MCB00752-08 Version 2

Myc inhibits p27-induced erythroid differentiation of leukemia cells by repressing erythroid master without reversing the p27-mediated ell cycle arrest.

Acosta et al.

SUPPLEMENTAL INFORMATION

TABLE S1 primers used in the RT-qPCR assays..

Amplicon Primers (5’3’) size (bp) CCAAGCTTCGTGGAACTCTC GATA1 202 CCTGCCCGTTTACTGACAAT TGATGGGCTACGGCTTCTAC GFP 156 CCTCGTAGCGGTAGCTGAAG CATTGATCACTTGTCTCTGG GYPA 220 GAGAAAGGGTACAACTTGCC CTGGTCGGAGCCTGTGTC EPOR 103 GAGCACGGTCAGCAGCAC AGCCTGACAGGGCTTTTG JUNB 201 GGGCTGTTCCATTTTAGTGC GATGCCTTAAAACGGAGGAAC MAD1 147 ACTTGATTCGGGTCCAAGTG AGTTCCAGGGAGCTCTGTCC MAFK 186 CACCTCCTCCTTGGTGAGAC AAGACTCCAGCGCCTTCTCTC MYC 527 GTTTTCCAACTCCGGGATCTG GGAACTGACTTGGCAGGAGA NFE2 177 TAAGGTGGTGGAGGAAGTGG CCGGCTAACTCTGAGGACAC p27 120 AGAAGAATCGTCGGTTGCAG TCACCGCCCTACACATCAAACT RPS14 157 CTGCGAGTGCTGTCAGAGG GCAAGAAGGTGCTGACTTCC ε-globin 169 TGCCAAAGTGAGTAGCCAGA GAGGACCATCATTGTGTCCA ζ-globin 165 AGTGCGGGAAGTAGGTCTTG

1 TABLE S2 Primary antibodies used in this work. It is indicated their use in immunoblot blot (IB), immunofluorescence (IF), immunoprecipitation (IP).

Used Reference Antigen Type Origin for Goat polyclonal Santa Cruz Biotech. IB I-19, sc-1616 Cdk1 Rabbit polyclonal Upstate Biotechnology IB 06-194 Cdk2 Rabbit polyclonal Santa Cruz Biotech. IB, IP M2, sc-163 Cdk4 Rabbit polyclonal Santa Cruz Biotech. IB C-22, sc-260 Cdk6 Rabbit polyclonal Santa Cruz Biotech. IB C-21, sc-177 Cyclin A Rabbit polyclonal Upstate Biotechnology IB 06-138 Cyclin B1 Mouse monoclonal Santa Cruz Biotech. IB GNS1, sc-245 Cyclin D1 Rabbit polyclonal Upstate Biotechnology IB 06-137 Cyclin D1 Mouse monoclonal Neomarkers IP Ab-2, DCS-11 Cyclin D2 Rabbit polyclonal Santa Cruz Biotech. IB C-17, sc-181 Cyclin D2 Mouse monoclonal Santa Cruz Biotech. IP DCS-5, sc-53637 Cyclin D3 Rabbit polyclonal Santa Cruz Biotech. IB, IP C-16, sc-182 Cyclin D3 Mouse monoclonal Santa Cruz Biotech. IP D-7, sc-6283 GATA1 Rat monoclonal Santa Cruz Biotech. IB N-6, sc-265 γ-Globin Mouse monoclonal Santa Cruz Biotech. IB Sc-21756 Mad1 Goat polyclonal Santa Cruz Biotech. IB, IF C-19, sc-222 Max Rabbit polyclonal Santa Cruz Biotech. IB C-124, sc-765 Mnt Rabbit polyclonal Santa Cruz Biotech. IB M-132, sc-769 Mxi1 Goat polyclonal Santa Cruz Biotech. IB C-17, sc-1720 Myc Rabbit polyclonal Santa Cruz Biotech. IB, IF N-262, sc-764 Myc, MadMyc Mouse monoclonal Santa Cruz Biotech. IB 9E10, sc-40 NFE2 Rabbit polyclonal Santa Cruz Biotech. IB C-19, sc-29 p21 Rabbit polyclonal Santa Cruz Biotech. IB, IP C-19, sc-528 p27 Mouse monoclonal BD Transduction Labs. IF Clone 57, 610242 p27 Rabbit polyclonal Santa Cruz Biotech IB C-19, sc-528 RB Rabbit polyclonal Santa Cruz Biotech IB C-15, sc-50 p-RB (S780) Rabbit polyclonal Cell Signaling IB 9307 p-RB (T821) Rabbit polyclonal Abcam IB 32015 Gift of Nicholas Cowan, IB - α-tubulin Rabbit polyclonal New York University

