Uva-DARE (Digital Academic Repository)

UvA-DARE (Digital Academic Repository)

Biliary cholesterol secretion in mice

Kosters, A.

Publication date 2005 Document Version Final published version

Link to publication

Citation for published version (APA): Kosters, A. (2005). Biliary cholesterol secretion in mice.

General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).

Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible.

UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl)

Download date:04 Oct 2021

Biliary cholesterol secretion in mice

Promovendus: Astrid Kosters Promotor: Prof. dr R.P.J Oude Elferink Co-promotor: Dr A.K. Groen

Biliary cholesterol secretion in mice Astrid Kosters/ University of Amsterdam, 2005/ Thesis

Biliary cholesterol secretion in mice

ACADEMISCH PROEFSCHRIFT

ter verkrijging van de graad van doctor aan de Universiteit van Amsterdam op gezag van de Rector Magnificus prof. mr. P.F. van der Heijden ten overstaan van een door het college voor promoties ingestelde commissie, in het openbaar te verdedigen in de Aula der Universiteit op dinsdag 21 juni 2005, te 12.00 uur

door Astrid Kosters geboren te Ermelo

Promotiecommissie:

Promotor: Prof. dr R.P.J. Oude Elferink

Co-promotor: Dr A.K. Groen

Overige leden: Prof. Dr. J.J. Kastelein Prof. Dr. F. Kuipers Prof. Dr. R.J.A. Wanders Dr. H.J. Verkade Dr. P.J. Voshol

Faculteit der Geneeskunde

The study described in this thesis was supported by grant from the Netherlands Organisation for Scientific Research (NWO), 902-23-193.

Additional financial support for the publication of this thesis was generously provided by the University of Amsterdam.

Contents

Abbreviations 9

Chapter 1: General Introduction 11

Chapter 2: Relation between hepatic expression of ATP-binding cassette 63 transporters G5 and G8 and biliary cholesterol secretion in mice.

Chapter 3: A mouse model of sitosterolemia: absence of Abcg8/sterolin-2 79 results in failure to secrete biliary cholesterol.

Chapter 4: Diosgenin-induced biliary cholesterol secretion in mice 113 requires Abcg8.

Chapter 5: The mechanism of biliary cholesterol secretion. 135

Summary 155

Samenvatting 161

Dankwoord 169

Abbreviations:

ApoAI: Apolipoprotein AI ABC: ATP-binding cassette BF: Bile flow BS: Bile salt CA: Cholic acid CDCA: Chenodeoxycholic acid CH: Cholesterol CYP: cytochrome P450 FCC: Flux control coefficient FXR: Farnesoid X Receptor GST: Glutathione transferase HDL: High density lipoprotein HMG-CoA: 3-hydroxy methyl-glutaryl-Coenzyme A HNF: Hepatocyte nuclear factor LDL: Low density protein LRH1: Liver receptor homolog-1 LXR: Liver X Receptor MDR: Multidrug resistance protein MRP: Multidrug resistance related protein PPAR: Peroxisome proliferator activating receptor PL: Phospholipid RXR: retinoid X receptor SCP2: Sterol Carrier Protein 2 SHP: Short heterodimeric partner SR-BI: Scavenger receptor class BI SREBP: Sterol regulatory element binding protein TUDC: Tauroursodeoxycholic acid

Chapter 1

General Introduction

Astrid Kosters, Milan Jirsa and Albert K. Groen

Modified from: Genetic background of cholesterol gallstone disease.

Published in: Biochim Biophys Acta 2003; 1637: 1-19.

Chapter 1

12 General introduction

Scope Cholesterol gallstone formation is a multifactorial process involving a multitude of metabolic pathways. The primary pathogenic factor is hypersecretion of free cholesterol into bile. For people living in the Western Hemisphere this is almost a normal condition, certainly in the elderly, which explains the very high incidence of gallstone disease. Probably due to the multifactorial background genes responsible for the high incidence have not yet been identified, despite the fact that genetic factors clearly play a role. Analysis of the many pathways involved in biliary cholesterol secretion reveals many potential candidates and considering the progress in unraveling the regulatory mechanisms of the responsible genes, identification of the primary gallstone genes will be successful in the near future.

Introduction Cholesterol gallstone disease is one of the most common disorders of the gastrointestinal tract in the Western Hemisphere. A number of independent risk factors for gallstone disease have been identified: age, gender, pregnancy and parity, chronic medication with estrogens and fibrates, obesity, rapid weight loss, pre- existing disease (diabetes mellitus, Crohn’s disease, resection of terminal ileum, Gaucher disease, Down’s syndrome) and states associated with gallbladder stasis such as spinal cord injuries, prolonged fasting, long term total parenteral nutrition, therapy with ocreotide analogues or somatostinoma and low physical activity. None of the listed risk factors explains the family clustering of either gallstone disease or the ethnic influences indicating involvement of genetic factors as a separate additional risk factor. The primary event on the way from gallstone free bile to cholesterol gallstones is supersaturation of bile with cholesterol. Saturation of bile with cholesterol is critically dependent on secretion rates of biliary lipids. Genes controlling the secretion rates are thus the first natural candidates. Additional defects - gallbladder hypomotility, accelerated cholesterol crystallization rate and mucus hypersecretion - appear simultaneously in patients with cholesterol gallstone. These additional defects may be balanced differently in patients with solitary and multiple stones. Genes involved in control of gallbladder motility, secretion of biliary mucin and possibly non-mucin proteins represent the second of Rosmodurc et al.(1), Jacquemin et al.(2), and Pullinger et al. (3) no gene mutation or polymorphism has been associated with cholesterol gallstones in humans. Fortunately the mammalian genome is highly conserved and the vast majority of human genes have their orthologues in other mammals. As a consequence similar genetic background might be expected in animal models of numerous human diseases. Mouse models provide comprehensive genetic resources and offer many possibilities for genetic manipulations. In addition, quantitative trait locus analysis may be used for identification of the primary genetic defects responsible for the phenotype of a multifactorial disease under controlled conditions. For these reasons mouse models became the model of choice for studies of the genetic background of gallstones (4). The first inventory of candidate mouse Lith genes has recently been reviewed by Lammert et al.(5).

13 Chapter 1

Scope of the review In this overview we will focus on the predominant form of gallstone disease, formation of cholesterol stones. Although in addition to lipids also proteins may play a role in the etiology (see review (6)) we will focus on the main biliary components cholesterol, phospholipid and bile acids. We will first discuss the metabolic pathways involved in metabolism of these lipids. Subsequently we will attempt to couple this information to what is known from human epidemiology and genetic studies. Finally a brief overview of the genetic diseases associated with gallstones will be presented.

Candidate genes involved in regulation of biliary cholesterol secretion

Recourses of biliary lipids Since cholesterol in bile is solubilized in a complex mixture of bile salts and phospholipid the concentration of these factors plays an important role in regulation of cholesterol saturation as given by the biliary cholesterol saturation index (CSI). The increased CSI observed in patients with cholesterol gallstones may result from increased biliary cholesterol secretion but may also be caused by decreased bile salt or phospholipid secretion or by a combination of these parameters. The main organ for cholesterol metabolism is the liver. It regulates the synthesis of cholesterol, the conversion of cholesterol into bile acids, the secretion of cholesterol into bile either directly or as bile salts, the uptake and hydrolysis/metabolism of plasma cholesterol(esters) in the form of HDL or LDL particles, the esterification of excess of free cholesterol, and the secretion of cholesterol into plasma. The source of cholesterol destined for biliary secretion is as yet not fully known. The major part is thought to be derived from a pre-existing hepatic cholesterol pool; however this pool is not well defined. One of the sources, although this represents only a small fraction (5%-20%) of total biliary cholesterol, is cholesterol from hepatic de novo cholesterol synthesis (7-9). The second source of biliary cholesterol is cholesterol derived from plasma lipoprotein particles of which HDL seems to be the major supplier (10). However, Abca1 knock-out mice which are deficient in HDL show no decrease in biliary cholesterol output, suggesting that either HDL may not be that important or its role can easily be taken-over by a parallel mechanism (11). In contrast to HDL no direct secretory pathway of LDL or VLDL cholesterol into bile has ever been reported. Bile acids are thought to be preferentially formed from newly synthesized cholesterol, however, depending on the conditions also cholesterol from plasma lipoprotein particles may be used as a precursor for bile acid synthesis (12;13). Increased biliary cholesterol secretion may result from the increase of de novo synthesis, the decreased conversion of cholesterol into bile acids, the decreased esterification or the increased uptake of cholesterol from plasma lipoprotein particles. In addition, the amount of phospholipids and bile acids as well as the pattern of secreted bile salts is important for regulation of cholesterol secretion into bile. Clearly defects in genes encoding proteins involved in all these processes may play an important role in the formation of cholesterol gallstones.

14 General introduction

Cholesterol synthesis Although newly formed cholesterol contributes only partially to biliary cholesterol, increased cholesterol synthesis may still be one of the mechanisms involved in the formation of cholesterol gallstones. The key enzyme in de novo cholesterol synthesis pathway is 3-hydroxy-3-methylglutaryl-Coenzyme A (HMG-CoA) reductase (14). Both the gene expression and the activity of the enzyme are regulated by intracellular cholesterol concentrations via cholesterol-derived oxysterols. Oxysterols function as regulators of the activity of the sterol regulatory element binding proteins (SREBP) (see below). These transcription factors regulate the expression of all genes in the cholesterol biosynthetic pathway (15). Rodents fed a high cholesterol diet accumulate cholesterol in the liver. Their cholesterol synthesis is reduced by decreasing the transcription of the genes encoding for HMG-CoA reductase (16), HMG-CoA synthase (17), farnesyl diphosphate synthase (18) and squalene synthase (19). The activity of HMG-CoA reductase is controlled by regulation of the half-life of the protein and the state of phosphorylation of the protein. In rodents a relation seems to exist between HMG-CoA reductase expression/activity and gallstone formation. The expression of HMG-CoA reductase in the liver was properly downregulated in the more gallstone resistant AKR strain upon feeding a high cholesterol diet (20) whereas in C57L/J mice which are susceptible for gallstone formation, the expression of HMG-CoA reductase remained unchanged. Furthermore, in hamsters fed a cholesterol gallstone inducing diet, the activity of HMG-CoA reductase increased enormously even long before the appearance of gallstones (21). In humans however, a relation between the activity of HMG-CoA reductase and biliary cholesterol secretion is less clear. Ahlberg et al. (22) determined the HMG-CoA reductase activity in the liver of 55 patients (10 with adenomyoma of the gallbladder wall, 45 with cholesterol gallstones). Bile of these patients was supersaturated with cholesterol. HMG-CoA reductase activity in gallstone patients, however, was not different from that seen in the gallstone-free controls. In addition, in the gallstone-free control group and in the group of bile acid-treated gallstone patients but not in untreated gallstone patients, the saturation of bile correlated with the activity of HMG-CoA reductase in the liver. Studies of Maton et al. (23) showed that there was no correlation between the activity of HMG-CoA reductase and the biliary cholesterol output in nine patients. Moreover, a similar activity of HMG-CoA reductase was found in patients with gallstones and gallstone free patients even though the saturation of the gallbladder bile was higher in gallstone patients (24). A possible caveat in these studies is that the measured in vitro activity of the enzyme may not reflect the activity of HMG-CoA reductase in the intracellular milieu.

Cholesterol esterifying enzymes Excess of intracellular cholesterol can be esterified by acyl-CoA cholesterol acyl-CoA transferase (ACAT) (25;26). Cholesterol esters are then stored in cytosolic droplets or are secreted into the circulation as part of lipoprotein particles. Two Acat genes have been identified: Acat1 and Acat2 (or Soat1 and Soat2, respectively). Although Acat1 is expressed in many tissues (26;27), the highest levels in mice were found in macrophages, and adrenocortical cells while only low expression was seen in the liver and the small intestine (28;29). In mice lacking the Acat1 gene, cholesterol esters are

15 Chapter 1

absent in the adrenal glands and peritoneal macrophages (30). In the liver, however, cholesterol esterification activity was still present suggesting the existence of a second Acat gene. Acat2 was identified in 1998 and the expression was shown to be restricted to liver and intestine (31-33). Acat2 deficient mice (34) had indeed a reduced cholesterol esterifying activity in the small intestine and liver. On a normal diet Acat2(-/-) mice showed no major differences in cholesterol metabolism compared to wild type mice. In contrast, a high cholesterol/high fat (HC/HF) diet reduced the intestinal cholesterol absorption in Acat2(-/-) mice to 15% of that of wild type mice. Moreover, the concentrations of cholesterol in gallbladder bile were 30% lower in Acat2(-/-) mice compared to wild type mice. This was reflected in the formation of gallstones: all wild type mice but none of the Acat2 deficient mice fed the HF/HC diet for 3-6 weeks developed cholesterol gallstones. Even after 3 months only 3 out of 14 Acat2 deficient mice had a few stones (34). These results in mice seem to contradict the human situation in gallstone formation, since Smith et al. (35) demonstrated that patients with cholesterol gallstones have decreased hepatic ACAT activity. Buhman et al. (34) argue that this is not per se contradicting because Acat2 deficiency in the intestine lowers cholesterol absorption, which may then decrease the flow of cholesterol to the liver resulting in the decreased biliary cholesterol output. Thus a specific deficiency of Acat2 in the liver may increase the risk of gallstone formation. However, in the human liver ACAT1 rather than ACAT2 seems to be higher expressed (36), and might therefore play a more important role than ACAT2 in esterification of hepatic cholesterol.

Cholesterol ester hydrolases Cholesterol esters derived from LDL-particles are hydrolyzed by the action of acid lysosomal cholesterol ester hydrolase. Neutral cholesterol ester hydrolase is responsible for hydrolysis of cholesterol esters stored in lipid droplets. In cholesterol- fed rats the activity of hepatic neutral cholesteryl ester hydrolase as well as mRNA levels were decreased (37). Moreover, inhibition of cholesterol biosynthesis by lovastatin and stimulation of biliary cholesterol secretion by chronic biliary diversion increased both the activity and the expression of the enzyme whereas chenodeoxycholate feeding decreased this. These data suggest that neutral cholesterol ester hydrolase responds to changes in cholesterol flux through the liver (37). The mechanism by which the enzyme is regulated is unknown. The increased activity and/or expression of neutral cholesterol ester hydrolase may contribute to the enhancement of biliary cholesterol secretion and hence formation of cholesterol gallstones.

Bile salt biosynthesis As already mentioned above, formation of cholesterol gallstones may also be induced by the decreased output of bile salts and/or the shift towards the more the hydrophobic bile salt species, thereby changing the CSI in bile. Excess of hepatic cholesterol can be converted into bile salts via two pathways: the classic or neutral pathway and the alternative or acidic pathway. Cholesterol 7α-hydroxylase (CYP7A1) plays a key role in the classic pathway, whereas sterol 27-hydroxylase (CYP27) is the regulatory

16 General introduction

enzyme in the acidic pathway. The neutral pathway is active exclusively in the liver. The alternative pathway, at least CYP27, is present in almost all tissues. Sterol 12α-hydroxylase (CYP8B1) controls the ratio of cholic acid (CA) and chenodeoxycholic acid (CDCA) synthesis in both neutral and alternative pathways and thereby regulates the bile salt hydrophobicity index. The biliary cholesterol secretion rate depends on the hydrophobicity of the bile salt. Therefore, via this seemingly indirect way, CYP8B1 may regulate biliary cholesterol output. A fourth cytochrome P450 involved in regulation of the rate of cholesterol secretion into bile is oxysterol 7α-hydroxylase (CYP7B1). This enzyme catalyzes the second step in the alternative pathway. In humans conversion of cholesterol to bile acids accounts for approximately half of the daily elimination of cholesterol from the body. The major portion of the remaining 50% is eliminated as free cholesterol (38;39). In rats up to 50% of the total bile acid synthesis may occur via the alternative pathway (40-42). This is not the case in healthy humans (43) where only less than 10% of the total bile acid synthesis appeared to be synthesized via this pathway (44;45). The increased delivery of cholesterol to the liver leads to increased bile acid synthesis via the classical pathway (46-48) through upregulation of CYP7A1 induced by the oxysterol receptor LXR in many species (49). However, hepatic overload of cholesterol, either by dietary cholesterol or by increased hepatic cholesterol synthesis, induces different responses of CYP7A1 in different species. In rodents, cholesterol feeding increases the expression of CYP7A1 and the conversion of cholesterol into bile acids. Rodents therefore are rather resistant to diet-induced hypercholesterolemia (48). In rabbits (50), hamsters (51), and Green Monkeys (52), CYP7A1 is not induced in response to the high load of dietary cholesterol which leads to the development of hypercholesterolemia and atherosclerosis in these animals. Most humans respond to excess of cholesterol similarly to rabbits and hamsters resulting in increased plasma LDL-cholesterol levels and atherosclerosis, although in some humans an increase in bile salt synthesis has been reported (53). This difference in response of CYP7A1 to the high cholesterol diet between rodents and humans is explained by the lack of binding of LXRα to the human CYP7A1 promoter due to a single nucleotide change in the human LXRE (54). In Cyp7a1(-/-) mice the rate of the bile acid synthesis and the size of the bile salt pool were reduced by approximately 60% and 80% respectively. This significant change affected the intestinal absorption of cholesterol and the fecal excretion of bile salts was decreased as well in these mice. In contrast, both the total fecal cholesterol excretion and the total fecal sterol excretion were increased. However compensatory increases in sterol synthesis took place in the liver and the intestine. Therefore the reduced cholesterol absorption did not affect plasma and tissue cholesterol levels (55). The disruption of Cyp7a1 did not change the molar ratio of cholesterol to total lipids in gallbladder bile and the effect on the formation of gallstones would probably be minimal. In hamsters overexpressing Cyp7a1 and fed a high cholesterol diet the rate of bile acid synthesis increased (56). Similarly CYP7A1 overexpression in HepG2 cells and primary human hepatocytes increased bile acid synthesis via the classic pathway and suppressed cholesterol synthesis (57) whereas in cholesterol-fed CYP7A1 transgenic mice lacking the endogenous Cyp7a(-/-) gene LXR could not bind the CYP7A1 promoter and failed to increase the expression of CYP7A1 (58). These studies showed that manipulation with CYP7A1 expression

17 Chapter 1

could change non-responsive species into responsive ones and vice versa. The differential regulation of CYP7A1between human and mouse by dietary cholesterol was confirmed in mice overexpressing human CYP7A1 on a Cypa1(-/-) background and mice expressing endogenous Cyp7a1. Surprisingly the effects of dietary cholesterol on bile acid pool size, fecal bile acid excretion and plasma lipoprotein cholesterol levels were similar in mice either expressing human or mouse CYP7A1/Cyp7a1 (59) which led the authors to conclude that the bile acid pool size might determine the expression of Cyp7a1 instead of Cyp7a1 activity regulating the bile acid pool size. Recently Pullinger et al. (3) reported high levels of LDL cholesterol in three patients with a homozygous mutation in CYP7A1. In one patient the hepatic cholesterol content was increased whereas fecal excretion of bile salts was absent. In addition, two of the three patients studied had hypertriglyceridemia and premature gallstone disease. The rate of bile acid synthesis and the activity of CYP7A1 protein are tightly feedback inhibited by bile acids returning to the liver via the enterohepatic circulation of bile. Hydrophobic bile acids are the main active bile acid species in this respect (48;60-62). The CYP7A1 promoter region contains a bile acid response element (BARE) that was first identified as a hepatocyte nuclear factor 4 (HNF4) binding site (63). This binding site overlaps with the binding site for several other factors from the family of monomeric nuclear receptors (64). In both mice and in human HepG2 cells CYP7A1 expression is repressed by bile acids via the activation of the bile acid receptor FXR, the subsequent activation of the small heterodimeric partner SHP and following repression of the liver receptor homologue LRH-1 (65-67). Furthermore, in HepG2 cells HNF4α has been shown to compete with LRH-1 for binding on their overlapping binding sites on the CYP7A1 promoter (65). Several groups reported that besides FXR-mediated downregulation of CYP7A1 by bile acids also the Jun kinase signaling pathway is activated by bile acids and plays an additional role in downregulation of CYP7A1 via SHP-dependent and SHP-independent pathways (68- 72). Multiple pathways are thus involved in regulation of the expression of CYP7A1 and the control of the rate of the synthesis of bile salts. Sterol 27-hydroxylase (CYP27) is an ubiquitously expressed mitochondrial enzyme that catalyzes the first step in the acidic pathway of bile acid synthesis and the 27-hydroxylation of bile acid intermediates in the neutral pathway (CYP7A1) (73). 27-hydroxycholesterol can compete with cholesterol in the further metabolization and is also a substrate for CYP7B1, the microsomal oxysterol hydroxylase (74). In extrahepatic tissues CYP27 metabolizes cholesterol to 27-hydroxycholesterol and 3β- hydroxy-5-cholestenoic acid which are then effluxed, incorporated into lipoproteins and transported to the liver, where they are probably metabolized via the alternative pathway into bile acids (75-78). In vitro, 27-hydroxycholesterol inhibits HMG-CoA reductase activity (14;79) and stimulates the activity of ACAT2 (80) resulting in a reduction of the intracellular free cholesterol concentrations. Recently 27- hydroxycholesterol was identified as a ligand for the nuclear receptor LXR (81) (see below). In rats, CYP27 expression is downregulated in vivo and in vitro by hydrophobic bile acids (41;82). In contrast, in rabbits no effect was seen of bile acids on the expression of CYP27. Cholesterol, however, did stimulate CYP27 expression

18 General introduction

in rabbits (83) which emphasizes again the differential physiological responses of pathways involved in cholesterol metabolism in the different species. In humans, mutation of CYP27 leads to the development of cerebrotendinous xanthomatosis (CTX), a disease marked by progressive neurological dysfunction and accelerated atherosclerosis (84). In these patients bile acid synthesis and the total bile acid pool are decreased whereas cholesterol synthesis is increased. But to our knowledge no data on gallstones in CTX patients have been reported. Mice deficient for Cyp27 showed a similar decrease in metabolism of cholesterol to bile acids and increase cholesterol synthesis as seen in humans (85), however, they did not develop the sympthoms of CTX. The expression of CYP7A1 mRNA in Cyp27(-/-) mice was increased enormously whereas the mRNA levels of CYP7B1 were decreased. Intestinal cholesterol absorption was also decreased which was compensated by an increased synthesis of cholesterol in liver and intestine. In gallbladder bile of the Cyp27(-/-) mice the cholesterol concentration was unchanged, whereas concentrations of bile acids and phospholipids were decreased. These changes resulted in increased molar ratios of cholesterol to the other biliary lipids in gallbladder bile and therefore the risk for cholesterol gallstone formation in Cyp27(-/-) mice was increased as well (86). In contrast, in mice overexpressing the human CYP27 gene no differences in total cholesterol levels in serum were observed and neither the composition of biliary bile acids was changed. This suggested that (87), despite being a ligand for the oxysterol receptor LXR (see below), the levels of 27-hydroxycholesterol (which were highly increased) are not of critical importance for cholesterol homeostasis in mice . Sterol 12α-hydroxylase (CYP8B1), a microsomal cytochrome P450, is responsible for the synthesis of cholic acid. Sterol 12α-hydroxylase acts at a branch point in the bile acid pathway determining the ratio of cholic acid to chenodeoxycholic acid. This may be important for the formation of gallstones since chenodeoxycholic acid, in contrast to cholic acid, may reduce the degree of cholesterol saturation in bile. The overall bile acid hydrophobicity index is important for cholesterol and bile acid synthesis, intestinal cholesterol absorption, biliary cholesterol secretion and gallstone formation (88;89). The expression of CYP8B1 is regulated by a negative feedback control by hydrophobic bile acids (90) in a similar manner to CYP7B1. In contrast, CYP8B1 expression was upregulated by hydrophilic bile acids whereas excess of dietary cholesterol decreased the expression of CYP8B1 by 40% (90). Overexpression of Cyp8b1 in rats resulted in an increased pool of cholic and deoxycholic acid and a corresponding decrease in the chenodeoxycholic and muricholic acid pool (91) but the overall rate of bile acid synthesis remained unchanged. Recently, Cyp8b1(-/-) mice have been generated as well (92) and in these mice the synthesis of cholic acid from chenodeoxycholic acid does not occur. This resulted in an increased concentration of chenodeoxycholic acid and muricholic acids (alpha and beta) in gallbladder bile of Cyp8b1(-/-) mice. This resulted in a more hydrophilic bile salt pool and potential gallstone formation in these mice is likely to be diminished. The feedback regulation of Cyp7a1 by bile salts was lost in the Cyp8b1(-/-) mice which resulted in a expansion of the bile acid pool and changes in cholesterol metabolism (92). Oxysterol 7α-hydroxylase (CYP7B1) catalyzes the second step in the alternative pathway. Mice deficient for Cyp7b1(-/-) (93) appeared to have normal bile

19 Chapter 1

acid synthesis, however, 25- and 27-hydroxysterols accumulated in serum and in several tissues including the liver. These two oxysterols have been shown to act as ligands for the nuclear receptor LXR (81;94) (see below). The levels of plasma and tissue cholesterol were not changed in the Cyp7b1(-/-) mice and bile of these mice was not analyzed. Recently Pandak et al. (95) reported that CYP7B1 in primary rat hepatocytes is regulated by bile acids, cholesterol and cAMP in a similar manner to CYP7A1. In contrast, overexpression of CYP7B1 in these cells did not result in increased bile acid synthesis suggesting that under normal conditions the activity of CYP7B1 is not a rate-controlling step in this pathway. A potential role for CYP7B1 in cholesterol gallstone formation remains to be investigated; however a role in the regulation of the intracellular concentration of oxysterols might be present for Cyp7b1. The expression of this gene has recently been shown to be suppressed indirectly by Srebp1c (probably via interaction with Sp1) in vitro (96), and the authors suggested that the oxysterol hydroxylase might be important for the regulation of the cellular sterol content together with LXR and Srebp1c.

Genes involved in intestinal cholesterol absorption Cholesterol taken up in the intestine originates from diet and bile. Depending on the species in most cases the biliary pool that undergoes enterohepatic recycling is the larger of the two. Apart from the influence of the bile acid composition and presence of phospholipids in the intestinal lumen on cholesterol absorption (97-101), large differences in cholesterol absorption have been observed between mouse strains (102). This suggests that also here genetic factors might be involved. Until recently very little was known about the proteins involved in regulation of cholesterol uptake. A role for the HDL receptor SR-B1 was proposed by Schulthess et al. (103). However, no defect in intestinal cholesterol absorption was observed SR-BI knockout mice (104;105), suggesting that this protein has no major role in intestinal cholesterol absorption. Furthermore the involvement of CD36 (or fatty acid translocase) and a third as yet unidentified protein which together accounted for most of the transport activity in isolated brush border membrane vesicles was proposed (106), but no further experimental data are available yet. The recently identified Niemann-Pick C1Like1 (NPC1L1) gene has been shown to be very important for intestinal cholesterol absorption (107). NPC1L1 was mainly expressed in the proximal part of the small intestine, which is the part where the major part of cholesterol uptake takes place. In mice deficient for this gene intestinal cholesterol absorption was 70% decreased and could not by bile salt feeding, indating a major role for this protein in cholesterol absorption. In addition to the active uptake there may be still considerable passive diffusion of cholesterol into the intestinal epithelial cells and recent data suggest that net cholesterol absorption is the result of both uptake and active secretion back to the lumen. The transporters that have been implicated in the secretory route belong to the family of ATP binding cassette (ABC) transporters, i.e.: ABCA1 (108;109), ABCB1 (also known as MDR1 or Pgp) (110-113) and ABCG5 and ABCG8 (114-116). ABCB1 is expressed in a number of tissues including the apical membrane of the enterocytes (117). In cell culture experiments, ABCB1 was associated with the uptake and trafficking of sterols. Nonspecific inhibitors of ABCB1 have been shown to

20 General introduction

inhibit cholesterol synthesis and the esterification of cholesterol putatively by blocking the trafficking of sterols from plasma membrane to ER (118-120). The increased expression of ABCB1 was associated with increased accumulation of cholesterol and enhanced kinetics of cholesterol esterification in a rat epithelial cell line (121;122). The mouse ortholog of ABCB1 consists of two genes, Abcb1a and Abcb1. Recently Luker et al. (123) determined that intestinal cholesterol absorption in Abcb1a /Abc1b double knockout mice was not affected. They did find, however, increased kinetics of cholesterol accumulation in the liver after oral administration of cholesterol. Although the above reports may suggest a role for MDR1 in intestinal and hepatic cholesterol handling, the in vitro and in vivo results are in conflict. Therefore a role for MDR1 in intestinal cholesterol absorption remains to be elucidated. Biliary lipid secretion is not affected in Abcb1a/b(-/-) mice (R. Ottenhoff, personal communication). ABCA1 is expressed in the liver and in the intestine (124;125). The subcellular localization of the protein in enterocytes and hepatocytes has not been reported yet, although in HeLa cells, a GFP-tagged ABCA1 was detected in intracellular vesicles and at the plasma membrane and whereas a basolateral localization in the polarized hepatocyte-like cell line WIF-B was shown (126;127). Also in Dog Gall Bladder Epithelial (DGBE) and CaCo2 cells basolateral localization of ABCA1 was found (128;129). Repa et al. (108) observed an increased intestinal expression of ABCA1 and a simultaneous inhibition of cholesterol absorption in mice fed a RXR agonist. Although the strong upregulation of ABCA1 expression in the intestine observed was mediated via the nuclear receptor RXR and indirectly via LXR, cholesterol absorption in Abca1 null mice was only slightly reduced (109). In addition, Plosch et al. (125) also showed that the LXR mediated inhibiting effect on cholesterol absorption was independent of ABCA1 (125). ABCA1 however was shown to be involved in the transport of cholesterol over the basolateral membrane of the intestine in Wisconsin hypo-alpha mutant (WHAM) chickens (110), which have a defective ABCA1 gene. Also in these chickens the effect of LXR activation on cholesterol absorption was shown to be independent of ABCA1. In an other recent study the inhibition of cholesterol absorption was associated with an increased intestinal expression of ABCA1 which was PPAR dependent (130) and this also involved a role for LXR. However, in this study and the study of Repa et al. (108) the expression of the second set of ABC-transporters implicated to have a role in intestinal cholesterol uptake was not investigated. These transporters are the recently identified ABC-halftransporters ABCG5 and ABCG8 (114;115;131). Mutations in either of these genes cause sitosterolemia, a disease of which one of the hallmarks is the increased absorption of plant sterols and other sterols including cholesterol. These two genes are most highly expressed in the proximal part of the intestine and in the liver (131). Repa et al.(132) showed that ABCG5 and ABCG8 mRNA were homogeneously expressed in enterocytes lining the microvilli. The proteins localize to the apical membrane of enterocytes, hepatocytes and gallbladder epithelial cells (133-136). In mice overexpressing the human ABCG5/G8 gene cluster, the fecal excretion of neutral sterols was greatly increased whereas the fractional absorption of cholesterol was decreased suggesting that the genes indeed might be involved in the efflux of cholesterol back into the intestinal lumen (137). In enterocytes, the ABCG5/ABCG8

21 Chapter 1

heterodimer limits the intestinal absorption of plant sterols and cholesterol by secretion of these sterols (116;131;137). Overexpression of human ABCG5 and G8 reduced the fractional dietary cholesterol absorption by about 50% and highly stimulated fecal neutral sterol output (138). Although fractional dietary absorption of cholesterol in G5G8(-/-) mice was unchanged, the absorption of plant sterols and cholestanol was greatly increased (137). Studies in CaCo2 cells by Iqbal et al. (139) suggested that several mechanisms for cholesterol absorption may be present. One of these pathways was ApoB and MTP dependent and could be induced by oleic acid whereas the other pathway was ApoB- independent but ABCA1and HDL assembly dependent and might involve other proteins as well. Even more recently, two other proteins were suggested to play a role in the ezetimibe sensitive pathway of cholesterol uptake. In experiments with CaCo-2 cells, the in cholesterol trafficking implicated annexin 2-caveolin 1 complex was found to dissociate upon treatment with ezetimibe (140). Ezetimibe is a specific intestinal cholesterol absorption inhibitor which did not influence expression levels of Abcg5 or Abcg8 in the enterocyte (141). Caveolin 1 is present in caveolae, which are flask like invaginations in the plasma membrane rich in cholesterol and sphingomyelin and caveolin1 has been implicated in several cellular processes, including intracellular cholesterol transport (142). Immunoprecipitation of caveolin1, but not annexin2 or other components of the complex, co-precipitated ezetimibe, suggesting ezetimibe directly binds to caveolin1 (140).

Genes involved intracellular trafficking of cholesterol One of the proteins reported to have a role in intracellular cholesterol/lipid trafficking and metabolism is the sterol carrier protein-2 (SCP2). The intracellular localization of SCP2 is still a matter of controversy. A number of studies localize the protein exclusively in the peroxisomes but others also reported presence of the protein in the cytosol. A role for SCP2 in intracellular lipid transport has been proposed in several studies. Purified SCP2 has been shown to bind cholesterol and to stimulate interorganellar cholesterol transfer (143) as well as the conversion of free cholesterol into cholesterol esters (144) and 7α-cholesterol (145;146) and to stimulate the transfer of sterols among intracellular membranes in vitro (147). However, SCP2 has been shown to have a similar or higher affinity for fatty acids and fatty acyl Coenzyme A than for cholesterol (148;149). Intracellular cholesterol transport by SCP2 was suggested when Puglielli et al. (150) showed in cultured fibroblasts, using antisense nucleotides, that SCP2 increased the transport rate of newly synthesized cholesterol from the ER to the plasma membrane. Furthermore overexpression of Scp2 in rat hepatoma cells enhanced intracellular cholesterol cycling, increased plasma membrane cholesterol content and decreased cholesterol esterification and HDL production (151). By using in vivo antisense oligonucleotide treatment in rats a role for SCP2 in the transport of newly synthesized cholesterol in biliary secretion was suggested (152). In diosgenin-fed rats in which cholesterol synthesis was increased hepatic SCP2 expression was increased as well (152). In mouse strains differing in susceptibility to cholesterol gallstone formation fed a lithogenic (gallstone inducing) diet, SCP2 mRNA and protein levels correlated with biliary cholesterol secretion rates (153). Adenovirus-mediated SCP2 transfer in C57BL/6 mice (154) resulted in

22 General introduction

decreased plasma HDL cholesterol levels and increased LDL cholesterol levels. The level of total plasma cholesterol remained unchanged. Hepatic free cholesterol levels were increased (1.6 fold) and cholesterol synthesis was decreased by 40% in Adenoviral SCP2 mice. The total bile acid pool was slightly increased in infected mice but the composition was not changed. Adenovirus-mediated overexpression of SCP2 increased the bile flow by 73% due to a 3-fold increase in bile acid independent bile flow. Biliary output of bile salts and phospholipids was increased by 50-60% whereas cholesterol secretion was increased 2-fold. This led the authors to the conclusion that overexpression of SCP2 enhanced the enterohepatic circulation of cholesterol and bile acids due to the increased intracellular cholesterol cycling (155). Scp2/Scpx knockout mice (156) in a gallstone-susceptible strain (C57BL/6 background) did not show any changes in plasma or liver cholesterol levels, instead these mice were defective in the peroxisomal oxidation of tetramethyl branched fatty acyl CoAs. Recently, the same group (157) reported that the Scp2/Scpx(-/-) mice have similar biliary cholesterol secretion rates compared to wild type mice, increased bile flow and decreased bile salt secretion rates on chow diet. Feeding a lithogenic diet resulted in a lower increase in biliary cholesterol secretion in Scp2(-/-) mice compared to wild type mice but the diet still induced cholesterol gallstone formation in both wild type and knockout mice. Although in gallstone patients higher hepatic levels of SCP2 protein were found (158) the above mentioned data suggest that the role of SCP2 in gallstone formation is not of major importance. Intracellular cholesterol transport has also been suggested to be mediated by liver fatty acid binding protein (L-FABP), which is one of the most abundant cytosolic proteins in the liver (159;160). This protein has been shown to bind cholesterol in vitro and to enhance sterol transport between membranes (161), although others could not confirm this (162). The expression of L-FABP was upregulated in livers of Scp-2 knockout mice (157). Recently Fabp(-/-) mice have been generated and in these mice hepatic SCP2 protein levels were increased, in contrast to SCPx levels which were reduced. Contrary to what was expected the absence of FABP in mouse liver resulted in increased free cholesterol and cholesterol esters concentration (163;164) suggesting that indeed FABP may be involved in intracellular cholesterol homeostasis. Unfortunately, biliary cholesterol secretion was not measured in these mice. Caveolin-1 is the main protein of caveolae, which are plasma membrane invaginations that are highly enriched in cholesterol and sphingomyelin. Caveolins/caveolae have been implicated in cell signaling (165), transcytosis (166;167) and in regulation of intracellular cholesterol transport (168) (reviewed in (165;169)). In the plasma membrane caveolin-1 interacts with cholesterol (170;171) and the protein is expressed in a variety of cell types and tissues including the liver where it is present in both the sinusoidal and canalicular membrane of the hepatocyte (172-174). The transcription of CAV1 is under the positive control of cholesterol via the SREBP pathway (see below), resulting in increased transcription of CAV1 when intracellular cholesterol levels are high (175). In vitro, caveolin-1 has been shown to form a complex with chaperone proteins which may facilitate the transport of cholesterol from the ER to the plasma membrane (176). In addition, caveolae appeared to be able to mediate cellular cholesterol efflux to plasma (177) whereas in hepatocytes the scavenger receptor SR-BI has been shown to be associated with caveolae indicating their role in

23 Chapter 1

cholesterol uptake (178). The reported upregulated expression of caveolin-1 in mice during cholesterol gallstone formation suggested a role for this protein in biliary cholesterol secretion (20) whereas expression of caveolin-2 was increased during hypersecretion of cholesterol by diosgenin feeding (179). Recently two groups reported the generation of Cav1 knockout mice (180;181). Unfortunately, the role of caveolin in biliary secretion was not investigated. The composition of lipoproteins was studied only by Drab et al. (181) and was not significantly changed in Cav1(-/-) mice. In adenovirus-mediated overexpression of CAV1 in C57Bl/6J mice (182), caveolin-1 protein was localized on the basolateral membrane of hepatocytes, and induced a ~twofold increase in plasma HDL-cholesterol levels. CAV1 overexpression inhibited the selective HDL-cholesteryl ester uptake mediated by SR-BI in cultured primary murine hepatocytes infected with AdCAV1. This supported the idea that caveolin-1 may play a role in HDL-cholesterol metabolism. In a second study of adenoviral overexpression of caveolin-1, the increased plasma HDL levels were confirmed and hepatic cholesterol levels were increased as well. In these mice biliary bile salt secretion was increased with similar increases in bile flow, cholesterol and phospholipid secretion rates. This will not change the lipid ratios in bile and therefore probably will not change the risk for gallstone formation. Adenoviral overexpression of caveolin-2 was performed in the same study and led to even higher increases in biliary lipid secretion rates but again an equal induction of the lipid secretion rates was observed. The Niemann-Pick C1 (NPC1) protein is a transmembrane protein containing a sterol sensing domain homologous to the domains found in HMG-CoA reductase, SCAP and Patched (183). Defects in the NPC1 gene result in intracellular accumulation of unesterified cholesterol together with several other lipids in the lysosomal compartment and cholesterol export from the lysosomes may be inhibited (184). The exact function of NPC1 is not known yet but it was initially suggested to be involved in intracellular cholesterol trafficking from the lysosomes to the plasma membrane (185). Recently the accumulation of cholesterol resulting from a defect in the Npc1 gene was suggested to be a secondary effect (186), whereas the primary defect was suggested to be a defect in intracellular sphingolipid distribution. A role in transport of cholesterol to the canalicular membrane for biliary cholesterol secretion was suggested when Npc1(-/-) mice fed a high cholesterol diet failed to upregulate biliary cholesterol secretion (187). On a high cholesterol diet no effect of NPC1 overexpression in wild type mice on cholesterol secretion was shown, whereas in Npc(-/-) mice the same NPC1 virus slightly increased cholesterol secretion. Also a second NPC gene was discovered (NPC2) and has the gene product was shown to have cholesterol binding properties (188-191). NPC2 and NPC1 have been suggested to play a role together in cholesterol/lipid homeostasis and seem to function in the same pathway, as mice in which either of the genes is ablated or severely reduced have similar phenotypes (192). The precise role of these proteins is not clear yet. Frolov et al (193) hypothesized that NPC1 and 2 would play a role in the generation of LDL cholesterol-derived oxysterols. In case of NPC disease, the production of LDL derived-oxysterols 25-hydroxycholesterol and 27-hydroxycholesterol is impaired. Since these oxysterols are endogenous ligands for LXR and potents suppressors of the SREBP pathway, this would result in lack of feedback inhibition on SREBP-dependent gene expression and lack of activation of LXR regulated

24 General introduction

pathways, resulting in increased cholesterol synthesis rates (194) and lack of downregulation of LDL-receptor mediated cholesterol uptake.

