DOCSLIB.ORG

Suporting Table 1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Suporting Table 1 MCB00752-08 Version 2 Myc inhibits p27-induced erythroid differentiation of leukemia cells by repressing erythroid master genes without reversing the p27-mediated ell cycle arrest. Acosta et al. SUPPLEMENTAL INFORMATION TABLE S1 Human primers used in the RT-qPCR assays.. Amplicon Gene Primers (5’3’) size (bp) CCAAGCTTCGTGGAACTCTC GATA1 202 CCTGCCCGTTTACTGACAAT TGATGGGCTACGGCTTCTAC GFP 156 CCTCGTAGCGGTAGCTGAAG CATTGATCACTTGTCTCTGG GYPA 220 GAGAAAGGGTACAACTTGCC CTGGTCGGAGCCTGTGTC EPOR 103 GAGCACGGTCAGCAGCAC AGCCTGACAGGGCTTTTG JUNB 201 GGGCTGTTCCATTTTAGTGC GATGCCTTAAAACGGAGGAAC MAD1 147 ACTTGATTCGGGTCCAAGTG AGTTCCAGGGAGCTCTGTCC MAFK 186 CACCTCCTCCTTGGTGAGAC AAGACTCCAGCGCCTTCTCTC MYC 527 GTTTTCCAACTCCGGGATCTG GGAACTGACTTGGCAGGAGA NFE2 177 TAAGGTGGTGGAGGAAGTGG CCGGCTAACTCTGAGGACAC p27 120 AGAAGAATCGTCGGTTGCAG TCACCGCCCTACACATCAAACT RPS14 157 CTGCGAGTGCTGTCAGAGG GCAAGAAGGTGCTGACTTCC ε-globin 169 TGCCAAAGTGAGTAGCCAGA GAGGACCATCATTGTGTCCA ζ-globin 165 AGTGCGGGAAGTAGGTCTTG 1 TABLE S2 Primary antibodies used in this work. It is indicated their use in immunoblot blot (IB), immunofluorescence (IF), immunoprecipitation (IP). Used Reference Antigen Type Origin for Actin Goat polyclonal Santa Cruz Biotech. IB I-19, sc-1616 Cdk1 Rabbit polyclonal Upstate Biotechnology IB 06-194 Cdk2 Rabbit polyclonal Santa Cruz Biotech. IB, IP M2, sc-163 Cdk4 Rabbit polyclonal Santa Cruz Biotech. IB C-22, sc-260 Cdk6 Rabbit polyclonal Santa Cruz Biotech. IB C-21, sc-177 Cyclin A Rabbit polyclonal Upstate Biotechnology IB 06-138 Cyclin B1 Mouse monoclonal Santa Cruz Biotech. IB GNS1, sc-245 Cyclin D1 Rabbit polyclonal Upstate Biotechnology IB 06-137 Cyclin D1 Mouse monoclonal Neomarkers IP Ab-2, DCS-11 Cyclin D2 Rabbit polyclonal Santa Cruz Biotech. IB C-17, sc-181 Cyclin D2 Mouse monoclonal Santa Cruz Biotech. IP DCS-5, sc-53637 Cyclin D3 Rabbit polyclonal Santa Cruz Biotech. IB, IP C-16, sc-182 Cyclin D3 Mouse monoclonal Santa Cruz Biotech. IP D-7, sc-6283 GATA1 Rat monoclonal Santa Cruz Biotech. IB N-6, sc-265 γ-Globin Mouse monoclonal Santa Cruz Biotech. IB Sc-21756 Mad1 Goat polyclonal Santa Cruz Biotech. IB, IF C-19, sc-222 Max Rabbit polyclonal Santa Cruz Biotech. IB C-124, sc-765 Mnt Rabbit polyclonal Santa Cruz Biotech. IB M-132, sc-769 Mxi1 Goat polyclonal Santa Cruz Biotech. IB C-17, sc-1720 Myc Rabbit polyclonal Santa Cruz Biotech. IB, IF N-262, sc-764 Myc, MadMyc Mouse monoclonal Santa Cruz Biotech. IB 9E10, sc-40 NFE2 Rabbit polyclonal Santa Cruz Biotech. IB C-19, sc-29 p21 Rabbit polyclonal Santa Cruz Biotech. IB, IP C-19, sc-528 p27 Mouse monoclonal BD Transduction Labs. IF Clone 57, 610242 p27 Rabbit polyclonal Santa Cruz Biotech IB C-19, sc-528 RB Rabbit polyclonal Santa Cruz Biotech IB C-15, sc-50 p-RB (S780) Rabbit polyclonal Cell Signaling IB 9307 p-RB (T821) Rabbit polyclonal Abcam IB 32015 Gift of Nicholas Cowan, IB - α-tubulin Rabbit polyclonal New York University 2 TABLE S3 Genes regulated by MYC in Kp27MER in the presence of p27. The table lists 200 genes showing an expression change in Kp27MER cells treated with ZnSO4 (p27 inducer) versus cells treated with ZnSO4 plus 4HT (MYC activator). Changes induced by 4HT in parental cells are subtracted. Values are mean of fold change (expressed as log2) of two independent experiments. The table includes genes with a fold change ≥log21.2 (≥2.3-fold)) and with a signal difference ≥50 between both experimental conditions (as defined by dChip program and with Affymetrix U133 biochip data). A negative fold change indicates down-regulation upon MYC activation. Genes in bold are erythroid-related genes included in Table 4. Fold Locus change GENE Link (log2) ZNF460: zinc finger protein 460 10794 6.65 NRTN: neurturin 4902 3.89 DUSP9: dual specificity phosphatase 9 1852 3.34 RAB3A: RAB3A, member RAS oncogene family 5864 2.77 LOC89944: hypothetical protein BC008326 89944 2.69 MATK: megakaryocyte-associated tyrosine kinase 4145 2.65 LOC221362: hypothetical protein LOC221362 221362 2.59 SLC19A2: solute carrier family 19 (thiamine transporter), member 2 10560 2.28 SLC39A6: solute carrier family 39 (zinc transporter), member 6 25800 2.2 JAG2: jagged 2 3714 2.18 STUB1: STIP1 homology and U-box containing protein 1 10273 2.12 KIAA0179: KIAA0179 23076 2.08 C17orf25: chromosome 17 open reading frame 25 51031 2.06 NUP210: nucleoporin 210kDa 23225 2.05 AIM1L: absent in melanoma 1-like 55057 2.04 PEBP1: phosphatidylethanolamine binding protein 1 5037 2.02 C22orf9: chromosome 22 open reading frame 9 23313 1.99 BLMH: bleomycin hydrolase 642 1.96 NR1D2: nuclear receptor subfamily 1, group D, member 2 9975 1.92 SLC29A1: solute carrier family 29 (nucleoside transporters), member 1 2030 1.92 STEAP1: six transmembrane epithelial antigen of the prostate 1 26872 1.89 DDX28: DEAD (Asp-Glu-Ala-Asp) box polypeptide 28 55794 1.86 PTK7: PTK7 protein tyrosine kinase 7 5754 1.86 CECR5: cat eye syndrome chromosome region, candidate 5 27440 1.81 SLC17A7: solute carrier family 17, member 7 57030 1.81 ZNF395: zinc finger protein 395 55893 1.81 CUTC: cutC copper transporter homolog (E. coli) 51076 1.8 RGS16: regulator of G-protein signalling 16 6004 1.8 PEX5: peroxisomal biogenesis factor 5 5830 1.79 GCSH: glycine cleavage system protein H (aminomethyl carrier) 2653 1.76 SLC27A2: solute carrier family 27 (fatty acid transporter), member 2 11001 1.76 SPG21: spastic paraplegia 21, maspardin (autosomal recessive, Mast syndrome) 51324 1.76 GNPDA1: glucosamine-6-phosphate deaminase 1 10007 1.75 LPL: lipoprotein lipase 4023 1.73 MTMR4: myotubularin related protein 4 9110 1.72 SORD: sorbitol dehydrogenase 6652 1.72 DHCR7: 7-dehydrocholesterol reductase 1717 1.7 MRPL4: mitochondrial ribosomal proteína L4 