2

TABLE S3 Genes regulated by MYC in Kp27MER in the presence of p27. The table lists 200 genes showing an expression change in Kp27MER cells treated with ZnSO4 (p27 inducer) versus cells treated with ZnSO4 plus 4HT (MYC activator). Changes induced by 4HT in parental cells are subtracted. Values are mean of fold change (expressed as log2) of two independent experiments. The table includes genes with a fold change ≥log21.2 (≥2.3-fold)) and with a signal difference ≥50 between both experimental conditions (as defined by dChip program and with Affymetrix U133 biochip data). A negative fold change indicates down-regulation upon MYC activation. Genes in bold are erythroid-related genes included in Table 4.

Fold change GENE Link (log2) ZNF460: zinc finger 460 10794 6.65 NRTN: neurturin 4902 3.89 DUSP9: dual specificity phosphatase 9 1852 3.34 RAB3A: RAB3A, member RAS oncogene family 5864 2.77 LOC89944: hypothetical protein BC008326 89944 2.69 MATK: megakaryocyte-associated tyrosine kinase 4145 2.65 LOC221362: hypothetical protein LOC221362 221362 2.59 SLC19A2: solute carrier family 19 (thiamine transporter), member 2 10560 2.28 SLC39A6: solute carrier family 39 (zinc transporter), member 6 25800 2.2 JAG2: jagged 2 3714 2.18 STUB1: STIP1 homology and U-box containing protein 1 10273 2.12 KIAA0179: KIAA0179 23076 2.08 C17orf25: 17 open reading frame 25 51031 2.06 NUP210: 210kDa 23225 2.05 AIM1L: absent in melanoma 1-like 55057 2.04 PEBP1: phosphatidylethanolamine binding protein 1 5037 2.02 C22orf9: chromosome 22 open reading frame 9 23313 1.99 BLMH: bleomycin hydrolase 642 1.96 NR1D2: nuclear receptor subfamily 1, group D, member 2 9975 1.92 SLC29A1: solute carrier family 29 (nucleoside transporters), member 1 2030 1.92 STEAP1: six transmembrane epithelial antigen of the prostate 1 26872 1.89 DDX28: DEAD (Asp-Glu-Ala-Asp) box polypeptide 28 55794 1.86 PTK7: PTK7 protein tyrosine kinase 7 5754 1.86 CECR5: cat eye syndrome chromosome region, candidate 5 27440 1.81 SLC17A7: solute carrier family 17, member 7 57030 1.81 ZNF395: zinc finger protein 395 55893 1.81 CUTC: cutC copper transporter homolog (E. coli) 51076 1.8 RGS16: regulator of G-protein signalling 16 6004 1.8 PEX5: peroxisomal biogenesis factor 5 5830 1.79 GCSH: glycine cleavage system protein H (aminomethyl carrier) 2653 1.76 SLC27A2: solute carrier family 27 (fatty acid transporter), member 2 11001 1.76 SPG21: spastic paraplegia 21, maspardin (autosomal recessive, Mast syndrome) 51324 1.76 GNPDA1: glucosamine-6-phosphate deaminase 1 10007 1.75 LPL: lipoprotein lipase 4023 1.73 MTMR4: myotubularin related protein 4 9110 1.72 SORD: sorbitol dehydrogenase 6652 1.72 DHCR7: 7-dehydrocholesterol reductase 1717 1.7 MRPL4: mitochondrial ribosomal proteína L4 51073 1.7 SLC5A3: solute carrier family 5 (inositol transporters), member 3 6526 1.7 EXPH5: exophilin 5 23086 1.69 MINA: MYC induced nuclear antigen 84864 1.69

