terataner MG13 ASAMF869-06 KF200500 Terataner MG13 ASAMF883-06 KF200520 Terataner MG13 ASAMF889-06 KF200544 Terataner MG13 ASAMF922-06 KF200566 Terataner MG13 ASAMI107-06 KF200600 Terataner MG13 ASAMF871-06 KF200613 Terataner MG13 ASAMF882-06 KF200646 Terataner MG13 ASAMF888-06 KF200710 Terataner MG13 ASAMF926-06 KF200760

160

Species BOLD Process ID Genback Accession No. Terataner MG13 ASAMF880-06 KF200780 Terataner MG13 ASAMF715-06 KF200835 Terataner MG13 ASAMF924-06 KF200852 Terataner MG13 ASAMF885-06 KF200878 Terataner MG13 ASAMF887-06 KF200897 Terataner MG13 ASAMF872-06 KF200929 Terataner MG13 ASAMF925-06 KF200974 Terataner MG13 ASAMF876-06 KF201014 Terataner MG13 ASAMF881-06 KF201055 Terataner MG13 ASAMF886-06 KF201071 Terataner MG19 ASAMI097-06 KF200242 Terataner MG19 ASAMF997-06 KF200288 Terataner MG19 ASANV753-09 KF200304 Terataner MG19 ASANV739-09 KF200314 Terataner MG19 ASAMI100-06 KF200376 Terataner MG19 ASAMI099-06 KF200385 Terataner MG19 ASAMI095-06 KF200387 Terataner MG19 ASAMI096-06 KF200426 Terataner MG19 ASAMF974-06 KF200593 Terataner MG19 ASANV735-09 KF200604 Terataner MG19 ASANV741-09 KF200628 Terataner MG19 ASANV736-09 KF200770 Terataner MG19 ASANV734-09 KF200793 Terataner MG19 ASAMI098-06 KF200888 Terataner MG19 ASAMF975-06 KF200905 Terataner MG19 ASAMF984-06 KF200936 Terataner MG19 ASANV747-09 KF200966 Terataner MG19 ASANV023-09 KF200973 Terataner MG19 ASANV740-09 KF200994 Terataner MG24 ASANV752-09 KF200185 Terataner MG24 ASANV737-09 KF200188 Terataner MG24 ASAMF861-06 KF200210 Terataner MG24 JDWAM689-05 KF200240 Terataner MG24 JDWAM507-05 KF200254 Terataner MG24 ASAMF989-06 KF200300 Terataner MG24 ASAMF716-06 KF200308 Terataner MG24 ASAMF990-06 KF200335 Terataner MG24 ASAMF987-06 KF200395 Terataner MG24 ASANV749-09 KF200456 Terataner MG24 ASAMI113-06 KF200468

161

Species BOLD Process ID Genback Accession No. Terataner MG24 ASAMF971-06 KF200475 Terataner MG24 ASAMF952-06 KF200481 Terataner MG24 ASANV751-09 KF200533 Terataner MG24 JDWAM693-05 KF200555 Terataner MG24 ASAMF983-06 KF200571 Terataner MG24 ASAMF951-06 KF200583 Terataner MG24 ASAMF950-06 KF200603 Terataner MG24 ASAMF863-06 KF200616 Terataner MG24 ASANV732-09 KF200692 Terataner MG24 JDWAM692-05 KF200694 Terataner MG24 ASAMF982-06 KF200740 Terataner MG24 ASAMF864-06 KF200758 Terataner MG24 JDWAM708-05 KF200771 Terataner MG24 ASAMF953-06 KF200825 Terataner MG24 ASANV748-09 KF200832 Terataner MG24 ASAMF981-06 KF200843 Terataner MG24 ASAMI114-06 KF200870 Terataner MG24 ASAMF852-06 KF200877 Terataner MG24 ASAMF954-06 KF200902 Terataner MG24 ASAMF866-06 KF200911 Terataner MG24 JDWAM694-05 KF200919 Terataner MG24 ASAMF860-06 KF200967 Terataner MG24 ASAMF862-06 KF200986 Terataner MG24 ASANV733-09 KF200993 Terataner MG24 ASAMF988-06 KF201017 Terataner MG24 ASAMF998-06 KF201033 Terataner MG24 ASAMF865-06 KF201036 Terataner MG26 ASANJ305-11 KF200178 Terataner MG26 ASANJ255-11 KF200268 Terataner MG26 ASANJ439-11 KF200307 Terataner MG26 ASANJ304-11 KF200394 Terataner MG26 ASANJ587-11 KF200545 Terataner MG26 ASANJ409-11 KF200556 Terataner MG26 ASANJ397-11 KF200596 Terataner MG26 ASANJ253-11 KF200609 Terataner MG26 ASANJ181-11 KF200638 Terataner MG26 ASANJ444-11 KF200983 Terataner xaltus ASANS029-09 HM418646 Terataner xaltus ASANS030-09 HM418647 Terataner xaltus ASANS031-09 HM418648

162

Species BOLD Process ID Genback Accession No. Terataner xaltus ASANS032-09 HM418649 Terataner xaltus ASANS360-09 HM418707 Terataner xaltus ASANS551-09 HM418711 Terataner xaltus ASAMI101-06 KF200783 Terataner xaltus ASAMF696-06 KF200867 Terataner xaltus ASAMF695-06 KF200876 Terataner xaltus ASAMI102-06 KF200975 Tetramorium ankarana ASANZ821-10 HQ547898 Tetramorium anodontion ASAND038-10 HQ546780 Tetramorium anodontion ASAND039-10 HQ546781 Tetramorium anodontion ASAND113-10 HQ546815 Tetramorium anodontion ASAND117-10 HQ546818 Tetramorium anodontion ASAND121-10 HQ546821 Tetramorium anodontion ASAND736-10 HQ547132 Tetramorium anodontion ASAND740-10 HQ547133 Tetramorium anodontion ASAND749-10 HQ547136 Tetramorium anodontion ASAND166-10 JN283026 Tetramorium anodontion ASAND760-10 KF200837 Tetramorium anodontion ASAND035-10 KF200937 Tetramorium anodontion ASAND754-10 KF200938 Tetramorium anodontion ASAND026-10 KF201039 Tetramorium attenboroughi ASAND009-10 HQ546770 Tetramorium attenboroughi ASAND014-10 HQ546771 Tetramorium attenboroughi ASAND016-10 HQ546773 Tetramorium attenboroughi ASAND042-10 HQ546782 Tetramorium attenboroughi ASAND194-10 HQ546838 Tetramorium attenboroughi ASAND020-10 JN283018 Tetramorium attenboroughi ASAND036-10 JN283019 Tetramorium attenboroughi ASAND114-10 JN283022 Tetramorium attenboroughi ASAND122-10 JN283023 Tetramorium attenboroughi ASAND206-10 JN283028 Tetramorium attenboroughi ASAND207-10 JN283029 Tetramorium attenboroughi ASAND580-10 JN283045 Tetramorium attenboroughi ASAND748-10 KF200294 Tetramorium attenboroughi ASAND018-10 KF200976 Tetramorium bessonii ASANO484-09 GU709707 Tetramorium bessonii ASANO754-09 GU709708 Tetramorium bessonii ASANO694-09 GU709709 Tetramorium bessonii ASANO756-09 GU709710 Tetramorium bessonii ASANO755-09 GU709711

163

Species BOLD Process ID Genback Accession No. Tetramorium bessonii ASANO757-09 GU709713 Tetramorium bessonii ASANP465-09 GU710328 Tetramorium bessonii ASANO660-09 HM373088 Tetramorium bessonii ASANP500-09 HM373104 Tetramorium bessonii ASANU467-09 HM418855 Tetramorium bessonii ASANY429-10 KF200180 Tetramorium bessonii ASANY419-10 KF200423 Tetramorium bessonii ASANY436-10 KF200553 Tetramorium bessonii ASANY422-10 KF200554 Tetramorium bessonii ASANY480-10 KF200608 Tetramorium bessonii ASANY506-10 KF200663 Tetramorium bessonii ASANY559-10 KF200709 Tetramorium bessonii ASANY562-10 KF200763 Tetramorium bessonii ASANY470-10 KF200922 Tetramorium bessonii ASANY533-10 KF200928 Tetramorium bessonii ASANY475-10 KF201025 Tetramorium bessonii ASANY425-10 KF201026 Tetramorium bessonii ASANY442-10 KF201029 Tetramorium bessonii ASANY717-10 KF201049 Tetramorium bessonii ASANY407-10 KF201075 Tetramorium cognatum ASANZ381-10 HQ547660 Tetramorium cognatum ASANZ405-10 HQ547669 Tetramorium cognatum ASANZ406-10 HQ547670 Tetramorium cognatum ASANZ407-10 HQ547671 Tetramorium cognatum ASANZ417-10 HQ547676 Tetramorium cognatum ASANZ418-10 HQ547677 Tetramorium cognatum ASANZ420-10 HQ547678 Tetramorium cognatum ASANZ352-10 JN283566 Tetramorium cognatum ASANZ367-10 JN283567 Tetramorium cognatum ASAMI032-05 KF200261 Tetramorium delagoense ASANO508-09 GU709690 Tetramorium delagoense ASANO515-09 GU709692 Tetramorium delagoense ASANO509-09 HM373076 Tetramorium delagoense ASANO511-09 HM373077 Tetramorium delagoense ASANV177-09 HM434273 Tetramorium delagoense ASAND015-10 HQ546772 Tetramorium delagoense ASAND072-10 HQ546794 Tetramorium delagoense ASAND106-10 HQ546811 Tetramorium delagoense ASAND115-10 HQ546816 Tetramorium delagoense ASAND220-10 HQ546856

164

Species BOLD Process ID Genback Accession No. Tetramorium delagoense ASAND222-10 HQ546857 Tetramorium delagoense ASAND753-10 HQ547140 Tetramorium delagoense ASAND755-10 JN283071 Tetramorium delagoense ASANG870-10 JN283116 Tetramorium delagoense ASANH070-10 JN283159 Tetramorium delagoense JDWAM459-05 KF200619 Tetramorium delagoense ASAND112-10 KF200823 Tetramorium electrum ASANZ110-10 HQ547534 Tetramorium electrum ASANZ208-10 HQ547584 Tetramorium electrum ASANZ262-10 HQ547609 Tetramorium electrum ASANZ267-10 HQ547613 Tetramorium electrum ASANZ338-10 HQ547640 Tetramorium electrum ASANZ377-10 HQ547659 Tetramorium electrum ASANZ390-10 HQ547662 Tetramorium electrum ASANZ394-10 HQ547663 Tetramorium electrum ASANZ403-10 HQ547668 Tetramorium electrum ASANZ534-10 HQ547773 Tetramorium electrum ASAMX230-06 KF200280 Tetramorium electrum ASAMI033-05 KF200531 Tetramorium electrum ASAMI035-05 KF200558 Tetramorium hobbit ASANZ319-10 HQ547637 Tetramorium ibycterum ASAND068-10 HQ546790 Tetramorium ibycterum ASAND069-10 HQ546791 Tetramorium ibycterum ASAND078-10 HQ546798 Tetramorium ibycterum ASAND119-10 HQ546819 Tetramorium ibycterum ASAND644-10 HQ547125 Tetramorium ibycterum ASAND750-10 HQ547137 Tetramorium ibycterum ASAND751-10 HQ547138 Tetramorium ibycterum ASAND680-10 JN283055 Tetramorium ibycterum ASAND713-10 JN283065 Tetramorium ibycterum ASAND727-10 JN283068 Tetramorium ibycterum ASAND728-10 JN283069 Tetramorium ibycterum ASAND735-10 JN283070 Tetramorium indet ASANZ104-10 HQ547527 Tetramorium indet ASANZ326-10 JF863081 Tetramorium kelleri ASANO624-09 GU709680 Tetramorium kelleri ASANO512-09 GU709683 Tetramorium kelleri ASANZ1018-10 HQ547520 Tetramorium kelleri ASANZ164-10 HQ547556 Tetramorium kelleri ASANZ182-10 HQ547569

165

Species BOLD Process ID Genback Accession No. Tetramorium kelleri ASANZ235-10 HQ547598 Tetramorium kelleri ASANZ389-10 HQ547661 Tetramorium kelleri ASANZ785-10 HQ547885 Tetramorium kelleri ASANZ982-10 HQ547926 Tetramorium kelleri ASANZ983-10 HQ547927 Tetramorium kelleri ASANZ996-10 HQ547936 Tetramorium kelleri ASANZ929-10 KF200324 Tetramorium mars ASANZ056-10 HQ547480 Tetramorium mars ASANZ076-10 HQ547489 Tetramorium mars ASANZ590-10 HQ547808 Tetramorium mars ASANZ949-10 HQ547916 Tetramorium mars ASANZ914-10 JN283570 Tetramorium mars ASANZ942-10 KF200727 Tetramorium MG095 ASANZ068-10 HQ547487 Tetramorium norvigi ASANY065-10 HQ547289 Tetramorium norvigi ASANY176-10 HQ547326 Tetramorium norvigi ASANY512-10 HQ547376 Tetramorium norvigi ASANY579-10 HQ547401 Tetramorium norvigi ASANY584-10 HQ547406 Tetramorium norvigi ASANY585-10 HQ547407 Tetramorium norvigi ASANY607-10 HQ547409 Tetramorium norvigi ASANY646-10 HQ547416 Tetramorium norvigi ASANY822-10 HQ547448 Tetramorium norvigi ASANY823-10 HQ547449 Tetramorium norvigi ASANY824-10 HQ547450 Tetramorium norvigi ASANY834-10 HQ547452 Tetramorium norvigi ASANY844-10 HQ547454 Tetramorium norvigi ASANY845-10 HQ547455 Tetramorium norvigi ASANH319-10 JN283244 Tetramorium norvigi ASANH563-10 JN283307 Tetramorium norvigi ASANH566-10 JN283309 Tetramorium norvigi ASANH568-10 JN283311 Tetramorium norvigi ASANY617-10 KF200232 Tetramorium plesiarum ASNAU106-09 HM882409 Tetramorium plesiarum ASNAU650-09 HM882425 Tetramorium plesiarum ASNAU665-09 HM882426 Tetramorium plesiarum ASNAU673-09 HM882428 Tetramorium plesiarum ASANZ095-10 HQ547503 Tetramorium plesiarum ASANZ097-10 HQ547504 Tetramorium plesiarum ASANZ099-10 HQ547505

166

Species BOLD Process ID Genback Accession No. Tetramorium plesiarum ASANZ1003-10 HQ547507 Tetramorium plesiarum ASANZ204-10 HQ547583 Tetramorium plesiarum ASANZ219-10 HQ547591 Tetramorium plesiarum ASANZ225-10 HQ547593 Tetramorium plesiarum ASANZ236-10 HQ547599 Tetramorium plesiarum ASANZ592-10 HQ547809 Tetramorium plesiarum ASANZ944-10 HQ547912 Tetramorium plesiarum ASANZ010-10 JF863056 Tetramorium plesiarum ASANZ221-10 JF863072 Tetramorium plesiarum ASANZ934-10 JF863116 Tetramorium plesiarum ASANZ951-10 JF863119 Tetramorium plesiarum ASNAU657-09 KF200436 Tetramorium plesiarum ASNAU098-09 KF200689 Tetramorium plesiarum ASNAU101-09 KF200912 Tetramorium proximum ASANZ474-10 HQ547726 Tetramorium proximum ASANY051-10 JF862994 Tetramorium proximum ASANY080-10 JF862999 Tetramorium proximum ASANY094-10 JF863001 Tetramorium proximum ASANY119-10 JF863005 Tetramorium proximum ASANY399-10 JF863021 Tetramorium proximum ASANY418-10 JF863022 Tetramorium proximum ASANY467-10 JF863026 Tetramorium proximum ASANY471-10 JF863028 Tetramorium proximum ASANY499-10 JF863030 Tetramorium proximum ASANY509-10 JF863031 Tetramorium proximum ASANY536-10 JF863033 Tetramorium proximum ASANY587-10 JF863041 Tetramorium proximum ASANY852-10 JF863051 Tetramorium proximum ASANV370-09 KF200704 Tetramorium proximum ASAMX061-06 KF200778 Tetramorium proximum ASAMX087-06 KF200844 Tetramorium proximum ASAMX086-06 KF200848 Tetramorium sericeiventre ASANP471-09 GU710247 Tetramorium sericeiventre ASANP479-09 GU710249 Tetramorium sericeiventre ASANP613-09 GU710250 Tetramorium sericeiventre ASANP612-09 GU710251 Tetramorium sericeiventre ASANP614-09 GU710253 Tetramorium sericeiventre ASANP478-09 HM373102 Tetramorium sericeiventre ASANY483-10 KF200192 Tetramorium sericeiventre ASANY518-10 KF200195

167

Species BOLD Process ID Genback Accession No. Tetramorium sericeiventre ASANI249-11 KF200251 Tetramorium sericeiventre ASANI118-11 KF200252 Tetramorium sericeiventre ASANI202-11 KF200255 Tetramorium sericeiventre ASIMA051-08 KF200318 Tetramorium sericeiventre ASANY444-10 KF200321 Tetramorium sericeiventre ASIMA147-08 KF200342 Tetramorium sericeiventre ASIMA049-08 KF200355 Tetramorium sericeiventre ASANY460-10 KF200361 Tetramorium sericeiventre ASIMA067-08 KF200369 Tetramorium sericeiventre ASANY416-10 KF200378 Tetramorium sericeiventre ASANI107-11 KF200379 Tetramorium sericeiventre ASANY451-10 KF200455 Tetramorium sericeiventre ASANI630-11 KF200465 Tetramorium sericeiventre ASAMX326-06 KF200474 Tetramorium sericeiventre ASANY411-10 KF200499 Tetramorium sericeiventre ASIMA073-08 KF200510 Tetramorium sericeiventre ASANY520-10 KF200532 Tetramorium sericeiventre ASANY558-10 KF200561 Tetramorium sericeiventre ASANI221-11 KF200580 Tetramorium sericeiventre ASIMA157-08 KF200582 Tetramorium sericeiventre ASANY532-10 KF200629 Tetramorium sericeiventre ASIMA130-08 KF200630 Tetramorium sericeiventre ASANY507-10 KF200636 Tetramorium sericeiventre ASANY723-10 KF200639 Tetramorium sericeiventre ASANI138-11 KF200656 Tetramorium sericeiventre ASIMA088-08 KF200686 Tetramorium sericeiventre ASIMA103-08 KF200695 Tetramorium sericeiventre ASIMA075-08 KF200702 Tetramorium sericeiventre ASIMA084-08 KF200706 Tetramorium sericeiventre ASIMA093-08 KF200707 Tetramorium sericeiventre ASIMA086-08 KF200708 Tetramorium sericeiventre ASANY486-10 KF200716 Tetramorium sericeiventre ASIMA063-08 KF200720 Tetramorium sericeiventre ASIMA154-08 KF200759 Tetramorium sericeiventre ASANY505-10 KF200761 Tetramorium sericeiventre ASANI680-11 KF200777 Tetramorium sericeiventre ASANY437-10 KF200790 Tetramorium sericeiventre ASIMA078-08 KF200806 Tetramorium sericeiventre ASANY760-10 KF200813 Tetramorium sericeiventre ASAMI036-05 KF200818

168

Species BOLD Process ID Genback Accession No. Tetramorium sericeiventre ASIMA139-08 KF200931 Tetramorium sericeiventre ASANY477-10 KF200939 Tetramorium sericeiventre ASANY481-10 KF200941 Tetramorium sericeiventre ASANY494-10 KF200946 Tetramorium sericeiventre ASANV342-09 KF200958 Tetramorium sericeiventre ASIMA111-08 KF200960 Tetramorium sericeiventre ASANY711-10 KF200962 Tetramorium sericeiventre ASIMA153-08 KF200972 Tetramorium sericeiventre ASANY529-10 KF200989 Tetramorium sericeiventre ASANI598-11 KF201000 Tetramorium sericeiventre ASANI292-11 KF201070 Tetramorium tosii ASANH302-10 JN283240 Tetramorium tosii ASANH303-10 JN283241 Tetramorium tosii ASANH444-10 JN283275 Tetramorium tosii ASANH644-10 JN283337 Tetramorium tosii ASANH450-10 KF200234 Tetramorium tosii ASANY243-10 KF200241 Tetramorium tosii ASAMX337-06 KF200381 Tetramorium tosii ASANY336-10 KF200529 Tetramorium tosii ASANY229-10 KF200742 Tetramorium tosii ASAMX338-06 KF200756 Tetramorium tosii ASANY227-10 KF200785 Tetramorium tosii ASAMX329-06 KF200814 Tetramorium tosii ASANY511-10 KF200838 Tetramorium tosii ASANY133-10 KF200977 Tetramorium valky ASANH463-10 JN283283 Tetramorium valky ASANH695-10 JN283364 Tetramorium valky ASANH699-10 JN283367 Tetramorium valky ASANY604-10 KF200238 Tetramorium valky ASANV444-09 KF200501 Tetramorium valky ASANY545-10 KF200530 Tetramorium valky ASANY242-10 KF200563 Tetramorium valky ASANY239-10 KF200574 Tetramorium valky ASANY841-10 KF200601 Tetramorium valky ASANV434-09 KF200620 Tetramorium valky ASANV227-09 KF200624 Tetramorium valky ASANV194-09 KF200651 Tetramorium valky ASANY516-10 KF200845 Tetramorium valky ASANY262-10 KF200864 Tetramorium valky ASANY603-10 KF201051

169

Species BOLD Process ID Genback Accession No. Tetramorium valky ASANV364-09 KF201066 Tetramorium zenatum ASANZ079-10 HQ547492 Tetramorium zenatum ASANZ089-10 HQ547498 Tetramorium zenatum ASANZ105-10 HQ547531 Tetramorium zenatum ASANZ130-10 HQ547547 Tetramorium zenatum ASANZ952-10 HQ547917 Tetramorium zenatum ASANH065-10 JN283156 Tetramorium zenatum ASANH066-10 JN283157 Tetramorium zenatum ASANH069-10 JN283158 Tetramorium zenatum ASANH284-10 JN283231

170

Appendix S2 Chapter 2- Analyses of Isolation by Distance with Disjunct Trends Excluded

A disjunct trend in a geographic vs. genetic distance plot has a lack of continuous variability at a genetic or geographic distribution, irrespective of scale. In other words, there is a visible gap observed in genetic (y axis) or geographic (x axis) measurements. An example of a disjunct genetic trend is observed in Anochetus goodmani and an example of a disjunct geographic trend is observed in Anochetus madagascarensis (Fig 2.6). Strong Mantel correlations coupled with disjunct plots of geographic or genetic distance may have several explanations. Geographic disjuncts may be due to sparse sampling patterns, or may actually represent the true distribution of a species. Genetic disjuncts, reflective of high genetic variability, may be explained by the presence of one or more cryptic species. I have completed a separate analyses with these cases removed to compare to my original results. See Table 2.4 for specific species that were excluded. Analyses excluding these cases showed very similar trends to my original results. Mean Mantel correlations (r values) differed slightly from the original results (Table S2.1). Ranges of Mantel correlations within genera did not differ drastically (Table S2.2). Welch’s two sample t- tests between mean Mantel correlations in ergatoid and alate species were significantly different as in the original analysis (Table S2.3). Body size and Mantel correlation comparisons were also similar to original results. There was a negative relationship between Weber’s length and isolation by distance values (Pearson’s correlation=-0.156), but this was not significant (t=-1.038, df=43, p=0.305) (Fig. S2.1). A positive trend between Camponotus Mantel correlations and Weber’s length was also observed (Pearson’s correlation=0.427), but this was also not significant (t=2.004, df=18, p=0.060) (Fig. S2.2). Mean Mantel correlations between size categories (< 1 mm, < 2 mm, < 3 mm, < 4 mm, < 5 mm, > 5 mm) were significantly different (F=3.134, df=5, p=0.018) (Fig. S2.3). Mean body size categories was almost significant in the original analysis.

171

Table S2.1- Comparison of isolation by distance values between all analyzed ant species (grey) and excluding disjunct trends (white). “Mean r” is the mean Mantel correlation and “StDev” is the standard deviation. Some fields are labeled “n/a” because there was only one analyzed species within the genus.

Genus State n (species) n (species) Mean r Mean r StDev StDev Anochetus Alate 2 1 0.234 0.293 n/a n/a Anochetus Ergatoid 2 0 0.850 n/a n/a n/a Camponotus Alate 19 17 0.469 0.368 0.193 0.241 Hypoponera Alate 7 5 0.437 0.379 0.194 0.319 Leptogenys Ergatoid 11 9 0.609 0.576 0.245 0.158 Odontomachus Ergatoid 1 1 0.408 0.408 n/a n/a Pheidole Alate 9 7 0.562 0.429 0.315 0.307 Strumigenys Alate (possibly ergatoid in 1-2 species) 10 7 0.644 0.648 0.308 0.284 Terataner Ergatoid 9 5 0.754 0.773 0.281 0.172 Tetramorium Alate 16 12 0.261 0.266 0.265 0.259

172

Table S2.2- Comparison of lowest and highest isolation by distance values for each ant genus. “Lowest r” and “highest r” is the species that has the lowest/highest significant Mantel correlation within their genus. All analyzed cases are highlighted in grey and excluded disjunct trends are highlighted in white. Some fields are labeled “n/a” because only one species within the genus was analyzed.

Species with Species with Species with Species with Genus Lowest r Lowest r lowest r lowest r Highest r Highest r highest r highest r Anochetus Anochetus Anochetus 0.176 n/a madagascarensis n/a 0.293 n/a grandidieri n/a Anochetus Anochetus Anochetus 0.700 n/a goodmani n/a 0.999 n/a boltoni n/a Camponotus Camponotus Camponotus Camponotus Camponotus 0.068 0.068 christi christi 0.906 0.686 hagensii gouldi Hypoponera Hypoponera Hypoponera Hypoponera Hypoponera 0.348 0.348 MG043 MG043 0.884 0.633 MG071 MG038 Leptogenys Leptogenys Leptogenys Leptogenys Leptogenys 0.336 0.336 JCR25 JCR25 0.853 0.853 JCR29 JCR29 Odontomachus n/a n/a n/a n/a n/a n/a n/a n/a Pheidole Pheidole Pheidole Pheidole Pheidole 0.182 0.182 grallatrix grallatrix 0.962 0.744 MG145 bessonii Strumigenys Strumigenys Strumigenys Strumigenys Strumigenys 0.405 0.611 scotti inatos 0.955 0.885 labaris origo Terataner Terataner Terataner Terataner Terataner 0.560 0.560 MG19 MG19 0.996 0.950 xaltus acanthus Tetramorium Tetramorium Tetramorium Tetramorium Tetramorium 0.249 0.249 MG095 MG095 0.706 0.706 plesiarum plesiarum

173

Table S2.3- Welch’s two sample t-test results between mean Mantel correlations (r) in ergatoid and alate species. Ergatoid mean r values were found to be significantly different between alate species in both excluded cases (white) and all cases (grey). All ergatoid species had significant values of isolation by distance.

State n mean r TTEST (t) TTEST (df) TTEST (p) Ergatoid 23 0.630 Alate 51 0.374 4.066 34.059 2.28 0e-07 Alate 39 0.392 5.624 58.96 2.699e-07

174

Fig. S2.1- Weber’s length and Mantel correlations of geographic and genetic distance (r value) of ant species with disjunct cases removed. There is a slight negative correlation (Pearson’s correlation=-0.156), but this is not significant as in the original analysis (t=-1.038, df=43, p=0.305).

175

Fig. S2.2- Camponotus Weber’s length and Mantel correlations of geographic and genetic distance (r value) with disjunct cases removed. There is a positive correlation (Pearson’s correlation=0.427), but this was not significant (t=2.004, df=18, p=0.060) as in the original analysis.

176

Fig. S2.3- Alate ant queen size categories and Mantel correlations of geographic and genetic distance (r values) with disjunct trends removed. Mean Mantel correlations are significantly different between size categories (F=3.134, df=5, p=0.018). In the original analysis, mean Mantel correlations were almost significant. (Sample sizes for each category is as follows: <1mm: n=7, <2mm: n=12, <3mm: n=8, <4mm: n=5, <5mm: n=5, >5mm: n=8).

177

Appendix S3 Chapter 2- Reexamining Isolation by Distance in Azteca pittieri

Using data from Pringle et al. (2012), I reanalyzed IBD in nine populations of the ant Azteca pittieri distributed along Mexico and Central America. Pringle et al. tested for IBD using estimates of population differentiation (ΦST) for one mitochondrial COI gene and three nuclear genes: Elongation Factor 1-alpha F1 (EF1αF1), Long-Wavelength Rhodopsin (LWRh) and Wingless (wg). Nuclear sequences were concatenated and analyzed separately from COI. Significant IBD was not found in COI (r=0.227, p=0.1) or in the nuclear genes (r=0.046, p=0.4). In my separate analysis with only COI, I removed population groupings and compared IBD between individuals using the same methods as in my Madagascar analyses. Significant IBD was found (r=0.539, p=0.002) (Fig. S3.1). See Pringle et al. (2012) for geographic distributions and Genbank accessions.

178

Fig. S3.1- Plot of COI genetic distance vs. geographic distance in the ant Azteca pittieri. Reanalysis of data from Pringle et al. (2012) shows significant IBD among A. pittieri (r=0.539, p=0.002).

179

Appendix S4 Chapter 3- coxA and hcpA BOLD process IDs and Genbank accessions

Table S4.1- BOLD process IDs and Genbank accessions for sequenced coxA in ants infected with Wolbachia.

Species BOLD Process ID Genbank Accession No. Amblyopone ambvky_m03 ASFTA1011-12 KF489952 Amblyopone ambvky_m03 ASFTA1012-12 KF489953 Amblyopone MGm04 ASFTA398-12 KF489954 Amblyoponine_genus1 MG01 ASFTA1489-12 KF489955 Anochetus grandidieri ASFTA1362-12 KF489969 Anochetus grandidieri ASFTA361-12 KF489959 Anochetus grandidieri ASFTA464-12 KF489970 Anochetus grandidieri ASFTA467-12 KF489972 Anochetus grandidieri ASFTA654-12 KF489968 Anochetus grandidieri ASFTA655-12 KF489967 Anochetus grandidieri ASFTA658-12 KF489966 Anochetus grandidieri ASFTA659-12 KF489965 Anochetus grandidieri ASFTA660-12 KF489964 Anochetus grandidieri ASFTA661-12 KF489963 Anochetus grandidieri ASFTA662-12 KF489962 Anochetus grandidieri ASFTA665-12 KF489960 Anochetus grandidieri ASFTA666-12 KF489958 Anochetus grandidieri ASFTA669-12 KF489957 Anochetus grandidieri ASFTA671-12 KF489973 Anochetus grandidieri ASFTA672-12 KF489961 Anochetus grandidieri ASFTA678-12 KF489956 Anochetus grandidieri ASFTA688-12 KF489971 Anochetus madagascarensis ASFTA1347-12 KF489975 Anochetus madagascarensis ASFTA677-12 KF489974 Aphaenogaster swammerdami ASFTA1408-12 KF489980 Aphaenogaster swammerdami ASFTA1409-12 KF489981 Aphaenogaster swammerdami ASFTA1410-12 KF489983 Aphaenogaster swammerdami ASFTA1426-12 KF489979 Aphaenogaster swammerdami ASFTA1432-12 KF489978 Aphaenogaster swammerdami ASFTA1450-12 KF489996 Aphaenogaster swammerdami ASFTA177-12 KF489994 Aphaenogaster swammerdami ASFTA186-12 KF489995 Aphaenogaster swammerdami ASFTA196-12 KF490000 Aphaenogaster swammerdami ASFTA200-12 KF489982

180

Species BOLD Process ID Genbank Accession No. Aphaenogaster swammerdami ASFTA217-12 KF489998 Aphaenogaster swammerdami ASFTA231-12 KF489989 Aphaenogaster swammerdami ASFTA411-12 KF489976 Aphaenogaster swammerdami ASFTA412-12 KF490001 Aphaenogaster swammerdami ASFTA495-12 KF489999 Aphaenogaster swammerdami ASFTA735-12 KF489993 Aphaenogaster swammerdami ASFTA736-12 KF489992 Aphaenogaster swammerdami ASFTA740-12 KF489988 Aphaenogaster swammerdami ASFTA741-12 KF489987 Aphaenogaster swammerdami ASFTA744-12 KF489986 Aphaenogaster swammerdami ASFTA745-12 KF489985 Aphaenogaster swammerdami ASFTA746-12 KF489984 Aphaenogaster swammerdami ASFTA749-12 KF489990 Aphaenogaster swammerdami ASFTA750-12 KF489991 Aphaenogaster swammerdami ASFTA752-12 KF489977 Aphaenogaster swammerdami ASFTA761-12 KF489997 Camponotus butteli ASFTA1319-12 KF490003 Camponotus butteli ASFTA1320-12 KF490005 Camponotus butteli ASFTA1321-12 KF490002 Camponotus butteli ASFTA1322-12 KF490004 Camponotus christi ASFTA1066-12 KF490011 Camponotus christi ASFTA1072-12 KF490010 Camponotus christi ASFTA1076-12 KF490008 Camponotus christi ASFTA1084-12 KF490007 Camponotus christi ASFTA1085-12 KF490009 Camponotus christi ASFTA1086-12 KF490013 Camponotus christi ASFTA1087-12 KF490006 Camponotus christi ASFTA1131-12 KF490012 Camponotus christi ferrugineus ASFTA1034-12 KF490025 Camponotus christi ferrugineus ASFTA1035-12 KF490024 Camponotus christi ferrugineus ASFTA1036-12 KF490023 Camponotus christi ferrugineus ASFTA1041-12 KF490016 Camponotus christi ferrugineus ASFTA1049-12 KF490022 Camponotus christi ferrugineus ASFTA1050-12 KF490021 Camponotus christi ferrugineus ASFTA1051-12 KF490020 Camponotus christi ferrugineus ASFTA1052-12 KF490019 Camponotus christi ferrugineus ASFTA1053-12 KF490018 Camponotus christi ferrugineus ASFTA1064-12 KF490017 Camponotus christi foersteri ASFTA1033-12 KF490037 Camponotus christi foersteri ASFTA1037-12 KF490032

181

Species BOLD Process ID Genbank Accession No. Camponotus christi foersteri ASFTA1040-12 KF490030 Camponotus christi foersteri ASFTA1045-12 KF490042 Camponotus christi foersteri ASFTA1046-12 KF490028 Camponotus christi foersteri ASFTA1056-12 KF490044 Camponotus christi foersteri ASFTA1067-12 KF490029 Camponotus christi foersteri ASFTA1069-12 KF490043 Camponotus christi foersteri ASFTA1071-12 KF490045 Camponotus christi foersteri ASFTA1102-12 KF490051 Camponotus christi foersteri ASFTA1103-12 KF490026 Camponotus christi foersteri ASFTA1104-12 KF490027 Camponotus christi foersteri ASFTA1105-12 KF490050 Camponotus christi foersteri ASFTA1138-12 KF490035 Camponotus christi foersteri ASFTA1143-12 KF490036 Camponotus christi foersteri ASFTA1144-12 KF490034 Camponotus christi foersteri ASFTA1145-12 KF490039 Camponotus christi foersteri ASFTA1580-12 KF490041 Camponotus christi foersteri ASFTA1581-12 KF490040 Camponotus christi foersteri ASFTA1589-12 KF490033 Camponotus christi foersteri ASFTA1590-12 KF490038 Camponotus christi foersteri ASFTA1601-12 KF490046 Camponotus christi foersteri ASFTA1602-12 KF490048 Camponotus christi foersteri ASFTA1603-12 KF490049 Camponotus christi foersteri ASFTA1604-12 KF490047 Camponotus christi foersteri ASFTA463-12 KF490031 Camponotus christi_01 ASFTA213-12 KF490014 Camponotus christi_02 ASFTA223-12 KF490015 Camponotus concolor ASFTA1147-12 KF490052 Camponotus dromedarius ASFTA1062-12 KF490055 Camponotus dromedarius ASFTA1082-12 KF490056 Camponotus dromedarius ASFTA1083-12 KF490053 Camponotus dromedarius ASFTA1108-12 KF490054 Camponotus dufouri ASFTA1337-12 KF490058 Camponotus dufouri ASFTA1338-12 KF490057 Camponotus gerberti ASFTA1093-12 KF490059 Camponotus gibber ASFTA1302-12 KF490061 Camponotus gibber ASFTA1331-12 KF490060 Camponotus grandidieri ASFTA1600-12 KF490062 Camponotus heteroclitus ASFTA1048-12 KF490067 Camponotus heteroclitus ASFTA1073-12 KF490063 Camponotus heteroclitus ASFTA1115-12 KF490072

182

Species BOLD Process ID Genbank Accession No. Camponotus heteroclitus ASFTA1116-12 KF490071 Camponotus heteroclitus ASFTA1286-12 KF490079 Camponotus heteroclitus ASFTA1290-12 KF490080 Camponotus heteroclitus ASFTA1298-12 KF490081 Camponotus heteroclitus ASFTA1299-12 KF490066 Camponotus heteroclitus ASFTA1303-12 KF490068 Camponotus heteroclitus ASFTA1323-12 KF490077 Camponotus heteroclitus ASFTA1339-12 KF490074 Camponotus heteroclitus ASFTA1591-12 KF490069 Camponotus heteroclitus ASFTA1592-12 KF490078 Camponotus heteroclitus ASFTA1593-12 KF490076 Camponotus heteroclitus ASFTA1594-12 KF490075 Camponotus heteroclitus ASFTA1595-12 KF490073 Camponotus heteroclitus ASFTA1596-12 KF490070 Camponotus heteroclitus ASFTA1597-12 KF490065 Camponotus heteroclitus ASFTA1598-12 KF490064 Camponotus hildebrandti ASFTA414-12 KF490082 Camponotus hova ASFTA952-12 KF490083 Camponotus MG002 ASFTA1304-12 KF490084 Camponotus MG003 ASFTA1312-12 KF490085 Camponotus MG003 ASFTA1313-12 KF490089 Camponotus MG003 ASFTA1314-12 KF490088 Camponotus MG003 ASFTA1315-12 KF490087 Camponotus MG003 ASFTA1316-12 KF490086 Camponotus MG004 ASFTA1307-12 KF490091 Camponotus MG004 ASFTA1309-12 KF490090 Camponotus MG004 ASFTA1326-12 KF490092 Camponotus MG005 ASFTA1025-12 KF490115 Camponotus MG005 ASFTA1026-12 KF490114 Camponotus MG005 ASFTA1027-12 KF490113 Camponotus MG005 ASFTA1028-12 KF490099 Camponotus MG005 ASFTA1029-12 KF490112 Camponotus MG005 ASFTA1059-12 KF490108 Camponotus MG005 ASFTA1060-12 KF490107 Camponotus MG005 ASFTA1068-12 KF490106 Camponotus MG005 ASFTA1088-12 KF490105 Camponotus MG005 ASFTA1089-12 KF490104 Camponotus MG005 ASFTA1092-12 KF490103 Camponotus MG005 ASFTA1094-12 KF490102 Camponotus MG005 ASFTA1095-12 KF490101

183

Species BOLD Process ID Genbank Accession No. Camponotus MG005 ASFTA1096-12 KF490100 Camponotus MG005 ASFTA1097-12 KF490110 Camponotus MG005 ASFTA1582-12 KF490093 Camponotus MG005 ASFTA1583-12 KF490095 Camponotus MG005 ASFTA1584-12 KF490096 Camponotus MG005 ASFTA1585-12 KF490098 Camponotus MG005 ASFTA1599-12 KF490094 Camponotus MG005 ASFTA1607-12 KF490097 Camponotus MG005 ASFTA203-12 KF490111 Camponotus MG005 ASFTA229-12 KF490109 Camponotus MG008 ASFTA1121-12 KF490116 Camponotus MG008 ASFTA1122-12 KF490118 Camponotus MG008 ASFTA1123-12 KF490117 Camponotus MG008 ASFTA192-12 KF490119 Camponotus MG014 ASFTA1288-12 KF490120 Camponotus MG014 ASFTA1325-12 KF490121 Camponotus MG014 ASFTA1328-12 KF490122 Camponotus MG017 ASFTA1135-12 KF490125 Camponotus MG017 ASFTA1136-12 KF490124 Camponotus MG017 ASFTA1137-12 KF490123 Camponotus MG018 ASFTA1032-12 KF490127 Camponotus MG018 ASFTA1129-12 KF490126 Camponotus MG018 ASFTA1140-12 KF490129 Camponotus MG018 ASFTA1141-12 KF490130 Camponotus MG018 ASFTA1142-12 KF490128 Camponotus MG019 ASFTA1109-12 KF490131 Camponotus MG022 ASFTA1081-12 KF490132 Camponotus MG023 ASFTA1030-12 KF490134 Camponotus MG023 ASFTA1031-12 KF490135 Camponotus MG023 ASFTA1110-12 KF490136 Camponotus MG023 ASFTA1111-12 KF490137 Camponotus MG023 ASFTA1112-12 KF490133 Camponotus MG023 ASFTA1113-12 KF490138 Camponotus MG023 ASFTA1117-12 KF490139 Camponotus MG023 ASFTA1127-12 KF490140 Camponotus MG023 ASFTA1128-12 KF490141 Camponotus MG023 ASFTA1132-12 KF490142 Camponotus MG023 ASFTA1133-12 KF490143 Camponotus MG023 ASFTA1134-12 KF490144 Camponotus MG024 ASFTA1042-12 KF490148