Genes involved in cellular uptake of cholesterol Apolipoprotein AI (ApoAI) is the main lipoprotein on HDL. Apoa1 knockout mice had low plasma HDL-cholesterol levels (195;196) and their rate of hepatic cholesterol synthesis was 50% lower than in wild type mice. The total body cholesterol content and hepatic cholesterol concentrations were not changed. In Apoa1(-/-) mice also the rate of bile acid synthesis was normal and the absolute concentrations of bile acids, phospholipids and cholesterol in gallbladder bile of Apoa1(-/-) mice were not different from wild type mice (196) despite the lower plasma HDL levels and reduced cholesterol synthesis. In contrast, Apoa1 overexpressing mice have been reported to have a twofold increase in biliary output of bile acid and cholesterol (197). The similar cholesterol concentrations in gallbladder bile of both wild type and Apoa1 knockout mice show that HDL cholesterol levels do not directly regulate biliary cholesterol secretion, which is consistent with observations in the Abca1 null mice. Apolipoprotein E (ApoE) is the major protein component of chylomicrons remnants (CM) and serves as the high affinity ligand for the LDL-receptor and LDL-receptor related protein (198). When wild type mice and Apoe knockout mice were fed a 0.02% and 0.5 % cholesterol diet, the percentage of intestinal cholesterol uptake in Apoe(-/-) mice was higher than in wild type mice (199). In Apoe knockout mice biliary cholesterol and bile salt secretion were not changed on chow diet. Biliary cholesterol secretion increased during either a high cholesterol or lithogenic diet but the increase was lower in Apoe(-/-) mice compared to wild type mice (199;200). Biliary bile salt secretion, however, was not affected in Apoe knockout mice on the lithogenic diet. As a result the saturation of bile with cholesterol in wild type mice increased and exceeded the maximal capacity of gallbladder bile to solubilize cholesterol by 61%. In Apoe null mice fed the lithogenic diet the CSI did not change significantly (199) which might explain the decreased gallstone formation compared to the wild type mice. These reports suggested a role for ApoE in the formation of cholesterol gallstones. Hepatic cholesterol concentrations were increased in Apoe deficient mice compared to wild type mice did; thus decreased hepatic cholesterol could not be responsible for the decreased secretion of biliary cholesterol in response to a high cholesterol diet. ApoE might play a role in controlling the availability of dietary cholesterol in the liver (as a component of chylomicrons) for bile secretion and furthermore it might regulate the bile cholesterol/ bile salt molar ratio, thereby controlling the cholesterol saturation in gallbladder bile. Absence of ApoE could alter intracellular trafficking of cholesterol to specific pools necessary for cholesterol transport to the canalicular membrane (201). An alternative option could be that ApoE present in bile (202) might play a role in regulating cholesterol crystallization and growth. In humans contradictory studies have been published for ApoE on this subject (202-205). Juvonen et al. (202) and Bertomeau et al. (203) found a positive correlation between ApoE4 phenotype and cholesterol crystals in bile, fast cholesterol crystallization in gallbladder bile and a higher cholesterol content in gallstones in patients bearing this polymorphism. However, this correlation could not be confirmed

25 Chapter 1

by Van Erpecum et al. (204) and Fischer et al. (205). Kesaniemi et al. (206) showed that the percentage of dietary cholesterol absorption decreased in the order of ApoE polymorphism E4> E3> E2, and also showed that the fecal excretion of cholesterol tended to be higher in individuals having the ApoE2 polymorphism compared with E3 or E4 individuals (207). In contrast, in a Japanese population with and without gallstones the ApoE4 allele did not contribute to the formation of cholesterol gallstones (208). Overexpression of the phospholipid transfer protein (PLTP), a plasma protein which is involved in remodeling of HDL, in mice resulted in increased clearance of HDL from blood and increased cholesterol, bile acid and phospholipid secretion in bile without changing the CSI. However the total concentration of lipids present in bile increased and may enhance the cristallization of cholesterol, resulting in increased gallstone formation (209). The scavenger receptor class B type I (SR-BI) (210) binds HDL with high affinity (211) and has the highest expression levels in the liver and steroidogenic tissues. At lower levels it is expressed on the apical surface of the small intestine (212). The expression of SR-BI in these tissues is coordinately regulated with cholesterol metabolism (213-215). In the promoter of SR-BI a number of binding sites for transcription factors have been identified including C/EBP, SF1 and SREBP1 (reviewed in (214;216)). SR-BI facilitates the cellular uptake of cholesterol (cholesteryl esters) from HDL. The mechanism by which this occurs is not known yet. The present believe is that only free cholesterol and cholesterol esters are taken up but not the apolipoproteins, and therefore that the particle is not internalized (217;218). However, several studies have suggested that the HDL particle is internalized and re- secreted (219-223) (224;225). As indicated above, HDL cholesterol has been suggested to be preferentially utilized for direct biliary secretion (226-228) and the generation of Srb1 knockout and overexpressing mice seemed indeed to imply an important role for SR-BI in biliary cholesterol secretion. Hepatic overexpression of Srb1 (226) in mice reduced plasma levels of HDL cholesterol and increased biliary cholesterol concentration whereas bile acid or phospholipid contents were not changed. The opposite characteristics were observed in mice with a disrupted Srb1 gene (229;230): total plasma cholesterol levels were elevated and biliary cholesterol secretion was reduced without alteration of biliary bile acid secretion, bile acid pool size or fecal bile excretion (104;229;230). This suggested a model in which hepatic SR-BI mediates the transfer of cholesterol from plasma HDL to bile for excretion and in which overactivity of SR-BI may induce increased biliary cholesterol secretion coupled to decreased plasma HDL levels and hence could play a role in gallstone formation. The generation of mice with a mutation in the mouse SR-BI promoter, resulting in a 50% expression of the protein, confirmed the importance of this protein the uptake of HDL cholesterol for biliary secretion. This study also showed that cholesterol derived from chylomicron remnants may contribute during the increased cholesterol secretion induced by a lithogenic diet. Furthermore gallstone formation was not affected in these mice but only slightly delayed (231). In addition to expression in the liver and the intestine SR-BI was recently found to be expressed in gallbladder epithelium but did not seem to play a major role in diet induced gallstone formation (232;233).

26 General introduction

Lipid transporters located at the hepatocyte canalicular membrane Bile formation is regulated by several transmembrane transport proteins belonging to the ATP binding cassette (ABC) transporter family. Since these ABC-transporters are responsible for the secretion of the predominant biliary components over the canalicular membrane, changes in the expression and/or activity of these proteins may result in an alteration of bile composition, which may influence gallstone formation. Until now three ABC-transporters localized at the canalicular membrane have been found to be involved in the secretion of the main lipid components of bile. The bile salt export pump (BSEP, or SPGP, or ABCB11) regulates the secretion of bile salts into bile. BSEP expression is restricted to the canalicular membrane of the hepatocyte. The second ABC-transporter is Mdr2 in rodents and MDR3 (ABCB4) in humans. Both act as a flippase for the phospholipid phosphatidylcholine. The third important canalicular ABC-transporter is MRP2 (ABCC2, cMoat), which is responsible for biliary secretion of organic anions and glutathione conjugates (234). The bile acid transporter BSEP (ABCB11) has been identified as one of the major Lith genes involved in gallstone formation in mice (235) (see below). In mice the protein may be responsible for transport of the more hydrophobic bile acids. In Bsep(- /-) mice (236) biliary bile salt output was reduced to 30% and plasma and hepatic bile acid concentrations were increased. In contrast, the concentration and output of both phospholipids and cholesterol in bile were both increased. The pattern of biliary bile salts in the Bsep knockout mice was shifted to more hydrophilic species. In addition, tetrahydroxylated bile acids were present in bile of knockout mice, which were not found in bile of wild type mice. To explain the unexpected increase in biliary lipid secretion in Bsep(-/-) mice, Wang et al. (236) postulated that accumulation of hepatic bile acids resulting from the absence of Bsep would inhibit bile acid synthesis which could lead to the accumulation of cholesterol in the liver. This in turn may stimulate biliary secretion of cholesterol. Expression levels of MDR2 were, however, not reported and upregulation of this protein by the increased intrahepatic bile acids (237) seems to be a more likely explanation. In contrast to mice the homozygous defect of BSEP in humans leads to the complete block of bile salt secretion and severe cholestasis (238). Mice overexpressing Bsep (239) showed increased bile salt secretion into bile as well as increased bile flow, CH and PL secretion, but no change in expression of the respective transporters was observed. Since fecal bile salt excretion was not changed and Cyp7a1 expression decreased, the authors suggested that the enterohepatic circulation was increased. Furthermore the proportion of TDC and TCDC of the total bile salt pool was increased resulting in a decreased hydrophobicity index, thus a more hydrophobic bile salt pool, whereas no change in the total bile salt pool was noticed. However this did not result in enhanced gallstone formation in mice overexpressing Bsep, which was the case when these mice were fed a lithogenic diet. BSEP is obviously present on the list of human candidate LITH genes but the results of the presented animal studies do not necessarily reflect the human situation. Disruption of the Mdr2 (Abcb4) gene in mice resulted in the absence of phospholipids into bile. In addition, biliary cholesterol secretion is also very low but bile acid secretion remains unaltered (240). The expression and activity of MDR2 can be regulated by bile salts (237;241) and recently direct binding of the bile acid receptor

27 Chapter 1

FXR to an FXRE in the MDR3 promoter has been reported (242). In addition, the expression of MDR2 is upregulated by HMG-CoA reductase inhibitors (243), fibrates (244;245), which are ligands of the nuclear receptor peroxisome proliferator-activated receptor (PPAR), and by peroxisome proliferators in general (246). Recently, cholesterol gallstone formation has been shown to occur in aging Mdr2(-/-) mice (247) whereas in patients with symptomatic cholelithiasis mutations in MDR3 gene have been found (1). These studies indeed suggest that Mdr2/3 and phospholipid in bile are important for cholesterol gallstone formation. This was further supported in a recent study in which mice were fed a PC enriched diet. In mice susceptible to gallstone formation the PC enriched diet reduced the gallstone incidence, which was according to the authors was probably due to effect on biliary lipid composition, although this was not tested in this study (248). The molecular mechanism of biliary cholesterol secretion has been an enigma for many decades. Recent discoveries have, however, shed new light on this interesting field of research. It has long been thought that the sterol simply follows phospholipids and that transport is not protein-mediated. The coupling between phospholipid and cholesterol is, however, certainly not absolute. For instance, dietary supplementation with the plant sterol diosgenin induces a 5-7 fold increase in biliary cholesterol secretion (249-251) and in mice even a higher upregulation of 15-fold has been reported (252). Recently candidates for such an activity have been discovered: the ABC halftransporters ABCG5 and ABCG8. In 1980, Miettinnen et al. demonstrated impaired biliary sterol secretion in patients suffering from sitosterolemia (253), additional to increased absorption. Arranged in a head-to-head orientation, the two genes are separated by ≤ 400 base pairs suggestive of coordinated regulation of expression (115;116;131). There are several lines of evidence that support a heterodimer model for ABCG5/Abcg5 and ABCG8/Abcg8 (114- 116;131;134;135;254;255). The data resulting from these studies combined strongly argue for the heterodimer model. Transgenic mice overexpressing both human ABCG5 and ABCG8 displayed up to 14 times overexpression of both genes specifically in liver and intestine. Cholesterol levels in gallbladder bile were five-fold increased, whereas bile salt and phospholipid levels were relatively unaffected (137). In Abcg5 and Abcg8 disrupted mice (G5G8(-/-)) biliary cholesterol levels were decreased over 90% without significant changes in bile salt and phospholipid levels. When G5G8(-/-) mice were fed a high-cholesterol diet they had massively increased hepatic cholesterol levels, yet biliary cholesterol levels hardly changed (138). Furthermore, as shown in this thesis (252), biliary cholesterol secretion rates in various mouse models were found to correlate with hepatic expression levels of Abcg5 and Abcg8. This illustrates that ABCG5 and G8 play a key role in biliary sterol secretion which will be further discussed in the remainder of this thesis.

Regulatory genes The regulation of the expression levels of the genes playing a role cholesterol homeostasis is controlled in a complex way by several liver enhanced transcription factors. The regulation of their target genes involves interaction between these transcription factors and recruitment of complexes of corepressing and coactivating

28 General introduction

factors, like PGC-1alpha (256), N-CoR and SMRT (257) and there may be different regulatory mechanisms between species. Transcription factors of the sterol regulatory element binding protein (SREBP) family may influence cholesterol gallstone formation via the regulation of cholesterol biosynthesis. Three isoforms of SREBPs have been identified. The SREBP1a and SREBP1c forms are transcribed from a single gene and only differ in the N-terminal sequence whereas SREBP2 is transcribed from a second gene. In most cell culture systems SREBP1a and SREBP2 are the predominantly expressed isoforms, whereas in the liver and other organs SREBP1c and SREBP2 are most highly expressed. When cells are depleted of sterols, the NH2 terminal part of the full-length membrane-bound form of each SREBP is cleaved and released from the membrane in two steps (258- 260). This cleavage upon low cellular cholesterol levels has been shown to be regulated by an ingenious mechanism in the ER and involves the action and conformational changes of SREBP cleavage activating protein (SCAP) and INSIG1 and INSIG2, a set of integral membrane proteins (261-268). At normal or high cholesterol levels the INSIG proteins bind to SCAP, which leads to the retention of SCAP in the ER. The binding of SCAP to SREBPs also leads to the retention of the SREBP proteins in the ER and cleavage, which occurs in the Golgi, is prevented. Another level of regulation of cholesterol synthesis by INSIG1 protein is the sterol induced binding of INSIG1 to the sterol sensing domain of HMG-CoA reductase which leads to an accelerated degradation of this protein (269;270). Each SREBP can act independently on the same genes (258;271) but the three isoforms have different target gene specificity. All three isoforms tend to stimulate the expression of multiple genes involved in both cholesterol and fatty acid synthesis but the relative degree of stimulation varies and they have differential effects on cholesterol synthesis as opposed to fatty acid synthesis. The generation of Srebp1 knockout mice resulted in a high rate of embryonic lethality (272). The mice that survived showed decreased hepatic fatty acid synthesis and the mRNA levels of these genes tended to be decreased. In contrast, the mRNA levels of genes of cholesterol synthesis were increased due to a compensatory activation of SREBP2. Srebp2 knockout mice were not viable at all (272). Mice overexpressing a dominant-positive truncated form of Srebp1a (273) developed fatty livers which was accompanied by massive increases in mRNA levels of cholesterol synthesizing and fatty acid synthesizing enzymes and of the LDL receptor, however, the plasma lipid levels were not changed in these animals. In mice overexpressing Srebp1c the liver was not enlarged and only a modest triglyceride accumulation was observed and similarly the mRNAs encoding the fatty acid synthesizing enzymes were only modestly increased. The mRNAs encoding cholesterol biosynthetic pathway enzymes were unchanged (272). Like overexpression of Srebp1a, overexpression of Srebp2 induced an enormous increase in the expression of genes in the pathways of cholesterol and fatty acid biosynthesis and increased cholesterol (ester) and triglyceride levels in the liver. The ratio of cholesterol synthesis/fatty acid biosynthesis, however, was much higher than in Srebp1a overexpressing mice (274). From these animal models it seemed that SREBP2 is more effective than SREBP1a in increasing the amount of mRNAs of genes in cholesterol synthesis whereas SREBP1a is more effective in activation of fatty acid synthesis. SREBP1c is the least effective

29 Chapter 1

of all three in both pathways. Recent microarray studies revealed that in mice overexpressing SREBP1a and SREBP2 (275) all genes involved in cholesterol synthesis showed upregulation. The same and other studies showed that rates of biliary cholesterol secretion were highly increased in these mice (252;275) but gallstone occurrence was not reported. The liver X receptor (LXR) subfamily of nuclear receptors consists of two members: LXRα (NR1H3) and LXRβ (NR1H2). Both have a different expression pattern. Whereas LXRβ is ubiquitously expressed, LXRα is most highly expressed in the liver and in the intestinal tract which are the tissues most involved in cholesterol metabolism. Both receptors heterodimerize with another nuclear receptor, the retinoic X receptor RXR, which is activated by 9-cis-retinoic acid. Activators of LXR identified thus far are the oxysterols 22R-hydroxycholesterol (adrenal glands), 24S- hydroxycholesterol (brain), 24S,25-epoxycholesterol (liver) (94), 27- hydroxycholesterol (human macrophages) which is a product of CYP27 action (81;276-278) and 6alpha-hydroxy bile acids (279;280). In addition to activation by ligands, LXR activity can be modulated through phosphorylation by PKA and PKC (281;282). In contrast, negative regulation of LXRalpha has been shown for another product of the cholesterol synthesis pathway, geranylgeranyl-pyrophosphate by interaction with nuclear coactivators of LXRalpha (278;283). Also polyunsaturated fatty acids have been shown to prevent binding of the LXR/RXR heterodimer to the LXRE (284;285). Genes positively regulated by LXRα have among others proven to be CYP7A1 (49;277), SREBP1c (286;287), ABCA1 (108;288), ABCG1 (289), ABCG4 (290), ABCG5/G8 (131), CETP (291), PLTP (292;293), ApoE (294), ApoAIV (295), and VEGF (296). LXRα binding to the CYP7A1 promoter increases the transcription and activity of CYP7A1 in mice leading to the conversion of cholesterol into bile acids. Lxrα(-/-) mice fail to upregulate CYP7A1 expression on a high cholesterol diet and accumulate cholesterol in the liver (49). Interestingly, Lxrα(-/-) mice are resistant to increased dietary cholesterol and do not develop fatty livers (297). In both types of knockout mice biliary lipids or gallstone formation was not investigated. Although beyond the scope of this review, apart from playing a very important role in cholesterol synthesis, LXR also plays a major role in the regulation of fatty acid metabolism via the activation of SREBP1C (286;287), which is the major transcription factor for regulation of fatty acid synthesis (298). By regulating the transcriptional activity of key target genes involved in cholesterol catabolism, storage, absorption and transport, LXRα seems to be the bodies’ key sensing molecule for maintaining cholesterol homeostasis. The farnesoid X receptor (FXR, NR1H4) was originally found to be activated by high concentrations of farnesol (299;300). It was shown that a number of bile acids, including chenodeoxycholic, deoxycholic and lithocholic acids, but not cholic acid, bound FXR and were able to induce the recruitment of coactivators and activated FXR mediated transcription in reporter cotransfection assays or in cultured cells (301-303). Recently, in in vitro assays, also late but not early intermediates of the classical bile acid synthesis pathway, were shown to be able to activate the human FXR to similar a extent as CDCA, which is the most potent physiological ligand thus far (304). In another study by Howard et al, the ability of CDCA to activate rat FXR could be inhibited by UDCA but was not affected by TCA (305). Furthermore this

30 General introduction

study identified forskolin (an activator of adenylate cyclase) and androgens as potential endogenous activators of FXR. Also the cholesterol precursor lanosterol was identified as ligand for a non-primate isoform of FXR, FXR beta (306). In contrast to the in vitro studies, in vivo cholic acid seemed to be a relevant ligand for FXR in mice (92). In rabbits DCA was shown to be a potent ligand (307), again emphasizing the species differenes. Furthermore it was shown that bile acids that do not activate FXR are able to induce FXR mRNA and protein levels but do not affect target gene expression levels. FXR is expressed at high levels in liver, intestine, kidneys, adrenal glands (299;300) and gallbladder but also in vascular endothelial cells (308), and at lower levels in a number of other tissues (306;309). Several isoforms of FXR have been identified, each with its own target specificity (309-311). Identified target genes of FXR include genes involved in bile acid transport and biosynthesis (312;313) that were previously known to be downregulated by bile acids: such as CYP7A1, CYP8B1 (314) and the basolateral sodium taurocholate cotransporter protein NTCP (315). Upregulation was shown for the hepatic canalicular bile salt transporter BSEP (316;317), the ileal bile acid binding protein I-BABP (301;318;319), the small heterodimeric partner (SHP) (66;67), and the transmembrane heparan sulfate proteoglycan Syndecan 1 (320). Mice with a targeted disruption of the Fxr gene (321) failed to correctly control bile acid biosynthesis and excretion. In a situation of an increased bile acid concentration, FXR is activated and promotes the transcription of SHP. Increased levels of SHP protein inactivate the liver receptor homologue LRH1 by forming a complex, which leads to an inhibition of transcription of CYP7A1 and other target genes (66;67). This mechanism has been shown for the target genes CYP7A1 and NTCP (66;67;322). However, direct regulation of FXR by binding of FXR to the BSEP promoter has also been shown (317). Apart from being a key player in bile salt metabolism, the identification of lanosterol as a ligand for FXR and target genes like Apolipoprotein AI (323), Apolipoprotein CIII (324), the VLDL receptor (325), phospholipid transfer protein (PLTP) (326;327) and the phospholipid pump MDR3 (242) may indicate that this nuclear receptor also may play an important role in cholesterol metabolism. Indeed FXR(-/-) mice showed higher levels of plasma HDL and increased plasma triglyceride levels and reduced expression levels of SR-BI. Furthermore bile flow, phospholipid and cholesterol secretion were increased in FXR(-/-) mice on normal lab chow due to increased bile salt secretion (328;329). SHP, the small heterodimeric partner (NR0B2) heterodimerizes with several nuclear receptors (330), including PPARalpha (331), ER(332), LRH-1 (66;67;333), LXRalpha (334) and HNF4alpha (335) to inhibit the activating properties of these nuclear receptors, but also acts as direct repressor (335). SHP has a ligand-binding domain but it lacks a DNA binding domain and is suggested to be a constitutive repressor but no endogenous ligand has been indentified thus far (336). It is expressed in the liver, intestine, heart, pancreas and adrenal glands (330), and has been shown to be a potent repressor of LRH-1 and its target genes. Two groups have generated mice lacking Shp (71;72). The composition of the total bile acid pool of these null mice showed differences compared to wild type mice, ie. the proportion of all muricholic acid species was decreased whereas cholate and deoxycholate proportions were increased.

31 Chapter 1

The liver receptor homologue LRH-1, also known as NR5A2, FTF or CPF, is a monomeric orphan receptor and is the mammalian homologue of the Drosophila fushi tarazu F1 receptor gene (64;337). It is expressed in liver, pancreas, intestine, and ovary and binds to DNA as monomer. LHR-1 is believed to serve as a tissue-specific competence factor for bile acid synthesis. No ligands have been reported for LRH-1 but target genes as determined in in vitro experiments include: α-fetoprotein (64), SHP (333), CETP (291), CYP7A1 (337), CYP8B1 (338), MRP3 (339), and LRH-1 autoregulation (340), ASBT (341), and SR-BI (342), all of which are genes in lipid metabolism. Mice deficient for FTF/LRH1 are embrionically lethal (343), however in FTF/LRH1(+/-) mice and mice in which FTF was adenovirally overexpressed indicated that in vivo FTF/LHR1 might act as a suppressor of bile acid synthesis, instead of acting as a activator of transcription (344), although other studies in FTF overexpressing mice contradicted this (68). More importantly, the ratio cholic acid/muricholic acid was increased in gallbladders of FTF(+/-) mice, which may influence the CSI in bile and may lead to enhanced gallstone formation (344). Together, SHP and LRH1 seem to be important factors in the regulation of expression of genes involved in transport and synthesis of bile acids, thereby influencing the CSI in bile. Peroxisome proliferator-activated receptors (PPAR) were identified as nuclear receptors activated by hypolipidemic compounds, like fibrates, but fatty acids have been found to be the natural ligands. Genes involved in fatty acid metabolism, β- oxidation and ω-oxidation have been found to be activated by PPARα (NR1C1) and specific target genes of PPARα are peroxisomal acyl-CoA oxidase (ACO), cytochrome P450 4A1 and enoyl-CoA/3-hydroxyacylCoA hydratase/dehydrogenase multifunctional enzyme. Mice with a targeted disruption of the Pparα gene lacked peroxisome proliferation and lacked induction of peroxisome proliferator-regulated genes in response to fibrates (345-347). In addition, Pparα-null mice showed increased total and HDL-cholesterol levels (348). Fibrates are known to lower plasma triglycerides and cholesterol levels (349). One of these fibrates, bezafibrate altered the bile acid composition in bile, by inducing an increase in cholic acid and a decrease in chenodeoxycholic acid, suggesting the involvement of PPARα in the expression of CYP8B1. Hunt et al. (347) showed that CYP8B1 is upregulated by PPARα ligands and a concomitant increase in the amount of cholic acid formed was found. CYP7A1 levels were not changed in Pparα null mice. In contrast, administration of fibrates to humans does reduce CYP7A1 expression, resulting in an increased risk for gallstone formation (349-352). Post et al. (353) recently showed that fibrates downregulated the expression of CYP7A1 and CYP27 in mice and that fecal bile acid secretion was decreased and fecal cholesterol secretion increased, both being PPARα dependent. Bezafibrate but not etofibrate administration to hyperlipidemic patients after cholecystectomy induced an increase of the lithogenic index in hepatic bile mainly as a result of an increase of biliary cholesterol concentrations (354). On the other hand, fibrates increase the expression of Mdr2 (246) and phospholipid secretion, suggesting that this is anti-gallstone formation. Also the xenobiotic nuclear receptors PXR/SXR and CAR play a role in regulation of cholesterol homeostasis, mainly by regulating bile acid metabolism (355-358), but whether this also plays a role in cholesterol gallstone formation

32 General introduction

remains to be investigated. PXR(-/-) mice did not show any defect in bilairy cholesterol secretion (355). Numerous functions of the liver are controlled primarily at the transcriptional level by the actions of a limited number of hepatocyte-enriched transcription factors which include the hepatocyte nuclear factor (HNF)1α, -1β, -3α, -3β, -3γ, -4α, and -6. Tcf1 (encoding for HNF1α) deletion induced enlarged fatty livers and hypercholesterolemia in mice. In addition, the expression of genes encoding for hepatic bile salt uptake (NTCP, Oatp1 and Oatp2) were decreased resulting in a defect in bile acid uptake and increased plasma bile salt levels. Furthermore CYP7A1 and HMGR expression levels were elevated resulting in increased synthesis of bile acids and hepatic cholesterol, whereas HDL metabolism was impaired. In addition FXR expression was downregulated and the gene was identified as a direct target of HNF1. The Tcf1(-/-) mice also showed elevated expression of genes encoding enzymes involved in the synthesis, catabolism, and transport of fatty acids and of the peroxisomal β-oxidation enzymes (CYP4A3, bifunctional enzyme and thiolase). In contrast, there was a marked reduction of liver fatty acid-binding protein (L-FABP) expression in the livers of Tcf1 null mice (359;360). Although the liver specific deletion of Hnf3∃ does not have large effects on liver gene expression (361), in mice with a liver specific overexpression of Hnf-3beta decreased expression of sinusoidal bile acid uptake transporter NTCP and the canalicular phospholipid transporter MDR2 was seen, but no influence on the expression of BSEP and MRP2 was observed. Complete deletion of the common dimerization partner of the nuclear receptors, RXRalpha, did not result in viable mice (362) but ablation of specific hepatic gene expression of RXR alpha showed defects in all pathways regulated by each of the nuclear receptors (363). Mice lacking hepatic Hnf4alpha accumulated lipids in the liver and serum cholesterol and triglyceride levels were enormously decreased whereas serum bile acid concentrations were increased (364). Unfortunately biliary lipids were not measured in this study. HNF4 has been also shown to regulate the expression of CYP8B1 (365;366) CYP7A1(367), and CYP27 (368).

Leptin Leptin is a secreted 16 kDa protein predominantly expressed in adipose tissue and identified as the gene having a major role in weight regulation (369). Obesity, losing weight rapidly (370) and fluctuations in weight (371) correlate with high frequency of gallstone formation. The direct relevance of leptin in gallstone formation is not clear yet, but several studies have indicated a role for this peptide. In Mexican Americans increased leptin plasma levels were associated with a high frequency of cholesterol stones (372). Absence of leptin due to the ob/ob mutation led to obesity and conferred resistance to diet-induced gallstone formation in gallstone susceptible C57BL/6J mice. This could be restored by leptin injection (373). Similar results were obtained in Obese Zucker rats in which biliary cholesterol secretion is impaired and could be partially restored by leptin injection (374).Other studies suggested that the pimary effect of leptin might be to affect gallbladder motilily. In obese db/db mice serum levels of cholesterol, glucose and leptin are increased and as well as gallbladder

33 Chapter 1 volume. In these mice the biliary cholesterol saturation index and the formation of cholesterol crystals was significantly diminished probably caused by a reduction in gallbladder motility which was also observed (375-377).

Lith genes Major indications for the genetic basis for cholesterol gallstone formation are the numerous inbred mouse strains with different basal levels of total plasma cholesterol (378) and differential susceptibility to gallstone formation. Total cholesterol levels in plasma (mainly HDL) were the highest in NZB/B1NJ and 129/J strains that had significantly higher total plasma cholesterol levels than the C3H/HeJ strain, whereas the lowest levels were found in the SWR/J strain. The other investigated mouse strains showed intermediate plasma cholesterol levels in the following order: A/J

34 General introduction

A candidate gene for Lith-1 was likely to be the bile salt export pump Bsep (235). However in a recent study the expression and canalicular presence of the BSEP protein were shown to be increased in C57L/J mice but in contrast, the transport of the bile salt taurocholic acid was decreased. The authors suggested that this might be due to increased cholesterol content of the canalicular membrane in C57L/J mice (388). Lith-2 was associated with Mrp2 (389) and increased bile flow as well as secretion rates of glutathione and bilirubin conjugates (390). Microarray analysis on liver of C57L/J mice and AKR/J mice revealed differentially expressed genes which included cytochrome P450 genes antioxidant and lipid peroxidation, fatty acid metabolism (391), and identified the transcription factor Nrf2 as potential Lith1 gene whereas none of other the proposed lith genes by QTL analysis was differentially regulated. Additional comparisons between C57L and AKR mice on a lithogenic diet revealed that in C57L mice SR-BI and ACAT2 expression was increased 2.5 fold and 2 fold respectively compared to AKR mice. In addition, HMG-CoA reductase expression failed to decrease properly in C57L mice when fed the lithogenic diet (392). This observation was further investigated and revealed that the feedback regulation of the processing of SREBP2 on the lithogenic diet in C57L mice was impaired (393). The lithogenic diet also increased both cholesterol ester hydrolase mRNA and protein levels in C75L mice whereas these remained unchanged in AKR mice. Together these gene profiles suggest that the hepatic uptake of HDL cholesterol might be increased, the transport of intracellular cholesterol transport increased, whereas cholesterol synthesis is not properly downregulated on the lithogenic diet in C57L mice. This then might result in increased biliary secretion of cholesterol and susceptibility for gallstone formation.

Indirect evidence for genetic background of human cholesterol gallstones

Epidemiology of cholesterol gallstones The highest prevalence of gallstones was reported in European and particularly Amerindian populations, the lowest prevalence was found in Africans and intermediate prevalence rates were observed in the Far East and India (394;395). Based on 22 sonographic studies published in the years 1979-1995, Kratzer et al. (394) estimated the mean prevalence rate of cholecystolithiasis in Europe to be 10- 12%. A similar value (15.7%) was calculated earlier by Brett and Barker (395) in their critical overview of a series of autopsy studies. Surprisingly, few data have been reported for North American populations while multiple studies were conducted in Latin America (396-401). In North America, the detailed prevalence data are available only for Hispanics (402;403) and Native Americans (404-407) while only a limited number of studies have been performed in North American Caucasians (408- 410). The data obtained by Bortnichak et al. (408) from 5209 subjects involved in the Framingham Heart Study are of particular interest because the association between cholesterol gallstones and increased risk of atherosclerosis in male but not female gallstone patients was reported for the first time in this study.

35 Chapter 1

Native Americans have the highest prevalence of cholelithiasis: 48% overall prevalence was found in Pima Indians (406) and somewhat lower prevalence rates were found in Chileans (397) and in other Native American populations (405;411). In contrast, the overall prevalence in other American populations was around (non- Caucasians) or below (Caucasians) 20%. The striking differences in prevalence rates of gallstones between different populations within the same American continents suggest a role of the genetic background in the etiology of the disease. However, most of the differences between epidemiological data may also be (partially) explained by environmental factors or by factors relating to study design (autopsy vs. sonography or cholecystography, prospective vs. retrospective, gender and age distribution, and response rate). To check the influence of the genetic background more rigorously, prevalence of the disease in migrants coming from the region with a certain prevalence of gallstones integrated into a new environment with a different prevalence of gallstones should be compared with the prevalence in the genetically homogenous acceptor population. Unfortunately rapid loss of the original genetic background within a few generations makes such studies difficult. In a recent cross-sectional population study of Brasca et al. (401) Italian and Spanish descendants fully integrated into the US society but having all four grandparents of the same Italian or Spanish origin presented higher prevalence rates for all age groups than those reported in Italy and Spain. Interestingly, the difference was significantly higher among the young subjects of both sexes, lower in the intermediate age group and almost no difference was found in subjects older than 60 years. These findings, in accordance with the data obtained from Pima Indians and other high-risk populations, clearly indicate the importance of genetic disposition for early manifestation of the disease. Recently, studies in Chilean Hispanics and Mapuche Indians showed that both bile acid synthesis and cholesterol synthesis was increased in individuals with gallstones compared to gallstone free individuals and that this increase probably preceded the formation of gallstone. The authors suggested that the increased synthesis was probably due to the increased loss of bile acids (412).

Family and twin studies Surprisingly few genetic studies on gallstone disease in humans have been published until now. In the first study conducted by Huddy in 1925 (413) the incidence of cholelithiasis in family members of 57 non-related affected individuals was 42% as compared with less than 16% in families of 100 controls with no history of “indigestion”. Kőrner (414) found the frequency of gallstones in 74 families of gallstone patients to be 5 times higher than in families of non-affected controls. In a study of Littler and Ellis (415) 20.8 % of 100 patients with gallstones gave a positive family history. Jackson et al. (416) studied first degree relatives from 100 patients with gallbladder disease. Definite or suggestive evidence of gallbladder disease was found in 72% of the first-degree relatives. Definite gallbladder disease at least in one parent was found in 33% and only in 2 cases neither parent had gallbladder disease. A different approach was chosen in a study of Van der Linden and Lindelőf (417) who compared the occurrence of gallstone disease in patient´s siblings and husbands or wives. Gallstone disease was found to occur more often among the siblings of

36 General introduction

gallstone disease patients. The incidence of gallstones in wifes of the gallstone patients and wifes of their healthy brothers did not differ (418) indicating genetic background of the disease. In their third study Van der Linden together with Simondson (419-421) focused on the incidence of gallstones among the parents of young (< 22 years) gallstone patients. A group of 37 patients was compared with two age and sex matched control groups: 37 randomly chosen healthy individuals (group I) and 37 patients with normal cholecystography performed because of uncharacteristic abdominal complains (group II). Either parent was affected in 20/37 patients but only in 7/37 and 14/37 subjects from control group I and II respectively. Neither parent had gallstones in 12, 29 and 23 subjects from patient group, control group I and control group II respectively. Lithogenicity of duodenal bile was investigated in older and younger sisters of 11 gallstone females (mean age 21.1 yr.) by Danzinger et al. (422). Four from 8 older sisters (mean age 29.4 yr), 1 from 10 age-matched controls and 1 from 10 younger sisters (mean age 20.3 yr) had lithogenic bile. Gilat et al.(419) studied, in a prospective manner, the frequency of gallstones in 171 first-degree relatives of patients with proven gallstones compared with 200 matched controls. All subjects were studied by oral cholecystography, and their height, weight, blood glucose, cholesterol, and other parameters were measured. Gallstones were found in 20.5% of the first-degree relatives and in 9.0% of the control group. In the most recent study, Sarin et al. (420) evaluated 330 first-degree relatives of gallstone-positive index patients using ultrasonography. Stones were found in 15.5% of first-degree relatives compared to only 3.6% of matched controls and the risk was higher for female relatives. Despite the different design of the presented studies their results univocally indicate the importance of genetic background of cholelithiasis. More evidence supporting the role of inherited disposition to gallstones comes from the twin studies. A definite preponderance of concordant cases of gallstones among the uniovular pairs (7 of 18) compared with the binovular pairs of twins of the same sex (3 of 37) was found in a catamnestic investigation of 101 Danish twins with gallstones performed by Harvald and Hauge (423). From two unselected series of twins investigated by Doig (424), cholelithiasis was present in one or both of 133 pairs. Concordance was demonstrated in 9 of 23 identical pairs but only in 4 of 42 fraternal pairs of the same sex. Unfortunately in the series of the selected pairs that underwent both clinical and laboratory investigation (see also Doig and Pitman (425), cholelithiasis occurred only in four monozygous and six dizygous couples. Concordance was seen in 2 monozygous and 1 dizygous pairs. An outstanding study of biliary lipid composition in monozygotic and dizygotic pairs of twins which was conducted by Antero Kesaniemi et al. (426). The relative contribution of genetic factors to biliary and serum lipid composition, including cholesterol precursors, squalene and methylated sterols which reflect the activity of cholesterol synthesis was studied in 17 monozygotic and 18 dizygotic middle aged male pairs of twins. Gallstones were found in seven monozygotic (3 concordant pairs) and three dizygotic subjects (all discordant pairs). The pairwise correlations of all measured parameters tended to be higher in the monozygotic than in the dizygotic pairs suggesting a significant genetic control. However, no target genes were identified.