3 Fold Locus change GENE Link (log2) TRIAP1: TP53 regulated inhibitor of apoptosis 1 51499 1.68 OXCT1: 3-oxoacid CoA transferase 1 5019 1.67 VPS13C: vacuolar protein sorting 13 homolog C (S. cerevisiae) 54832 1.67 HIG2: hypoxia-inducible protein 2 29923 1.65 DSCR2: Down syndrome critical region gene 2 8624 1.63 MPZL1: myelin protein zero-like 1 9019 1.63 CCNE1: cyclin E1 898 1.62 TSPO: translocator protein (18kDa) 706 1.62 NQO1: NAD(P)H dehydrogenase, quinone 1 1728 1.58 SKP2: S-phase kinase-associated protein 2 (p45) 6502 1.58 C19orf2: open reading frame 2 8725 1.56 CD320: CD320 molécula 51293 1.56 RGS14: regulator of G-protein signalling 14 10636 1.56 UCK2: uridine-cytidine kinase 2 7371 1.56 NOLC1: nucleolar and coiled-body phosphoprotein 1 9221 1.54 XPO6: exportin 6 23214 1.54 KIAA0090: KIAA0090 23065 1.52 KIAA0664: KIAA0664 23277 1.52 AATF: apoptosis antagonizing transcription factor 26574 1.51 PWP1: PWP1 homolog (S. cerevisiae) 11137 1.5 LEPR: leptin receptor 3953 1.49 CTPS: CTP synthase 1503 1.48 DDX48: DEAD (Asp-Glu-Ala-Asp) box polypeptide 48 9775 1.47 PRPF19: PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae) 27339 1.47 RCHY1: ring finger and CHY zinc finger domain containing 1 25898 1.47 SLC39A4: solute carrier family 39 (zinc transporter), member 4 55630 1.47 LAS1L: LAS1-like (S. cerevisiae) 81887 1.45 PDCD11: programmed cell death 11 22984 1.44 GCDH: glutaryl-Coenzyme A dehydrogenase 2639 1.43 REPIN1: replication initiator 1 29803 1.43 ODC1: ornithine decarboxylase 1 4953 1.42 WDR74: WD repeat domain 74 /// WD repeat domain 74 54663 1.42 LYPLA1: lysophospholipase I 10434 1.41 TMEM161A: transmembrane protein 161A 54929 1.4 EIF3S1: eukaryotic translation initiation factor 3, subunit 1 alpha, 35kDa 8669 1.39 MAST2: microtubule associated serine/threonine kinase 2 23139 1.39 NUP214: nucleoporin 214kDa 8021 1.39 OPN3: opsin 3 (encephalopsin, panopsin) 23596 1.38 MTRR: 5-methyltetrahydrofolate-homocysteine methyltransferase reductase 4552 1.37 FBXO41: F-box protein 41 150726 1.36 GLS: glutaminase 2744 1.36 PARP1: poly (ADP-ribose) polymerase family, member 1 142 1.36 CSE1L: CSE1 chromosome segregation 1-like 1434 1.34 LYPLA2: lysophospholipase II 11313 -1.32 ADAMTSL4: ADAMTS-like 4 54507 -1.33 ACRV1: acrosomal vesicle protein 1 56 -1.35 CAP1: CAP, adenylate cyclase-associated protein 1 (yeast) 10487 -1.35 CSGlcA-T: chondroitin sulfate glucuronyltransferase 54480 -1.35 KRT10: keratin 10 (epidermolytic hyperkeratosis) 3858 -1.35 CMTM6: CKLF-like MARVEL transmembrane domain containing 6 54918 -1.36 GYPB: glycophorin B (MNS blood group) 2994 -1.36