184

Species BOLD Process ID Genbank Accession No. Camponotus MG024 ASFTA1047-12 KF490146 Camponotus MG024 ASFTA1055-12 KF490145 Camponotus MG024 ASFTA1375-12 KF490147 Camponotus MG026 ASFTA1038-12 KF490154 Camponotus MG026 ASFTA1039-12 KF490151 Camponotus MG026 ASFTA1061-12 KF490149 Camponotus MG026 ASFTA1106-12 KF490153 Camponotus MG026 ASFTA1107-12 KF490152 Camponotus MG026 ASFTA1139-12 KF490150 Camponotus MG030 ASFTA1289-12 KF490155 Camponotus MG035 ASFTA1043-12 KF490162 Camponotus MG035 ASFTA1058-12 KF490160 Camponotus MG035 ASFTA1070-12 KF490159 Camponotus MG035 ASFTA900-12 KF490156 Camponotus MG035 ASFTA906-12 KF490157 Camponotus MG035 ASFTA907-12 KF490158 Camponotus MG035 ASFTA911-12 KF490161 Camponotus MG039 ASFTA224-12 pending Camponotus MG039 ASFTA1297-12 KF490165 Camponotus MG039 ASFTA1300-12 KF490167 Camponotus MG039 ASFTA1301-12 KF490166 Camponotus MG039 ASFTA188-12 KF490163 Camponotus MG039 ASFTA189-12 KF490164 Camponotus MG039 ASFTA237-12 KF490168 Camponotus MG040 ASFTA1125-12 KF490170 Camponotus MG040 ASFTA1310-12 KF490171 Camponotus MG040 ASFTA1311-12 KF490169 Camponotus MG040 ASFTA1317-12 KF490172 Camponotus MG041 ASFTA1124-12 KF490173 Camponotus MG041 ASFTA1126-12 KF490174 Camponotus MG043 ASFTA1296-12 KF490175 Camponotus MG043 ASFTA1333-12 KF490176 Camponotus MG046 ASFTA1021-12 KF490177 Camponotus MG047 ASFTA193-12 pending Camponotus MG047 ASFTA191-12 KF490178 Camponotus MG048 ASFTA057-12 KF490180 Camponotus MG048 ASFTA058-12 KF490179 Camponotus MG049 ASFTA1389-12 KF490182 Camponotus MG049 ASFTA1401-12 KF490181 Camponotus MG053 ASFTA1586-12 KF490184

185

Species BOLD Process ID Genbank Accession No. Camponotus MG053 ASFTA1587-12 KF490183 Camponotus MG053 ASFTA1605-12 KF490186 Camponotus MG053 ASFTA1606-12 KF490185 Camponotus MG054 ASFTA1146-12 KF490187 Camponotus MG078 ASFTA1044-12 KF490190 Camponotus MG078 ASFTA1054-12 KF490189 Camponotus MG078 ASFTA187-12 KF490188 Camponotus MG088 ASFTA903-12 KF490192 Camponotus MG088 ASFTA967-12 KF490191 Camponotus MG088 ASFTA968-12 KF490193 Camponotus MG089 ASFTA1114-12 KF490194 Camponotus MG089 ASFTA1130-12 KF490195 Camponotus MG096 ASFTA055-12 KF490196 Camponotus MG096 ASFTA056-12 KF490198 Camponotus MG096 ASFTA1340-12 KF490197 Camponotus MG101 ASFTA1608-12 KF490199 Camponotus MG111 ASFTA1063-12 KF490201 Camponotus MG111 ASFTA1090-12 KF490202 Camponotus MG111 ASFTA1091-12 KF490206 Camponotus MG111 ASFTA1098-12 KF490203 Camponotus MG111 ASFTA1099-12 KF490200 Camponotus MG111 ASFTA1100-12 KF490205 Camponotus MG111 ASFTA1101-12 KF490204 Camponotus MG112 ASFTA1080-12 KF490207 Camponotus MG119 ASFTA1075-12 KF490209 Camponotus MG119 ASFTA1118-12 KF490211 Camponotus MG119 ASFTA1119-12 KF490208 Camponotus MG119 ASFTA1120-12 KF490210 Camponotus MG120 ASFTA894-12 KF490213 Camponotus MG120 ASFTA895-12 KF490215 Camponotus MG120 ASFTA901-12 KF490214 Camponotus MG120 ASFTA912-12 KF490212 Camponotus MG121 ASFTA1074-12 KF490216 Camponotus pictipes ASFTA1057-12 KF490220 Camponotus pictipes ASFTA1077-12 KF490218 Camponotus pictipes ASFTA1078-12 KF490219 Camponotus pictipes ASFTA1079-12 KF490217 Camponotus roeseli ASFTA1065-12 KF490221 Cardiocondyla beanka_Q01 ASFTA887-12 KF490222 Cardiocondyla emeryi ASFTA747-12 KF490223

186

Species BOLD Process ID Genbank Accession No. Cardiocondyla wroughtonii ASFTA455-12 KF490230 Cardiocondyla wroughtonii ASFTA742-12 KF490233 Cardiocondyla wroughtonii ASFTA751-12 KF490224 Cardiocondyla wroughtonii ASFTA776-12 KF490226 Cardiocondyla wroughtonii ASFTA784-12 KF490235 Cardiocondyla wroughtonii ASFTA786-12 KF490234 Cardiocondyla wroughtonii ASFTA794-12 KF490231 Cardiocondyla wroughtonii ASFTA795-12 KF490225 Cardiocondyla wroughtonii ASFTA798-12 KF490228 Cardiocondyla wroughtonii ASFTA799-12 KF490227 Cardiocondyla wroughtonii ASFTA803-12 KF490229 Cardiocondyla wroughtonii ASFTA813-12 KF490232 Carebara beanka_m01 ASFTA888-12 KF490236 Cataulacus ebrardi ASFTA762-12 KF490237 Cataulacus oberthueri ASFTA909-12 KF490239 Cataulacus oberthueri ASFTA944-12 KF490238 Cataulacus oberthueri ASFTA945-12 KF490241 Cataulacus oberthueri ASFTA985-12 KF490240 Cataulacus porcatus ASFTA034-12 KF490242 Cataulacus porcatus ASFTA035-12 KF490243 Cataulacus porcatus ASFTA036-12 KF490244 Cataulacus porcatus ASFTA037-12 KF490245 Cataulacus porcatus ASFTA038-12 KF490246 Cataulacus porcatus ASFTA039-12 KF490247 Cataulacus porcatus ASFTA040-12 KF490248 Cataulacus porcatus ASFTA041-12 KF490249 Cataulacus porcatus ASFTA042-12 KF490250 Cataulacus porcatus ASFTA043-12 KF490251 Cataulacus porcatus ASFTA044-12 KF490252 Cataulacus porcatus ASFTA045-12 KF490253 Cataulacus porcatus ASFTA046-12 KF490254 Cataulacus porcatus ASFTA047-12 KF490255 Cataulacus porcatus ASFTA048-12 KF490256 Cataulacus porcatus ASFTA049-12 KF490257 Cataulacus porcatus ASFTA050-12 KF490258 Cataulacus porcatus ASFTA051-12 KF490259 Cataulacus porcatus ASFTA052-12 KF490260 Cataulacus porcatus ASFTA053-12 KF490261 Cataulacus porcatus ASFTA054-12 KF490262 Cataulacus porcatus ASFTA1573-12 KF490275

187

Species BOLD Process ID Genbank Accession No. Cataulacus porcatus ASFTA1574-12 KF490274 Cataulacus porcatus ASFTA227-12 KF490273 Cataulacus porcatus ASFTA318-12 KF490282 Cataulacus porcatus ASFTA338-12 KF490283 Cataulacus porcatus ASFTA370-12 KF490284 Cataulacus porcatus ASFTA481-12 KF490263 Cataulacus porcatus ASFTA483-12 KF490264 Cataulacus porcatus ASFTA484-12 KF490265 Cataulacus porcatus ASFTA485-12 KF490266 Cataulacus porcatus ASFTA486-12 KF490267 Cataulacus porcatus ASFTA487-12 KF490268 Cataulacus porcatus ASFTA488-12 KF490269 Cataulacus porcatus ASFTA489-12 KF490270 Cataulacus porcatus ASFTA490-12 KF490271 Cataulacus porcatus ASFTA492-12 KF490272 Cataulacus porcatus ASFTA913-12 KF490281 Cataulacus porcatus ASFTA916-12 KF490280 Cataulacus porcatus ASFTA922-12 KF490279 Cataulacus porcatus ASFTA938-12 KF490278 Cataulacus porcatus ASFTA939-12 KF490277 Cataulacus porcatus ASFTA948-12 KF490276 Cataulacus regularis ASFTA166-12 KF490287 Cataulacus regularis ASFTA168-12 KF490285 Cataulacus regularis ASFTA172-12 KF490286 Cataulacus wasmanni ASFTA918-12 KF490288 Cataulacus wasmanni ASFTA940-12 KF490291 Cataulacus wasmanni ASFTA950-12 KF490289 Cataulacus wasmanni ASFTA964-12 KF490290 Cerapachys beanka_m02 ASFTA875-12 KF490292 Cerapachys beanka_m03 ASFTA874-12 KF490293 Cerapachys L_MG11 ASFTA919-12 KF490294 Cerapachys L_MG11 ASFTA920-12 KF490296 Cerapachys L_MG11 ASFTA928-12 KF490295 Cerapachys P_DR04 ASFTA297-12 KF490297 Cerapachys P_MG01 ASFTA954-12 KF490298 Cerapachys P_MG02 ASFTA1232-12 KF490302 Cerapachys P_MG02 ASFTA1379-12 KF490304 Cerapachys P_MG02 ASFTA420-12 KF490303 Cerapachys P_MG02 ASFTA423-12 KF490301 Cerapachys P_MG02 ASFTA657-12 KF490299

188

Species BOLD Process ID Genbank Accession No. Cerapachys P_MG02 ASFTA896-12 KF490300 Cerapachys P_MG02 ASFTA902-12 KF490305 Cerapachys P_MG02 ASFTA956-12 KF490307 Cerapachys P_MG02 ASFTA957-12 KF490306 Cerapachys P_MG02 ASFTA929-12 KF490311 Cerapachys P_MG02 ASFTA935-12 KF490308 Cerapachys P_MG02 ASFTA936-12 KF490309 Cerapachys P_MG02 ASFTA943-12 KF490310 Cerapachys P_MG02 ASFTA1361-12 KF490312 Cerapachys P_MG02 ASFTA419-12 KF490313 Cerapachys prey01 ASFTA1240-12 KF490315 Cerapachys prey01 ASFTA1241-12 KF490316 Cerapachys prey01 ASFTA1242-12 KF490314 Cerapachys prey01 ASFTA1243-12 KF490317 Cerapachys prey01 ASFTA1244-12 KF490318 Cerapachys prey02 ASFTA1245-12 KF490321 Cerapachys prey02 ASFTA1246-12 KF490320 Cerapachys prey02 ASFTA1247-12 KF490319 Cerapachys prey03 ASFTA1248-12 KF490323 Cerapachys prey03 ASFTA1249-12 KF490322 Cerapachys prey03 ASFTA1250-12 KF490324 Cerapachys prey04 ASFTA1251-12 KF490326 Cerapachys prey04 ASFTA1252-12 KF490328 Cerapachys prey04 ASFTA1253-12 KF490327 Cerapachys prey04 ASFTA1254-12 KF490329 Cerapachys prey04 ASFTA1255-12 KF490325 Cerapachys prey05 ASFTA1256-12 KF490330 Cerapachys prey06 ASFTA1257-12 KF490331 Cerapachys undet ASFTA1235-12 KF490334 Cerapachys undet ASFTA1236-12 KF490335 Cerapachys undet ASFTA1237-12 KF490336 Cerapachys undet ASFTA1238-12 KF490337 Cerapachys undet ASFTA1239-12 KF490338 Cerapachys undet ASFTA852-12 KF490339 Cerapachys undet ASFTA857-12 KF490341 Cerapachys undet ASFTA858-12 KF490332 Cerapachys undet ASFTA861-12 KF490340 Cerapachys undet ASFTA862-12 KF490333 Crematogaster BBB35 ASFTA064-12 KF490343 Crematogaster BBB35 ASFTA451-12 KF490342

189

Species BOLD Process ID Genbank Accession No. Crematogaster BBB55 ASFTA059-12 KF490362 Crematogaster BBB55 ASFTA060-12 KF490344 Crematogaster BBB55 ASFTA061-12 KF490363 Crematogaster BBB55 ASFTA062-12 KF490361 Crematogaster BBB55 ASFTA063-12 KF490360 Crematogaster BBB55 ASFTA444-12 KF490345 Crematogaster BBB55 ASFTA445-12 KF490346 Crematogaster BBB55 ASFTA446-12 KF490347 Crematogaster BBB55 ASFTA447-12 KF490348 Crematogaster BBB55 ASFTA448-12 KF490349 Crematogaster BBB55 ASFTA449-12 KF490350 Crematogaster BBB55 ASFTA450-12 KF490351 Crematogaster BBB55 ASFTA452-12 KF490352 Crematogaster BBB55 ASFTA453-12 KF490353 Crematogaster BBB55 ASFTA454-12 KF490354 Crematogaster BBB55 ASFTA458-12 KF490355 Crematogaster BBB55 ASFTA459-12 KF490356 Crematogaster BBB55 ASFTA461-12 KF490357 Crematogaster BBB55 ASFTA462-12 KF490358 Crematogaster BBB55 ASFTA699-12 KF490359 Crematogaster DRw11 ASFTA1490-12 KF490364 Crematogaster DRw16 ASFTA1491-12 KF490365 Crematogaster grevei ASFTA202-12 KF490366 Crematogaster grevei ASFTA215-12 KF490370 Crematogaster grevei ASFTA216-12 KF490369 Crematogaster grevei ASFTA218-12 KF490368 Crematogaster grevei ASFTA230-12 KF490367 Crematogaster hova-complex_m1 ASFTA065-12 KF490371 Crematogaster hova-complex_m1 ASFTA066-12 KF490372 Crematogaster MG02 ASFTA1013-12 KF490374 Crematogaster MG02 ASFTA457-12 KF490373 Crematogaster undet ASFTA1393-12 KF490375 Crematogaster undet ASFTA1405-12 KF490376 Formica lepida ASFTA377-12 KF490377 Formica lepida ASFTA378-12 KF490378 Hypoponera DR01 ASFTA206-12 KF490379 Hypoponera MG016 ASFTA1494-12 KF490380 Hypoponera MG016 ASFTA155-12 KF490381 Hypoponera MG026 ASFTA255-12 KF490384 Hypoponera MG026 ASFTA273-12 KF490383

190

Species BOLD Process ID Genbank Accession No. Hypoponera MG026 ASFTA468-12 KF490382 Hypoponera MG028 ASFTA250-12 KF490385 Hypoponera MG028 ASFTA263-12 KF490386 Hypoponera MG031 ASFTA251-12 KF490388 Hypoponera MG031 ASFTA471-12 KF490387 Hypoponera MG039 ASFTA478-12 KF490389 Hypoponera MG044 ASFTA1167-12 KF490390 Hypoponera MG046 ASFTA1163-12 KF490391 Hypoponera MG046 ASFTA1168-12 KF490392 Hypoponera MG047 ASFTA1166-12 KF490393 Hypoponera MG048 ASFTA1172-12 KF490394 Hypoponera MG051 ASFTA1164-12 KF490395 Hypoponera MG066 ASFTA465-12 KF490397 Hypoponera MG066 ASFTA470-12 KF490396 Hypoponera MG092 ASFTA1171-12 KF490398 Hypoponera opacior ASFTA847-12 KF490399 Hypoponera opacior ASFTA848-12 KF490400 Hypoponera punctatissima ASFTA1148-12 KF490410 Hypoponera punctatissima ASFTA782-12 KF490406 Hypoponera punctatissima ASFTA783-12 KF490405 Hypoponera punctatissima ASFTA792-12 KF490402 Hypoponera punctatissima ASFTA796-12 KF490401 Hypoponera punctatissima ASFTA800-12 KF490403 Hypoponera punctatissima ASFTA802-12 KF490404 Hypoponera punctatissima ASFTA804-12 KF490407 Hypoponera punctatissima ASFTA805-12 KF490408 Hypoponera punctatissima ASFTA806-12 KF490409 Lepisiota canescens ASFTA1150-12 KF490411 Lepisiota canescens ASFTA1151-12 KF490412 Lepisiota canescens ASFTA1152-12 KF490413 Lepisiota canescens ASFTA1153-12 KF490414 Lepisiota canescens ASFTA1154-12 KF490415 Lepisiota canescens ASFTA1155-12 KF490416 Lepisiota canescens ASFTA1156-12 KF490417 Leptogenys acutirostris ASFTA082-12 KF490418 Leptogenys angusta ASFTA1355-12 KF490421 Leptogenys angusta ASFTA1451-12 KF490426 Leptogenys angusta ASFTA259-12 KF490428 Leptogenys angusta ASFTA265-12 KF490420 Leptogenys angusta ASFTA266-12 KF490419

191

Species BOLD Process ID Genbank Accession No. Leptogenys angusta ASFTA277-12 KF490425 Leptogenys angusta ASFTA278-12 KF490424 Leptogenys angusta ASFTA281-12 KF490423 Leptogenys angusta ASFTA282-12 KF490422 Leptogenys angusta ASFTA820-12 KF490427 Leptogenys antongilensis ASFTA260-12 KF490432 Leptogenys antongilensis ASFTA267-12 KF490431 Leptogenys antongilensis ASFTA269-12 KF490430 Leptogenys antongilensis ASFTA270-12 KF490429 Leptogenys arcirostris ASFTA071-12 KF490434 Leptogenys arcirostris ASFTA084-12 KF490433 Leptogenys falcigera ASFTA087-12 KF490436 Leptogenys falcigera ASFTA264-12 KF490435 Leptogenys falcigera ASFTA271-12 KF490437 Leptogenys gracilis ASFTA272-12 KF490439 Leptogenys gracilis ASFTA491-12 KF490438 Leptogenys grandidieri ASFTA244-12 KF490440 Leptogenys JCR01 ASFTA817-12 KF490442 Leptogenys JCR01 ASFTA830-12 KF490443 Leptogenys JCR01 ASFTA841-12 KF490441 Leptogenys JCR06 ASFTA261-12 KF490444 Leptogenys JCR08 ASFTA077-12 KF490445 Leptogenys JCR10 ASFTA840-12 KF490446 Leptogenys JCR23 ASFTA073-12 KF490448 Leptogenys JCR23 ASFTA083-12 KF490449 Leptogenys JCR23 ASFTA285-12 KF490447 Leptogenys JCR24 ASFTA076-12 KF490451 Leptogenys JCR24 ASFTA079-12 KF490453 Leptogenys JCR24 ASFTA080-12 KF490452 Leptogenys JCR24 ASFTA081-12 KF490450 Leptogenys JCR25 ASFTA075-12 KF490455 Leptogenys JCR25 ASFTA078-12 KF490454 Leptogenys JCR25 ASFTA258-12 KF490459 Leptogenys JCR25 ASFTA262-12 KF490460 Leptogenys JCR25 ASFTA818-12 KF490461 Leptogenys JCR25 ASFTA825-12 KF490456 Leptogenys JCR25 ASFTA836-12 KF490462 Leptogenys JCR25 ASFTA844-12 KF490458 Leptogenys JCR25 ASFTA846-12 KF490457 Leptogenys JCR26 ASFTA256-12 KF490463

192

Species BOLD Process ID Genbank Accession No. Leptogenys JCR29 ASFTA072-12 KF490468 Leptogenys JCR29 ASFTA074-12 KF490466 Leptogenys JCR29 ASFTA243-12 KF490469 Leptogenys JCR29 ASFTA257-12 KF490467 Leptogenys JCR29 ASFTA831-12 KF490464 Leptogenys JCR29 ASFTA832-12 KF490465 Leptogenys JCR31 ASFTA253-12 KF490471 Leptogenys JCR31 ASFTA254-12 KF490470 Leptogenys JCR33 ASFTA425-12 KF490472 Leptogenys oswaldi ASFTA268-12 KF490473 Leptogenys ridens ASFTA069-12 KF490475 Leptogenys ridens ASFTA070-12 KF490474 Leptogenys ridens ASFTA245-12 KF490476 Leptogenys ridens ASFTA246-12 KF490477 Leptogenys ridens ASFTA247-12 KF490478 Leptogenys saussurei ASFTA828-12 KF490479 Leptogenys truncatirostris ASFTA812-12 KF490480 Leptogenys voeltzkowi ASFTA275-12 KF490481 Lophomyrmex TH01 ASFTA1229-12 KF490482 Melanaspis mga ASFTA443-12 KF490483 Melissotarsus insularis ASFTA1430-12 KF490488 Melissotarsus insularis ASFTA1431-12 KF490489 Melissotarsus insularis ASFTA1433-12 KF490490 Melissotarsus insularis ASFTA626-12 KF490491 Melissotarsus insularis ASFTA634-12 KF490484 Melissotarsus insularis ASFTA635-12 KF490485 Melissotarsus insularis ASFTA667-12 KF490487 Melissotarsus insularis ASFTA668-12 KF490486 Meranoplus radamae ASFTA146-12 KF490492 Monomorium ambvky_m03 ASFTA981-12 KF490493 Monomorium bifidoclypeatum ASFTA094-12 KF490494 Monomorium chnodes ASFTA095-12 KF490495 Monomorium DR02 ASFTA201-12 KF490496 Monomorium DRm07d ASFTA207-12 KF490497 Monomorium DRm07d ASFTA209-12 KF490498 Monomorium DRQ02 ASFTA1499-12 KF490499 Monomorium exiguum ASFTA298-12 KF490500 Monomorium fisheri ASFTA111-12 KF490501 Monomorium fisheri ASFTA114-12 KF490502 Monomorium flavimembra ASFTA099-12 KF490508

193

Species BOLD Process ID Genbank Accession No. Monomorium flavimembra ASFTA104-12 KF490503 Monomorium flavimembra ASFTA105-12 KF490505 Monomorium flavimembra ASFTA106-12 KF490504 Monomorium flavimembra ASFTA107-12 KF490506 Monomorium flavimembra ASFTA109-12 KF490509 Monomorium flavimembra ASFTA110-12 KF490507 Monomorium gongromos ASFTA100-12 KF490512 Monomorium gongromos ASFTA101-12 KF490511 Monomorium gongromos ASFTA116-12 KF490510 Monomorium hanneli ASFTA021-12 KF490516 Monomorium hanneli ASFTA030-12 KF490513 Monomorium hanneli ASFTA167-12 KF490517 Monomorium hanneli ASFTA473-12 KF490514 Monomorium hanneli ASFTA480-12 KF490515 Monomorium hildebrandti ASFTA025-12 KF490518 Monomorium hildebrandti ASFTA032-12 KF490519 Monomorium hildebrandti_02 ASFTA323-12 KF490522 Monomorium hildebrandti_02 ASFTA326-12 KF490527 Monomorium hildebrandti_02 ASFTA327-12 KF490526 Monomorium hildebrandti_02 ASFTA328-12 KF490523 Monomorium hildebrandti_02 ASFTA329-12 KF490525 Monomorium hildebrandti_02 ASFTA373-12 KF490520 Monomorium hildebrandti_02 ASFTA374-12 KF490521 Monomorium hildebrandti_02 ASFTA375-12 KF490524 Monomorium madecassum ASFTA158-12 KF490528 Monomorium madecassum ASFTA159-12 KF490529 Monomorium micrommaton ASFTA026-12 KF490530 Monomorium modestum ASFTA337-12 KF490531 Monomorium termitobium ASFTA022-12 KF490535 Monomorium termitobium ASFTA023-12 KF490536 Monomorium termitobium ASFTA024-12 KF490537 Monomorium termitobium ASFTA027-12 KF490539 Monomorium termitobium ASFTA028-12 KF490540 Monomorium termitobium ASFTA029-12 KF490541 Monomorium termitobium ASFTA031-12 KF490542 Monomorium termitobium ASFTA033-12 KF490543 Monomorium termitobium ASFTA1398-12 KF490544 Monomorium termitobium ASFTA1434-12 KF490532 Monomorium termitobium ASFTA1439-12 KF490551 Monomorium termitobium ASFTA1447-12 KF490550

194

Species BOLD Process ID Genbank Accession No. Monomorium termitobium ASFTA1448-12 KF490549 Monomorium termitobium ASFTA1571-12 KF490538 Monomorium termitobium ASFTA1572-12 KF490534 Monomorium termitobium ASFTA164-12 KF490533 Monomorium termitobium ASFTA466-12 KF490548 Monomorium termitobium ASFTA472-12 KF490547 Monomorium termitobium ASFTA474-12 KF490546 Monomorium termitobium ASFTA475-12 KF490545 Monomorium termitobium_03 ASFTA330-12 KF490553 Monomorium termitobium_03 ASFTA331-12 KF490552 Monomorium termitobium_04 ASFTA181-12 KF490555 Monomorium termitobium_04 ASFTA302-12 KF490554 Monomorium undet ASFTA815-12 KF490556 Monomorium versicolor ASFTA220-12 KF490557 Myrmicine_genus01 MG01 ASFTA1360-12 KF490562 Myrmicine_genus01 MG01 ASFTA1411-12 KF490559 Myrmicine_genus01 MG01 ASFTA1412-12 KF490558 Myrmicine_genus01 MG01 ASFTA1422-12 KF490560 Myrmicine_genus01 MG01 ASFTA493-12 KF490561 Myrmicine_genus16 MG07 ASFTA646-12 KF490563 Myrmicine_genus16 MG07 ASFTA647-12 KF490564 Nesomyrmex beanka01 ASFTA864-12 KF490568 Nesomyrmex beanka01 ASFTA867-12 KF490565 Nesomyrmex beanka01 ASFTA869-12 KF490567 Nesomyrmex beanka01 ASFTA870-12 KF490566 Nesomyrmex beanka01 ASFTA871-12 KF490569 Nesomyrmex beanka02 ASFTA863-12 KF490570 Nesomyrmex beanka04 ASFTA872-12 KF490571 Nesomyrmex DRm02 ASFTA358-12 KF490572 Nesomyrmex DRQ01 ASFTA175-12 KF490573 Nesomyrmex DRQ01 ASFTA199-12 KF490574 Nesomyrmex madecassus ASFTA1453-12 KF490576 Nesomyrmex madecassus ASFTA680-12 KF490583 Nesomyrmex madecassus ASFTA681-12 KF490582 Nesomyrmex madecassus ASFTA682-12 KF490575 Nesomyrmex madecassus ASFTA683-12 KF490581 Nesomyrmex madecassus ASFTA684-12 KF490580 Nesomyrmex madecassus ASFTA685-12 KF490579 Nesomyrmex madecassus ASFTA686-12 KF490578 Nesomyrmex madecassus ASFTA687-12 KF490577

195

Species BOLD Process ID Genbank Accession No. Nesomyrmex MG04 ASFTA1391-12 KF490586 Nesomyrmex MG04 ASFTA1454-12 KF490587 Nesomyrmex MG04 ASFTA1455-12 KF490590 Nesomyrmex MG04 ASFTA1456-12 KF490589 Nesomyrmex MG04 ASFTA628-12 KF490588 Nesomyrmex MG04 ASFTA629-12 KF490584 Nesomyrmex MG04 ASFTA630-12 KF490585 Nesomyrmex MG06 ASFTA1384-12 KF490591 Nesomyrmex MG12 ASFTA899-12 KF490596 Nesomyrmex MG12 ASFTA910-12 KF490592 Nesomyrmex MG12 ASFTA924-12 KF490595 Nesomyrmex MG12 ASFTA937-12 KF490594 Nesomyrmex MG12 ASFTA942-12 KF490593 Nesomyrmex MG14 ASFTA949-12 KF490597 Nesomyrmex MG27 ASFTA1452-12 KF490598 Nylanderia beanka_m02 ASFTA878-12 KF490604 Nylanderia beanka_m04 ASFTA868-12 KF490605 Nylanderia beanka_m05 ASFTA892-12 KF490606 Nylanderia beanka01 ASFTA890-12 KF490600 Nylanderia beanka01 ASFTA891-12 KF490599 Nylanderia beanka02 ASFTA880-12 KF490603 Nylanderia beanka02 ASFTA882-12 KF490601 Nylanderia beanka02 ASFTA883-12 KF490602 Nylanderia bourbonica ASFTA873-12 KF490607 Nylanderia DRw01 ASFTA1492-12 KF490608 Nylanderia DRw01 ASFTA1493-12 KF490609 Nylanderia humbloti ASFTA881-12 KF490611 Nylanderia humbloti ASFTA884-12 KF490612 Nylanderia humbloti ASFTA885-12 KF490613 Nylanderia humbloti ASFTA893-12 KF490610 Nylanderia madagascarensis_DR0 ASFTA205-12 KF490614 Nylanderia MG03 ASFTA987-12 KF490616 Nylanderia MG03 ASFTA998-12 KF490615 Nylanderia MG04 ASFTA914-12 KF490617 Nylanderia MG04 ASFTA930-12 KF490618 Nylanderia MG06 ASFTA1014-12 KF490620 Nylanderia MG06 ASFTA350-12 KF490621 Nylanderia MG06 ASFTA997-12 KF490619 Nylanderia MG09 ASFTA174-12 KF490625 Nylanderia MG09 ASFTA178-12 KF490624

196

Species BOLD Process ID Genbank Accession No. Nylanderia MG09 ASFTA905-12 KF490623 Nylanderia MG09 ASFTA965-12 KF490622 Nylanderia MG10 ASFTA960-12 KF490627 Nylanderia MG10 ASFTA961-12 KF490626 Nylanderia undet ASFTA067-12 KF490629 Nylanderia undet ASFTA388-12 KF490650 Nylanderia undet ASFTA397-12 KF490646 Nylanderia undet ASFTA426-12 KF490638 Nylanderia undet ASFTA504-12 KF490630 Nylanderia undet ASFTA505-12 KF490634 Nylanderia undet ASFTA510-12 KF490654 Nylanderia undet ASFTA511-12 KF490653 Nylanderia undet ASFTA512-12 KF490652 Nylanderia undet ASFTA513-12 KF490632 Nylanderia undet ASFTA514-12 KF490633 Nylanderia undet ASFTA519-12 KF490644 Nylanderia undet ASFTA528-12 KF490645 Nylanderia undet ASFTA543-12 KF490655 Nylanderia undet ASFTA544-12 KF490631 Nylanderia undet ASFTA547-12 KF490651 Nylanderia undet ASFTA555-12 KF490649 Nylanderia undet ASFTA556-12 KF490648 Nylanderia undet ASFTA557-12 KF490647 Nylanderia undet ASFTA577-12 KF490643 Nylanderia undet ASFTA579-12 KF490642 Nylanderia undet ASFTA582-12 KF490641 Nylanderia undet ASFTA583-12 KF490640 Nylanderia undet ASFTA584-12 KF490639 Nylanderia undet ASFTA593-12 KF490637 Nylanderia undet ASFTA594-12 KF490636 Nylanderia undet ASFTA606-12 KF490635 Nylanderia undet ASFTA612-12 KF490628 Odontomachus simillimus ASFTA780-12 KF490663 Odontomachus simillimus ASFTA781-12 KF490664 Odontomachus simillimus ASFTA785-12 KF490665 Odontomachus simillimus ASFTA787-12 KF490661 Odontomachus simillimus ASFTA789-12 KF490657 Odontomachus simillimus ASFTA790-12 KF490659 Odontomachus simillimus ASFTA791-12 KF490658 Odontomachus simillimus ASFTA807-12 KF490662

197

Species BOLD Process ID Genbank Accession No. Odontomachus simillimus ASFTA808-12 KF490660 Odontomachus simillimus ASFTA810-12 KF490656 Odontomachus troglodytes ASFTA001-12 KF490667 Odontomachus troglodytes ASFTA009-12 KF490679 Odontomachus troglodytes ASFTA011-12 KF490678 Odontomachus troglodytes ASFTA012-12 KF490677 Odontomachus troglodytes ASFTA013-12 KF490675 Odontomachus troglodytes ASFTA014-12 KF490674 Odontomachus troglodytes ASFTA015-12 KF490666 Odontomachus troglodytes ASFTA016-12 KF490673 Odontomachus troglodytes ASFTA017-12 KF490672 Odontomachus troglodytes ASFTA018-12 KF490671 Odontomachus troglodytes ASFTA019-12 KF490670 Odontomachus troglodytes ASFTA380-12 KF490668 Odontomachus troglodytes ASFTA456-12 KF490669 Odontomachus troglodytes ASFTA698-12 KF490676 Pachycondyla perroti ASFTA1366-12 KF490681 Pachycondyla perroti ASFTA1371-12 KF490680 Paraparatrechina glabra ASFTA561-12 KF490682 Paratrechina longicornis ASFTA003-12 KF490684 Paratrechina longicornis ASFTA004-12 KF490685 Paratrechina longicornis ASFTA006-12 KF490688 Paratrechina longicornis ASFTA007-12 KF490687 Paratrechina longicornis ASFTA068-12 KF490683 Paratrechina longicornis ASFTA1444-12 KF490686 Pheidole annemariae ASFTA1214-12 KF490689 Pheidole annemariae ASFTA1224-12 KF490690 Pheidole beanka04 ASFTA866-12 KF490691 Pheidole beanka04 ASFTA886-12 KF490692 Pheidole bessonii ASFTA1216-12 KF490693 Pheidole californica ASFTA433-12 KF490695 Pheidole californica ASFTA434-12 KF490694 Pheidole californica ASFTA435-12 KF490696 Pheidole creightoni ASFTA400-12 KF490697 Pheidole creightoni ASFTA432-12 KF490698 Pheidole longispinosa scabrata ASFTA1182-12 KF490699 Pheidole lucida ASFTA946-12 KF490700 Pheidole madecassa ASFTA1222-12 KF490701 Pheidole megacephala ASFTA676-12 KF490702 Pheidole MG001 ASFTA947-12 KF490703

198

Species BOLD Process ID Genbank Accession No. Pheidole MG007 ASFTA1019-12 KF490704 Pheidole MG007 ASFTA992-12 KF490705 Pheidole MG015 ASFTA002-12 KF490709 Pheidole MG015 ASFTA1022-12 KF490713 Pheidole MG015 ASFTA1023-12 KF490712 Pheidole MG015 ASFTA1024-12 KF490708 Pheidole MG015 ASFTA144-12 KF490706 Pheidole MG015 ASFTA145-12 KF490714 Pheidole MG015 ASFTA149-12 KF490710 Pheidole MG015 ASFTA151-12 KF490707 Pheidole MG015 ASFTA152-12 KF490711 Pheidole MG018 ASFTA1000-12 KF490716 Pheidole MG018 ASFTA1018-12 KF490717 Pheidole MG018 ASFTA1020-12 KF490715 Pheidole MG018 ASFTA991-12 KF490718 Pheidole MG046 ASFTA427-12 KF490720 Pheidole MG046 ASFTA428-12 KF490719 Pheidole MG046 ASFTA980-12 KF490721 Pheidole MG051 ASFTA563-12 KF490722 Pheidole MG052 ASFTA877-12 KF490723 Pheidole MG052 ASFTA958-12 KF490725 Pheidole MG052 ASFTA959-12 KF490724 Pheidole MG078 ASFTA085-12 KF490726 Pheidole MG081 ASFTA537-12 KF490727 Pheidole MG126 ASFTA379-12 KF490728 Pheidole MG145 ASFTA150-12 KF490734 Pheidole MG145 ASFTA153-12 KF490733 Pheidole MG145 ASFTA208-12 KF490732 Pheidole MG145 ASFTA214-12 KF490731 Pheidole MG145 ASFTA225-12 KF490729 Pheidole MG145 ASFTA239-12 KF490730 Pheidole MG146 ASFTA1436-12 KF490735 Pheidole MG148 ASFTA545-12 KF490736 Pheidole MG150 ASFTA385-12 KF490743 Pheidole MG150 ASFTA386-12 KF490742 Pheidole MG150 ASFTA389-12 KF490739 Pheidole MG150 ASFTA394-12 KF490740 Pheidole MG150 ASFTA608-12 KF490745 Pheidole MG150 ASFTA609-12 KF490744 Pheidole MG150 ASFTA614-12 KF490741

199

Species BOLD Process ID Genbank Accession No. Pheidole MG150 ASFTA615-12 KF490738 Pheidole MG150 ASFTA616-12 KF490737 Pheidole MG151 ASFTA1388-12 KF490747 Pheidole MG151 ASFTA387-12 KF490752 Pheidole MG151 ASFTA558-12 KF490749 Pheidole MG151 ASFTA604-12 KF490746 Pheidole MG151 ASFTA605-12 KF490748 Pheidole MG151 ASFTA617-12 KF490751 Pheidole MG151 ASFTA618-12 KF490750 Pheidole MG157 ASFTA1227-12 KF490754 Pheidole MG157 ASFTA1228-12 KF490753 Pheidole MGs046 ASFTA1443-12 KF490755 Pheidole MGs060 ASFTA1185-12 KF490756 Pheidole MGs060 ASFTA1206-12 KF490757 Pheidole MGs060 ASFTA1221-12 KF490758 Pheidole MGs077 ASFTA562-12 KF490759 Pheidole MGs087 ASFTA1195-12 KF490761 Pheidole MGs087 ASFTA1198-12 KF490760 Pheidole MGs089 ASFTA1207-12 KF490764 Pheidole MGs089 ASFTA1208-12 KF490763 Pheidole MGs089 ASFTA1209-12 KF490762 Pheidole MGs093 ASFTA1177-12 KF490765 Pheidole MGs120 ASFTA1187-12 KF490767 Pheidole MGs120 ASFTA1192-12 KF490769 Pheidole MGs120 ASFTA1197-12 KF490770 Pheidole MGs120 ASFTA1199-12 KF490766 Pheidole MGs120 ASFTA1225-12 KF490768 Pheidole MGs122 ASFTA1175-12 KF490771 Pheidole MGs122 ASFTA1186-12 KF490777 Pheidole MGs122 ASFTA1193-12 KF490774 Pheidole MGs122 ASFTA1200-12 KF490776 Pheidole MGs122 ASFTA1201-12 KF490775 Pheidole MGs122 ASFTA1215-12 KF490772 Pheidole MGs122 ASFTA1223-12 KF490773 Pheidole MGs123 ASFTA1173-12 KF490779 Pheidole MGs123 ASFTA1176-12 KF490781 Pheidole MGs123 ASFTA1179-12 KF490780 Pheidole MGs123 ASFTA1188-12 KF490778 Pheidole MGs124 ASFTA1190-12 KF490782 Pheidole MGs125 ASFTA1178-12 KF490783

200

Species BOLD Process ID Genbank Accession No. Pheidole MGs125 ASFTA1180-12 KF490784 Pheidole MGs128 ASFTA1181-12 KF490792 Pheidole MGs128 ASFTA1191-12 KF490791 Pheidole MGs128 ASFTA1194-12 KF490789 Pheidole MGs128 ASFTA1202-12 KF490788 Pheidole MGs128 ASFTA1203-12 KF490785 Pheidole MGs128 ASFTA1204-12 KF490787 Pheidole MGs128 ASFTA1220-12 KF490786 Pheidole MGs128 ASFTA1435-12 KF490790 Pheidole MGs129 ASFTA1174-12 KF490794 Pheidole MGs129 ASFTA1183-12 KF490797 Pheidole MGs129 ASFTA1184-12 KF490795 Pheidole MGs129 ASFTA1196-12 KF490796 Pheidole MGs129 ASFTA1217-12 KF490798 Pheidole MGs129 ASFTA1219-12 KF490793 Pheidole MGs130 ASFTA1189-12 KF490801 Pheidole MGs130 ASFTA1205-12 KF490799 Pheidole MGs130 ASFTA1210-12 KF490800 Pheidole MGs131 ASFTA1218-12 KF490802 Pheidole undet ASFTA1399-12 KF490805 Pheidole undet ASFTA619-12 KF490803 Pheidole undet ASFTA620-12 KF490804 Pheidole undet ASFTA621-12 KF490806 Plagiolepis alluaudi ASFTA1006-12 KF490823 Plagiolepis alluaudi ASFTA1010-12 KF490822 Plagiolepis alluaudi ASFTA1396-12 KF490815 Plagiolepis alluaudi ASFTA1404-12 KF490820 Plagiolepis alluaudi ASFTA1428-12 KF490807 Plagiolepis alluaudi ASFTA395-12 KF490821 Plagiolepis alluaudi ASFTA396-12 KF490810 Plagiolepis alluaudi ASFTA610-12 KF490818 Plagiolepis alluaudi ASFTA611-12 KF490814 Plagiolepis alluaudi ASFTA632-12 KF490816 Plagiolepis alluaudi ASFTA633-12 KF490809 Plagiolepis alluaudi ASFTA648-12 KF490819 Plagiolepis alluaudi ASFTA650-12 KF490817 Plagiolepis alluaudi ASFTA651-12 KF490813 Plagiolepis alluaudi ASFTA652-12 KF490811 Plagiolepis alluaudi ASFTA653-12 KF490812 Plagiolepis alluaudi ASFTA988-12 KF490808