51073 1.7 SLC5A3: solute carrier family 5 (inositol transporters), member 3 6526 1.7 EXPH5: exophilin 5 23086 1.69 MINA: MYC induced nuclear antigen 84864 1.69 3 Fold Locus change GENE Link (log2) TRIAP1: TP53 regulated inhibitor of apoptosis 1 51499 1.68 OXCT1: 3-oxoacid CoA transferase 1 5019 1.67 VPS13C: vacuolar protein sorting 13 homolog C (S. cerevisiae) 54832 1.67 HIG2: hypoxia-inducible protein 2 29923 1.65 DSCR2: Down syndrome critical region gene 2 8624 1.63 MPZL1: myelin protein zero-like 1 9019 1.63 CCNE1: cyclin E1 898 1.62 TSPO: translocator protein (18kDa) 706 1.62 NQO1: NAD(P)H dehydrogenase, quinone 1 1728 1.58 SKP2: S-phase kinase-associated protein 2 (p45) 6502 1.58 C19orf2: Chromosome 19 open reading frame 2 8725 1.56 CD320: CD320 molécula 51293 1.56 RGS14: regulator of G-protein signalling 14 10636 1.56 UCK2: uridine-cytidine kinase 2 7371 1.56 NOLC1: nucleolar and coiled-body phosphoprotein 1 9221 1.54 XPO6: exportin 6 23214 1.54 KIAA0090: KIAA0090 23065 1.52 KIAA0664: KIAA0664 23277 1.52 AATF: apoptosis antagonizing transcription factor 26574 1.51 PWP1: PWP1 homolog (S. cerevisiae) 11137 1.5 LEPR: leptin receptor 3953 1.49 CTPS: CTP synthase 1503 1.48 DDX48: DEAD (Asp-Glu-Ala-Asp) box polypeptide 48 9775 1.47 PRPF19: PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae) 27339 1.47 RCHY1: ring finger and CHY zinc finger domain containing 1 25898 1.47 SLC39A4: solute carrier family 39 (zinc transporter), member 4 55630 1.47 LAS1L: LAS1-like (S. cerevisiae) 81887 1.45 PDCD11: programmed cell death 11 22984 1.44 GCDH: glutaryl-Coenzyme A dehydrogenase 2639 1.43 REPIN1: replication initiator 1 29803 1.43 ODC1: ornithine decarboxylase 1 4953 1.42 WDR74: WD repeat domain 74 /// WD repeat domain 74 54663 1.42 LYPLA1: lysophospholipase I 10434 1.41 TMEM161A: transmembrane protein 161A 54929 1.4 EIF3S1: eukaryotic translation initiation factor 3, subunit 1 alpha, 35kDa 8669 1.39 MAST2: microtubule associated serine/threonine kinase 2 23139 1.39 NUP214: nucleoporin 214kDa 8021 1.39 OPN3: opsin 3 (encephalopsin, panopsin) 23596 1.38 MTRR: 5-methyltetrahydrofolate-homocysteine methyltransferase reductase 4552 1.37 FBXO41: F-box protein 41 150726 1.36 GLS: glutaminase 2744 1.36 PARP1: poly (ADP-ribose) polymerase family, member 1 142 1.36 CSE1L: CSE1 chromosome segregation 1-like 1434 1.34 LYPLA2: lysophospholipase II 11313 -1.32 ADAMTSL4: ADAMTS-like 4 54507 -1.33 ACRV1: acrosomal vesicle protein 1 56 -1.35 CAP1: CAP, adenylate cyclase-associated protein 1 (yeast) 10487 -1.35 CSGlcA-T: chondroitin sulfate glucuronyltransferase 54480 -1.35 KRT10: keratin 10 (epidermolytic hyperkeratosis) 3858 -1.35 CMTM6: CKLF-like MARVEL transmembrane domain containing 6 54918 -1.36 GYPB: glycophorin B (MNS blood group) 2994 -1.36 4 Fold Locus change GENE Link (log2) NFE2: nuclear factor (erythroid-derived 2), 45kDa 4778 -1.36 RAB5B: RAB5B, member