4 Fold Locus change GENE Link (log2) NFE2: nuclear factor (erythroid-derived 2), 45kDa 4778 -1.36 RAB5B: RAB5B, member RAS oncogene family 5869 -1.36 EPB49: erythrocyte membrane protein band 4.9 (dematin) 2039 -1.38 MPP1: membrane protein, palmitoylated 1, 55kDa 4354 -1.39 RHOG: ras homolog gene family, member G (rho G) 391 -1.4 LASP1: LIM and SH3 protein 1 3927 -1.41 KYNU: kynureninase (L-kynurenine hydrolase) 8942 -1.42 LYL1: lymphoblastic leukemia derived sequence 1 4066 -1.42 TNNT1: troponin T type 1 (skeletal, slow) 7138 -1.42 BCAM: basal cell adhesion molecule (Lutheran blood group) 4059 -1.43 UGP2: UDP-glucose pyrophosphorylase 2 7360 -1.43 ARFGAP3: ADP-ribosylation factor GTPase activating protein 3 26286 -1.44 KRT8: keratin 8 3856 -1.44 MINK1: misshapen-like kinase 1 (zebrafish) 50488 -1.44 USP11: ubiquitin specific peptidase 11 8237 -1.44 ALAS2: aminolevulinate, delta-, synthase 2 212 -1.45 SIDT2: SID1 transmembrane family, member 2 51092 -1.45 STAT5A: signal transducer and activator of transcription 5A 6776 -1.45 TMEM110: transmembrane protein 110 375346 -1.45 NEU1: sialidase 1/neuraminidase 4758 -1.46 GTF2F1: general transcription factor IIF, polypeptide 1, 74kDa 2962 -1.46 PEO1: progressive external ophthalmoplegia 1 56652 -1.47 STAT3: signal transducer and activator of transcription 3 6774 -1.48 GATA1: GATA binding protein 1 2623 -1.48 C5orf4: chromosome 5 open reading frame 4 10826 -1.49 CD63: CD63 molécula 967 -1.49 HMBS: hydroxymethylbilane synthase 3145 -1.49 KCNH2: potassium voltage-gated channel, subfamily H, member 2 3757 -1.49 SAMSN1: SAM domain, SH3 domain and nuclear localisation signals, 1 64092 -1.49 ARHGEF2: rho/rac guanine nucleotide exchange factor (GEF) 2 9181 -1.5 MINPP1: multiple inositol polyphosphate histidine phosphatase, 1 9562 -1.5 SHC1: SHC (Src homology 2 domain containing) transforming protein 1 6464 -1.5 CTAGE5: CTAGE family, member 5 4253 -1.51 JUNB: jun B proto-oncogene 3726 -1.51 PTPRC: protein tyrosine phosphatase, receptor type, C 5788 -1.51 RAC2: rho family, small GTP binding protein Rac2 5880 -1.52 KIAA0748: KIAA0748 9840 -1.53 KRT18: keratin 18 3875 -1.53 TRPV2: transient receptor potential cation channel, subfamily V, member 2 51393 -1.53 CLEC11A: C-type lectin domain family 11, member A 6320 -1.54 CTSD: cathepsin D (lysosomal aspartyl peptidase) 1509 -1.54 LRP10: low density lipoprotein receptor-related protein 10 26020 -1.54 RHOC: ras homolog gene family, member C 389 -1.56 S100A11: S100 calcium binding protein A11 (calgizzarin) 6282 -1.56 SERPINH1: serpin peptidase inhibitor, clade H , member 1 871 -1.56 AKR1C2: aldo-keto reductase family 1, member C2 1646 -1.57 AMPD3: adenosine monophosphate deaminase (isoform E) 272 -1.57 SEC14L1: SEC14-like 1 (S. cerevisiae) 6397 -1.57 CREM: cAMP responsive element modulator 1390 -1.58 NAGA: N-acetylgalactosaminidase, alpha- 4668 -1.58 RIT1: Ras-like without CAAX 1 6016 -1.58