37 Chapter 1

Single gene defects The first evidence that human gallstone disease might be caused by a single gene defect came recently from the studies of Rosmorduc and colleagues (1) and Jacquemin et al. (427). In the first study, six symptomatic adult patients with a peculiar form of biliary gallstone disease characterized by intrahepatic sludge, gallbladder cholesterol gallstones associated with mild chronic cholestasis and recurrence of symptoms after cholecystectomy were studied. In 2 of them, hepatic bile analysis showed supersaturation with cholesterol together with low phospholipid concentration. This finding led to the hypothesis that a defect in the MDR3 gene could constitute the genetic basis for this highly symptomatic and recurrent form of gallstone disease. Indeed, a heterozygous nonsense mutation in 2 patients, a homozygous missense mutation in 3 other patients, and a heterozygous missense mutation in 1 patient were detected. None of these mutations was reported previously in patients with progressive familiar intrahepatic cholestasis type 3 caused by homozygous mutations of MDR3 gene leading to complete absence of MDR3 protein and secretion of phospholipids into bile (427;428). None of the studied patients manifested any sign of liver disease in childhood. Jacquemin et al. (427) investigated 31 patients with cholestatic liver disease possessing the features of progressive familiar intrahepatic cholestasis type 3. Mutations of MDR3 were detected in 17 patients. Gallbladder stones were found in 4 children and 2 parents. Both studies showed that defects of MDR3 might play a more general role in liver diseases such as liver cirrhosis, cholesterol gallstones and familial cholestasis of pregnancy (see also (429;430), however, making direct links between liver diseases with common and frequent phenotype and mutations in less conserved regions of the coding sequence that do not affect protein expression without functional studies and further analysis of the genetic background might be premature (431). However recently, Rosmorduc et al identified point mutations in ABCB4 as a major risk factor in a group of patients with gallstones. These mutations were shown to be associated with recurrent cholelithiasis in young adults (432). A new link between another single gene defect, the CYP7A1 deficiency, and premature cholesterol gallstones associated with hypercholesterolemia resistant to HMG-CoA inhibitors in two male homoyzgotes has recently been reported in an elegant study of Pullinger and colleagues (3).

Multiple gene defects and polymorphism studies Direct evidence for the role of genes in human gallstones should come from multiple gene defects and polymorphisms associated with gallstones. No multiple gene mutations have been reported in a gallstone patient to our knowledge. In contrast, putative association between a series human gene polymorphisms and gallstones have been published. Some of these studies were already discussed in the above sections. A brief overview of the polymorphism studies will be presented in this section. ApoE polymorphism is the most extensively studied polymorphism in gallstone patients. Controversial data published on the protective role of the epsilon4 allele against gallstones have already been mentioned (202-205). In contrast, the epsilon2 allele seems to act as a protecting factor against gallstones in the middle age according to Niemi et al. (433) whose data are further supported by the earlier work

38 General introduction

of Kesaniemi et al. (206). These authors demonstrated that the percentage of dietary cholesterol absorption decreased in the order of ApoE isoforms E4> E3> E2, and also showed that the fecal excretion of cholesterol tended to be higher in individuals having the ApoE2 phenotype compared with E3 or E4 individuals (207). In a study of polymorphisms at the ApoB, ApoAI, and cholesteryl ester transfer protein gene loci in patients with gallbladder disease conducted by Juvonen et al. (434) CETP polymorphism associated with another HDL lowering factor might be associated with cholesterol gallstone disease. A link between the X+ allele of the ApoB gene and the increased risk of cholesterol gallstone disease was proposed by Han et al. (435). Beside the genes involved in biliary secretion of cholesterol, a set of genes controlling emptying of the gallbladder might participate in on the etiology of gallstone disease. A search for mutations and/or polymorphisms in the cholecystokinine receptor gene in gallstone patients performed by Nardone et al. (436) was, however, unsuccessful. In contrast to the previous section no genetic or biochemically defined risk factor(s) associated with the strong increase of the risk of gallstone disease has been disclosed in any of the studies presented in this section.

Genetic diseases associated with cholesterol gallstones Genetic diseases associated with cholesterol gallstones caused by defects of the genes that are not directly involved in biliary lipid secretion will be listed in this section. Increased incidence of radiolucent gallstones has been observed in patients with cystic fibrosis (437-439), Down syndrome (440) and Gaucher disease (441). Patients with cystic fibrosis now commonly survive into adulthood and are at high risk for the development of gallstones. The diagnosis may be obscured by other common gastrointestinal complications of cystic fibrosis. Radiolucent gallstones found on cholecystography were thought to be cholesterol gallstones. This hypothesis was further supported by changes of biliary lipid composition found by Roy et al. (442). In this study in 14 patients with cystic fibrosis who had stopped taking pancreatic enzymes for one week the molar percentage of cholesterol and cholesterol saturation index were comparable to values of the cholelithiasis group and almost twice higher than those of controls. In 12 patients with cystic fibrosis taking pancreatic enzymes, the molar percentage of cholesterol and saturation index did not differ from those of controls. The findings of Roy et al. (442) were not confirmed in a later study by Angelico et al. (443) who found non-significant changes in cholesterol saturation index between patients with cystic fibrosis with (1.21 +/- 0.28, n = 10) and without (0.99 +/- 0.54, n = 7) gallstones. Gallstones available from two patients who died of severe bronchopneumopathy contained mainly calcium bilirubinate and protein while their cholesterol content was only 44% and 28% of dry weight. Interestingly samples of duodenal bile from all 17 patients were checked for microlithiasis and the findings were negative. The authors came to the conclusion that radiolucent gallstones of patients with cystic fibrosis are not of the conventional cholesterol type. The link between increased risk of gallstones and Down syndrome (DS) was suggested by Elias Pollina et al. (444) who analyzed 56 cases of cholelithiasis in patients aged two months to 15 years. A combination of cholelithiasis with Down

39 Chapter 1 syndrome was present in four cases from the studied series. Several cases of gallstones in infants with Down syndrome were reported in two later studies of Aughton et al. (445) and Aynaci (446). A systematic prospective study was carried out recently (440). Of the 126 patients with Down syndrome who underwent abdominal ultrasound examination, six (4.7%) were found to have cholelithiasis. In contrast, among the 577 age-matched controls, only one (0.2%) 7-year old girl had gallstones. All seven children with cholelithiasis were born at term, were asymptomatic, and did not have identifiable risk factors for gallstones. In the six children with Down syndrome and cholelithiasis, abdominal x-ray did not show radiopaque gallstones indicating a high amount of cholesterol in the stones. However, to our knowledge no data on the composition of bile or gallstones from patients with Down syndrome have been published. The fact that gallstones are often found in patients with Gaucher disease was based on clinical experience but little epidemiological data is available. Perez-Calvo and coworkers (441) published recently the results of a national study of co-morbidity with other common diseases such as dementia, Parkinson disease, ischemic stroke, ischemic heart disease, non rheumatic valvular disease, hematological and non- hematological malignancies, pulmonary fibrosis, tuberculosis, schizophrenia and gallstones conducted in 67 patients with Gaucher disease, 132 nonaffected heterozygous carriers and 59 healthy relatives. Gaucher's patients appeared to have the greatest risk of developing gallstone disease. This increased risk was particularly high among female patients and could not be explained in terms of differences in age. Patients with Gaucher disease have very low HDL-cholesterol, the underlying mechanism is not known but increased reverse cholesterol transport leading to increased biliary secretion of cholesterol has been suggested.

Conclusions and future prospects The etiology of cholesterol gallstone disease is clearly multifactorial. This is probably the reason that apart from a few (very rare) exceptions the genetic background of this extremely common disease has not been elucidated. In this overview we show that secretion of the main biliary components cholesterol phospholipid and bile salts are all subject to complex regulatory mechanisms and are formed by complex metabolic pathways. Relatively small changes in secretion rates of one or more of these biliary components may be enough to induce gallstone formation. Therefore, subtle changes in a number of the steps caused by polymorphisms in the responsible genes may well underlie formation of gallstones. Identification of these polymorphisms is the challenge for the near future.

40 General introduction

REFERENCES

1. Rosmorduc O, Hermelin B, Poupon R. Mdr3 gene defect in adults with symptomatic intrahepatic and gallbladder cholesterol cholelithiasis. Gastroenterology 2001; 120(6):1459- 67. 2. Jacquemin E. Role of multidrug resistance 3 deficiency in pediatric and adult liver disease: one gene for three diseases. Semin Liver Dis 2001; 21(4):551-62. 3. Pullinger CR, Eng C, Salen G, Shefer S, Batta AK, Erickson SK et al. Human cholesterol 7alpha-hydroxylase (CYP7A1) deficiency has a hypercholesterolemic phenotype. J Clin Invest 2002; 110(1):109-17. 4. Paigen B, Schork NJ, Svenson KL, Cheah YC, Mu JL, Lammert F et al. Quantitative trait loci mapping for cholesterol gallstones in AKR/J and C57L/J strains of mice. Physiol Genomics 2000; 4(1):59-65. 5. Lammert F, Carey MC, Paigen B. Chromosomal organization of candidate genes involved in cholesterol gallstone formation: a murine gallstone map. Gastroenterology 2001; 120(1):221- 38. 6. Jirsa M, Groen AK. Role of biliary proteins and non-protein factors in kinetics of cholesterol crystallisation and gallstone growth. Front Biosci 2001; 6:154-67. 7. Empen K, Lange K, Stange EF, Scheibner J. Newly synthesized cholesterol in human bile and plasma: quantitation by mass isotopomer distribution analysis. Am J Physiol 1997; 272(2 Pt 1):367-73. 8. Robins SJ, Fasulo JM, Lessard PD, Patton GM. Hepatic cholesterol synthesis and the secretion of newly synthesized cholesterol in bile. Biochem J 1993; 289(Pt 1):41-4. 9. Scheibner J, Fuchs M, Hormann E, Tauber G, Stange EF. Biliary cholesterol secretion and bile acid formation in the hamster: the role of newly synthesized cholesterol. J Lipid Res 1994; 35(4):690-7. 10. Schwartz CC, Halloran LG, Vlahcevic ZR, Gregory DH, Swell L. Preferential utilization of free cholesterol from high-density lipoproteins for biliary cholesterol secretion in man. Science 1978; 200(4337):62-4. 11. Groen AK, Bloks VW, Bandsma RH, Ottenhoff R, Chimini G, Kuipers F. Hepatobiliary cholesterol transport is not impaired in Abca1-null mice lacking HDL. J Clin Invest 2001; 108(6):843-50. 12. Bandsma RH, Kuipers F, Vonk RJ, Boverhof R, Sauer PJ, Nagel GT et al. The contribution of newly synthesized cholesterol to bile salt synthesis in rats quantified by mass isotopomer distribution analysis. Biochim Biophys Acta 2000; 1483(3):343-51. 13. Scheibner J, Fuchs M, Schiemann M, Stange EF. Deoxycholate and cholate modulate the source of cholesterol substrate for bile acid synthesis in the rat. Hepatology 1995; 21(2):529- 38. 14. Goldstein JL, Brown MS. Regulation of the mevalonate pathway. Nature 1990; 343(6257):425-30. 15. Sakakura Y, Shimano H, Sone H, Takahashi A, Inoue N, Toyoshima H et al. Sterol regulatory element-binding proteins induce an entire pathway of cholesterol synthesis. Biochem Biophys Res Commun 2001; 286(1):176-83. 16. Siperstein MD, Fagan VM. Feedback control of mevalonate synthesis by dietary cholesterol. J Biol Chem 1966; 241(3):602-9. 17. Clinkenbeard KD, Reed WD, Mooney RA, Lane MD. Intracellular localization of the 3- hydroxy-3-methylglutaryl coenzme A cycle enzymes in liver. Separate cytoplasmic and mitochondrial 3- hydroxy-3-methylglutaryl coenzyme A generating systems for cholesterogenesis and ketogenesis. J Biol Chem 1975; 250(8):3108-16. 18. Clarke CA, Bouchard G, Paigen B, Carey MC. Molecular cloning and sequence of a cholesterol-repressible enzyme related to prenyltransferase in the isoprene biosynthetic pathway. Mol Cell Biol 1987; 7(9):3138-46. 19. Shechter I, Klinger E, Rucker ML, Engstrom RG, Spirito JA, Islam MA et al. Solubilization, purification, and characterization of a truncated form of rat hepatic squalene synthetase. J Biol Chem 1992; 267(12):8628-35. 20. Fuchs M, Ivandic B, Muller O, Schalla C, Scheibner J, Bartsch P et al. Biliary cholesterol hypersecretion in gallstone-susceptible mice is associated with hepatic up-regulation of the high-density lipoprotein receptor SRBI. Hepatology 2001; 33(6):1451-9.

41 Chapter 1

21. Ginsberg RL, Duane WC, Flock EV. Hepatic 3-hydroxy-3-methylglutaryl CoA reductase activity in hamsters on a lithogenic diet. J Lab Clin Med 1977; 89(5):928-36. 22. Ahlberg J, Angelin B, Einarsson K. Hepatic 3-hydroxy-3-methylglutaryl coenzyme A reductase activity and biliary lipid composition in man: relation to cholesterol gallstone disease and effects of cholic acid and chenodeoxycholic acid treatment. J Lipid Res 1981; 22(3):410-22. 23. Maton PN, Reuben A, Dowling RH. Relationship between hepatic cholesterol synthesis and biliary cholesterol secretion in man: hepatic cholesterol synthesis is not a major regulator of biliary lipid secretion. Clin Sci (Lond) 1982; 62(5):515-9. 24. Reihner E, Angelin B, Bjorkhem I, Einarsson K. Hepatic cholesterol metabolism in cholesterol gallstone disease. J Lipid Res 1991; 32(3):469-75. 25. Chang TY, Chang CC, Cheng D. Acyl-coenzyme A:cholesterol acyltransferase. Annu Rev Biochem 1997; 66:613-38. 26. Goodman DS. Cholesterol ester metabolism. Physiol Rev 1965; 45(4):747-839. 27. Chang CC, Huh HY, Cadigan KM, Chang TY. Molecular cloning and functional expression of human acyl-coenzyme A:cholesterol acyltransferase cDNA in mutant Chinese hamster ovary cells. J Biol Chem 1993; 268(28):20747-55. 28. Uelmen PJ, Oka K, Sullivan M, Chang CC, Chang TY, Chan L. Tissue-specific expression and cholesterol regulation of acylcoenzyme A:cholesterol acyltransferase (ACAT) in mice. Molecular cloning of mouse ACAT cDNA, chromosomal localization, and regulation of ACAT in vivo and in vitro. J Biol Chem 1995; 270(44):26192-201. 29. Meiner V, Tam C, Gunn MD, Dong LM, Weisgraber KH, Novak S et al. Tissue expression studies on the mouse acyl-CoA: cholesterol acyltransferase gene (Acact): findings supporting the existence of multiple cholesterol esterification enzymes in mice. J Lipid Res 1997; 38(9):1928-33. 30. Meiner VL, Cases S, Myers HM, Sande ER, Bellosta S, Schambelan M et al. Disruption of the acyl-CoA:cholesterol acyltransferase gene in mice: evidence suggesting multiple cholesterol esterification enzymes in mammals. Proc Natl Acad Sci U S A 1996; 93(24):14041-6. 31. Anderson RA, Joyce C, Davis M, Reagan JW, Clark M, Shelness GS et al. Identification of a form of acyl-CoA:cholesterol acyltransferase specific to liver and intestine in nonhuman primates. J Biol Chem 1998; 273(41):26747-54. 32. Cases S, Novak S, Zheng YW, Myers HM, Lear SR, Sande E et al. ACAT-2, a second mammalian acyl-CoA:cholesterol acyltransferase. Its cloning, expression, and characterization. J Biol Chem 1998; 273(41):26755-64. 33. Oelkers P, Behari A, Cromley D, Billheimer JT, Sturley SL. Characterization of two human genes encoding acyl coenzyme A:cholesterol acyltransferase-related enzymes. J Biol Chem 1998; 273(41):26765-71. 34. Buhman KK, Accad M, Novak S, Choi RS, Wong JS, Hamilton RL et al. Resistance to diet- induced hypercholesterolemia and gallstone formation in ACAT2-deficient mice. Nat Med 2000; 6(12):1341-7. 35. Smith JL, Hardie IR, Pillay SP, de Jersey J. Hepatic acyl-coenzyme A:cholesterol acyltransferase activity is decreased in patients with cholesterol gallstones. J Lipid Res 1990; 31(11):1993-2000. 36. Chang CC, Sakashita N, Ornvold K, Lee O, Chang ET, Dong R et al. Immunological quantitation and localization of ACAT-1 and ACAT-2 in human liver and small intestine. J Biol Chem 2000; 275(36):28083-92. 37. Ghosh S, Natarajan R, Pandak WM, Hylemon PB, Grogan WM. Regulation of hepatic neutral cholesteryl ester hydrolase by hormones and changes in cholesterol flux. Am J Physiol 1998; 274(4 Pt 1):662-8. 38. Vlahcevic ZR, Pandak WM, Stravitz RT. Regulation of bile acid biosynthesis. Gastroenterol Clin North Am 1999; 28(1):1-25. 39. Vlahcevic. Physiology and pahtophysiology of enterohepatic circulation of bile acids. In: T ZDaB, editor. Hepatology: Textbook of liver diseases. Philadelphia: W.B. Saunders, 1996: 376-417. 40. Vlahcevic ZR, Stravitz RT, Heuman DM, Hylemon PB, Pandak WM. Quantitative estimations of the contribution of different bile acid pathways to total bile acid synthesis in the rat. Gastroenterology 1997; 113(6):1949-57. 41. Stravitz RT, Vlahcevic ZR, Russell TL, Heizer ML, Avadhani NG, Hylemon PB. Regulation of sterol 27-hydroxylase and an alternative pathway of bile acid biosynthesis in primary cultures of rat hepatocytes. J Steroid Biochem Mol Biol 1996; 57(5-6):337-47.

42 General introduction

42. Princen HM, Meijer P, Wolthers BG, Vonk RJ, Kuipers F. Cyclosporin A blocks bile acid synthesis in cultured hepatocytes by specific inhibition of chenodeoxycholic acid synthesis. Biochem J 1991; 275(Pt 2):501-5. 43. Duane WC. Measurement of bile acid synthesis by three different methods in hypertriglyceridemic and control subjects. J Lipid Res 1997; 38(1):183-8. 44. Swell L, Gustafsson J, Schwartz CC, Halloran LG, Danielsson H, Vlahcevic ZR. An in vivo evaluation of the quantitative significance of several potential pathways to cholic and chenodeoxycholic acids from cholesterol in man. J Lipid Res 1980; 21(4):455-66. 45. Goldman M, Vlahcevic ZR, Schwartz CC, Gustafsson J, Swell L. Bile acid metabolism in cirrhosis. VIII. Quantitative evaluation of bile acid synthesis from [7 beta-3H]7 alpha- hydroxycholesterol and [G- 3H]26-hydroxycholesterol. Hepatology 1982; 2(1):59-66. 46. Turley SD, Spady DK, Dietschy JM. Regulation of fecal bile acid excretion in male golden Syrian hamsters fed a cereal-based diet with and without added cholesterol. Hepatology 1997; 25(4):797-803. 47. Turley SD, Schwarz M, Spady DK, Dietschy JM. Gender-related differences in bile acid and sterol metabolism in outbred CD-1 mice fed low- and high-cholesterol diets. Hepatology 1998; 28(4):1088-94. 48. Pandak WM, Li YC, Chiang JY, Studer EJ, Gurley EC, Heuman DM et al. Regulation of cholesterol 7 alpha-hydroxylase mRNA and transcriptional activity by taurocholate and cholesterol in the chronic biliary diverted rat. J Biol Chem 1991; 266(6):3416-21. 49. Peet DJ, Turley SD, Ma W, Janowski BA, Lobaccaro JM, Hammer RE et al. Cholesterol and bile acid metabolism are impaired in mice lacking the nuclear oxysterol receptor LXR alpha. Cell 1998; 93(5):693-704. 50. Xu G, Salen G, Shefer S, Ness GC, Nguyen LB, Tint GS et al. Increasing hepatic cholesterol 7alpha-hydroxylase reduces plasma cholesterol concentrations in normocholesterolemic and hypercholesterolemic rabbits. Hepatology 1996; 24(4):882-7. 51. Horton JD, Cuthbert JA, Spady DK. Regulation of hepatic 7 alpha-hydroxylase expression and response to dietary cholesterol in the rat and hamster. J Biol Chem 1995; 270(10):5381-7. 52. Rudel L, Deckelman C, Wilson M, Scobey M, Anderson R. Dietary cholesterol and downregulation of cholesterol 7 alpha- hydroxylase and cholesterol absorption in African green monkeys. J Clin Invest 1994; 93(6):2463-72. 53. Couture P, Otvos JD, Cupples LA, Wilson PW, Schaefer EJ, Ordovas JM. Association of the A-204C polymorphism in the cholesterol 7alpha- hydroxylase gene with variations in plasma low density lipoprotein cholesterol levels in the Framingham Offspring Study. J Lipid Res 1999; 40(10):1883-9. 54. Chiang JY, Kimmel R, Stroup D. Regulation of cholesterol 7alpha-hydroxylase gene (CYP7A1) transcription by the liver orphan receptor (LXRalpha). Gene 2001; 262(1-2):257- 65. 55. Schwarz M, Russell DW, Dietschy JM, Turley SD. Marked reduction in bile acid synthesis in cholesterol 7alpha-hydroxylase-deficient mice does not lead to diminished tissue cholesterol turnover or to hypercholesterolemia. J Lipid Res 1998; 39(9):1833-43. 56. Spady DK, Cuthbert JA, Willard MN, Meidell RS. Adenovirus-mediated transfer of a gene encoding cholesterol 7 alpha- hydroxylase into hamsters increases hepatic enzyme activity and reduces plasma total and low density lipoprotein cholesterol. J Clin Invest 1995; 96(2):700-9. 57. Pandak WM, Schwarz C, Hylemon PB, Mallonee D, Valerie K, Heuman DM et al. Effects of CYP7A1 overexpression on cholesterol and bile acid homeostasis. Am J Physiol Gastrointest Liver Physiol 2001; 281(4):878-89. 58. Agellon LB, Drover VA, Cheema SK, Gbaguidi GF, Walsh A. Dietary cholesterol fails to stimulate the human cholesterol 7alpha- hydroxylase gene (CYP7A1) in transgenic mice. J Biol Chem 2002; 277(23):20131-4. 59. Tiemann M, Han Z, Soccio R, Bollineni J, Shefer S, Sehayek E et al. Cholesterol feeding of mice expressing cholesterol 7alpha-hydroxylase increases bile acid pool size despite decreased enzyme activity. Proc Natl Acad Sci U S A 2004; 101(7):1846-1851. 60. Pandak WM, Vlahcevic ZR, Heuman DM, Redford KS, Chiang JY, Hylemon PB. Effects of different bile salts on steady-state mRNA levels and transcriptional activity of cholesterol 7 alpha-hydroxylase. Hepatology 1994; 19(4):941-7. 61. Chiang JY, Miller WF, Lin GM. Regulation of cholesterol 7 alpha-hydroxylase in the liver. Purification of cholesterol 7 alpha-hydroxylase and the immunochemical evidence for the induction of cholesterol 7 alpha-hydroxylase by cholestyramine and circadian rhythm. J Biol Chem 1990; 265(7):3889-97.

43 Chapter 1

62. Crestani M, Karam WG, Chiang JY. Effects of bile acids and steroid/thyroid hormones on the expression of cholesterol 7 alpha-hydroxylase mRNA and the CYP7 gene in HepG2 cells. Biochem Biophys Res Commun 1994; 198(2):546-53. 63. Crestani M, Sadeghpour A, Stroup D, Galli G, Chiang JY. Transcriptional activation of the cholesterol 7alpha-hydroxylase gene (CYP7A) by nuclear hormone receptors. J Lipid Res 1998; 39(11):2192-200. 64. Galarneau L, Pare JF, Allard D, Hamel D, Levesque L, Tugwood JD et al. The alpha1- fetoprotein locus is activated by a nuclear receptor of the Drosophila FTZ-F1 family. Mol Cell Biol 1996; 16(7):3853-65. 65. Chen W, Owsley E, Yang Y, Stroup D, Chiang JY. Nuclear receptor-mediated repression of human cholesterol 7alpha- hydroxylase gene transcription by bile acids. J Lipid Res 2001; 42(9):1402-12. 66. Lu TT, Makishima M, Repa JJ, Schoonjans K, Kerr TA, Auwerx J et al. Molecular basis for feedback regulation of bile acid synthesis by nuclear receptors. Mol Cell 2000; 6(3):507-15. 67. Goodwin B, Jones SA, Price RR, Watson MA, McKee DD, Moore LB et al. A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell 2000; 6(3):517-26. 68. Pare JF, Malenfant D, Courtemanche C, Jacob-Wagner M, Roy S, Allard D et al. The fetoprotein transcription factor (FTF) gene is essential to embryogenesis and cholesterol homeostasis, and regulated by a DR4 element. J Biol Chem 2004. 69. Gupta S, Natarajan R, Payne SG, Studer EJ, Spiegel S, Dent P et al. Deoxycholic acid activates the c-Jun N-terminal kinase pathway via FAS receptor activation in primary hepatocytes. Role of acidic sphingomyelinase-mediated ceramide generation in FAS receptor activation. J Biol Chem 2004; 279(7):5821-5828. 70. Holt JA, Luo G, Billin AN, Bisi J, McNeill YY, Kozarsky KF et al. Definition of a novel growth factor-dependent signal cascade for the suppression of bile acid biosynthesis. Genes Dev 2003; 17(13):1581-1591. 71. Kerr TA, Saeki S, Schneider M, Schaefer K, Berdy S, Redder T et al. Loss of nuclear receptor SHP impairs but does not eliminate negative feedback regulation of bile acid synthesis. Dev Cell 2002; 2(6):713-720. 72. Wang L, Lee YK, Bundman D, Han Y, Thevananther S, Kim CS et al. Redundant pathways for negative feedback regulation of bile acid production. Dev Cell 2002; 2(6):721-731. 73. Cali JJ, Russell DW. Characterization of human sterol 27-hydroxylase. A mitochondrial cytochrome P-450 that catalyzes multiple oxidation reaction in bile acid biosynthesis. J Biol Chem 1991; 266(12):7774-8. 74. Schwarz M, Lund EG, Lathe R, Bjorkhem I, Russell DW. Identification and characterization of a mouse oxysterol 7alpha-hydroxylase cDNA. J Biol Chem 1997; 272(38):23995-4001. 75. Lund E, Andersson O, Zhang J, Babiker A, Ahlborg G, Diczfalusy U et al. Importance of a novel oxidative mechanism for elimination of intracellular cholesterol in humans. Arterioscler Thromb Vasc Biol 1996; 16(2):208-12. 76. Babiker A, Andersson O, Lund E, Xiu RJ, Deeb S, Reshef A et al. Elimination of cholesterol in macrophages and endothelial cells by the sterol 27-hydroxylase mechanism. Comparison with high density lipoprotein-mediated reverse cholesterol transport. J Biol Chem 1997; 272(42):26253-61. 77. Babiker A, Diczfalusy U. Transport of side-chain oxidized oxysterols in the human circulation. Biochim Biophys Acta 1998; 1392(2-3):333-9. 78. Bjorkhem I, Andersson O, Diczfalusy U, Sevastik B, Xiu RJ, Duan C et al. Atherosclerosis and sterol 27-hydroxylase: evidence for a role of this enzyme in elimination of cholesterol from human macrophages. Proc Natl Acad Sci U S A 1994; 91(18):8592-6. 79. Axelson M, Larsson O, Zhang J, Shoda J, Sjovall J. Structural specificity in the suppression of HMG-CoA reductase in human fibroblasts by intermediates in bile acid biosynthesis. J Lipid Res 1995; 36(2):290-8. 80. Bhuvaneswaran C, Synouri-Vrettakou S, Mitropoulos KA. Activation of acyl-CoA: cholesterol acyltransferase in rat liver microsomes by 25-hydroxycholesterol. Biochem Pharmacol 1997; 53(1):27-34. 81. Fu X, Menke JG, Chen Y, Zhou G, MacNaul KL, Wright SD et al. 27-Hydroxycholesterol Is an Endogenous Ligand for Liver X Receptor in Cholesterol-loaded Cells. J Biol Chem 2001; 276(42):38378-87.

44 General introduction

82. Twisk J, de Wit EC, Princen HM. Suppression of sterol 27-hydroxylase mRNA and transcriptional activity by bile acids in cultured rat hepatocytes. Biochem J 1995; 305(Pt 2):505-11. 83. Araya Z, Sjoberg H, Wikvall K. Different effects on the expression of CYP7 and CYP27 in rabbit liver by cholic acid and cholestyramine. Biochem Biophys Res Commun 1995; 216(3):868-73. 84. Salen G, Shefer S, Cheng FW, Dayal B, Batta AK, Tint GS. Cholic acid biosynthesis: the enzymatic defect in cerebrotendinous xanthomatosis. J Clin Invest 1979; 63(1):38-44. 85. Rosen H, Reshef A, Maeda N, Lippoldt A, Shpizen S, Triger L et al. Markedly reduced bile acid synthesis but maintained levels of cholesterol and vitamin D metabolites in mice with disrupted sterol 27-hydroxylase gene. J Biol Chem 1998; 273(24):14805-12. 86. Repa JJ, Lund EG, Horton JD, Leitersdorf E, Russell DW, Dietschy JM et al. Disruption of the sterol 27-hydroxylase gene in mice results in hepatomegaly and hypertriglyceridemia. Reversal by cholic acid feeding. J Biol Chem 2000; 275(50):39685-92. 87. Meir K, Kitsberg D, Alkalay I, Szafer F, Rosen H, Shpitzen S et al. Human sterol 27- hydroxylase (CYP27) overexpressor transgenic mouse model. Evidence against 27- hydroxycholesterol as a critical regulator of cholesterol homeostasis. J Biol Chem 2002; 277(37):34036-34041. 88. Heuman DM, Hylemon PB, Vlahcevic ZR. Regulation of bile acid synthesis. III. Correlation between biliary bile salt hydrophobicity index and the activities of enzymes regulating cholesterol and bile acid synthesis in the rat. J Lipid Res 1989; 30(8):1161-71. 89. Duckworth PF, Vlahcevic ZR, Studer EJ, Gurley EC, Heuman DM, Beg ZH et al. Effect of hydrophobic bile acids on 3-hydroxy-3-methylglutaryl-coenzyme A reductase activity and mRNA levels in the rat. J Biol Chem 1991; 266(15):9413-8. 90. Vlahcevic ZR, Eggertsen G, Bjorkhem I, Hylemon PB, Redford K, Pandak WM. Regulation of sterol 12alpha-hydroxylase and cholic acid biosynthesis in the rat. Gastroenterology 2000; 118(3):599-607. 91. Pandak WM, Bohdan P, Franklund C, Mallonee DH, Eggertsen G, Bjorkhem I et al. Expression of sterol 12alpha-hydroxylase alters bile acid pool composition in primary rat hepatocytes and in vivo. Gastroenterology 2001; 120(7):1801-9. 92. Li-Hawkins J, Gafvels M, Olin M, Lund EG, Andersson U, Schuster G et al. Cholic acid mediates negative feedback regulation of bile acid synthesis in mice. J Clin Invest 2002; 110(8):1191-1200. 93. Li-Hawkins J, Lund EG, Turley SD, Russell DW. Disruption of the oxysterol 7alpha- hydroxylase gene in mice. J Biol Chem 2000; 275(22):16536-42. 94. Spencer TA, Li D, Russel JS, Collins JL, Bledsoe RK, Consler TG et al. Pharmacophore analysis of the nuclear oxysterol receptor LXRalpha. J Med Chem 2001; 44(6):886-97. 95. Pandak WM, Hylemon PB, Ren S, Marques D, Gil G, Redford K et al. Regulation of oxysterol 7alpha-hydroxylase (CYP7B1) in primary cultures of rat hepatocytes. Hepatology 2002; 35(6):1400-8. 96. Norlin M, Chiang JY. Transcriptional regulation of human oxysterol 7alpha-hydroxylase by sterol response element binding protein. Biochem Biophys Res Commun 2004; 316(1):158- 164. 97. Reynier MO, Montet JC, Gerolami A, Marteau C, Crotte C, Montet AM et al. Comparative effects of cholic, chenodeoxycholic, and ursodeoxycholic acids on micellar solubilization and intestinal absorption of cholesterol. J Lipid Res 1981; 22(3):467-473. 98. Wang DQ, Lammert F, Cohen DE, Paigen B, Carey MC. Cholic acid aids absorption, biliary secretion, and phase transitions of cholesterol in murine cholelithogenesis. Am J Physiol 1999; 276(3 Pt 1):G751-G760. 99. Voshol PJ, Havinga R, Wolters H, Ottenhoff R, Princen HM, Oude Elferink RP et al. Reduced plasma cholesterol and increased fecal sterol loss in multidrug resistance gene 2 P- glycoprotein-deficient mice. Gastroenterology 1998; 114(5):1024-1034. 100. Watt SM, Simmonds WJ. The specificity of bile salts in the intestinal absorption of micellar cholesterol in the rat. Clin Exp Pharmacol Physiol 1976; 3(4):305-322. 101. Rodgers JB, O'Connor PJ. Effect of phosphatidylcholine on fatty acid and cholesterol absorption from mixed micellar solutions. Biochim Biophys Acta 1975; 409(2):192-200. 102. Schwarz M, Davis DL, Vick BR, Russell DW. Genetic analysis of intestinal cholesterol absorption in inbred mice. J Lipid Res 2001; 42(11):1801-1811.

45 Chapter 1

103. Schulthess G, Compassi S, Werder M, Han CH, Phillips MC, Hauser H. Intestinal sterol absorption mediated by scavenger receptors is competitively inhibited by amphipathic peptides and proteins. Biochemistry 2000; 39(41):12623-31. 104. Mardones P, Quinones V, Amigo L, Moreno M, Miquel JF, Schwarz M et al. Hepatic cholesterol and bile acid metabolism and intestinal cholesterol absorption in scavenger receptor class B type I-deficient mice. J Lipid Res 2001; 42(2):170-80. 105. Altmann SW, Davis HR, Jr., Yao X, Laverty M, Compton DS, Zhu LJ et al. The identification of intestinal scavenger receptor class B, type I (SR-BI) by expression cloning and its role in cholesterol absorption. Biochim Biophys Acta 2002; 1580(1):77-93. 106. Werder M, Han CH, Wehrli E, Bimmler D, Schulthess G, Hauser H. Role of scavenger receptors SR-BI and CD36 in selective sterol uptake in the small intestine. Biochemistry 2001; 40(38):11643-50. 107. Altmann SW, Davis HR, Jr., Zhu LJ, Yao X, Hoos LM, Tetzloff G et al. Niemann-Pick C1 Like 1 protein is critical for intestinal cholesterol absorption. Science 2004; 303(5661):1201- 1204. 108. Repa JJ, Turley SD, Lobaccaro JA, Medina J, Li L, Lustig K et al. Regulation of absorption and ABC1-mediated efflux of cholesterol by RXR heterodimers. Science 2000; 289(5484):1524-9. 109. Drobnik W, Lindenthal B, Lieser B, Ritter M, Weber TC, Liebisch G et al. ATP-binding cassette transporter A1 (ABCA1) affects total body sterol metabolism. Gastroenterology 2001; 120(5):1203-11. 110. Mulligan JD, Flowers MT, Tebon A, Bitgood JJ, Wellington C, Hayden MR et al. ABCA1 is essential for efficient basolateral cholesterol efflux during the absorption of dietary cholesterol in chickens. J Biol Chem 2003; 278(15):13356-13366. 111. Ueda K, Clark DP, Chen CJ, Roninson IB, Gottesman MM, Pastan I. The human multidrug resistance (mdr1) gene. cDNA cloning and transcription initiation. J Biol Chem 1987; 262(2):505-508. 112. Roninson IB. Molecular mechanism of multidrug resistance in tumor cells. Clin Physiol Biochem 1987; 5(3-4):140-151. 113. Fojo AT, Ueda K, Slamon DJ, Poplack DG, Gottesman MM, Pastan I. Expression of a multidrug-resistance gene in human tumors and tissues. Proc Natl Acad Sci U S A 1987; 84(1):265-269. 114. Lee MH, Lu K, Hazard S, Yu H, Shulenin S, Hidaka H et al. Identification of a gene, ABCG5, important in the regulation of dietary cholesterol absorption. Nat Genet 2001; 27(1):79-83. 115. Lu K, Lee MH, Hazard S, Brooks-Wilson A, Hidaka H, Kojima H et al. Two genes that map to the STSL locus cause sitosterolemia: genomic structure and spectrum of mutations involving sterolin-1 and sterolin-2, encoded by ABCG5 and ABCG8, respectively. Am J Hum Genet 2001; 69(2):278-290. 116. Lu K, Lee MH, Yu H, Zhou Y, Sandell SA, Salen G et al. Molecular cloning, genomic organization, genetic variations, and characterization of murine sterolin genes Abcg5 and Abcg8. J Lipid Res 2002; 43(4):565-578. 117. Ichikawa M, Yoshimura A, Furukawa T, Sumizawa T, Nakazima Y, Akiyama S. Glycosylation of P-glycoprotein in a multidrug-resistant KB cell line, and in the human tissues. Biochim Biophys Acta 1991; 1073(2):309-315. 118. Lange Y. Cholesterol movement from plasma membrane to rough endoplasmic reticulum. Inhibition by progesterone. J Biol Chem 1994; 269(5):3411-4. 119. Metherall JE, Waugh K, Li H. Progesterone inhibits cholesterol biosynthesis in cultured cells. Accumulation of cholesterol precursors. J Biol Chem 1996; 271(5):2627-33. 120. Field FJ, Born E, Chen H, Murthy S, Mathur SN. Esterification of plasma membrane cholesterol and triacylglycerol-rich lipoprotein secretion in CaCo-2 cells: possible role of p- glycoprotein. J Lipid Res 1995; 36(7):1533-43. 121. Tessner TG, Stenson WF. Overexpression of MDR1 in an intestinal cell line results in increased cholesterol uptake from micelles. Biochem Biophys Res Commun 2000; 267(2):565-71. 122. Luker GD, Nilsson KR, Covey DF, Piwnica-Worms D. Multidrug resistance (MDR1) P- glycoprotein enhances esterification of plasma membrane cholesterol. J Biol Chem 1999; 274(11):6979-91. 123. Luker GD, Dahlheimer JL, Ostlund RE, Jr., Piwnica-Worms D. Decreased hepatic accumulation and enhanced esterification of cholesterol in mice deficient in mdr1a and mdr1b P-glycoproteins. J Lipid Res 2001; 42(9):1389-94.