RAS oncogene family 5869 -1.36 EPB49: erythrocyte membrane protein band 4.9 (dematin) 2039 -1.38 MPP1: membrane protein, palmitoylated 1, 55kDa 4354 -1.39 RHOG: ras homolog gene family, member G (rho G) 391 -1.4 LASP1: LIM and SH3 protein 1 3927 -1.41 KYNU: kynureninase (L-kynurenine hydrolase) 8942 -1.42 LYL1: lymphoblastic leukemia derived sequence 1 4066 -1.42 TNNT1: troponin T type 1 (skeletal, slow) 7138 -1.42 BCAM: basal cell adhesion molecule (Lutheran blood group) 4059 -1.43 UGP2: UDP-glucose pyrophosphorylase 2 7360 -1.43 ARFGAP3: ADP-ribosylation factor GTPase activating protein 3 26286 -1.44 KRT8: keratin 8 3856 -1.44 MINK1: misshapen-like kinase 1 (zebrafish) 50488 -1.44 USP11: ubiquitin specific peptidase 11 8237 -1.44 ALAS2: aminolevulinate, delta-, synthase 2 212 -1.45 SIDT2: SID1 transmembrane family, member 2 51092 -1.45 STAT5A: signal transducer and activator of transcription 5A 6776 -1.45 TMEM110: transmembrane protein 110 375346 -1.45 NEU1: sialidase 1/neuraminidase
Load more

Recommended publications
  • Gene Expression Studies: from Case-Control to Multiple-Population-Based Studies
    From the Institute of Human Genetics, Helmholtz Zentrum Munchen,¨ Deutsches Forschungszentrum fur¨ Gesundheit und Umwelt (GmbH) Head: Prof. Dr. Thomas Meitinger Gene expression studies: From case-control to multiple-population-based studies Thesis Submitted for a Doctoral Degree in Natural Sciences at the Faculty of Medicine, Ludwig-Maximilians-Universitat¨ Munchen¨ Katharina Schramm Dachau, Germany 2016 With approval of the Faculty of Medicine Ludwig-Maximilians-Universit¨atM ¨unchen Supervisor/Examiner: Prof. Dr. Thomas Illig Co-Examiners: Prof. Dr. Roland Kappler Dean: Prof. Dr. med. dent. Reinhard Hickel Date of oral examination: 22.12.2016 II Dedicated to my family. III Abstract Recent technological developments allow genome-wide scans of gene expression levels. The reduction of costs and increasing parallelization of processing enable the quantification of 47,000 transcripts in up to twelve samples on a single microarray. Thereby the data collec- tion of large population-based studies was improved. During my PhD, I first developed a workflow for the statistical analyses of case-control stu- dies of up to 50 samples. With large population-based data sets generated I established a pipeline for quality control, data preprocessing and correction for confounders, which re- sulted in substantially improved data. In total, I processed more than 3,000 genome-wide expression profiles using the generated pipeline. With 993 whole blood samples from the population-based KORA (Cooperative Health Research in the Region of Augsburg) study we established one of the largest population-based resource. Using this data set we contributed to a number of transcriptome-wide association studies within national (MetaXpress) and international (CHARGE) consortia.