5 Fold Locus change GENE Link (log2) HOXD1: homeobox D1 3231 -1.61 MCAM: melanoma cell adhesion molecule 4162 -1.61 MCL1: myeloid cell leukemia sequence 1 (BCL2-related) 4170 -1.61 RHCE: Rh blood group, CcEe antigens 6006 -1.61 CALB1: calbindin 1, 28kDa 793 -1.62 CAPN1: calpain 1, (mu/I) large subunit 823 -1.63 FLJ20245: hypothetical protein FLJ20245 54863 -1.63 PEX6: peroxisomal biogenesis factor 6 5190 -1.64 TNFAIP8: tumor necrosis factor, alpha-induced protein 8 25816 -1.65 AKR1C1: aldo-keto reductase family 1, member C1 1645 -1.66 RAB13: RAB13, member RAS oncogene family 5872 -1.66 GABRE: gamma-aminobutyric acid (GABA) A receptor, epsilon 2564 -1.67 RHD: Rh blood group, D antigen 6007 -1.68 CHST12: carbohydrate (chondroitin 4) sulfotransferase 12 55501 -1.7 IRF4: interferon regulatory factor 4 3662 -1.7 ADAM8: ADAM metallopeptidase domain 8 101 -1.71 ITFG2: integrin alpha FG-GAP repeat containing 2 55846 -1.71 LCP2: lymphocyte cytosolic protein 2 3937 -1.72 SLC10A3: solute carrier family 10 (sodium/bile acid transporter family), member 3 8273 -1.77 ST3GAL2: ST3 beta-galactoside alpha-2,3-sialyltransferase 2 6483 -1.77 FDXR: ferredoxin reductase 2232 -1.78 SEC24D: SEC24 related gene family, member D (S. cerevisiae) 9871 -1.79 SLCO2B1: solute carrier organic anion transporter family, member 2B1 11309 -1.79 FAM62A: family with sequence similarity 62, member A 23344 -1.8 CBFA2T3: core-binding factor, runt domain, alpha subunit 2; translocated to, 3 863 -1.84 YES1: V-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 7525 -1.84 ID1: inhibitor of DNA binding 1, dominant negative helix-loop-helix protein 3397 -1.85 ACSM3: acyl-CoA synthetase medium-chain family member 3 6296 -1.87 HBB: hemoglobin, beta 3043 -1.88 LMO2: LIM domain only 2 (rhombotin-like 1) 4005 -1.88 ARL4A: ADP-ribosylation factor-like 4A 10124 -1.9 MIR16: membrane interacting protein of RGS16 51573 -1.96 CD97: CD97 molécula 976 -1.98 GPR56: G protein-coupled receptor 56 9289 -1.99 CARD9: caspase recruitment domain family, member 9 64170 -2.01 C11orf21: chromosome 11 open reading frame 21 29125 -2.04 SELENBP1: selenium binding protein 1 8991 -2.04 HEY1: hairy/enhancer-of-split related with YRPW motif 1 23462 -2.06 BCL2L1: BCL2-like 1 598 -2.08 SNPH: syntaphilin 9751 -2.09 ESR1: estrogen receptor 1 2099 -2.1 SH3BP1: SH3-domain binding protein 1 23616 -2.13 PIM1: pim-1 oncogene /// pim-1 oncogene 5292 -2.14 TAX1BP3: Tax1 (human T-cell leukemia virus type I) binding protein 3 30851 -2.19 FLJ20489: hypothetical protein FLJ20489 55652 -2.21 SNCG: synuclein, gamma (breast cancer-specific protein 1) 6623 -2.24 ARHGEF5: Rho guanine nucleotide exchange factor (GEF) 5 7984 -2.28 FADS1: fatty acid desaturase 1 3992 -2.3 POLD4: polymerase (DNA-directed), delta 4 57804 -2.3 SHANK2: SH3 and multiple ankyrin repeat domains 2 22941 -2.32 SLC2A3: solute carrier family 2 (facilitated glucose transporter), member 3 6515 -2.35

6 Fold Locus change GENE Link (log2) MYC: v-myc myelocytomatosis viral oncogene homolog (avian) 4609 -2.47 AQP3: aquaporin 3 (Gill blood group) 360 -2.48 CSH2: chorionic somatomammotropin hormone 2 1443 -2.49 AIF1: allograft inflammatory factor 1 199 -2.7 EPOR: erythropoietin receptor 2057 -3.62 KLF6: Kruppel-like factor 6 1316 -4.03

7

TABLE S4 Genes regulated by MYC in Kp27MER in the presence of p27 related to erythroid lineage or K562 differentiation. The expression changes were calculated from the microarray data by the dChIP program. A negative fold change indicates down-regulation upon MYC activation.

Transcripción factors ID Gene Fold change References NFE2 Nuclear factor erythroid-derived 2, 45kDa 4778 -1.36 (3, 4) LYL1 Lymphoblastic leukemia derived sequence 1 4066 -1.42 (16) JUNB Jun B proto-oncogene 3726 -1.51 (11) STAT5A Signal transducer and activator of 6776 -1.45 (8, 24) transcription 5A GATA1 GATA binding protein 1 2623 -1.48 (6, 28) STAT3 Signal transducer and activator of 6774 -1.48 (14) transcription 3 LMO2 LIM domain only 2 (rhombotin-like 1) 4005 -1.88 (19, 26)