201

Species BOLD Process ID Genbank Accession No. Plagiolepis madecassa ASFTA1394-12 KF490824 Plagiolepis madecassa ASFTA429-12 KF490825 Plagiolepis MG01 ASFTA160-12 KF490826 Plagiolepis MG05 ASFTA1397-12 KF490827 Plagiolepis MG05 ASFTA173-12 KF490828 Plagiolepis undet ASFTA1406-12 KF490829 Platythyrea arthuri ASFTA1495-12 KF490831 Platythyrea arthuri ASFTA1496-12 KF490830 Pogonomyrmex AR01 ASFTA851-12 KF490832 Ponera exotica ASFTA801-12 KF490833 Ponera SC01 ASFTA788-12 KF490834 Prionopelta MG01 ASFTA439-12 KF490835 Prionopelta MG01 ASFTA440-12 KF490836 Prionopelta MG01 ASFTA441-12 KF490837 Prionopelta MG01 ASFTA442-12 KF490839 Prionopelta MG01 ASFTA656-12 KF490840 Prionopelta MG01 ASFTA663-12 KF490838 Proceratium ambvky_m01 ASFTA921-12 KF490841 Proceratium MG02 ASFTA932-12 KF490842 Proceratium MGm02 ASFTA430-12 KF490843 Pyramica ambatrix ASFTA1016-12 KF490844 Pyramica ambatrix ASFTA306-12 KF490850 Pyramica ambatrix ASFTA333-12 KF490848 Pyramica ambatrix ASFTA335-12 KF490845 Pyramica ambatrix ASFTA351-12 KF490849 Pyramica ambatrix ASFTA931-12 KF490847 Pyramica ambatrix ASFTA995-12 KF490846 Pyramica erynnes ASFTA1004-12 KF490859 Pyramica erynnes ASFTA1005-12 KF490860 Pyramica erynnes ASFTA1009-12 KF490861 Pyramica erynnes ASFTA1015-12 KF490862 Pyramica erynnes ASFTA345-12 KF490851 Pyramica erynnes ASFTA353-12 KF490853 Pyramica erynnes ASFTA531-12 KF490858 Pyramica erynnes ASFTA533-12 KF490863 Pyramica erynnes ASFTA534-12 KF490856 Pyramica erynnes ASFTA535-12 KF490854 Pyramica erynnes ASFTA536-12 KF490857 Pyramica erynnes ASFTA553-12 KF490855 Pyramica erynnes ASFTA966-12 KF490852

202

Species BOLD Process ID Genbank Accession No. Pyramica ludovici ASFTA242-12 KF490869 Pyramica ludovici ASFTA392-12 KF490866 Pyramica ludovici ASFTA548-12 KF490864 Pyramica ludovici ASFTA564-12 KF490868 Pyramica ludovici ASFTA876-12 KF490865 Pyramica ludovici ASFTA917-12 KF490867 Pyramica mandibularis ASFTA498-12 KF490871 Pyramica mandibularis ASFTA502-12 KF490870 Solenopsis mameti ASFTA010-12 KF490875 Solenopsis mameti ASFTA020-12 KF490872 Solenopsis mameti ASFTA1017-12 KF490874 Solenopsis mameti ASFTA391-12 KF490877 Solenopsis mameti ASFTA941-12 KF490873 Solenopsis mameti ASFTA971-12 KF490876 Solenopsis mameti ASFTA990-12 KF490878 Strumigenys abdera ASFTA102-12 KF490880 Strumigenys abdera ASFTA103-12 KF490879 Strumigenys actis ASFTA344-12 KF490883 Strumigenys actis ASFTA506-12 KF490887 Strumigenys actis ASFTA507-12 KF490888 Strumigenys actis ASFTA515-12 KF490881 Strumigenys actis ASFTA516-12 KF490882 Strumigenys actis ASFTA518-12 KF490884 Strumigenys actis ASFTA524-12 KF490885 Strumigenys actis ASFTA525-12 KF490886 Strumigenys ambvky_m02 ASFTA984-12 KF490889 Strumigenys ampyx ASFTA097-12 KF490891 Strumigenys ampyx ASFTA098-12 KF490892 Strumigenys ampyx ASFTA1003-12 KF490895 Strumigenys ampyx ASFTA112-12 KF490893 Strumigenys ampyx ASFTA113-12 KF490894 Strumigenys ampyx ASFTA376-12 KF490898 Strumigenys ampyx ASFTA933-12 KF490890 Strumigenys ampyx ASFTA962-12 KF490897 Strumigenys ampyx ASFTA963-12 KF490896 Strumigenys apios ASFTA096-12 KF490900 Strumigenys apios ASFTA115-12 KF490901 Strumigenys apios ASFTA970-12 KF490899 Strumigenys bola ASFTA141-12 KF490903 Strumigenys bola ASFTA142-12 KF490902

203

Species BOLD Process ID Genbank Accession No. Strumigenys chilo ASFTA165-12 KF490908 Strumigenys chilo ASFTA169-12 KF490907 Strumigenys chilo ASFTA360-12 KF490905 Strumigenys chilo ASFTA923-12 KF490904 Strumigenys chilo ASFTA925-12 KF490906 Strumigenys chroa ASFTA128-12 KF490909 Strumigenys coveri ASFTA1008-12 KF490910 Strumigenys coveri ASFTA986-12 KF490911 Strumigenys deverra ASFTA132-12 KF490912 Strumigenys deverra ASFTA139-12 KF490913 Strumigenys dicomas ASFTA521-12 KF490918 Strumigenys dicomas ASFTA522-12 KF490917 Strumigenys dicomas ASFTA565-12 KF490914 Strumigenys dicomas ASFTA591-12 KF490915 Strumigenys dicomas ASFTA597-12 KF490919 Strumigenys dicomas ASFTA598-12 KF490916 Strumigenys DRm01 ASFTA1498-12 KF490920 Strumigenys europs ASFTA117-12 KF490922 Strumigenys europs ASFTA118-12 KF490921 Strumigenys lexex ASFTA1162-12 KF490923 Strumigenys luca ASFTA1159-12 KF490924 Strumigenys lucomo ASFTA1161-12 KF490925 Strumigenys lucomo ASFTA953-12 KF490926 Strumigenys lucomo ASFTA999-12 KF490927 Strumigenys lysis ASFTA1160-12 KF490928 Strumigenys norax ASFTA1001-12 KF490929 Strumigenys undet ASFTA138-12 KF490930 Strumigenys vazimba ASFTA299-12 KF490941 Strumigenys vazimba ASFTA300-12 KF490940 Strumigenys vazimba ASFTA307-12 KF490938 Strumigenys vazimba ASFTA308-12 KF490937 Strumigenys vazimba ASFTA309-12 KF490935 Strumigenys vazimba ASFTA310-12 KF490931 Strumigenys vazimba ASFTA346-12 KF490934 Strumigenys vazimba ASFTA352-12 KF490933 Strumigenys vazimba ASFTA354-12 KF490932 Strumigenys vazimba ASFTA915-12 KF490936 Strumigenys vazimba ASFTA993-12 KF490939 Tapinoma melanocephalum ASFTA005-12 KF490943 Tapinoma melanocephalum ASFTA008-12 KF490950

204

Species BOLD Process ID Genbank Accession No. Tapinoma melanocephalum ASFTA460-12 KF490948 Tapinoma melanocephalum ASFTA675-12 KF490945 Tapinoma melanocephalum ASFTA690-12 KF490942 Tapinoma melanocephalum ASFTA693-12 KF490946 Tapinoma melanocephalum ASFTA715-12 KF490949 Tapinoma melanocephalum ASFTA725-12 KF490947 Tapinoma melanocephalum ASFTA733-12 KF490944 Tapinoma MG01 ASFTA701-12 KF490951 Tapinoma MG02 ASFTA707-12 KF490953 Tapinoma MG02 ASFTA709-12 KF490952 Tapinoma MG03 ASFTA703-12 KF490958 Tapinoma MG03 ASFTA704-12 KF490954 Tapinoma MG03 ASFTA705-12 KF490955 Tapinoma MG03 ASFTA706-12 KF490959 Tapinoma MG03 ASFTA730-12 KF490960 Tapinoma MG03 ASFTA731-12 KF490956 Tapinoma MG03 ASFTA732-12 KF490957 Tapinoma MG05 ASFTA702-12 KF490963 Tapinoma MG05 ASFTA717-12 KF490962 Tapinoma MG05 ASFTA727-12 KF490961 Tapinoma MG06 ASFTA729-12 KF490964 Tapinoma subtile ASFTA627-12 KF490966 Tapinoma subtile ASFTA710-12 KF490965 Technomyrmex albipes ASFTA622-12 KF490977 Technomyrmex albipes ASFTA623-12 KF490969 Technomyrmex albipes ASFTA624-12 KF490967 Technomyrmex albipes ASFTA631-12 KF490974 Technomyrmex albipes ASFTA638-12 KF490978 Technomyrmex albipes ASFTA673-12 KF490976 Technomyrmex albipes ASFTA674-12 KF490972 Technomyrmex albipes ASFTA689-12 KF490971 Technomyrmex albipes ASFTA691-12 KF490970 Technomyrmex albipes ASFTA692-12 KF490973 Technomyrmex albipes ASFTA850-12 KF490968 Technomyrmex albipes ASFTA982-12 KF490975 Technomyrmex anterops ASFTA431-12 KF490979 Technomyrmex difficilis ASFTA603-12 KF490984 Technomyrmex difficilis ASFTA636-12 KF490980 Technomyrmex difficilis ASFTA637-12 KF490983 Technomyrmex difficilis ASFTA639-12 KF490985

205

Species BOLD Process ID Genbank Accession No. Technomyrmex difficilis ASFTA640-12 KF490986 Technomyrmex difficilis ASFTA641-12 KF490988 Technomyrmex difficilis ASFTA644-12 KF490982 Technomyrmex difficilis ASFTA645-12 KF490981 Technomyrmex difficilis ASFTA649-12 KF490989 Technomyrmex difficilis ASFTA849-12 KF490987 Technomyrmex docens ASFTA1344-12 KF490990 Technomyrmex fisheri ASFTA1370-12 KF490993 Technomyrmex fisheri ASFTA642-12 KF490991 Technomyrmex fisheri ASFTA643-12 KF490992 Technomyrmex innocens ASFTA908-12 KF490994 Technomyrmex madecassus ASFTA194-12 KF490996 Technomyrmex madecassus ASFTA197-12 KF490995 Technomyrmex pallipes ASFTA1449-12 KF490997 Technomyrmex vitiensis ASFTA1149-12 KF490998 Terataner MG01 ASFTA1351-12 KF490999 Terataner MG09 ASFTA1352-12 KF491000 Terataner MG11 ASFTA180-12 KF491001 Terataner MG11 ASFTA183-12 KF491004 Terataner MG11 ASFTA293-12 KF491002 Terataner MG11 ASFTA301-12 KF491003 Terataner undet ASFTA1233-12 KF491009 Terataner undet ASFTA1234-12 KF491006 Terataner undet ASFTA853-12 KF491007 Terataner undet ASFTA854-12 KF491008 Terataner undet ASFTA855-12 KF491011 Terataner undet ASFTA856-12 KF491005 Terataner undet ASFTA859-12 KF491012 Terataner undet ASFTA860-12 KF491010 Tetramorium bicarinatum ASFTA1420-12 KF491013 Tetramorium cognatum ASFTA1263-12 KF491014 Tetramorium cognatum ASFTA1266-12 KF491015 Tetramorium cognatum ASFTA437-12 KF491016 Tetramorium coillum ASFTA764-12 KF491017 Tetramorium coillum ASFTA765-12 KF491018 Tetramorium ibycterum ASFTA1358-12 KF491019 Tetramorium isectum ASFTA1280-12 KF491020 Tetramorium latreillei ASFTA1278-12 KF491021 Tetramorium MG035 ASFTA1279-12 KF491022 Tetramorium MG035 ASFTA1284-12 KF491023

206

Species BOLD Process ID Genbank Accession No. Tetramorium MG035 ASFTA575-12 KF491024 Tetramorium MG036 ASFTA600-12 KF491025 Tetramorium MG037 ASFTA1259-12 KF491028 Tetramorium MG037 ASFTA1260-12 KF491027 Tetramorium MG037 ASFTA1262-12 KF491026 Tetramorium MG039 ASFTA1281-12 KF491029 Tetramorium MG039 ASFTA1283-12 KF491030 Tetramorium MG040 ASFTA1265-12 KF491031 Tetramorium MG042 ASFTA1276-12 KF491032 Tetramorium MG047 ASFTA1267-12 KF491034 Tetramorium MG047 ASFTA1274-12 KF491033 Tetramorium MG047 ASFTA1285-12 KF491035 Tetramorium MG052 ASFTA1258-12 KF491036 Tetramorium MG052b ASFTA1273-12 KF491037 Tetramorium MG053 ASFTA1277-12 KF491038 Tetramorium MG088 ASFTA1261-12 KF491039 Tetramorium MG089 ASFTA1268-12 KF491042 Tetramorium MG089 ASFTA1270-12 KF491041 Tetramorium MG089 ASFTA1271-12 KF491043 Tetramorium MG089 ASFTA1272-12 KF491040 Tetramorium MG093 ASFTA1264-12 KF491044 Tetramorium MG093 ASFTA1287-12 KF491045 Tetramorium MG103 ASFTA552-12 KF491052 Tetramorium MG103 ASFTA574-12 KF491048 Tetramorium MG103 ASFTA586-12 KF491046 Tetramorium MG103 ASFTA587-12 KF491050 Tetramorium MG103 ASFTA588-12 KF491047 Tetramorium MG103 ASFTA595-12 KF491051 Tetramorium MG103 ASFTA601-12 KF491049 Tetramorium MG111 ASFTA542-12 KF491054 Tetramorium MG111 ASFTA567-12 KF491056 Tetramorium MG111 ASFTA568-12 KF491055 Tetramorium MG111 ASFTA779-12 KF491053 Tetramorium MG112 ASFTA774-12 KF491058 Tetramorium MG112 ASFTA775-12 KF491057 Tetramorium MG118 ASFTA766-12 KF491059 Tetramorium MG118 ASFTA768-12 KF491060 Tetramorium MG119 ASFTA767-12 KF491061 Tetramorium MG119 ASFTA811-12 KF491062 Tetramorium MG120 ASFTA777-12 KF491063

207

Species BOLD Process ID Genbank Accession No. Tetramorium MG120 ASFTA778-12 KF491064 Tetramorium MG121 ASFTA569-12 KF491068 Tetramorium MG121 ASFTA576-12 KF491065 Tetramorium MG121 ASFTA580-12 KF491070 Tetramorium MG121 ASFTA581-12 KF491069 Tetramorium MG121 ASFTA589-12 KF491066 Tetramorium MG121 ASFTA602-12 KF491071 Tetramorium MG121 ASFTA809-12 KF491067 Tetramorium MG122 ASFTA769-12 KF491074 Tetramorium MG122 ASFTA770-12 KF491073 Tetramorium MG122 ASFTA771-12 KF491072 Tetramorium MG125 ASFTA994-12 KF491075 Tetramorium MG134 ASFTA973-12 KF491076 Tetramorium MG134 ASFTA976-12 KF491078 Tetramorium MG134 ASFTA977-12 KF491077 Tetramorium MG135 ASFTA974-12 KF491081 Tetramorium MG135 ASFTA975-12 KF491080 Tetramorium MG135 ASFTA978-12 KF491082 Tetramorium MG135 ASFTA979-12 KF491079 Tetramorium MG142 ASFTA972-12 KF491083 Tetramorium norvigi ASFTA1226-12 KF491086 Tetramorium norvigi ASFTA1230-12 KF491085 Tetramorium norvigi ASFTA1231-12 KF491084 Tetramorium proximum ASFTA1282-12 KF491087 Tetramorium proximum ASFTA517-12 KF491088 Tetramorium proximum ASFTA526-12 KF491089 Tetramorium proximum ASFTA527-12 KF491090 Tetramorium quasirum ASFTA590-12 KF491092 Tetramorium quasirum ASFTA596-12 KF491091 Tetramorium quasirum ASFTA772-12 KF491093 Tetramorium ranarum ASFTA529-12 KF491094 Tetramorium robustior ASFTA540-12 KF491096 Tetramorium robustior ASFTA541-12 KF491095 Tetramorium robustior ASFTA572-12 KF491098 Tetramorium robustior ASFTA599-12 KF491097 Tetramorium undet ASFTA551-12 KF491102 Tetramorium undet ASFTA571-12 KF491100 Tetramorium undet ASFTA573-12 KF491101 Tetramorium undet ASFTA670-12 KF491099 Tetraponera beanka06 ASFTA865-12 KF491103

208

Species BOLD Process ID Genbank Accession No. Tetraponera DR02 ASFTA233-12 pending Tetraponera DR06 ASFTA195-12 KF491104 Tetraponera DR09 ASFTA240-12 KF491105 Tetraponera grandidieri ASFTA088-12 KF491106 Tetraponera grandidieri_01 ASFTA182-12 KF491107 Tetraponera merita ASFTA1353-12 KF491108 Tetraponera merita ASFTA697-12 KF491109 Tetraponera MG02 ASFTA1386-12 KF491110 Tetraponera MG04 ASFTA1403-12 KF491111 Tetraponera MG04 ASFTA1437-12 KF491112 Tetraponera MG04 ASFTA1441-12 KF491113 Tetraponera MG17 ASFTA369-12 KF491114 Tetraponera MG17 ASFTA371-12 KF491115 Tetraponera undet ASFTA1413-12 KF491123 Tetraponera undet ASFTA1414-12 KF491121 Tetraponera undet ASFTA1415-12 KF491120 Tetraponera undet ASFTA1418-12 KF491118 Tetraponera undet ASFTA1419-12 KF491124 Tetraponera undet ASFTA1445-12 KF491117 Tetraponera undet ASFTA381-12 KF491116 Tetraponera undet ASFTA382-12 KF491119 Tetraponera undet ASFTA436-12 KF491122

209

Table S4.2- BOLD process IDs and Genbank accessions for sequenced hcpA in ants infected with Wolbachia. All genbank accession numbers are still pending release.

Species Process ID Genbank Accession No. Adelomyrmex SC02 ASFTA814-12 pending Anochetus grandidieri ASFTA1362-12 pending Anochetus grandidieri ASFTA361-12 pending Anochetus grandidieri ASFTA464-12 pending Anochetus grandidieri ASFTA658-12 pending Anochetus grandidieri ASFTA659-12 pending Anochetus grandidieri ASFTA660-12 pending Anochetus grandidieri ASFTA662-12 pending Anochetus grandidieri ASFTA665-12 pending Anochetus grandidieri ASFTA672-12 pending Anochetus grandidieri ASFTA678-12 pending Anochetus grandidieri ASFTA688-12 pending Aphaenogaster swammerdami ASFTA1408-12 pending Aphaenogaster swammerdami ASFTA1409-12 pending Aphaenogaster swammerdami ASFTA1410-12 pending Aphaenogaster swammerdami ASFTA1421-12 pending Aphaenogaster swammerdami ASFTA1427-12 pending Aphaenogaster swammerdami ASFTA1432-12 pending Aphaenogaster swammerdami ASFTA1450-12 pending Aphaenogaster swammerdami ASFTA186-12 pending Aphaenogaster swammerdami ASFTA196-12 pending Aphaenogaster swammerdami ASFTA200-12 pending Aphaenogaster swammerdami ASFTA204-12 pending Aphaenogaster swammerdami ASFTA217-12 pending Aphaenogaster swammerdami ASFTA231-12 pending Aphaenogaster swammerdami ASFTA343-12 pending Aphaenogaster swammerdami ASFTA408-12 pending Aphaenogaster swammerdami ASFTA409-12 pending Aphaenogaster swammerdami ASFTA410-12 pending Aphaenogaster swammerdami ASFTA411-12 pending Aphaenogaster swammerdami ASFTA412-12 pending Aphaenogaster swammerdami ASFTA494-12 pending Aphaenogaster swammerdami ASFTA495-12 pending Aphaenogaster swammerdami ASFTA734-12 pending Aphaenogaster swammerdami ASFTA736-12 pending Aphaenogaster swammerdami ASFTA737-12 pending Aphaenogaster swammerdami ASFTA738-12 pending Aphaenogaster swammerdami ASFTA740-12 pending

210

Species Process ID Genbank Accession No. Aphaenogaster swammerdami ASFTA741-12 pending Aphaenogaster swammerdami ASFTA744-12 pending Aphaenogaster swammerdami ASFTA745-12 pending Aphaenogaster swammerdami ASFTA746-12 pending Aphaenogaster swammerdami ASFTA748-12 pending Aphaenogaster swammerdami ASFTA749-12 pending Aphaenogaster swammerdami ASFTA750-12 pending Aphaenogaster swammerdami ASFTA752-12 pending Aphaenogaster swammerdami ASFTA754-12 pending Aphaenogaster swammerdami ASFTA756-12 pending Aphaenogaster swammerdami ASFTA760-12 pending Aphaenogaster swammerdami ASFTA761-12 pending Camponotus butteli ASFTA1318-12 pending Camponotus butteli ASFTA1320-12 pending Camponotus butteli ASFTA1321-12 pending Camponotus christi ASFTA1072-12 pending Camponotus christi ASFTA417-12 pending Camponotus christi ferrugineus ASFTA1036-12 pending Camponotus christi ferrugineus ASFTA1052-12 pending Camponotus christi ferrugineus ASFTA1064-12 pending Camponotus christi foersteri ASFTA1033-12 pending Camponotus christi foersteri ASFTA1037-12 pending Camponotus christi foersteri ASFTA1040-12 pending Camponotus christi foersteri ASFTA1056-12 pending Camponotus christi foersteri ASFTA1067-12 pending Camponotus christi foersteri ASFTA1069-12 pending Camponotus christi foersteri ASFTA1071-12 pending Camponotus christi foersteri ASFTA1102-12 pending Camponotus christi foersteri ASFTA1103-12 pending Camponotus christi foersteri ASFTA1104-12 pending Camponotus christi foersteri ASFTA1105-12 pending Camponotus christi foersteri ASFTA1138-12 pending Camponotus christi foersteri ASFTA1143-12 pending Camponotus christi foersteri ASFTA1144-12 pending Camponotus christi foersteri ASFTA1145-12 pending Camponotus christi foersteri ASFTA1580-12 pending Camponotus christi foersteri ASFTA1581-12 pending Camponotus christi foersteri ASFTA1589-12 pending Camponotus christi foersteri ASFTA1590-12 pending Camponotus christi foersteri ASFTA1601-12 pending

211

Species Process ID Genbank Accession No. Camponotus christi foersteri ASFTA1602-12 pending Camponotus christi foersteri ASFTA1603-12 pending Camponotus christi foersteri ASFTA1604-12 pending Camponotus christi foersteri ASFTA463-12 pending Camponotus christi_02 ASFTA222-12 pending Camponotus christi_02 ASFTA223-12 pending Camponotus concolor ASFTA927-12 pending Camponotus concolor ASFTA969-12 pending Camponotus dufouri ASFTA1337-12 pending Camponotus dufouri ASFTA1338-12 pending Camponotus dufouri ASFTA1363-12 pending Camponotus dufouri ASFTA413-12 pending Camponotus gibber ASFTA1302-12 pending Camponotus gibber ASFTA1330-12 pending Camponotus gibber ASFTA1331-12 pending Camponotus gibber ASFTA1335-12 pending Camponotus gibber ASFTA1336-12 pending Camponotus heteroclitus ASFTA1048-12 pending Camponotus heteroclitus ASFTA1073-12 pending Camponotus heteroclitus ASFTA1115-12 pending Camponotus heteroclitus ASFTA1116-12 pending Camponotus heteroclitus ASFTA1286-12 pending Camponotus heteroclitus ASFTA1290-12 pending Camponotus heteroclitus ASFTA1298-12 pending Camponotus heteroclitus ASFTA1299-12 pending Camponotus heteroclitus ASFTA1303-12 pending Camponotus heteroclitus ASFTA1323-12 pending Camponotus heteroclitus ASFTA1339-12 pending Camponotus heteroclitus ASFTA1591-12 pending Camponotus heteroclitus ASFTA1592-12 pending Camponotus heteroclitus ASFTA1593-12 pending Camponotus heteroclitus ASFTA1594-12 pending Camponotus heteroclitus ASFTA1595-12 pending Camponotus heteroclitus ASFTA1596-12 pending Camponotus heteroclitus ASFTA1597-12 pending Camponotus heteroclitus ASFTA1598-12 pending Camponotus hildebrandti ASFTA414-12 pending Camponotus hildebrandti ASFTA415-12 pending Camponotus hildebrandti ASFTA418-12 pending Camponotus hova ASFTA897-12 pending

212

Species Process ID Genbank Accession No. Camponotus hova ASFTA904-12 pending Camponotus hova ASFTA952-12 pending Camponotus MG002 ASFTA1304-12 pending Camponotus MG003 ASFTA1312-12 pending Camponotus MG003 ASFTA1313-12 pending Camponotus MG003 ASFTA1315-12 pending Camponotus MG003 ASFTA1316-12 pending Camponotus MG004 ASFTA1293-12 pending Camponotus MG004 ASFTA1305-12 pending Camponotus MG004 ASFTA1306-12 pending Camponotus MG004 ASFTA1307-12 pending Camponotus MG004 ASFTA1308-12 pending Camponotus MG004 ASFTA1309-12 pending Camponotus MG004 ASFTA1324-12 pending Camponotus MG004 ASFTA1326-12 pending Camponotus MG005 ASFTA1025-12 pending Camponotus MG005 ASFTA1026-12 pending Camponotus MG005 ASFTA1027-12 pending Camponotus MG005 ASFTA1028-12 pending Camponotus MG005 ASFTA1029-12 pending Camponotus MG005 ASFTA1059-12 pending Camponotus MG005 ASFTA1060-12 pending Camponotus MG005 ASFTA1068-12 pending Camponotus MG005 ASFTA1088-12 pending Camponotus MG005 ASFTA1089-12 pending Camponotus MG005 ASFTA1092-12 pending Camponotus MG005 ASFTA1094-12 pending Camponotus MG005 ASFTA1095-12 pending Camponotus MG005 ASFTA1096-12 pending Camponotus MG005 ASFTA1097-12 pending Camponotus MG005 ASFTA1582-12 pending Camponotus MG005 ASFTA1583-12 pending Camponotus MG005 ASFTA1584-12 pending Camponotus MG005 ASFTA1585-12 pending Camponotus MG005 ASFTA1599-12 pending Camponotus MG005 ASFTA203-12 pending Camponotus MG005 ASFTA229-12 pending Camponotus MG008 ASFTA1121-12 pending Camponotus MG008 ASFTA1122-12 pending Camponotus MG008 ASFTA1123-12 pending

213

Species Process ID Genbank Accession No. Camponotus MG008 ASFTA192-12 pending Camponotus MG014 ASFTA1288-12 pending Camponotus MG014 ASFTA1291-12 pending Camponotus MG014 ASFTA1292-12 pending Camponotus MG014 ASFTA1294-12 pending Camponotus MG014 ASFTA1325-12 pending Camponotus MG014 ASFTA1327-12 pending Camponotus MG014 ASFTA1328-12 pending Camponotus MG014 ASFTA1329-12 pending Camponotus MG014 ASFTA1332-12 pending Camponotus MG015 ASFTA1334-12 pending Camponotus MG017 ASFTA1136-12 pending Camponotus MG017 ASFTA1137-12 pending Camponotus MG023 ASFTA1030-12 pending Camponotus MG023 ASFTA1031-12 pending Camponotus MG023 ASFTA1110-12 pending Camponotus MG023 ASFTA1112-12 pending Camponotus MG023 ASFTA1113-12 pending Camponotus MG023 ASFTA1132-12 pending Camponotus MG023 ASFTA1134-12 pending Camponotus MG024 ASFTA1042-12 pending Camponotus MG024 ASFTA1375-12 pending Camponotus MG026 ASFTA1061-12 pending Camponotus MG03_maculatus_nr ASFTA1402-12 pending Camponotus MG030 ASFTA1289-12 pending Camponotus MG035 ASFTA1043-12 pending Camponotus MG035 ASFTA1058-12 pending Camponotus MG035 ASFTA1070-12 pending Camponotus MG035 ASFTA898-12 pending Camponotus MG035 ASFTA900-12 pending Camponotus MG035 ASFTA906-12 pending Camponotus MG035 ASFTA907-12 pending Camponotus MG039 ASFTA1300-12 pending Camponotus MG039 ASFTA1301-12 pending Camponotus MG039 ASFTA224-12 pending Camponotus MG039 ASFTA232-12 pending Camponotus MG039 ASFTA237-12 pending Camponotus MG040 ASFTA1125-12 pending Camponotus MG040 ASFTA1310-12 pending Camponotus MG040 ASFTA1317-12 pending

214

Species Process ID Genbank Accession No. Camponotus MG041 ASFTA1124-12 pending Camponotus MG041 ASFTA1126-12 pending Camponotus MG043 ASFTA1296-12 pending Camponotus MG043 ASFTA1333-12 pending Camponotus MG046 ASFTA1021-12 pending Camponotus MG047 ASFTA193-12 pending Camponotus MG048 ASFTA057-12 pending Camponotus MG048 ASFTA058-12 pending Camponotus MG049 ASFTA1348-12 pending Camponotus MG049 ASFTA1389-12 pending Camponotus MG049 ASFTA1401-12 pending Camponotus MG049 ASFTA1438-12 pending Camponotus MG053 ASFTA1587-12 pending Camponotus MG078 ASFTA1044-12 pending Camponotus MG078 ASFTA1054-12 pending Camponotus MG088 ASFTA903-12 pending Camponotus MG089 ASFTA1114-12 pending Camponotus MG089 ASFTA1130-12 pending Camponotus MG096 ASFTA055-12 pending Camponotus MG096 ASFTA056-12 pending Camponotus MG096 ASFTA1340-12 pending Camponotus MG111 ASFTA1063-12 pending Camponotus MG111 ASFTA1090-12 pending Camponotus MG111 ASFTA1091-12 pending Camponotus MG111 ASFTA1099-12 pending Camponotus MG111 ASFTA1100-12 pending Camponotus MG111 ASFTA1101-12 pending Camponotus MG120 ASFTA894-12 pending Camponotus MG120 ASFTA901-12 pending Camponotus MG120 ASFTA912-12 pending Camponotus pictipes ASFTA1077-12 pending Camponotus pictipes ASFTA1079-12 pending Camponotus undet ASFTA416-12 pending Cardiocondyla wroughtonii ASFTA742-12 pending Cardiocondyla wroughtonii ASFTA751-12 pending Cardiocondyla wroughtonii ASFTA776-12 pending Cardiocondyla wroughtonii ASFTA784-12 pending Cardiocondyla wroughtonii ASFTA786-12 pending Cardiocondyla wroughtonii ASFTA794-12 pending Cardiocondyla wroughtonii ASFTA795-12 pending

215

Species Process ID Genbank Accession No. Cardiocondyla wroughtonii ASFTA798-12 pending Cardiocondyla wroughtonii ASFTA799-12 pending Cardiocondyla wroughtonii ASFTA813-12 pending Carebara DRm01 ASFTA368-12 pending Carebara DRm02 ASFTA355-12 pending Cataulacus ebrardi ASFTA762-12 pending Cataulacus ebrardi ASFTA763-12 pending Cataulacus oberthueri ASFTA909-12 pending Cataulacus oberthueri ASFTA944-12 pending Cataulacus oberthueri ASFTA945-12 pending Cataulacus oberthueri ASFTA985-12 pending Cataulacus porcatus ASFTA034-12 pending Cataulacus porcatus ASFTA035-12 pending Cataulacus porcatus ASFTA036-12 pending Cataulacus porcatus ASFTA037-12 pending Cataulacus porcatus ASFTA038-12 pending Cataulacus porcatus ASFTA039-12 pending Cataulacus porcatus ASFTA040-12 pending Cataulacus porcatus ASFTA041-12 pending Cataulacus porcatus ASFTA042-12 pending Cataulacus porcatus ASFTA043-12 pending Cataulacus porcatus ASFTA044-12 pending Cataulacus porcatus ASFTA045-12 pending Cataulacus porcatus ASFTA046-12 pending Cataulacus porcatus ASFTA047-12 pending Cataulacus porcatus ASFTA048-12 pending Cataulacus porcatus ASFTA050-12 pending Cataulacus porcatus ASFTA051-12 pending Cataulacus porcatus ASFTA052-12 pending Cataulacus porcatus ASFTA053-12 pending Cataulacus porcatus ASFTA054-12 pending Cataulacus porcatus ASFTA1350-12 pending Cataulacus porcatus ASFTA1372-12 pending Cataulacus porcatus ASFTA1378-12 pending Cataulacus porcatus ASFTA1385-12 pending Cataulacus porcatus ASFTA1395-12 pending Cataulacus porcatus ASFTA1429-12 pending Cataulacus porcatus ASFTA1573-12 pending Cataulacus porcatus ASFTA1574-12 pending Cataulacus porcatus ASFTA481-12 pending

216

Species Process ID Genbank Accession No. Cataulacus porcatus ASFTA483-12 pending Cataulacus porcatus ASFTA484-12 pending Cataulacus porcatus ASFTA486-12 pending Cataulacus porcatus ASFTA487-12 pending Cataulacus porcatus ASFTA488-12 pending Cataulacus porcatus ASFTA489-12 pending Cataulacus porcatus ASFTA490-12 pending Cataulacus porcatus ASFTA492-12 pending Cataulacus porcatus ASFTA913-12 pending Cataulacus porcatus ASFTA916-12 pending Cataulacus porcatus ASFTA922-12 pending Cataulacus porcatus ASFTA938-12 pending Cataulacus porcatus ASFTA939-12 pending Cataulacus porcatus ASFTA948-12 pending Cataulacus regularis ASFTA166-12 pending Cataulacus regularis ASFTA168-12 pending Cataulacus regularis ASFTA172-12 pending Cataulacus wasmanni ASFTA918-12 pending Cataulacus wasmanni ASFTA940-12 pending Cataulacus wasmanni ASFTA950-12 pending Cataulacus wasmanni ASFTA964-12 pending Cerapachys beanka_m03 ASFTA874-12 pending Cerapachys L_MG04 ASFTA1374-12 pending Cerapachys L_MG05 ASFTA210-12 pending Cerapachys L_MG05 ASFTA211-12 pending Cerapachys L_MG11 ASFTA919-12 pending Cerapachys L_MG11 ASFTA928-12 pending Cerapachys P_DR03 ASFTA295-12 pending Cerapachys P_DR04 ASFTA297-12 pending Cerapachys P_MG02 ASFTA1232-12 pending Cerapachys P_MG02 ASFTA1379-12 pending Cerapachys P_MG02 ASFTA421-12 pending Cerapachys P_MG02 ASFTA422-12 pending Cerapachys P_MG02 ASFTA423-12 pending Cerapachys P_MG02 ASFTA679-12 pending Cerapachys P_MG06 ASFTA929-12 pending Cerapachys P_MG06 ASFTA943-12 pending Cerapachys P_MG07 ASFTA1354-12 pending Cerapachys P_MG07 ASFTA1361-12 pending Cerapachys P_MG11 ASFTA419-12 pending

217

Species Process ID Genbank Accession No. Cerapachys prey01 ASFTA1240-12 pending Cerapachys prey01 ASFTA1241-12 pending Cerapachys prey01 ASFTA1242-12 pending Cerapachys prey01 ASFTA1243-12 pending Cerapachys prey01 ASFTA1244-12 pending Cerapachys prey02 ASFTA1245-12 pending Cerapachys prey02 ASFTA1246-12 pending Cerapachys prey02 ASFTA1247-12 pending Cerapachys prey03 ASFTA1248-12 pending Cerapachys prey03 ASFTA1249-12 pending Cerapachys prey03 ASFTA1250-12 pending Cerapachys prey04 ASFTA1251-12 pending Cerapachys prey04 ASFTA1252-12 pending Cerapachys prey04 ASFTA1253-12 pending Cerapachys prey04 ASFTA1254-12 pending Cerapachys prey04 ASFTA1255-12 pending Cerapachys prey05 ASFTA1256-12 pending Cerapachys prey06 ASFTA1257-12 pending Cerapachys undet ASFTA1235-12 pending Cerapachys undet ASFTA1236-12 pending Cerapachys undet ASFTA1237-12 pending Cerapachys undet ASFTA1238-12 pending Cerapachys undet ASFTA1239-12 pending Cerapachys undet ASFTA852-12 pending Cerapachys undet ASFTA857-12 pending Cerapachys undet ASFTA858-12 pending Cerapachys undet ASFTA861-12 pending Cerapachys undet ASFTA862-12 pending Crematogaster BBB35 ASFTA064-12 pending Crematogaster BBB35 ASFTA451-12 pending Crematogaster BBB55 ASFTA059-12 pending Crematogaster BBB55 ASFTA060-12 pending Crematogaster BBB55 ASFTA061-12 pending Crematogaster BBB55 ASFTA062-12 pending Crematogaster BBB55 ASFTA063-12 pending Crematogaster BBB55 ASFTA444-12 pending Crematogaster BBB55 ASFTA445-12 pending Crematogaster BBB55 ASFTA446-12 pending Crematogaster BBB55 ASFTA447-12 pending Crematogaster BBB55 ASFTA448-12 pending

218

Species Process ID Genbank Accession No. Crematogaster BBB55 ASFTA449-12 pending Crematogaster BBB55 ASFTA450-12 pending Crematogaster BBB55 ASFTA458-12 pending Crematogaster BBB55 ASFTA459-12 pending Crematogaster BBB55 ASFTA699-12 pending Crematogaster BBB55 ASFTA743-12 pending Crematogaster BBB55 ASFTA757-12 pending Crematogaster BBB55 ASFTA758-12 pending Crematogaster BBB55 ASFTA759-12 pending Crematogaster grevei ASFTA202-12 pending Crematogaster grevei ASFTA215-12 pending Crematogaster grevei ASFTA216-12 pending Crematogaster grevei ASFTA218-12 pending Crematogaster grevei ASFTA230-12 pending Crematogaster hova-complex_m1 ASFTA065-12 pending Crematogaster hova-complex_m1 ASFTA066-12 pending Crematogaster MG02 ASFTA457-12 pending Crematogaster undet ASFTA1390-12 pending Crematogaster undet ASFTA1393-12 pending Crematogaster undet ASFTA1405-12 pending Crematogaster undet ASFTA1440-12 pending Hypoponera MG016 ASFTA155-12 pending Hypoponera MG026 ASFTA255-12 pending Hypoponera MG026 ASFTA273-12 pending Hypoponera MG026 ASFTA274-12 pending Hypoponera MG026 ASFTA468-12 pending Hypoponera MG028 ASFTA250-12 pending Hypoponera MG028 ASFTA280-12 pending Hypoponera MG039 ASFTA477-12 pending Hypoponera MG039 ASFTA478-12 pending Hypoponera MG039 ASFTA479-12 pending Hypoponera MG040 ASFTA1382-12 pending Hypoponera MG066 ASFTA465-12 pending Hypoponera MG066 ASFTA470-12 pending Hypoponera opacior ASFTA847-12 pending Hypoponera opacior ASFTA848-12 pending Hypoponera punctatissima ASFTA1148-12 pending Hypoponera punctatissima ASFTA782-12 pending Hypoponera punctatissima ASFTA783-12 pending Hypoponera punctatissima ASFTA792-12 pending

219

Species Process ID Genbank Accession No. Hypoponera punctatissima ASFTA797-12 pending Hypoponera punctatissima ASFTA800-12 pending Hypoponera punctatissima ASFTA802-12 pending Hypoponera punctatissima ASFTA804-12 pending Hypoponera punctatissima ASFTA805-12 pending Hypoponera punctatissima ASFTA806-12 pending Lepisiota canescens ASFTA1150-12 pending Lepisiota canescens ASFTA1151-12 pending Lepisiota canescens ASFTA1152-12 pending Lepisiota canescens ASFTA1153-12 pending Lepisiota canescens ASFTA1154-12 pending Lepisiota canescens ASFTA1155-12 pending Lepisiota canescens ASFTA1156-12 pending Lepisiota canescens ASFTA1157-12 pending Leptogenys acutirostris ASFTA082-12 pending Leptogenys acutirostris ASFTA827-12 pending Leptogenys angusta ASFTA1349-12 pending Leptogenys angusta ASFTA1355-12 pending Leptogenys angusta ASFTA1356-12 pending Leptogenys angusta ASFTA1377-12 pending Leptogenys angusta ASFTA1381-12 pending Leptogenys angusta ASFTA259-12 pending Leptogenys angusta ASFTA265-12 pending Leptogenys angusta ASFTA266-12 pending Leptogenys angusta ASFTA277-12 pending Leptogenys angusta ASFTA278-12 pending Leptogenys angusta ASFTA281-12 pending Leptogenys angusta ASFTA282-12 pending Leptogenys angusta ASFTA816-12 pending Leptogenys angusta ASFTA819-12 pending Leptogenys angusta ASFTA820-12 pending Leptogenys angusta ASFTA821-12 pending Leptogenys angusta ASFTA822-12 pending Leptogenys angusta ASFTA823-12 pending Leptogenys angusta ASFTA829-12 pending Leptogenys angusta ASFTA837-12 pending Leptogenys angusta ASFTA838-12 pending Leptogenys angusta ASFTA839-12 pending Leptogenys angusta ASFTA842-12 pending Leptogenys angusta ASFTA843-12 pending