    [Show full text]
  • A Study of Chemotherapy Resistance in Acute Myeloid Leukemia
    A Study of Chemotherapy Resistance in Acute Myeloid Leukemia A DISSERTATION SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL OF THE UNIVERSITY OF MINNESOTA BY Susan Kay Rathe IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY David A. Largaespada October, 2013 © Susan Kay Rathe 2013 Acknowledgements Funding: The leukemia research was funded by The Leukemia & Lymphoma Society (grant 7019-04). The MMuFLR workflow was funded by The Children's Cancer Research Fund. University of Minnesota Resources: The BioMedical Genomics Center provided services for gene expression microarray, RNA sequencing, oligo preparation, and Sanger sequencing. The Minnesota Supercomputing Institute maintains the Galaxy Software, as well as provides data management services and training. The Masonic Cancer Center Bioinformatics Core provided guidance in the analysis of the RNA-seq data. The FDA Drug Screen was performed at the Institute for Therapeutics Discovery and Development. Colleagues: First and foremost, I would like to recognize Dr. David Largaespada for his mentorship and the opportunity to continue research he started while a postdoc in Dr. Neal Copeland’s lab. I would also like to thank the many members of the Largaespada lab who provided direct or indirect assistance to my research. Dr. Bin Yin continued Dr. Largaespada’s work on the BXH-2 AML cell lines by making drug resistant derivatives and provided training in cell culture and drug assay techniques. Dr. Won-Il Kim developed the TNM mouse model and provided training in mouse related experimental techniques. Miechaleen Diers did all of the tail vein injections for the AML transplants and assisted with necropsies.
    [Show full text]
  • To Study Mutant P53 Gain of Function, Various Tumor-Derived P53 Mutants
    Differential effects of mutant TAp63γ on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression. A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science By Shama K Khokhar M.Sc., Bilaspur University, 2004 B.Sc., Bhopal University, 2002 2007 1 COPYRIGHT SHAMA K KHOKHAR 2007 2 WRIGHT STATE UNIVERSITY SCHOOL OF GRADUATE STUDIES Date of Defense: 12-03-07 I HEREBY RECOMMEND THAT THE THESIS PREPARED UNDER MY SUPERVISION BY SHAMA KHAN KHOKHAR ENTITLED Differential effects of mutant TAp63γ on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression BE ACCEPTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF Master of Science Madhavi P. Kadakia, Ph.D. Thesis Director Daniel Organisciak , Ph.D. Department Chair Committee on Final Examination Madhavi P. Kadakia, Ph.D. Steven J. Berberich, Ph.D. Michael Leffak, Ph.D. Joseph F. Thomas, Jr., Ph.D. Dean, School of Graduate Studies 3 Abstract Khokhar, Shama K. M.S., Department of Biochemistry and Molecular Biology, Wright State University, 2007 Differential effect of TAp63γ mutants on transactivation of p53 and/or p63 responsive genes and their effects on global gene expression. p63, a member of the p53 gene family, known to play a role in development, has more recently also been implicated in cancer progression. Mice lacking p63 exhibit severe developmental defects such as limb truncations, abnormal skin, and absence of hair follicles, teeth, and mammary glands. Germline missense mutations of p63 have been shown to be responsible for several human developmental syndromes including SHFM, EEC and ADULT syndromes and are associated with anomalies in the development of organs of epithelial origin.
    [Show full text]
  • Exploring Prostate Cancer Genome Reveals Simultaneous Losses of PTEN, FAS and PAPSS2 in Patients with PSA Recurrence After Radical Prostatectomy