46 General introduction

124. Lawn RM, Wade DP, Couse TL, Wilcox JN. Localization of human atp-binding cassette transporter 1 (abc1) in normal and atherosclerotic tissues. Arterioscler Thromb Vasc Biol 2001; 21(3):378-85. 125. Plosch T, Kok T, Bloks VW, Smit MJ, Havinga R, Chimini G et al. Increased hepatobiliary and fecal cholesterol excretion upon activation of the liver X receptor is independent of ABCA1. J Biol Chem 2002; 277(37):33870-33877. 126. Neufeld EB, Remaley AT, Demosky SJ, Stonik JA, Cooney AM, Comly M et al. Cellular localization and trafficking of the human abca1 transporter. J Biol Chem 2001; 276(29):27584-90. 127. Neufeld EB, Demosky SJ, Jr., Stonik JA, Combs C, Remaley AT, Duverger N et al. The ABCA1 transporter functions on the basolateral surface of hepatocytes. Biochem Biophys Res Commun 2002; 297(4):974-979. 128. Lee J, Shirk A, Oram JF, Lee SP, Kuver R. Polarized cholesterol and phospholipid efflux in cultured gall-bladder epithelial cells: evidence for an ABCA1-mediated pathway. Biochem J 2002; 364(Pt 2):475-84. 129. Ohama T, Hirano K, Zhang Z, Aoki R, Tsujii K, Nakagawa-Toyama Y et al. Dominant expression of ATP-binding cassette transporter-1 on basolateral surface of Caco-2 cells stimulated by LXR/RXR ligands. Biochem Biophys Res Commun 2002; 296(3):625-630. 130. Knight BL, Patel DD, Humphreys SM, Wiggins D, Gibbons GF. Inhibition of cholesterol absorption associated with a PPAR alpha-dependent increase in ABC binding cassette transporter A1 in mice. J Lipid Res 2003; 44(11):2049-2058. 131. Berge KE, Tian H, Graf GA, Yu L, Grishin NV, Schultz J et al. Accumulation of dietary cholesterol in sitosterolemia caused by mutations in adjacent ABC transporters. Science 2000; 290(5497):1771-5. 132. Repa JJ, Berge KE, Pomajzl C, Richardson JA, Hobbs H, Mangelsdorf DJ. Regulation of ATP-binding cassette sterol transporters ABCG5 and ABCG8 by the liver X receptors alpha and beta. J Biol Chem 2002; 277(21):18793-18800. 133. Tauscher A, Kuver R. ABCG5 and ABCG8 are expressed in gallbladder epithelial cells. Biochem Biophys Res Commun 2003; 307(4):1021-1028. 134. Graf GA, Li WP, Gerard RD, Gelissen I, White A, Cohen JC et al. Coexpression of ATP- binding cassette proteins ABCG5 and ABCG8 permits their transport to the apical surface. J Clin Invest 2002; 110(5):659-69. 135. Graf GA, Yu L, Li WP, Gerard R, Tuma PL, Cohen JC et al. ABCG5 and ABCG8 are obligate heterodimers for protein trafficking and biliary cholesterol excretion. J Biol Chem 2003; 278(48):48275-48282. 136. Scoggan KA, Gruber H, Lariviere K. A missense mutation in the Abcg5 gene causes phytosterolemia in SHR, stroke-prone SHR, and WKY rats. J Lipid Res 2003; 44(5):911-916. 137. Yu L, Li-Hawkins J, Hammer RE, Berge KE, Horton JD, Cohen JC et al. Overexpression of ABCG5 and ABCG8 promotes biliary cholesterol secretion and reduces fractional absorption of dietary cholesterol. J Clin Invest 2002; 110(5):671-680. 138. Yu L, Hammer RE, Li-Hawkins J, von Bergmann K, Lutjohann D, Cohen JC et al. Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in biliary cholesterol secretion. Proc Natl Acad Sci U S A 2002; 99(25):16237-16242. 139. Iqbal J, Anwar K, Hussain MM. Multiple, independently regulated pathways of cholesterol transport across the intestinal epithelial cells. J Biol Chem 2003; 278(34):31610-31620. 140. Smart EJ, De Rose RA, Farber SA. Annexin 2-caveolin 1 complex is a target of ezetimibe and regulates intestinal cholesterol transport. Proc Natl Acad Sci U S A 2004; 101(10):3450-3455. 141. Repa JJ, Dietschy JM, Turley SD. Inhibition of cholesterol absorption by SCH 58053 in the mouse is not mediated via changes in the expression of mRNA for ABCA1, ABCG5, or ABCG8 in the enterocyte. J Lipid Res 2002; 43(11):1864-1874. 142. Field FJ, Born E, Murthy S, Mathur SN. Caveolin is present in intestinal cells: role in cholesterol trafficking? J Lipid Res 1998; 39(10):1938-1950. 143. Chanderbhan R, Noland BJ, Scallen TJ, Vahouny GV. Sterol carrier protein2. Delivery of cholesterol from adrenal lipid droplets to mitochondria for pregnenolone synthesis. J Biol Chem 1982; 257(15):8928-34. 144. Murphy EJ, Schroeder F. Sterol carrier protein-2 mediated cholesterol esterification in transfected L-cell fibroblasts. Biochim Biophys Acta 1997; 1345(3):283-92. 145. Seltman H, Diven W, Rizk M, Noland BJ, Chanderbhan R, Scallen TJ et al. Regulation of bile-acid synthesis. Role of sterol carrier protein 2 in the biosynthesis of 7 alpha- hydroxycholesterol. Biochem J 1985; 230(1):19-24.

47 Chapter 1

146. Lidstrom-Olsson B, Wikvall K. The role of sterol carrier protein2 and other hepatic lipid- binding proteins in bile-acid biosynthesis. Biochem J 1986; 238(3):879-84. 147. Woodford JK, Colles SM, Myers-Payne S, Billheimer JT, Schroeder F. Sterol carrier protein-2 stimulates intermembrane sterol transfer by direct membrane interaction. Chem Phys Lipids 1995; 76(1):73-84. 148. Frolov A, Cho TH, Billheimer JT, Schroeder F. Sterol carrier protein-2, a new fatty acyl coenzyme A-binding protein. J Biol Chem 1996; 271(50):31878-84. 149. Stolowich NJ, Frolov A, Atshaves B, Murphy EJ, Jolly CA, Billheimer JT et al. The sterol carrier protein-2 fatty acid binding site: an NMR, circular dichroic, and fluorescence spectroscopic determination. Biochemistry 1997; 36(7):1719-29. 150. Puglielli L, Rigotti A, Greco AV, Santos MJ, Nervi F. Sterol carrier protein-2 is involved in cholesterol transfer from the endoplasmic reticulum to the plasma membrane in human fibroblasts. J Biol Chem 1995; 270(32):18723-6. 151. Baum CL, Reschly EJ, Gayen AK, Groh ME, Schadick K. Sterol carrier protein-2 overexpression enhances sterol cycling and inhibits cholesterol ester synthesis and high density lipoprotein cholesterol secretion. J Biol Chem 1997; 272(10):6490-8. 152. Puglielli L, Rigotti A, Amigo L, Nunez L, Greco AV, Santos MJ et al. Modulation of intrahepatic cholesterol trafficking: evidence by in vivo antisense treatment for the involvement of sterol carrier protein-2 in newly synthesized cholesterol transport into rat bile [published erratum appears in Biochem J 1998 May 1;331(Pt 3):975]. Biochem J 1996; 317(Pt 3):681-7. 153. Fuchs M, Lammert F, Wang DQ, Paigen B, Carey MC, Cohen DE. Sterol carrier protein 2 participates in hypersecretion of biliary cholesterol during gallstone formation in genetically gallstone- susceptible mice. Biochem J 1998; 336(Pt 1):33-7. 154. Zanlungo S, Amigo L, Mendoza H, Miquel JF, Vio C, Glick JM et al. Sterol carrier protein 2 gene transfer changes lipid metabolism and enterohepatic sterol circulation in mice. Gastroenterology 2000; 119(6):1708-19. 155. Amigo L, Zanlungo S, Miquel JF, Glick JM, Hyogo H, Cohen DE et al. Hepatic overexpression of sterol carrier protein-2 inhibits VLDL production and reciprocally enhances biliary lipid secretion. J Lipid Res 2003; 44(2):399-407. 156. Seedorf U, Raabe M, Ellinghaus P, Kannenberg F, Fobker M, Engel T et al. Defective peroxisomal catabolism of branched fatty acyl coenzyme A in mice lacking the sterol carrier protein-2/sterol carrier protein-x gene function. Genes Dev 1998; 12(8):1189-201. 157. Fuchs M, Hafer A, Munch C, Kannenberg F, Teichmann S, Scheibner J et al. Disruption of the sterol carrier protein 2 gene in mice impairs billiary lipid secretion and hepatic cholesterol metabolism. J Biol Chem 2001; 22:22. 158. Ito T, Kawata S, Imai Y, Kakimoto H, Trzaskos JM, Matsuzawa Y. Hepatic cholesterol metabolism in patients with cholesterol gallstones: enhanced intracellular transport of cholesterol. Gastroenterology 1996; 110(5):1619-27. 159. Jefferson JR, Powell DM, Rymaszewski Z, Kukowska-Latallo J, Lowe JB, Schroeder F. Altered membrane structure in transfected mouse L-cell fibroblasts expressing rat liver fatty acid-binding protein. J Biol Chem 1990; 265(19):11062-8. 160. Jefferson JR, Slotte JP, Nemecz G, Pastuszyn A, Scallen TJ, Schroeder F. Intracellular sterol distribution in transfected mouse L-cell fibroblasts expressing rat liver fatty acid-binding protein. J Biol Chem 1991; 266(9):5486-96. 161. Woodford JK, Behnke WD, Schroeder F. Liver fatty acid binding protein enhances sterol transfer by membrane interaction. Mol Cell Biochem 1995; 152(1):51-62. 162. Thumser AE, Wilton DC. The binding of cholesterol and bile salts to recombinant rat liver fatty acid-binding protein. Biochem J 1996; 320(Pt 3):729-33. 163. Martin GG, Danneberg H, Kumar LS, Atshaves BP, Erol E, Bader M et al. Decreased liver fatty acid binding capacity and altered liver lipid distribution in mice lacking the liver fatty acid-binding protein gene. J Biol Chem 2003; 278(24):21429-21438. 164. Martin GG, Huang H, Atshaves BP, Binas B, Schroeder F. Ablation of the liver fatty acid binding protein gene decreases fatty acyl CoA binding capacity and alters fatty acyl CoA pool distribution in mouse liver. Biochemistry 2003; 42(39):11520-11532. 165. Anderson RG. The caveolae membrane system. Annu Rev Biochem 1998; 67:199-225. 166. Dehouck B, Fenart L, Dehouck MP, Pierce A, Torpier G, Cecchelli R. A new function for the LDL receptor: transcytosis of LDL across the blood-brain barrier. J Cell Biol 1997; 138(4):877-89.

48 General introduction

167. Tiruppathi C, Song W, Bergenfeldt M, Sass P, Malik AB. Gp60 activation mediates albumin transcytosis in endothelial cells by tyrosine kinase-dependent pathway. J Biol Chem 1997; 272(41):25968-75. 168. Fielding CJ, Fielding PE. Intracellular cholesterol transport. J Lipid Res 1997; 38(8):1503-21. 169. Smart EJ, Graf GA, McNiven MA, Sessa WC, Engelman JA, Scherer PE et al. Caveolins, liquid-ordered domains, and signal transduction. Mol Cell Biol 1999; 19(11):7289-304. 170. Murata M, Peranen J, Schreiner R, Wieland F, Kurzchalia TV, Simons K. VIP21/caveolin is a cholesterol-binding protein. Proc Natl Acad Sci U S A 1995; 92(22):10339-43. 171. Thiele C, Hannah MJ, Fahrenholz F, Huttner WB. Cholesterol binds to synaptophysin and is required for biogenesis of synaptic vesicles [see comments]. Nat Cell Biol 2000; 2(1):42-9. 172. Nibbering CP. Lipid composition of hepatocyte canalicular membrane. Relevance to bile formation. University of Utrecht, 2001. 173. Calvo M, Enrich C. Biochemical analysis of a caveolae-enriched plasma membrane fraction from rat liver. Electrophoresis 2000; 21(16):3386-95. 174. Pol A, Calvo M, Lu A, Enrich C. The "early-sorting" endocytic compartment of rat hepatocytes is involved in the intracellular pathway of caveolin-1 (VIP-21). Hepatology 1999; 29(6):1848-57. 175. Bist A, Fielding PE, Fielding CJ. Two sterol regulatory element-like sequences mediate upregulation of caveolin gene transcription in response to low density lipoprotein free cholesterol. Proc Natl Acad Sci U S A 1997; 94(20):10693-8. 176. Smart EJ, Ying Y, Donzell WC, Anderson RG. A role for caveolin in transport of cholesterol from endoplasmic reticulum to plasma membrane. J Biol Chem 1996; 271(46):29427-35. 177. Fielding PE, Fielding CJ. Plasma membrane caveolae mediate the efflux of cellular free cholesterol. Biochemistry 1995; 34(44):14288-92. 178. Babitt J, Trigatti B, Rigotti A, Smart EJ, Anderson RG, Xu S et al. Murine SR-BI, a high density lipoprotein receptor that mediates selective lipid uptake, is N-glycosylated and fatty acylated and colocalizes with plasma membrane caveolae. J Biol Chem 1997; 272(20):13242- 9. 179. Miquel JF, Rigotti A, Zanlungo SF, Amigo L, Mendoza H, Moreno M, Garrido J, Arias PF, Nervi F. Caveolin-2 is contitutively expressed in the liver and upregulatedin cholesterol hypersecretion state (abstr.). Gastroenterology 1999; 116:A1246. 180. Razani B, Engelman JA, Wang XB, Schubert W, Zhang XL, Marks CB et al. Caveolin-1 null mice are viable but show evidence of hyperproliferative and vascular abnormalities. J Biol Chem 2001; 276(41):38121-38. 181. Drab M, Verkade P, Elger M, Kasper M, Lohn M, Lauterbach B et al. Loss of caveolae, vascular dysfunction, and pulmonary defects in caveolin-1 gene-disrupted mice. Science 2001; 293(5539):2449-52. 182. Frank PG, Pedraza A, Cohen DE, Lisanti MP. Adenovirus-mediated expression of caveolin-1 in mouse liver increases plasma high-density lipoprotein levels. Biochemistry 2001; 40(36):10892-900. 183. Carstea ED, Morris JA, Coleman KG, Loftus SK, Zhang D, Cummings C et al. Niemann-Pick C1 disease gene: homology to mediators of cholesterol homeostasis. Science 1997; 277(5323):228-31. 184. Pentchev PG, Brady RO, Blanchette-Mackie EJ, Vanier MT, Carstea ED, Parker CC et al. The Niemann-Pick C lesion and its relationship to the intracellular distribution and utilization of LDL cholesterol. Biochim Biophys Acta 1994; 1225(3):235-43. 185. Mukherjee S, Maxfield FR. Lipid and cholesterol trafficking in NPC. Biochim Biophys Acta 2004; 1685(1-3):28-37. 186. Malathi K, Higaki K, Tinkelenberg AH, Balderes DA, Almanzar-Paramio D, Wilcox LJ et al. Mutagenesis of the putative sterol-sensing domain of yeast Niemann Pick C-related protein reveals a primordial role in subcellular sphingolipid distribution. J Cell Biol 2004; 164(4):547- 556. 187. Amigo L, Mendoza H, Castro J, Quinones V, Miquel JF, Zanlungo S. Relevance of Niemann- Pick type C1 protein expression in controlling plasma cholesterol and biliary lipid secretion in mice. Hepatology 2002; 36(4 Pt 1):819-828. 188. Friedland N, Liou HL, Lobel P, Stock AM. Structure of a cholesterol-binding protein deficient in Niemann-Pick type C2 disease. Proc Natl Acad Sci U S A 2003; 100(5):2512-2517. 189. Ko DC, Binkley J, Sidow A, Scott MP. The integrity of a cholesterol-binding pocket in Niemann-Pick C2 protein is necessary to control lysosome cholesterol levels. Proc Natl Acad Sci U S A 2003; 100(5):2518-2525.

49 Chapter 1

190. Naureckiene S, Sleat DE, Lackland H, Fensom A, Vanier MT, Wattiaux R et al. Identification of HE1 as the second gene of niemann-pick C disease. Science 2000; 290(5500):2298-301. 191. Okamura N, Kiuchi S, Tamba M, Kashima T, Hiramoto S, Baba T et al. A porcine homolog of the major secretory protein of human epididymis, HE1, specifically binds cholesterol. Biochim Biophys Acta 1999; 1438(3):377-387. 192. Sleat DE, Wiseman JA, El Banna M, Price SM, Verot L, Shen MM et al. Genetic evidence for nonredundant functional cooperativity between NPC1 and NPC2 in lipid transport. Proc Natl Acad Sci U S A 2004; 101(16):5886-5891. 193. Frolov A, Zielinski SE, Crowley JR, Dudley-Rucker N, Schaffer JE, Ory DS. NPC1 and NPC2 regulate cellular cholesterol homeostasis through generation of low density lipoprotein cholesterol-derived oxysterols. J Biol Chem 2003; 278(28):25517-25525. 194. Xie C, Turley SD, Pentchev PG, Dietschy JM. Cholesterol balance and metabolism in mice with loss of function of Niemann-Pick C protein. Am J Physiol 1999; 276(2 Pt 1):E336-E344. 195. Williamson R, Lee D, Hagaman J, Maeda N. Marked reduction of high density lipoprotein cholesterol in mice genetically modified to lack apolipoprotein A-I. Proc Natl Acad Sci U S A 1992; 89(15):7134-8. 196. Jolley CD, Dietschy JM, Turley SD. Induction of bile acid synthesis by cholesterol and cholestyramine feeding is unimpaired in mice deficient in apolipoprotein AI. Hepatology 2000; 32(6):1309-16. 197. Rigotti A, Amigo L, Quiones V, Zanlungo S, Arrese M, Miquel JF, Nervi F. Role of apolipoproteins A-I and E in controlling biliary lipid secretion in mice. Gastroenterology 1999; 116:L0379. 198. Herz J, Willnow TE. Lipoprotein and receptor interactions in vivo. Curr Opin Lipidol 1995; 6(2):97-103. 199. Sehayek E, Shefer S, Nguyen LB, Ono JG, Merkel M, Breslow JL. Apolipoprotein E regulates dietary cholesterol absorption and biliary cholesterol excretion: studies in C57BL/6 apolipoprotein E knockout mice. Proc Natl Acad Sci U S A 2000; 97(7):3433-7. 200. Amigo L, Quinones V, Mardones P, Zanlungo S, Miquel JF, Nervi F et al. Impaired biliary cholesterol secretion and decreased gallstone formation in apolipoprotein E-deficient mice fed a high-cholesterol diet. Gastroenterology 2000; 118(4):772-9. 201. Kuipers F, Vanree JM, Hofker MH, Wolters H, Veld GI, Havinga R et al. Altered lipid metabolism in apolipoprotein e-deficient mice does not affect cholesterol balance across the liver. Hepatology 1996; 24(1):241-247. 202. Juvonen T, Kervinen K, Kairaluoma MI, Lajunen LH, Kesaniemi YA. Gallstone cholesterol content is related to apolipoprotein E polymorphism. Gastroenterology 1993; 104(6):1806-13. 203. Bertomeu A, Ros E, Zambon D, Vela M, Perez-Ayuso RM, Targarona E et al. Apolipoprotein E polymorphism and gallstones. Gastroenterology 1996; 111(6):1603-10. 204. van Erpecum KJ, Van Berge-henegouwen GP, Eckhardt ER, Portincasa P, Van De Heijning BJ, Dallinga-Thie GM et al. Cholesterol crystallization in human gallbladder bile: relation to gallstone number, bile composition, and apolipoprotein E4 isoform. Hepatology 1998; 27(6):1508-16. 205. Fischer S, Dolu MH, Zundt B, Meyer G, Geisler S, Jungst D. Apolipoprotein E polymorphism and lithogenic factors in gallbladder bile. Eur J Clin Invest 2001; 31(9):789-95. 206. Kesaniemi YA, Ehnholm C, Miettinen TA. Intestinal cholesterol absorption efficiency in man is related to apoprotein E phenotype. J Clin Invest 1987; 80(2):578-81. 207. Miettinen THGHVaAO. Cholesterol absorption, elimination, and synthesis related to LDL kinetics during varying fat intake in men with different apoprotein E phenotypes. Arterioscler Thromb Vasc Biol 1992; 12:1044-1052. 208. Hasegawa K, Terada S, Kubota K, Itakura H, Imamura H, Ohnishi S et al. Effect of apolipoprotein E polymorphism on bile lipid composition and the formation of cholesterol gallstone. Am J Gastroenterol 2003; 98(7):1605-1609. 209. Post SM, de Crom R, van Haperen R, van Tol A, Princen HM. Increased fecal bile acid excretion in transgenic mice with elevated expression of human phospholipid transfer protein. Arterioscler Thromb Vasc Biol 2003; 23(5):892-897. 210. Acton SL, Scherer PE, Lodish HF, Krieger M. Expression cloning of SR-BI, a CD36-related class B scavenger receptor. J Biol Chem 1994; 269(33):21003-9. 211. Acton S, Rigotti A, Landschulz KT, Xu S, Hobbs HH, Krieger M. Identification of scavenger receptor SR-BI as a high density lipoprotein receptor. Science 1996; 271(5248):518-20.

50 General introduction

212. Voshol PJ, Schwarz M, Rigotti A, Krieger M, Groen AK, Kuipers F. Down-regulation of intestinal scavenger receptor class B, type I (SR-BI) expression in rodents under conditions of deficient bile delivery to the intestine. Biochem J 2001; 356(Pt 2):317-25. 213. Spady DK, Kearney DM, Hobbs HH. Polyunsaturated fatty acids up-regulate hepatic scavenger receptor B1 (SR-BI) expression and HDL cholesteryl ester uptake in the hamster. J Lipid Res 1999; 40(8):1384-94. 214. Trigatti B, Rigotti A, Krieger M. The role of the high-density lipoprotein receptor SR-BI in cholesterol metabolism [In Process Citation]. Curr Opin Lipidol 2000; 11(2):123-31. 215. Krieger M, Kozarsky K. Influence of the HDL receptor SR-BI on atherosclerosis. Curr Opin Lipidol 1999; 10(6):491-7. 216. Krieger M. Charting the fate of the "good cholesterol": identification and characterization of the high-density lipoprotein receptor SR-BI. Annu Rev Biochem 1999; 68:523-58. 217. Knecht TP, Pittman RC. A plasma membrane pool of cholesteryl esters that may mediate the selective uptake of cholesteryl esters from high-density lipoproteins. Biochim Biophys Acta 1989; 1002(3):365-375. 218. Oram JF, Johnson CJ, Brown TA. Interaction of high density lipoprotein with its receptor on cultured fibroblasts and macrophages. Evidence for reversible binding at the cell surface without internalization. J Biol Chem 1987; 262(5):2405-2410. 219. Kambouris AM, Roach PD, Calvert GD, Nestel PJ. Retroendocytosis of high density lipoproteins by the human hepatoma cell line, HepG2. Arteriosclerosis 1990; 10(4):582-590. 220. Takahashi K, Fukuda S, Naito M, Horiuchi S, Takata K, Morino Y. Endocytic pathway of high density lipoprotein via trans-Golgi system in rat resident peritoneal macrophages. Lab Invest 1989; 61(3):270-277. 221. Heeren J, Grewal T, Laatsch A, Rottke D, Rinninger F, Enrich C et al. Recycling of apoprotein E is associated with cholesterol efflux and high density lipoprotein internalization. J Biol Chem 2003; 278(16):14370-14378. 222. Miller NE, Weinstein DB, Steinberg D. Binding, internalization, and degradation of high density lipoprotein by cultured normal human fibroblasts. J Lipid Res 1977; 18(4):438-450. 223. Rogler G, Aschenbrenner E, Gross V, Stange EF, Scholmerich J. Intracellular transport of high-density lipoprotein 3 in intestinal epithelial cells (Caco-2) is tubulin associated. Digestion 2000; 61(1):47-58. 224. Rogler G, Herold G, Fahr C, Fahr M, Rogler D, Reimann FM et al. High-density lipoprotein 3 retroendocytosis: a new lipoprotein pathway in the enterocyte (Caco-2). Gastroenterology 1992; 103(2):469-480. 225. Silver DL, Wang N, Xiao X, Tall AR. High density lipoprotein (hdl) particle uptake mediated by scavenger receptor class b type 1 results in selective sorting of hdl cholesterol from protein and polarized cholesterol secretion. J Biol Chem 2001; 276(27):25287-93. 226. Kozarsky KF, Donahee MH, Rigotti A, Iqbal SN, Edelman ER, Krieger M. Overexpression of the HDL receptor SR-BI alters plasma HDL and bile cholesterol levels. Nature 1997; 387(6631):414-7. 227. Cohen DE. Hepatocellular transport and secretion of biliary lipids. Curr Opin Lipidol 1999; 10(4):295-302. 228. Robins SJ, Fasulo JM. High density lipoproteins, but not other lipoproteins, provide a vehicle for sterol transport to bile. J Clin Invest 1997; 99(3):380-4. 229. Rigotti A, Trigatti BL, Penman M, Rayburn H, Herz J, Krieger M. A targeted mutation in the murine gene encoding the high density lipoprotein (HDL) receptor scavenger receptor class B type I reveals its key role in HDL metabolism. Proc Natl Acad Sci U S A 1997; 94(23):12610- 5. 230. Trigatti B, Rayburn H, Vinals M, Braun A, Miettinen H, Penman M et al. Influence of the high density lipoprotein receptor SR-BI on reproductive and cardiovascular pathophysiology. Proc Natl Acad Sci U S A 1999; 96(16):9322-7. 231. Wang DQ, Carey MC. Susceptibility to murine cholesterol gallstone formation is not affected by partial disruption of the HDL receptor SR-BI. Biochim Biophys Acta 2002; 1583(2):141- 150. 232. Miquel JF, Moreno M, Amigo L, Molina H, Mardones P, Wistuba II et al. Expression and regulation of scavenger receptor class B type I (SR-BI) in gall bladder epithelium. Gut 2003; 52(7):1017-1024. 233. Johnson MS, Svensson PA, Boren J, Billig H, Carlsson LM, Carlsson B. Expression of scavenger receptor class B type I in gallbladder columnar epithelium. J Gastroenterol Hepatol 2002; 17(6):713-720.

51 Chapter 1

234. Elferink RPJO, Frijters CMG, Paulusma C, Groen AK. Regulation of canalicular transport activities. J Hepatol 1996; 24(:Suppl 1994;1):Suppl 1994;1):94-99 12. 235. Bouchard G, Nelson HM, Lammert F, Rowe LB, Carey MC, Paigen B. High-resolution maps of the murine Chromosome 2 region containing the cholesterol gallstone locus, Lith1. Mamm Genome 1999; 10(11):1070-4. 236. Wang R, Salem M, Yousef IM, Tuchweber B, Lam P, Childs SJ et al. Targeted inactivation of sister of P-glycoprotein gene (spgp) in mice results in nonprogressive but persistent intrahepatic cholestasis. Proc Natl Acad Sci U S A 2001; 98(4):2011-6. 237. Frijters CM, Ottenhoff R, van Wijland MJ, van Nieuwkerk CM, Groen AK, Oude Elferink RP. Regulation of mdr2 P-glycoprotein expression by bile salts. Biochem J 1997; 321(Pt 2):389-95. 238. Strautnieks SS, Bull LN, Knisely AS, Kocoshis SA, Dahl N, Arnell H et al. A gene encoding a liver-specific ABC transporter is mutated in progressive familial intrahepatic cholestasis. Nat Genet 1998; 20(3):233-8. 239. Figge A, Lammert F, Paigen B, Henkel A, Matern S, Korstanje R et al. Hepatic overexpression of murine Abcb11 increases hepatobiliary lipid secretion and reduces hepatic steatosis. J Biol Chem 2004; 279(4):2790-2799. 240. Smit JJ, Schinkel AH, Oude Elferink RP, Groen AK, Wagenaar E, van Deemter L et al. Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a complete absence of phospholipid from bile and to liver disease. Cell 1993; 75(3):451-62. 241. Ruetz S, Gros P. Enhancement of Mdr2-mediated phosphatidylcholine translocation by the bile salt taurocholate. Implications for hepatic bile formation. J Biol Chem 1995; 270(43):25388-95. 242. Huang L, Zhao A, Lew JL, Zhang T, Hrywna Y, Thompson JR et al. Farnesoid X receptor activates transcription of the phospholipid pump MDR3. J Biol Chem 2003; 278(51):51085- 51090. 243. Hooiveld GJ, Vos TA, Scheffer GL, Van Goor H, Koning H, Bloks V et al. 3-Hydroxy-3- methylglutaryl-coenzyme A reductase inhibitors (statins) induce hepatic expression of the phospholipid translocase mdr2 in rats. Gastroenterology 1999; 117(3):678-87. 244. Chianale J, Vollrath V, Wielandt AM, Amigo L, Rigotti A, Nervi F et al. Fibrates induce mdr2 gene expression and biliary phospholipid secretion in the mouse. Biochem J 1996; 314(Pt 3):781-6. 245. Carrella M, Feldman D, Cogoi S, Csillaghy A, Weinhold PA. Enhancement of mdr2 gene transcription mediates the biliary transfer of phosphatidylcholine supplied by an increased biosynthesis in the pravastatin-treated rat. Hepatology 1999; 29(6):1825-32. 246. Miranda S, Vollrath V, Wielandt AM, Loyola G, Bronfman M, Chianale J. Overexpression of mdr2 gene by peroxisome proliferators in the mouse liver. J Hepatol 1997; 26(6):1331-9. 247. Lammert F, Wang DQ, Hillebrandt S, Geier A, Fickert P, Trauner M et al. Spontaneous cholecysto- and hepatolithiasis in Mdr2-/- mice: a model for low phospholipid-associated cholelithiasis. Hepatology 2004; 39(1):117-128. 248. Kasbo J, Tuchweber B, Perwaiz S, Bouchard G, Lafont H, Domingo N et al. Phosphatidylcholine-enriched diet prevents gallstone formation in mice susceptible to cholelithiasis. J Lipid Res 2003; 44(12):2297-2303. 249. Cayen MN, Dvornik D. Effect of diosgenin on lipid metabolism in rats. J Lipid Res 1979; 20(2):162-74. 250. Accatino L, Pizarro M, Solis N, Koenig CS. Effects of diosgenin, a plant-derived steroid, on bile secretion and hepatocellular cholestasis induced by estrogens in the rat. Hepatology 1998; 28(1):129-40. 251. Thewles A, Parslow RA, Coleman R. Effect of diosgenin on biliary cholesterol transport in the rat. Biochem J 1993; 291(Pt 3):793-8. 252. Kosters A, Frijters RJ, Schaap FG, Vink E, Plosch T, Ottenhoff R et al. Relation between hepatic expression of ATP-binding cassette transporters G5 and G8 and biliary cholesterol secretion in mice. J Hepatol 2003; 38(6):710-716. 253. Miettinen TA. Phytosterolaemia, xanthomatosis and premature atherosclerotic arterial disease: a case with high plant sterol absorption, impaired sterol elimination and low cholesterol synthesis. Eur J Clin Invest 1980; 10(1):27-35. 254. Klett EL, Lu K, Kosters A, Vink E, Lee MH, Altenburg M et al. A mouse model of sitosterolemia: absence of Abcg8/sterolin-2 results in failure to secrete biliary cholesterol. BMC Med 2004; 2(1):5.

52 General introduction

255. Plosch T, Bloks VW, Terasawa Y, Berdy S, Siegler K, Van Der SF et al. Sitosterolemia in ABC-transporter G5-deficient mice is aggravated on activation of the liver-X receptor. Gastroenterology 2004; 126(1):290-300. 256. Zhang Y, Castellani LW, Sinal CJ, Gonzalez FJ, Edwards PA. Peroxisome proliferator- activated receptor-gamma coactivator 1alpha (PGC-1alpha) regulates triglyceride metabolism by activation of the nuclear receptor FXR. Genes Dev 2004; 18(2):157-169. 257. Hu X, Li S, Wu J, Xia C, Lala DS. Liver X receptors interact with corepressors to regulate gene expression. Mol Endocrinol 2003; 17(6):1019-1026. 258. Wang X, Sato R, Brown MS, Hua X, Goldstein JL. SREBP-1, a membrane-bound transcription factor released by sterol- regulated proteolysis. Cell 1994; 77(1):53-62. 259. Hua X, Sakai J, Brown MS, Goldstein JL. Regulated cleavage of sterol regulatory element binding proteins requires sequences on both sides of the endoplasmic reticulum membrane. J Biol Chem 1996; 271(17):10379-84. 260. Sakai J, Duncan EA, Rawson RB, Hua X, Brown MS, Goldstein JL. Sterol-regulated release of SREBP-2 from cell membranes requires two sequential cleavages, one within a transmembrane segment. Cell 1996; 85(7):1037-46. 261. Yang T, Goldstein JL, Brown MS. Overexpression of membrane domain of SCAP prevents sterols from inhibiting SCAPmiddle dotSREBP exit from endoplasmic reticulum. J Biol Chem 2000; 275(38):29881-6. 262. Yang T, Espenshade PJ, Wright ME, Yabe D, Gong Y, Aebersold R et al. Crucial step in cholesterol homeostasis: sterols promote binding of SCAP to INSIG-1, a membrane protein that facilitates retention of SREBPs in ER. Cell 2002; 110(4):489-500. 263. Adams CM, Goldstein JL, Brown MS. Cholesterol-induced conformational change in SCAP enhanced by Insig proteins and mimicked by cationic amphiphiles. Proc Natl Acad Sci U S A 2003; 100(19):10647-10652. 264. Engelking LJ, Kuriyama H, Hammer RE, Horton JD, Brown MS, Goldstein JL et al. Overexpression of Insig-1 in the livers of transgenic mice inhibits SREBP processing and reduces insulin-stimulated lipogenesis. J Clin Invest 2004; 113(8):1168-1175. 265. Janowski BA. The hypocholesterolemic agent LY295427 up-regulates INSIG-1, identifying the INSIG-1 protein as a mediator of cholesterol homeostasis through SREBP. Proc Natl Acad Sci U S A 2002; 99(20):12675-12680. 266. Yabe D, Xia ZP, Adams CM, Rawson RB. Three mutations in sterol-sensing domain of SCAP block interaction with insig and render SREBP cleavage insensitive to sterols. Proc Natl Acad Sci U S A 2002; 99(26):16672-16677. 267. Yabe D, Brown MS, Goldstein JL. Insig-2, a second endoplasmic reticulum protein that binds SCAP and blocks export of sterol regulatory element-binding proteins. Proc Natl Acad Sci U S A 2002; 99(20):12753-12758. 268. Yabe D, Komuro R, Liang G, Goldstein JL, Brown MS. Liver-specific mRNA for Insig-2 down-regulated by insulin: implications for fatty acid synthesis. Proc Natl Acad Sci U S A 2003; 100(6):3155-3160. 269. Sever N, Song BL, Yabe D, Goldstein JL, Brown MS, DeBose-Boyd RA. Insig-dependent ubiquitination and degradation of mammalian 3-hydroxy-3-methylglutaryl-CoA reductase stimulated by sterols and geranylgeraniol. J Biol Chem 2003; 278(52):52479-52490. 270. Sever N, Yang T, Brown MS, Goldstein JL, DeBose-Boyd RA. Accelerated degradation of HMG CoA reductase mediated by binding of insig-1 to its sterol-sensing domain. Mol Cell 2003; 11(1):25-33. 271. Yokoyama C, Wang X, Briggs MR, Admon A, Wu J, Hua X et al. SREBP-1, a basic-helix- loop-helix-leucine zipper protein that controls transcription of the low density lipoprotein receptor gene. Cell 1993; 75(1):187-97. 272. Shimano H, Shimomura I, Hammer RE, Herz J, Goldstein JL, Brown MS et al. Elevated levels of SREBP-2 and cholesterol synthesis in livers of mice homozygous for a targeted disruption of the SREBP-1 gene. J Clin Invest 1997; 100(8):2115-24. 273. Shimano H, Horton JD, Hammer RE, Shimomura I, Brown MS, Goldstein JL. Overproduction of cholesterol and fatty acids causes massive liver enlargement in transgenic mice expressing truncated SREBP-1a. J Clin Invest 1996; 98(7):1575-84. 274. Horton JD, Shimomura I, Brown MS, Hammer RE, Goldstein JL, Shimano H. Activation of cholesterol synthesis in preference to fatty acid synthesis in liver and adipose tissue of transgenic mice overproducing sterol regulatory element-binding protein-2. J Clin Invest 1998; 101(11):2331-9.