220

Species Process ID Genbank Accession No. Leptogenys angusta ASFTA845-12 pending Leptogenys antongilensis ASFTA260-12 pending Leptogenys antongilensis ASFTA267-12 pending Leptogenys antongilensis ASFTA269-12 pending Leptogenys antongilensis ASFTA270-12 pending Leptogenys arcirostris ASFTA249-12 pending Leptogenys falcigera ASFTA087-12 pending Leptogenys falcigera ASFTA264-12 pending Leptogenys falcigera ASFTA271-12 pending Leptogenys gracilis ASFTA272-12 pending Leptogenys gracilis ASFTA482-12 pending Leptogenys gracilis ASFTA491-12 pending Leptogenys grandidieri ASFTA244-12 pending Leptogenys JCR01 ASFTA817-12 pending Leptogenys JCR01 ASFTA830-12 pending Leptogenys JCR01 ASFTA841-12 pending Leptogenys JCR06 ASFTA261-12 pending Leptogenys JCR10 ASFTA276-12 pending Leptogenys JCR10 ASFTA840-12 pending Leptogenys JCR23 ASFTA284-12 pending Leptogenys JCR23 ASFTA285-12 pending Leptogenys JCR24 ASFTA079-12 pending Leptogenys JCR24 ASFTA081-12 pending Leptogenys JCR25 ASFTA258-12 pending Leptogenys JCR25 ASFTA262-12 pending Leptogenys JCR25 ASFTA818-12 pending Leptogenys JCR25 ASFTA824-12 pending Leptogenys JCR25 ASFTA825-12 pending Leptogenys JCR25 ASFTA826-12 pending Leptogenys JCR25 ASFTA836-12 pending Leptogenys JCR25 ASFTA844-12 pending Leptogenys JCR25 ASFTA846-12 pending Leptogenys JCR26 ASFTA256-12 pending Leptogenys JCR29 ASFTA1373-12 pending Leptogenys JCR29 ASFTA243-12 pending Leptogenys JCR29 ASFTA252-12 pending Leptogenys JCR29 ASFTA257-12 pending Leptogenys JCR29 ASFTA283-12 pending Leptogenys JCR29 ASFTA831-12 pending Leptogenys JCR29 ASFTA832-12 pending

221

Species Process ID Genbank Accession No. Leptogenys JCR29 ASFTA833-12 pending Leptogenys JCR29 ASFTA834-12 pending Leptogenys JCR29 ASFTA835-12 pending Leptogenys JCR33 ASFTA425-12 pending Leptogenys JCR34 ASFTA476-12 pending Leptogenys MG01 ASFTA1369-12 pending Leptogenys oswaldi ASFTA268-12 pending Leptogenys ridens ASFTA245-12 pending Leptogenys ridens ASFTA246-12 pending Leptogenys ridens ASFTA247-12 pending Leptogenys ridens ASFTA248-12 pending Leptogenys saussurei ASFTA828-12 pending Leptogenys truncatirostris ASFTA812-12 pending Lophomyrmex TH01 ASFTA1229-12 pending Melanaspis mga ASFTA443-12 pending Melissotarsus insularis ASFTA1430-12 pending Melissotarsus insularis ASFTA1431-12 pending Melissotarsus insularis ASFTA1433-12 pending Melissotarsus insularis ASFTA634-12 pending Melissotarsus insularis ASFTA635-12 pending Melissotarsus insularis ASFTA667-12 pending Melissotarsus insularis ASFTA668-12 pending Meranoplus radamae ASFTA146-12 pending Meranoplus radamae ASFTA147-12 pending Meranoplus radamae ASFTA148-12 pending Meranoplus radamae ASFTA154-12 pending Meranoplus radamae ASFTA161-12 pending Monomorium ambvky_m03 ASFTA981-12 pending Monomorium bifidoclypeatum ASFTA094-12 pending Monomorium DR02 ASFTA201-12 pending Monomorium fisheri ASFTA111-12 pending Monomorium fisheri ASFTA114-12 pending Monomorium fisheri ASFTA1578-12 pending Monomorium fisheri ASFTA1579-12 pending Monomorium flavimembra ASFTA099-12 pending Monomorium flavimembra ASFTA104-12 pending Monomorium flavimembra ASFTA105-12 pending Monomorium flavimembra ASFTA106-12 pending Monomorium flavimembra ASFTA107-12 pending Monomorium flavimembra ASFTA109-12 pending

222

Species Process ID Genbank Accession No. Monomorium flavimembra ASFTA110-12 pending Monomorium gongromos ASFTA100-12 pending Monomorium gongromos ASFTA101-12 pending Monomorium gongromos ASFTA116-12 pending Monomorium hanneli ASFTA021-12 pending Monomorium hanneli ASFTA030-12 pending Monomorium hanneli ASFTA167-12 pending Monomorium hanneli ASFTA473-12 pending Monomorium hanneli ASFTA480-12 pending Monomorium hildebrandti ASFTA025-12 pending Monomorium hildebrandti ASFTA032-12 pending Monomorium hildebrandti_02 ASFTA323-12 pending Monomorium hildebrandti_02 ASFTA326-12 pending Monomorium hildebrandti_02 ASFTA327-12 pending Monomorium hildebrandti_02 ASFTA329-12 pending Monomorium hildebrandti_02 ASFTA373-12 pending Monomorium hildebrandti_02 ASFTA374-12 pending Monomorium hildebrandti_02 ASFTA375-12 pending Monomorium madecassum ASFTA158-12 pending Monomorium madecassum ASFTA159-12 pending Monomorium micrommaton ASFTA026-12 pending Monomorium termitobium ASFTA022-12 pending Monomorium termitobium ASFTA023-12 pending Monomorium termitobium ASFTA024-12 pending Monomorium termitobium ASFTA027-12 pending Monomorium termitobium ASFTA028-12 pending Monomorium termitobium ASFTA029-12 pending Monomorium termitobium ASFTA031-12 pending Monomorium termitobium ASFTA033-12 pending Monomorium termitobium ASFTA1407-12 pending Monomorium termitobium ASFTA1434-12 pending Monomorium termitobium ASFTA1439-12 pending Monomorium termitobium ASFTA1447-12 pending Monomorium termitobium ASFTA1448-12 pending Monomorium termitobium ASFTA1571-12 pending Monomorium termitobium ASFTA1572-12 pending Monomorium termitobium ASFTA164-12 pending Monomorium termitobium ASFTA466-12 pending Monomorium termitobium ASFTA472-12 pending Monomorium termitobium ASFTA474-12 pending

223

Species Process ID Genbank Accession No. Monomorium termitobium ASFTA475-12 pending Monomorium termitobium_03 ASFTA330-12 pending Monomorium termitobium_03 ASFTA331-12 pending Monomorium termitobium_04 ASFTA302-12 pending Monomorium undet ASFTA815-12 pending Myrmicine_genus01 MG01 ASFTA1360-12 pending Myrmicine_genus01 MG01 ASFTA1411-12 pending Myrmicine_genus01 MG01 ASFTA1422-12 pending Myrmicine_genus01 MG01 ASFTA493-12 pending Myrmicine_genus16 MG07 ASFTA647-12 pending Nesomyrmex DRm02 ASFTA358-12 pending Nesomyrmex DRQ01 ASFTA175-12 pending Nesomyrmex DRQ01 ASFTA199-12 pending Nesomyrmex madecassus ASFTA680-12 pending Nesomyrmex madecassus ASFTA681-12 pending Nesomyrmex madecassus ASFTA682-12 pending Nesomyrmex madecassus ASFTA683-12 pending Nesomyrmex madecassus ASFTA684-12 pending Nesomyrmex madecassus ASFTA685-12 pending Nesomyrmex madecassus ASFTA686-12 pending Nesomyrmex madecassus ASFTA687-12 pending Nesomyrmex MG04 ASFTA1391-12 pending Nesomyrmex MG04 ASFTA628-12 pending Nesomyrmex MG04 ASFTA629-12 pending Nesomyrmex MG06 ASFTA1384-12 pending Nesomyrmex MG14 ASFTA949-12 pending Nesomyrmex retusispinosus ASFTA424-12 pending Nesomyrmex sikorai ASFTA089-12 pending Nesomyrmex sikorai ASFTA090-12 pending Nesomyrmex sikorai ASFTA091-12 pending Nylanderia beanka01 ASFTA891-12 pending Nylanderia beanka02 ASFTA882-12 pending Nylanderia beanka02 ASFTA880-12 pending Nylanderia beanka02 ASFTA883-12 pending Nylanderia MG07 ASFTA238-12 pending Nylanderia MG09 ASFTA174-12 pending Nylanderia MG09 ASFTA905-12 pending Nylanderia MG09 ASFTA965-12 pending Nylanderia undet ASFTA067-12 pending Nylanderia undet ASFTA1383-12 pending

224

Species Process ID Genbank Accession No. Nylanderia undet ASFTA426-12 pending Nylanderia undet ASFTA504-12 pending Nylanderia undet ASFTA505-12 pending Nylanderia undet ASFTA510-12 pending Nylanderia undet ASFTA511-12 pending Nylanderia undet ASFTA512-12 pending Nylanderia undet ASFTA513-12 pending Nylanderia undet ASFTA514-12 pending Nylanderia undet ASFTA519-12 pending Nylanderia undet ASFTA528-12 pending Nylanderia undet ASFTA544-12 pending Nylanderia undet ASFTA547-12 pending Nylanderia undet ASFTA555-12 pending Nylanderia undet ASFTA557-12 pending Nylanderia undet ASFTA577-12 pending Nylanderia undet ASFTA578-12 pending Nylanderia undet ASFTA579-12 pending Nylanderia undet ASFTA582-12 pending Nylanderia undet ASFTA583-12 pending Nylanderia undet ASFTA584-12 pending Nylanderia undet ASFTA593-12 pending Nylanderia undet ASFTA594-12 pending Nylanderia undet ASFTA606-12 pending Nylanderia undet ASFTA607-12 pending Nylanderia undet ASFTA612-12 pending Odontomachus simillimus ASFTA780-12 pending Odontomachus simillimus ASFTA781-12 pending Odontomachus simillimus ASFTA785-12 pending Odontomachus simillimus ASFTA787-12 pending Odontomachus simillimus ASFTA789-12 pending Odontomachus simillimus ASFTA790-12 pending Odontomachus simillimus ASFTA791-12 pending Odontomachus simillimus ASFTA807-12 pending Odontomachus simillimus ASFTA808-12 pending Odontomachus simillimus ASFTA810-12 pending Odontomachus troglodytes ASFTA001-12 pending Odontomachus troglodytes ASFTA009-12 pending Odontomachus troglodytes ASFTA011-12 pending Odontomachus troglodytes ASFTA012-12 pending Odontomachus troglodytes ASFTA013-12 pending

225

Species Process ID Genbank Accession No. Odontomachus troglodytes ASFTA014-12 pending Odontomachus troglodytes ASFTA015-12 pending Odontomachus troglodytes ASFTA016-12 pending Odontomachus troglodytes ASFTA017-12 pending Odontomachus troglodytes ASFTA018-12 pending Odontomachus troglodytes ASFTA019-12 pending Odontomachus troglodytes ASFTA303-12 pending Odontomachus troglodytes ASFTA456-12 pending Odontomachus troglodytes ASFTA698-12 pending Paraparatrechina glabra ASFTA561-12 pending Paratrechina longicornis ASFTA003-12 pending Paratrechina longicornis ASFTA004-12 pending Paratrechina longicornis ASFTA006-12 pending Paratrechina longicornis ASFTA007-12 pending Paratrechina longicornis ASFTA068-12 pending Paratrechina longicornis ASFTA1444-12 pending Pheidole beanka04 ASFTA866-12 pending Pheidole beanka04 ASFTA886-12 pending Pheidole californica ASFTA405-12 pending Pheidole californica ASFTA407-12 pending Pheidole californica ASFTA433-12 pending Pheidole californica ASFTA435-12 pending Pheidole clementensis ASFTA1345-12 pending Pheidole creightoni ASFTA1346-12 pending Pheidole creightoni ASFTA400-12 pending Pheidole creightoni ASFTA401-12 pending Pheidole creightoni ASFTA403-12 pending Pheidole creightoni ASFTA404-12 pending Pheidole creightoni ASFTA406-12 pending Pheidole creightoni ASFTA432-12 pending Pheidole longispinosa scabrata ASFTA1182-12 pending Pheidole lucida ASFTA946-12 pending Pheidole madecassa ASFTA1222-12 pending Pheidole megacephala ASFTA676-12 pending Pheidole MG001 ASFTA947-12 pending Pheidole MG007 ASFTA1019-12 pending Pheidole MG015 ASFTA002-12 pending Pheidole MG015 ASFTA1022-12 pending Pheidole MG015 ASFTA1023-12 pending Pheidole MG015 ASFTA1024-12 pending

226

Species Process ID Genbank Accession No. Pheidole MG015 ASFTA144-12 pending Pheidole MG015 ASFTA145-12 pending Pheidole MG015 ASFTA149-12 pending Pheidole MG015 ASFTA151-12 pending Pheidole MG015 ASFTA152-12 pending Pheidole MG046 ASFTA428-12 pending Pheidole MG046 ASFTA980-12 pending Pheidole MG052 ASFTA877-12 pending Pheidole MG052 ASFTA958-12 pending Pheidole MG052 ASFTA959-12 pending Pheidole MG078 ASFTA085-12 pending Pheidole MG081 ASFTA537-12 pending Pheidole MG145 ASFTA150-12 pending Pheidole MG145 ASFTA153-12 pending Pheidole MG145 ASFTA214-12 pending Pheidole MG145 ASFTA225-12 pending Pheidole MG146 ASFTA1436-12 pending Pheidole MG150 ASFTA608-12 pending Pheidole MG150 ASFTA609-12 pending Pheidole MG150 ASFTA614-12 pending Pheidole MG150 ASFTA615-12 pending Pheidole MG150 ASFTA616-12 pending Pheidole MG151 ASFTA558-12 pending Pheidole MG151 ASFTA604-12 pending Pheidole MG151 ASFTA605-12 pending Pheidole MG151 ASFTA617-12 pending Pheidole MG151 ASFTA618-12 pending Pheidole MG154 ASFTA092-12 pending Pheidole MG154 ASFTA093-12 pending Pheidole MG157 ASFTA1227-12 pending Pheidole MG157 ASFTA1228-12 pending Pheidole MGs046 ASFTA1442-12 pending Pheidole MGs046 ASFTA1443-12 pending Pheidole MGs060 ASFTA1185-12 pending Pheidole MGs060 ASFTA1206-12 pending Pheidole MGs060 ASFTA1211-12 pending Pheidole MGs060 ASFTA1221-12 pending Pheidole MGs077 ASFTA562-12 pending Pheidole MGs087 ASFTA1195-12 pending Pheidole MGs087 ASFTA1198-12 pending

227

Species Process ID Genbank Accession No. Pheidole MGs089 ASFTA1207-12 pending Pheidole MGs089 ASFTA1209-12 pending Pheidole MGs120 ASFTA1197-12 pending Pheidole MGs120 ASFTA1199-12 pending Pheidole MGs125 ASFTA1180-12 pending Pheidole MGs128 ASFTA1203-12 pending Pheidole MGs129 ASFTA1184-12 pending Pheidole MGs129 ASFTA1196-12 pending Pheidole MGs130 ASFTA1189-12 pending Pheidole MGs130 ASFTA1205-12 pending Pheidole MGs130 ASFTA1213-12 pending Pheidole MGs131 ASFTA1218-12 pending Pheidole paiute ASFTA402-12 pending Pheidole undet ASFTA1364-12 pending Pheidole undet ASFTA619-12 pending Pheidole undet ASFTA620-12 pending Pheidole undet ASFTA621-12 pending Plagiolepis alluaudi ASFTA1396-12 pending Plagiolepis alluaudi ASFTA1404-12 pending Plagiolepis alluaudi ASFTA1428-12 pending Plagiolepis alluaudi ASFTA610-12 pending Plagiolepis alluaudi ASFTA611-12 pending Plagiolepis alluaudi ASFTA633-12 pending Plagiolepis alluaudi ASFTA648-12 pending Plagiolepis alluaudi ASFTA650-12 pending Plagiolepis alluaudi ASFTA651-12 pending Plagiolepis alluaudi ASFTA652-12 pending Plagiolepis alluaudi ASFTA653-12 pending Plagiolepis alluaudi ASFTA988-12 pending Plagiolepis madecassa ASFTA1394-12 pending Plagiolepis madecassa ASFTA429-12 pending Plagiolepis MG01 ASFTA160-12 pending Plagiolepis MG05 ASFTA1397-12 pending Plagiolepis MG05 ASFTA173-12 pending Plagiolepis undet ASFTA1406-12 pending Pogonomyrmex AR01 ASFTA851-12 pending Ponera exotica ASFTA801-12 pending Prionopelta MG01 ASFTA1380-12 pending Prionopelta MG01 ASFTA438-12 pending Prionopelta MG01 ASFTA439-12 pending

228

Species Process ID Genbank Accession No. Prionopelta MG01 ASFTA440-12 pending Prionopelta MG01 ASFTA441-12 pending Prionopelta MG01 ASFTA442-12 pending Prionopelta MG01 ASFTA656-12 pending Prionopelta MG01 ASFTA663-12 pending Prionopelta undet ASFTA399-12 pending Proceratium MGm02 ASFTA430-12 pending Pyramica ambatrix ASFTA1016-12 pending Pyramica ambatrix ASFTA931-12 pending Pyramica ambatrix ASFTA995-12 pending Pyramica erynnes ASFTA1004-12 pending Pyramica erynnes ASFTA1005-12 pending Pyramica erynnes ASFTA1009-12 pending Pyramica erynnes ASFTA1015-12 pending Pyramica erynnes ASFTA530-12 pending Pyramica erynnes ASFTA531-12 pending Pyramica erynnes ASFTA532-12 pending Pyramica erynnes ASFTA533-12 pending Pyramica erynnes ASFTA534-12 pending Pyramica erynnes ASFTA535-12 pending Pyramica erynnes ASFTA536-12 pending Pyramica erynnes ASFTA553-12 pending Pyramica erynnes ASFTA560-12 pending Pyramica erynnes ASFTA966-12 pending Pyramica ludovici ASFTA1357-12 pending Pyramica ludovici ASFTA242-12 pending Pyramica ludovici ASFTA538-12 pending Pyramica ludovici ASFTA546-12 pending Pyramica ludovici ASFTA548-12 pending Pyramica ludovici ASFTA549-12 pending Pyramica ludovici ASFTA550-12 pending Pyramica ludovici ASFTA559-12 pending Pyramica ludovici ASFTA564-12 pending Pyramica ludovici ASFTA876-12 pending Pyramica ludovici ASFTA917-12 pending Pyramica mandibularis ASFTA496-12 pending Pyramica mandibularis ASFTA497-12 pending Pyramica mandibularis ASFTA498-12 pending Pyramica mandibularis ASFTA499-12 pending Pyramica mandibularis ASFTA500-12 pending

229

Species Process ID Genbank Accession No. Pyramica mandibularis ASFTA501-12 pending Pyramica mandibularis ASFTA502-12 pending Pyramica mandibularis ASFTA503-12 pending Solenopsis mameti ASFTA010-12 pending Solenopsis mameti ASFTA020-12 pending Solenopsis mameti ASFTA1017-12 pending Solenopsis mameti ASFTA941-12 pending Strumigenys abdera ASFTA102-12 pending Strumigenys abdera ASFTA103-12 pending Strumigenys actis ASFTA344-12 pending Strumigenys actis ASFTA506-12 pending Strumigenys actis ASFTA507-12 pending Strumigenys actis ASFTA508-12 pending Strumigenys actis ASFTA509-12 pending Strumigenys actis ASFTA515-12 pending Strumigenys actis ASFTA516-12 pending Strumigenys actis ASFTA518-12 pending Strumigenys actis ASFTA523-12 pending Strumigenys actis ASFTA524-12 pending Strumigenys actis ASFTA525-12 pending Strumigenys ambvky_m02 ASFTA984-12 pending Strumigenys ampyx ASFTA097-12 pending Strumigenys ampyx ASFTA098-12 pending Strumigenys ampyx ASFTA112-12 pending Strumigenys ampyx ASFTA113-12 pending Strumigenys ampyx ASFTA376-12 pending Strumigenys ampyx ASFTA955-12 pending Strumigenys ampyx ASFTA962-12 pending Strumigenys ampyx ASFTA963-12 pending Strumigenys apios ASFTA096-12 pending Strumigenys apios ASFTA115-12 pending Strumigenys bibiolona ASFTA120-12 pending Strumigenys bibiolona ASFTA121-12 pending Strumigenys bola ASFTA140-12 pending Strumigenys bola ASFTA141-12 pending Strumigenys bola ASFTA142-12 pending Strumigenys chilo ASFTA165-12 pending Strumigenys chilo ASFTA169-12 pending Strumigenys chroa ASFTA122-12 pending Strumigenys chroa ASFTA123-12 pending

230

Species Process ID Genbank Accession No. Strumigenys chroa ASFTA125-12 pending Strumigenys covina ASFTA126-12 pending Strumigenys covina ASFTA127-12 pending Strumigenys covina ASFTA129-12 pending Strumigenys covina ASFTA130-12 pending Strumigenys covina ASFTA131-12 pending Strumigenys covina ASFTA143-12 pending Strumigenys deverra ASFTA132-12 pending Strumigenys deverra ASFTA139-12 pending Strumigenys dicomas ASFTA1367-12 pending Strumigenys dicomas ASFTA520-12 pending Strumigenys dicomas ASFTA521-12 pending Strumigenys dicomas ASFTA522-12 pending Strumigenys dicomas ASFTA554-12 pending Strumigenys dicomas ASFTA565-12 pending Strumigenys dicomas ASFTA570-12 pending Strumigenys dicomas ASFTA585-12 pending Strumigenys dicomas ASFTA591-12 pending Strumigenys dicomas ASFTA592-12 pending Strumigenys dicomas ASFTA597-12 pending Strumigenys dicomas ASFTA598-12 pending Strumigenys europs ASFTA117-12 pending Strumigenys europs ASFTA118-12 pending Strumigenys luca ASFTA1159-12 pending Strumigenys sphera ASFTA539-12 pending Strumigenys undet ASFTA156-12 pending Strumigenys undet ASFTA157-12 pending Strumigenys undet ASFTA162-12 pending Strumigenys undet ASFTA163-12 pending Strumigenys undet ASFTA170-12 pending Strumigenys undet ASFTA171-12 pending Strumigenys undet ASFTA613-12 pending Strumigenys vazimba ASFTA299-12 pending Strumigenys vazimba ASFTA300-12 pending Strumigenys vazimba ASFTA307-12 pending Strumigenys vazimba ASFTA308-12 pending Strumigenys vazimba ASFTA309-12 pending Strumigenys vazimba ASFTA310-12 pending Strumigenys vazimba ASFTA346-12 pending Strumigenys vazimba ASFTA352-12 pending

231

Species Process ID Genbank Accession No. Strumigenys vazimba ASFTA354-12 pending Tapinoma melanocephalum ASFTA005-12 pending Tapinoma melanocephalum ASFTA008-12 pending Tapinoma melanocephalum ASFTA460-12 pending Tapinoma melanocephalum ASFTA675-12 pending Tapinoma melanocephalum ASFTA690-12 pending Tapinoma melanocephalum ASFTA693-12 pending Tapinoma melanocephalum ASFTA711-12 pending Tapinoma melanocephalum ASFTA712-12 pending Tapinoma melanocephalum ASFTA713-12 pending Tapinoma melanocephalum ASFTA714-12 pending Tapinoma melanocephalum ASFTA725-12 pending Tapinoma melanocephalum ASFTA733-12 pending Tapinoma MG02 ASFTA707-12 pending Tapinoma MG02 ASFTA709-12 pending Tapinoma MG03 ASFTA703-12 pending Tapinoma MG03 ASFTA704-12 pending Tapinoma MG03 ASFTA705-12 pending Tapinoma MG03 ASFTA706-12 pending Tapinoma MG03 ASFTA716-12 pending Tapinoma MG03 ASFTA730-12 pending Tapinoma MG03 ASFTA731-12 pending Tapinoma MG03 ASFTA732-12 pending Tapinoma MG05 ASFTA717-12 pending Tapinoma MG05 ASFTA728-12 pending Tapinoma subtile ASFTA710-12 pending Tapinoma subtile ASFTA726-12 pending Technomyrmex albipes ASFTA1342-12 pending Technomyrmex albipes ASFTA622-12 pending Technomyrmex albipes ASFTA623-12 pending Technomyrmex albipes ASFTA624-12 pending Technomyrmex albipes ASFTA625-12 pending Technomyrmex albipes ASFTA631-12 pending Technomyrmex albipes ASFTA638-12 pending Technomyrmex albipes ASFTA673-12 pending Technomyrmex albipes ASFTA674-12 pending Technomyrmex albipes ASFTA689-12 pending Technomyrmex albipes ASFTA691-12 pending Technomyrmex albipes ASFTA692-12 pending Technomyrmex anterops ASFTA431-12 pending

232

Species Process ID Genbank Accession No. Technomyrmex difficilis ASFTA603-12 pending Technomyrmex difficilis ASFTA636-12 pending Technomyrmex difficilis ASFTA637-12 pending Technomyrmex difficilis ASFTA639-12 pending Technomyrmex difficilis ASFTA640-12 pending Technomyrmex difficilis ASFTA641-12 pending Technomyrmex difficilis ASFTA644-12 pending Technomyrmex difficilis ASFTA645-12 pending Technomyrmex difficilis ASFTA649-12 pending Technomyrmex docens ASFTA1344-12 pending Technomyrmex fisheri ASFTA1370-12 pending Technomyrmex fisheri ASFTA642-12 pending Technomyrmex fisheri ASFTA643-12 pending Technomyrmex madecassus ASFTA664-12 pending Technomyrmex mayri ASFTA1343-12 pending Technomyrmex pallipes ASFTA1449-12 pending Technomyrmex vitiensis ASFTA1149-12 pending Terataner MG01 ASFTA1351-12 pending Terataner MG09 ASFTA1352-12 pending Terataner MG11 ASFTA180-12 pending Terataner MG11 ASFTA183-12 pending Terataner MG11 ASFTA184-12 pending Terataner MG11 ASFTA293-12 pending Terataner MG11 ASFTA294-12 pending Terataner undet ASFTA1233-12 pending Terataner undet ASFTA1234-12 pending Terataner undet ASFTA853-12 pending Terataner undet ASFTA854-12 pending Terataner undet ASFTA855-12 pending Terataner undet ASFTA856-12 pending Terataner undet ASFTA859-12 pending Terataner undet ASFTA860-12 pending Tetramorium bicarinatum ASFTA1416-12 pending Tetramorium bicarinatum ASFTA1420-12 pending Tetramorium cognatum ASFTA1266-12 pending Tetramorium coillum ASFTA765-12 pending Tetramorium ibycterum ASFTA1358-12 pending Tetramorium latreillei ASFTA1278-12 pending Tetramorium MG035 ASFTA1279-12 pending Tetramorium MG035 ASFTA1284-12 pending

233

Species Process ID Genbank Accession No. Tetramorium MG035 ASFTA575-12 pending Tetramorium MG036 ASFTA600-12 pending Tetramorium MG037 ASFTA1260-12 pending Tetramorium MG040 ASFTA1265-12 pending Tetramorium MG042 ASFTA1276-12 pending Tetramorium MG047 ASFTA1274-12 pending Tetramorium MG052b ASFTA1273-12 pending Tetramorium MG089 ASFTA1268-12 pending Tetramorium MG089 ASFTA1270-12 pending Tetramorium MG089 ASFTA1271-12 pending Tetramorium MG089 ASFTA1272-12 pending Tetramorium MG093 ASFTA1264-12 pending Tetramorium MG093 ASFTA1287-12 pending Tetramorium MG103 ASFTA574-12 pending Tetramorium MG103 ASFTA586-12 pending Tetramorium MG103 ASFTA587-12 pending Tetramorium MG103 ASFTA588-12 pending Tetramorium MG103 ASFTA601-12 pending Tetramorium MG111 ASFTA1365-12 pending Tetramorium MG111 ASFTA567-12 pending Tetramorium MG111 ASFTA779-12 pending Tetramorium MG112 ASFTA774-12 pending Tetramorium MG112 ASFTA775-12 pending Tetramorium MG118 ASFTA766-12 pending Tetramorium MG118 ASFTA768-12 pending Tetramorium MG119 ASFTA811-12 pending Tetramorium MG120 ASFTA778-12 pending Tetramorium MG121 ASFTA569-12 pending Tetramorium MG121 ASFTA580-12 pending Tetramorium MG121 ASFTA581-12 pending Tetramorium MG121 ASFTA602-12 pending Tetramorium MG121 ASFTA809-12 pending Tetramorium MG122 ASFTA769-12 pending Tetramorium MG122 ASFTA771-12 pending Tetramorium MG125 ASFTA1007-12 pending Tetramorium MG134 ASFTA973-12 pending Tetramorium MG134 ASFTA976-12 pending Tetramorium MG134 ASFTA977-12 pending Tetramorium MG135 ASFTA974-12 pending Tetramorium norvigi ASFTA1226-12 pending

234

Species Process ID Genbank Accession No. Tetramorium norvigi ASFTA1230-12 pending Tetramorium norvigi ASFTA1231-12 pending Tetramorium proximum ASFTA1282-12 pending Tetramorium proximum ASFTA527-12 pending Tetramorium quasirum ASFTA590-12 pending Tetramorium quasirum ASFTA772-12 pending Tetramorium robustior ASFTA540-12 pending Tetramorium robustior ASFTA541-12 pending Tetramorium robustior ASFTA572-12 pending Tetramorium robustior ASFTA599-12 pending Tetramorium undet ASFTA670-12 pending Tetraponera beanka06 ASFTA865-12 pending Tetraponera DR02 ASFTA212-12 pending Tetraponera DR02 ASFTA233-12 pending Tetraponera DR06 ASFTA195-12 pending Tetraponera DR09 ASFTA240-12 pending Tetraponera DRQ02 ASFTA241-12 pending Tetraponera grandidieri_01 ASFTA182-12 pending Tetraponera manangotra ASFTA179-12 pending Tetraponera merita ASFTA1353-12 pending Tetraponera merita ASFTA694-12 pending Tetraponera merita ASFTA695-12 pending Tetraponera merita ASFTA696-12 pending Tetraponera MG04 ASFTA1387-12 pending Tetraponera MG04 ASFTA1392-12 pending Tetraponera MG04 ASFTA1403-12 pending Tetraponera MG04 ASFTA1437-12 pending Tetraponera MG17 ASFTA369-12 pending Tetraponera MG17 ASFTA371-12 pending Tetraponera undet ASFTA1413-12 pending Tetraponera undet ASFTA1414-12 pending Tetraponera undet ASFTA1415-12 pending Tetraponera undet ASFTA1417-12 pending Tetraponera undet ASFTA1418-12 pending Tetraponera undet ASFTA1419-12 pending Tetraponera undet ASFTA1445-12 pending Tetraponera undet ASFTA436-12 pending

235

Table S4.3- BOLD process IDs and Genbank accessions for coxA and hcpA in ants infected with Wolbachia. Wolbachia was detected over four amplifications, two times using DNA extracted from somatic tissue and two times using reproductive tissue. All Genbank accession numbers for hcpA are still pending release. “NS” indicates hcpA could not be successfully sequenced.

Species BOLD Process ID Genbank Accession Genbank Accession (coxA) (hcpA) Camponotus christi foersteri ASFTA1580-12 KF490041 pending Camponotus christi foersteri ASFTA1581-12 KF490040 pending Camponotus christi foersteri ASFTA1589-12 KF490033 pending Camponotus christi foersteri ASFTA1590-12 KF490038 pending Camponotus christi foersteri ASFTA1601-12 KF490046 pending Camponotus christi foersteri ASFTA1602-12 KF490048 pending Camponotus christi foersteri ASFTA1603-12 KF490049 pending Camponotus christi foersteri ASFTA1604-12 KF490047 pending Camponotus grandidieri ASFTA1600-12 KF490062 NS Camponotus heteroclitus ASFTA1591-12 KF490069 pending Camponotus heteroclitus ASFTA1592-12 KF490078 pending Camponotus heteroclitus ASFTA1593-12 KF490076 pending Camponotus heteroclitus ASFTA1594-12 KF490075 pending Camponotus heteroclitus ASFTA1595-12 KF490073 pending Camponotus heteroclitus ASFTA1596-12 KF490070 pending Camponotus heteroclitus ASFTA1597-12 KF490065 pending Camponotus heteroclitus ASFTA1598-12 KF490064 pending Camponotus MG005 ASFTA1582-12 KF490093 pending Camponotus MG005 ASFTA1583-12 KF490095 pending Camponotus MG005 ASFTA1584-12 KF490096 pending Camponotus MG005 ASFTA1585-12 KF490098 pending Camponotus MG005 ASFTA1599-12 KF490094 pending Camponotus MG053 ASFTA1586-12 KF490184 NS Camponotus MG053 ASFTA1587-12 KF490183 pending Camponotus MG053 ASFTA1605-12 KF490186 NS Camponotus MG053 ASFTA1606-12 KF490185 NS

236

Appendix S5 Chapter 3- Wolbachia Prevalence in Formicidae

Table S5.1- A survey of Wolbachia infection in 8 ant subfamilies following the “PCR” rule. All subfamilies were infected with Wolbachia, but infection varied across taxa. Cerapachyinae had the highest infection (63/152=41.45 %) and Amblyoponinae had the lowest infection (14/575=2.43 %). Estimates reported here are conservative as the result of more permissive “PCR” rule passes and thus, may be higher than the “true” infection prevalence.

Subfamily No. of Infected Total Surveyed % Infected Amblyoponinae 14 575 2.43 % Cerapachyinae 63 152 41.45 % Dolichoderinae 82 287 28.57 % Formicinae 372 1796 20.71 % Myrmicinae 727 5581 13.01 % Ponerinae 211 1990 10.60 % Proceratiinae 4 22 18.18 % Pseudomyrmecinae 43 195 22.05 %

237

Table S5.2- A survey of Wolbachia infection in 61 ant genera following the “PCR” rule. 47/61 genera (77.05 %) were infected with Wolbachia. 14 genera had 0 % infection. Cataulacus had the highest infection frequency (65/93=69.89 %) and Mystrium had the lowest infection frequency (1/333=0.30 %). Estimates reported here are conservative as the result of more permissive PCR passes and thus, may be higher than the “true” infection prevalence.

Genus No. of Infected Total Surveyed % Infected Adelomyrmex 1 2 50.00 % Adetomyrma 0 50 0.00 % Amblyopone 3 126 2.38 % Amblyoponine_genus1 1 43 2.33 % Anochetus 22 139 15.83 % Anoplolepis 0 2 0.00 % Aphaenogaster 45 78 57.69 % Brachymyrmex 0 49 0.00 % Camponotus 260 1432 18.16 % Cardiocondyla 15 90 16.67 % Carebara 4 22 18.18 % Cataulacus 65 93 69.89 % Cerapachyine_genus6 1 6 16.67 % Cerapachys 62 143 43.36 % Cerapachys_F01 0 1 0.00 % Crematogaster 42 270 15.56 % Discothyrea 0 2 0.00 % Eutetramorium 0 31 0.00 % Formica 2 10 20.00 % Hypoponera 43 915 4.70 % Lasius 0 2 0.00 % Lepisiota 8 13 61.54 % Leptogenys 107 564 18.97 % Leptothorax 0 1 0.00 % Lophomyrmex 1 2 50.00 % Melanaspis 2 6 33.33 % Melissotarsus 8 18 44.44 % Meranoplus 5 20 25.00 % Monomorium 71 444 15.99 % Morganella 0 28 0.00 % Myrmicine_genus01 5 8 62.50 % Myrmicine_genus02 2 4 50.00 % Myrmicine_genus05 1 1 100.00 % Myrmicine_genus16 2 9 22.22 % Mystrium 1 333 0.30 % Nesomyrmex 43 131 32.82 %

238

Genus No. of Infected Total Surveyed % Infected Nylanderia 71 190 37.37 % Ochetellus 0 2 0.00 % Odontomachus 26 44 59.09 % Pachycondyla 9 198 4.55 % Paraparatrechina 1 2 50.00 % Paratrechina 6 20 30.00 % Pheidole 141 1774 7.95 % Pilotrochus 0 1 0.00 % Plagiolepis 24 75 32.00 % Platythyrea 2 78 2.56 % Pogonomyrmex 1 6 16.67 % Ponera 2 52 3.85 % Prionopelta 9 23 39.13 % Proceratium 4 20 20.00 % Simopone 0 3 0.00 % Solenopsis 7 36 19.44 % Strumigenys 105 834 12.59 % Tapinolepis 0 1 0.00 % Tapinoma 41 116 35.34 % Technomyrmex 41 169 24.26 % Temnothorax 0 1 0.00 % Terataner 19 137 13.87 % Tetramorium 100 1423 7.03 % Tetraponera 43 195 22.05 %

239

Table S5.3- A survey of Wolbachia infection in 1,155 ant species following the “PCR” rule. 374/1,155 species (32.38 %) were infected with Wolbachia anad 781 species had 0 % infection. Cataulacus porcatus had the highest infection frequency (51/63=80.95 %) and Pheidole megacephala had the lowest infection frequency (1/65=1.54 %) (for species with n ≥ 20 individuals). Estimates reported here are conservative as the result of more permissive PCR passes and thus, may be higher than the “true” infection prevalence.