Membrane and cytoplasmic JAG2 Jagged 2 3714 2.18 (10, 15) GYPB Glycophorin B (MNS blood group) 2994 -1.36 (5, 27) EPB49 Erythrocyte membrane protein band 4.9 2039 -1.38 (20, 25) (dematin) MPP1 Erythrocyte membrane protein 55kDa 4354 -1.39 (1) ALAS2 Delta-Aminolevulinate synthase 2 212 -1.45 (2, 13) HMBS Hydroxymethylbilane synthase/ 3145 -1.49 (4, 17) porphobilinogen deaminase NEU1 sialidase 1/neuraminidase 4758 -1.46 (23) RHCE Rh blood group, CcEe antigens 6006 -1.61 (29) RHD Rh blood group, D antigen 6007 -1.57 (29) MCL1 Myeloid Cell Leukemia 1 -BCL2-related 4170 -1.61 (7, 12) HBB Hemoglobin, beta 3043 -1.88 BCL2L1 BCL2-like 1, BclX 598 -2.09 (8, 9) AQP3 Aquaporin 3, Gill blood group 360 -2.48 (21, 22) EPOR Erythropoietin receptor 2057 -3.62 (18)

References to Table S4

1. Bryant, P. J., and D. F. Woods. 1992. A major palmitoylated membrane protein of human erythrocytes shows homology to yeast guanylate kinase and to the product of a Drosophila tumor suppressor gene.. Cell 68:621-622. 2. Cox, T. C., M. J. Bawden, A. Martin, and B. K. May. 1991. Human erythroid 5- aminolevulinate synthase: promoter analysis and identification of an iron-responsive element in the mRNA. EMBO J 10:1891-902. 3. Chan, J. Y., X. L. Han, and Y. W. Kan. 1993. Isolation of cDNA encoding the human NF-E2 protein. Proc Natl Acad Sci U S A 90:11366-70. 4. Chenais, B. 1998. Requirement of GATA-1 and p45 NF-E2 expression in butyric acid- induced erythroid differentiation. Biochem Biophys Res Commun 253:883-6. 5. Ferrari, B., and A. A. Pavia. 1986. Blood group antigens: synthesis of Ss antigenic peptides related to human glycophorin B. Int J Pept Protein Res 28:456-61.