    Int. J. Mol. Sci. 2015, 16, 3856-3869; doi:10.3390/ijms16023856 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Article Exploring Prostate Cancer Genome Reveals Simultaneous Losses of PTEN, FAS and PAPSS2 in Patients with PSA Recurrence after Radical Prostatectomy Chinyere Ibeawuchi 1, Hartmut Schmidt 2, Reinhard Voss 3, Ulf Titze 4, Mahmoud Abbas 5, Joerg Neumann 6, Elke Eltze 7, Agnes Marije Hoogland 8, Guido Jenster 9, Burkhard Brandt 10 and Axel Semjonow 1,* 1 Prostate Center, Department of Urology, University Hospital Muenster, Albert-Schweitzer-Campus 1, Gebaeude 1A, Muenster D-48149, Germany; E-Mail: [email protected] 2 Center for Laboratory Medicine, University Hospital Muenster, Albert-Schweitzer-Campus 1, Gebaeude 1A, Muenster D-48149, Germany; E-Mail: [email protected] 3 Interdisciplinary Center for Clinical Research, University of Muenster, Albert-Schweitzer-Campus 1, Gebaeude D3, Domagkstrasse 3, Muenster D-48149, Germany; E-Mail: [email protected] 4 Pathology, Lippe Hospital Detmold, Röntgenstrasse 18, Detmold D-32756, Germany; E-Mail: [email protected] 5 Institute of Pathology, Mathias-Spital-Rheine, Frankenburg Street 31, Rheine D-48431, Germany; E-Mail: [email protected] 6 Institute of Pathology, Klinikum Osnabrueck, Am Finkenhuegel 1, Osnabrueck D-49076, Germany; E-Mail: [email protected] 7 Institute of Pathology, Saarbrücken-Rastpfuhl, Rheinstrasse 2, Saarbrücken D-66113, Germany; E-Mail: [email protected] 8 Department
    [Show full text]
  • Dematin (18): Sc-135881
    SAN TA C RUZ BI OTEC HNOL OG Y, INC . Dematin (18): sc-135881 BACKGROUND APPLICATIONS Caldesmon, Filamin 1, Nebulin, Villin, Plastin, ADF, Gelsolin, Dematin and Dematin (18) is recommended for detection of Dematin of mouse, rat and Cofilin are differentially expressed Actin binding proteins. Dematin is a human origin by Western Blotting (starting dilution 1:200, dilution range bundling protein of the erythrocyte membrane skeleton. Dematin is localized 1:100-1:1000), immunoprecipitation [1-2 µg per 100-500 µg of total protein to the spectrin-Actin junctions and its Actin-bundling activity is abolished (1 ml of cell lysate)] and immunofluorescence (starting dilution 1:50, dilution upon phosphorylation by cAMP-dependent protein kinase. It may also play a range 1:50-1:500). role in the regulation of cell shape, implying a role in tumorigenesis. Dematin Suitable for use as control antibody for Dematin siRNA (h): sc-105286, is a trimeric protein containing two identical subunits and a larger subunit. Dematin siRNA (m): sc-142992, Dematin shRNA Plasmid (h): sc-105286-SH, It is localized to the heart, brain, lung, skeletal muscle and kidney. The Dematin shRNA Plasmid (m): sc-142992-SH, Dematin shRNA (h) Lentiviral Dematin gene is located on human chromosome 8p21, a region frequently Particles: sc-105286-V and Dematin shRNA (m) Lentiviral Particles: delet ed in prostate cancer, and mouse chromosome 14. sc-142992-V. REFERENCES Molecular Weight of Dematin: 52/48 kDa. 1. Rana, A.P., et al. 1993. Cloning of human erythroid Dematin reveals Positive Controls: Hep G2 cell lysate: sc-2227.
    [Show full text]
  • Supp Material.Pdf
    Simon et al. Supplementary information: Table of contents p.1 Supplementary material and methods p.2-4 • PoIy(I)-poly(C) Treatment • Flow Cytometry and Immunohistochemistry • Western Blotting • Quantitative RT-PCR • Fluorescence In Situ Hybridization • RNA-Seq • Exome capture • Sequencing Supplementary Figures and Tables Suppl. items Description pages Figure 1 Inactivation of Ezh2 affects normal thymocyte development 5 Figure 2 Ezh2 mouse leukemias express cell surface T cell receptor 6 Figure 3 Expression of EZH2 and Hox genes in T-ALL 7 Figure 4 Additional mutation et deletion of chromatin modifiers in T-ALL 8 Figure 5 PRC2 expression and activity in human lymphoproliferative disease 9 Figure 6 PRC2 regulatory network (String analysis) 10 Table 1 Primers and probes for detection of PRC2 genes 11 Table 2 Patient and T-ALL characteristics 12 Table 3 Statistics of RNA and DNA sequencing 13 Table 4 Mutations found in human T-ALLs (see Fig. 3D and Suppl. Fig. 4) 14 Table 5 SNP populations in analyzed human T-ALL samples 15 Table 6 List of altered genes in T-ALL for DAVID analysis 20 Table 7 List of David functional clusters 31 Table 8 List of acquired SNP tested in normal non leukemic DNA 32 1 Simon et al. Supplementary Material and Methods PoIy(I)-poly(C) Treatment. pIpC (GE Healthcare Lifesciences) was dissolved in endotoxin-free D-PBS (Gibco) at a concentration of 2 mg/ml. Mice received four consecutive injections of 150 μg pIpC every other day. The day of the last pIpC injection was designated as day 0 of experiment.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • Human Lectins, Their Carbohydrate Affinities and Where to Find Them