53 Chapter 1

275. Horton JD, Shah NA, Warrington JA, Anderson NN, Park SW, Brown MS et al. Combined analysis of oligonucleotide microarray data from transgenic and knockout mice identifies direct SREBP target genes. Proc Natl Acad Sci U S A 2003; 100(21):12027-12032. 276. Janowski BA, Willy PJ, Devi TR, Falck JR, Mangelsdorf DJ. An oxysterol signalling pathway mediated by the nuclear receptor LXR alpha. Nature 1996; 383(6602):728-31. 277. Lehmann JM, Kliewer SA, Moore LB, Smith-Oliver TA, Oliver BB, Su JL et al. Activation of the nuclear receptor LXR by oxysterols defines a new hormone response pathway. J Biol Chem 1997; 272(6):3137-40. 278. Forman BM, Ruan B, Chen J, Schroepfer GJ, Jr., Evans RM. The orphan nuclear receptor LXRalpha is positively and negatively regulated by distinct products of mevalonate metabolism. Proc Natl Acad Sci U S A 1997; 94(20):10588-93. 279. Song C, Liao S. Cholestenoic acid is a naturally occurring ligand for liver X receptor alpha. Endocrinology 2000; 141(11):4180-4. 280. Song C, Hiipakka RA, Liao S. Selective activation of liver X receptor alpha by 6alpha- hydroxy bile acids and analogs. Steroids 2000; 65(8):423-427. 281. Huang CJ, Feltkamp D, Nilsson S, Gustafsson JA. Synergistic activation of RLD-1 by agents triggering PKA and PKC dependent signalling. Biochem Biophys Res Commun 1998; 243(3):657-663. 282. Tamura K, Chen YE, Horiuchi M, Chen Q, Daviet L, Yang Z et al. LXRalpha functions as a cAMP-responsive transcriptional regulator of gene expression. Proc Natl Acad Sci U S A 2000; 97(15):8513-8. 283. Gan X, Kaplan R, Menke JG, MacNaul K, Chen Y, Sparrow CP et al. Dual mechanisms of ABCA1 regulation by geranylgeranyl pyrophosphate. J Biol Chem 2001; 276(52):48702- 48708. 284. Ou J, Tu H, Shan B, Luk A, DeBose-Boyd RA, Bashmakov Y et al. Unsaturated fatty acids inhibit transcription of the sterol regulatory element-binding protein-1c (SREBP-1c) gene by antagonizing ligand- dependent activation of the LXR. Proc Natl Acad Sci U S A 2001; 98(11):6027-32. 285. Yoshikawa T, Shimano H, Amemiya-Kudo M, Yahagi N, Hasty AH, Matsuzaka T et al. Identification of Liver X Receptor-Retinoid X Receptor as an Activator of the Sterol Regulatory Element-Binding Protein 1c Gene Promoter. Mol Cell Biol 2001; 21(9):2991- 3000. 286. Repa JJ, Liang G, Ou J, Bashmakov Y, Lobaccaro JM, Shimomura I et al. Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptors, LXRalpha and LXRbeta. Genes Dev 2000; 14(22):2819-30. 287. Schultz JR, Tu H, Luk A, Repa JJ, Medina JC, Li L et al. Role of LXRs in control of lipogenesis. Genes Dev 2000; 14(22):2831-8. 288. Costet P, Luo Y, Wang N, Tall AR. Sterol-dependent transactivation of the ABC1 promoter by the liver X Receptor/Retinoid X receptor [In Process Citation]. J Biol Chem 2000; 275(36):28240-5. 289. Venkateswaran A, Repa JJ, Lobaccaro JM, Bronson A, Mangelsdorf DJ, Edwards PA. Human white/murine ABC8 mRNA levels are highly induced in lipid-loaded macrophages. A transcriptional role for specific oxysterols. J Biol Chem 2000; 275(19):14700-7. 290. Engel T, Lorkowski S, Lueken A, Rust S, Schluter B, Berger G et al. The human abcg4 gene is regulated by oxysterols and retinoids in monocyte-derived macrophages. Biochem Biophys Res Commun 2001; 288(2):483-8. 291. Luo Y, Liang CP, Tall AR. The orphan nuclear receptor LRH-1 potentiates the sterol- mediated induction of the human CETP gene by liver X receptor. J Biol Chem 2001; 276(27):24767-73. 292. Mak PA, Kast-Woelbern HR, Anisfeld AM, Edwards PA. Identification of PLTP as an LXR target gene and apoE as an FXR target gene reveals overlapping targets for the two nuclear receptors. J Lipid Res 2002; 43(12):2037-2041. 293. Cao G, Beyer TP, Yang XP, Schmidt RJ, Zhang Y, Bensch WR et al. Phospholipid transfer protein is regulated by liver X receptors in vivo. J Biol Chem 2002; 277(42):39561-39565. 294. Laffitte BA, Repa JJ, Joseph SB, Wilpitz DC, Kast HR, Mangelsdorf DJ et al. LXRs control lipid-inducible expression of the apolipoprotein E gene in macrophages and adipocytes. Proc Natl Acad Sci U S A 2001; 98(2):507-12. 295. Liang Y, Jiang XC, Liu R, Liang G, Beyer TP, Gao H et al. Liver X Receptors Regulate Apolipoprotein AIV-Implications of the Anti-atherosclerotic Effect of LXR Agonists. Mol Endocrinol 2004.

54 General introduction

296. Walczak R, Joseph SB, Laffitte BA, Castrillo A, Pei L, Tontonoz P. Transcription of the vascular endothelial growth factor gene in macrophages is regulated by liver X receptors. J Biol Chem 2004; 279(11):9905-9911. 297. Alberti S, Schuster G, Parini P, Feltkamp D, Diczfalusy U, Rudling M et al. Hepatic cholesterol metabolism and resistance to dietary cholesterol in LXRbeta-deficient mice. J Clin Invest 2001; 107(5):565-73. 298. Joseph SB, Laffitte BA, Patel PH, Watson MA, Matsukuma KE, Walczak R et al. Direct and indirect mechanisms for regulation of fatty acid synthase gene expression by liver X receptors. J Biol Chem 2002; 277(13):11019-11025. 299. Forman BM, Goode E, Chen J, Oro AE, Bradley DJ, Perlmann T et al. Identification of a nuclear receptor that is activated by farnesol metabolites. Cell 1995; 81(5):687-93. 300. Seol W, Choi HS, Moore DD. Isolation of proteins that interact specifically with the retinoid X receptor: two novel orphan receptors. Mol Endocrinol 1995; 9(1):72-85. 301. Makishima M, Okamoto AY, Repa JJ, Tu H, Learned RM, Luk A et al. Identification of a nuclear receptor for bile acids. Science 1999; 284(5418):1362-5. 302. Parks DJ, Blanchard SG, Bledsoe RK, Chandra G, Consler TG, Kliewer SA et al. Bile acids: natural ligands for an orphan nuclear receptor. Science 1999; 284(5418):1365-8. 303. Wang H, Chen J, Hollister K, Sowers LC, Forman BM. Endogenous bile acids are ligands for the nuclear receptor FXR/BAR. Mol Cell 1999; 3(5):543-53. 304. Nishimaki-Mogami T, Une M, Fujino T, Sato Y, Tamehiro N, Kawahara Y et al. Identification of intermediates in the bile acid synthetic pathway as ligands for the farnesoid X receptor. J Lipid Res 2004. 305. Howard WR, Pospisil JA, Njolito E, Noonan DJ. Catabolites of cholesterol synthesis pathways and forskolin as activators of the farnesoid X-activated nuclear receptor. Toxicol Appl Pharmacol 2000; 163(2):195-202. 306. Otte K, Kranz H, Kober I, Thompson P, Hoefer M, Haubold B et al. Identification of farnesoid X receptor beta as a novel mammalian nuclear receptor sensing lanosterol. Mol Cell Biol 2003; 23(3):864-872. 307. Xu G, Pan LX, Li H, Forman BM, Erickson SK, Shefer S et al. Regulation of the farnesoid X receptor (FXR) by bile acid flux in rabbits. J Biol Chem 2002; 277(52):50491-50496. 308. Bishop-Bailey D, Walsh DT, Warner TD. Expression and activation of the farnesoid X receptor in the vasculature. Proc Natl Acad Sci U S A 2004; 101(10):3668-3673. 309. Huber RM, Murphy K, Miao B, Link JR, Cunningham MR, Rupar MJ et al. Generation of multiple farnesoid-X-receptor isoforms through the use of alternative promoters. Gene 2002; 290(1-2):35-43. 310. Lew JL, Zhao A, Yu J, Huang L, De Pedro N, Pelaez F et al. The farnesoid X receptor controls gene expression in a ligand- and promoter-selective fashion. J Biol Chem 2004; 279(10):8856-8861. 311. Zhang Y, Kast-Woelbern HR, Edwards PA. Natural structural variants of the nuclear receptor farnesoid X receptor affect transcriptional activation. J Biol Chem 2003; 278(1):104-110. 312. Hylemon PB, Stravitz RT, Vlahcevic ZR. Molecular genetics and regulation of bile acid biosynthesis. Prog Liver Dis 1994; 12:99-120. 313. Bahar RJ, Stolz A. Bile acid transport. Gastroenterol Clin North Am 1999; 28(1):27-58. 314. Jelinek DF, Andersson S, Slaughter CA, Russell DW. Cloning and regulation of cholesterol 7 alpha-hydroxylase, the rate- limiting enzyme in bile acid biosynthesis. J Biol Chem 1990; 265(14):8190-7. 315. Cattori V, Eckhardt U, Hagenbuch B. Molecular cloning and functional characterization of two alternatively spliced Ntcp isoforms from mouse liver1. Biochim Biophys Acta 1999; 1445(1):154-9. 316. Green RM, Hoda F, Ward KL. Molecular cloning and characterization of the murine bile salt export pump. Gene 2000; 241(1):117-23. 317. Ananthanarayanan M, Balasubramanian N, Makishima M, Mangelsdorf DJ, Suchy FJ. Human bile salt export pump promoter is transactivated by the farnesoid X receptor/bile acid receptor. J Biol Chem 2001; 276(31):28857-65. 318. Crossman MW, Hauft SM, Gordon JI. The mouse ileal lipid-binding protein gene: a model for studying axial patterning during gut morphogenesis. J Cell Biol 1994; 126(6):1547-64. 319. Grober J, Zaghini I, Fujii H, Jones SA, Kliewer SA, Willson TM et al. Identification of a bile acid-responsive element in the human ileal bile acid-binding protein gene. Involvement of the farnesoid X receptor/9-cis-retinoic acid receptor heterodimer. J Biol Chem 1999; 274(42):29749-54.

55 Chapter 1

320. Anisfeld AM, Kast-Woelbern HR, Meyer ME, Jones SA, Zhang Y, Williams KJ et al. Syndecan-1 expression is regulated in an isoform-specific manner by the farnesoid-X receptor. J Biol Chem 2003; 278(22):20420-20428. 321. Sinal CJ, Tohkin M, Miyata M, Ward JM, Lambert G, Gonzalez FJ. Targeted disruption of the nuclear receptor FXR/BAR impairs bile acid and lipid homeostasis. Cell 2000; 102(6):731-44. 322. Denson LA, Sturm E, Echevarria W, Zimmerman TL, Makishima M, Mangelsdorf DJ et al. The Orphan Nuclear Receptor, shp, Mediates Bile Acid-Induced Inhibition of the Rat Bile Acid Transporter, ntcp. Gastroenterology 2001; 121(1):140-7. 323. Claudel T, Sturm E, Duez H, Torra IP, Sirvent A, Kosykh V et al. Bile acid-activated nuclear receptor FXR suppresses apolipoprotein A-I transcription via a negative FXR response element. J Clin Invest 2002; 109(7):961-971. 324. Claudel T, Inoue Y, Barbier O, Duran-Sandoval D, Kosykh V, Fruchart J et al. Farnesoid X receptor agonists suppress hepatic apolipoprotein CIII expression. Gastroenterology 2003; 125(2):544-555. 325. Sirvent A, Claudel T, Martin G, Brozek J, Kosykh V, Darteil R et al. The farnesoid X receptor induces very low density lipoprotein receptor gene expression. FEBS Lett 2004; 566(1- 3):173-177. 326. Urizar NL, Dowhan DH, Moore DD. The farnesoid X-activated receptor mediates bile acid activation of phospholipid transfer protein gene expression. J Biol Chem 2000; 275(50):39313-7. 327. Laffitte BA, Kast HR, Nguyen CM, Zavacki AM, Moore DD, Edwards PA. Identification of the DNA binding specificity and potential target genes for the farnesoid X-activated receptor. J Biol Chem 2000; 275(14):10638-47. 328. Lambert G, Amar MJ, Guo G, Brewer HB, Jr., Gonzalez FJ, Sinal CJ. The farnesoid X- receptor is an essential regulator of cholesterol homeostasis. J Biol Chem 2003; 278(4):2563- 2570. 329. Kok T, Hulzebos CV, Wolters H, Havinga R, Agellon LB, Stellaard F et al. Enterohepatic circulation of bile salts in farnesoid X receptor-deficient mice: efficient intestinal bile salt absorption in the absence of ileal bile acid-binding protein. J Biol Chem 2003; 278(43):41930- 41937. 330. Seol W, Choi HS, Moore DD. An orphan nuclear hormone receptor that lacks a DNA binding domain and heterodimerizes with other receptors. Science 1996; 272(5266):1336-9. 331. Masuda N, Yasumo H, Tamura T, Hashiguchi N, Furusawa T, Tsukamoto T et al. An orphan nuclear receptor lacking a zinc-finger DNA-binding domain: interaction with several nuclear receptors. Biochim Biophys Acta 1997; 1350(1):27-32. 332. Johansson L, Thomsen JS, Damdimopoulos AE, Spyrou G, Gustafsson JA, Treuter E. The orphan nuclear receptor SHP inhibits agonist-dependent transcriptional activity of estrogen receptors ERalpha and ERbeta. J Biol Chem 1999; 274(1):345-53. 333. Lee YK, Parker KL, Choi HS, Moore DD. Activation of the promoter of the orphan receptor SHP by orphan receptors that bind DNA as monomers. J Biol Chem 1999; 274(30):20869-73. 334. Brendel C, Schoonjans K, Botrugno OA, Treuter E, Auwerx J. The small heterodimer partner interacts with the liver X receptor alpha and represses its transcriptional activity. Mol Endocrinol 2002; 16(9):2065-2076. 335. Lee YK, Dell H, Dowhan DH, Hadzopoulou-Cladaras M, Moore DD. The orphan nuclear receptor SHP inhibits hepatocyte nuclear factor 4 and retinoid X receptor transactivation: two mechanisms for repression. Mol Cell Biol 2000; 20(1):187-195. 336. Seol W, Chung M, Moore DD. Novel receptor interaction and repression domains in the orphan receptor SHP. Mol Cell Biol 1997; 17(12):7126-31. 337. Nitta M, Ku S, Brown C, Okamoto AY, Shan B. CPF: an orphan nuclear receptor that regulates liver-specific expression of the human cholesterol 7alpha-hydroxylase gene. Proc Natl Acad Sci U S A 1999; 96(12):6660-5. 338. del Castillo-Olivares A, Gil G. Role of FXR and FTF in bile acid-mediated suppression of cholesterol 7alpha-hydroxylase transcription. Nucleic Acids Res 2000; 28(18):3587-93. 339. Inokuchi A, Hinoshita E, Iwamoto Y, Kohno K, Kuwano M, Uchiumi T. Enhanced expression of the human multidrug resistance protein 3 by bile salt in human enterocytes. A transcriptional control of a plausible bile acid transporter. J Biol Chem 2001; 276(50):46822- 46829. 340. Pare JF, Roy S, Galarneau L, Belanger L. The mouse fetoprotein transcription factor (FTF) gene promoter is regulated by three GATA elements with tandem E box and Nkx motifs, and

56 General introduction

FTF in turn activates the Hnf3beta, Hnf4alpha, and Hnf1alpha gene promoters. J Biol Chem 2001; 276(16):13136-13144. 341. Chen F, Ma L, Dawson PA, Sinal CJ, Sehayek E, Gonzalez FJ et al. Liver receptor homologue-1 mediates species- and cell line-specific bile acid-dependent negative feedback regulation of the apical sodium-dependent bile acid transporter. J Biol Chem 2003; 278(22):19909-19916. 342. Schoonjans K, Annicotte JS, Huby T, Botrugno OA, Fayard E, Ueda Y et al. Liver receptor homolog 1 controls the expression of the scavenger receptor class B type I. EMBO Rep 2002; 3(12):1181-1187. 343. Falender AE, Lanz R, Malenfant D, Belanger L, Richards JS. Differential expression of steroidogenic factor-1 and FTF/LRH-1 in the rodent ovary. Endocrinology 2003; 144(8):3598- 3610. 344. Castillo-Olivares A, Campos JA, Pandak WM, Gil G. The Role of {alpha}1-Fetoprotein Transcription Factor/LRH-1 in Bile Acid Biosynthesis: A KNOWN NUCLEAR RECEPTOR ACTIVATOR THAT CAN ACT AS A SUPPRESSOR OF BILE ACID BIOSYNTHESIS. J Biol Chem 2004; 279(16):16813-16821. 345. Lee SS, Pineau T, Drago J, Lee EJ, Owens JW, Kroetz DL et al. Targeted disruption of the alpha isoform of the peroxisome proliferator- activated receptor gene in mice results in abolishment of the pleiotropic effects of peroxisome proliferators. Mol Cell Biol 1995; 15(6):3012-22. 346. Aoyama T, Peters JM, Iritani N, Nakajima T, Furihata K, Hashimoto T et al. Altered constitutive expression of fatty acid-metabolizing enzymes in mice lacking the peroxisome proliferator-activated receptor alpha (PPARalpha). J Biol Chem 1998; 273(10):5678-84. 347. Hunt MC, Yang YZ, Eggertsen G, Carneheim CM, Gafvels M, Einarsson C et al. The peroxisome proliferator-activated receptor alpha (PPARalpha) regulates bile acid biosynthesis. J Biol Chem 2000; 275(37):28947-53. 348. Peters JM, Hennuyer N, Staels B, Fruchart JC, Fievet C, Gonzalez FJ et al. Alterations in lipoprotein metabolism in peroxisome proliferator-activated receptor alpha-deficient mice. J Biol Chem 1997; 272(43):27307-12. 349. Stahlberg D, Reihner E, Rudling M, Berglund L, Einarsson K, Angelin B. Influence of bezafibrate on hepatic cholesterol metabolism in gallstone patients: reduced activity of cholesterol 7 alpha-hydroxylase. Hepatology 1995; 21(4):1025-30. 350. Grundy SM, Ahrens EH, Jr., Salen G, Schreibman PH, Nestel PJ. Mechanisms of action of clofibrate on cholesterol metabolism in patients with hyperlipidemia. J Lipid Res 1972; 13(4):531-51. 351. Kesaniemi YA, Grundy SM. Influence of gemfibrozil and clofibrate on metabolism of cholesterol and plasma triglycerides in man. Jama 1984; 251(17):2241-6. 352. Caroli-Bosc FX, Le Gall P, Pugliese P, Delabre B, Caroli-Bosc C, Demarquay JF et al. Role of fibrates and HMG-CoA reductase inhibitors in gallstone formation: epidemiological study in an unselected population. Dig Dis Sci 2001; 46(3):540-4. 353. Post SM, Duez H, Gervois PP, Staels B, Kuipers F, Princen HM. Fibrates suppress bile acid synthesis via peroxisome proliferator- activated receptor-alpha-mediated downregulation of cholesterol 7alpha- hydroxylase and sterol 27-hydroxylase expression. Arterioscler Thromb Vasc Biol 2001; 21(11):1840-5. 354. Raedsch R, Plachky J, Wolf N, Simonis G. Biliary lipids, lithogenic index and biliary drug concentrations during etofibrate and bezafibrate treatment. Eur J Drug Metab Pharmacokinet 1995; 20(2):113-118. 355. Guo GL, Lambert G, Negishi M, Ward JM, Brewer HB, Jr., Kliewer SA et al. Complementary roles of farnesoid X receptor, pregnane X receptor, and constitutive androstane receptor in protection against bile acid toxicity. J Biol Chem 2003; 278(46):45062-45071. 356. Goodwin B, Gauthier KC, Umetani M, Watson MA, Lochansky MI, Collins JL et al. Identification of bile acid precursors as endogenous ligands for the nuclear xenobiotic pregnane X receptor. Proc Natl Acad Sci U S A 2003; 100(1):223-228. 357. Staudinger JL, Goodwin B, Jones SA, Hawkins-Brown D, MacKenzie KI, LaTour A et al. The nuclear receptor PXR is a lithocholic acid sensor that protects against liver toxicity. Proc Natl Acad Sci U S A 2001; 98(6):3369-3374. 358. Xie W, Radominska-Pandya A, Shi Y, Simon CM, Nelson MC, Ong ES et al. An essential role for nuclear receptors SXR/PXR in detoxification of cholestatic bile acids. Proc Natl Acad Sci U S A 2001; 98(6):3375-3380.

57 Chapter 1

359. Akiyama TE, Ward JM, Gonzalez FJ. Regulation of the liver fatty acid-binding protein gene by hepatocyte nuclear factor 1alpha (HNF1alpha). Alterations in fatty acid homeostasis in HNF1alpha-deficient mice. J Biol Chem 2000; 275(35):27117-22. 360. Shih DQ, Bussen M, Sehayek E, Ananthanarayanan M, Shneider BL, Suchy FJ et al. Hepatocyte nuclear factor-1alpha is an essential regulator of bile acid and plasma cholesterol metabolism. Nat Genet 2001; 27(4):375-82. 361. Sund NJ, Ang SL, Sackett SD, Shen W, Daigle N, Magnuson MA et al. Hepatocyte nuclear factor 3beta (Foxa2) is dispensable for maintaining the differentiated state of the adult hepatocyte. Mol Cell Biol 2000; 20(14):5175-83. 362. Kastner P, Grondona JM, Mark M, Gansmuller A, LeMeur M, Decimo D et al. Genetic analysis of RXR alpha developmental function: convergence of RXR and RAR signaling pathways in heart and eye morphogenesis. Cell 1994; 78(6):987-1003. 363. Wan YJ, An D, Cai Y, Repa JJ, Hung-Po Chen T, Flores M et al. Hepatocyte-specific mutation establishes retinoid X receptor alpha as a heterodimeric integrator of multiple physiological processes in the liver. Mol Cell Biol 2000; 20(12):4436-44. 364. Hayhurst GP, Lee YH, Lambert G, Ward JM, Gonzalez FJ. Hepatocyte nuclear factor 4alpha (nuclear receptor 2A1) is essential for maintenance of hepatic gene expression and lipid homeostasis. Mol Cell Biol 2001; 21(4):1393-403. 365. Castillo-Olivares A, Gil G. Suppression of sterol 12alpha-hydroxylase transcription by the short heterodimer partner: insights into the repression mechanism. Nucleic Acids Res 2001; 29(19):4035-4042. 366. Zhang M, Chiang JY. Transcriptional regulation of the human sterol 12alpha-hydroxylase gene (CYP8B1): roles of heaptocyte nuclear factor 4alpha in mediating bile acid repression. J Biol Chem 2001; 276(45):41690-9. 367. Stroup D, Chiang JY. HNF4 and COUP-TFII interact to modulate transcription of the cholesterol 7alpha-hydroxylase gene (CYP7A1). J Lipid Res 2000; 41(1):1-11. 368. Garuti R, Croce MA, Piccinini L, Tiozzo R, Bertolini S, Calandra S. Functional analysis of the promoter of human sterol 27-hydroxylase gene in HepG2 cells. Gene 2002; 283(1-2):133-43. 369. Pelleymounter MA, Cullen MJ, Baker MB, Hecht R, Winters D, Boone T et al. Effects of the obese gene product on body weight regulation in ob/ob mice. Science 1995; 269(5223):540- 543. 370. Liddle RA, Goldstein RB, Saxton J. Gallstone formation during weight-reduction dieting. Arch Intern Med 1989; 149(8):1750-1753. 371. Syngal S, Coakley EH, Willett WC, Byers T, Williamson DF, Colditz GA. Long-term weight patterns and risk for cholecystectomy in women. Ann Intern Med 1999; 130(6):471-477. 372. Duggirala R, Mitchell BD, Blangero J, Stern MP. Genetic determinants of variation in gallbladder disease in the Mexican- American population. Genet Epidemiol 1999; 16(2):191- 204. 373. Hyogo H, Roy S, Cohen DE. Restoration of gallstone susceptibility by leptin in C57BL/6J ob/ob mice. J Lipid Res 2003; 44(6):1232-1240. 374. VanPatten S, Ranginani N, Shefer S, Nguyen LB, Rossetti L, Cohen DE. Impaired biliary lipid secretion in obese Zucker rats: leptin promotes hepatic cholesterol clearance. Am J Physiol Gastrointest Liver Physiol 2001; 281(2):393-404. 375. Tran KQ, Goldblatt MI, Swartz-Basile DA, Svatek C, Nakeeb A, Pitt HA. Diabetes and hyperlipidemia correlate with gallbladder contractility in leptin-related murine obesity. J Gastrointest Surg 2003; 7(7):857-862. 376. Tran KQ, Graewin SJ, Swartz-Basile DA, Nakeeb A, Svatek CL, Pitt HA. Leptin-resistant obese mice have paradoxically low biliary cholesterol saturation. Surgery 2003; 134(2):372- 377. 377. Tran KQ, Swartz-Basile DA, Nakeeb A, Pitt HA. Gallbladder motility in agouti-yellow and leptin-resistant obese mice. J Surg Res 2003; 113(1):56-61. 378. Kirk EA, Moe GL, Caldwell MT, Lernmark JA, Wilson DL, LeBoeuf RC. Hyper- and hypo- responsiveness to dietary fat and cholesterol among inbred mice: searching for level and variability genes. J Lipid Res 1995; 36(7):1522-32. 379. Wang DQ, Lammert F, Paigen B, Carey MC. Phenotypic characterization of lith genes that determine susceptibility to cholesterol cholelithiasis in inbred mice. Pathophysiology Of biliary lipid secretion. J Lipid Res 1999; 40(11):2066-79. 380. Khanuja B, Cheah YC, Hunt M, Nishina PM, Wang DQ, Chen HW et al. Lith1, a major gene affecting cholesterol gallstone formation among inbred strains of mice. Proc Natl Acad Sci U S A 1995; 92(17):7729-33.

58 General introduction

381. Hofmann AF, Grundy SM, Lachin JM, Lan SP, Baum RA, Hanson RF et al. Pretreatment biliary lipid composition in white patients with radiolucent gallstones in the National Cooperative Gallstone Study. Gastroenterology 1982; 83(4):738-52. 382. Alexander M, Portman OW. Different susceptibilities to the formation of cholesterol gallstones in mice. Hepatology 1987; 7(2):257-65. 383. Wittenburg H, Lammert F, Wang DQ, Churchill GA, Li R, Bouchard G et al. Interacting QTLs for cholesterol gallstones and gallbladder mucin in AKR and SWR strains of mice. Physiol Genomics 2002; 8(1):67-77. 384. Wittenburg H, Lyons MA, Li R, Churchill GA, Carey MC, Paigen B. FXR and ABCG5/ABCG8 as determinants of cholesterol gallstone formation from quantitative trait locus mapping in mice. Gastroenterology 2003; 125(3):868-881. 385. Lyons MA, Wittenburg H, Li R, Walsh KA, Leonard MR, Churchill GA et al. New quantitative trait loci that contribute to cholesterol gallstone formation detected in an intercross of CAST/Ei and 129S1/SvImJ inbred mice. Physiol Genomics 2003; 14(3):225-239. 386. Lyons MA, Wittenburg H, Li R, Walsh KA, Leonard MR, Korstanje R et al. Lith6: a new QTL for cholesterol gallstones from an intercross of CAST/Ei and DBA/2J inbred mouse strains. J Lipid Res 2003; 44(9):1763-1771. 387. Lammert F, Wang DQ, Wittenburg H, Bouchard G, Hillebrandt S, Taenzler B et al. Lith genes control mucin accumulation, cholesterol crystallization, and gallstone formation in A/J and AKR/J inbred mice. Hepatology 2002; 36(5):1145-1154. 388. Hoda F, Green RM. Hepatic canalicular membrane transport of bile salt in C57L/J and AKR/J mice: implications for cholesterol gallstone formation. J Membr Biol 2003; 196(1):9-14. 389. Bouchard G, Chao, HC, Lammert, F, Wang DQH, Paigen B. CMoat is a candidate for Lith2, a cholesterol gallstone gene found on chromosome 19 in inbred mice (abstr). Hepatology 1998; 28:502A. 390. Bouchard G, Carey MC, Paigen B. In the genitic locus containing the second gallstone gene Lith2, an Mrp2 polymorphism is linked to heightened secretion of organic anions (abstr). Gastroenterology 2000; 2000(108):A1017. 391. Dyck PA, Hoda F, Osmer ES, Green RM. Microarray analysis of hepatic gene expression in gallstone-susceptible and gallstone-resistant mice. Mamm Genome 2003; 14(9):601-610. 392. Lammert F, Wang DQ, Paigen B, Carey MC. Phenotypic characterization of Lith genes that determine susceptibility to cholesterol cholelithiasis in inbred mice: integrated activities of hepatic lipid regulatory enzymes. J Lipid Res 1999; 40(11):2080-90. 393. Xu G, Muller O, Stange EF, Fuchs M. Impaired regulation of sterol regulatory element binding protein 2 in cholesterol gallstone-susceptible mice. Biochim Biophys Acta 2004; 1688(3):274-279. 394. Kratzer W, Mason RA, Kachele V. Prevalence of gallstones in sonographic surveys worldwide [see comments]. J Clin Ultrasound 1999; 27(1):1-7. 395. Brett M, Barker DJ. The world distribution of gallstones. Int J Epidemiol 1976; 5(4):335-41. 396. Sugimoto M, Abei T, Kameda H. A clinical study on gallstones in Bolivia. Jpn J Med 1983; 22(2):90-4. 397. Nervi F, Duarte I, Gomez G, Rodriguez G, Del Pino G, Ferrerio O et al. Frequency of gallbladder cancer in Chile, a high-risk area. Int J Cancer 1988; 41(5):657-60. 398. Moro PL, Checkley W, Gilman RH, Cabrera L, Lescano AG, Bonilla JJ et al. Gallstone disease in Peruvian coastal natives and highland migrants. Gut 2000; 46(4):569-73. 399. Moro PL, Checkley W, Gilman RH, Lescano G, Bonilla JJ, Silva B et al. Gallstone disease in high-altitude Peruvian rural populations. Am J Gastroenterol 1999; 94(1):153-8. 400. Miquel JF, Covarrubias C, Villaroel L, Mingrone G, Greco AV, Puglielli L et al. Genetic epidemiology of cholesterol cholelithiasis among Chilean Hispanics, Amerindians, and Maoris. Gastroenterology 1998; 115(4):937-46. 401. Brasca AP, Pezzotto SM, Berli D, Villavicencio R, Fay O, Gianguzzo MP et al. Epidemiology of gallstone disease in Argentina: prevalences in the general population and European descendants. Dig Dis Sci 2000; 45(12):2392-8. 402. Maurer KR, Everhart JE, Ezzati TM, Johannes RS, Knowler WC, Larson DL et al. Prevalence of gallstone disease in Hispanic populations in the United States. Gastroenterology 1989; 96(2 Pt 1):487-92. 403. Diehl AK, Schwesinger WH, Holleman DR, Jr., Chapman JB, Kurtin WE. Gallstone characteristics in Mexican Americans and non-Hispanic whites. Dig Dis Sci 1994; 39(10):2223-8.

59 Chapter 1

404. Williams CN, Johnston JL, Weldon KL. Prevalence of gallstones and gallbladder disease in Canadian Micmac Indian women. Can Med Assoc J 1977; 117(7):758-60. 405. Weiss KM, Ferrell RE, Hanis CL, Styne PN. Genetics and epidemiology of gallbladder disease in New World native peoples. Am J Hum Genet 1984; 36(6):1259-78. 406. Sampliner RE, Bennett PH, Comess LJ, Rose FA, Burch TA. Gallbladder disease in pima indians. Demonstration of high prevalence and early onset by cholecystography. N Engl J Med 1970; 283(25):1358-64. 407. Bennion LJ, Knowler WC, Mott DM, Spagnola AM, Bennett PH. Development of lithogenic bile during puberty in Pima indians. N Engl J Med 1979; 300(16):873-6. 408. Bortnichak EA, Freeman DH, Jr., Ostfeld AM, Castelli WP, Kannel WB, Feinleib M et al. The association between cholesterol cholelithiasis and coronary heart disease in Framingham, Massachusetts. Am J Epidemiol 1985; 121(1):19-30. 409. Ratner J, Lisbona A, Rosenbloom M, Palayew M, Szabolcsi S, Tupaz T. The prevalence of gallstone disease in very old institutionalized persons. Jama 1991; 265(7):902-3. 410. Williams CN, Johnston JL. Prevalence of gallstones and risk factors in Caucasian women in a rural Canadian community. Can Med Assoc J 1980; 122(6):664-8. 411. Thistle JL, Schoenfield LJ. Lithogenic bile among young Indian women. N Engl J Med 1971; 284(4):177-81. 412. Galman C, Miquel JF, Perez RM, Einarsson C, Stahle L, Marshall G et al. Bile acid synthesis is increased in Chilean Hispanics with gallstones and in gallstone high-risk Mapuche Indians. Gastroenterology 2004; 126(3):741-748. 413. Huddy GPB. A study of the family histories of 300 patients suffering from chronic upper abdominal lesions. Lancet 1925; 269:276-8. 414. Kõrner G. Über die familiäre Häufung der Gallenblasenkrankheiten. Z fûr Menschliche Verarbungs und Konstitutionslehre 1937; 20:528-82. 415. Littler TR, Ellis GR. Gall-stones: a clinical survey. Brit Med J 1952; 1:842-4. 416. Jackson ChE, Gay BC. Inheritance of gall-bladder disease. Surgery 1959; 46(5):853-7. 417. van der Linden W, Lindelöf G. The familial occurrence of gallstone disease. Acta Genet Basel 1965; 15:159-64. 418. van der Linden W, Westlin N. The familial occurrence of gallstone disease II. Occurrence in Husbands and Wives. Acta Genet Basel 1966; 16:377-82. 419. Gilat T, Feldman C, Halpern Z, Dan M, Bar-Meir S. An increased familial frequency of gallstones. Gastroenterology 1983; 84(2):242-6. 420. Sarin SK, Negi VS, Dewan R, Sasan S, Saraya A. High familial prevalence of gallstones in the first-degree relatives of gallstone patients. Hepatology 1995; 22(1):138-41. 421. van der Linden W, Simonson N. Familial occurrence of gallstone disease. Incidence in parents of young patients. Hum Hered 1973; 23(2):123-7. 422. Danzinger RG, Gordon H, Schoenfield LJ, Thistle JL. Lithogenic bile in siblings of young women with cholelithiasis. Mayo Clin Proc 1972; 47(10):762-6. 423. Harvald B, Hauge M. A catamnestic investigation of Danish twins. A preliminary report. Dan Med Bull 1956; 3(5):150-8. 424. Doig R. Illness in twins: III. Cholelithiasis. Med J Austr 1957; 44:716-717. 425. Doig RPF. Illness in twins: I. A study of twins from a general hospital population. Med J Austr 1957; 44:612-617. 426. Antero Kesaniemi Y, Koskenvuo M, Vuoristo M, Miettinen TA. Biliary lipid composition in monozygotic and dizygotic pairs of twins. Gut 1989; 30(12):1750-6. 427. Jacquemin E, de Vree JM, Cresteil D, Sokal EM, Sturm E, Dumont M et al. The wide spectrum of multidrug resistance 3 deficiency: from neonatal cholestasis to cirrhosis of adulthood. Gastroenterology 2001; 120(6):1448-58. 428. de Vree JM, Jacquemin E, Sturm E, Cresteil D, Bosma PJ, Aten J et al. Mutations in the MDR3 gene cause progressive familial intrahepatic cholestasis. Proc Natl Acad Sci U S A 1998; 95(1):282-7. 429. Dixon PH, Weerasekera N, Linton KJ, Donaldson O, Chambers J, Egginton E et al. Heterozygous MDR3 missense mutation associated with intrahepatic cholestasis of pregnancy: evidence for a defect in protein trafficking. Hum Mol Genet 2000; 9(8):1209- 1217. 430. Jacquemin E, Hadchouel M. Genetic basis of progressive familial intrahepatic cholestasis. J Hepatol 1999; 31(2):377-381. 431. Ortiz D, Arias IM. MDR3 mutations: a glimpse into pandora's box and the future of canalicular pathophysiology. Gastroenterology 2001; 120(6):1549-52.

60 General introduction

432. Rosmorduc O, Hermelin B, Boelle PY, Parc R, Taboury J, Poupon R. ABCB4 gene mutation- associated cholelithiasis in adults. Gastroenterology 2003; 125(2):452-459. 433. Niemi M, Kervinen K, Rantala A, Kauma H, Paivansalo M, Savolainen MJ et al. The role of apolipoprotein E and glucose intolerance in gallstone disease in middle aged subjects. Gut 1999; 44(4):557-62. 434. Juvonen T, Savolainen MJ, Kairaluoma MI, Lajunen LH, Humphries SE, Kesaniemi YA. Polymorphisms at the apoB, apoA-I, and cholesteryl ester transfer protein gene loci in patients with gallbladder disease. J Lipid Res 1995; 36(4):804-12. 435. Han T, Jiang Z, Suo G, Zhang S. Apolipoprotein B-100 gene Xba I polymorphism and cholesterol gallstone disease. Clin Genet 2000; 57(4):304-8. 436. Nardone G, Ferber IA, Miller LJ. The integrity of the cholecystokinin receptor gene in gallbladder disease and obesity. Hepatology 1995; 22(6):1751-3. 437. L'Heureux P R, Isenberg JN, Sharp HL, Warwick WJ. Gallbladder disease in cystic fibrosis. AJR Am J Roentgenol 1977; 128(6):953-6. 438. Rovsing H, Sloth K. Micro-gallbladder and biliary calculi in mucoviscidosis. Acta Radiol Diagn (Stockh) 1973; 14(5):588-92. 439. Stern RC, Rothstein FC, Doershuk CF. Treatment and prognosis of symptomatic gallbladder disease in patients with cystic fibrosis. J Pediatr Gastroenterol Nutr 1986; 5(1):35-40. 440. Toscano E, Trivellini V, Andria G. Cholelithiasis in Down's syndrome. Arch Dis Child 2001; 85(3):242-3. 441. Perez-Calvo J, Bernal M, Giraldo P, Torralba MA, Civeira F, Giralt M et al. Co-morbidity in Gaucher's disease results of a nationwide enquiry in Spain. Eur J Med Res 2000; 5(6):231-5. 442. Roy CC, Weber AM, Morin CL, Combes JC, Nussle D, Megevand A et al. Abnormal biliary lipid composition in cystic fibrosis. Effect of pancreatic enzymes. N Engl J Med 1977; 297(24):1301-5. 443. Angelico M, Gandin C, Canuzzi P, Bertasi S, Cantafora A, De Santis A et al. Gallstones in cystic fibrosis: a critical reappraisal. Hepatology 1991; 14(5):768-75. 444. Elias Pollina J, Garate J, Martin Bejarano E, Vitoria JC, Sojo A, Ubalde J et al. [Cholelithiasis in childhood. Proposals based on a multicentric study]. Cir Pediatr 1992; 5(2):96-100. 445. Aughton DJ, Gibson P, Cacciarelli A. Cholelithiasis in infants with Down syndrome. Three cases and literature review. Clin Pediatr (Phila) 1992; 31(11):650-2. 446. Aynaci FM, Erduran E, Mocan H, Okten A, Sarpkaya AO. Cholelithiasis in infants with Down syndrome: report of two cases. Acta Paediatr 1995; 84(6):711-2.

Chapter 2

Relation between hepatic expression of ATP- binding cassette transporters G5 and G8 and biliary cholesterol secretion in mice

Published in: Journal of Hepatology, 2003, 38: 710-716.

Astrid Kosters, Raoul J.J.M. Frijters, Frank G. Schaap, Edwin Vink, Torsten Plösch,

Roelof Ottenhoff, Milan Jirsa, Iris M. De Cuyper, Folkert Kuipers and Albert K.

Groen.