Species No. of Infected Total Surveyed % Infected Adelomyrmex SC01 0 1 0.00 % Adelomyrmex SC02 1 1 100.00 % Adetomyrma ambvky_m01 0 1 0.00 % Adetomyrma DRm01 0 9 0.00 % Adetomyrma MG01 0 5 0.00 % Adetomyrma MG02 0 4 0.00 % Adetomyrma MG03 0 6 0.00 % Adetomyrma MGm03 0 7 0.00 % Adetomyrma MGm04 0 1 0.00 % Adetomyrma MGm05 0 1 0.00 % Adetomyrma MGm06 0 1 0.00 % Adetomyrma venatrix 0 11 0.00 % Amblyopone ambvky_m01 0 1 0.00 % Amblyopone ambvky_m02 0 1 0.00 % Amblyopone ambvky_m03 2 3 66.67 % Amblyopone MG01 0 22 0.00 % Amblyopone MG02 0 9 0.00 % Amblyopone MG03 0 3 0.00 % Amblyopone MG04 0 33 0.00 % Amblyopone MG05 0 14 0.00 % Amblyopone MG06 0 8 0.00 % Amblyopone MGm01 0 3 0.00 % Amblyopone MGm02 0 7 0.00 % Amblyopone MGm03 0 3 0.00 % Amblyopone MGm04 1 6 16.67 % Amblyopone pallipes 0 1 0.00 % Amblyopone sp. Mad-01 0 9 0.00 % Amblyoponine_genus1 DRm01 0 6 0.00 % Amblyoponine_genus1 DRm02 0 3 0.00 % Amblyoponine_genus1 DRm03 0 7 0.00 % Amblyoponine_genus1 DRm04 0 3 0.00 % Amblyoponine_genus1 DRm05 0 1 0.00 % Amblyoponine_genus1 MG01 1 16 6.25 % Amblyoponine_genus1 MG02 0 1 0.00 % Amblyoponine_genus1 MG04 0 6 0.00 %

240

Species No. of Infected Total Surveyed % Infected Anochetus goodmani 1 5 20.00 % Anochetus grandidieri 18 41 43.90 % Anochetus madagascarensis 3 84 3.57 % Anochetus pubescens 0 9 0.00 % Anoplolepis gracilipes 0 2 0.00 % Aphaenogaster gonacantha 0 6 0.00 % Aphaenogaster MG05 0 1 0.00 % Aphaenogaster occidentalis 0 2 0.00 % Aphaenogaster swammerdami 45 69 65.22 % Brachymyrmex cordemoyi 0 44 0.00 % Brachymyrmex obscurior 0 2 0.00 % Camponotus ambatovaky01 0 1 0.00 % Camponotus ambatovaky02 0 5 0.00 % Camponotus auropubens 0 6 0.00 % Camponotus butteli 5 9 55.56 % Camponotus cervicalis 0 1 0.00 % Camponotus christi 45 83 54.21 % Camponotus christi_01 2 3 66.67 % Camponotus christi_02 4 4 100.00 % Camponotus concolor 3 12 25.00 % Camponotus darwinii 0 16 0.00 % Camponotus DR01 0 4 0.00 % Camponotus dromedarius 4 7 57.14 % Camponotus DRw07 0 2 0.00 % Camponotus DRw16 0 1 0.00 % Camponotus dufouri 4 36 11.11 % Camponotus echinoploides 0 19 0.00 % Camponotus edmondi 0 16 0.00 % Camponotus ellioti 0 10 0.00 % Camponotus ethicus 0 1 0.00 % Camponotus gerberti 1 1 100.00 % Camponotus gibber 5 10 50.00 % Camponotus gouldi 0 18 0.00 % Camponotus grandidieri 1 59 1.69 % Camponotus hagensii 0 16 0.00 % Camponotus heteroclitus 19 30 63.33 % Camponotus hildebrandti 3 4 75.00 % Camponotus hova 3 9 33.33 % Camponotus imitator 0 13 0.00 % Camponotus kelleri 0 10 0.00 % Camponotus maculatus 0 21 0.00 % Camponotus MG001 0 11 0.00 %

241

Species No. of Infected Total Surveyed % Infected Camponotus MG002 1 37 2.70 % Camponotus MG003 5 10 50.00 % Camponotus MG004 8 10 80.00 % Camponotus MG005 23 71 32.39 % Camponotus MG008 4 4 100.00 % Camponotus MG009 0 14 0.00 % Camponotus MG010 0 7 0.00 % Camponotus MG011 0 6 0.00 % Camponotus MG012 0 1 0.00 % Camponotus MG014 9 10 90.00 % Camponotus MG015 2 5 40.00 % Camponotus MG016 0 4 0.00 % Camponotus MG017 3 3 100.00 % Camponotus MG018 5 16 31.25 % Camponotus MG019 1 3 33.33 % Camponotus MG020 0 9 0.00 % Camponotus MG021 0 6 0.00 % Camponotus MG022 1 1 100.00 % Camponotus MG023 12 19 63.16 % Camponotus MG024 4 6 66.67 % Camponotus MG025 0 9 0.00 % Camponotus MG026 6 10 60.00 % Camponotus MG027 0 10 0.00 % Camponotus MG028 0 11 0.00 % Camponotus MG03_maculatus_nr 1 1 100.00 % Camponotus MG030 1 2 50.00 % Camponotus MG031 0 10 0.00 % Camponotus MG033 0 10 0.00 % Camponotus MG034 0 4 0.00 % Camponotus MG035 8 15 53.33 % Camponotus MG039 8 26 30.77 % Camponotus MG040 4 9 44.44 % Camponotus MG041 2 2 100.00 % Camponotus MG043 2 3 66.67 % Camponotus MG045 0 1 0.00 % Camponotus MG046 1 19 5.26 % Camponotus MG047 2 15 13.33 % Camponotus MG048 2 11 18.18 % Camponotus MG049 4 11 36.36 % Camponotus MG050 0 13 0.00 % Camponotus MG051 0 8 0.00 % Camponotus MG053 4 70 5.71 %

242

Species No. of Infected Total Surveyed % Infected Camponotus MG054 2 30 6.67 % Camponotus MG059 0 7 0.00 % Camponotus MG062 0 3 0.00 % Camponotus MG064 0 2 0.00 % Camponotus MG065 0 10 0.00 % Camponotus MG066 0 9 0.00 % Camponotus MG067 0 1 0.00 % Camponotus MG068 0 5 0.00 % Camponotus MG070 0 9 0.00 % Camponotus MG071 0 10 0.00 % Camponotus MG072 0 5 0.00 % Camponotus MG073 0 5 0.00 % Camponotus MG074 0 5 0.00 % Camponotus MG075 0 1 0.00 % Camponotus MG077 0 3 0.00 % Camponotus MG078 3 8 37.50 % Camponotus MG079 0 5 0.00 % Camponotus MG081 0 10 0.00 % Camponotus MG083 0 1 0.00 % Camponotus MG088 3 15 20.00 % Camponotus MG089 2 8 25.00 % Camponotus MG090 0 4 0.00 % Camponotus MG091 0 2 0.00 % Camponotus MG096 3 16 18.75 % Camponotus MG097 0 6 0.00 % Camponotus MG098 0 11 0.00 % Camponotus MG099 0 2 0.00 % Camponotus MG100 0 10 0.00 % Camponotus MG100a 0 15 0.00 % Camponotus MG100b 0 6 0.00 % Camponotus MG101 1 26 3.85 % Camponotus MG102 0 8 0.00 % Camponotus MG104 0 6 0.00 % Camponotus MG109 0 8 0.00 % Camponotus MG111 7 9 77.78 % Camponotus MG112 1 1 100.00 % Camponotus MG115 0 2 0.00 % Camponotus MG116 0 10 0.00 % Camponotus MG119 4 4 100.00 % Camponotus MG120 5 5 100.00 % Camponotus MG121 1 10 10.00 % Camponotus MG122 0 1 0.00 %

243

Species No. of Infected Total Surveyed % Infected Camponotus mocquerysi 0 16 0.00 % Camponotus nasicus 0 10 0.00 % Camponotus niveosetosus 0 15 0.00 % Camponotus nossibeensis 0 23 0.00 % Camponotus pictipes 4 7 57.14 % Camponotus putatus 0 11 0.00 % Camponotus quadrimaculatus 0 23 0.00 % Camponotus radamae 0 2 0.00 % Camponotus RE01 0 3 0.00 % Camponotus reaumuri 0 1 0.00 % Camponotus repens 0 11 0.00 % Camponotus robustus 0 10 0.00 % Camponotus roeseli 1 10 10.00 % Camponotus ursus 0 8 0.00 % Camponotus variegatus 0 1 0.00 % Camponotus vicinus 0 1 0.00 % Camponotus voeltzkowii 0 14 0.00 % Cardiocondyla beanka_Q01 1 1 100.00 % Cardiocondyla emeryi 2 21 9.52 % Cardiocondyla kagutsuchi 0 4 0.00 % Cardiocondyla mauritanica 0 8 0.00 % Cardiocondyla nuda 0 16 0.00 % Cardiocondyla obscurior 0 4 0.00 % Cardiocondyla shuckardi 0 14 0.00 % Cardiocondyla venustula 0 2 0.00 % Cardiocondyla wroughtonii 12 19 63.16 % Carebara beanka_m01 1 4 25.00 % Carebara beanka_Q01 0 2 0.00 % Carebara beanka_s01 0 1 0.00 % Carebara beanka01 0 5 0.00 % Carebara DRm01 2 3 66.67 % Carebara DRm02 1 1 100.00 % Carebara DRm03 0 1 0.00 % Carebara MG01 0 5 0.00 % Cataulacus ebrardi 3 15 20.00 % Cataulacus oberthueri 4 4 100.00 % Cataulacus porcatus 51 63 80.95 % Cataulacus regularis 3 7 42.86 % Cataulacus wasmanni 4 4 100.00 % Cerapachyine_genus6 DR01 1 3 33.33 % Cerapachyine_genus6 hirsuta 0 2 0.00 % Cerapachyine_genus6 scelesta 0 1 0.00 %

244

Species No. of Infected Total Surveyed % Infected Cerapachys beanka_m01 1 2 50.00 % Cerapachys beanka_m02 1 1 100.00 % Cerapachys beanka_m03 1 1 100.00 % Cerapachys beanka_m04 0 1 0.00 % Cerapachys beanka_m05 0 1 0.00 % Cerapachys biroi 1 4 25.00 % Cerapachys DR01 0 10 0.00 % Cerapachys DR02 0 11 0.00 % Cerapachys DRQ02 0 2 0.00 % Cerapachys DRQ03 0 2 0.00 % Cerapachys DRw03 0 1 0.00 % Cerapachys FO1_DRm02 0 9 0.00 % Cerapachys L_DR01 0 1 0.00 % Cerapachys L_MG01 0 1 0.00 % Cerapachys L_MG02 0 4 0.00 % Cerapachys L_MG04 1 1 100.00 % Cerapachys L_MG05 2 5 40.00 % Cerapachys L_MG11 4 5 80.00 % Cerapachys L_MG14 0 1 0.00 % Cerapachys L_MG42 0 1 0.00 % Cerapachys lividus 0 4 0.00 % Cerapachys MG03 0 1 0.00 % Cerapachys MG42 0 1 0.00 % Cerapachys P_DR01 0 1 0.00 % Cerapachys P_DR02 0 2 0.00 % Cerapachys P_DR03 1 1 100.00 % Cerapachys P_DR04 1 1 100.00 % Cerapachys P_MG01 1 1 100.00 % Cerapachys P_MG02 12 12 100.00 % Cerapachys P_MG06 5 10 50.00 % Cerapachys P_MG07 2 2 100.00 % Cerapachys P_MG11 1 1 100.00 % Cerapachys prey01 5 5 100.00 % Cerapachys prey02 3 3 100.00 % Cerapachys prey03 3 4 75.00 % Cerapachys prey04 5 5 100.00 % Cerapachys prey05 1 1 100.00 % Cerapachys prey06 1 1 100.00 % Cerapachys SC01 0 4 0.00 % Cerapachys YT01 0 1 0.00 % Cerapachys_F01 beanka 0 1 0.00 % Crematogaster adrepens 0 5 0.00 %

245

Species No. of Infected Total Surveyed % Infected Crematogaster BBB12 0 1 0.00 % Crematogaster BBB14 0 1 0.00 % Crematogaster BBB32 0 5 0.00 % Crematogaster BBB35 2 3 66.67 % Crematogaster BBB37 0 1 0.00 % Crematogaster BBB38 0 1 0.00 % Crematogaster BBB41 0 3 0.00 % Crematogaster BBB43 0 1 0.00 % Crematogaster BBB44 0 18 0.00 % Crematogaster BBB45 0 1 0.00 % Crematogaster BBB48 0 2 0.00 % Crematogaster BBB49 0 2 0.00 % Crematogaster BBB51 0 3 0.00 % Crematogaster BBB55 25 36 69.44 % Crematogaster BBB56 0 2 0.00 % Crematogaster castanea 0 1 0.00 % Crematogaster DRm01 0 1 0.00 % Crematogaster DRm02 0 2 0.00 % Crematogaster DRQ01 0 2 0.00 % Crematogaster DRw01 0 7 0.00 % Crematogaster DRw02 0 3 0.00 % Crematogaster DRw03 0 1 0.00 % Crematogaster DRw04 0 8 0.00 % Crematogaster DRw05 0 2 0.00 % Crematogaster DRw06 0 2 0.00 % Crematogaster DRw09 0 12 0.00 % Crematogaster DRw11 1 1 100.00 % Crematogaster DRw13 0 3 0.00 % Crematogaster DRw14 0 1 0.00 % Crematogaster DRw15 0 2 0.00 % Crematogaster DRw16 1 1 100.00 % Crematogaster DRw17 0 6 0.00 % Crematogaster grevei 5 7 71.43 % Crematogaster hova-complex_m1 2 3 66.67 % Crematogaster hova-complex_m2 0 10 0.00 % Crematogaster hova-complex_m3 0 20 0.00 % Crematogaster hova-complex_m4 0 18 0.00 % Crematogaster hova-complex_m5 0 8 0.00 % Crematogaster KM01 0 2 0.00 % Crematogaster madecassa 0 5 0.00 % Crematogaster mahery 0 5 0.00 % Crematogaster MG02 2 3 66.67 %

246

Species No. of Infected Total Surveyed % Infected Crematogaster MG03 0 5 0.00 % Crematogaster MG04 0 5 0.00 % Crematogaster ranavalonae 0 5 0.00 % Crematogaster rasoherinae 0 5 0.00 % Crematogaster sewellii 0 2 0.00 % Discothyrea MG01 0 1 0.00 % Discothyrea testacea 0 1 0.00 % Eutetramorium mocquerysi 0 31 0.00 % Formica fusca 0 3 0.00 % Formica lepida 2 2 100.00 % Formica neorufibarbis 0 1 0.00 % Formica subpolita 0 4 0.00 % Hypoponera DR01 1 11 9.09 % Hypoponera DR02 0 1 0.00 % Hypoponera DR03 0 2 0.00 % Hypoponera DRm01 0 10 0.00 % Hypoponera DRQ05 0 1 0.00 % Hypoponera indigens 0 15 0.00 % Hypoponera johannae 0 13 0.00 % Hypoponera KM03 0 1 0.00 % Hypoponera MG001 0 17 0.00 % Hypoponera MG002 0 10 0.00 % Hypoponera MG003 0 10 0.00 % Hypoponera MG004 0 12 0.00 % Hypoponera MG005 0 10 0.00 % Hypoponera MG006 0 5 0.00 % Hypoponera MG007 0 10 0.00 % Hypoponera MG008 0 10 0.00 % Hypoponera MG009 0 10 0.00 % Hypoponera MG010 0 10 0.00 % Hypoponera MG011 0 10 0.00 % Hypoponera MG012 0 4 0.00 % Hypoponera MG013 0 10 0.00 % Hypoponera MG014 0 10 0.00 % Hypoponera MG015 0 10 0.00 % Hypoponera MG016 2 18 11.11 % Hypoponera MG017 0 2 0.00 % Hypoponera MG018 0 3 0.00 % Hypoponera MG021 0 10 0.00 % Hypoponera MG025 0 20 0.00 % Hypoponera MG026 5 17 29.41 % Hypoponera MG027 0 18 0.00 %

247

Species No. of Infected Total Surveyed % Infected Hypoponera MG028 3 6 50.00 % Hypoponera MG029 0 1 0.00 % Hypoponera MG031 2 11 18.18 % Hypoponera MG032 0 5 0.00 % Hypoponera MG033 0 3 0.00 % Hypoponera MG034 0 2 0.00 % Hypoponera MG036 0 10 0.00 % Hypoponera MG038 0 49 0.00 % Hypoponera MG039 4 15 26.67 % Hypoponera MG040 1 11 9.09 % Hypoponera MG041 0 10 0.00 % Hypoponera MG042 0 10 0.00 % Hypoponera MG043 1 16 6.25 % Hypoponera MG044 1 10 10.00 % Hypoponera MG045 0 10 0.00 % Hypoponera MG046 2 10 20.00 % Hypoponera MG047 1 10 10.00 % Hypoponera MG048 1 10 10.00 % Hypoponera MG049 0 3 0.00 % Hypoponera MG050 0 3 0.00 % Hypoponera MG051 2 10 20.00 % Hypoponera MG052 0 10 0.00 % Hypoponera MG053 0 10 0.00 % Hypoponera MG054 0 10 0.00 % Hypoponera MG055 0 2 0.00 % Hypoponera MG056 0 12 0.00 % Hypoponera MG057 0 3 0.00 % Hypoponera MG058 0 10 0.00 % Hypoponera MG062 0 3 0.00 % Hypoponera MG063 0 4 0.00 % Hypoponera MG064 0 10 0.00 % Hypoponera MG065 0 10 0.00 % Hypoponera MG066 2 18 11.11 % Hypoponera MG067 0 25 0.00 % Hypoponera MG068 0 3 0.00 % Hypoponera MG069 0 1 0.00 % Hypoponera MG070 0 10 0.00 % Hypoponera MG071 0 35 0.00 % Hypoponera MG072 0 10 0.00 % Hypoponera MG073 0 10 0.00 % Hypoponera MG074 1 10 10.00 % Hypoponera MG075 0 12 0.00 %

248

Species No. of Infected Total Surveyed % Infected Hypoponera MG076 0 10 0.00 % Hypoponera MG077 0 10 0.00 % Hypoponera MG078 0 5 0.00 % Hypoponera MG079 0 11 0.00 % Hypoponera MG080 0 13 0.00 % Hypoponera MG081 0 10 0.00 % Hypoponera MG082 0 10 0.00 % Hypoponera MG083 0 5 0.00 % Hypoponera MG084 0 10 0.00 % Hypoponera MG085 0 3 0.00 % Hypoponera MG086 0 1 0.00 % Hypoponera MG087 0 10 0.00 % Hypoponera MG088 0 35 0.00 % Hypoponera MG089 0 10 0.00 % Hypoponera MG090 0 1 0.00 % Hypoponera MG091 0 1 0.00 % Hypoponera MG092 1 7 14.29 % Hypoponera MG093 0 1 0.00 % Hypoponera opaciceps 0 2 0.00 % Hypoponera opacior 2 4 50.00 % Hypoponera punctatissima 11 15 73.33 % Hypoponera sakalava 0 9 0.00 % Hypoponera YT01 0 1 0.00 % Lasius alienus 0 2 0.00 % Lepisiota canescens 8 10 80.00 % Lepisiota frauenfeldi 0 1 0.00 % Leptogenys acutirostris 2 4 50.00 % Leptogenys alluaudi 0 15 0.00 % Leptogenys angusta 30 48 62.50 % Leptogenys antongilensis 4 8 50.00 % Leptogenys arcirostris 3 15 20.00 % Leptogenys coerulescens 0 12 0.00 % Leptogenys DR01 0 1 0.00 % Leptogenys DRm01 0 10 0.00 % Leptogenys DRm02 3 10 30.00 % Leptogenys falcigera 3 20 15.00 % Leptogenys gracilis 3 6 50.00 % Leptogenys grandidieri 1 7 14.29 % Leptogenys incisa 0 2 0.00 % Leptogenys JCR01 3 14 21.43 % Leptogenys JCR02 0 3 0.00 % Leptogenys JCR03 0 7 0.00 %

249

Species No. of Infected Total Surveyed % Infected Leptogenys JCR04 0 5 0.00 % Leptogenys JCR05 0 2 0.00 % Leptogenys JCR06 1 2 50.00 % Leptogenys JCR07 0 3 0.00 % Leptogenys JCR08 1 2 50.00 % Leptogenys JCR10 2 2 100.00 % Leptogenys JCR11 0 1 0.00 % Leptogenys JCR12 0 1 0.00 % Leptogenys JCR13 0 2 0.00 % Leptogenys JCR14 0 10 0.00 % Leptogenys JCR15 0 4 0.00 % Leptogenys JCR16 0 4 0.00 % Leptogenys JCR17 0 10 0.00 % Leptogenys JCR18 0 2 0.00 % Leptogenys JCR19 0 1 0.00 % Leptogenys JCR20 0 10 0.00 % Leptogenys JCR21 0 24 0.00 % Leptogenys JCR22 0 32 0.00 % Leptogenys JCR23 4 48 8.33 % Leptogenys JCR24 4 23 17.39 % Leptogenys JCR25 13 36 36.11 % Leptogenys JCR26 1 5 20.00 % Leptogenys JCR27 0 4 0.00 % Leptogenys JCR29 12 29 41.38 % Leptogenys JCR30 0 1 0.00 % Leptogenys JCR31 2 13 15.38 % Leptogenys JCR33 1 1 100.00 % Leptogenys JCR34 1 1 100.00 % Leptogenys JCR39 0 12 0.00 % Leptogenys JCR42 0 2 0.00 % Leptogenys maxillosa 0 4 0.00 % Leptogenys MG01 1 1 100.00 % Leptogenys oswaldi 1 14 7.14 % Leptogenys pavesii 0 2 0.00 % Leptogenys ridens 6 11 54.55 % Leptogenys saussurei 1 10 10.00 % Leptogenys suarensis 0 7 0.00 % Leptogenys truncatirostris 1 32 3.13 % Leptogenys voeltzkowi 3 9 33.33 % Lophomyrmex TH01 1 2 50.00 % Melanaspis mga 2 6 33.33 % Melissotarsus insularis 8 18 44.44 %

250

Species No. of Infected Total Surveyed % Infected Meranoplus mayri 0 10 0.00 % Meranoplus radamae 5 10 50.00 % Monomorium ambvky_m01 0 1 0.00 % Monomorium ambvky_m02 0 1 0.00 % Monomorium ambvky_m03 1 1 100.00 % Monomorium bicolor_complex 0 9 0.00 % Monomorium bicolor_nr 0 2 0.00 % Monomorium bifidoclypeatum 1 3 33.33 % Monomorium chnodes 1 11 9.09 % Monomorium clarinode 0 10 0.00 % Monomorium cryptobium 0 9 0.00 % Monomorium destructor 0 18 0.00 % Monomorium DR02 2 3 66.67 % Monomorium DRm07b 0 3 0.00 % Monomorium DRm07c 0 1 0.00 % Monomorium DRm07d 2 2 100.00 % Monomorium DRQ02 1 4 25.00 % Monomorium DRQ06 0 2 0.00 % Monomorium DRw02 0 1 0.00 % Monomorium DRw03 0 3 0.00 % Monomorium exiguum 1 24 4.17 % Monomorium ferodens 0 10 0.00 % Monomorium fisheri 4 17 23.53 % Monomorium flavimembra 8 9 88.89 % Monomorium floricola 0 13 0.00 % Monomorium gongromos 3 10 30.00 % Monomorium hanneli 5 16 31.25 % Monomorium hildebrandti 2 17 11.76 % Monomorium hildebrandti_01 0 3 0.00 % Monomorium hildebrandti_02 8 13 61.54 % Monomorium infuscum 0 10 0.00 % Monomorium latinode 0 16 0.00 % Monomorium lepidum 0 1 0.00 % Monomorium madecassum 2 18 11.11 % Monomorium micrommaton 1 2 50.00 % Monomorium modestum 1 35 2.86 % Monomorium notorthotenes 0 10 0.00 % Monomorium pharaonis 0 10 0.00 % Monomorium platynode 0 1 0.00 % Monomorium robustior 0 9 0.00 % Monomorium sakalavum 0 1 0.00 % Monomorium sechellense 0 11 0.00 %

251

Species No. of Infected Total Surveyed % Infected Monomorium shuckardi 0 7 0.00 % Monomorium subopacum 0 10 0.00 % Monomorium termitobium 21 43 48.84 % Monomorium termitobium_02 0 14 0.00 % Monomorium termitobium_03 2 12 16.67 % Monomorium termitobium_04 2 4 50.00 % Monomorium termitobium_05 0 1 0.00 % Monomorium termitobium_06 0 1 0.00 % Monomorium versicolor 2 4 50.00 % Morganella conspicua 0 14 0.00 % Morganella mga 0 14 0.00 % Myrmicine_genus01 MG01 5 6 83.33 % Myrmicine_genus01 MG02 0 2 0.00 % Myrmicine_genus02 MG01 2 4 50.00 % Myrmicine_genus05 MG02 1 1 100.00 % Myrmicine_genus16 MG03 0 4 0.00 % Myrmicine_genus16 MG07 2 2 100.00 % Mystrium ambvky_m01 0 1 0.00 % Mystrium DR01 0 1 0.00 % Mystrium DRm01 0 1 0.00 % Mystrium DRm02 0 6 0.00 % Mystrium DRm05 0 1 0.00 % Mystrium MG01 0 24 0.00 % Mystrium MG05 0 9 0.00 % Mystrium MGm02 0 1 0.00 % Mystrium mysticum 0 173 0.00 % Mystrium mysticumDR02 0 3 0.00 % Mystrium oberthueri 1 25 4.00 % Mystrium rogeri 0 61 0.00 % Mystrium silvestrii 0 2 0.00 % Nesomyrmex angulatus 0 1 0.00 % Nesomyrmex beanka01 5 5 100.00 % Nesomyrmex beanka02 1 5 20.00 % Nesomyrmex beanka03 0 2 0.00 % Nesomyrmex beanka04 1 1 100.00 % Nesomyrmex beanka05 0 1 0.00 % Nesomyrmex DRm02 1 1 100.00 % Nesomyrmex DRQ01 2 2 100.00 % Nesomyrmex madecassus 9 10 90.00 % Nesomyrmex madecassus_01m 1 1 100.00 % Nesomyrmex MG01 0 1 0.00 % Nesomyrmex MG02 3 6 50.00 %

252

Species No. of Infected Total Surveyed % Infected Nesomyrmex MG04 7 19 36.84 % Nesomyrmex MG06 1 10 10.00 % Nesomyrmex MG07 0 1 0.00 % Nesomyrmex MG10 0 21 0.00 % Nesomyrmex MG11 0 2 0.00 % Nesomyrmex MG12 5 5 100.00 % Nesomyrmex MG13 0 5 0.00 % Nesomyrmex MG14 1 1 100.00 % Nesomyrmex MG18 0 3 0.00 % Nesomyrmex MG20 1 1 100.00 % Nesomyrmex MG26 0 1 0.00 % Nesomyrmex MG27 1 5 20.00 % Nesomyrmex retusispinosus 1 1 100.00 % Nesomyrmex sikorai 3 10 30.00 % Nylanderia amia 0 1 0.00 % Nylanderia beanka_m01 0 1 0.00 % Nylanderia beanka_m02 1 1 100.00 % Nylanderia beanka_m03 0 1 0.00 % Nylanderia beanka_m04 1 1 100.00 % Nylanderia beanka_m05 1 5 20.00 % Nylanderia beanka01 2 2 100.00 % Nylanderia beanka02 3 4 75.00 % Nylanderia bourbonica 1 17 5.88 % Nylanderia DRw01 2 2 100.00 % Nylanderia DRw04 0 1 0.00 % Nylanderia humbloti 5 5 100.00 % Nylanderia madagascarensis 0 25 0.00 % Nylanderia madagascarensis_DR0 6 16 37.50 % Nylanderia MG01 0 5 0.00 % Nylanderia MG03 2 5 40.00 % Nylanderia MG04 2 2 100.00 % Nylanderia MG05 0 1 0.00 % Nylanderia MG06 3 12 25.00 % Nylanderia MG07 4 7 57.14 % Nylanderia MG08 0 2 0.00 % Nylanderia MG09 4 5 80.00 % Nylanderia MG10 2 3 66.67 % Nylanderia mixta 0 1 0.00 % Nylanderia ogasawarensis 0 1 0.00 % Nylanderia vividula_cf01 0 1 0.00 % Ochetellus glaber 0 2 0.00 % Odontomachus coquereli 1 14 7.14 %

253

Species No. of Infected Total Surveyed % Infected Odontomachus simillimus 10 10 100.00 % Odontomachus troglodytes 15 20 75.00 % Pachycondyla ambigua 0 31 0.00 % Pachycondyla cambouei 1 47 2.13 % Pachycondyla comorensis 0 3 0.00 % Pachycondyla darwinii madecass 0 1 0.00 % Pachycondyla DR01 0 1 0.00 % Pachycondyla DR02 0 1 0.00 % Pachycondyla DR03 0 10 0.00 % Pachycondyla DRm09 0 1 0.00 % Pachycondyla DRQ01 0 4 0.00 % Pachycondyla JCR01 0 2 0.00 % Pachycondyla JCR02 0 2 0.00 % Pachycondyla JCR05 0 11 0.00 % Pachycondyla JCR07 0 3 0.00 % Pachycondyla JCR09 0 2 0.00 % Pachycondyla JCR10 0 7 0.00 % Pachycondyla JCR20 0 2 0.00 % Pachycondyla melanaria 0 15 0.00 % Pachycondyla perroti 2 9 22.22 % Pachycondyla sikorae 0 10 0.00 % Pachycondyla wasmannii 6 34 17.65 % Paraparatrechina glabra 1 2 50.00 % Paratrechina longicornis 6 20 30.00 % Pheidole ambvk_m01 0 5 0.00 % Pheidole ambvk_m02 0 1 0.00 % Pheidole ambvky_s08 0 2 0.00 % Pheidole ambvky_s09 0 2 0.00 % Pheidole ambvky_s10 0 3 0.00 % Pheidole annemariae 2 20 10.00 % Pheidole beanka_m01 0 5 0.00 % Pheidole beanka_Q01 0 5 0.00 % Pheidole beanka_Q02 0 3 0.00 % Pheidole beanka_Q03 0 5 0.00 % Pheidole beanka_s01 0 1 0.00 % Pheidole beanka_s02 0 1 0.00 % Pheidole beanka_s03 0 5 0.00 % Pheidole beanka_s04 0 1 0.00 % Pheidole beanka_s05 0 1 0.00 % Pheidole beanka04 2 5 40.00 % Pheidole bessonii 1 30 3.33 % Pheidole bessonii_02 0 2 0.00 %

254

Species No. of Infected Total Surveyed % Infected Pheidole californica 5 36 13.89 % Pheidole clementensis 1 1 100.00 % Pheidole creightoni 7 10 70.00 % Pheidole DRm04 0 1 0.00 % Pheidole DRw12 0 5 0.00 % Pheidole DRw13 0 5 0.00 % Pheidole DRw15 0 1 0.00 % Pheidole ensifera 0 10 0.00 % Pheidole flavens farquharensis 0 10 0.00 % Pheidole grallatrix 0 28 0.00 % Pheidole longispinosa 0 20 0.00 % Pheidole longispinosa scabrata 1 3 33.33 % Pheidole lucida 1 5 20.00 % Pheidole madecassa 1 1 100.00 % Pheidole megacephala 1 65 1.54 % Pheidole megacephala_beanka01 0 5 0.00 % Pheidole megacephala_beanka02 0 2 0.00 % Pheidole MG001 1 20 5.00 % Pheidole MG002 0 2 0.00 % Pheidole MG003 0 2 0.00 % Pheidole MG004 0 16 0.00 % Pheidole MG005 0 3 0.00 % Pheidole MG006 0 4 0.00 % Pheidole MG007 2 12 16.67 % Pheidole MG008 0 5 0.00 % Pheidole MG009 0 14 0.00 % Pheidole MG010 0 16 0.00 % Pheidole MG011 0 10 0.00 % Pheidole MG012 0 10 0.00 % Pheidole MG013 0 10 0.00 % Pheidole MG014 0 11 0.00 % Pheidole MG015 9 20 45.00 % Pheidole MG016 0 10 0.00 % Pheidole MG017 0 6 0.00 % Pheidole MG018 4 15 26.67 % Pheidole MG019 0 10 0.00 % Pheidole MG020 0 10 0.00 % Pheidole MG021 0 10 0.00 % Pheidole MG022 0 10 0.00 % Pheidole MG023 0 1 0.00 % Pheidole MG024 0 11 0.00 % Pheidole MG025 0 10 0.00 %

255

Species No. of Infected Total Surveyed % Infected Pheidole MG026 0 2 0.00 % Pheidole MG029 0 10 0.00 % Pheidole MG032 0 3 0.00 % Pheidole MG046 3 5 60.00 % Pheidole MG051 1 4 25.00 % Pheidole MG052 3 3 100.00 % Pheidole MG055 0 1 0.00 % Pheidole MG059 0 4 0.00 % Pheidole MG071 0 6 0.00 % Pheidole MG072 0 2 0.00 % Pheidole MG073 0 10 0.00 % Pheidole MG074 0 23 0.00 % Pheidole MG075 0 10 0.00 % Pheidole MG076 1 5 20.00 % Pheidole MG077 0 15 0.00 % Pheidole MG078 1 14 7.14 % Pheidole MG079 0 10 0.00 % Pheidole MG080 0 10 0.00 % Pheidole MG081 1 15 6.67 % Pheidole MG094 0 2 0.00 % Pheidole MG106 0 4 0.00 % Pheidole MG107 0 2 0.00 % Pheidole MG109 0 10 0.00 % Pheidole MG110 0 3 0.00 % Pheidole MG111 0 5 0.00 % Pheidole MG112 0 10 0.00 % Pheidole MG116 0 1 0.00 % Pheidole MG117 0 15 0.00 % Pheidole MG118 0 14 0.00 % Pheidole MG119 0 10 0.00 % Pheidole MG120 0 10 0.00 % Pheidole MG121 0 18 0.00 % Pheidole MG122 0 1 0.00 % Pheidole MG126 1 14 7.14 % Pheidole MG128 0 5 0.00 % Pheidole MG129 0 5 0.00 % Pheidole MG134 0 7 0.00 % Pheidole MG135 0 1 0.00 % Pheidole MG145 10 40 25.00 % Pheidole MG146 1 15 6.67 % Pheidole MG147 0 17 0.00 % Pheidole MG148 1 16 6.25 %

256

Species No. of Infected Total Surveyed % Infected Pheidole MG150 10 29 34.48 % Pheidole MG151 8 36 22.22 % Pheidole MG152 0 2 0.00 % Pheidole MG153 0 5 0.00 % Pheidole MG154 2 19 10.53 % Pheidole MG155 0 14 0.00 % Pheidole MG156 0 10 0.00 % Pheidole MG157 2 10 20.00 % Pheidole MG158 0 17 0.00 % Pheidole MG159 0 10 0.00 % Pheidole MG160 0 1 0.00 % Pheidole MG161 0 1 0.00 % Pheidole MGs002 0 5 0.00 % Pheidole MGs006 0 1 0.00 % Pheidole MGs011 0 9 0.00 % Pheidole MGs014 0 1 0.00 % Pheidole MGs027 0 1 0.00 % Pheidole MGs040 0 1 0.00 % Pheidole MGs043 0 3 0.00 % Pheidole MGs044 0 10 0.00 % Pheidole MGs045 0 10 0.00 % Pheidole MGs046 2 15 13.33 % Pheidole MGs047 0 10 0.00 % Pheidole MGs048 0 10 0.00 % Pheidole MGs049 0 1 0.00 % Pheidole MGs050 0 1 0.00 % Pheidole MGs051 0 10 0.00 % Pheidole MGs052 0 1 0.00 % Pheidole MGs053 0 10 0.00 % Pheidole MGs054 0 4 0.00 % Pheidole MGs055 0 4 0.00 % Pheidole MGs056 0 10 0.00 % Pheidole MGs057 0 3 0.00 % Pheidole MGs058 0 5 0.00 % Pheidole MGs059 0 1 0.00 % Pheidole MGs060 4 10 40.00 % Pheidole MGs061 0 4 0.00 % Pheidole MGs063 0 4 0.00 % Pheidole MGs064 0 14 0.00 % Pheidole MGs065 0 10 0.00 % Pheidole MGs066 0 10 0.00 % Pheidole MGs067 0 10 0.00 %

257

Species No. of Infected Total Surveyed % Infected Pheidole MGs068 0 10 0.00 % Pheidole MGs070 1 10 10.00 % Pheidole MGs071 0 3 0.00 % Pheidole MGs072 0 1 0.00 % Pheidole MGs073 0 10 0.00 % Pheidole MGs075 0 10 0.00 % Pheidole MGs076 0 15 0.00 % Pheidole MGs077 1 19 5.26 % Pheidole MGs078 0 3 0.00 % Pheidole MGs079 0 10 0.00 % Pheidole MGs082 0 5 0.00 % Pheidole MGs083 0 3 0.00 % Pheidole MGs084 0 4 0.00 % Pheidole MGs085 0 10 0.00 % Pheidole MGs086 0 2 0.00 % Pheidole MGs087 2 3 66.67 % Pheidole MGs088 0 5 0.00 % Pheidole MGs089 3 5 60.00 % Pheidole MGs090 0 1 0.00 % Pheidole MGs092 0 10 0.00 % Pheidole MGs093 1 1 100.00 % Pheidole MGs094 0 10 0.00 % Pheidole MGs095 0 10 0.00 % Pheidole MGs096 0 2 0.00 % Pheidole MGs097 0 14 0.00 % Pheidole MGs098 0 3 0.00 % Pheidole MGs099 0 1 0.00 % Pheidole MGs100 0 10 0.00 % Pheidole MGs101 0 1 0.00 % Pheidole MGs102 0 5 0.00 % Pheidole MGs104 0 4 0.00 % Pheidole MGs106 0 5 0.00 % Pheidole MGs107 0 8 0.00 % Pheidole MGs108 0 2 0.00 % Pheidole MGs109 0 1 0.00 % Pheidole MGs110 0 1 0.00 % Pheidole MGs120 5 19 26.32 % Pheidole MGs121 0 7 0.00 % Pheidole MGs122 7 26 26.92 % Pheidole MGs123 4 10 40.00 % Pheidole MGs124 1 3 33.33 % Pheidole MGs125 2 3 66.67 %

258

Species No. of Infected Total Surveyed % Infected Pheidole MGs126 0 10 0.00 % Pheidole MGs127 0 1 0.00 % Pheidole MGs128 8 14 57.14 % Pheidole MGs129 6 12 50.00 % Pheidole MGs130 4 10 40.00 % Pheidole MGs131 1 10 10.00 % Pheidole MGs132 0 10 0.00 % Pheidole micula 0 1 0.00 % Pheidole nemoralis 0 35 0.00 % Pheidole oswaldi 0 30 0.00 % Pheidole paiute 1 1 100.00 % Pheidole SC01 0 15 0.00 % Pheidole sikorae litigiosa 0 10 0.00 % Pheidole veteratrix 0 10 0.00 % Pheidole voeltzkowii 0 33 0.00 % Pheidole voeltzkowii_03 0 2 0.00 % Pheidole YT01 0 2 0.00 % Pilotrochus besmerus 0 1 0.00 % Plagiolepis alluaudi 18 38 47.37 % Plagiolepis madecassa 2 12 16.67 % Plagiolepis MG01 1 6 16.67 % Plagiolepis MG05 2 16 12.50 % Platythyrea arthuri 2 11 18.18 % Platythyrea bicuspis 0 9 0.00 % Platythyrea DR01 0 9 0.00 % Platythyrea DR02 0 18 0.00 % Platythyrea DR03 0 1 0.00 % Platythyrea MG01 0 1 0.00 % Platythyrea mocquerysi 0 29 0.00 % Pogonomyrmex AR01 1 1 100.00 % Pogonomyrmex atratus 0 1 0.00 % Pogonomyrmex brevibarbis 0 1 0.00 % Pogonomyrmex naegelii 0 1 0.00 % Pogonomyrmex pronotalis 0 1 0.00 % Pogonomyrmex vermiculatus_cf 0 1 0.00 % Ponera exotica 1 35 2.86 % Ponera MG01 0 12 0.00 % Ponera SC01 1 5 20.00 % Prionopelta MG01 8 10 80.00 % Prionopelta MG03 0 2 0.00 % Prionopelta SC01 0 10 0.00 % Proceratium ambvky_m01 1 1 100.00 %

259

Species No. of Infected Total Surveyed % Infected Proceratium DRm02 0 1 0.00 % Proceratium MG02 2 5 40.00 % Proceratium MG03 0 3 0.00 % Proceratium MG14 0 1 0.00 % Proceratium MGm02 1 1 100.00 % Proceratium SC02 0 1 0.00 % Pyramica ambatrix 7 20 35.00 % Pyramica DR01 0 11 0.00 % Pyramica erynnes 16 18 88.89 % Pyramica khakaura 0 4 0.00 % Pyramica ludovici 12 24 50.00 % Pyramica mandibularis 8 22 36.36 % Pyramica membranifera 0 10 0.00 % Pyramica MG02 0 9 0.00 % Pyramica olsoni 0 4 0.00 % Pyramica serket 0 3 0.00 % Pyramica seti 0 4 0.00 % Pyramica symmetrix 0 6 0.00 % Pyramica victrix 0 10 0.00 % Simopone nonnihil 0 2 0.00 % Simopone rex 0 1 0.00 % Solenopsis geminata 0 26 0.00 % Solenopsis mameti 7 10 70.00 % Strumigenys abdera 2 10 20.00 % Strumigenys actis 11 27 40.74 % Strumigenys admixta 0 10 0.00 % Strumigenys agra 0 1 0.00 % Strumigenys alapa 0 1 0.00 % Strumigenys alperti 0 11 0.00 % Strumigenys ambvky_m01 0 1 0.00 % Strumigenys ambvky_m02 1 1 100.00 % Strumigenys ambvky_m03 0 1 0.00 % Strumigenys ambvky_m04 1 1 100.00 % Strumigenys ampyx 10 31 32.26 % Strumigenys apios 3 11 27.27 % Strumigenys balux 1 5 20.00 % Strumigenys bathron 0 10 0.00 % Strumigenys bibiolona 2 12 16.67 % Strumigenys bola 3 3 100.00 % Strumigenys cabira 0 10 0.00 % Strumigenys carisa 0 10 0.00 % Strumigenys carolinae 0 10 0.00 %

260

Species No. of Infected Total Surveyed % Infected Strumigenys charino 0 3 0.00 % Strumigenys chilo 6 29 20.69 % Strumigenys chilo_01 0 2 0.00 % Strumigenys chroa 6 10 60.00 % Strumigenys coveri 2 20 10.00 % Strumigenys covina 6 10 60.00 % Strumigenys deverra 2 10 20.00 % Strumigenys dexis 0 10 0.00 % Strumigenys dicomas 12 32 37.50 % Strumigenys diota 0 4 0.00 % Strumigenys diux 0 14 0.00 % Strumigenys dora 0 10 0.00 % Strumigenys DR01 0 10 0.00 % Strumigenys DR03 0 3 0.00 % Strumigenys DRm01 2 7 28.57 % Strumigenys DRm04 0 4 0.00 % Strumigenys DRQ02 0 1 0.00 % Strumigenys epulo 0 8 0.00 % Strumigenys epulo_01 0 1 0.00 % Strumigenys epulo_02 0 2 0.00 % Strumigenys europs 4 8 50.00 % Strumigenys fanano 0 18 0.00 % Strumigenys fronto 0 10 0.00 % Strumigenys glycon 0 10 0.00 % Strumigenys grandidieri 0 25 0.00 % Strumigenys inatos 0 20 0.00 % Strumigenys labaris 0 25 0.00 % Strumigenys levana 0 21 0.00 % Strumigenys lexex 1 12 8.33 % Strumigenys livens 0 10 0.00 % Strumigenys luca 1 22 4.55 % Strumigenys lucomo 3 25 12.00 % Strumigenys lura 0 15 0.00 % Strumigenys lutron 0 10 0.00 % Strumigenys lysis 1 10 10.00 % Strumigenys manga 0 10 0.00 % Strumigenys MG01 0 10 0.00 % Strumigenys MG01_gorgon_nr 0 1 0.00 % Strumigenys MG02 0 4 0.00 % Strumigenys MG03 0 4 0.00 % Strumigenys MG075 0 10 0.00 % Strumigenys MG08 0 5 0.00 %