    biomolecules Review Human Lectins, Their Carbohydrate Affinities and Where to Review HumanFind Them Lectins, Their Carbohydrate Affinities and Where to FindCláudia ThemD. Raposo 1,*, André B. Canelas 2 and M. Teresa Barros 1 1, 2 1 Cláudia D. Raposo * , Andr1 é LAQVB. Canelas‐Requimte,and Department M. Teresa of Chemistry, Barros NOVA School of Science and Technology, Universidade NOVA de Lisboa, 2829‐516 Caparica, Portugal; [email protected] 12 GlanbiaLAQV-Requimte,‐AgriChemWhey, Department Lisheen of Chemistry, Mine, Killoran, NOVA Moyne, School E41 of ScienceR622 Co. and Tipperary, Technology, Ireland; canelas‐ [email protected] NOVA de Lisboa, 2829-516 Caparica, Portugal; [email protected] 2* Correspondence:Glanbia-AgriChemWhey, [email protected]; Lisheen Mine, Tel.: Killoran, +351‐212948550 Moyne, E41 R622 Tipperary, Ireland; [email protected] * Correspondence: [email protected]; Tel.: +351-212948550 Abstract: Lectins are a class of proteins responsible for several biological roles such as cell‐cell in‐ Abstract:teractions,Lectins signaling are pathways, a class of and proteins several responsible innate immune for several responses biological against roles pathogens. such as Since cell-cell lec‐ interactions,tins are able signalingto bind to pathways, carbohydrates, and several they can innate be a immuneviable target responses for targeted against drug pathogens. delivery Since sys‐ lectinstems. In are fact, able several to bind lectins to carbohydrates, were approved they by canFood be and a viable Drug targetAdministration for targeted for drugthat purpose. delivery systems.Information In fact, about several specific lectins carbohydrate were approved recognition by Food by andlectin Drug receptors Administration was gathered for that herein, purpose. plus Informationthe specific organs about specific where those carbohydrate lectins can recognition be found by within lectin the receptors human was body.
    [Show full text]
  • Supplementary Data
    Progressive Disease Signature Upregulated probes with progressive disease U133Plus2 ID Gene Symbol Gene Name 239673_at NR3C2 nuclear receptor subfamily 3, group C, member 2 228994_at CCDC24 coiled-coil domain containing 24 1562245_a_at ZNF578 zinc finger protein 578 234224_at PTPRG protein tyrosine phosphatase, receptor type, G 219173_at NA NA 218613_at PSD3 pleckstrin and Sec7 domain containing 3 236167_at TNS3 tensin 3 1562244_at ZNF578 zinc finger protein 578 221909_at RNFT2 ring finger protein, transmembrane 2 1552732_at ABRA actin-binding Rho activating protein 59375_at MYO15B myosin XVB pseudogene 203633_at CPT1A carnitine palmitoyltransferase 1A (liver) 1563120_at NA NA 1560098_at AKR1C2 aldo-keto reductase family 1, member C2 (dihydrodiol dehydrogenase 2; bile acid binding pro 238576_at NA NA 202283_at SERPINF1 serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), m 214248_s_at TRIM2 tripartite motif-containing 2 204766_s_at NUDT1 nudix (nucleoside diphosphate linked moiety X)-type motif 1 242308_at MCOLN3 mucolipin 3 1569154_a_at NA NA 228171_s_at PLEKHG4 pleckstrin homology domain containing, family G (with RhoGef domain) member 4 1552587_at CNBD1 cyclic nucleotide binding domain containing 1 220705_s_at ADAMTS7 ADAM metallopeptidase with thrombospondin type 1 motif, 7 232332_at RP13-347D8.3 KIAA1210 protein 1553618_at TRIM43 tripartite motif-containing 43 209369_at ANXA3 annexin A3 243143_at FAM24A family with sequence similarity 24, member A 234742_at SIRPG signal-regulatory protein gamma
    [Show full text]