Abcg5/Abcg8 and biliary cholesterol secretion

ABSTRACT

Mutations in genes encoding the ABC-transporters ABCG5 and ABCG8 underlie sitosterolemia, which is characterized by elevated plasma levels of phytosterols due to increased intestinal absorption and impaired biliary secretion of sterols. The aim of our study was to correlate the expression levels of Abcg5 and Abcg8 to biliary cholesterol secretion in various (genetically-modified) mouse models. Bile was collected from genetically-modified mice fed a chow diet, or from mice fed either a chow diet, or chow supplemented with either 1% diosgenin, 0.1% simvastatin, or a synthetic LXR agonist, for determination of biliary lipids. Livers and small intestines were harvested and expression levels of Abcg5, Abcg8 and Abcb4 were determined by real-time PCR. Intestinal expression of Abcg5 and Abcg8 did not show much variation between the various models. In contrast, a linear correlation between hepatic expression levels of Abcg5 and Abcg8 and biliary cholesterol secretion rates was found. This relation was independent of Abcb4-mediated phospholipid secretion. However, in diosgenin-fed mice showing cholesterol hypersecretion, hepatic Abcg5 and Abcg8 expression levels remained unchanged. In conclusion, our results strongly support a role for Abcg5 and Abcg8 in regulation of biliary cholesterol secretion, but also indicate the existence of a largely independent route of cholesterol secretion.

65 Chapter 2

INTRODUCTION

Both liver and intestine play an important role in cholesterol homeostasis. The liver is a major site of cholesterol biosynthesis and for uptake of cholesterol-containing lipoproteins from plasma. Cholesterol is then redistributed by the liver, i.e., incorporated into HDL and VLDL particles or after remodeling and metabolism, secreted into bile either as free cholesterol or as bile salts. Subsequently, 60-80% of biliary cholesterol is reabsorbed from the intestine and transported back to the liver via the chylomicron pathway, completing the enterohepatic circulation (1). Uptake of cholesterol by the intestine and its secretion into bile have long been thought to represent passive processes, but recent observations strongly indicate the involvement of (transport) proteins. The HDL-receptor SR-BI, its family member CD36 and a hitherto undefined protein (2-4) have been implicated in cholesterol uptake in the intestine. Efflux back into the intestinal lumen to reduce the efficiency of net cholesterol absorption has been suggested to be mediated by the ATP Binding Cassette (ABC) half transporters ABCG5 and ABCG8. Mutations in either of these genes have been shown to underlie the disease sitosterolemia (5-7). The main characteristics of this disorder are highly increased plasma levels of non-cholesterol sterols from plant and fish origin and normal to mildly increased plasma cholesterol levels (8;9), which result from increased intestinal absorption. In addition, biliary secretion of sterols is impaired in sitosterolemia patients (10-12). The human ABCG5 and ABCG8 genes are located next to each other in a head-to-head direction on opposite strands of chromosome 2p21 (5-7) The two genes are separated by only a small intergenic region which acts as a bi-directional promoter (13), and although a number of potential transcription factor binding sites were found in the intergenic region no obvious regulatory elements involved in cholesterol metabolism were detected. A similar chromosomal organization was found for the mouse Abcg5/Abcg8 genes (14), however in mice the intergenic region was found not to be active as a promoter (14). ABCG5 and ABCG8 are predominantly and coordinately expressed in the liver and intestine. In mice, the expression of both genes is increased in response to a high cholesterol diet via activation of the liver-X-receptor LXR (15). Furthermore, in WIF-B cells, a polarized hepatoma cell line, both proteins have been shown to be localized at the canalicular membrane (16). Recently, Yu et al. (17) generated mice overexpressing the human ABCG5/ABCG8 genomic sequence 14-fold. This induced a 5-fold increase in both gallbladder cholesterol concentration and in fecal neutral sterol excretion. These data strongly suggest that Abcg5 and Abcg8 are involved in biliary cholesterol secretion. Accordingly, the cholesterol concentration in gallbladder bile of Abcg5/Abcg8 knockout mice was decreased (only 10% of wild type mice) (18). To investigate the role of Abcg5/Abcg8 in regulation of biliary cholesterol secretion, we determined in the present study, the expression levels of the genes under a variety of conditions, which increased or decreased biliary cholesterol secretion in mice. A good correlation between expression of Abcg5/Abcg8 and biliary cholesterol secretion was found in all but one mouse model.

66 Abcg5/Abcg8 and biliary cholesterol secretion

MATERIAL AND METHODS

Animals and procedures Mice overexpressing the truncated, constitutively active form of Srebp2 (19) were obtained from the Jackson Laboratory. These mice were bred in a C57B6SJL-TgN background and were compared to C57B6SJLF1/J mice (as advised by the Jackson Laboratory). Srebp2 transgenic mice and their respective wild types were fed a control casein-based diet (AM-II, Hope-Farms, Wageningen, The Netherlands). Abca1–/– mice, generated as described (20), and wild-type mice with a DBA/1 background were obtained from IFFA Credo (L’Arbresle, France). Abcb4-/- mice with a FVB background (21) were bred at the Academic Medical Center. Abca1-/- mice (3–6 months), Abcb4-/- mice and their respective controls were fed RMH-B chow (Hope Farms). C57BL/6J mice (purchased from Harlan, Horst, The Netherlands) and Abca1-/- and DBA/1 wild type mice were administered the synthetic LXR agonist T0901317 (Tularik Inc., South San Francisco, CA, USA) at a dose of 20 µmol/kg/day by gavage for 4 days (22). To investigate the effect of simvastatin, male FVB mice were fed RMH-B chow (Hope Farms) or chow supplemented with 0.1 % (w/w) simvastatin (MSD Inc. Whitehouse Station, NJ) for 5 days. Male FVB mice were fed at the age of four months either AM-II diet or AM-II supplemented with 1% (w/w) diosgenin (Sigma, The Netherlands) for 18 days. At the end of the experiments, bile was collected by cannulation of the common bile duct via the gallbladder, under Hypnorm (fentanyl/fluanisone; 1 ml/kg) and diazepam (10 mg/kg) anesthesia. A heat pad was used to maintain body temperature. Bile collection was performed for 30 minutes and production was determined gravimetrically assuming 1g/ml for bile. Bile salts, phospholipids and cholesterol were determined using standard enzymatic techniques as described previously (23). At the end of the procedure, blood was collected by cardiac puncture, and the liver and small intestine were rapidly excised and snapfrozen in liquid nitrogen. Experimental protocols were approved by the Ethics Committees for Animal Experiments at the Academic Medical Center, Amsterdam and at the University Hospital Groningen, Groningen.

Determination of mRNA expression levels Total RNA was isolated from 200-300 mg mouse liver or intestine according to Chomczynski and Sacchi (24). Oligo-dT-primed cDNA was synthesized using Superscript II reverse transcriptase (Invitrogen, Breda, The Netherlands). Real-time PCR using the LightCycler system (Roche, Mannheim, Germany) was performed on mouse Abcg5 (nt 1408-1669 of NM_031884), Abcg8 (nt 93-256 of AF324495), Abcb4 (nt 252-575 of NM_008830) and Gapdh (nt 744-998 of M32599). For quantification, a calibration curve was made for each gene consisting of serial dilutions of plasmids containing the appropriate fragment. Expression levels were normalized to the levels of Gapdh.

67 Chapter 2

Polyclonal antibody production Primers were designed to amplify the cDNA fragment encoding amino acids 256 - 392 of mouse Abcg5 (GenBank accession NP_114090). Primers (Invitrogen) were as follows: mm Abcg5 forward 5'-CAT ATG GAG CTC TTC CAA CAC TTC GAC-3' and mm Abcg5 reverse 5'-GGA TCC TAA ACG AGA CGC ATA ATC ACT GC-3'. Total RNA was isolated from mouse liver using Trizol reagent (Invitrogen) and used as template in RT-PCR (Qiagen, Hilden Germany) using the above mentioned primers. The RT-PCR product, a 425-bp ABCG5 fragment was TA-cloned in pCR2.1 (Invitrogen) and recloned as NdeI-BamHI fragment in the prokaryotic expression vector pET15b (Novagen, Madison, WI, USA). The Abcg5 fragment was expressed as an N-terminally hexahistidine-tagged protein in E. coli strain BL21 (λDE3) (Novagen). The recombinant protein was purified under denaturing conditions using two rounds of metal affinity chromatography according to the manufacturers' instructions (AP Biotech, Roosendaal, The Netherlands). Antiserum was raised at Biogenes GmbH (Berlin, Germany). For this purpose, rabbits received multiple injections of 100 µg of the recombinant Abcg5 protein mixed with Freund's adjuvant.

Immunodetection and N-glycosidation of ABCG5 Proteins (50 µg) from total liver homogenates were separated on 8 % SDS- polyacrylamide gels and blotted onto nitrocellulose membranes. Membranes were blocked in blocking buffer (5 % (w/v) dry milk in Tris-buffered saline with 0.05 % Tween 20 [TTBS]). Subsequently, membranes were incubated for 1 hr at room temperature with Abcg5 antiserum (1:1000 in blocking buffer). Membranes were washed three times in TTBS, and incubated with horseradish peroxidase-conjugated goat anti-rabbit antibodies (Bio-Rad, The Netherlands) (1:2000 in blocking buffer). Subsequently, membranes were washed four times in TTBS containing 500 mM NaCl and immunoreactive bands were detected by chemoluminence (Lumi-lightplus (Roche). For study of the N-glycosylation state of Abcg5, 50 µg liver protein was de-N- glycosylated with 2 U of N-glycosidase F according to the manufacturer’s instructions (Roche), and Abcg5 was immunodetected as described above.

Statistical analysis All values represent means ± SE. Statistical differences between the groups were analyzed by Mann-Whitney-U-test and Spearman’s rank correlation (SPPS 9.0.1 for Windows, SPSS Inc., Chicago, USA). A p-value < 0.05 was considered statistically significant.

68 Abcg5/Abcg8 and biliary cholesterol secretion

RESULTS

A great number of mouse models with either increased (Srebp2 overexpressing mice, dietary diosgenin, dietary simvastatin or LXR agonist administration), unchanged (Abca1 knock-out mice) or decreased (Abcb4 knock-out mice) biliary cholesterol secretion was selected for this study. The data on biliary secretion of bile salts, phospholipids and cholesterol in the various mouse models are summarized in Table 1. In mice overexpressing a constitutively active form of the sterol regulatory element binding protein 2 (Srebp2), a twenty-fold increase of biliary cholesterol secretion (p<0.05) was observed. Furthermore, phospholipid secretion was about threefold induced (p<0.05) (Table 1). The hepatic mRNA levels of Abcg5 and Abcg8 were increased 5.0-5.5 times (p<0.05) (Figure 1a) in Srebp2 transgenic mice. In contrast, intestinal expression levels of Abcg5 and Abcg8 were not affected (Figure 1b). In Abcb4(-/-) (Mdr2(-/-) mice biliary phospholipid secretion is absent and cholesterol secretion is low (Table 1, (25;26). Hepatic expression levels of Abcg5 and Abcg8 were decreased 2.5-3.0 fold in Abcb4(-/-) mice (p<0.05 for Abcg5, p<0.01 for Abcg8) (Figure 1a). In Abca1(-/-) mice, biliary cholesterol secretion is not affected (Table 1, (27). In livers of Abca1(-/-) mice expression levels of Abcg8 were not changed compared to wild-type mice, whereas Abcg5 expression was slightly downregulated (p<0.05) (Figure 1a). In contrast, the intestinal expression levels of both genes were 1.5-2.0 fold (not significantly) increased in Abca1-/- mice (Figure 1b). In mice (C57Bl/6J strain) administered the synthetic LXR agonist T0901317, increased levels of both hepatic Abcg5 and Abcg8 mRNA (p<0.05) (Figure 1a) were found, as well as a 2.5-fold increase in biliary cholesterol secretion (p<0.05) (Table 1). In Abca1(-/-) mice, T0901317 induced similar increases in hepatic Abcg5 and Abcg8 expression (p<0.05) (Figure 1a) and biliary cholesterol secretion (p<0.05) (Table 1). Treatment of FVB mice with the HMG-CoA reductase inhibitor simvastatin (28) for 5

Table 1: Biliary lipid secretion rates of the various mouse models used in this study Cholesterol output Phospholipid output Bile Salt output Mouse strain (nmol/min.100 gr.) (nmol/min.100 gr.) (nmol/min.100 gr.) Srebp2 wt (C57B6SJLF1/J) (n=3) 1.4 ± 0.3 22.1 ± 5.8 280 ± 88 Srebp2 Tg (C57B6SJL-TgN) (n=3) 30.3 ± 5.5* 59.5 ± 4.2* 276 ± 28 Control (FVB, RMB diet) (n=3) 3.1 ± 0.7 23.6 ± 4.6 219 ± 32 Simvastatin (FVB) (n=3) 6.2 ± 1.3* 37.4 ± 3.2* 282 ± 22 Abcb4 -/- (FVB) (n=3) 0.1 ± 0.1* 0.3 ± 0.3 * 394 ± 51 Abca1 wt (DBA/1) (n=5) 8.5 ± 0.6 67.9 ± 2.9 428 ± 60 Abca1 -/- (DBA/1) (n=5) 10.4 ± 2.1 82.0 ± 15.0 574 ± 135 C57BL/6J (n = 4) 3.8 ± 0.5 52.8 ± 4.5 583 ± 93 C57BL/6J + T0901317 (n =4) 10.3 ± 1.3* 44.1 ± 3.9 477 ± 82 Abca1 wt (DBA/1) + T0901317 (n = 5) 16.5 ± 2.3* 36.2 ± 3.5 302 ± 58 Abca1 -/- (DBA/1) + T0901317 (n = 5) 22.3 ± 5.3* 56.2 ± 15.6 290 ± 79 Control (FVB, AM-II diet) (n=4) 0.5 ± 0.1 36.0 ± 1.7 295 ± 25 Diosgenin (FVB) (n=4) 8.7 ± 0.6* 41.3 ± 2.4 304 ± 42 Mice were cannulated and bile was analyzed for cholesterol, phospholipid and bile salt outputs as described in Material and Methods. Data represent means ± SE for the indicated number of animals. * indicates significant difference to the respective control group (Mann-Whitney-U-test, p<0.05). Abbreviations: T0901317: LXR agonist;

69 Chapter 2

Figure 1: Hepatic and intestinal expression levels of Abcg5 and Abcg8 in mouse models with alterations in biliary cholesterol output. mRNA levels of Abcg5 and Abcg8 in liver (A) and intestine (B) were determined by real-time PCR and normalized to Gapdh levels. Data are given as fold difference to control or wild type values. * Indicates significant differences (Mann-Whitney-U-test, p<0.05). days induced biliary cholesterol secretion 2-fold (Table 1). In addition to inducing biliary cholesterol secretion, simvastatin treatment also increased the secretion of phospholipid into bile (Table 1). At day 5 the expression of Abcg5 was increased 2.6-

70 Abcg5/Abcg8 and biliary cholesterol secretion fold (p<0.05) in livers of simvastatin-treated mice whereas the expression of Abcg8 was increased 1.5-fold (p<0.05) (Figure 1a). Both hepatic and intestinal expression levels of Abcg5 and Abcg8 were unchanged in mice fed a 1% diosgenin-diet for 18 days compared to wild-type mice (Figures 1a and b), despite the ~16-fold increase of biliary cholesterol output (p<0.05). Therefore Abcg5 protein levels in livers of these mice were examined. In liver, Abcg5 appears to be present as 75 and 90 kDa forms as detected in Western analysis (Figure 2a). Antigen competition experiments strongly decreased the signal, validating the presence of Abcg5 in the 75 and 90 kDa bands (data not shown). After treatment of liver homogenates with N-glycosidase F, both forms shifted to a lower molecular mass of 64 kDa indicating that the 75 and 90 kDa bands likely result from different extents of N-glycosylation. Similarly as Abcg5 mRNA levels, Abcg5 protein levels in diosgenin-fed mice were not different from Abcg5 protein levels in control livers (Figure 2a). When the changes in hepatic expression of Abcg5 and Abcg8 measured in the different models were plotted against the “fold change” in biliary cholesterol output a linear relation was observed with only the Srebp2 overexpressing mice and the diosgenin-fed mice deviating (Figure 3). The relative cholesterol and phospholipid secretion rates vary in the models used in this study. It is well known that phospholipids may drive cholesterol secretion, which may have influenced the relation we found in Figure 3. Previously, we have shown that under basal conditions, Abcb4 fully controls phospholipid secretion and that there is a proportional relationship between hepatic Abcb4 expression and biliary phospholipid secretion (29). Therefore we determined the hepatic expression levels of Abcb4 in the different models. To segregate effects of phospholipid secretion on cholesterol secretion, the ratios of Abcg5 and Abcg8 to Abcb4 expression were calculated and the normalized “fold change” ratios were plotted as a function of the ratio of cholesterol to phospholipid secretion that were found in the models used. As

A B

Figure 2: Abcg5 protein expression in livers of control and diosgenin-fed mice. (A) Total liver homogenate (50 µg protein) derived from 4 control (lane 1-4) and 4 diosgenin-fed mice (lane 5-8) was separated on SDS-Page (8%). Proteins were transferred to nitrocelluse membrane and detected with Abcg5 antiserum as described in Materials and Methods. (B) N-glycosidase F treatment of total liver homogenate. Total liver homogenate (50 µg protein) of control FVB mice was incubated with or without PGNase as described in Materials and Methods. Thereafter the samples were subjected to SDS-Page (8%) and detected with Abcg5 antiserum.

71 Chapter 2

Figure 3: Relation between hepatic expression of Abcg5 and Abcg8 and biliary cholesterol output. The fold induction of hepatic expression levels of Abcg5 (closed symbols) and Abcg8 (open symbols) for the various models (•) as given in Figure 1 was plotted against fold induction of biliary cholesterol output. This resulted in a linear correlation between the two parameters with the exception of the Srebp2 transgenic mice (■) and the diosgenin-fed mice (♦)

shown in Figure 4, also without the possible confounding influence of phospholipid secretion, expression levels of Abcg5 and Abcg8 correlated with cholesterol secretion (r = 0.61, p = 0.001 for Abcg5 and r = 0.71, p= 0.001 for Abcg8). As clearly can be seen from the figures, this correction especially influenced the relation between Abcg5/Abcg8 expression and biliary cholesterol secretion in Srebp2 transgenic mice. However, after correction for phospholipid secretion, the diosgenin-fed mice remained an exception. This relation strongly supports the notion that Abcg5 and Abcg8 play a role in the control of biliary cholesterol secretion.

72 Abcg5/Abcg8 and biliary cholesterol secretion

Discussion

In the present study, we found a linear relation between hepatic Abcg5 and Abcg8 expression levels and biliary cholesterol secretion rates in several mouse models with a wide variation in biliary cholesterol secretion rates. An exception to this relation was the diosgenin-fed model. Surprisingly, hepatic Abcg5 and Abcg8 expression levels remained unchanged in diosgenin-fed mice compared to control mice, whereas biliary cholesterol secretion was induced 16-fold (Table 1,(30). The mechanism of action of the plant sterol diosgenin is unknown at present. Therefore diosgenin might have affected the levels of Abcg5/Abcg8 protein in the liver. However, similarly to the mRNA levels of Abcg5 and Abcg8, no differences in Abcg5 protein levels were detected in diosgenin-fed mice compared to control mice. Unfortunately, due to the absence of a suitable antibody we have not been able to determine levels of Abcg8 protein. Since studies of Graf et al. (16) in cultured cells indicated that Abcg5 and Abcg8 function as an obligate heterodimer measurement of one of the partners should suffice. Graf et al. (16) demonstrated in addition that only the fully glycosylated forms of the proteins traffic to the canalicular membrane. If these results can be extrapolated to the situation in the intact liver, the data in Figure 2a suggest that diosgenin also did not influence the degree of glycosylation of at least Abcg5 and hence probably did not effect the localization of the protein. Apparently a different, perhaps, parallel mechanism of biliary cholesterol secretion is operational in the presence of diosgenin. Activation of the nuclear hormone receptor LXR has been shown to induce Abcg5 and Abcg8 expression as well as Abca1 expression (15). Although we have shown that biliary cholesterol secretion is not affected in Abca1-/- mice (Table 1, (27), Vaisman et al. (31) demonstrated increased concentrations of cholesterol and phospholipid in gallbladder bile of Abca1 overexpressing mice, which might indicate compensation of the disrupted gene in the Abca1(-/-) mice. Apparently, Abcg5 and Abcg8 are not involved herein, since only a small downregulation or no change in hepatic expression was detected for Abcg5 and Abcg8, respectively, in liver of Abca1(-/-) mice. Although, intestinal Abcg5 and Abcg8 expression levels were increased in Abca1(-/-) mice, this increase was not significant. In addition, the fecal neutral steroid excretion was not changed significantly (27) in these mice, indicating that intestinal cholesterol absorption was not changed. Interestingly, the high output of biliary cholesterol in Srebp2 transgenic mice (21-fold increase) and diosgenin-fed mice (16-fold increase) did not affect the intestinal expression of Abcg5 and Abcg8 in the respective models (Figure 1b). To our knowledge no data is available on the intestinal cholesterol absorption in Srebp2 transgenic mice. In contrast, dietary diosgenin has been reported to inhibit intestinal cholesterol uptake (32). Since Berge et al. (5) have shown that dietary cholesterol increases intestinal expression of both Abcg5 and Abcg8, an increase in intestinal expression of both genes might have been expected in Srebp2 transgenic and diosgenin-fed mice, on basis of the massively enhanced delivery of biliary cholesterol. This amount is probably more than the amount of cholesterol ingested on a 2% cholesterol diet. This may indicate that dietary and biliary cholesterol in the intestinal lumen are two separate pools which behave differently in regulation of Abcg5/Abcg8 expression.

73 Chapter 2

In conclusion, we found a significant correlation between the hepatic expression of Abcg5 and Abcg8 and biliary cholesterol output across different (genetically- modified) strains of mice subjected to different treatments that alter biliary cholesterol secretion. Interestingly, no major differences in intestinal expression of Abcg5 and Abcg8 were found in the investigated mouse models, despite the large amount of biliary cholesterol delivered into the intestine of especially the Srebp2 transgenic mice and the diosgenin-fed mice. Our data on hepatic Abcg5/Abcg8 expression and biliary cholesterol secretion are in line with the observations made in the ABCG5/ABCG8 transgenic (17) and Abcg5/Abcg8 knockout mice (18) and suggest that Abcg5 and Abcg8 indeed play an important role in regulation of biliary cholesterol secretion. However, the fact that dietary diosgenin strongly induces cholesterol secretion without affecting Abcg5 and Abcg8 expression suggests that other parallel routes of biliary cholesterol secretion may be operational. The existence of more than one secretory pathway for cholesterol into bile has been suggested previously in studies with diosgenin-fed rats (33).

Figure 4: Phospholipid-independent relation between hepatic expression levels of Abcg5 and Abcg8 and biliary cholesterol output in various mouse models. Abcg5 (closed symbols) and Abcg8 (open symbols) expression levels were normalized to Abcb4 expression levels. The normalized Abcg5 and Abcg8 values were plotted against the normalized biliary cholesterol output (cholesterol/phospholipid ratio) to determine the relation of hepatic Abcg5 and Abcg8 expression and the biliary cholesterol output corrected for the influence of differences in phospholipid secretion in the various models. Compared to the relation on Figure 3, data for Srebp2 transgenic mice (■) now follow the linear relation between Abcg5 and Abcg8 expression and biliary cholesterol secretion (r = 0.61, p = 0.001 for Abcg5 and r = 0.71, p= 0.001 for Abcg8) whereas the diosgenin condition still deviates.

74 Abcg5/Abcg8 and biliary cholesterol secretion

Acknowledgments:

This work was supported by grants 902-23-193 and 902-23-262 from the Netherlands Organization for Scientific Research (NWO), grant WS00-46 from the Dutch Society for Digestive Diseases (MLDS), and grant CEZ: L17/98:00023001 from the Ministry of Health, Czech Republic.

75 Chapter 2

REFERENCES

1. Kuipers F, Oude Elferink RP, Verkade HJ, Groen AK. Mechanisms and (patho)physiological significance of biliary cholesterol secretion. Subcell Biochem 1997; 28:295-318. 2. Hauser H, Dyer JH, Nandy A, Vega MA, Werder M, Bieliauskaite E et al. Identification of a receptor mediating absorption of dietary cholesterol in the intestine. Biochemistry 1998; 37(51):17843-17850. 3. Kramer W, Glombik H, Petry S, Heuer H, Schafer H, Wendler W et al. Identification of binding proteins for cholesterol absorption inhibitors as components of the intestinal cholesterol transporter. FEBS Lett 2000; 487(2):293-297. 4. Werder M, Han CH, Wehrli E, Bimmler D, Schulthess G, Hauser H. Role of scavenger receptors SR-BI and CD36 in selective sterol uptake in the small intestine. Biochemistry 2001; 40(38):11643-11650. 5. Berge KE, Tian H, Graf GA, Yu L, Grishin NV, Schultz J et al. Accumulation of dietary cholesterol in sitosterolemia caused by mutations in adjacent ABC transporters. Science 2000; 290(5497):1771-1775. 6. Lee MH, Lu K, Hazard S, Yu H, Shulenin S, Hidaka H et al. Identification of a gene, ABCG5, important in the regulation of dietary cholesterol absorption. Nat Genet 2001; 27(1):79-83. 7. Lu K, Lee MH, Hazard S, Brooks-Wilson A, Hidaka H, Kojima H et al. Two genes that map to the STSL locus cause sitosterolemia: genomic structure and spectrum of mutations involving sterolin-1 and sterolin-2, encoded by ABCG5 and ABCG8, respectively. Am J Hum Genet 2001; 69(2):278-290. 8. Bhattacharyya AK, Connor WE. Beta-sitosterolemia and xanthomatosis. A newly described lipid storage disease in two sisters. J Clin Invest 1974; 53(4):1033-1043. 9. Gregg RE, Connor WE, Lin DS, Brewer HB, Jr. Abnormal metabolism of shellfish sterols in a patient with sitosterolemia and xanthomatosis. J Clin Invest 1986; 77(6):1864-1872. 10. Salen G, Shefer S, Nguyen L, Ness GC, Tint GS, Shore V. Sitosterolemia. J Lipid Res 1992; 33(7):945-955. 11. Lutjohann D, Bjorkhem I, Beil UF, von Bergmann K. Sterol absorption and sterol balance in phytosterolemia evaluated by deuterium-labeled sterols: effect of sitostanol treatment. J Lipid Res 1995; 36(8):1763-1773. 12. Miettinen TA. Phytosterolaemia, xanthomatosis and premature atherosclerotic arterial disease: a case with high plant sterol absorption, impaired sterol elimination and low cholesterol synthesis. Eur J Clin Invest 1980; 10(1):27-35. 13. Remaley AT, Bark S, Walts AD, Freeman L, Shulenin S, Annilo T et al. Comparative genome analysis of potential regulatory elements in the ABCG5-ABCG8 gene cluster. Biochem Biophys Res Commun 2002; 295(2):276-282. 14. Lu K, Lee MH, Yu H, Zhou Y, Sandell SA, Salen G et al. Molecular cloning, genomic organization, genetic variations, and characterization of murine sterolin genes Abcg5 and Abcg8. J Lipid Res 2002; 43(4):565-578. 15. Repa JJ, Berge KE, Pomajzl C, Richardson JA, Hobbs H, Mangelsdorf DJ. Regulation of ATP- binding cassette sterol transporters ABCG5 and ABCG8 by the liver X receptors alpha and beta. J Biol Chem 2002; 277(21):18793-18800. 16. Graf GA, Li WP, Gerard RD, Gelissen I, White A, Cohen JC et al. Coexpression of ATP- binding cassette proteins ABCG5 and ABCG8 permits their transport to the apical surface. J Clin Invest 2002; 110(5):659-669. 17. Yu L, Li-Hawkins J, Hammer RE, Berge KE, Horton JD, Cohen JC et al. Overexpression of ABCG5 and ABCG8 promotes biliary cholesterol secretion and reduces fractional absorption of dietary cholesterol. J Clin Invest 2002; 110(5):671-680.

76 Abcg5/Abcg8 and biliary cholesterol secretion

18. Yu L, Hammer RE, Li-Hawkins J, von Bergmann K, Lutjohann D, Cohen JC et al. Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in biliary cholesterol secretion. Proc Natl Acad Sci U S A 2002; 99(25):16237-16242. 19. Horton JD, Shimomura I, Brown MS, Hammer RE, Goldstein JL, Shimano H. Activation of cholesterol synthesis in preference to fatty acid synthesis in liver and adipose tissue of transgenic mice overproducing sterol regulatory element-binding protein-2. J Clin Invest 1998; 101(11):2331-2339. 20. Hamon Y, Broccardo C, Chambenoit O, Luciani MF, Toti F, Chaslin S et al. ABC1 promotes engulfment of apoptotic cells and transbilayer redistribution of phosphatidylserine. Nat Cell Biol 2000; 2(7):399-406. 21. Oude Elferink RP, Ottenhoff R, van Wijland M, Frijters CM, van Nieuwkerk C, Groen AK. Uncoupling of biliary phospholipid and cholesterol secretion in mice with reduced expression of mdr2 P-glycoprotein. J Lipid Res 1996; 37(5):1065-1075. 22. Plosch T, Kok T, Bloks VW, Smit MJ, Havinga R, Chimini G et al. Increased hepatobiliary and fecal cholesterol excretion upon activation of the liver X receptor is independent of ABCA1. J Biol Chem 2002; 277(37):33870-33877. 23. Nibbering CP, Groen AK, Ottenhoff R, Brouwers JF, vanBerge-Henegouwen GP, van Erpecum KJ. Regulation of biliary cholesterol secretion is independent of hepatocyte canalicular membrane lipid composition: a study in the diosgenin-fed rat model. J Hepatol 2001; 35(2):164- 169. 24. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987; 162(1):156-159. 25. Oude Elferink RP, Ottenhoff R, van Wijland M, Smit JJ, Schinkel AH, Groen AK. Regulation of biliary lipid secretion by mdr2 P-glycoprotein in the mouse. J Clin Invest 1995; 95(1):31-38. 26. Smit JJ, Schinkel AH, Oude Elferink RP, Groen AK, Wagenaar E, van Deemter L et al. Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a complete absence of phospholipid from bile and to liver disease. Cell 1993; 75(3):451-462. 27. Groen AK, Bloks VW, Bandsma RH, Ottenhoff R, Chimini G, Kuipers F. Hepatobiliary cholesterol transport is not impaired in Abca1-null mice lacking HDL. J Clin Invest 2001; 108(6):843-850. 28. Endo A. The discovery and development of HMG-CoA reductase inhibitors. J Lipid Res 1992; 33(11):1569-1582. 29. Groen AK, Elferink RP, Tager JM. Control analysis of biliary lipid secretion. J Theor Biol 1996; 182(3):427-436. 30. Nibbering CP. Lipid composition of hepatocyte canalicular membrane. Relevance to bile formation. University of Utrecht, 2001. 31. Vaisman BL, Lambert G, Amar M, Joyce C, Ito T, Shamburek RD et al. ABCA1 overexpression leads to hyperalphalipoproteinemia and increased biliary cholesterol excretion in transgenic mice. J Clin Invest 2001; 108(2):303-309. 32. Cayen MN, Dvornik D. Effect of diosgenin on lipid metabolism in rats. J Lipid Res 1979; 20(2):162-174. 33. Thewles A, Parslow RA, Coleman R. Effect of diosgenin on biliary cholesterol transport in the rat. Biochem J 1993; 291 ( Pt 3):793-798.

Chapter 3

A mouse model of sitosterolemia:

absence of Abcg8/sterolin-2 results in

failure to secrete biliary cholesterol

Eric L Klett, Kangmo Lu, Astrid Kosters, Edwin Vink, Mi-Hye Lee, Michael

Altenburg, Sarah Shefer, Ashok K Batta, Hongwei Yu, Jianliang Chen,

Richard Klein, Norbert Looije, Ronald Oude-Elferink, Albert K Groen,

Nobuyo Maeda, Gerald Salen, and Shailendra B Patel

Modified from: A mouse model of sitosterolemia: absence of

Abcg8/sterolin-2 results in failure to secrete biliary cholesterol.

Published in: BioMed Central Medicine 2004, 2:5.

Chapter 3

80 Characterization of the Abcg8 knockout mouse

ABSTRACT

Mutations in either of two genes comprising the STSL locus, ATP-binding cassette (ABC)-transporters ABCG5 (encoding sterolin-1) and ABCG8 (encoding sterolin-2), result in sitosterolemia, a rare autosomal recessive disorder of sterol trafficking characterized by increased plasma plant sterol levels. Based upon the genetics of sitosterolemia, ABCG5/sterolin-1 and ABCG8/sterolin-2 are hypothesized to function as obligate heterodimers. No phenotypic difference has yet been described in humans with complete defects in either ABCG5 or ABCG8. These proteins, based upon the defects in humans, are responsible for regulating dietary sterol entry and biliary sterol secretion. In order to mimic the human disease, we created, by a targeted disruption, a mouse model of sitosterolemia resulting in Abcg8/sterolin-2 deficiency alone. Homozygous knockout mice are viable and exhibit sitosterolemia. Mice deficient in Abcg8 have significantly increased plasma and tissue plant sterol levels (sitosterol and campesterol) consistent with sitosterolemia. Abcg8 deficient mice had an impaired ability to secrete cholesterol into bile, but still maintained the ability to secrete sitosterol. We also report an intermediate phenotype in the heterozygous Abcg8(+/-) mice that are not sitosterolemic, but have a decreased level of biliary sterol secretion relative to wild-type mice. In conclusion, these data indicate that Abcg8/sterolin-2 is necessary for biliary sterol secretion and that loss of Abcg8/sterolin-2 has a more profound effect upon biliary cholesterol secretion than sitosterol. Since biliary sitosterol secretion is preserved, although not elevated in the sitosterolemic mice, this observation suggests that mechanisms other than by Abcg8/sterolin-2 may be responsible for its secretion into bile.

81 Chapter 3

INTRODUCTION

Absorption of dietary cholesterol from the intestine is an important part of cholesterol homeostasis and represents the initial step that allows dietary cholesterol to exert its metabolic effects. A typical western diet contains relatively equal amounts of cholesterol and non-cholesterol sterols, mainly plant sterols, of which about 55% of the dietary cholesterol is absorbed and retained compared to ~1% of the dietary non- cholesterol sterols (1-3). Schoenheimer recognized more than 75 years ago that only cholesterol, but not non-cholesterol sterols, is absorbed in the intestine, although the exact molecular mechanisms by which preferential cholesterol absorption occurs has not been fully elucidated (4). Similarly, although the liver secretes free cholesterol into bile, it can preferentially excrete non-cholesterol sterols into bile and the mechanism(s) of this process has yet to be elucidated as well. Only recently, through the study of a rare human disease, have clues to this process been revealed. Sitosterolemia (MIM 210250, also known as phytosterolemia) is a rare autosomal, recessively inherited disorder characterized by elevated blood and tissue plant sterol levels (5). Affected individuals can develop tendon and/or tuberous xanthomas, hemolytic episodes, arthralgias, arthritis, and premature atherosclerosis (6;7). Sitosterolemic patients have diagnostically elevated plasma plant sterol levels (for example, sitosterol, campesterol, stigmasterol, and avenosterol) and their 5-saturated stanol metabolites, particularly sitostanol, with normal or only moderately increased cholesterol levels. Clinical studies have shown that affected individuals hyperabsorb all dietary sterols and have lost the ability to excrete sterols into bile (8;9) . Infusion of sitosterol and cholesterol into normal individuals leads to a rapid and preferential excretion of sitosterol into bile, but in sitosterolemic individuals biliary sterol secretion is almost absent (7;9). Previous studies on sitosterolemia have suggested a defect involving a putative sterol ’transporter’ expressed in the intestinal brush border and/or the hepatic canalicular membrane (10;11). Genetic analyses of sitosterolemia pedigrees allowed the mapping of the STSL locus to human chromosome 2p21, between D2S2294 and D2S2298 (12;13). By using positional cloning procedures or by screening for genes induced by exposure to LXR agonists, two groups identified not one but two genes, ABCG5 and ABCG8, which encode the proteins sterolin-1 and sterolin-2, mutations of which cause sitosterolemia (14-16). Interestingly, complete mutation in either ABCG5 alone or ABCG8 alone is not only necessary, but also sufficient to cause the disease (15). To date, no patient with sitosterolemia has been identified with mutations in both genes. Based upon these data, and the similarity of the clinical and biochemical phenotype in patients with mutation in either gene, sterolin-1 and sterolin-2 are hypothesized to function as obligate heterodimers. This is also supported by the fact that each of these proteins is a ‘half-transporter’, containing six transmembrane domains, and not the classical 12 transmembrane characteristic of functional ABC transporters. The exact function of these two proteins still remains unknown but recent studies have shown that overexpression of ABCG5/ABCG8 in a transgenic mouse model results in an increased biliary cholesterol concentration and a 50% reduction in the fractional absorption of dietary cholesterol (17). It has been suggested that ABCG5 and ABCG8 act as mutual chaperones for both maturation and correct apical targeting. Co-

82 Characterization of the Abcg8 knockout mouse expression of both was required for apical trafficking in a polarized cell line, as well in vivo using Abcg5/Abcg8 double-knockout mice (18;19). However, no functional assay has yet been developed to demonstrate whether or not the two half-transporters function as homo- or heterodimers and whether they selectively pump sterols. Likewise, the cellular localization of these two proteins has yet to be shown in a model deficient in either Abcg5 or Abcg8 alone. A mouse model disrupting both Abcg5 and Abcg8 simultaneously results in a phenotype similar to that of the human disease (20). However, it is important to point out that the human disease is caused by complete mutation in one or the other gene, but not both simultaneously. We hypothesized that disruption of only one of the half-transporters would result in sitosterolemia and selective loss of either sterolin may show a differential effect on the biliary secretion of sterols or intestinal absorption of sterols. In order to test this hypothesis, we report a mouse model that has a selective genetic mutation of Abcg8. Mice homozygous for Abcg8 loss exhibit many of the characteristics of the human disease sitosterolemia. In addition, we report studies of biliary sterol secretion that show that despite forced secretion, Abcg8-deficient animals cannot secrete cholesterol into bile, although sitosterol secretion seemed unaffected.