261

Species No. of Infected Total Surveyed % Infected Strumigenys micrans 0 1 0.00 % Strumigenys milae 0 4 0.00 % Strumigenys mola 0 3 0.00 % Strumigenys nambao 0 4 0.00 % Strumigenys norax 1 2 50.00 % Strumigenys origo 0 19 0.00 % Strumigenys peyrierasi 0 2 0.00 % Strumigenys rabesoni 0 10 0.00 % Strumigenys rogeri 0 9 0.00 % Strumigenys scotti 0 15 0.00 % Strumigenys sphera 1 14 7.14 % Strumigenys sphera_cf3 0 1 0.00 % Strumigenys sylvaini 1 17 5.88 % Strumigenys tegar 2 8 25.00 % Strumigenys vazimba 12 36 33.33 % Strumigenys wardi 0 21 0.00 % Strumigenys YT01 0 1 0.00 % Tapinolepis MG05 0 1 0.00 % Tapinoma melanocephalum 13 26 50.00 % Tapinoma MG01 2 5 40.00 % Tapinoma MG02 9 10 90.00 % Tapinoma MG03 9 12 75.00 % Tapinoma MG04 0 9 0.00 % Tapinoma MG05 4 15 26.67 % Tapinoma MG06 1 4 25.00 % Tapinoma MG10 0 3 0.00 % Tapinoma MG11 0 3 0.00 % Tapinoma sp. Mad-05 0 2 0.00 % Tapinoma subtile 3 26 11.54 % Technomyrmex albipes 15 35 42.86 % Technomyrmex ambvky_m01 0 2 0.00 % Technomyrmex anterops 1 2 50.00 % Technomyrmex curiosus 0 6 0.00 % Technomyrmex curiosus_01 0 3 0.00 % Technomyrmex difficilis 11 28 39.29 % Technomyrmex difficilis_01 3 15 20.00 % Technomyrmex difficilis_02 0 1 0.00 % Technomyrmex docens 1 3 33.33 % Technomyrmex DRm01 0 2 0.00 % Technomyrmex fisheri 3 5 60.00 % Technomyrmex fisheri_01 0 1 0.00 % Technomyrmex innocens 1 4 25.00 %

262

Species No. of Infected Total Surveyed % Infected Technomyrmex madecassus 3 34 8.82 % Technomyrmex mayri 1 8 12.50 % Technomyrmex pallipes 1 9 11.11 % Technomyrmex vitiensis 1 9 11.11 % Technomyrmex voeltzkowi 0 1 0.00 % Terataner acanthus 0 5 0.00 % Terataner alluaudi 0 10 0.00 % Terataner beanka01 0 3 0.00 % Terataner DR01 0 1 0.00 % Terataner DRw01 0 1 0.00 % Terataner foreli 0 8 0.00 % Terataner MG01 1 9 11.11 % Terataner MG02 0 9 0.00 % Terataner MG03 0 3 0.00 % Terataner MG04 0 9 0.00 % Terataner MG08 0 1 0.00 % Terataner MG09 1 2 50.00 % Terataner MG11 9 20 45.00 % Terataner MG14 0 13 0.00 % Terataner MG24 0 7 0.00 % Terataner rufipes 0 3 0.00 % Terataner steinheili 0 2 0.00 % Terataner xaltus 0 16 0.00 % Tetramorium ambatovy 0 11 0.00 % Tetramorium andrei 0 20 0.00 % Tetramorium australimum 0 1 0.00 % Tetramorium beanka_m01 0 1 0.00 % Tetramorium bessonii 0 27 0.00 % Tetramorium bicarinatum 2 29 6.90 % Tetramorium bonibony 0 1 0.00 % Tetramorium caldarium 0 4 0.00 % Tetramorium cognatum 3 24 12.50 % Tetramorium coillum 2 13 15.38 % Tetramorium delagoense 0 43 0.00 % Tetramorium DRm05 0 2 0.00 % Tetramorium DRQ01 0 2 0.00 % Tetramorium DRQ03 0 4 0.00 % Tetramorium dysalum 0 36 0.00 % Tetramorium echinatum 0 22 0.00 % Tetramorium electrum 0 23 0.00 % Tetramorium fulgidum 0 10 0.00 % Tetramorium hispidum 0 1 0.00 %

263

Species No. of Infected Total Surveyed % Infected Tetramorium humbloti 0 21 0.00 % Tetramorium ibycterum 1 1 100.00 % Tetramorium incertum 0 14 0.00 % Tetramorium isectum 1 10 10.00 % Tetramorium kali 0 9 0.00 % Tetramorium kelleri 0 25 0.00 % Tetramorium lanuginosum 0 32 0.00 % Tetramorium latreillei 1 10 10.00 % Tetramorium macki 0 1 0.00 % Tetramorium mahafaly 0 10 0.00 % Tetramorium malagasy 0 14 0.00 % Tetramorium marginatum 0 19 0.00 % Tetramorium MG01_delagoense_n 0 11 0.00 % Tetramorium MG013 0 1 0.00 % Tetramorium MG014 0 1 0.00 % Tetramorium MG016 0 1 0.00 % Tetramorium MG02_delagoense_n 0 6 0.00 % Tetramorium MG027 0 3 0.00 % Tetramorium MG029 0 1 0.00 % Tetramorium MG031 0 10 0.00 % Tetramorium MG032 0 3 0.00 % Tetramorium MG035 3 11 27.27 % Tetramorium MG036 1 12 8.33 % Tetramorium MG037 3 10 30.00 % Tetramorium MG038 0 6 0.00 % Tetramorium MG039 2 10 20.00 % Tetramorium MG040 1 10 10.00 % Tetramorium MG041 0 10 0.00 % Tetramorium MG042 1 10 10.00 % Tetramorium MG044 1 4 25.00 % Tetramorium MG046 0 10 0.00 % Tetramorium MG047 3 10 30.00 % Tetramorium MG048 0 1 0.00 % Tetramorium MG049 0 3 0.00 % Tetramorium MG050 0 1 0.00 % Tetramorium MG052 1 9 11.11 % Tetramorium MG052b 1 1 100.00 % Tetramorium MG053 1 10 10.00 % Tetramorium MG055 0 1 0.00 % Tetramorium MG063 0 2 0.00 % Tetramorium MG074 0 5 0.00 % Tetramorium MG075 0 3 0.00 %

264

Species No. of Infected Total Surveyed % Infected Tetramorium MG076 0 10 0.00 % Tetramorium MG078 0 3 0.00 % Tetramorium MG082 0 15 0.00 % Tetramorium MG083 0 10 0.00 % Tetramorium MG084 0 10 0.00 % Tetramorium MG085 0 5 0.00 % Tetramorium MG086 0 10 0.00 % Tetramorium MG087 0 16 0.00 % Tetramorium MG088 1 20 5.00 % Tetramorium MG089 4 10 40.00 % Tetramorium MG090 0 2 0.00 % Tetramorium MG091 0 3 0.00 % Tetramorium MG092 0 8 0.00 % Tetramorium MG093 2 10 20.00 % Tetramorium MG094 0 5 0.00 % Tetramorium MG095 0 1 0.00 % Tetramorium MG101 0 1 0.00 % Tetramorium MG103 7 13 53.85 % Tetramorium MG108 0 6 0.00 % Tetramorium MG109 0 10 0.00 % Tetramorium MG110 0 10 0.00 % Tetramorium MG111 5 23 21.74 % Tetramorium MG112 2 7 28.57 % Tetramorium MG117 0 2 0.00 % Tetramorium MG118 2 18 11.11 % Tetramorium MG119 2 17 11.76 % Tetramorium MG120 2 10 20.00 % Tetramorium MG121 8 28 28.57 % Tetramorium MG122 3 15 20.00 % Tetramorium MG125 3 5 60.00 % Tetramorium MG126 0 4 0.00 % Tetramorium MG127 0 2 0.00 % Tetramorium MG128 0 2 0.00 % Tetramorium MG130 0 2 0.00 % Tetramorium MG131 0 5 0.00 % Tetramorium MG132 0 5 0.00 % Tetramorium MG133 0 1 0.00 % Tetramorium MG134 3 5 60.00 % Tetramorium MG135 4 5 80.00 % Tetramorium MG137 0 5 0.00 % Tetramorium MG140 0 4 0.00 % Tetramorium MG141 0 3 0.00 %

265

Species No. of Infected Total Surveyed % Infected Tetramorium MG142 1 5 20.00 % Tetramorium MG143 0 1 0.00 % Tetramorium MG144 0 1 0.00 % Tetramorium MG146 0 2 0.00 % Tetramorium MG150 0 1 0.00 % Tetramorium MG151 0 2 0.00 % Tetramorium naganum 0 10 0.00 % Tetramorium nigriflavum 0 4 0.00 % Tetramorium norvigi 3 20 15.00 % Tetramorium olana 0 5 0.00 % Tetramorium pleganon 0 18 0.00 % Tetramorium plesiarum 3 26 11.54 % Tetramorium popell 0 11 0.00 % Tetramorium proximum 4 21 19.05 % Tetramorium quasirum 3 32 9.38 % Tetramorium ranarum 1 1 100.00 % Tetramorium robotika 0 10 0.00 % Tetramorium robustior 4 22 18.18 % Tetramorium ryanphelanae 0 1 0.00 % Tetramorium sargina 0 2 0.00 % Tetramorium schaufussii_gp02 0 2 0.00 % Tetramorium scytalum 0 26 0.00 % Tetramorium sericeiventre 0 59 0.00 % Tetramorium severini 0 17 0.00 % Tetramorium shamshir 0 10 0.00 % Tetramorium silvicolum 0 10 0.00 % Tetramorium simillimum 0 51 0.00 % Tetramorium steinheili 0 6 0.00 % Tetramorium tantillum 0 9 0.00 % Tetramorium tosii 0 25 0.00 % Tetramorium tuberculatum 0 5 0.00 % Tetramorium wardi 0 8 0.00 % Tetramorium zenatum 1 27 3.70 % Tetraponera beanka_m01 0 1 0.00 % Tetraponera beanka_Q01 0 1 0.00 % Tetraponera beanka01 0 4 0.00 % Tetraponera beanka02 0 5 0.00 % Tetraponera beanka03 0 5 0.00 % Tetraponera beanka04 0 2 0.00 % Tetraponera beanka05 0 5 0.00 % Tetraponera beanka06 1 3 33.33 % Tetraponera beanka07 0 1 0.00 %

266

Species No. of Infected Total Surveyed % Infected Tetraponera beanka08 0 5 0.00 % Tetraponera DR01 0 3 0.00 % Tetraponera DR02 2 7 28.57 % Tetraponera DR03 0 1 0.00 % Tetraponera DR04 0 1 0.00 % Tetraponera DR05 0 1 0.00 % Tetraponera DR06 1 1 100.00 % Tetraponera DR07 0 1 0.00 % Tetraponera DR08 0 1 0.00 % Tetraponera DR09 1 1 100.00 % Tetraponera DRQ02 1 5 20.00 % Tetraponera grandidieri 1 12 8.33 % Tetraponera grandidieri_01 1 1 100.00 % Tetraponera hespera 0 1 0.00 % Tetraponera inermis 0 1 0.00 % Tetraponera manangotra 5 5 100.00 % Tetraponera merita 7 13 53.85 % Tetraponera MG01 0 5 0.00 % Tetraponera MG02 1 34 2.94 % Tetraponera MG03 0 5 0.00 % Tetraponera MG04 5 5 100.00 % Tetraponera MG05 0 1 0.00 % Tetraponera MG06 0 3 0.00 % Tetraponera MG07 0 2 0.00 % Tetraponera MG17 6 6 100.00 % Tetraponera MG18 0 11 0.00 % Tetraponera MG19 1 4 25.00 % Tetraponera PSW084 0 1 0.00 %

267

Appendix S6 Chapter 3- Comparison of “PCR” and “Sequence” Rules for Detection of Wolbachia Infection

Table S6.1- Comparison of Wolbachia infection frequency in subfamilies using “PCR” (PCR) and “sequence” (SEQ) rules. Infection estimates under the “PCR” rule were on average 2.71 % higher compared to the “sequence” rule.

Subfamily No. of Infected No. of Infected Total % Infected % Infected (PCR) (SEQ) Surveyed (PCR) (SEQ) Amblyoponinae 14 13 575 2.43 % 2.26 % Cerapachyinae 63 58 152 41.45 % 38.16 % Dolichoderinae 82 68 287 28.57 % 23.69 % Formicinae 372 355 1796 20.71 % 19.77 % Myrmicinae 726 675 5581 13.01 % 12.09 % Ponerinae 211 185 1990 10.60 % 9.30 % Proceratiinae 4 3 22 18.18 % 13.64 % Pseudomyrmecinae 43 32 195 22.05 % 16.41 %

268

Table S6.2- Comparison of Wolbachia infection frequency in genera using “PCR” (PCR) and “sequence” (SEQ) rules. Infection estimates under the “PCR” rule were equivalent in 18/42 genera, or on average 2.68 % higher than the “sequence” rule.

Genus No. of Infected No. of Infected Total % Infected % Infected (PCR) (SEQ) Surveyed (PCR) (SEQ) Adelomyrmex 1 1 2 50.00 % 50.00 % Amblyopone 3 3 126 2.38 % 2.38 % Amblyoponine_genus1 1 1 43 2.33 % 2.33 % Anochetus 22 20 139 15.83 % 14.39 % Aphaenogaster 45 41 78 57.69 % 52.56 % Camponotus 260 254 1432 18.16 % 17.74 % Cardiocondyla 15 14 90 16.67 % 15.56 % Carebara 4 3 22 18.18 % 13.64 % Cataulacus 65 62 93 69.89 % 66.67 % Cerapachys 62 58 143 43.36 % 40.56 % Crematogaster 42 41 270 15.56 % 15.19 % Formica 2 2 10 20.00 % 20.00 % Hypoponera 43 38 915 4.70 % 4.15 % Lepisiota 8 8 13 61.54 % 61.54 % Leptogenys 107 96 564 18.97 % 17.02 % Lophomyrmex 1 1 2 50.00 % 50.00 % Melissotarsus 8 8 18 44.44 % 44.44 % Meranoplus 5 5 20 25.00 % 25.00 % Monomorium 71 68 444 15.99 % 15.32 % Myrmicine_genus01 5 5 8 62.50 % 62.50 % Myrmicine_genus16 2 2 9 22.22 % 22.22 % Nesomyrmex 43 38 131 32.82 % 29.01 % Nylanderia 71 61 190 37.37 % 32.11 % Odontomachus 26 25 44 59.09 % 56.82 % Pachycondyla 9 2 198 4.55 % 1.01 % Paraparatrechina 1 1 2 50.00 % 50.00 % Paratrechina 6 6 20 30.00 % 30.00 % Pheidole 141 133 1774 7.95 % 7.50 % Plagiolepis 24 23 75 32.00 % 30.67 % Platythyrea 2 2 78 2.56 % 2.56 % Pogonomyrmex 1 1 6 16.67 % 16.67 % Ponera 2 2 52 3.85 % 3.85 % Prionopelta 9 9 23 39.13 % 39.13 % Proceratium 4 3 20 20.00 % 15.00 % Pyramica 43 43 145 29.66 % 29.66 % Solenopsis 7 7 36 19.44 % 19.44 % Strumigenys 105 93 834 12.59 % 11.15 % Tapinoma 41 32 116 35.34 % 27.59 %

269

Genus No. of Infected No. of Infected Total % Infected % Infected (PCR) (SEQ) Surveyed (PCR) (SEQ) Technomyrmex 41 36 169 24.26 % 21.30 % Terataner 19 16 137 13.87 % 11.68 % Tetramorium 100 93 1423 7.03 % 6.54 % Tetraponera 43 32 195 22.05 % 16.41 %

270

Table S6.3- Comparison of Wolbachia infection frequency in species using “PCR” (PCR) and “sequence” (SEQ) rules. Infection estimates under the “PCR” rule were equivalent in 299/346 species, or on average 18.01 % higher than the “sequence” rule.

Species No. of No. of Total % % Infected Infected Surveyed Infected Infected (PCR) (SEQ) (PCR) (SEQ) Adelomyrmex SC02 1 1 1 100.00 % 100.00 % Amblyopone ambvky_m03 2 2 3 66.67 % 66.67 % Amblyopone MGm04 1 1 6 16.67 % 16.67 % Amblyoponine_genus1 MG01 1 1 16 6.25 % 6.25 % Anochetus grandidieri 18 18 41 43.90 % 43.90 % Anochetus madagascarensis 3 2 84 3.57 % 2.38 % Aphaenogaster swammerdami 45 41 69 65.22 % 59.42 % Camponotus butteli 5 5 9 55.56 % 55.56 % Camponotus christi 45 45 83 54.21 % 54.21 % Camponotus christi_01 2 1 3 66.67 % 33.33 % Camponotus christi_02 4 2 4 100.00 % 50.00 % Camponotus concolor 3 3 12 25.00 % 25.00 % Camponotus dromedarius 4 4 7 57.14 % 57.14 % Camponotus dufouri 4 4 36 11.11 % 11.11 % Camponotus gerberti 1 1 1 100.00 % 100.00 % Camponotus gibber 5 5 10 50.00 % 50.00 % Camponotus grandidieri 1 1 59 1.69 % 1.69 % Camponotus heteroclitus 19 19 30 63.33 % 63.33 % Camponotus hildebrandti 3 3 4 75.00 % 75.00 % Camponotus hova 3 3 9 33.33 % 33.33 % Camponotus MG002 1 1 37 2.70 % 2.70 % Camponotus MG003 5 5 10 50.00 % 50.00 % Camponotus MG004 8 8 10 80.00 % 80.00 % Camponotus mg005 23 23 71 32.39 % 32.39 % Camponotus MG008 4 4 4 100.00 % 100.00 % Camponotus MG014 9 9 10 90.00 % 90.00 % Camponotus MG015 2 1 5 40.00 % 20.00 % Camponotus MG017 3 3 3 100.00 % 100.00 % Camponotus MG018 5 5 16 31.25 % 31.25 % Camponotus MG019 1 1 3 33.33 % 33.33 % Camponotus MG022 1 1 1 100.00 % 100.00 % Camponotus MG023 12 12 19 63.16 % 63.16 % Camponotus MG024 4 4 6 66.67 % 66.67 % Camponotus MG026 6 6 10 60.00 % 60.00 % Camponotus MG03_maculatus_nr 1 1 1 100.00 % 100.00 % Camponotus MG030 1 1 2 50.00 % 50.00 % Camponotus MG035 8 8 15 53.33 % 53.33 %

271

Species No. of No. of Total % % Infected Infected Surveyed Infected Infected (PCR) (SEQ) (PCR) (SEQ) Camponotus MG039 8 8 26 30.77 % 30.77 % Camponotus MG040 4 4 9 44.44 % 44.44 % Camponotus MG041 2 2 2 100.00 % 100.00 % Camponotus MG043 2 2 3 66.67 % 66.67 % Camponotus MG046 1 1 19 5.26 % 5.26 % Camponotus MG047 2 2 15 13.33 % 13.33 % Camponotus MG048 2 2 11 18.18 % 18.18 % Camponotus MG049 4 4 11 36.36 % 36.36 % Camponotus MG053 4 4 70 5.71 % 5.71 % Camponotus MG054 2 1 30 6.67 % 3.33 % Camponotus MG078 3 3 8 37.50 % 37.50 % Camponotus MG088 3 3 15 20.00 % 20.00 % Camponotus MG089 2 2 8 25.00 % 25.00 % Camponotus MG096 3 3 16 18.75 % 18.75 % Camponotus MG101 1 1 26 3.85 % 3.85 % Camponotus MG111 7 7 9 77.78 % 77.78 % Camponotus MG112 1 1 1 100.00 % 100.00 % Camponotus MG119 4 4 4 100.00 % 100.00 % Camponotus MG120 5 4 5 100.00 % 80.00 % Camponotus MG121 1 1 10 10.00 % 10.00 % Camponotus pictipes 4 4 7 57.14 % 57.14 % Camponotus roeseli 1 1 10 10.00 % 10.00 % Cardiocondyla beanka_Q01 1 1 1 100.00 % 100.00 % Cardiocondyla emeryi 2 1 21 9.52 % 4.76 % Cardiocondyla wroughtonii 12 12 19 63.16 % 63.16 % Carebara beanka_m01 1 1 4 25.00 % 25.00 % Carebara DRm01 2 1 3 66.67 % 33.33 % Carebara DRm02 1 1 1 100.00 % 100.00 % Cataulacus ebrardi 3 2 15 20.00 % 13.33 % Cataulacus oberthueri 4 4 4 100.00 % 100.00 % Cataulacus porcatus 51 49 63 80.95 % 77.78 % Cataulacus regularis 3 3 7 42.86 % 42.86 % Cataulacus wasmanni 4 4 4 100.00 % 100.00 % Cerapachys beanka_m02 1 1 1 100.00 % 100.00 % Cerapachys beanka_m03 1 1 1 100.00 % 100.00 % Cerapachys L_MG04 1 1 1 100.00 % 100.00 % Cerapachys L_MG05 2 2 5 40.00 % 40.00 % Cerapachys L_MG11 4 3 5 80.00 % 60.00 % Cerapachys P_DR03 1 1 1 100.00 % 100.00 % Cerapachys P_DR04 1 1 1 100.00 % 100.00 %

272

Species No. of No. of Total % % Infected Infected Surveyed Infected Infected (PCR) (SEQ) (PCR) (SEQ) Cerapachys P_MG01 1 1 1 100.00 % 100.00 % Cerapachys P_MG02 12 12 12 100.00 % 100.00 % Cerapachys P_MG06 5 4 10 50.00 % 40.00 % Cerapachys P_MG07 2 2 2 100.00 % 100.00 % Cerapachys P_MG11 1 1 1 100.00 % 100.00 % Cerapachys prey01 5 5 5 100.00 % 100.00 % Cerapachys prey02 3 3 3 100.00 % 100.00 % Cerapachys prey03 3 3 4 75.00 % 75.00 % Cerapachys prey04 5 5 5 100.00 % 100.00 % Cerapachys prey05 1 1 1 100.00 % 100.00 % Cerapachys prey06 1 1 1 100.00 % 100.00 % Crematogaster BBB35 2 2 3 66.67 % 66.67 % Crematogaster BBB55 25 24 36 69.44 % 66.67 % Crematogaster DRw11 1 1 1 100.00 % 100.00 % Crematogaster DRw16 1 1 1 100.00 % 100.00 % Crematogaster grevei 5 5 7 71.43 % 71.43 % Crematogaster hova-complex_m1 2 2 3 66.67 % 66.67 % Crematogaster MG02 2 2 3 66.67 % 66.67 % Formica lepida 2 2 2 100.00 % 100.00 % Hypoponera DR01 1 1 11 9.09 % 9.09 % Hypoponera MG016 2 2 18 11.11 % 11.11 % Hypoponera MG026 5 4 17 29.41 % 23.53 % Hypoponera MG028 3 3 6 50.00 % 50.00 % Hypoponera MG031 2 2 11 18.18 % 18.18 % Hypoponera MG039 4 3 15 26.67 % 20.00 % Hypoponera MG040 1 1 11 9.09 % 9.09 % Hypoponera MG044 1 1 10 10.00 % 10.00 % Hypoponera MG046 2 2 10 20.00 % 20.00 % Hypoponera MG047 1 1 10 10.00 % 10.00 % Hypoponera MG048 1 1 10 10.00 % 10.00 % Hypoponera MG051 2 1 10 20.00 % 10.00 % Hypoponera MG066 2 2 18 11.11 % 11.11 % Hypoponera MG092 1 1 7 14.29 % 14.29 % Hypoponera opacior 2 2 4 50.00 % 50.00 % Hypoponera punctatissima 11 11 15 73.33 % 73.33 % Lepisiota canescens 8 8 10 80.00 % 80.00 % Leptogenys acutirostris 2 2 4 50.00 % 50.00 % Leptogenys angusta 30 26 48 62.50 % 54.17 % Leptogenys antongilensis 4 4 8 50.00 % 50.00 % Leptogenys arcirostris 3 3 15 20.00 % 20.00 %

273

Species No. of No. of Total % % Infected Infected Surveyed Infected Infected (PCR) (SEQ) (PCR) (SEQ) Leptogenys falcigera 3 3 20 15.00 % 15.00 % Leptogenys gracilis 3 3 6 50.00 % 50.00 % Leptogenys grandidieri 1 1 7 14.29 % 14.29 % Leptogenys JCR01 3 3 14 21.43 % 21.43 % Leptogenys JCR06 1 1 2 50.00 % 50.00 % Leptogenys JCR08 1 1 2 50.00 % 50.00 % Leptogenys JCR10 2 2 2 100.00 % 100.00 % Leptogenys JCR23 4 4 48 8.33 % 8.33 % Leptogenys JCR24 4 4 23 17.39 % 17.39 % Leptogenys JCR25 13 11 36 36.11 % 30.56 % Leptogenys JCR26 1 1 5 20.00 % 20.00 % Leptogenys JCR29 12 12 29 41.38 % 41.38 % Leptogenys JCR31 2 2 13 15.38 % 15.38 % Leptogenys JCR33 1 1 1 100.00 % 100.00 % Leptogenys JCR34 1 1 1 100.00 % 100.00 % Leptogenys MG01 1 1 1 100.00 % 100.00 % Leptogenys oswaldi 1 1 14 7.14 % 7.14 % Leptogenys ridens 6 6 11 54.55 % 54.55 % Leptogenys saussurei 1 1 10 10.00 % 10.00 % Leptogenys truncatirostris 1 1 32 3.13 % 3.13 % Leptogenys voeltzkowi 3 1 9 33.33 % 11.11 % Lophomyrmex TH01 1 1 2 50.00 % 50.00 % Melissotarsus insularis 8 8 18 44.44 % 44.44 % Meranoplus radamae 5 5 10 50.00 % 50.00 % Monomorium ambvky_m03 1 1 1 100.00 % 100.00 % Monomorium bifidoclypeatum 1 1 3 33.33 % 33.33 % Monomorium chnodes 1 1 11 9.09 % 9.09 % Monomorium DR02 2 1 3 66.67 % 33.33 % Monomorium DRm07d 2 2 2 100.00 % 100.00 % Monomorium DRQ02 1 1 4 25.00 % 25.00 % Monomorium exiguum 1 1 24 4.17 % 4.17 % Monomorium fisheri 4 4 17 23.53 % 23.53 % Monomorium flavimembra 8 7 9 88.89 % 77.78 % Monomorium gongromos 3 3 10 30.00 % 30.00 % Monomorium hanneli 5 5 16 31.25 % 31.25 % Monomorium hildebrandti 2 2 17 11.76 % 11.76 % Monomorium hildebrandti_02 8 8 13 61.54 % 61.54 % Monomorium madecassum 2 2 18 11.11 % 11.11 % Monomorium micrommaton 1 1 2 50.00 % 50.00 % Monomorium modestum 1 1 35 2.86 % 2.86 %

274

Species No. of No. of Total % % Infected Infected Surveyed Infected Infected (PCR) (SEQ) (PCR) (SEQ) Monomorium termitobium 21 21 43 48.84 % 48.84 % Monomorium termitobium_03 2 2 12 16.67 % 16.67 % Monomorium termitobium_04 2 2 4 50.00 % 50.00 % Monomorium versicolor 2 1 4 50.00 % 25.00 % Myrmicine_genus01 MG01 5 5 6 83.33 % 83.33 % Myrmicine_genus16 MG07 2 2 2 100.00 % 100.00 % Nesomyrmex beanka01 5 5 5 100.00 % 100.00 % Nesomyrmex beanka02 1 1 5 20.00 % 20.00 % Nesomyrmex beanka04 1 1 1 100.00 % 100.00 % Nesomyrmex DRm02 1 1 1 100.00 % 100.00 % Nesomyrmex DRQ01 2 2 2 100.00 % 100.00 % Nesomyrmex madecassus 9 9 10 90.00 % 90.00 % Nesomyrmex MG04 7 7 19 36.84 % 36.84 % Nesomyrmex MG06 1 1 10 10.00 % 10.00 % Nesomyrmex MG12 5 5 5 100.00 % 100.00 % Nesomyrmex MG14 1 1 1 100.00 % 100.00 % Nesomyrmex MG27 1 1 5 20.00 % 20.00 % Nesomyrmex retusispinosus 1 1 1 100.00 % 100.00 % Nesomyrmex sikorai 3 3 10 30.00 % 30.00 % Nylanderia beanka_m02 1 1 1 100.00 % 100.00 % Nylanderia beanka_m04 1 1 1 100.00 % 100.00 % Nylanderia beanka_m05 1 1 5 20.00 % 20.00 % Nylanderia beanka01 2 2 2 100.00 % 100.00 % Nylanderia beanka02 3 3 4 75.00 % 75.00 % Nylanderia bourbonica 1 1 17 5.88 % 5.88 % Nylanderia DRw01 2 2 2 100.00 % 100.00 % Nylanderia humbloti 5 4 5 100.00 % 80.00 % Nylanderia madagascarensis_DR0 6 1 16 37.50 % 6.25 % Nylanderia MG03 2 2 5 40.00 % 40.00 % Nylanderia MG04 2 2 2 100.00 % 100.00 % Nylanderia MG06 3 3 12 25.00 % 25.00 % Nylanderia MG07 4 1 7 57.14 % 14.29 % Nylanderia MG09 4 4 5 80.00 % 80.00 % Nylanderia MG10 2 2 3 66.67 % 66.67 % Odontomachus simillimus 10 10 10 100.00 % 100.00 % Odontomachus troglodytes 15 15 20 75.00 % 75.00 % Pachycondyla perroti 2 2 9 22.22 % 22.22 % Paraparatrechina glabra 1 1 2 50.00 % 50.00 % Paratrechina longicornis 6 6 20 30.00 % 30.00 % Pheidole annemariae 2 2 20 10.00 % 10.00 %

275

Species No. of No. of Total % % Infected Infected Surveyed Infected Infected (PCR) (SEQ) (PCR) (SEQ) Pheidole beanka04 2 2 5 40.00 % 40.00 % Pheidole bessonii 1 1 30 3.33 % 3.33 % Pheidole californica 5 5 36 13.89 % 13.89 % Pheidole clementensis 1 1 1 100.00 % 100.00 % Pheidole creightoni 7 7 10 70.00 % 70.00 % Pheidole longispinosa scabrata 1 1 3 33.33 % 33.33 % Pheidole lucida 1 1 5 20.00 % 20.00 % Pheidole madecassa 1 1 1 100.00 % 100.00 % Pheidole megacephala 1 1 65 1.54 % 1.54 % Pheidole MG001 1 1 20 5.00 % 5.00 % Pheidole MG007 2 2 12 16.67 % 16.67 % Pheidole MG015 9 9 20 45.00 % 45.00 % Pheidole MG018 4 4 15 26.67 % 26.67 % Pheidole MG046 3 3 5 60.00 % 60.00 % Pheidole MG051 1 1 4 25.00 % 25.00 % Pheidole MG052 3 3 3 100.00 % 100.00 % Pheidole MG078 1 1 14 7.14 % 7.14 % Pheidole MG081 1 1 15 6.67 % 6.67 % Pheidole MG126 1 1 14 7.14 % 7.14 % Pheidole MG145 10 6 40 25.00 % 15.00 % Pheidole MG146 1 1 15 6.67 % 6.67 % Pheidole MG148 1 1 16 6.25 % 6.25 % Pheidole MG150 10 9 29 34.48 % 31.03 % Pheidole MG151 8 7 36 22.22 % 19.44 % Pheidole MG154 2 2 19 10.53 % 10.53 % Pheidole MG157 2 2 10 20.00 % 20.00 % Pheidole MGs046 2 2 15 13.33 % 13.33 % Pheidole MGs060 4 4 10 40.00 % 40.00 % Pheidole MGs077 1 1 19 5.26 % 5.26 % Pheidole MGs087 2 2 3 66.67 % 66.67 % Pheidole MGs089 3 3 5 60.00 % 60.00 % Pheidole MGs093 1 1 1 100.00 % 100.00 % Pheidole MGs120 5 5 19 26.32 % 26.32 % Pheidole MGs122 7 7 26 26.92 % 26.92 % Pheidole MGs123 4 4 10 40.00 % 40.00 % Pheidole MGs124 1 1 3 33.33 % 33.33 % Pheidole MGs125 2 2 3 66.67 % 66.67 % Pheidole MGs128 8 8 14 57.14 % 57.14 % Pheidole MGs129 6 5 12 50.00 % 41.67 % Pheidole MGs130 4 4 10 40.00 % 40.00 %

276

Species No. of No. of Total % % Infected Infected Surveyed Infected Infected (PCR) (SEQ) (PCR) (SEQ) Pheidole MGs131 1 1 10 10.00 % 10.00 % Pheidole paiute 1 1 1 100.00 % 100.00 % Plagiolepis alluaudi 18 17 38 47.37 % 44.74 % Plagiolepis madecassa 2 2 12 16.67 % 16.67 % Plagiolepis MG01 1 1 6 16.67 % 16.67 % Plagiolepis MG05 2 2 16 12.50 % 12.50 % Platythyrea arthuri 2 2 11 18.18 % 18.18 % Pogonomyrmex AR01 1 1 1 100.00 % 100.00 % Ponera exotica 1 1 35 2.86 % 2.86 % Ponera SC01 1 1 5 20.00 % 20.00 % Prionopelta MG01 8 8 10 80.00 % 80.00 % Proceratium ambvky_m01 1 1 1 100.00 % 100.00 % Proceratium MG02 2 1 5 40.00 % 20.00 % Proceratium MGm02 1 1 1 100.00 % 100.00 % Pyramica ambatrix 7 7 20 35.00 % 35.00 % Pyramica erynnes 16 16 18 88.89 % 88.89 % Pyramica ludovici 12 12 24 50.00 % 50.00 % Pyramica mandibularis 8 8 22 36.36 % 36.36 % Solenopsis mameti 7 7 10 70.00 % 70.00 % Strumigenys abdera 2 2 10 20.00 % 20.00 % Strumigenys actis 11 11 27 40.74 % 40.74 % Strumigenys ambvky_m02 1 1 1 100.00 % 100.00 % Strumigenys ampyx 10 10 31 32.26 % 32.26 % Strumigenys apios 3 3 11 27.27 % 27.27 % Strumigenys bibiolona 2 2 12 16.67 % 16.67 % Strumigenys bola 3 3 3 100.00 % 100.00 % Strumigenys chilo 6 5 29 20.69 % 17.24 % Strumigenys chroa 6 4 10 60.00 % 40.00 % Strumigenys coveri 2 2 20 10.00 % 10.00 % Strumigenys covina 6 6 10 60.00 % 60.00 % Strumigenys deverra 2 2 10 20.00 % 20.00 % Strumigenys dicomas 12 12 32 37.50 % 37.50 % Strumigenys DRm01 2 1 7 28.57 % 14.29 % Strumigenys europs 4 2 8 50.00 % 25.00 % Strumigenys lexex 1 1 12 8.33 % 8.33 % Strumigenys luca 1 1 22 4.55 % 4.55 % Strumigenys lucomo 3 3 25 12.00 % 12.00 % Strumigenys lysis 1 1 10 10.00 % 10.00 % Strumigenys norax 1 1 2 50.00 % 50.00 % Strumigenys sphera 1 1 14 7.14 % 7.14 %

277

Species No. of No. of Total % % Infected Infected Surveyed Infected Infected (PCR) (SEQ) (PCR) (SEQ) Strumigenys vazimba 12 11 36 33.33 % 30.56 % Tapinoma melanocephalum 13 13 26 50.00 % 50.00 % Tapinoma MG01 2 1 5 40.00 % 20.00 % Tapinoma MG02 9 2 10 90.00 % 20.00 % Tapinoma MG03 9 8 12 75.00 % 66.67 % Tapinoma MG05 4 4 15 26.67 % 26.67 % Tapinoma MG06 1 1 4 25.00 % 25.00 % Tapinoma subtile 3 3 26 11.54 % 11.54 % Technomyrmex albipes 15 14 35 42.86 % 40.00 % Technomyrmex anterops 1 1 2 50.00 % 50.00 % Technomyrmex difficilis 11 10 28 39.29 % 35.71 % Technomyrmex docens 1 1 3 33.33 % 33.33 % Technomyrmex fisheri 3 3 5 60.00 % 60.00 % Technomyrmex innocens 1 1 4 25.00 % 25.00 % Technomyrmex madecassus 3 3 34 8.82 % 8.82 % Technomyrmex mayri 1 1 8 12.50 % 12.50 % Technomyrmex pallipes 1 1 9 11.11 % 11.11 % Technomyrmex vitiensis 1 1 9 11.11 % 11.11 % Terataner MG01 1 1 9 11.11 % 11.11 % Terataner MG09 1 1 2 50.00 % 50.00 % Terataner MG11 9 6 20 45.00 % 30.00 % Tetramorium bicarinatum 2 2 29 6.90 % 6.90 % Tetramorium cognatum 3 3 24 12.50 % 12.50 % Tetramorium coillum 2 2 13 15.38 % 15.38 % Tetramorium ibycterum 1 1 1 100.00 % 100.00 % Tetramorium isectum 1 1 10 10.00 % 10.00 % Tetramorium latreillei 1 1 10 10.00 % 10.00 % Tetramorium MG035 3 3 11 27.27 % 27.27 % Tetramorium MG036 1 1 12 8.33 % 8.33 % Tetramorium MG037 3 3 10 30.00 % 30.00 % Tetramorium MG039 2 2 10 20.00 % 20.00 % Tetramorium MG040 1 1 10 10.00 % 10.00 % Tetramorium MG042 1 1 10 10.00 % 10.00 % Tetramorium MG047 3 3 10 30.00 % 30.00 % Tetramorium MG052 1 1 9 11.11 % 11.11 % Tetramorium MG052b 1 1 1 100.00 % 100.00 % Tetramorium MG053 1 1 10 10.00 % 10.00 % Tetramorium MG088 1 1 20 5.00 % 5.00 % Tetramorium MG089 4 4 10 40.00 % 40.00 % Tetramorium MG093 2 2 10 20.00 % 20.00 %

278

Species No. of No. of Total % % Infected Infected Surveyed Infected Infected (PCR) (SEQ) (PCR) (SEQ) Tetramorium MG103 7 7 13 53.85 % 53.85 % Tetramorium MG111 5 5 23 21.74 % 21.74 % Tetramorium MG112 2 2 7 28.57 % 28.57 % Tetramorium MG118 2 2 18 11.11 % 11.11 % Tetramorium MG119 2 2 17 11.76 % 11.76 % Tetramorium MG120 2 2 10 20.00 % 20.00 % Tetramorium MG121 8 7 28 28.57 % 25.00 % Tetramorium MG122 3 3 15 20.00 % 20.00 % Tetramorium MG125 3 2 5 60.00 % 40.00 % Tetramorium MG134 3 3 5 60.00 % 60.00 % Tetramorium MG135 4 4 5 80.00 % 80.00 % Tetramorium MG142 1 1 5 20.00 % 20.00 % Tetramorium norvigi 3 3 20 15.00 % 15.00 % Tetramorium proximum 4 4 21 19.05 % 19.05 % Tetramorium quasirum 3 3 32 9.38 % 9.38 % Tetramorium ranarum 1 1 1 100.00 % 100.00 % Tetramorium robustior 4 4 22 18.18 % 18.18 % Tetraponera beanka06 1 1 3 33.33 % 33.33 % Tetraponera DR02 2 2 7 28.57 % 28.57 % Tetraponera DR06 1 1 1 100.00 % 100.00 % Tetraponera DR09 1 1 1 100.00 % 100.00 % Tetraponera DRQ02 1 1 5 20.00 % 20.00 % Tetraponera grandidieri 1 1 12 8.33 % 8.33 % Tetraponera grandidieri_01 1 1 1 100.00 % 100.00 % Tetraponera manangotra 5 1 5 100.00 % 20.00 % Tetraponera merita 7 5 13 53.85 % 38.46 % Tetraponera MG02 1 1 34 2.94 % 2.94 % Tetraponera MG04 5 5 5 100.00 % 100.00 % Tetraponera MG17 6 2 6 100.00 % 33.33 %

279

Appendix S7 Chapter 3- coxA and hcpA Allele Identifications

Table S7.1- List of identified coxA and hcpA alleles for species infected with Wolbachia. Allele 2 and allele 6 were the most common coxA alleles, while the remaining 19 identified alleles each made up fewer than 4 % of the distribution. Allele 127, allele 47 and allele 7 were the most common hcpA alleles, while the remaining 20 alleles each made up fewer than 5 % of the distribution. Only full sequences without ambiguous base pairs could be identified. Alleles were identified using the Wolbachia MLST database (http://pubmlst.org/Wolbachia/) (Baldo et al. 2006; Jolley et al. 2004). (NS= not successfully sequenced) (NI= could not be identified through the MLST database).