  • Identification of Novel Genes in Human Airway Epithelial Cells Associated with Chronic Obstructive Pulmonary Disease (COPD) Usin
    www.nature.com/scientificreports OPEN Identifcation of Novel Genes in Human Airway Epithelial Cells associated with Chronic Obstructive Received: 6 July 2018 Accepted: 7 October 2018 Pulmonary Disease (COPD) using Published: xx xx xxxx Machine-Based Learning Algorithms Shayan Mostafaei1, Anoshirvan Kazemnejad1, Sadegh Azimzadeh Jamalkandi2, Soroush Amirhashchi 3, Seamas C. Donnelly4,5, Michelle E. Armstrong4 & Mohammad Doroudian4 The aim of this project was to identify candidate novel therapeutic targets to facilitate the treatment of COPD using machine-based learning (ML) algorithms and penalized regression models. In this study, 59 healthy smokers, 53 healthy non-smokers and 21 COPD smokers (9 GOLD stage I and 12 GOLD stage II) were included (n = 133). 20,097 probes were generated from a small airway epithelium (SAE) microarray dataset obtained from these subjects previously. Subsequently, the association between gene expression levels and smoking and COPD, respectively, was assessed using: AdaBoost Classifcation Trees, Decision Tree, Gradient Boosting Machines, Naive Bayes, Neural Network, Random Forest, Support Vector Machine and adaptive LASSO, Elastic-Net, and Ridge logistic regression analyses. Using this methodology, we identifed 44 candidate genes, 27 of these genes had been previously been reported as important factors in the pathogenesis of COPD or regulation of lung function. Here, we also identifed 17 genes, which have not been previously identifed to be associated with the pathogenesis of COPD or the regulation of lung function. The most signifcantly regulated of these genes included: PRKAR2B, GAD1, LINC00930 and SLITRK6. These novel genes may provide the basis for the future development of novel therapeutics in COPD and its associated morbidities.
    [Show full text]
  • Detailed Characterization of Human Induced Pluripotent Stem Cells Manufactured for Therapeutic Applications
    Stem Cell Rev and Rep DOI 10.1007/s12015-016-9662-8 Detailed Characterization of Human Induced Pluripotent Stem Cells Manufactured for Therapeutic Applications Behnam Ahmadian Baghbaderani 1 & Adhikarla Syama2 & Renuka Sivapatham3 & Ying Pei4 & Odity Mukherjee2 & Thomas Fellner1 & Xianmin Zeng3,4 & Mahendra S. Rao5,6 # The Author(s) 2016. This article is published with open access at Springerlink.com Abstract We have recently described manufacturing of hu- help determine which set of tests will be most useful in mon- man induced pluripotent stem cells (iPSC) master cell banks itoring the cells and establishing criteria for discarding a line. (MCB) generated by a clinically compliant process using cord blood as a starting material (Baghbaderani et al. in Stem Cell Keywords Induced pluripotent stem cells . Embryonic stem Reports, 5(4), 647–659, 2015). In this manuscript, we de- cells . Manufacturing . cGMP . Consent . Markers scribe the detailed characterization of the two iPSC clones generated using this process, including whole genome se- quencing (WGS), microarray, and comparative genomic hy- Introduction bridization (aCGH) single nucleotide polymorphism (SNP) analysis. We compare their profiles with a proposed calibra- Induced pluripotent stem cells (iPSCs) are akin to embryonic tion material and with a reporter subclone and lines made by a stem cells (ESC) [2] in their developmental potential, but dif- similar process from different donors. We believe that iPSCs fer from ESC in the starting cell used and the requirement of a are likely to be used to make multiple clinical products. We set of proteins to induce pluripotency [3]. Although function- further believe that the lines used as input material will be used ally identical, iPSCs may differ from ESC in subtle ways, at different sites and, given their immortal status, will be used including in their epigenetic profile, exposure to the environ- for many years or even decades.
    [Show full text]