83 Chapter 3

Methods

Targeting vector construction and generation of knockout mice A mouse genomic bacterial artificial chromosome (BAC) library (CitbCJ7, ES cell line/129Sv, Research Genetics, Inc., Huntsville, AL, USA) was screened by using primers designed from the sequences of mouse Abcg5 and Abcg8 cDNA as previously reported (21). A positive BAC clone was used as a template to amplify genomic DNA fragments of Abcg8. Long-fragment polymerase chain reaction (PCR) was performed using Expanded Long Template PCR system kit (Roche Applied Science, Indianapolis, IA, USA). An approximately 4.5 kb ‘long-arm’ genomic fragment containing partial exon 1 to partial exon 3 was inserted into the Pml I restriction-cloning site A of OSDUPDEL vector. The ‘short-arm’ genomic fragment, containing partial exon 4 to partial exon 6, was cloned into the Not I-Kpn I of cloning site B. Homologous targeting would result in complete intron 3, partial exon 3 and partial exon 4 replacement by the neomycin-resistance cassette, resulting in the disruption of the ABC Walker A motif (Figure 1a). ES cells (129/SvEvTac-cell line) were electroporated with the linearized targeting vector DNA and cultured on sub- confluent embryonic fibroblasts. Transfected cell colonies were selected by culturing cells in medium containing 200 µg/mL G418 (Life Technologies, Rockville, MD, USA). The ES cells were screened for homologous recombination by PCR with the forward primer, neoF (5’- GGGTCGTTTGTTCGGATCAA- 3’) from neo cassette, and reverse primer intron 6R (5’-ACCAGTTGGTCCTAGCTCGA-3’), which is located outside the targeting construct in mouse Abcg8 intron 6. Positively targeted ES cell clones were confirmed by Southern blotting, using ES cell DNA digested by BamHI and a probe comprising of a 562 bp PCR fragment from partial intron 2 and exon 3 of Abcg8 gene. Positively targeted ES cells were microinjected into C57BL6 blastocysts and transplanted into pseudopregnant recipients. Five highly chimeric mice (agouti coat color, three males and two females) were isolated and bred with C57BL/6J mice to generate germ-line transmission heterozygous mice of Abcg8 gene disruption. Heterozygous offspring mice were backcrossed to C57BL/6J mice (n > 5) to produce a disrupted line and inter-crossed to generate knockout mice.

Animals and diets All mice were maintained on a standard rodent chow (Harlan Teklad mouse/rat diet LM-485) which contained 61 mg/kg cholesterol, 31 mg/kg campesterol, and 105 mg/kg sitosterol, given free access to water and maintained at 25°C with a 12-h light, 12-h dark cycle. All animals were housed in the facilities for laboratory animals provided by the Division of Laboratory Animal Resources ACLAM. The Institutional Animal Care and Research Advisory Committee at Medical University of South Carolina approved all experiments.

Genotyping by PCR Mouse tail DNA was isolated and purified by cutting approximately 0.5 cm of mouse tail and digesting it in 500 µl lysis buffer (50 mM Tris-HCl, pH8.0, 100mM EDTA, 125 mM NaCl, 1% SDS, 200 µg Proteinase K) with rocking overnight at 55o C. 200

84 Characterization of the Abcg8 knockout mouse

µl saturated NaCl was added into digested solution with vigorous shaking for at least 60 seconds. Mixed solution was spun down at maximum speed in top micro- centrifuge for 20 min. The supernatant was transferred to a new tube with equal volume 100% EtOH and mixed by inversion. The DNA pellet was washed in 70% EtOH and resuspended in 100-150 µl TE buffer. UV spectrophotometry and electrophoresis were used to analyze the quality and quantity of the genomic DNA. Genotyping was performed by multiplex PCR reaction using three separate primers (two Abcg8 gene specific primers, mg8-in3F 5’- CCCAATGATGAATGAGACGCT- 3’, mg8-R9 5’-TTTGTCACGCTGGGCCTGG-3’ and neoF for identification of Abcg8 target status). The PCR reaction consisted of 1x PCR buffer (1.5 mM MgCl2, 16 mM (NH4)2SO4, 0.1mM dNTPs, 67 mM Tris-HCl (pH8.8)) 1µM of each primer, water and 1.0 units of Taq polymerase. The reactions were cycled as follows: 94°C for 30 sec, 60°C for 30 sec, 72°C for 1 min for 35 cycles. The PCR products were identified by electrophoresis.

Southern blot analysis To confirm PCR results, DNAs were digested with Bam HI, subjected to electrophoresis in a 0.6% agarose gel and transferred to nylon membrane. Southern blot filters were hybridized with a 562 bp PCR fragment from partial intron 2 and exon 3 of Abcg8 32 P-randomly- labeled probe as previously described (22).

Northern blot analysis Isolation of liver and intestinal total RNA from Abcg8(+/+), Abcg8(+/-) and Abcg8(- /-) mice and Northern blot analyses were performed as previously described (23). The probe for Abcg5 was 1964 bp (nt 136-2099, GeneBank™ accession no. AH011511) and the probe for Abcg8 was 2019 bp (nt 103-2126, GeneBank™ accession no. AH011518).

Reverse Transcription (RT)-PCR To confirm that there was no alternative splicing of the disrupted allele, RT-PCR was performed on cDNAs of pooled mouse liver. Briefly, samples of total RNA (0.5 µg) from pooled mouse livers (n = 4) were reverse transcribed according to the SuperScript_First-Strand Synthesis System (Invitrogen, Carlsbad, CA, USA) using random hexamers in a final total reaction volume of 20 µl. RT-PCR was performed using primers located outside of the targeted region: F1 (CCTCAGCTGGTGAGGAGGTG) with R1 (GATGGAGAAGGTGAAGTTGCC), F2 (ATTTCCAATGACTTCCGGGAC) with R1 and F3 (CTGGAAGACGGGCTGTACACT) with R1, to produce expected product lengths of 1449, 654 and 429 bp respectively in wild-type cDNA.

Quantitative RT-PCR Primers were based upon previously published primer sets (24-26) or designed using MacVector, (Table 1). Samples of total RNA (0.5 µg) from pooled mouse livers (n = 4) were reverse transcribed according to the SuperScript™First-Strand Synthesis System (Invitrogen, Carlsbad, CA, USA) using random hexamers with a final total reaction volume of 20 µl. Quantitative RT-PCR was performed on a PE Biosystems

85 Chapter 3

Table 1: Oligonucleotide primers used for quantitative RT-PCR

Target gene Primer sequence Length of GenBank amplicon accession no. Abcg5 Forward: 5'-AGGTCATGATGCTAGATGAGC-3' 260 bp AH011511 Reverse: 5'-CAAAGGGATTGGAATGTTCAG-3' Abcg8 Forward: 5'-CTCCTCGGAAAGTGACAACAG-3' 190 bp AH011518 Reverse: 5'-TAGATTTCGGATGCCCAGCTC-3' Hmgr Forward: 5'-CCGGCAACAACAAGATCTGTG-3' 114 bp BB664708 Reverse: 5'-ATGTACAGGATGGCGATGCA-3' Cyp7a1 Forward: 5'-CAGGGAGATGCTCTGTGTTCA-3' 121 bp NM_007824 Reverse: 5'-AGGCATACATCCCTTCCGTGA-3' Abca1 Forward: 5'-CCCAGAGCAAAAAGCGACTC-3' 89 bp NM_013454 Reverse: 5'-GGTCATCATCACTTTGGTCCTTG-3' Mdr2 Forward: 5'-GCAGCGAGAAACGGAACAG-3' 64 bp NM_008830 Reverse: 5'-GGTTGCTGATGCTGCCTAGTT-3' LXRα Forward: 5'-GCTCTGCTCATTGCCATCAG-3' 79 bp AF085745 Reverse: 5'-TGTTGCAGCCTCTCTACTTGGA-3' Srebp-1c Forward: 5'-GGAGCCATGGATTGCACATT-3' 103 bp BI656094 Reverse: 5'-CCTGTCTCACCCCCAGCATA-3' Srebp-2 Forward: 5'-CTGCAGCCTCAAGTGCAAAG-3' 119 bp AF374267 Reverse: 5'-CAGTGTGCCATTGGCTGTCT-3' Cyclophilin Forward: 5'-AAGTTCCATCGTGTCATCAAGGAC-3' 173 bp M60456 Reverse: 5'-CCATTGGTGTCTTTGCCTGC-3'

GeneAmp®_ 5700 sequence Detection System (Forest City, CA, USA). Standard reaction volume was 10 µl containing 1X QuantiTect SYBR Green PCR master mix (Qiagen, Valencia, CA, USA), 0.002 U AmpErase UNG enzyme (PE Biosystems, Forest City, CA, USA), 0.7 µl of cDNA template from reverse transcription reaction as above and 100-500 nM of oligonucleotide primers. Initial steps of RT-PCR were two minutes at 50°C for UNG activation, followed by a 15 minute hold at 95°C. Cycles (n = 40) consisted of a 15 second melt at 95°C, followed by a 1 minute annealing/extension at 60°C. The final step was a 60°C incubation for 1 minute. At the end of the run, samples were heated to 95°C with a ramp time of 20 minutes to construct dissociation curves to ensure that single PCR products were obtained. All reactions were performed in triplicate. Threshold cycle (CT) analysis of all samples was set at 0.5 relative fluorescence units. The relative quantities of message of genes of interest from the mouse liver samples used in real-time RT-PCR were normalized to cyclophilin to compensate for variations in input RNA amounts. The data were analyzed using the comparative threshold cycle method (CT). Briefly, the CT values are averaged, from the triplicates defining a ∆-CT value calculated by taking the average CT of the gene of interest and subtracting it from the average CT of cyclophilin. The ∆-CT was calculated by subtracting the average ∆-CT(calibrator)

86 Characterization of the Abcg8 knockout mouse

values from the ∆-CT(sample). The relative quantification was then calculated by the expression 2 -Average ∆-CT. The mRNA quantity for the calibrator (wild type) was expressed as 1 and all other quantities were expressed as a fold difference relative to the calibrator (wild type).

Plasma lipid analysis by fast protein liquid chromatography Following 16 hrs of fasting, blood samples (n = 3) from each of the Abcg8(+/+), Abcg8(+/-) and Abcg8(-/-) mice were collected from the retro-orbital venous plexus using heparinized capillary tubes under isoflurane anesthesia, and placed into precooled tubes containing 10 µl of 0.5 M EDTA. Equal volumes of plasma from each genotype were pooled and 100 µL of the pooled sample were injected and fractionated by fast protein liquid chromatography (FPLC) using a Superose 6 HR10/30 column (Pharmacia Biotech Inc., Piscataway, NJ, USA) and analyzed as described (27).

Sterol composition of plasma and tissues Following a four-hour fast of 12-week-old mice fed on regular rodent chow diet; blood and tissues were collected under isofluorane anesthesia from each of the Abcg8(+/+), Abcg8(+/-) and Abcg8(-/-) mice (n = 3 for each group). Blood was collected from the retro-orbital venous plexus by heparinized glass tube. The animals were sacrificed by cervical dislocation for tissue collection. Plasma (100 µl) was saponified in 1 N NaOH for one hour, 1.5 mL water added and sterols extracted with three sequential portions of 1.5 mL ethyl acetate, containing 70 µg 5α-cholestane as an internal standard, pooled and dried. Mouse tissues (liver, spleen and brain) were weighed, homogenized in 1 mL phosphate buffer saline (PBS) with a dounce homogenizer (15 strokes at 500 rpm) and a small aliquot of the whole homogenate assayed for protein concentration. Aliquots for sterol analysis from whole tissue homogenates were extracted as described above. Dried sterol samples were derivatized as trimethylsilylethers, redissolved in 10 µL hexane and 2 µL samples were injected into a capillary column (26 m length, 0.32 mm ID, 0.45 mm OD) coated with liquid CpWAX 57 CB (Chrompak, Bridgewater, NJ, USA) in a Hewlett-Packard Gas Chromatograph equipped with a flame ionization detector (28). Concentrations of plasma and tissue sterols were reported as mg/dL and µg /g wet weight tissue, respectively.

Polyclonal antibody production Three separate polyclonal anti-Abcg5/sterolin-1 antibodies have been raised as previously described (20;29;30). In experiments, anti-Abcg5/sterolin-1 antibodies are labeled as follows: 1) SC - from the Patel group, 2) AMC - from the AMC Liver Center group, and 3) UTSW - from the Hobbs group.

Membrane protein preparations Total membranes were prepared by taking approximately 500 mg of liver tissue cut into small pieces and homogenized in ice cold lysis buffer (5 mM Tris-pH7.5, 250 mM sucrose with protease inhibitors) by a dounce homogenizer times 10 strokes. Samples were then subjected to centrifugation - 1300g for 10 minutes at 4°C. The

87 Chapter 3 supernatant was saved and the pellet was resuspended and again subjected to dounce homogenization times 10 strokes then centrifuged 1000g for 10 minutes at 4°C. This step was repeated twice each time with the supernatant being collected and kept on ice. The supernatants were then pooled and subjected to ultracentrifugation at 100,000g for 60 minutes at 4°C. The supernatant was removed and the pellet was resuspended in lysis buffer. Plasma membranes were prepared as previously described (31). Protein sample concentrations were then determined by Bio-Rad protein colorimetric assay per manufacturer’s protocol (BioRad, Hercules, CA, USA). 50 µg of membrane proteins were then resolved on 7.5% SDS acrylamide gel.

Immunoblotting Proteins resolved by SDS-PAGE were transferred to nitrocellulose membranes. Membranes were then blocked for one hour in 5% dry milk in PBS-T (Phosphate Buffered saline and 0.1% Tween 20). Blots were then probed with primary antibody against Abcg5 in 5% milk in PBS-T overnight at 4°C. The blot was then washed three times for five minutes in TBS-T (Tris Buffered Saline/0.1% Tween-20) with 150 mM NaCl, and secondarily stained with goat-anti-rabbit conjugated HRP 1:10,000 dilution in 5% milk in PBS-T for one hour. The blot was again washed three times for five minutes in TBS-T with 150 mM NaCl then covered in Western Lightning® Chemiluminescence Reagent Plus (PerkinElmer Life Sciences, Inc. Boston, MA, USA), wrapped in plastic, exposed to film and developed.

Immunohistochemical analysis Snap-frozen liver and intestine tissue were cut to produce 8 µm thick frozen sections, air-dried for 30 minutes onto glass slides and stored at -80°C until required. The slides were stained with hematoxylin, rinsed three times with PBS, fixed for 10 min with cooled methanol at -20°C and then rinsed three times with PBS. Slides for antibody staining were initially blocked in PBS/0.1M glycine/10% goat serum for 60 min at room temperature then incubated with anti-sterolin-1 antibody (1:15 dilution) overnight at 4°C. The slides were washed with 1 x PBS and incubated with secondary antibody (goat-anti-rabbit IgG conjugated with rhodamine, 1:1000 dilution) for 30 min at room temperature, washed and then observed under an Olympus BX-5 confocal microscope with Fluoview. The sections stained at the AMC Liver Center were fixed in 100% acetone for 30 min at room temperature, blocked in a solution of PBS/0.05% Tween-20/5% goat serum (GS) for one hour, then incubated with Anti-sterolin-1 (1:40 dilution) diluted in PBS/Tween/GS, for one hour. Thereafter, slides were washed 3 x 10 min in PBS/Tween and the secondary antibody (goat-anti-rabbit Alexa 488) was applied in 1:1000 dilution in PBST/GS for one hour at room temperature. After washing for 3 x 10 min the sections were mounted in Dapi/Dapco solution. Fluorescence microscopy was done with a Leica DM RA2 microscope equipped with a Leica DC350F photo camera. The pictures were analyzed and overlaid using FW4000 software (Leica).

88 Characterization of the Abcg8 knockout mouse

Transfection and immunostaining of COS-1 cells COS-1 cells were transiently transfected with pCMV-mouse Abcg5 and pCMV- mouse Abcg8 expression constructs using the Qiagen SuperFect reagent per protocol (Valencia, CA, USA). Briefly, COS-1 cells were seeded onto a six-well plate the day prior to transfection to generate 60% confluence when grown at 37°C and 5% CO2 in DMEM supplemented with 10% FBS, 100 U/ml penicillin, 100 µg/ml streptomycin and 1X glutamine. On the day of transfection, 2 µg of DNA was mixed with Qiagen SuperFect reagent and incubated for 10 minutes. This mixture was then added to serum-free media and placed on the cells to incubate for two hours. The cells were washed once with 1x PBS and fresh media was added. The transfected cells were then incubated for 48 hours to ensure expression and subsequently fixed with a 1:1 mixture of acetone:methanol. In preparation for immunostaining, cells were blocked with 2% goat serum in PBS for 30 minutes, then incubated with 1:50 dilution of primary antibody anti-Abcg5 in 2% goat serum-PBS for 1.5 hours, and subsequently incubated with secondary rhodamine anti-rabbit IgG antibody for 30 minutes. Cells were then observed under an Olympus BX-5 confocal microscope with Fluoview.

Dynamic biliary lipid collection and analysis Mice were anaesthetized by intraperitoneal injection of 1 mL/kg fentanyl/fluanisone and 10 mg/kg Diazepam. The abdomen was opened and, after distal ligation of the bile duct, the gallbladder was cannulated. Bile sampling started directly after cannulation and was collected for 10 min. Bile flow was determined gravimetrically. Biliary bile salt, sterol and phospholipid concentrations were determined as described previously (32). To determine maximal secretion rates of biliary lipid secretion, bile was diverted for 90 min to deplete the endogenous bile salt pool. Subsequently, tauroursodeoxycholate (Sigma Chemical Co., MO, USA) dissolved in PBS was infused into the jugular vein in stepwise increasing rates from 600-1800 nmol/min/100g body weight. Bile was collected in 10 min fractions and analyzed for bile salt and lipid content. In separate experiments, following distal ligation of the bile duct and cannulation of gallbladder, bile was diverted for 30 minutes while mice were infused with sterile PBS. Subsequently, the mice were infused continuously with 1200 nmol/min/100g body weight of tauroursodeoxycholate and two 30-minute fractions were collected. Sterol analyses of bile were performed by GC analysis as described above.

Assay of HMG-CoA and cholesterol 7α-hydroxylase enzyme activity Mouse liver microsomes were prepared by differential centrifugation (33). Briefly, 0.1-0.2g liver was homogenized in a Potter-Elvjhem homogenizer with five volumes of buffer (0.25 M sucrose, 0.1 M Tris, 0.1 mM disodium EDTA, 0.1 mM DTT, pH 7.4). Microsomes were isolated by differential centrifugation (10,000g to 100,000g). The pellets were washed and resuspended in storage buffer (0.1 M dipotassium phosphate, 0.05 M KCl, 1 mM DTT, 5 mM disodium EDTA, 20% glycerol, pH 7.4) at 25-30 mg protein/ml. Protein concentrations were determined according to the method of Lowry et al. (34). The activity of cholesterol 7 -hydroxylase (EC 1.14.12.17) was measured by anisotope incorporation method according to Shefer et al. (35) with some modifications. The reaction mixture (final volume 0.5 ml)

89 Chapter 3

consisted of potassium phosphate buffer (100 mM K2HPO4, 0.1 mM EDTA, 5 mM DTT, 30 mM nicotinamide, pH 7.4), [14C]-cholesterol (5 × 105 dpm) solubilized in 50 µl of 25% (wt/vol) β-cyclodextrin (final concentration 0.8%), and 50-200 µg of microsomal protein. The reaction was initiated by the addition of NADPH or an NADPH-generating system (3.4 mM NADP+, 30 mM glucose-6-phosphate, 0.3 U of glucose-6-phosphate dehydrogenase) and continued for 15 min at 37o C. The reaction was stopped with 0.5 ml of 1 N KOH, 5 µg of butylated hydroxytoluene, and 10 µl of ethanolic potassium hydroxide. [3H]7α-hydroxycholesterol (1 x104 dpm/5 µg) was added as an internal recovery standard. After saponification at 37o C for one hour, sterols were extracted twice with 3 ml of n-hexane and the extracts were evaporated to dryness under nitrogen. The residue was dissolved in 0.3 ml of n-hexane: 2-propanol (97.3 vol/vol) and applied to a silica column (500 mg; sep-pak, by 4 ml of n- hexane:2-propanol (97.3 vol/vol)). 7α-hydroxycholesterol was eluted with 3 mL of n- hexane:2-propanol (80:20 vol:vol) and further isolated by TLC on silica gel plates (Silica gel 60, EM Science, Gibbestown, NJ, USA) with diethyl ether, and quantified by liquid scintillation counting using Ecolume (ICN Radiochemicals Irvine, CA, USA). Assays were carried out in duplicate with correction for zero-time controls. HMG-CoA reductase (EC 1.1.1.3.4) activity was determined according to the method of Xu et al. (36) with modifications as described (32).

Statistical analysis Data are shown as means ± SD or SE as stated in the legends. The Student’s t test was used to determine the statistical significance of differences between the groups of animals. Significance was set at P values < 0.05.

90 Characterization of the Abcg8 knockout mouse

RESULTS

Generation of Abcg8/sterolin-2 deficient mice The targeting construct (Figure 1a) results in the potential disruption of normal splicing, as well as loss of some coding sequences involving exons 3 and 4. After ES cell electroporation with the linearized targeted plasmid DNA, two homologous recombinant ES clones (out of 58 ES clones screened) were identified. Blastocyst injection of these resulted in five highly chimeric mice (three males, two females). One male and one female, both from the same ES clone, showed germline transmission and the female line was used to establish a multi-generational colony bred onto a C57Bl/6J background. Heterozygous mice were fertile and gave rise to normal litter sizes. Breeding heterozygous animals led to wild type, heterozygous and homozygous knockout mice in the expected Mendelian distribution (data not shown). Although not quantitative, Northern analyses showed that while the knockout mice showed no detectable mRNA for Abcg8, expression of Abcg5 appeared unaltered (Figure 1c). To exclude the possibility of alternative splicing with the production of a non-functional but truncated Abcg8/sterolin-2 protein that may serve as a chaperone for Abcg5/sterolin- 1, RT-PCR was performed on cDNA reverse transcribed from total liver RNA from Abcg8-deficient mice. No mRNA for Abcg8/sterolin-2 was detected containing any sequences downstream of exon 4 in the Abcg8-deficient mice, whether primers were located in exons 4 and 13, exons 9 and 13 or exons 10 and 13 (Figure 1 d,e). This demonstrates that if an alternatively spliced message could potentially code for a truncated protein, it is not detectable in the Abcg8-deficient mice. The membrane spanning domains of Abcg8/sterolin-2 are encoded by exons 9-13.

Sterol levels in Abcg8/sterolin-2 deficient animals Elevated plant sterols in tissue and plasma are diagnostic of sitosterolemia. Sterol levels, as determined by gas chromatography (GC) analysis, in plasma and tissues of the Abcg8(-/-) mice are shown in Table 2. There were no differences in tissue weights between wild types, heterozygotes and knockouts. Plasma cholesterol levels of the homozygous and heterozygous mice were decreased by 52% and 26%, respectively, compared to those of wild-type mice (n = 3 all groups, Table 2). Plant sterols were almost undetectable in wild type and heterozygous mice, but were significantly elevated in Abcg8(-/-) mice. Plasma campesterol and sitosterol levels were 8- and 36- fold higher in Abcg8(-/-) mice compared to wild-type mice (8.76 ± 2.10 and 18.52 ± 5.03 mg/dL, respectively, versus 1.14 ± 0.69 and 0.50 ± 0.55 mg/dL). There was no significant difference in the plasma plant sterol levels between heterozygous and wild type mice. Liver cholesterol content of the Abcg8-/- mice was reduced by ~50% relative to wild-type liver (1202 ± 264 µg/g wet weight tissue, versus 2280 ± 310 µg/g wet weight tissue, respectively). The reduced cholesterol content was offset by a 5- fold increase in campesterol and a 22-fold increase in sitosterol (233.9 ± 48.1 and 376.3 ± 96.1 µg/g wet weight tissue, respectively) in Abcg8(-/-) mice compared to wild-type mice (52.2 ± 15.0 and 16.7 ± 8.6 µg/g wet weight tissue, respectively, Table 2). Comparing total sterol levels in showed that this was not changed between wild type and knockout animals. There were no significant differences of liver cholesterol

91 Chapter 3

Figure 1: Generation of mice deficient in Abcg8/sterolin-2. The targeted disruption strategy of Abcg8 is as shown (panel a). Southern blot analysis of BamHI digested mouse genomic DNA, probed with [32P]- randomly labelled probe resulting in a 6.0 kb band for wild type, a 2.7 kb band for homozygous and two bands of 5.9 and 2.6 kb for the heterozygote (panel b). Northern blot analysis of hepatic RNA showed a loss of Abcg8/sterolin-2 mRNA in the homozygote and decreased Abcg8/sterolin-2 mRNA in the heterozygote, although Abcg5/sterolin-1 mRNA appeared relatively unaffected in the knockout mice (panel c). Probes were approximately 1.9 kb for Abcg5 and 2 kb for Abcg8 (see Methods for more detail). RT-PCR analyses of hepatic cDNA showed no Abcg8/sterolin-2 message, downstream of exon 4 in the Abcg8-/- mice, whether primers were located in exons 4 and 13 (panel d), exons 9 and 13 or exons 10 and 13 (panel e).

92 Characterization of the Abcg8 knockout mouse

Table 2: Mouse plasma and tissue sterol analyses

Plasma (mg/dL)

Group Cholesterol Campesterol Stigmasterol β-Sitosterol

Abcg8(+/+) 73.0 ± 14 1.1 ± 0.7 ND 0.5 ± 0.5 Abcg8(+/-) 54.0 ± 10* 1.8 ± 0.3* ND 0.8 ± 0.2* Abcg8(-/-) 35.0 ± 6.0* 8.8 ± 2.1* ND 18.5 ± 5.0*

Liver (µg/g wet tissue)

Group Cholesterol Campesterol Stigmasterol β-Sitosterol Abcg8(+/+) 2280 ± 310 52.2 ± 15.0 ND 16.7 ± 8.6 Abcg8(+/-) 2460 ± 588 76.4 ± 12.3* 1.6 ± 3.3* 26.7 ± 6.4* Abcg8(-/-) 1202 ± 264* 233.9 ± 48.1* 22.7 ± 6.3* 376.3 ± 91.6*

Spleen (µg/g wet tissue)

Group Cholesterol Campesterol Stigmasterol β-Sitosterol Abcg8(+/+) 2702 ± 310 41.7 ± 7.6 15.1 ± 14.1 21.9 ± 10.9 Abcg8(+/-) 2578 ± 320 66.8 ± 18.8* 14.5 ± 16.9* 32.2 ± 6.1* Abcg8(-/-) 1779 ± 195* 353.8 ± 97.5* ND* 436.6 ± 148.5*

Brain (µg/g wet tissue)

Group Cholesterol Plant sterols Desmosterol Lathosterol Abcg8(+/+) 11301 ± 156 10.2 ± 3.9 102.0 ± 13.3 52.0 ± 0.3 Abcg8(+/-) 11846 ± 814 24.5 ± 5.5 113.7 ± 25.5 49.1 ± 4.2 Abcg8(-/-) 11846 ± 1061 63.0 ± 6.5 123 ± 18.3 56.9 ± 9.5 Animals used in these studies were 12 weeks of age, a mixture of male and female and fed a regular chow diet. *P < 0.05 for (-/-) versus (+/+) and (-/-) versus (+/-). ND, not detectable.

or plant sterol contents between Abcg8(+/+) and Abcg8(+/-) mice. Spleen sterol contents reflected the liver profiles (Table 2). No significant differences in brain sterol contents were observed, as would be expected, since the blood brain barrier is intact and prevents entry of these sterols in sitosterolemia (Table 2). There were only traces of plant sterols in the brains from knockout animals, probably reflecting blood contamination during tissue harvesting. Interestingly, the majority of the elevated tissue plant sterols are unesterified. The livers of Abcg8(+/+), (+/-) and (-/-) mice have relatively similar levels of esterified cholesterol (Figure 2a). However, there is little if any esterification of sitosterol or campesterol (Figure 2b,c) consistent with previous findings (37;38). Thus all of the expansion of tissue sterol pools is as free sterols. FPLC analyses for sterols (measured enzymatically and thus reflecting total sterols) and triglycerides were performed on plasma samples from fasted animals fed a regular chow diet. No significant differences were observed for the sterol profiles (Figure 3a), but surprisingly, the Abcg8(-/-) knockout mice had a significantly higher triglyceride level in the LDL lipoprotein fractions compared to wild type and heterozygous mice (Figure 3b). The size of this peak was variable between different littermate analyses, but is always increased in the knockout animals. Total plasma triglyceride levels of the Abcg8(-/-) mice were slightly higher (79.2 ± 14 mg/dL)

93 Chapter 3

Figure 2: Free versus esterified sterol levels in the livers of Abcg8(+/+), Abcg8(+/-) and Abcg8(-/-) mice. Sterol contents of liver extracts of 12-week-old female mice fed a regular chow diet, determined by GC analysis show that the majority of sterols in all genotypes are unesterified. Esterified cholesterol (panel a) remains relatively constant for each genotype. However, no esterified sitosterol in the livers from Abcg8(+/+) and Abcg8(+/-) mice and very little from Abcg8( -/-) mice was detected (panel b). Small amounts of esterified campesterol were detected in each of the genotypes (panel c). compared to the wild type (63.4 ± 13 mg/dL) and heterozygotes (46.6 ± 12 mg/dL, n = 3 for all genotypes). Preliminary analyses of proteins in the isolated FPLC fractions

94 Characterization of the Abcg8 knockout mouse

Figure 3: Lipid profiles of the plasma of Abcg8(+/+), Abcg8(+/-) and Abcg8(-/-) mice. Lipoproteins were separated from pooled mouse plasma samples by FPLC. Total sterols (panel a) and triglyceride (panel b) profiles of the fractions are shown. There was no difference of cholesterol profiles in the groups, but there was a small triglyceride peak in Abcg8-/- mice in fractions 21-25, corresponding to the LDL-size range, the significance of which is not known at present.

did not show any qualitative changes in Apolipoproteins B, E, AI, or AII. The significance of this triglyceride rich peak remains unclear at present.

Liver gene expression and enzyme activity change in Abcg8/sterolin-2 deficient mice To investigate the effects of a deficiency of Abcg8/sterolin-2 on the genes that regulate sterol metabolism, quantitative RT-PCR was performed looking at the expression levels of Abcg5, Abcg8, Hmgr, Cyp7a1, Abca1, Mdr2, Lxr, Srebp-1c, and Srebp-2 mRNA in the livers of mice fed a regular chow diet (Figure 4a). As expected, Abcg8 mRNA expression levels were undetectable in the Abcg8(-/-) mice and were reduced by ~50% in the heterozygous mice, relative to wild-type mice. Interestingly, by quantitative RT-PCR, the mRNA expression of Abcg5 in the knockout mice was also reduced by more than 60% compared to the wild type mice, although no changes were noted in the heterozygous mice. The results found in the knockout mice are in contrast to the results found using Northern blot hybridization. Expression of HMG- CoA reductase mRNA was decreased by ~50% and ~80% in the heterozygote and knockout mice respectively, in keeping with limited observations in human patients with this disorder (7). To verify whether the mRNA changes resulted in alteration of the enzyme activity changes, liver samples were analyzed for HMG-CoA reductase activity and Cyp7a1 activity (Figure 4b). HMG-CoA reductase activity was reduced by 30% and 60% in the Abcg8(+/-) and Abcg8(-/-) mice, respectively (Figure 4b), and thus reflected the changes in mRNA expression. In contrast, although the Cyp7a1 mRNA expression levels were essentially unchanged in the knockout mouse, Cyp7a1 activity was significantly decreased by 37% (P < 0.01). In the heterozygous mice, both the mRNA and activity of Cyp7a1 were decreased.

95 Chapter 3

Figure 4: Analyses of mRNA expression and enzyme activity in mouse livers. Panel (a) shows RT-PCR quantitation of mRNA levels for Abcg5, Abcg8, Hmgr, Cyp7a1, Abca1, Mdr2, Lxr, Srebp-1c and Srebp-2 in mouse livers from Abcg8(+/+) (open bars), Abcg8(+/-) (hatched bars) and Abcg8(-/-) (filled bars). Knockout mice showed an ~60% reduction in mRNA for Abcg5/sterolin-1 and an 80% reduction in the message for HMG CoA reductase. Relatively no message for Abcg8/sterolin-2 was detected in the knockout mice. Panel (b) shows the enzyme activities for HMG-CoA reductase and CYP7a1 in livers from Abcg8(+/+), Abcg8(+/-) and Abcg8(-/-) mice. Activities of HMG-CoA reductase and CYP7a1 were significantly reduced in the Abcg8(-/-) mouse liver (*P < 0.05, see text for discussion).

Localization of Abcg5 protein in Abcg8/sterolin-2 deficient mice Does the loss of Abcg8/sterolin-2 result in loss of Abcg5/sterolin-1 expression, as might be predicted from the genetic studies and more recently from the in vitro and in vivo expression studies? A robust antibody to mouse Abcg8/sterolin-2 is not currently available. However, three separate groups have developed rabbit polyclonal antibody to mouse Abcg5/sterolin-1. These three antibodies were used in Western blotting and immunohistochemistry experiments on the liver and intestine of Abcg8(-/-) mice.

96 Characterization of the Abcg8 knockout mouse

Immunohistochemistry experiments were carried out using all three antibodies. In acute transfection studies, the SC antibody recognized over-expressed mouse Abcg5/sterolin-1 in COS-1 cells, but not mouse Abcg8/sterolin-2 (Figure 5b,c). Co- transfection of COS-1 cells with both Abcg5 and Abcg8 cDNAs did not alter the pattern of immunofluorescence, although we are not able to confirm simultaneous expression of Abcg8 in cells expressing Abcg5/sterolin-1, as we have no suitable antibody for Abcg8/sterolin-2 (Figure 5d). Nevertheless, this experiment indicates that the SC antibody can recognize Abcg5/sterolin-1 but does not cross-react with Abcg8/sterolin-2. Serial sections of intestinal tissue were incubated with anti- Abcg5/sterolin-1 to determine the cellular location of Abcg5/sterolin-1. The pattern of staining of Abcg5/sterolin-1 in the intestinal sections is clearly apical and localized to the villi of the enterocytes (Figure 5g,h,i). Loss of Abcg8/sterolin-2 does not seem to affect this pattern of staining. To further confirm that the antibody used recognizes Abcg5/sterolin-1 the experiment was repeated with pre-incubation of the peptide to which the antibody was raised. This showed this pattern is blocked (Figure 5f). To further confirm that Abcg5/sterolin-1 expression is preserved and may be apical, immunohistochemistry was performed in Amsterdam using the AMC antibody to stain liver sections from wild-type and knockout mice (30), (Figure 5l, m). Although the signal given by the antibody given after immunostaining liver sections could be competed with the peptide against which it was raised and the sections incubated with the preimmune serum were negative, the antibody gave a similar signal in sections of livers of Abcg5(-/-) mice (data not shown). This suggests that either the AMC antibody is not specific in immunostaining or alternatively that the Abcg5 protein is not absent in Abcg5(-/-) mice. The antibody generated by the SC has not been tested on intestinal sections of Abcg5(-/-) mice. Also the UTSW antibody was used to stain liver sections of wild type and knockout mice. Again, there is apical expression of Abcg5/sterolin-1 in both wild type and knockout livers (Figure 6a,b). However, the same antibody was reported in an earlier study (19) not to be able to recognize endogenous mouse Abcg5 protein in liver sections. As has been previously published, Abcg5/sterolin-1 exists in two separate forms, the ‘immature’ 75 kDa protein and a fully glycosylated ‘mature’ 93 kDa protein (19;30). Using the SC anti-Abcg5/sterolin-1 peptide antibody (which is directed against rat sterolin-1), a 75 kDa band is detected (Figure 7a) in total membrane fractions. This antibody did not detect a ‘mature’ 93 kDa band in either wild type or knockout animals nor is the 75 kDa band sensitive to either Endo-H or PNGaseF. The lower panel shows same aliquots probed with anti-transferrin, which was Endo H sensitive. This suggests that the protein detected with the SC antibody might not be Abcg5, since if this is the immature form of Abcg5 it should have been sensitive to both Endo-H and PNGaseF treatment. In total liver homogenates, the AMC antibody detected both forms of Abcg5/sterolin-1 in wild-type animals whereas in the knockout mice only the 75 kDa form is detected (Figure 7b upper panel). In wild type mice the 93 kDa band was PGNase sensitive but EndoH resistant, indicating that it was fully glycosylated. In contrast the 75kDa band was both EndoH and PGNase sensitive, indicating that it was indeed not glycosylated. Western blotting of total plasma membrane fractions of both Abcg8 wild type and knockout mice showed clearly that in the knockout animals the mature form of Abcg5 protein is not detected at the

97 Chapter 3

98 Characterization of the Abcg8 knockout mouse

Figure 5: Immunohistochemical evaluation of mouse Abcg5/sterolin-1 expression in liver and intestine. COS-1 cells were transiently transfected with pCMV-mouse Abcg5 or pCMV-mouse Abcg8 constructs, allowed to express for 48 hours then fixed and incubated with antibody. pCMV empty vector transfected COS-1 cells incubated with SC anti-Abcg5/ sterolin-1 showed no significant fluorescence (panel a). Abcg5 transfected COS-1 cells incubated with SC anti-Abcg5/sterolin-1 antibody showed a membrane distribution (panel b), where as Abcg8 transfected cells incubated with SC anti-Abcg5 antibody showed no significant fluorescence (panel c). Abcg5 and Abcg8 co-transfected COS-1cells incubated with SC anti-Abcg5/sterolin-1 antibody resulted in a fluorescence pattern similar to Abcg5 alone (panel d). The yellow bar represents 20 µm. Wild-type intestine incubated with SC pre-immune serum (panel e), or SC anti-Abcg5/sterolin-1 antibody pre-incubated with the blocking peptide (panel f) showed no specific signals. Wild-type, Abcg8(+/-) and Abcg8(-/-) intestine (panels g, h and i respectively) incubated with SC anti-Abcg5/ sterolin-1 antibody, showed no difference in expression patterns, despite the loss of Abcg8/sterolin-2 in the knockout mice. Single arrowhead shows intestinal villus and double arrowhead shows crypt. The yellow bar represents 50 µm. Antibody staining of liver sections was also performed at the AMC Liver Center. As a control, an antibody to Bsep/Abcb11 was used and showed a clear apical distribution in both wild type (panel j) and Abcg8 knockout mice (panel k). Using AMC antibody against Abcg5/sterolin-1 (see text), in both wild type (panel l) and Abcg8 knockout liver (panel m), the pattern of expression was also apical and unchanged (see text for discussion). Arrows indicate bile canaliculi

plasma membrane (Figure 7b, lower panel). Immunoblotting total membrane fractions with the UTSW antibody resulted in the detection of the ‘mature’ and ‘immature’ forms of Abcg5/sterolin-1 in wild-type animals but neither of the forms was detected in the knockout mouse (Figure 7c). These results indicate that in liver, the absence of Abcg8 indeed does prevent Abcg5 from traveling to the plasma membrane and the Abcg5 present in the knockout animals remains in the ER.