Process ID Species coxA allele hcpA allele ASFTA361-12 Wolbachia sp. Anochetus grandidieri allele 6 NI ASFTA658-12 Wolbachia sp. Anochetus grandidieri allele 50 NI ASFTA659-12 Wolbachia sp. Anochetus grandidieri allele 2 NI ASFTA660-12 Wolbachia sp. Anochetus grandidieri allele 50 NI ASFTA662-12 Wolbachia sp. Anochetus grandidieri allele 50 NI ASFTA665-12 Wolbachia sp. Anochetus grandidieri allele 6 allele 7 ASFTA666-12 Wolbachia sp. Anochetus grandidieri allele 6 NS ASFTA669-12 Wolbachia sp. Anochetus grandidieri allele 50 NS ASFTA678-12 Wolbachia sp. Anochetus grandidieri allele 6 NI ASFTA1408-12 Wolbachia sp. Aphaenogaster swammerdami allele 2 NI ASFTA1409-12 Wolbachia sp. Aphaenogaster swammerdami allele 2 NI ASFTA1410-12 Wolbachia sp. Aphaenogaster swammerdami allele 2 allele 127 ASFTA1421-12 Wolbachia sp. Aphaenogaster swammerdami NS allele 127 ASFTA1426-12 Wolbachia sp. Aphaenogaster swammerdami allele 2 NS ASFTA1427-12 Wolbachia sp. Aphaenogaster swammerdami NS allele 127 ASFTA186-12 Wolbachia sp. Aphaenogaster swammerdami NI allele 47 ASFTA196-12 Wolbachia sp. Aphaenogaster swammerdami NI allele 47 ASFTA200-12 Wolbachia sp. Aphaenogaster swammerdami NI allele 47 ASFTA204-12 Wolbachia sp. Aphaenogaster swammerdami NS allele 47 ASFTA217-12 Wolbachia sp. Aphaenogaster swammerdami NI allele 47 ASFTA231-12 Wolbachia sp. Aphaenogaster swammerdami NI allele 47 ASFTA343-12 Wolbachia sp. Aphaenogaster swammerdami NS allele 47 ASFTA408-12 Wolbachia sp. Aphaenogaster swammerdami NS allele 47 ASFTA410-12 Wolbachia sp. Aphaenogaster swammerdami NS allele 47 ASFTA411-12 Wolbachia sp. Aphaenogaster swammerdami NI allele 47 ASFTA412-12 Wolbachia sp. Aphaenogaster swammerdami NI allele 47 ASFTA494-12 Wolbachia sp. Aphaenogaster swammerdami NS allele 127 ASFTA495-12 Wolbachia sp. Aphaenogaster swammerdami allele 2 allele 127

280

Process ID Species coxA allele hcpA allele ASFTA734-12 Wolbachia sp. Aphaenogaster swammerdami NS allele 47 ASFTA735-12 Wolbachia sp. Aphaenogaster swammerdami allele 2 NS ASFTA736-12 Wolbachia sp. Aphaenogaster swammerdami allele 2 allele 127 ASFTA737-12 Wolbachia sp. Aphaenogaster swammerdami NS allele 127 ASFTA738-12 Wolbachia sp. Aphaenogaster swammerdami NS allele 47 ASFTA740-12 Wolbachia sp. Aphaenogaster swammerdami allele 2 allele 127 ASFTA741-12 Wolbachia sp. Aphaenogaster swammerdami NI allele 127 ASFTA744-12 Wolbachia sp. Aphaenogaster swammerdami NI allele 127 ASFTA745-12 Wolbachia sp. Aphaenogaster swammerdami allele 2 allele 127 ASFTA746-12 Wolbachia sp. Aphaenogaster swammerdami allele 2 allele 127 ASFTA748-12 Wolbachia sp. Aphaenogaster swammerdami NS allele 47 ASFTA749-12 Wolbachia sp. Aphaenogaster swammerdami NI allele 127 ASFTA750-12 Wolbachia sp. Aphaenogaster swammerdami allele 2 allele 127 ASFTA752-12 Wolbachia sp. Aphaenogaster swammerdami allele 2 NI ASFTA754-12 Wolbachia sp. Aphaenogaster swammerdami NS allele 127 ASFTA756-12 Wolbachia sp. Aphaenogaster swammerdami NS allele 127 ASFTA760-12 Wolbachia sp. Aphaenogaster swammerdami NS allele 127 ASFTA761-12 Wolbachia sp. Aphaenogaster swammerdami allele 2 NI ASFTA1318-12 Wolbachia sp. Camponotus butteli NS allele 127 ASFTA1320-12 Wolbachia sp. Camponotus butteli NI allele 127 ASFTA1072-12 Wolbachia sp. Camponotus christi NI allele 47 ASFTA417-12 Wolbachia sp. Camponotus christi NS allele 127 ASFTA1034-12 Wolbachia sp. Camponotus christi ferrugineus allele 2 NS ASFTA1035-12 Wolbachia sp. Camponotus christi ferrugineus allele 2 NS ASFTA1036-12 Wolbachia sp. Camponotus christi ferrugineus allele 2 allele 127 ASFTA1041-12 Wolbachia sp. Camponotus christi ferrugineus allele 2 NS ASFTA1049-12 Wolbachia sp. Camponotus christi ferrugineus allele 2 NS ASFTA1050-12 Wolbachia sp. Camponotus christi ferrugineus allele 2 NS ASFTA1051-12 Wolbachia sp. Camponotus christi ferrugineus allele 2 NS ASFTA1052-12 Wolbachia sp. Camponotus christi ferrugineus allele 2 allele 127 ASFTA1053-12 Wolbachia sp. Camponotus christi ferrugineus allele 2 NS ASFTA1064-12 Wolbachia sp. Camponotus christi ferrugineus allele 2 NI ASFTA1033-12 Wolbachia sp. Camponotus christi foersteri allele 2 allele 127 ASFTA1037-12 Wolbachia sp. Camponotus christi foersteri NI allele 127 ASFTA1045-12 Wolbachia sp. Camponotus christi foersteri allele 2 NS ASFTA1056-12 Wolbachia sp. Camponotus christi foersteri allele 2 NI ASFTA1067-12 Wolbachia sp. Camponotus christi foersteri allele 2 NI ASFTA1069-12 Wolbachia sp. Camponotus christi foersteri allele 2 NI ASFTA1071-12 Wolbachia sp. Camponotus christi foersteri allele 2 NI ASFTA1102-12 Wolbachia sp. Camponotus christi foersteri allele 2 allele 127

281

Process ID Species coxA allele hcpA allele ASFTA1103-12 Wolbachia sp. Camponotus christi foersteri allele 2 allele 127 ASFTA1105-12 Wolbachia sp. Camponotus christi foersteri allele 2 allele 127 ASFTA1138-12 Wolbachia sp. Camponotus christi foersteri allele 2 NI ASFTA1143-12 Wolbachia sp. Camponotus christi foersteri allele 2 allele 127 ASFTA1144-12 Wolbachia sp. Camponotus christi foersteri allele 2 NI ASFTA1580-12 Wolbachia sp. Camponotus christi foersteri allele 2 allele 127 ASFTA1581-12 Wolbachia sp. Camponotus christi foersteri allele 2 allele 127 ASFTA1589-12 Wolbachia sp. Camponotus christi foersteri allele 2 allele 127 ASFTA1590-12 Wolbachia sp. Camponotus christi foersteri allele 2 NI ASFTA1601-12 Wolbachia sp. Camponotus christi foersteri allele 2 NI ASFTA1602-12 Wolbachia sp. Camponotus christi foersteri allele 2 allele 127 ASFTA1603-12 Wolbachia sp. Camponotus christi foersteri allele 2 allele 127 ASFTA1604-12 Wolbachia sp. Camponotus christi foersteri allele 2 allele 127 ASFTA463-12 Wolbachia sp. Camponotus christi foersteri allele 2 allele 127 ASFTA213-12 Wolbachia sp. Camponotus christi_01 allele 2 NS ASFTA222-12 Wolbachia sp. Camponotus christi_02 NS allele 127 ASFTA1337-12 Wolbachia sp. Camponotus dufouri allele 2 allele 127 ASFTA1338-12 Wolbachia sp. Camponotus dufouri allele 2 allele 127 ASFTA1363-12 Wolbachia sp. Camponotus dufouri NS allele 127 ASFTA413-12 Wolbachia sp. Camponotus dufouri NS allele 127 ASFTA1093-12 Wolbachia sp. Camponotus gerberti allele 2 NS ASFTA1302-12 Wolbachia sp. Camponotus gibber NI allele 127 ASFTA1330-12 Wolbachia sp. Camponotus gibber NS allele 127 ASFTA1331-12 Wolbachia sp. Camponotus gibber NI allele 127 ASFTA1335-12 Wolbachia sp. Camponotus gibber NS allele 127 ASFTA1600-12 Wolbachia sp. Camponotus grandidieri allele 6 NS ASFTA1048-12 Wolbachia sp. Camponotus heteroclitus allele 2 allele 127 ASFTA1073-12 Wolbachia sp. Camponotus heteroclitus allele 2 allele 47 ASFTA1115-12 Wolbachia sp. Camponotus heteroclitus allele 2 NI ASFTA1116-12 Wolbachia sp. Camponotus heteroclitus allele 2 NI ASFTA1286-12 Wolbachia sp. Camponotus heteroclitus allele 2 NI ASFTA1290-12 Wolbachia sp. Camponotus heteroclitus NI allele 127 ASFTA1298-12 Wolbachia sp. Camponotus heteroclitus NI allele 127 ASFTA1299-12 Wolbachia sp. Camponotus heteroclitus NI allele 47 ASFTA1303-12 Wolbachia sp. Camponotus heteroclitus NI allele 47 ASFTA1323-12 Wolbachia sp. Camponotus heteroclitus NI allele 127 ASFTA1339-12 Wolbachia sp. Camponotus heteroclitus allele 2 allele 47 ASFTA1591-12 Wolbachia sp. Camponotus heteroclitus allele 2 allele 47 ASFTA1592-12 Wolbachia sp. Camponotus heteroclitus allele 2 allele 47 ASFTA1593-12 Wolbachia sp. Camponotus heteroclitus allele 2 allele 127

282

Process ID Species coxA allele hcpA allele ASFTA1594-12 Wolbachia sp. Camponotus heteroclitus allele 2 allele 47 ASFTA1595-12 Wolbachia sp. Camponotus heteroclitus allele 2 NI ASFTA1596-12 Wolbachia sp. Camponotus heteroclitus allele 2 allele 127 ASFTA1597-12 Wolbachia sp. Camponotus heteroclitus allele 2 allele 127 ASFTA1598-12 Wolbachia sp. Camponotus heteroclitus allele 2 allele 127 ASFTA414-12 Wolbachia sp. Camponotus hildebrandti NI allele 127 ASFTA415-12 Wolbachia sp. Camponotus hildebrandti NS allele 127 ASFTA418-12 Wolbachia sp. Camponotus hildebrandti NS allele 127 ASFTA952-12 Wolbachia sp. Camponotus hova allele 2 allele 127 ASFTA1304-12 Wolbachia sp. Camponotus MG002 NI allele 127 ASFTA1312-12 Wolbachia sp. Camponotus MG003 NI allele 127 ASFTA1313-12 Wolbachia sp. Camponotus MG003 NI allele 127 ASFTA1315-12 Wolbachia sp. Camponotus MG003 NI allele 127 ASFTA1316-12 Wolbachia sp. Camponotus MG003 allele 2 allele 127 ASFTA1293-12 Wolbachia sp. Camponotus MG004 NS allele 47 ASFTA1305-12 Wolbachia sp. Camponotus MG004 NS allele 47 ASFTA1307-12 Wolbachia sp. Camponotus MG004 NI allele 47 ASFTA1309-12 Wolbachia sp. Camponotus MG004 allele 2 NI ASFTA1326-12 Wolbachia sp. Camponotus MG004 allele 2 NI ASFTA1025-12 Wolbachia sp. Camponotus MG005 NI allele 127 ASFTA1026-12 Wolbachia sp. Camponotus MG005 NI allele 127 ASFTA1028-12 Wolbachia sp. Camponotus MG005 allele 2 allele 127 ASFTA1029-12 Wolbachia sp. Camponotus MG005 NI allele 127 ASFTA1059-12 Wolbachia sp. Camponotus MG005 NI allele 127 ASFTA1060-12 Wolbachia sp. Camponotus MG005 allele 2 allele 127 ASFTA1068-12 Wolbachia sp. Camponotus MG005 NI allele 127 ASFTA1092-12 Wolbachia sp. Camponotus MG005 allele 2 NI ASFTA1094-12 Wolbachia sp. Camponotus MG005 allele 2 allele 127 ASFTA1095-12 Wolbachia sp. Camponotus MG005 allele 2 allele 127 ASFTA1096-12 Wolbachia sp. Camponotus MG005 allele 2 allele 127 ASFTA1097-12 Wolbachia sp. Camponotus MG005 allele 2 NI ASFTA1582-12 Wolbachia sp. Camponotus MG005 allele 2 allele 127 ASFTA1583-12 Wolbachia sp. Camponotus MG005 allele 2 allele 127 ASFTA1584-12 Wolbachia sp. Camponotus MG005 allele 2 allele 127 ASFTA1585-12 Wolbachia sp. Camponotus MG005 allele 2 allele 127 ASFTA1599-12 Wolbachia sp. Camponotus MG005 allele 2 allele 127 ASFTA1607-12 Wolbachia sp. Camponotus MG005 allele 2 NS ASFTA203-12 Wolbachia sp. Camponotus MG005 NI allele 127 ASFTA229-12 Wolbachia sp. Camponotus MG005 allele 2 allele 127 ASFTA1121-12 Wolbachia sp. Camponotus MG008 NI allele 127

283

Process ID Species coxA allele hcpA allele ASFTA1122-12 Wolbachia sp. Camponotus MG008 NI allele 127 ASFTA1123-12 Wolbachia sp. Camponotus MG008 NI allele 127 ASFTA192-12 Wolbachia sp. Camponotus MG008 NI allele 127 ASFTA1292-12 Wolbachia sp. Camponotus MG014 NS allele 127 ASFTA1136-12 Wolbachia sp. Camponotus MG017 NI allele 127 ASFTA1137-12 Wolbachia sp. Camponotus MG017 NI allele 127 ASFTA1030-12 Wolbachia sp. Camponotus MG023 allele 2 allele 127 ASFTA1031-12 Wolbachia sp. Camponotus MG023 allele 2 allele 127 ASFTA1110-12 Wolbachia sp. Camponotus MG023 allele 2 NI ASFTA1112-12 Wolbachia sp. Camponotus MG023 allele 2 allele 127 ASFTA1113-12 Wolbachia sp. Camponotus MG023 allele 2 allele 127 ASFTA1132-12 Wolbachia sp. Camponotus MG023 NI allele 127 ASFTA1134-12 Wolbachia sp. Camponotus MG023 NI allele 127 ASFTA1042-12 Wolbachia sp. Camponotus MG024 allele 2 allele 127 ASFTA1047-12 Wolbachia sp. Camponotus MG024 allele 2 NS ASFTA1055-12 Wolbachia sp. Camponotus MG024 allele 2 NS ASFTA1375-12 Wolbachia sp. Camponotus MG024 allele 2 allele 127 ASFTA1038-12 Wolbachia sp. Camponotus MG026 allele 2 NS ASFTA1039-12 Wolbachia sp. Camponotus MG026 allele 2 NS ASFTA1061-12 Wolbachia sp. Camponotus MG026 allele 2 NI ASFTA1106-12 Wolbachia sp. Camponotus MG026 allele 2 NS ASFTA1107-12 Wolbachia sp. Camponotus MG026 allele 2 NS ASFTA1139-12 Wolbachia sp. Camponotus MG026 allele 2 NS ASFTA1402-12 Wolbachia sp. Camponotus MG03_maculatus_nr NS allele 127 ASFTA1289-12 Wolbachia sp. Camponotus MG030 NI allele 47 ASFTA1043-12 Wolbachia sp. Camponotus MG035 allele 2 NI ASFTA1058-12 Wolbachia sp. Camponotus MG035 allele 2 allele 47 ASFTA1070-12 Wolbachia sp. Camponotus MG035 allele 2 allele 47 ASFTA906-12 Wolbachia sp. Camponotus MG035 allele 2 NI ASFTA907-12 Wolbachia sp. Camponotus MG035 allele 2 NI ASFTA911-12 Wolbachia sp. Camponotus MG035 allele 2 NS ASFTA1300-12 Wolbachia sp. Camponotus MG039 NI allele 127 ASFTA1301-12 Wolbachia sp. Camponotus MG039 NI allele 127 ASFTA224-12 Wolbachia sp. Camponotus MG039 NI allele 127 ASFTA232-12 Wolbachia sp. Camponotus MG039 NS allele 127 ASFTA1125-12 Wolbachia sp. Camponotus MG040 allele 2 allele 47 ASFTA1310-12 Wolbachia sp. Camponotus MG040 NI allele 127 ASFTA1317-12 Wolbachia sp. Camponotus MG040 NI allele 127 ASFTA1124-12 Wolbachia sp. Camponotus MG041 allele 2 allele 47 ASFTA1126-12 Wolbachia sp. Camponotus MG041 allele 2 allele 47

284

Process ID Species coxA allele hcpA allele ASFTA1296-12 Wolbachia sp. Camponotus MG043 NI allele 127 ASFTA1021-12 Wolbachia sp. Camponotus MG046 allele 2 allele 127 ASFTA193-12 Wolbachia sp. Camponotus MG047 NI allele 127 ASFTA057-12 Wolbachia sp. Camponotus MG048 allele 2 allele 127 ASFTA058-12 Wolbachia sp. Camponotus MG048 allele 2 allele 127 ASFTA1348-12 Wolbachia sp. Camponotus MG049 NS allele 127 ASFTA1389-12 Wolbachia sp. Camponotus MG049 allele 2 allele 127 ASFTA1401-12 Wolbachia sp. Camponotus MG049 allele 2 NI ASFTA1438-12 Wolbachia sp. Camponotus MG049 NS allele 127 ASFTA1586-12 Wolbachia sp. Camponotus MG053 allele 2 NS ASFTA1587-12 Wolbachia sp. Camponotus MG053 allele 2 allele 47 ASFTA1606-12 Wolbachia sp. Camponotus MG053 allele 2 NS ASFTA1044-12 Wolbachia sp. Camponotus MG078 allele 2 allele 127 ASFTA1054-12 Wolbachia sp. Camponotus MG078 allele 2 allele 47 ASFTA903-12 Wolbachia sp. Camponotus MG088 NI allele 127 ASFTA1114-12 Wolbachia sp. Camponotus MG089 allele 2 allele 127 ASFTA1130-12 Wolbachia sp. Camponotus MG089 allele 2 allele 127 ASFTA055-12 Wolbachia sp. Camponotus MG096 allele 2 allele 127 ASFTA056-12 Wolbachia sp. Camponotus MG096 allele 2 allele 127 ASFTA1340-12 Wolbachia sp. Camponotus MG096 NI allele 127 ASFTA1608-12 Wolbachia sp. Camponotus MG101 allele 2 NS ASFTA1063-12 Wolbachia sp. Camponotus MG111 NI allele 127 ASFTA1091-12 Wolbachia sp. Camponotus MG111 NI allele 127 ASFTA1100-12 Wolbachia sp. Camponotus MG111 NI allele 127 ASFTA1101-12 Wolbachia sp. Camponotus MG111 NI allele 127 ASFTA1118-12 Wolbachia sp. Camponotus MG119 allele 2 NS ASFTA901-12 Wolbachia sp. Camponotus MG120 NI allele 47 ASFTA912-12 Wolbachia sp. Camponotus MG120 allele 2 NI ASFTA1077-12 Wolbachia sp. Camponotus pictipes NI allele 127 ASFTA1079-12 Wolbachia sp. Camponotus pictipes NI allele 127 ASFTA1065-12 Wolbachia sp. Camponotus roeseli allele 2 NS ASFTA416-12 Wolbachia sp. Camponotus undet NS allele 127 ASFTA747-12 Wolbachia sp. Cardiocondyla emeryi allele 6 NS ASFTA455-12 Wolbachia sp. Cardiocondyla wroughtonii allele 6 NS ASFTA742-12 Wolbachia sp. Cardiocondyla wroughtonii NI allele 40 ASFTA776-12 Wolbachia sp. Cardiocondyla wroughtonii allele 6 NI ASFTA794-12 Wolbachia sp. Cardiocondyla wroughtonii allele 6 NI ASFTA798-12 Wolbachia sp. Cardiocondyla wroughtonii allele 6 NI ASFTA799-12 Wolbachia sp. Cardiocondyla wroughtonii allele 6 NI ASFTA803-12 Wolbachia sp. Cardiocondyla wroughtonii allele 2 NS

285

Process ID Species coxA allele hcpA allele ASFTA368-12 Wolbachia sp. Carebara DRm01 NS allele 42 ASFTA355-12 Wolbachia sp. Carebara DRm02 NS allele 42 ASFTA762-12 Wolbachia sp. Cataulacus ebrardi allele 2 allele 127 ASFTA909-12 Wolbachia sp. Cataulacus oberthueri NI allele 47 ASFTA944-12 Wolbachia sp. Cataulacus oberthueri NI allele 47 ASFTA945-12 Wolbachia sp. Cataulacus oberthueri allele 2 NI ASFTA985-12 Wolbachia sp. Cataulacus oberthueri NI allele 47 ASFTA037-12 Wolbachia sp. Cataulacus porcatus allele 6 NI ASFTA039-12 Wolbachia sp. Cataulacus porcatus allele 6 NI ASFTA040-12 Wolbachia sp. Cataulacus porcatus allele 6 allele 7 ASFTA041-12 Wolbachia sp. Cataulacus porcatus allele 6 NI ASFTA042-12 Wolbachia sp. Cataulacus porcatus allele 6 NI ASFTA043-12 Wolbachia sp. Cataulacus porcatus allele 6 NI ASFTA044-12 Wolbachia sp. Cataulacus porcatus allele 6 NI ASFTA045-12 Wolbachia sp. Cataulacus porcatus allele 6 NI ASFTA046-12 Wolbachia sp. Cataulacus porcatus allele 6 NI ASFTA047-12 Wolbachia sp. Cataulacus porcatus allele 6 NI ASFTA049-12 Wolbachia sp. Cataulacus porcatus allele 6 NS ASFTA050-12 Wolbachia sp. Cataulacus porcatus allele 6 NI ASFTA051-12 Wolbachia sp. Cataulacus porcatus allele 6 NI ASFTA052-12 Wolbachia sp. Cataulacus porcatus allele 6 NI ASFTA054-12 Wolbachia sp. Cataulacus porcatus allele 6 allele 7 ASFTA1350-12 Wolbachia sp. Cataulacus porcatus NS allele 7 ASFTA1395-12 Wolbachia sp. Cataulacus porcatus NS allele 7 ASFTA1573-12 Wolbachia sp. Cataulacus porcatus allele 6 NI ASFTA1574-12 Wolbachia sp. Cataulacus porcatus allele 6 NI ASFTA338-12 Wolbachia sp. Cataulacus porcatus allele 6 NS ASFTA481-12 Wolbachia sp. Cataulacus porcatus allele 6 NI ASFTA483-12 Wolbachia sp. Cataulacus porcatus allele 6 NI ASFTA485-12 Wolbachia sp. Cataulacus porcatus allele 6 NS ASFTA486-12 Wolbachia sp. Cataulacus porcatus NI allele 7 ASFTA487-12 Wolbachia sp. Cataulacus porcatus allele 6 NI ASFTA488-12 Wolbachia sp. Cataulacus porcatus NI allele 7 ASFTA913-12 Wolbachia sp. Cataulacus porcatus NI allele 127 ASFTA916-12 Wolbachia sp. Cataulacus porcatus NI allele 7 ASFTA938-12 Wolbachia sp. Cataulacus porcatus allele 6 NI ASFTA172-12 Wolbachia sp. Cataulacus regularis allele 2 allele 127 ASFTA918-12 Wolbachia sp. Cataulacus wasmanni allele 2 allele 127 ASFTA940-12 Wolbachia sp. Cataulacus wasmanni NI allele 127 ASFTA950-12 Wolbachia sp. Cataulacus wasmanni allele 2 allele 127

286

Process ID Species coxA allele hcpA allele ASFTA964-12 Wolbachia sp. Cataulacus wasmanni allele 2 allele 127 ASFTA874-12 Wolbachia sp. Cerapachys beanka_m03 allele 32 NI ASFTA297-12 Wolbachia sp. Cerapachys P_DR04 allele 6 NI ASFTA954-12 Wolbachia sp. Cerapachys P_MG01 allele 2 NS ASFTA1232-12 Wolbachia sp. Cerapachys P_MG02 allele 6 NI ASFTA423-12 Wolbachia sp. Cerapachys P_MG02 NI allele 7 ASFTA657-12 Wolbachia sp. Cerapachys P_MG02 allele 6 NS ASFTA679-12 Wolbachia sp. Cerapachys P_MG02 NS allele 7 ASFTA896-12 Wolbachia sp. Cerapachys P_MG02 allele 6 NS ASFTA902-12 Wolbachia sp. Cerapachys P_MG02 allele 6 NS ASFTA943-12 Wolbachia sp. Cerapachys P_MG06 allele 6 NI ASFTA1354-12 Wolbachia sp. Cerapachys P_MG07 NS allele 1 ASFTA419-12 Wolbachia sp. Cerapachys P_MG11 allele 1 NI ASFTA1245-12 Wolbachia sp. Cerapachys prey02 allele 37 allele 41 ASFTA1247-12 Wolbachia sp. Cerapachys prey02 allele 37 NI ASFTA1254-12 Wolbachia sp. Cerapachys prey04 allele 2 NI ASFTA1255-12 Wolbachia sp. Cerapachys prey04 allele 2 allele 55 ASFTA1256-12 Wolbachia sp. Cerapachys prey05 allele 2 NI ASFTA1235-12 Wolbachia sp. Cerapachys undet allele 6 NI ASFTA1238-12 Wolbachia sp. Cerapachys undet allele 2 NI ASFTA852-12 Wolbachia sp. Cerapachys undet allele 6 NI ASFTA858-12 Wolbachia sp. Cerapachys undet allele 6 NI ASFTA862-12 Wolbachia sp. Cerapachys undet allele 6 NI ASFTA064-12 Wolbachia sp. Crematogaster BBB35 allele 2 allele 47 ASFTA451-12 Wolbachia sp. Crematogaster BBB35 allele 2 allele 47 ASFTA059-12 Wolbachia sp. Crematogaster BBB55 allele 2 NI ASFTA060-12 Wolbachia sp. Crematogaster BBB55 allele 2 NI ASFTA061-12 Wolbachia sp. Crematogaster BBB55 allele 6 allele 7 ASFTA062-12 Wolbachia sp. Crematogaster BBB55 NI allele 7 ASFTA063-12 Wolbachia sp. Crematogaster BBB55 allele 6 NI ASFTA444-12 Wolbachia sp. Crematogaster BBB55 NI allele 7 ASFTA446-12 Wolbachia sp. Crematogaster BBB55 allele 6 allele 7 ASFTA450-12 Wolbachia sp. Crematogaster BBB55 allele 6 NI ASFTA452-12 Wolbachia sp. Crematogaster BBB55 allele 2 NS ASFTA462-12 Wolbachia sp. Crematogaster BBB55 allele 6 NS ASFTA743-12 Wolbachia sp. Crematogaster BBB55 NS allele 47 ASFTA758-12 Wolbachia sp. Crematogaster BBB55 NS allele 47 ASFTA759-12 Wolbachia sp. Crematogaster BBB55 NS allele 47 ASFTA1491-12 Wolbachia sp. Crematogaster DRw16 allele 2 NS ASFTA202-12 Wolbachia sp. Crematogaster grevei NI allele 47

287

Process ID Species coxA allele hcpA allele ASFTA215-12 Wolbachia sp. Crematogaster grevei allele 2 allele 47 ASFTA216-12 Wolbachia sp. Crematogaster grevei allele 2 allele 47 ASFTA218-12 Wolbachia sp. Crematogaster grevei allele 2 allele 47 ASFTA230-12 Wolbachia sp. Crematogaster grevei NI allele 47 ASFTA065-12 Wolbachia sp. Crematogaster hova-complex_m1 allele 2 allele 47 ASFTA066-12 Wolbachia sp. Crematogaster hova-complex_m1 allele 2 allele 47 ASFTA1393-12 Wolbachia sp. Crematogaster undet allele 2 NI ASFTA1405-12 Wolbachia sp. Crematogaster undet allele 2 NI ASFTA206-12 Wolbachia sp. Hypoponera DR01 allele 32 NS ASFTA155-12 Wolbachia sp. Hypoponera MG016 allele 2 NI ASFTA273-12 Wolbachia sp. Hypoponera MG026 NI allele 127 ASFTA468-12 Wolbachia sp. Hypoponera MG026 allele 6 NI ASFTA250-12 Wolbachia sp. Hypoponera MG028 allele 109 NI ASFTA251-12 Wolbachia sp. Hypoponera MG031 allele 20 NS ASFTA478-12 Wolbachia sp. Hypoponera MG039 allele 20 NI ASFTA465-12 Wolbachia sp. Hypoponera MG066 allele 11 NI ASFTA470-12 Wolbachia sp. Hypoponera MG066 allele 11 NI ASFTA847-12 Wolbachia sp. Hypoponera opacior allele 2 allele 75 ASFTA848-12 Wolbachia sp. Hypoponera opacior NI allele 75 ASFTA783-12 Wolbachia sp. Hypoponera punctatissima allele 6 NI ASFTA792-12 Wolbachia sp. Hypoponera punctatissima allele 6 NI ASFTA796-12 Wolbachia sp. Hypoponera punctatissima allele 6 NS ASFTA800-12 Wolbachia sp. Hypoponera punctatissima allele 6 NI ASFTA802-12 Wolbachia sp. Hypoponera punctatissima allele 6 NI ASFTA806-12 Wolbachia sp. Hypoponera punctatissima allele 6 NI ASFTA082-12 Wolbachia sp. Leptogenys acutirostris allele 50 NI ASFTA1451-12 Wolbachia sp. Leptogenys angusta allele 6 NS ASFTA265-12 Wolbachia sp. Leptogenys angusta allele 6 NI ASFTA277-12 Wolbachia sp. Leptogenys angusta allele 6 NI ASFTA278-12 Wolbachia sp. Leptogenys angusta NI allele 11 ASFTA281-12 Wolbachia sp. Leptogenys angusta NI allele 7 ASFTA820-12 Wolbachia sp. Leptogenys angusta NI allele 11 ASFTA822-12 Wolbachia sp. Leptogenys angusta NS allele 11 ASFTA829-12 Wolbachia sp. Leptogenys angusta NS allele 11 ASFTA837-12 Wolbachia sp. Leptogenys angusta NS allele 11 ASFTA838-12 Wolbachia sp. Leptogenys angusta NS allele 11 ASFTA839-12 Wolbachia sp. Leptogenys angusta NS allele 11 ASFTA842-12 Wolbachia sp. Leptogenys angusta NS allele 11 ASFTA843-12 Wolbachia sp. Leptogenys angusta NS allele 11 ASFTA269-12 Wolbachia sp. Leptogenys antongilensis NI allele 47

288

Process ID Species coxA allele hcpA allele ASFTA071-12 Wolbachia sp. Leptogenys arcirostris allele 147 NS ASFTA084-12 Wolbachia sp. Leptogenys arcirostris allele 147 NS ASFTA249-12 Wolbachia sp. Leptogenys arcirostris NS allele 175 ASFTA087-12 Wolbachia sp. Leptogenys falcigera allele 82 allele 112 ASFTA482-12 Wolbachia sp. Leptogenys gracilis NS allele 127 ASFTA491-12 Wolbachia sp. Leptogenys gracilis allele 2 allele 127 ASFTA817-12 Wolbachia sp. Leptogenys JCR01 NI allele 1 ASFTA830-12 Wolbachia sp. Leptogenys JCR01 allele 1 allele 1 ASFTA841-12 Wolbachia sp. Leptogenys JCR01 allele 1 allele 1 ASFTA077-12 Wolbachia sp. Leptogenys JCR08 allele 1 NS ASFTA840-12 Wolbachia sp. Leptogenys JCR10 allele 50 NI ASFTA073-12 Wolbachia sp. Leptogenys JCR23 allele 50 NS ASFTA083-12 Wolbachia sp. Leptogenys JCR23 allele 6 NS ASFTA285-12 Wolbachia sp. Leptogenys JCR23 NI allele 42 ASFTA076-12 Wolbachia sp. Leptogenys JCR24 allele 6 NS ASFTA079-12 Wolbachia sp. Leptogenys JCR24 allele 6 NI ASFTA080-12 Wolbachia sp. Leptogenys JCR24 allele 6 NS ASFTA081-12 Wolbachia sp. Leptogenys JCR24 allele 6 NI ASFTA078-12 Wolbachia sp. Leptogenys JCR25 allele 32 NS ASFTA258-12 Wolbachia sp. Leptogenys JCR25 NI allele 1 ASFTA262-12 Wolbachia sp. Leptogenys JCR25 allele 6 NI ASFTA072-12 Wolbachia sp. Leptogenys JCR29 allele 6 NS ASFTA074-12 Wolbachia sp. Leptogenys JCR29 allele 2 NS ASFTA243-12 Wolbachia sp. Leptogenys JCR29 allele 2 NI ASFTA257-12 Wolbachia sp. Leptogenys JCR29 allele 2 NI ASFTA831-12 Wolbachia sp. Leptogenys JCR29 allele 23 NI ASFTA832-12 Wolbachia sp. Leptogenys JCR29 allele 23 NI ASFTA1369-12 Wolbachia sp. Leptogenys MG01 NS allele 7 ASFTA069-12 Wolbachia sp. Leptogenys ridens allele 147 NS ASFTA070-12 Wolbachia sp. Leptogenys ridens allele 147 NS ASFTA245-12 Wolbachia sp. Leptogenys ridens NI allele 174 ASFTA246-12 Wolbachia sp. Leptogenys ridens allele 147 allele 174 ASFTA247-12 Wolbachia sp. Leptogenys ridens allele 147 allele 174 ASFTA812-12 Wolbachia sp. Leptogenys truncatirostris NI allele 77 ASFTA443-12 Wolbachia sp. Melanaspis mga allele 14 NI ASFTA1430-12 Wolbachia sp. Melissotarsus insularis allele 2 allele 186 ASFTA1433-12 Wolbachia sp. Melissotarsus insularis allele 2 NI ASFTA626-12 Wolbachia sp. Melissotarsus insularis allele 2 NS ASFTA634-12 Wolbachia sp. Melissotarsus insularis allele 2 NI ASFTA635-12 Wolbachia sp. Melissotarsus insularis allele 2 NI

289

Process ID Species coxA allele hcpA allele ASFTA667-12 Wolbachia sp. Melissotarsus insularis allele 2 allele 186 ASFTA668-12 Wolbachia sp. Melissotarsus insularis allele 2 allele 186 ASFTA146-12 Wolbachia sp. Meranoplus radamae allele 2 allele 127 ASFTA148-12 Wolbachia sp. Meranoplus radamae NS allele 127 ASFTA154-12 Wolbachia sp. Meranoplus radamae NS allele 127 ASFTA981-12 Wolbachia sp. Monomorium ambvky_m03 allele 6 NI ASFTA094-12 Wolbachia sp. Monomorium bifidoclypeatum allele 6 NI ASFTA201-12 Wolbachia sp. Monomorium DR02 NI allele 127 ASFTA209-12 Wolbachia sp. Monomorium DRm07d allele 37 NS ASFTA111-12 Wolbachia sp. Monomorium fisheri NI allele 47 ASFTA1578-12 Wolbachia sp. Monomorium fisheri NS allele 11 ASFTA1579-12 Wolbachia sp. Monomorium fisheri NS allele 11 ASFTA099-12 Wolbachia sp. Monomorium flavimembra allele 2 allele 127 ASFTA104-12 Wolbachia sp. Monomorium flavimembra allele 2 allele 127 ASFTA105-12 Wolbachia sp. Monomorium flavimembra allele 2 NI ASFTA106-12 Wolbachia sp. Monomorium flavimembra allele 6 NI ASFTA107-12 Wolbachia sp. Monomorium flavimembra allele 2 allele 47 ASFTA109-12 Wolbachia sp. Monomorium flavimembra allele 2 allele 127 ASFTA110-12 Wolbachia sp. Monomorium flavimembra allele 6 NI ASFTA100-12 Wolbachia sp. Monomorium gongromos allele 2 allele 47 ASFTA101-12 Wolbachia sp. Monomorium gongromos allele 2 allele 47 ASFTA116-12 Wolbachia sp. Monomorium gongromos allele 2 NI ASFTA021-12 Wolbachia sp. Monomorium hanneli allele 6 NI ASFTA030-12 Wolbachia sp. Monomorium hanneli allele 6 NI ASFTA167-12 Wolbachia sp. Monomorium hanneli allele 32 NI ASFTA025-12 Wolbachia sp. Monomorium hildebrandti allele 7 allele 60 ASFTA032-12 Wolbachia sp. Monomorium hildebrandti NI allele 127 ASFTA323-12 Wolbachia sp. Monomorium hildebrandti_02 NI allele 127 ASFTA375-12 Wolbachia sp. Monomorium hildebrandti_02 allele 32 NI ASFTA158-12 Wolbachia sp. Monomorium madecassum allele 47 NI ASFTA159-12 Wolbachia sp. Monomorium madecassum allele 32 NI ASFTA022-12 Wolbachia sp. Monomorium termitobium allele 7 NI ASFTA023-12 Wolbachia sp. Monomorium termitobium allele 2 allele 127 ASFTA027-12 Wolbachia sp. Monomorium termitobium NI allele 127 ASFTA028-12 Wolbachia sp. Monomorium termitobium allele 2 NI ASFTA029-12 Wolbachia sp. Monomorium termitobium allele 2 allele 127 ASFTA1434-12 Wolbachia sp. Monomorium termitobium NI allele 11 ASFTA1439-12 Wolbachia sp. Monomorium termitobium NI allele 11 ASFTA1571-12 Wolbachia sp. Monomorium termitobium allele 7 NI ASFTA1572-12 Wolbachia sp. Monomorium termitobium NI allele 55

290

Process ID Species coxA allele hcpA allele ASFTA164-12 Wolbachia sp. Monomorium termitobium allele 47 NI ASFTA466-12 Wolbachia sp. Monomorium termitobium allele 2 allele 127 ASFTA472-12 Wolbachia sp. Monomorium termitobium allele 7 allele 60 ASFTA474-12 Wolbachia sp. Monomorium termitobium allele 2 NI ASFTA331-12 Wolbachia sp. Monomorium termitobium_03 NI allele 195 ASFTA302-12 Wolbachia sp. Monomorium termitobium_04 NI allele 23 ASFTA1360-12 Wolbachia sp. Myrmicine_genus01 MG01 allele 6 NI ASFTA1411-12 Wolbachia sp. Myrmicine_genus01 MG01 allele 6 NI ASFTA1412-12 Wolbachia sp. Myrmicine_genus01 MG01 allele 6 NS ASFTA493-12 Wolbachia sp. Myrmicine_genus01 MG01 allele 37 NI ASFTA646-12 Wolbachia sp. Myrmicine_genus16 MG07 allele 7 NS ASFTA647-12 Wolbachia sp. Myrmicine_genus16 MG07 allele 7 allele 11 ASFTA358-12 Wolbachia sp. Nesomyrmex DRm02 NI allele 127 ASFTA175-12 Wolbachia sp. Nesomyrmex DRQ01 allele 2 NI ASFTA199-12 Wolbachia sp. Nesomyrmex DRQ01 allele 2 NI ASFTA1453-12 Wolbachia sp. Nesomyrmex madecassus allele 2 NS ASFTA680-12 Wolbachia sp. Nesomyrmex madecassus allele 6 allele 7 ASFTA681-12 Wolbachia sp. Nesomyrmex madecassus allele 6 allele 7 ASFTA682-12 Wolbachia sp. Nesomyrmex madecassus allele 6 allele 7 ASFTA684-12 Wolbachia sp. Nesomyrmex madecassus allele 6 allele 7 ASFTA685-12 Wolbachia sp. Nesomyrmex madecassus allele 6 NI ASFTA686-12 Wolbachia sp. Nesomyrmex madecassus allele 6 allele 7 ASFTA687-12 Wolbachia sp. Nesomyrmex madecassus allele 6 allele 7 ASFTA1391-12 Wolbachia sp. Nesomyrmex MG04 allele 6 allele 7 ASFTA1454-12 Wolbachia sp. Nesomyrmex MG04 allele 6 NS ASFTA1455-12 Wolbachia sp. Nesomyrmex MG04 allele 6 NS ASFTA1456-12 Wolbachia sp. Nesomyrmex MG04 allele 6 NS ASFTA628-12 Wolbachia sp. Nesomyrmex MG04 allele 6 NI ASFTA629-12 Wolbachia sp. Nesomyrmex MG04 allele 6 NI ASFTA924-12 Wolbachia sp. Nesomyrmex MG12 allele 6 NS ASFTA937-12 Wolbachia sp. Nesomyrmex MG12 allele 6 NS ASFTA942-12 Wolbachia sp. Nesomyrmex MG12 allele 6 NS ASFTA1452-12 Wolbachia sp. Nesomyrmex MG27 allele 2 NS ASFTA891-12 Wolbachia sp. Nylanderia beanka01 NI allele 127 ASFTA880-12 Wolbachia sp. Nylanderia beanka02 NI allele 47 ASFTA883-12 Wolbachia sp. Nylanderia beanka02 NI allele 47 ASFTA1492-12 Wolbachia sp. Nylanderia DRw01 allele 2 NS ASFTA930-12 Wolbachia sp. Nylanderia MG04 allele 20 NS ASFTA174-12 Wolbachia sp. Nylanderia MG09 allele 2 allele 47 ASFTA905-12 Wolbachia sp. Nylanderia MG09 allele 2 NI