8 6. Ferreira, R., K. Ohneda, M. Yamamoto, and S. Philipsen. 2005. GATA1 function, a paradigm for transcription factors in hematopoiesis. Mol Cell Biol 25:1215-27. 7. Fukuchi, Y., M. Kizaki, K. Yamato, C. Kawamura, A. Umezawa, J. Hata, T. Nishihara, and Y. Ikeda. 2001. Mcl-1, an early-induction molecule, modulates activin A-induced apoptosis and differentiation of CML cells. Oncogene 20:704-13. 8. Garcon, L., C. Rivat, C. James, C. Lacout, V. Camara-Clayette, V. Ugo, Y. Lecluse, A. Bennaceur-Griscelli, and W. Vainchenker. 2006. Constitutive activation of STAT5 and Bcl-xL overexpression can induce endogenous erythroid colony formation in human primary cells. Blood 108:1551-4. 9. Hafid-Medheb, K., Y. Augery-Bourget, M. N. Minatchy, N. Hanania, and J. Robert- Lezenes. 2003. Bcl-XL is required for heme synthesis during the chemical induction of erythroid differentiation of murine erythroleukemia cells independently of its antiapoptotic function. Blood 101:2575-83. 10. Ishiko, E., I. Matsumura, S. Ezoe, K. Gale, J. Ishiko, Y. Satoh, H. Tanaka, H. Shibayama, M. Mizuki, T. Era, T. Enver, and Y. Kanakura. 2005. Notch signals inhibit the development of erythroid/megakaryocytic cells by suppressing GATA-1 activity through the induction of HES1. J Biol Chem 280:4929-39. 11. Jacobs-Helber, S. M., R. M. Abutin, C. Tian, M. Bondurant, A. Wickrema, and S. T. Sawyer. 2002. Role of JunB in erythroid differentiation. J Biol Chem 277:4859-66. 12. Josefsen, D., J. H. Myklebust, J. Lomo, M. Sioud, H. K. Blomhoff, and E. B. Smeland. 2000. Differential expression of bcl-2 homologs in human CD34(+) hematopoietic progenitor cells induced to differentiate into erythroid or granulocytic cells. Stem Cells 18:261-72. 13. Kawasaki, N., K. Morimoto, T. Tanimoto, and T. Hayakawa. 1996. Control of hemoglobin synthesis in erythroid differentiating K562 cells. I. Role of iron in erythroid cell heme synthesis. Arch Biochem Biophys 328:289-94. 14. Kirito, K., M. Uchida, M. Takatoku, K. Nakajima, T. Hirano, Y. Miura, and N. Komatsu. 1998. A novel function of Stat1 and Stat3 proteins in erythropoietin-induced erythroid differentiation of a human leukemia cell line. Blood 92:462-71. 15. Lam, L. T., C. Ronchini, J. Norton, A. J. Capobianco, and E. H. Bresnick. 2000. Suppression of erythroid but not megakaryocytic differentiation of human K562 erythroleukemic cells by notch-1. J Biol Chem 275:19676-84. 16. Meng, Y. S., H. Khoury, J. E. Dick, and M. D. Minden. 2005. Oncogenic potential of the transcription factor LYL1 in acute myeloblastic leukemia. Leukemia 19:1941-7. 17. Morceau, F., B. Chenais, R. Gillet, J. C. Jardillier, P. Jeannesson, and C. Trentesaux. 1996. Transcriptional and posttranscriptional regulation of erythroid gene expression in anthracycline-induced differentiation of human erythroleukemic cells. Cell Growth Differ 7:1023-9. 18. Mulcahy, L. 2001. The erythropoietin receptor. Semin Oncol 28:19-23. 19. Osada, H., G. Grutz, H. Axelson, A. Forster, and T. H. Rabbitts. 1995. Association of erythroid transcription factors: complexes involving the LIM protein RBTN2 and the zinc-finger protein GATA1. Proc Natl Acad Sci U S A 92:9585-9. 20. Rana, A. P., P. Ruff, G. J. Maalouf, D. W. Speicher, and A. H. Chishti. 1993. Cloning of human erythroid dematin reveals another member of the villin family. Proc Natl Acad Sci U S A 90:6651-5. 21. Roudier, N., P. Ripoche, P. Gane, P. Y. Le Pennec, G. Daniels, J. P. Cartron, and P. Bailly. 2002. AQP3 deficiency in and the molecular basis of a novel blood group system, GIL. J Biol Chem 277:45854-9. 22. Roudier, N., J. M. Verbavatz, C. Maurel, P. Ripoche, and F. Tacnet. 1998. Evidence for the presence of aquaporin-3 in human red blood cells. J Biol Chem 273:8407-12.

9 23. Rowley, P. T., B. M. Ohlsson-Wilhelm, and B. A. Farley. 1981. Erythropoiesis in vitro: enhancement by neuraminidase. Blood 57:483-90. 24. Schuringa, J. J., K. Y. Chung, G. Morrone, and M. A. Moore. 2004. Constitutive activation of STAT5A promotes human hematopoietic stem cell self-renewal and erythroid differentiation. J Exp Med 200:623-35. 25. Siegel, D. L., and D. Branton. 1985. Partial purification and characterization of an actin-bundling protein, band 4.9, from human erythrocytes. J Cell Biol 100:775-85. 26. Valge-Archer, V. E., H. Osada, A. J. Warren, A. Forster, J. Li, R. Baer, and T. H. Rabbitts. 1994. The LIM protein RBTN2 and the basic helix-loop-helix protein TAL1 are present in a complex in erythroid cells. Proc Natl Acad Sci U S A 91:8617-21. 27. Watanabe, T., T. Mitchell, E. Sariban, K. Sabbath, J. Griffin, and D. Kufe. 1985. Effects of 1-beta-D-arabinofuranosylcytosine and phorbol ester on differentiation of human K562 erythroleukemia cells. Mol Pharmacol 27:683-8. 28. Welch, J. J., J. A. Watts, C. R. Vakoc, Y. Yao, H. Wang, R. C. Hardison, G. A. Blobel, L. A. Chodosh, and M. J. Weiss. 2004. Global regulation of erythroid gene expression by transcription factor GATA-1. Blood 104:3136-47. 29. Wiener, E., A. Shiels, S. N. Wickramasinghe, and N. D. Avent. 1998. Effect of 1-beta- D-arabino-furanosyl-cytosine (ara-C) induction of K562 cells on expression of Rh and other blood group active proteins. Br J Haematol 103:259-67.

10