291

Process ID Species coxA allele hcpA allele ASFTA965-12 Wolbachia sp. Nylanderia MG09 allele 2 NI ASFTA960-12 Wolbachia sp. Nylanderia MG10 allele 20 NS ASFTA067-12 Wolbachia sp. Nylanderia undet allele 6 NI ASFTA1383-12 Wolbachia sp. Nylanderia undet NS allele 127 ASFTA426-12 Wolbachia sp. Nylanderia undet NI allele 47 ASFTA505-12 Wolbachia sp. Nylanderia undet allele 2 allele 127 ASFTA511-12 Wolbachia sp. Nylanderia undet allele 2 allele 127 ASFTA512-12 Wolbachia sp. Nylanderia undet allele 2 NI ASFTA513-12 Wolbachia sp. Nylanderia undet allele 2 allele 127 ASFTA514-12 Wolbachia sp. Nylanderia undet allele 2 allele 127 ASFTA519-12 Wolbachia sp. Nylanderia undet allele 2 allele 127 ASFTA543-12 Wolbachia sp. Nylanderia undet allele 2 NS ASFTA547-12 Wolbachia sp. Nylanderia undet allele 2 allele 127 ASFTA555-12 Wolbachia sp. Nylanderia undet allele 2 allele 127 ASFTA577-12 Wolbachia sp. Nylanderia undet allele 2 NI ASFTA578-12 Wolbachia sp. Nylanderia undet NS allele 127 ASFTA579-12 Wolbachia sp. Nylanderia undet allele 20 allele 127 ASFTA582-12 Wolbachia sp. Nylanderia undet NI allele 127 ASFTA583-12 Wolbachia sp. Nylanderia undet allele 2 allele 127 ASFTA584-12 Wolbachia sp. Nylanderia undet allele 2 allele 127 ASFTA594-12 Wolbachia sp. Nylanderia undet allele 2 NI ASFTA606-12 Wolbachia sp. Nylanderia undet allele 2 allele 186 ASFTA612-12 Wolbachia sp. Nylanderia undet allele 20 allele 127 ASFTA780-12 Wolbachia sp. Odontomachus simillimus allele 6 NI ASFTA785-12 Wolbachia sp. Odontomachus simillimus allele 6 NI ASFTA787-12 Wolbachia sp. Odontomachus simillimus allele 6 NI ASFTA789-12 Wolbachia sp. Odontomachus simillimus allele 6 NI ASFTA790-12 Wolbachia sp. Odontomachus simillimus allele 6 NI ASFTA791-12 Wolbachia sp. Odontomachus simillimus allele 6 NI ASFTA807-12 Wolbachia sp. Odontomachus simillimus allele 6 NI ASFTA011-12 Wolbachia sp. Odontomachus troglodytes allele 2 allele 42 ASFTA012-12 Wolbachia sp. Odontomachus troglodytes allele 2 NI ASFTA013-12 Wolbachia sp. Odontomachus troglodytes allele 2 NI ASFTA014-12 Wolbachia sp. Odontomachus troglodytes allele 2 allele 42 ASFTA015-12 Wolbachia sp. Odontomachus troglodytes NI allele 42 ASFTA016-12 Wolbachia sp. Odontomachus troglodytes allele 2 NI ASFTA017-12 Wolbachia sp. Odontomachus troglodytes NI allele 7 ASFTA018-12 Wolbachia sp. Odontomachus troglodytes allele 2 NI ASFTA019-12 Wolbachia sp. Odontomachus troglodytes NI allele 42 ASFTA303-12 Wolbachia sp. Odontomachus troglodytes NS allele 7

292

Process ID Species coxA allele hcpA allele ASFTA698-12 Wolbachia sp. Odontomachus troglodytes allele 2 NI ASFTA561-12 Wolbachia sp. Paraparatrechina glabra allele 7 allele 11 ASFTA006-12 Wolbachia sp. Paratrechina longicornis allele 147 allele 175 ASFTA007-12 Wolbachia sp. Paratrechina longicornis allele 147 allele 175 ASFTA068-12 Wolbachia sp. Paratrechina longicornis allele 6 allele 7 ASFTA1444-12 Wolbachia sp. Paratrechina longicornis allele 6 NI ASFTA1214-12 Wolbachia sp. Pheidole annemariae allele 2 NS ASFTA1224-12 Wolbachia sp. Pheidole annemariae allele 20 NS ASFTA886-12 Wolbachia sp. Pheidole beanka04 NI allele 127 ASFTA1216-12 Wolbachia sp. Pheidole bessonii allele 2 NS ASFTA407-12 Wolbachia sp. Pheidole californica NS allele 78 ASFTA435-12 Wolbachia sp. Pheidole californica NI allele 78 ASFTA400-12 Wolbachia sp. Pheidole creightoni NI allele 78 ASFTA401-12 Wolbachia sp. Pheidole creightoni NS allele 78 ASFTA403-12 Wolbachia sp. Pheidole creightoni NS allele 55 ASFTA404-12 Wolbachia sp. Pheidole creightoni NS allele 78 ASFTA406-12 Wolbachia sp. Pheidole creightoni NS allele 78 ASFTA432-12 Wolbachia sp. Pheidole creightoni NI allele 78 ASFTA1182-12 Wolbachia sp. Pheidole longispinosa scabrata allele 2 NI ASFTA1222-12 Wolbachia sp. Pheidole madecassa allele 2 allele 127 ASFTA676-12 Wolbachia sp. Pheidole megacephala allele 2 allele 55 ASFTA1019-12 Wolbachia sp. Pheidole MG007 allele 37 NI ASFTA992-12 Wolbachia sp. Pheidole MG007 allele 50 NS ASFTA002-12 Wolbachia sp. Pheidole MG015 allele 6 NI ASFTA1023-12 Wolbachia sp. Pheidole MG015 allele 6 NI ASFTA1024-12 Wolbachia sp. Pheidole MG015 allele 6 NI ASFTA145-12 Wolbachia sp. Pheidole MG015 allele 6 NI ASFTA152-12 Wolbachia sp. Pheidole MG015 allele 77 NI ASFTA428-12 Wolbachia sp. Pheidole MG046 NI allele 47 ASFTA980-12 Wolbachia sp. Pheidole MG046 NI allele 127 ASFTA877-12 Wolbachia sp. Pheidole MG052 allele 2 allele 55 ASFTA958-12 Wolbachia sp. Pheidole MG052 allele 2 allele 55 ASFTA959-12 Wolbachia sp. Pheidole MG052 allele 2 allele 55 ASFTA537-12 Wolbachia sp. Pheidole MG081 allele 37 allele 41 ASFTA150-12 Wolbachia sp. Pheidole MG145 NI allele 42 ASFTA153-12 Wolbachia sp. Pheidole MG145 allele 2 NI ASFTA208-12 Wolbachia sp. Pheidole MG145 allele 2 NS ASFTA214-12 Wolbachia sp. Pheidole MG145 NI allele 127 ASFTA225-12 Wolbachia sp. Pheidole MG145 allele 2 allele 127 ASFTA1436-12 Wolbachia sp. Pheidole MG146 NI allele 42

293

Process ID Species coxA allele hcpA allele ASFTA545-12 Wolbachia sp. Pheidole MG148 allele 2 NS ASFTA608-12 Wolbachia sp. Pheidole MG150 allele 2 allele 127 ASFTA609-12 Wolbachia sp. Pheidole MG150 allele 2 allele 127 ASFTA614-12 Wolbachia sp. Pheidole MG150 NI allele 127 ASFTA615-12 Wolbachia sp. Pheidole MG150 allele 2 NI ASFTA616-12 Wolbachia sp. Pheidole MG150 allele 2 allele 127 ASFTA558-12 Wolbachia sp. Pheidole MG151 allele 2 allele 127 ASFTA604-12 Wolbachia sp. Pheidole MG151 allele 2 allele 127 ASFTA605-12 Wolbachia sp. Pheidole MG151 allele 2 NI ASFTA617-12 Wolbachia sp. Pheidole MG151 allele 2 allele 127 ASFTA618-12 Wolbachia sp. Pheidole MG151 allele 2 allele 127 ASFTA092-12 Wolbachia sp. Pheidole MG154 NS allele 127 ASFTA1227-12 Wolbachia sp. Pheidole MG157 NI allele 47 ASFTA1228-12 Wolbachia sp. Pheidole MG157 allele 2 NI ASFTA1443-12 Wolbachia sp. Pheidole MGs046 NI allele 41 ASFTA1185-12 Wolbachia sp. Pheidole MGs060 allele 2 NI ASFTA1206-12 Wolbachia sp. Pheidole MGs060 allele 2 allele 127 ASFTA1221-12 Wolbachia sp. Pheidole MGs060 allele 2 NI ASFTA562-12 Wolbachia sp. Pheidole MGs077 allele 37 allele 41 ASFTA1195-12 Wolbachia sp. Pheidole MGs087 allele 6 NI ASFTA1198-12 Wolbachia sp. Pheidole MGs087 allele 6 NI ASFTA1207-12 Wolbachia sp. Pheidole MGs089 allele 37 NI ASFTA1208-12 Wolbachia sp. Pheidole MGs089 allele 37 NS ASFTA1209-12 Wolbachia sp. Pheidole MGs089 allele 37 allele 41 ASFTA1177-12 Wolbachia sp. Pheidole MGs093 allele 37 NS ASFTA1187-12 Wolbachia sp. Pheidole MGs120 allele 2 NS ASFTA1192-12 Wolbachia sp. Pheidole MGs120 allele 2 NS ASFTA1197-12 Wolbachia sp. Pheidole MGs120 allele 2 NI ASFTA1199-12 Wolbachia sp. Pheidole MGs120 allele 2 allele 42 ASFTA1225-12 Wolbachia sp. Pheidole MGs120 allele 2 NS ASFTA1175-12 Wolbachia sp. Pheidole MGs122 allele 2 NS ASFTA1186-12 Wolbachia sp. Pheidole MGs122 allele 2 NS ASFTA1193-12 Wolbachia sp. Pheidole MGs122 allele 2 NS ASFTA1200-12 Wolbachia sp. Pheidole MGs122 allele 2 NS ASFTA1201-12 Wolbachia sp. Pheidole MGs122 allele 2 NS ASFTA1223-12 Wolbachia sp. Pheidole MGs122 allele 2 NS ASFTA1173-12 Wolbachia sp. Pheidole MGs123 allele 33 NS ASFTA1179-12 Wolbachia sp. Pheidole MGs123 allele 2 NS ASFTA1190-12 Wolbachia sp. Pheidole MGs124 allele 2 NS ASFTA1178-12 Wolbachia sp. Pheidole MGs125 allele 2 NS

294

Process ID Species coxA allele hcpA allele ASFTA1180-12 Wolbachia sp. Pheidole MGs125 allele 2 NI ASFTA1181-12 Wolbachia sp. Pheidole MGs128 allele 2 NS ASFTA1202-12 Wolbachia sp. Pheidole MGs128 allele 2 NS ASFTA1204-12 Wolbachia sp. Pheidole MGs128 allele 2 NS ASFTA1220-12 Wolbachia sp. Pheidole MGs128 allele 2 NS ASFTA1174-12 Wolbachia sp. Pheidole MGs129 allele 2 NS ASFTA1183-12 Wolbachia sp. Pheidole MGs129 allele 2 NS ASFTA1184-12 Wolbachia sp. Pheidole MGs129 allele 2 allele 47 ASFTA1196-12 Wolbachia sp. Pheidole MGs129 allele 2 allele 47 ASFTA1217-12 Wolbachia sp. Pheidole MGs129 allele 2 NS ASFTA1219-12 Wolbachia sp. Pheidole MGs129 allele 2 NS ASFTA1189-12 Wolbachia sp. Pheidole MGs130 allele 2 allele 127 ASFTA1205-12 Wolbachia sp. Pheidole MGs130 allele 2 allele 127 ASFTA1210-12 Wolbachia sp. Pheidole MGs130 allele 2 NS ASFTA1218-12 Wolbachia sp. Pheidole MGs131 allele 2 allele 127 ASFTA402-12 Wolbachia sp. Pheidole paiute NS allele 78 ASFTA619-12 Wolbachia sp. Pheidole undet allele 2 allele 127 ASFTA620-12 Wolbachia sp. Pheidole undet allele 2 allele 127 ASFTA621-12 Wolbachia sp. Pheidole undet allele 2 allele 127 ASFTA610-12 Wolbachia sp. Plagiolepis alluaudi NI allele 47 ASFTA611-12 Wolbachia sp. Plagiolepis alluaudi allele 2 allele 47 ASFTA632-12 Wolbachia sp. Plagiolepis alluaudi allele 2 NS ASFTA633-12 Wolbachia sp. Plagiolepis alluaudi allele 2 allele 47 ASFTA648-12 Wolbachia sp. Plagiolepis alluaudi allele 2 NI ASFTA652-12 Wolbachia sp. Plagiolepis alluaudi allele 2 NI ASFTA653-12 Wolbachia sp. Plagiolepis alluaudi allele 2 allele 127 ASFTA988-12 Wolbachia sp. Plagiolepis alluaudi allele 2 allele 47 ASFTA1394-12 Wolbachia sp. Plagiolepis madecassa allele 6 NI ASFTA160-12 Wolbachia sp. Plagiolepis MG01 allele 2 allele 127 ASFTA1397-12 Wolbachia sp. Plagiolepis MG05 NI allele 47 ASFTA173-12 Wolbachia sp. Plagiolepis MG05 allele 2 NI ASFTA851-12 Wolbachia sp. Pogonomyrmex AR01 NI allele 45 ASFTA801-12 Wolbachia sp. Ponera exotica allele 6 NI ASFTA1380-12 Wolbachia sp. Prionopelta MG01 NS allele 11 ASFTA438-12 Wolbachia sp. Prionopelta MG01 NS allele 127 ASFTA439-12 Wolbachia sp. Prionopelta MG01 NI allele 127 ASFTA442-12 Wolbachia sp. Prionopelta MG01 NI allele 127 ASFTA656-12 Wolbachia sp. Prionopelta MG01 allele 7 allele 11 ASFTA663-12 Wolbachia sp. Prionopelta MG01 allele 6 NI ASFTA335-12 Wolbachia sp. Pyramica ambatrix allele 2 NS

295

Process ID Species coxA allele hcpA allele ASFTA1009-12 Wolbachia sp. Pyramica erynnes NI allele 127 ASFTA1015-12 Wolbachia sp. Pyramica erynnes NI allele 127 ASFTA534-12 Wolbachia sp. Pyramica erynnes allele 2 allele 127 ASFTA536-12 Wolbachia sp. Pyramica erynnes NI allele 127 ASFTA553-12 Wolbachia sp. Pyramica erynnes NI allele 127 ASFTA560-12 Wolbachia sp. Pyramica erynnes NS allele 127 ASFTA966-12 Wolbachia sp. Pyramica erynnes allele 2 allele 127 ASFTA546-12 Wolbachia sp. Pyramica ludovici NS allele 7 ASFTA548-12 Wolbachia sp. Pyramica ludovici allele 6 allele 7 ASFTA550-12 Wolbachia sp. Pyramica ludovici NS allele 7 ASFTA559-12 Wolbachia sp. Pyramica ludovici NS allele 7 ASFTA564-12 Wolbachia sp. Pyramica ludovici allele 6 NI ASFTA498-12 Wolbachia sp. Pyramica mandibularis allele 6 NI ASFTA502-12 Wolbachia sp. Pyramica mandibularis allele 6 NI ASFTA010-12 Wolbachia sp. Solenopsis mameti NI allele 45 ASFTA020-12 Wolbachia sp. Solenopsis mameti allele 20 NI ASFTA1017-12 Wolbachia sp. Solenopsis mameti NI allele 207 ASFTA102-12 Wolbachia sp. Strumigenys abdera allele 7 NI ASFTA103-12 Wolbachia sp. Strumigenys abdera allele 7 allele 11 ASFTA506-12 Wolbachia sp. Strumigenys actis allele 20 NI ASFTA515-12 Wolbachia sp. Strumigenys actis allele 20 NI ASFTA516-12 Wolbachia sp. Strumigenys actis allele 20 NI ASFTA097-12 Wolbachia sp. Strumigenys ampyx allele 15 allele 23 ASFTA112-12 Wolbachia sp. Strumigenys ampyx allele 20 NI ASFTA113-12 Wolbachia sp. Strumigenys ampyx allele 20 allele 127 ASFTA933-12 Wolbachia sp. Strumigenys ampyx allele 2 NS ASFTA115-12 Wolbachia sp. Strumigenys apios allele 6 NI ASFTA121-12 Wolbachia sp. Strumigenys bibiolona NS allele 127 ASFTA125-12 Wolbachia sp. Strumigenys chroa NS allele 195 ASFTA127-12 Wolbachia sp. Strumigenys covina NS allele 127 ASFTA130-12 Wolbachia sp. Strumigenys covina NS allele 195 ASFTA143-12 Wolbachia sp. Strumigenys covina NS allele 47 ASFTA1367-12 Wolbachia sp. Strumigenys dicomas NS allele 41 ASFTA554-12 Wolbachia sp. Strumigenys dicomas NS allele 127 ASFTA565-12 Wolbachia sp. Strumigenys dicomas NI allele 127 ASFTA597-12 Wolbachia sp. Strumigenys dicomas allele 2 NI ASFTA598-12 Wolbachia sp. Strumigenys dicomas allele 20 NI ASFTA1162-12 Wolbachia sp. Strumigenys lexex allele 6 NS ASFTA1159-12 Wolbachia sp. Strumigenys luca allele 6 NI ASFTA1161-12 Wolbachia sp. Strumigenys lucomo allele 2 NS

296

Process ID Species coxA allele hcpA allele ASFTA1160-12 Wolbachia sp. Strumigenys lysis allele 7 NS ASFTA1001-12 Wolbachia sp. Strumigenys norax allele 7 NS ASFTA156-12 Wolbachia sp. Strumigenys undet NS allele 11 ASFTA157-12 Wolbachia sp. Strumigenys undet NS allele 11 ASFTA162-12 Wolbachia sp. Strumigenys undet NS allele 11 ASFTA613-12 Wolbachia sp. Strumigenys undet NS allele 7 ASFTA354-12 Wolbachia sp. Strumigenys vazimba allele 50 NI ASFTA008-12 Wolbachia sp. Tapinoma melanocephalum allele 2 NI ASFTA460-12 Wolbachia sp. Tapinoma melanocephalum allele 2 NI ASFTA675-12 Wolbachia sp. Tapinoma melanocephalum allele 2 NI ASFTA690-12 Wolbachia sp. Tapinoma melanocephalum allele 2 NI ASFTA693-12 Wolbachia sp. Tapinoma melanocephalum allele 2 allele 51 ASFTA715-12 Wolbachia sp. Tapinoma melanocephalum allele 2 NS ASFTA725-12 Wolbachia sp. Tapinoma melanocephalum allele 2 NI ASFTA733-12 Wolbachia sp. Tapinoma melanocephalum allele 2 NI ASFTA709-12 Wolbachia sp. Tapinoma MG02 allele 6 NI ASFTA703-12 Wolbachia sp. Tapinoma MG03 allele 2 allele 127 ASFTA704-12 Wolbachia sp. Tapinoma MG03 allele 2 allele 127 ASFTA705-12 Wolbachia sp. Tapinoma MG03 allele 2 allele 127 ASFTA706-12 Wolbachia sp. Tapinoma MG03 NI allele 127 ASFTA730-12 Wolbachia sp. Tapinoma MG03 allele 2 allele 127 ASFTA731-12 Wolbachia sp. Tapinoma MG03 allele 2 allele 127 ASFTA732-12 Wolbachia sp. Tapinoma MG03 allele 2 allele 127 ASFTA702-12 Wolbachia sp. Tapinoma MG05 allele 6 NS ASFTA717-12 Wolbachia sp. Tapinoma MG05 allele 6 NI ASFTA729-12 Wolbachia sp. Tapinoma MG06 allele 92 NS ASFTA1342-12 Wolbachia sp. Technomyrmex albipes NS allele 55 ASFTA622-12 Wolbachia sp. Technomyrmex albipes allele 2 allele 55 ASFTA623-12 Wolbachia sp. Technomyrmex albipes allele 2 allele 55 ASFTA624-12 Wolbachia sp. Technomyrmex albipes allele 2 allele 55 ASFTA625-12 Wolbachia sp. Technomyrmex albipes NS allele 55 ASFTA631-12 Wolbachia sp. Technomyrmex albipes allele 2 allele 55 ASFTA638-12 Wolbachia sp. Technomyrmex albipes allele 2 allele 55 ASFTA673-12 Wolbachia sp. Technomyrmex albipes allele 2 NI ASFTA674-12 Wolbachia sp. Technomyrmex albipes allele 2 allele 55 ASFTA689-12 Wolbachia sp. Technomyrmex albipes allele 2 allele 55 ASFTA691-12 Wolbachia sp. Technomyrmex albipes allele 2 allele 55 ASFTA692-12 Wolbachia sp. Technomyrmex albipes allele 2 allele 55 ASFTA603-12 Wolbachia sp. Technomyrmex difficilis allele 6 NI ASFTA636-12 Wolbachia sp. Technomyrmex difficilis NI allele 7

297

Process ID Species coxA allele hcpA allele ASFTA637-12 Wolbachia sp. Technomyrmex difficilis allele 6 NI ASFTA639-12 Wolbachia sp. Technomyrmex difficilis allele 6 NI ASFTA640-12 Wolbachia sp. Technomyrmex difficilis allele 6 allele 7 ASFTA641-12 Wolbachia sp. Technomyrmex difficilis allele 6 allele 7 ASFTA644-12 Wolbachia sp. Technomyrmex difficilis allele 6 allele 7 ASFTA645-12 Wolbachia sp. Technomyrmex difficilis allele 6 allele 7 ASFTA649-12 Wolbachia sp. Technomyrmex difficilis allele 6 allele 7 ASFTA1370-12 Wolbachia sp. Technomyrmex fisheri allele 2 allele 127 ASFTA642-12 Wolbachia sp. Technomyrmex fisheri allele 2 allele 127 ASFTA643-12 Wolbachia sp. Technomyrmex fisheri allele 2 allele 127 ASFTA664-12 Wolbachia sp. Technomyrmex madecassus NS allele 7 ASFTA1449-12 Wolbachia sp. Technomyrmex pallipes allele 2 NI ASFTA1149-12 Wolbachia sp. Technomyrmex vitiensis NI allele 195 ASFTA183-12 Wolbachia sp. Terataner MG11 NI allele 127 ASFTA184-12 Wolbachia sp. Terataner MG11 NS allele 127 ASFTA294-12 Wolbachia sp. Terataner MG11 NS allele 47 ASFTA1233-12 Wolbachia sp. Terataner undet NI allele 127 ASFTA1266-12 Wolbachia sp. Tetramorium cognatum allele 6 NI ASFTA1358-12 Wolbachia sp. Tetramorium ibycterum allele 2 NI ASFTA1280-12 Wolbachia sp. Tetramorium isectum allele 2 NS ASFTA1278-12 Wolbachia sp. Tetramorium latreillei allele 6 NI ASFTA1279-12 Wolbachia sp. Tetramorium MG035 allele 6 NI ASFTA1284-12 Wolbachia sp. Tetramorium MG035 allele 17 NI ASFTA575-12 Wolbachia sp. Tetramorium MG035 allele 6 NI ASFTA600-12 Wolbachia sp. Tetramorium MG036 allele 17 NI ASFTA1262-12 Wolbachia sp. Tetramorium MG037 allele 50 NS ASFTA1281-12 Wolbachia sp. Tetramorium MG039 allele 50 NS ASFTA1265-12 Wolbachia sp. Tetramorium MG040 allele 6 allele 195 ASFTA1276-12 Wolbachia sp. Tetramorium MG042 allele 7 NI ASFTA1258-12 Wolbachia sp. Tetramorium MG052 allele 6 NS ASFTA1261-12 Wolbachia sp. Tetramorium MG088 allele 37 NS ASFTA1268-12 Wolbachia sp. Tetramorium MG089 allele 50 NI ASFTA1271-12 Wolbachia sp. Tetramorium MG089 allele 50 NI ASFTA1264-12 Wolbachia sp. Tetramorium MG093 allele 37 NI ASFTA1287-12 Wolbachia sp. Tetramorium MG093 NI allele 55 ASFTA552-12 Wolbachia sp. Tetramorium MG103 allele 32 NS ASFTA574-12 Wolbachia sp. Tetramorium MG103 allele 37 NI ASFTA586-12 Wolbachia sp. Tetramorium MG103 allele 37 NI ASFTA587-12 Wolbachia sp. Tetramorium MG103 allele 50 NI ASFTA595-12 Wolbachia sp. Tetramorium MG103 allele 32 NS

298

Process ID Species coxA allele hcpA allele ASFTA601-12 Wolbachia sp. Tetramorium MG103 allele 37 NI ASFTA567-12 Wolbachia sp. Tetramorium MG111 allele 2 NI ASFTA568-12 Wolbachia sp. Tetramorium MG111 allele 23 NS ASFTA779-12 Wolbachia sp. Tetramorium MG111 allele 2 allele 127 ASFTA774-12 Wolbachia sp. Tetramorium MG112 allele 2 NI ASFTA775-12 Wolbachia sp. Tetramorium MG112 NI allele 127 ASFTA811-12 Wolbachia sp. Tetramorium MG119 allele 2 NI ASFTA777-12 Wolbachia sp. Tetramorium MG120 allele 50 NS ASFTA580-12 Wolbachia sp. Tetramorium MG121 allele 23 allele 7 ASFTA581-12 Wolbachia sp. Tetramorium MG121 NI allele 7 ASFTA589-12 Wolbachia sp. Tetramorium MG121 allele 50 NS ASFTA769-12 Wolbachia sp. Tetramorium MG122 allele 6 NI ASFTA771-12 Wolbachia sp. Tetramorium MG122 allele 2 NI ASFTA994-12 Wolbachia sp. Tetramorium MG125 allele 17 NS ASFTA973-12 Wolbachia sp. Tetramorium MG134 allele 109 allele 186 ASFTA976-12 Wolbachia sp. Tetramorium MG134 allele 109 allele 186 ASFTA977-12 Wolbachia sp. Tetramorium MG134 allele 109 allele 186 ASFTA1226-12 Wolbachia sp. Tetramorium norvigi allele 6 NI ASFTA1230-12 Wolbachia sp. Tetramorium norvigi allele 6 NI ASFTA1231-12 Wolbachia sp. Tetramorium norvigi allele 6 NI ASFTA1282-12 Wolbachia sp. Tetramorium proximum allele 17 NI ASFTA517-12 Wolbachia sp. Tetramorium proximum allele 17 NS ASFTA526-12 Wolbachia sp. Tetramorium proximum allele 17 NS ASFTA590-12 Wolbachia sp. Tetramorium quasirum allele 50 NI ASFTA529-12 Wolbachia sp. Tetramorium ranarum allele 37 NS ASFTA540-12 Wolbachia sp. Tetramorium robustior allele 6 NI ASFTA541-12 Wolbachia sp. Tetramorium robustior allele 6 NI ASFTA572-12 Wolbachia sp. Tetramorium robustior allele 50 NI ASFTA551-12 Wolbachia sp. Tetramorium undet allele 50 NS ASFTA571-12 Wolbachia sp. Tetramorium undet allele 50 NS ASFTA573-12 Wolbachia sp. Tetramorium undet allele 50 NS ASFTA670-12 Wolbachia sp. Tetramorium undet allele 17 NI ASFTA865-12 Wolbachia sp. Tetraponera beanka06 NI allele 186 ASFTA212-12 Wolbachia sp. Tetraponera DR02 NS allele 47 ASFTA240-12 Wolbachia sp. Tetraponera DR09 allele 2 allele 47 ASFTA088-12 Wolbachia sp. Tetraponera grandidieri allele 2 NS ASFTA182-12 Wolbachia sp. Tetraponera grandidieri_01 NI allele 47 ASFTA179-12 Wolbachia sp. Tetraponera manangotra NS allele 47 ASFTA1353-12 Wolbachia sp. Tetraponera merita allele 2 allele 47 ASFTA696-12 Wolbachia sp. Tetraponera merita NS allele 11

299

Process ID Species coxA allele hcpA allele ASFTA697-12 Wolbachia sp. Tetraponera merita allele 32 NS ASFTA1441-12 Wolbachia sp. Tetraponera MG04 allele 15 NS ASFTA371-12 Wolbachia sp. Tetraponera MG17 NI allele 47 ASFTA1413-12 Wolbachia sp. Tetraponera undet allele 94 NI ASFTA1414-12 Wolbachia sp. Tetraponera undet allele 94 NI ASFTA1415-12 Wolbachia sp. Tetraponera undet allele 94 NI ASFTA1418-12 Wolbachia sp. Tetraponera undet allele 94 NI ASFTA1419-12 Wolbachia sp. Tetraponera undet allele 94 allele 110 ASFTA1445-12 Wolbachia sp. Tetraponera undet allele 94 NI

300

Appendix S8 Chapter 3- Investigating Dispersal State and Wolbachia Infection

Table S8.1- Analyzing if queen dispersal state (alate/ergatoid) corresponds with Wolbachia infection. Dispersal state was determined with searches for queen specimen descriptions on Antweb (www.antweb.org) (Fisher 2013) and confirmation by Brian Fisher (personal communications, 2013). Only Wolbachia surveyed species with n ≥ 10 individuals were included and the “PCR” rule of infection was applied. Wolbachia infection was found in 43 % of (130/300) of alate species, and 53 % (9/17) of ergatoid species. A Fisher’s exact test did not confirm a significant relationship between Wolbachia infection and dispersal state (p= 0.203).

Species Wolbachia Infected Dispersal State Anochetus grandidieri Yes Alate Anochetus madagascarensis Yes Alate Aphaenogaster swammerdami Yes Alate Brachymyrmex cordemoyi No Alate Camponotus christi Yes Alate Camponotus concolor Yes Alate Camponotus darwinii No Alate Camponotus dufouri Yes Alate Camponotus echinoploides No Alate Camponotus edmondi No Alate Camponotus ellioti No Alate Camponotus gibber Yes Alate Camponotus gouldi No Alate Camponotus grandidieri Yes Alate Camponotus hagensii No Alate Camponotus heteroclitus Yes Alate Camponotus kelleri No Alate Camponotus maculatus No Alate Camponotus MG001 No Alate Camponotus MG002 Yes Alate Camponotus MG003 Yes Alate Camponotus MG004 Yes Alate Camponotus MG005 Yes Alate Camponotus MG009 No Alate Camponotus MG014 Yes Alate Camponotus MG018 Yes Alate Camponotus MG023 Yes Alate Camponotus MG026 Yes Alate Camponotus MG028 No Alate Camponotus MG031 No Alate Camponotus MG033 No Alate Camponotus MG035 Yes Alate Camponotus MG039 Yes Alate Camponotus MG047 Yes Alate Camponotus MG048 Yes Alate Camponotus MG049 Yes Alate Camponotus MG050 No Alate

301

Species Wolbachia Infected Dispersal State Camponotus MG053 Yes Alate Camponotus MG054 Yes Alate Camponotus MG065 No Alate Camponotus MG081 No Alate Camponotus MG088 Yes Alate Camponotus MG096 Yes Alate Camponotus MG100 No Alate Camponotus MG100a No Alate Camponotus MG101 Yes Alate Camponotus niveosetosus madaga No Alate Camponotus putatus No Alate Camponotus quadrimaculatus No Alate Camponotus repens No Alate Camponotus robustus No Alate Camponotus roeseli Yes Alate Camponotus voeltzkowii No Alate Cardiocondyla emeryi Yes Alate Cardiocondyla nuda No Alate Cardiocondyla shuckardi No Alate Cardiocondyla wroughtonii Yes Alate Cataulacus ebrardi Yes Alate Cataulacus porcatus Yes Alate Cerapachys P_MG02 Yes Ergatoid Cerapachys P_MG06 Yes Alate Crematogaster hova-complex_m2 No Alate Crematogaster hova-complex_m3 No Alate Crematogaster hova-complex_m4 No Alate Eutetramorium mocquerysi No Ergatoid Hypoponera DR01 Yes Alate Hypoponera indigens No Alate Hypoponera johannae No Alate Hypoponera MG001 No Alate Hypoponera MG002 No Alate Hypoponera MG003 No Alate Hypoponera MG004 No Alate Hypoponera MG005 No Alate Hypoponera MG008 No Alate Hypoponera MG009 No Alate Hypoponera MG011 No Alate Hypoponera MG013 No Alate Hypoponera MG014 No Alate Hypoponera MG016 Yes Alate Hypoponera MG021 No Alate Hypoponera MG025 No Alate Hypoponera MG026 Yes Alate Hypoponera MG027 No Alate Hypoponera MG031 Yes Alate Hypoponera MG036 No Alate Hypoponera MG038 No Alate Hypoponera MG039 Yes Alate

302

Species Wolbachia Infected Dispersal State Hypoponera MG040 Yes Alate Hypoponera MG041 No Alate Hypoponera MG042 No Alate Hypoponera MG045 No Alate Hypoponera MG046 Yes Alate Hypoponera MG047 Yes Alate Hypoponera MG048 Yes Alate Hypoponera MG051 Yes Alate Hypoponera MG052 No Alate Hypoponera MG054 No Alate Hypoponera MG056 No Alate Hypoponera MG058 No Alate Hypoponera MG064 No Alate Hypoponera MG065 No Alate Hypoponera MG066 Yes Alate Hypoponera MG067 No Alate Hypoponera MG071 No Alate Hypoponera MG072 No Alate Hypoponera MG073 No Alate Hypoponera MG075 No Alate Hypoponera MG076 No Alate Hypoponera MG077 No Alate Hypoponera MG079 No Alate Hypoponera MG080 No Alate Hypoponera MG081 No Alate Hypoponera MG082 No Alate Hypoponera MG087 No Alate Hypoponera MG088 No Alate Hypoponera MG089 No Alate Hypoponera punctatissima Yes Alate Lepisiota canescens Yes Alate Leptogenys angusta Yes Ergatoid Leptogenys coerulescens No Ergatoid Leptogenys JCR21 No Ergatoid Leptogenys JCR23 Yes Ergatoid Leptogenys JCR24 Yes Ergatoid Leptogenys JCR25 Yes Ergatoid Leptogenys JCR29 Yes Ergatoid Leptogenys JCR31 Yes Ergatoid Melissotarsus insularis Yes Alate Meranoplus mayri No Alate Meranoplus radamae Yes Alate Monomorium chnodes Yes Alate Monomorium clarinode No Alate Monomorium destructor No Alate Monomorium exiguum Yes Alate Monomorium fisheri Yes Alate Monomorium floricola No Alate Monomorium gongromos Yes Alate Monomorium hanneli Yes Alate

303

Species Wolbachia Infected Dispersal State Monomorium hildebrandti Yes Alate Monomorium infuscum No Alate Monomorium latinode No Alate Monomorium madecassum Yes Alate Monomorium modestum Yes Alate Monomorium notorthotenes No Alate Monomorium pharaonis No Alate Monomorium sechellense No Alate Monomorium subopacum No Alate Monomorium termitobium Yes Alate Mystrium MG01 No Alate Mystrium mysticum No Ergatoid Mystrium oberthueri Yes Ergatoid Mystrium rogeri No Alate Nesomyrmex madecassus Yes Alate Nesomyrmex MG04 Yes Alate Nesomyrmex MG06 Yes Alate Nesomyrmex MG10 No Alate Nesomyrmex sikorai Yes Alate Nylanderia bourbonica Yes Alate Nylanderia madagascarensis No Alate Odontomachus coquereli Yes Ergatoid Odontomachus simillimus Yes Alate Odontomachus troglodytes Yes Alate Pachycondyla ambigua No Alate Pachycondyla cambouei Yes Alate Pachycondyla JCR05 No Ergatoid Pachycondyla melanaria No Alate Pachycondyla sikorae No Alate Pachycondyla wasmannii Yes Alate Paratrechina longicornis Yes Alate Pheidole annemariae Yes Alate Pheidole bessonii Yes Alate Pheidole californica Yes Alate Pheidole flavens farquharensis No Alate Pheidole grallatrix No Alate Pheidole longispinosa No Alate Pheidole megacephala Yes Alate Pheidole MG001 Yes Alate Pheidole MG004 No Alate Pheidole MG007 Yes Alate Pheidole MG009 No Alate Pheidole MG010 No Alate Pheidole MG011 No Alate Pheidole MG015 Yes Alate Pheidole MG016 No Alate Pheidole MG018 Yes Alate Pheidole MG020 No Alate Pheidole MG021 No Alate Pheidole MG022 No Alate

304

Species Wolbachia Infected Dispersal State Pheidole MG024 No Alate Pheidole MG029 No Alate Pheidole MG073 No Alate Pheidole MG074 No Alate Pheidole MG075 No Alate Pheidole MG077 No Alate Pheidole MG078 Yes Alate Pheidole MG081 Yes Alate Pheidole MG109 No Alate Pheidole MG118 No Alate Pheidole MG119 No Alate Pheidole MG121 No Alate Pheidole MG126 Yes Alate Pheidole MG145 Yes Alate Pheidole MG145 Yes Alate Pheidole MG147 No Alate Pheidole MG151 Yes Alate Pheidole MG155 No Alate Pheidole MG158 No Alate Pheidole MGs056 No Alate Pheidole MGs075 No Alate Pheidole MGs123 Yes Alate Pheidole nemoralis No Alate Pheidole oswaldi No Alate Pheidole SC01 No Alate Pheidole sikorae litigiosa No Alate Pheidole voeltzkowii No Alate Plagiolepis alluaudi Yes Alate Plagiolepis madecassa Yes Alate Plagiolepis MG05 Yes Alate Platythyrea arthuri Yes Alate Platythyrea mocquerysi No Alate Ponera exotica Yes Alate Prionopelta MG01 Yes Alate Prionopelta SC01 No Alate Solenopsis mameti Yes Alate Strumigenys actis Yes Alate Strumigenys admixta No Alate Strumigenys alperti No Alate Strumigenys ampyx Yes Alate Strumigenys apios Yes Alate Strumigenys bathron No Alate Strumigenys bibiolona Yes Alate Strumigenys cabira No Alate Strumigenys carolinae No Alate Strumigenys chilo Yes Alate Strumigenys chroa Yes Alate Strumigenys coveri Yes Alate Strumigenys covina Yes Alate Strumigenys deverra Yes Alate

305

Species Wolbachia Infected Dispersal State Strumigenys dexis No Alate Strumigenys dicomas Yes Alate Strumigenys diux No Alate Strumigenys dora No Alate Strumigenys fanano No Alate Strumigenys fronto No Alate Strumigenys glycon No Alate Strumigenys grandidieri No Alate Strumigenys inatos No Alate Strumigenys labaris No Alate Strumigenys levana No Alate Strumigenys lexex Yes Alate Strumigenys livens No Alate Strumigenys luca Yes Alate Strumigenys lucomo Yes Alate Strumigenys lura No Alate Strumigenys lutron No Alate Strumigenys lysis Yes Alate Strumigenys manga No Alate Strumigenys MG01 No Alate Strumigenys MG075 No Alate Strumigenys origo No Alate Strumigenys rabesoni No Alate Strumigenys scotti No Alate Strumigenys sphera Yes Alate Strumigenys sylvaini Yes Alate Strumigenys vazimba Yes Alate Strumigenys wardi No Alate Tapinoma melanocephalum Yes Alate Tapinoma MG03 Yes Alate Tapinoma subtile Yes Alate Technomyrmex albipes Yes Alate Technomyrmex difficilis Yes Alate Technomyrmex madecassus Yes Alate Terataner alluaudi No Ergatoid Terataner MG14 No Ergatoid Terataner xaltus No Ergatoid Tetramorium ambatovy No Alate Tetramorium andrei No Alate Tetramorium bessonii No Alate Tetramorium bicarinatum Yes Alate Tetramorium cognatum Yes Alate Tetramorium coillum Yes Alate Tetramorium delagoense No Alate Tetramorium dysalum No Alate Tetramorium electrum No Alate Tetramorium humbloti No Alate Tetramorium kelleri No Alate Tetramorium lanuginosum No Alate Tetramorium mahafaly No Alate

306

Species Wolbachia Infected Dispersal State Tetramorium malagasy No Alate Tetramorium marginatum No Alate Tetramorium MG031 No Alate Tetramorium MG035 Yes Alate Tetramorium MG036 Yes Alate Tetramorium MG037 Yes Alate Tetramorium MG039 Yes Alate Tetramorium MG042 Yes Alate Tetramorium MG046 No Alate Tetramorium MG047 Yes Alate Tetramorium MG076 No Alate Tetramorium MG083 No Alate Tetramorium MG111 Yes Alate Tetramorium naganum No Alate Tetramorium norvigi Yes Alate Tetramorium pleganon No Alate Tetramorium plesiarum Yes Alate Tetramorium popell No Alate Tetramorium proximum Yes Alate Tetramorium quasirum Yes Alate Tetramorium scytalum No Alate Tetramorium sericeiventre No Alate Tetramorium severini No Alate Tetramorium shamshir No Alate Tetramorium simillimum No Alate Tetramorium tosii No Alate Tetramorium zenatum Yes Alate Tetraponera grandidieri Yes Alate Tetraponera merita Yes Alate Tetraponera MG02 Yes Alate

307