Biliary secretion of bile salts, sterol and phospholipids in Abcg8/sterolin-2 deficient mice Sitosterolemic individuals have an impaired ability to secrete cholesterol and plant sterols into bile (39;40). We analyzed the knockout mice for any alterations in biliary sterol handling. Analyses of the initial endogenous bile secretion showed that the sterol and phospholipid contents in Abcg8(-/-) mice were reduced as compared to wild-type mice, (Figure 8a,b,c, bile salt secretion not statistically significant, for sterol secretion P = 0.02 and for phospholipid secretion P = 0.03). To investigate whether the defect in biliary sterol secretion could be (partly) restored by forced biliary sterol secretion, mice were infused with stepwise increasing doses of tauroursodeoxycholic acid (TUDC). Mice were first depleted of their endogenous bile salt pools for 90 min and subsequently infused via the jugular vein with increasing doses of TUDC. As shown in Figure 8d, bile salt secretion was not different between the different genotypes during the depletion or the TUDC infusion phases of the experiment. However, a different pattern emerged for the secretion of phospholipid (Figure 8e). There was no difference between wild type and heterozygous mice, but knockout mice showed a trend of lower phospholipid secretion during both the depletion and infusion phase. Even more dramatic was the effect on biliary sterol secretion although

99 Chapter 3

Figure 6: Immunohistochemical evaluation of mouse Abcg5/sterolin-1 expression in liver. Wild type liver incubated with UTSW anti-Abcg5/sterolin-1 resulted in apical expression (panel a). Merged image clearly shows the apical distribution. Likewise Abcg8-/- liver incubated with the same UTSW anti-Abcg5/sterolin-1 antibody resulted in a similar apical expression pattern relative to the wild type (panel b). White arrows indicate bile canaliculi and asterisk indicates a bile duct. The yellow bar represents 50 µm.

the sterol contents were determined enzymatically and no distinction is made as to whether this is sitosterol or cholesterol (Figure 8f, but see below). In the knockout mice, almost no stimulated sterol secretion was noted, with an intermediate phenotype in the heterozygous mice. In the heterozygous mice, sterol secretion increased to reach a maximal level of about 75-80% of the wild type suggesting that Abcg8/sterolin-2 is a rate-limiting step for biliary ‘cholesterol’ secretion, at high rates of bile salt secretion. In the knockout mice, sterol secretion remained at a constant level during the depletion phase and increased minimally upon infusion of TUDC. Since the Abcg8(-/-) mice still secreted some sterols we were interested in which biliary sterol species were being secreted. Therefore bile was collected from mice during a constant infusion of TUDC and analyzed by GC. Mice were first depleted of their endogenous bile acid pools for 30 minutes then infused with a continuous dose of TUDC (1200 nmol/min/100 g body weight). The knockout mice showed a significantly diminished ability to secrete cholesterol, yet still maintained the ability to secrete sitosterol whereas campesterol secretion was slightly lower compared to wild-type mice (Figure 9). Surprisingly, the Abcg8(+/-) mice tended to show an increased ability to secrete all sterols above the levels seen in the wild-type mice, although this was not statistically significant

100 Characterization of the Abcg8 knockout mouse

DISCUSSION

The mechanism by which dietary cholesterol is specifically absorbed and dietary non- cholesterol sterols primarily excluded or the mechanism(s) by which the liver can selectively secrete sterols has not been elucidated. Identification of the genetic defect(s) in a rare human disorder, sitosterolemia, where these processes are specifically disrupted, may finally have led to the identification of the ‘transporters’ responsible for these processes. The cause of sitosterolemia is a complete defect in one of two genes (but not both), which are organized in a head-to-head configuration at the STSL locus. We report a mouse model of sitosterolemia, with a selective, but complete, defect in one of these genes, Abcg8. This mouse reflects the known defects described in human sitosterolemia (5;7;41). Plasma and all tissues, apart from the brain, have significantly elevated sitosterol levels. Homozygous knockout mice are viable, fertile and sitosterolemic. However, fertility seems to be reduced when homozygous mice are bred together (S. Patel and J. Oatis, unpublished observation). This model reflects many other observed changes described in limited studies in human patients. For example, in humans, the activity of HMG-CoA reductase and CYP7a1 have been reported to be low (7;35). In this study, we show that the mRNA and enzyme activities in the livers from knockout animals are also significantly reduced. Additionally, the activity of the rate-limiting enzyme for bile acid synthesis, CYP7a1, is reduced, although no changes at the mRNA level were noticed. This is also in keeping with previous studies that show that sitosterol is a direct inhibitor of this enzyme in vitro (35).The reduced activity of Cyp7a1 in Abcg8(-/-) mice did not result in detectable differences in biliary bile salt secretion rates. Biliary sterols of Abcg8-deficient mice were dramatically different compared to wild-type mice. Measurement of biliary sterol secretion rates in Abcg8(-/-) mice demonstrated a failure to increase sterol secretion into bile despite exogenous infusion of bile acids. Furthermore, complete loss of Abcg8/sterolin-2 results in a reduced ability to secrete cholesterol into bile, although secretion of sitosterol seemed to be preserved. Arguably, since the body pools and plasma sitosterol levels in the knockout mice are so considerably elevated, perhaps the biliary sitosterol levels could be considered to be inappropriately low. Despite this reservation, the finding that sitosterol is present in the bile suggests that plant sterols may be secreted independent of Abcg8/sterolin-2. The ability of Abcg8(-/-) mice to secrete bile salt into bile as compared to wild type mice was not significantly impaired whereas phospholipid secretion tended to be lower in Acbg8(-/-) mice. Collectively these data suggest that Abcg8/sterolin-2 is necessary for hepatobiliary cholesterol secretion in mice. Abcg8(-/-) mice appeared normal and healthy maintained on a regular rodent chow diet. Their phenotypic features are very similar to those recently reported for a mouse deficient in both sterolins simultaneously (7;20). Plasma and hepatic plant sterol levels in Abcg8(-/-) and Abcg5/Abcg8 knockout are increased similarly with marked decreases in cholesterol levels. Interestingly, plasma triglyceride levels of the Abcg8(-/-) mice were slightly higher than wild-type animals and this increased triglyceride is carried in the LDL fraction range, as measured by FPLC. The significance of this is not clear, although preliminary SDS-PAGE analyses of all the fractions failed to reveal any differences between wild type and knockout samples.

101 Chapter 3

Hepatic levels of GC-measured cholesterol were greatly reduced in Abcg8(-/-) mice compared to wild type mice, yet mRNA levels of HMG-CoA reductase and enzyme activity are also reduced without any significant change in mRNA levels of Srebp1c and Srebp2. The basis for this is not clear at present, unless the increase in plant sterols leads to a suppression of SREBP activation. Sitosterol has been shown to directly inhibit Cyp7a1 activity in vitro and we presume this may account for the reduced enzyme activity (42).Abcg8/sterolin-2 deficient mice also allow us to examine the role of this protein in biliary sterol secretion. Bile of these mice is sterol poor and upon stimulation by increasing bile salt excretion, Abcg8/sterolin-2 deficient mice cannot respond, in contrast to the wild type mice. However, sitosterol secretion is similar in both genotypes. Thus, Abcg8/sterolin-2 is necessary for cholesterol secretion but not necessary for plant sterol secretion. It could be argued that although the biliary sitosterol output is comparable to that seen in wild-type mice that this is inappropriately low, since the tissue and plasma pools of sitosterol are highly elevated in the knockout mice. Despite this caveat, the findings of sitosterol in significant quantities in bile suggest that mechanisms other than via the sterolins can ‘export’ some of these sterols. Interestingly, humans who are heterozygous for genetic defects in either ABCG5 or ABCG8 seem to be phenotypically normal, although also affected heterozygote individuals have been described (43). Mice heterozygous for Abcg8/sterolin-2 deficiency have normal levels of plant sterols in plasma and liver and show endogenous sterol secretion rates that are not different from wild type mice whereas during high bile salt secretion rates sterol secretion is slightly impaired. Note that under steady-state conditions on a rodent chow diet, heterozygous animals show no significant elevations in plasma or tissue sitosterol levels, suggesting that the activity of these proteins may not be rate limiting. Furthermore, the heterozygous Abcg8 mice showed higher levels of biliary sitosterol relative to the wild type mice during stimulation with bile salts, while the rate of total biliary sterol secretion is reduced compared to wild type mice during this stimulation. Since the heterozygous mice are not sitosterolemic, either the activity of these proteins is not rate limiting or other mechanisms can compensate for a loss of this activity, but not for cholesterol excretion. On the other hand, since feeding is intermittent, a slow, but continuous secretion during post-prandial periods could easily negate any mild temporary increase in tissue and plasma plant sterol levels in heterozygous animals. This may be amenable to testing by placing these animals on a high plant sterol diet and measuring the plasma sterol levels. Recently, Kosters et al. reported that Abcg5/Abcg8 mRNA expression in a variety of different mouse strains correlated with biliary cholesterol secretion rates (30). In these studies, although diosgenin-fed mice showed a marked increase in biliary cholesterol output, mRNA levels of Abcg5 and Abcg8 were not altered. Using Western blot analyses, the protein level of Abcg5 was also not altered by diosgenin, although Abcg8 was not measured, due to the lack of a suitable antibody. It was concluded that a parallel route for biliary cholesterol secretion might be operational, independent of the sterolins. While biliary cholesterol secretion is not completely absent in the Abcg8-deficient mice it appeared that sterolin-2 plays a major role in this process. In a genetic screen of plasma plant sterol levels, Sehayek et al. identified three loci that may be responsible for controlling plasma plant sterol levels and not one of these loci mapped to the murine STSL region (44). Thus, there is

102 Characterization of the Abcg8 knockout mouse

Figure 7: N-glycosylation of Abcg5/sterolin-1 analyses in Abcg8(-/-) mouse liver. (A) Mouse liver total membranes stained with b SC anti-Abcg5/sterolin-1 after treatment with Endo-H or PNGaseF shows a 75 kDa band present in both genotypes, which is resistant to deglycosylation (panel a, upper part). Staining of wild-type liver homogenate with preimmune serum showed no detectable bands. Lower portion of panel (a) shows the same aliquots stained for anti-transferrin as a control for deglycosylation. (B) AMC anti-Abcg5/sterolin-1 staining of mouse liver homogenate shows a ‘mature’ ~90 kDa band in the wild- type mice but not in the Abcg8(-/-) mice (upper panel). Staining of total liver plasma membrane fractions showed the absence of Abcg5 in Abcg8(-/-) lanes (panel b, lower part). A 75 kDa form is present which is sensitive to deglycosylation. (C) Mouse liver total membranes stained with UTSW anti-Abcg5/sterolin-1 shows a ‘mature’ ~90 kDa band and an ‘immature’ 75 kDa band in the wild-type mice but no signal is detected in the Abcg8(-/-) mice. Treatment with Endo-H or PNGaseF results in a lower molecular weight protein in the wild-type mice. Abcg5/Abcg8-/- liver homogenate used for negative control.

103 Chapter 3

D 350 in either ABCG5 or ABCG8 seemA to be phenotypically normal, although also affected ) ) 2400 G8(+/+) ) heterozygote individuals have been ) described (43). Mice heterozygous for G8(+/-) 300 Abcg8/sterolin-2 deficiency have normal levels G8(-/-)of plant sterols in plasma and liver 2000 250 and show endogenous sterol secretion rates that are not different from wild type mice whereas during high bile salt secretion rates1600 sterol secretion is slightly impaired. Note 200 that under steady-state conditions on a rodent chow diet, heterozygous animals show 1200 150 no significant elevations in plasma or tissue sitosterol levels, suggesting that the activity of these proteins may not be rate limiting. Furthermore, the heterozygous 800 100 Abcg8 mice showed higher levels of biliary sitosterol relative to the wild type mice during stimulation with bile salts, while the rate of total biliary sterol secretion is 50 400 Bile salt secretion (nmol/min.100g secretion salt Bile reduced compared to wild type mice during (nmol/min.100g secretion salt Bile this stimulation. Since the heterozygous Bile salt secretion (nmol/min.100g secretion salt Bile Bile salt secretion (nmol/min.100g secretion salt Bile 0 mice are not sitosterolemic, either the activity0 of these proteins is not rate limiting or 0 50 100 150 200 250 otherAbcg8(+/+) mechanisms Abcg8(+/-) can compensate Abcg8(-/-) for a loss of this activity, Timebut (min) not for cholesterol 9 ) ) excretion. On the other hand, since feeding is intermittent, a slow, but continuous B 70 E 8 secretion during post-prandial periods could G8(+/+)easily negate any mild temporary G8(+/-) 60 7 increase in tissue and plasma plant sterol levels inG8(-/-) heterozygous animals. This may be

6 amenable to testing by placing these animals50 on a high plant sterol diet and measuring

5 the plasma sterol levels. 40 4 30 3 (nmol/min.100g) (nmol/min.100g) 20 2 Phospholipid secretion Phospholipid Phospholipid secretion Phospholipid

1 10 Cholesterol secretion (nmol/min.100g secretion Cholesterol Cholesterol secretion (nmol/min.100g secretion Cholesterol 0 0 Abcg8(+/+) Abcg8(+/-) Abcg8(-/-) 0 50 100 150 200 250 Time (min) ) ) 40 C 6 G8(+/+) F G8(+/-) g 35 g G8(-/-) 5 30

25 4

20 3 15 2 10

5 1 Cholesterol secretion (nmol/min.100 Cholesterol secretion (nmol/min.100 Phospholipid secretion (nmol/min.100g secretion Phospholipid Phospholipid secretion (nmol/min.100g secretion Phospholipid 0 0 Abcg8(+/+) Abcg8(+/-) Abcg8(-/-) 0 50 100Time (min) 150 200 250

Figure 8: Biliary sterol, phospholipid and bile salt analyses. Bile salt, sterol and phospholipid contents from male Abcg8(+/+) (n = 8), Abcg8(+/-) (n = 7), and Abcg8(-/-) (n = 5) mice were examined as described in Methods. Bile was collected following an initial 10 min cannulation. No difference was observed in bile salt secretion rates (panel A). Phospholipid secretion was lower in Abcg8(-/-) mice but these differences were not statistically significant (panel B). Biliary sterol was significantly reduced in the Abcg8(-/-) mice compared to the wild-type mice (panel C). *P < 0.05. The right panel shows biliary bile salt, sterol and phospholipid secretion rates from female Abcg8(+/+) (n = 5), Abcg8(+/-) (n = 4), and Abcg8(-/-) (n = 4) mice measured following 90-minute bile salt depletion (arrow). This was followed by a stepwise increased TUDC infusion (600-2400 nmol/min.100g) as described in the Method section. No differences were observed in the ability of the Abcg8(-/-) mice to secrete bile salts (panel d), but there is a trend towards a reduced ability to secrete phospholipid (panel e) and a marked inability of the knockout mice to secrete sterols (panel f) compared to wild type mice. Data are shown as mean ± s.e.m.

104 Characterization of the Abcg8 knockout mouse

support for at least four loci that may be involved in regulating plasma plant sterol levels. To date the STSL locus is the only one proven to be involved in dietary sterol trafficking and the identity of the others remains to be elucidated. We, as well as others, have proposed Abcg5/sterolin-1 and Abcg8/sterolin-2 to function as obligate heterodimers. Thus knocking out Abcg8/sterolin-2 alone is equivalent to a functional loss of both sterolins. It has been shown that Abcg8/sterolin-2 expression is required for correct apical trafficking of Abcg5/sterolin-1 to the apical surface in a polarized cell line and more recently in vivo by over-expression experiments (18;19). Determination of mRNA expression levels of Abcg5 in Abcg8(-/-) mice using two different methods (northern blot and real-time PCR) were inconsistent. Furthermore, in experiments shown here, using three separately developed anti-Abcg5/ sterolin-1 antibodies, we have obtained inconsistent data regarding the trafficking of Abcg5/sterolin-1 in Abcg8(-/-) mice. Based upon immunoblots of classical N- glycosylation maturation treatment and plasma membrane fractions it would appear that Abcg5/sterolin-1, in the Abcg8(-/-) mice, does not exit the endoplasmic reticulum and is not present at the canalicular membrane. However, by immunohistochemistry of intestinal sections using the SC antibody it appears that Abcg5/sterolin-1 is apically expressed in the Abcg8-deficient mice. In contrast, for liver sections of Abcg8(-/-) mice no conclusive results were obtained. Together with the results from Western blot analyses from these results suggest that no Abcg5 is present at the canalicular membrane of Abcg8-/- mice, whereas for the intestine, it seems that Abcg5 is expressed apically, although the antibody was not tested on Abcg5(-/-) sections. Interestingly, in a report of Abcg5/Abcg8 localization in canine gallbladder epithelial cells, these two proteinswere found intracellularly under baseline conditions (42). But when given liver X receptor alpha (LXRα) agonist, Abcg5/sterolin-1 and Abcg8/sterolin-2 appeared to be expressed at the apical surface. In these studies the UTSW anti-Abcg5/sterolin-1 antibody was used. It is apparent with these conflicting data that the trafficking of these transporters is not as clear-cut. In a recent paper, Mangrivite et al. showed that the apical sorting of rat SPNT in polarized renal epithelial cells was independent of N- glycosylation (45). Therefore, at this time, we can neither exclude the possibility that Abcg5/sterolin-1 expression is functional in our Abcg8/sterolin-2 deficient mice nor can we rule it out, as there is no functional assay for these proteins at present. Recenlty, Plösch et al. have described an Abcg5/sterolin-1 deficient mouse in which gallbladder cholesterol concentrations are 50% lower than in wild type mice and, when fed a LXR agonist, tended to secrete more biliary cholesterol than wild-type mice (46). Taken together, these animal models suggest that Abcg5/sterolin-1 and Abcg8/sterolin-2 may have independent function in vivo or that there are proteins other than the sterolins that can secrete biliary sterols or the remaining may be protein independent. In conclusion, the major findings in this study are that disruption of only one of the two genes comprising the STSL locus is necessary and sufficient to cause sitosterolemia, and that the loss of Abcg8/sterolin-2 leads to the loss of biliary cholesterol secretion. These data strongly support the direct role of Abcg8/sterolin-2 as a key player in biliary cholesterol secretion, although biliary sitosterol secretion was apparently preserved and suggest that there are mechanisms other than Abcg8/sterolin-2 that allow for the secretion of sitosterol into bile.

105 Chapter 3

Figure 9: Biliary cholesterol and sitosterol secretion. Biliary sterols were analyzed by GC analyses in Abcg8(+/+) (n = 4), Abcg8(+/-) (n = 3) and Abcg8(-/-) (n = 4) mice following 30-minute bile salt depletion followed by a continuous TUDC infusion as described in Methods. Abcg8(-/-) mice were unable to secrete cholesterol into bile with forced TUDC administration relative to the wild-type mice (panel a, *P < 0.05). Interestingly, the Abcg8(-/-) mice were able to still secrete sitosterol (panel b) and campesterol (panel c). Heterozygous mice showed an increased ability to secrete all sterols with forced TUDC administration, although the results were not statistically significant. 106 Characterization of the Abcg8 knockout mouse

ACKNOWLEDGEMENTS

We would like to thank Dr B Stieger for kindly providing anti-Bsep antibody and Dr H. Hobbs for providing the UTSW anti-Abcg5/sterolin-1 antibody. We would also like to thank John Oatis, III for his excellent animal husbandry and Prof. F. Kuipers for providing liver tissue of Abcg5 knockout mice. Grants from the American Heart Association, Beginning Grant-In-Aid Mid-Atlantic Affiliate (KL), NIH Postdoctoral Training Grant T32 HL07260 (ELK), the Netherlands Organization for Scientific Research (NOW) 902-23-193 (AK) as well as the National Institutes of Health Grant HL60613 (SBP) and DK56830 (GS) supported this work.

107 Chapter 3

REFERENCES

1. Nair PP, Turjman N, Kessie G, Calkins B, Goodman GT, Davidovitz H et al. Diet, nutrition intake, and metabolism in populations at high and low risk for colon cancer. Dietary cholesterol, beta-sitosterol, and stigmasterol. Am J Clin Nutr 1984; 40(4 Suppl):927-930. 2. Weihrauch JL, Gardner JM. Sterol content of foods of plant origin. J Am Diet Assoc 1978; 73(1):39-47. 3. Wilson MD, Rudel LL. Review of cholesterol absorption with emphasis on dietary and biliary cholesterol. J Lipid Res 1994; 35(6):943-955. 4. Schoenheimer R. Uber die Bedeutung der Pflanzensterine fur den tierischen Organismus. Z fur physiol Chem 1929; 180:1-5. 5. Bhattacharyya AK, Connor WE. Beta-sitosterolemia and xanthomatosis. A newly described lipid storage disease in two sisters. J Clin Invest 1974; 53(4):1033-1043. 6. Shulman RS, Bhattacharyya AK, Connor WE, Fredrickson DS. Beta-sitosterolemia and xanthomatosis. N Engl J Med 1976; 294(9):482-483. 7. Salen G, Shefer S, Nguyen L, Ness GC, Tint GS, Shore V. Sitosterolemia. J Lipid Res 1992; 33(7):945-955. 8. Salen G, Shore V, Tint GS, Forte T, Shefer S, Horak I et al. Increased sitosterol absorption, decreased removal, and expanded body pools compensate for reduced cholesterol synthesis in sitosterolemia with xanthomatosis. J Lipid Res 1989; 30(9):1319-1330. 9. Bhattacharyya AK, Connor WE, Lin DS, McMurry MM, Shulman RS. Sluggish sitosterol turnover and hepatic failure to excrete sitosterol into bile cause expansion of body pool of sitosterol in patients with sitosterolemia and xanthomatosis. Arterioscler Thromb 1991; 11(5):1287-1294. 10. Patel SB, Salen G, Hidaka H, Kwiterovich PO, Stalenhoef AF, Miettinen TA et al. Mapping a gene involved in regulating dietary cholesterol absorption. The sitosterolemia locus is found at chromosome 2p21. J Clin Invest 1998; 102(5):1041-1044. 11. Patel SB, Honda A, Salen G. Sitosterolemia: exclusion of genes involved in reduced cholesterol biosynthesis. J Lipid Res 1998; 39(5):1055-1061. 12. Lee MH, Gordon D, Ott J, Lu K, Ose L, Miettinen T et al. Fine mapping of a gene responsible for regulating dietary cholesterol absorption; founder effects underlie cases of phytosterolaemia in multiple communities. Eur J Hum Genet 2001; 9(5):375-384. 13. Lu K, Lee MH, Carpten JD, Sekhon M, Patel SB. High-resolution physical and transcript map of human chromosome 2p21 containing the sitosterolaemia locus. Eur J Hum Genet 2001; 9(5):364-374. 14. Lu K, Lee MH, Hazard S, Brooks-Wilson A, Hidaka H, Kojima H et al. Two genes that map to the STSL locus cause sitosterolemia: genomic structure and spectrum of mutations involving sterolin-1 and sterolin-2, encoded by ABCG5 and ABCG8, respectively. Am J Hum Genet 2001; 69(2):278-290. 15. Berge KE, Tian H, Graf GA, Yu L, Grishin NV, Schultz J et al. Accumulation of dietary cholesterol in sitosterolemia caused by mutations in adjacent ABC transporters. Science 2000; 290(5497):1771-1775. 16. Lee MH, Lu K, Hazard S, Yu H, Shulenin S, Hidaka H et al. Identification of a gene, ABCG5, important in the regulation of dietary cholesterol absorption. Nat Genet 2001; 27(1):79-83. 17. Yu L, Li-Hawkins J, Hammer RE, Berge KE, Horton JD, Cohen JC et al. Overexpression of ABCG5 and ABCG8 promotes biliary cholesterol secretion and reduces fractional absorption of dietary cholesterol. J C lin Invest 2002; 110(5):671-680. 18. Graf GA, Li WP, Gerard RD, Gelissen I, White A, Cohen JC et al. Coexpression of ATP- binding cassette proteins ABCG5 and ABCG8 permits their transport to the apical surface. J Clin Invest 2002; 110(5):659-669. 19. Graf GA, Yu L, Li WP, Gerard R, Tuma PL, Cohen JC et al. ABCG5 and ABCG8 are obligate heterodimers for protein trafficking and biliary cholesterol excretion. J Biol Chem 2003; 278(48):48275-48282. 20. Yu L, Hammer RE, Li-Hawkins J, Von Bergmann K, Lutjohann D, Cohen JC et al. Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in biliary cholesterol secretion. Proc Natl Acad Sci U S A 2002; 99(25):16237-16242. 21. Lu K, Lee MH, Yu H, Zhou Y, Sandell SA, Salen G et al. Molecular cloning, genomic organization, genetic variations, and characterization of murine sterolin genes Abcg5 and Abcg8. J Lipid Res 2002; 43(4):565-578.

108 Characterization of the Abcg8 knockout mouse

22. Southern EM. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol 1975; 98(3):503-517. 23. Wu J, Zhu YH, Patel SB. Cyclosporin-induced dyslipoproteinemia is associated with selective activation of SREBP-2. Am J Physiol 1999; 277(6 Pt 1):E1087-E1094. 24. Plosch T, Kok T, Bloks VW, Smit MJ, Havinga R, Chimini G et al. Increased hepatobiliary and fecal cholesterol excretion upon activation of the liver X receptor is independent of ABCA1. J Biol Chem 2002; 277(37):33870-33877. 25. Grefhorst A, Elzinga BM, Voshol PJ, Plosch T, Kok T, Bloks VW et al. Stimulation of lipogenesis by pharmacological activation of the liver X receptor leads to production of large, triglyceride-rich very low density lipoprotein particles. J Biol Chem 2002; 277(37):34182- 34190. 26. Yang J, Goldstein JL, Hammer RE, Moon YA, Brown MS, Horton JD. Decreased lipid synthesis in livers of mice with disrupted Site-1 protease gene. Proc Natl Acad Sci U S A 2001; 98(24):13607-13612. 27. Knouff C, Hinsdale ME, Mezdour H, Altenburg MK, Watanabe M, Quarfordt SH et al. Apo E structure determines VLDL clearance and atherosclerosis risk in mice. J Clin Invest 1999; 103(11):1579-1586. 28. Nguyen LB, Shefer S, Salen G, Horak I, Tint GS, McNamara DJ. The effect of abnormal plasma and cellular sterol content and composition on low density lipoprotein uptake and degradation by monocytes and lymphocytes in sitosterolemia with xanthomatosis. Metabolism 1988; 37(4):346-351. 29. Yu H, Pandit B, Klett E, Lee MH, Lu K, Helou K et al. The rat STSL locus: characterization, chromosomal assignment, and genetic variations in sitosterolemic hypertensive rats. BMC Cardiovasc Disord 2003; 3(1):4. 30. Kosters A, Frijters RJ, Schaap FG, Vink E, Plosch T, Ottenhoff R et al. Relation between hepatic expression of ATP-binding cassette transporters G5 and G8 and biliary cholesterol secretion in mice. J Hepatol 2003; 38(6):710-716. 31. Meier PJ, Sztul ES, Reuben A, Boyer JL. Structural and functional polarity of canalicular and basolateral plasma membrane vesicles isolated in high yield from rat liver. J Cell Biol 1984; 98(3):991-1000. 32. Nicolau G, Shefer S, Salen G, Mosbach EH. Determination of hepatic 3-hydroxy-3- methylglutaryl CoA reductase activity in man. J Lipid Res 1974; 15(1):94-98. 33. Shefer S, Salen G, Batta AK. Cholesterol 7 alpha-hydroxylase (7 alpha-monooxygenase EC 1.14.12.17). Boca Raton: CRC 1986. 34. Lowry OH, Rosebrough NJ, Farr AL, Randell RJ. Protein measurements with the Folin phenol reagent. J Biol Chem 1951; 193:265-275. 35. Shefer S, Salen G, Nguyen L, Batta AK, Packin V, Tint GS et al. Competitive inhibition of bile acid synthesis by endogenous cholestanol and sitosterol in sitosterolemia with xanthomatosis. Effect on cholesterol 7 alpha-hydroxylase. J Clin Invest 1988; 82(6):1833- 1839. 36. Xu G, Salen G, Shefer S, Ness GC, Nguyen LB, Parker TS et al. Unexpected inhibition of cholesterol 7 alpha-hydroxylase by cholesterol in New Zealand white and Watanabe heritable hyperlipidemic rabbits. J Clin Invest 1995; 95(4):1497-1504. 37. Field FJ, Mathur SN. beta-sitosterol: esterification by intestinal acylcoenzyme A: cholesterol acyltransferase (ACAT) and its effect on cholesterol esterification. J Lipid Res 1983; 24(4):409-417. 38. Tavani DM, Nes WR, Billheimer JT. The sterol substrate specificity of acyl CoA: :cholesterol acyltransferase from rat liver. J Lipid Res 1982; 23(5):774-781. 39. Miettinen TA. Phytosterolaemia, xanthomatosis and premature atherosclerotic arterial disease: a case with high plant sterol absorption, impaired sterol elimination and low cholesterol synthesis. Eur J Clin Invest 1980; 10(1):27-35. 40. Salen G, Ahrens EH, Jr., Grundy SM. Metabolism of beta-sitosterol in man. J Clin Invest 1970; 49(5):952-967. 41. Bjorkhem I, Boberg KM. Inborn errors in bile acid biosynthesis and storage of other than cholesterol. In: Scriver CR, Beaudet AL, Sly WS, Valle D, editors. The Metabolic Basis of Inherited Disease. New York: McGraw-Hill Inc, 1995: 2073-2102. 42. Tauscher A, Kuver R. ABCG5 and ABCG8 are expressed in gallbladder epithelial cells. Biochem Biophys Res Commun 2003; 307(4):1021-1028.

109 Chapter 3

43. Hidaka H, Nakamura T, Aoki T, Kojima H, Nakajima Y, Kosugi K et al. Increased plasma plant sterol levels in heterozygotes with sitosterolemia and xanthomatosis. J Lipid Res 1990; 31(5):881-888. 44. Sehayek E, Duncan EM, Lutjohann D, Von Bergmann K, Ono JG, Batta AK et al. Loci on chromosomes 14 and 2, distinct from ABCG5/ABCG8, regulate plasma plant sterol levels in a C57BL/6J x CASA/Rk intercross. Proc Natl Acad Sci U S A 2002; 99(25):16215-16219. 45. Mangravite LM, Giacomini KM. Sorting of rat SPNT in renal epithelium is independent of N- glycosylation. Pharm Res 2003; 20(2):319-323. 46. Plosch T, Bloks VW, Terasawa Y, Berdy S, Siegler K, Van Der SF et al. Sitosterolemia in ABC-transporter G5-deficient mice is aggravated on activation of the liver-X receptor. Gastroenterology 2004; 126(1):290-300.

110

Chapter 4

Diosgenin-induced biliary cholesterol secretion

in mice requires Abcg8

Published in: Hepatology 2005, 41: 141-150. Astrid Kosters, Raoul J.J.M Frijters, Cindy Kunne, Edwin Vink, Marit S. Schneiders, Frank G. Schaap, Catharina P. Nibbering, Shailendra B. Patel, Albert K. Groen

Chapter 4

114 Diosgenin-induced cholesterol secretion requires Abcg8

ABSTRACT The plant sterol diosgenin has been shown to stimulate biliary cholesterol secretion in mice without affecting the expression of the ABC-transporter heterodimer Abcg5/g8. The aim of this study was to investigate the mechanism of diosgenin-induced cholesterol hypersecretion and to identify the genes involved. Surprisingly, despite its lack of effect on Abcg5/g8 expression in wild type mice, diosgenin did not stimulate biliary cholesterol secretion in mice deficient for Abcg8. Analysis of the kinetics of cholesterol secretion suggested that diosgenin probably activates a step before Abcg5/g8. To identify potential diosgenin-targets, gene expression profiling was performed in mice fed a diosgenin-supplemented diet. Diosgenin-feeding increased hepatic expression of genes involved in cholesterol synthesis as well as genes encoding several cytochrome P450s. No significant change in expression of known cholesterol transporters was found. Comparison with published expression-profiling data for Srebp2-overexpressing mice, another mouse model in which biliary cholesterol secretion is elevated, revealed a number of genes with unknown function that were upregulated in both diosgenin-fed mice and mice overexpressing Srebp2. In conclusion, we found that although Abcg8 is essential for the majority of diosgenin- induced biliary cholesterol hypersecretion, diosgenin probably does not directly interact with Abcg8/Abcg5 but rather increases cholesterol delivery to the heterodimer.

115 Chapter 4

INTRODUCTION

The human liver secretes about 1 gram of cholesterol per day into the bile. Most of this cholesterol is taken up from the blood in the form of lipoproteins. The pathways involved in transhepatic cholesterol trafficking into bile are still largely unknown. A number of intracellular proteins such as Niemann Pick C 1 and 2, Sterol Carrier Protein 2, liver-type Fatty Acid Binding Protein, Rab9, and caveolins have been implicated but their quantitative importance is unknown (see for review (1;2). After arrival at the canalicular membrane of the hepatocyte cholesterol is secreted into the bile. It has long been assumed that biliary cholesterol secretion was not protein- mediated. This concept changed with the discovery of the ABC-half transporters ABCG5 and ABGG8. Patients with mutations in either of these genes show increased intestinal absorption of sterols as well as decreased biliary sterol secretion suggesting a primary role of these transporters in plant sterol metabolism as well as in cholesterol transport (3-5). The important role of Abcg5/g8 in biliary cholesterol output was confirmed in mice overexpressing human ABCG5/G8 or in mice lacking both genes, indicating that the majority of biliary cholesterol secretion is mediated by Abcg5/g8 (6;7). However, it should be noted that 10-30% of biliary cholesterol secretion is independent of Abcg5/g8 activity (7-9). We have recently shown in a variety of mouse models that the hepatic expression levels of both Abcg5 and Abcg8 correlate with biliary cholesterol flux (10), with one exception: mice fed a diosgenin-containing diet showed no change in hepatic Abcg5/g8 expression despite a dramatic 15-fold increase in cholesterol secretion. Diosgenin (3β, 25R-Spirost-5-en-3-ol), a plant sterol, is structurally similar to cholesterol and dietary diosgenin has been shown to increase biliary cholesterol secretion 5-7-fold in rats without altering the biliary output of bile salts and phospholipids (11-14). The mechanism by which diosgenin increases biliary cholesterol secretion has been an enigma for many years. In rats, dietary diosgenin had no effect on hepatic cholesterol concentrations nor on total plasma cholesterol levels (12). The compound did increase 3-hydroxy-3-methylglutaryl coenzyme A reductase activity of rat liver, indicating increased de novo cholesterol synthesis (11;12). Since diosgenin induced biliary cholesterol secretion 15-fold in mice without altering hepatic Abcg5/g8 expression an alternative pathway for biliary cholesterol output was hypothesized. To investigate the existence of such a pathway, we fed Abcg8(-/-) mice a 1% diosgenin-supplemented diet. Surprisingly, in the absence of Abcg8, diosgenin failed to substantially induce cholesterol secretion indicating that Abcg8 was necessary for the majority of diosgenin-mediated biliary cholesterol secretion. To elucidate the genes involved in this pathway, we compared gene expression profiles in livers of control and diosgenin-fed mice. In particular genes involved in cholesterol synthesis were increased as were a number of cytochrome P450 genes. Our data suggest that diosgenin increases the supply of cholesterol to the canalicular membrane, which activates Abcg5/g8-dependent as well as Abcg5/g8- independent pathways of biliary cholesterol secretion.

116 Diosgenin-induced cholesterol secretion requires Abcg8

MATERIAL and METHODS

Animals and diets Male FVB mice and female Abcg8(+/+), Abcg8(+/-) and Abcg8(-/-) (C57Bl/6x129Sv) were fed either a control diet (AM-II, Hope Farms, Woerden, The Netherlands) or a control diet supplemented with 1.0% (wt/wt) diosgenin for 18 days. The FVB mice were taken from our own colony. Abcg8 mice (15) were bred in the animal facility of the AMC Liver Center. Diosgenin (Sigma Chemical Co., MO, USA) was dissolved in chloroform, mixed with the diet and the chloroform was evaporated in a fume hood for at least 24 hrs. Control diet was subjected to the same procedure without the diosgenin. All animal experiments were approved by the animal ethics committee of the Academic Medical Center.

Bile sampling and biliary lipid analysis Mouse surgery, cannulation of the gallbladder and bile collection was performed as described previously (8). To determine maximal secretion rates of biliary lipids, tauroursodeoxycholate (Sigma Chemical Co., MO, USA) dissolved in PBS (45 mM stock solution) was infused into the jugular vein at stepwise increasing rates from 600-2400 nmol/min.100g body wt. Bile was collected and analyzed for bile salt and lipid content as described before (16). Biliary bile salt composition was determined by HPLC as described (17).

Micro array analysis Total RNA was isolated from liver by the guanidium thiocyanate method and phenol- chloroform extracted according to Chomczynski et al. (18) and purified over a CsCl gradient. Poly(A)+ RNA was purified from total RNA using the PolyA-tract kit (Promega, Leiden, The Netherlands). 3 µg Poly(A)+ RNA pooled from 4 mice for each condition was converted into double stranded cDNA using the Superscript II Choice system (Invitrogen, Groningen, The Netherlands) employing a modified oligo- dT primer consisting of a T7-promoter sequence in front of an oligo-dT(24): GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG – dT(24). The double-stranded cDNA was purified with phenol/chloroform/isoamylalcohol extraction and precipitated with 7.5M ammonium acetate and ethanol. Biotin-labeled cRNA was synthesized using Enzo Bioarray transcript labeling kit (Enzo Diagnostics, Farmingdale, NY, USA) according to the manufacturer’s instructions. The obtained cRNA was purified using RNeasy spin columns (Qiagen, Hilden, Germany). The purified cRNA was fragmented by incubation in a solution containing 40 mM Tris acetate (pH 8.1), 100 mM potassium acetate and 30 mM magnesium acetate at 94° C for 35 min. 15 µg of biotin-labeled fragmented cRNA mixtures were hybridized to the mouse array MG-U74v2 (Affymetrix, Santa Clara, CA), consisting of 3 separate chips, each containing ± 12000 probe sets. Chip A was hybridized in duplicate, which generated excellent results hence chip B and C were hybridized once. After hybridization the chips were washed and stained and scanned at the Leiden Genomic Technology Center according to the manufacturer’s instructions. The data was analyzed using Affymetrix Microarray Suite 5.0 software (MAS 5.0).

117 Chapter 4

Real-time PCR Real-time PCR was carried out on a LightCycler instrument (Roche Diagnostics, Mannheim, Germany) as described previously (10). The primers used for real-time PCR in this study are shown in Table 1.

HMG-CoA reductase Enzyme Assay HMG-CoA-reductase activity was determined as described elsewhere (19).

Cholesterol Efflux Assay Cholesterol efflux assays were performed as described (20). In short, dog gallbladder epithelial cells were grown for 5 days until confluency in collagen-coated 24-well plates in DMEM /10% fetal calf serum in presence of 2 µg/ml diosgenin or vehicle (ethanol, final concentration 0.4%). Cells were loaded with [3H]cholesterol by incubation for 24 h with DMEM supplemented with 30 µg/ml cholesterol, 0.5 µCi/ml [3H]cholesterol, 10 mM Hepes pH 7.4 and 0.2% fatty acid free BSA. Cells were then washed twice with PBS with 0.2% BSA (w/v) and once with PBS. The efflux assay was started by the addition of serum-free DMEM containing 10 mM Hepes pH 7.4 and 10 mM TUDC. After 1 h incubation at 37°C, the medium was collected and centrifuged. The remaining cellular lipids were extracted with 2-propanol and [3H]cholesterol was quantified by liquid scintillation counting. Efflux was calculated as the proportion of cellular cholesterol effluxed to the medium.

Statistical analysis: Data are presented as means ± SE. Statistical significance of differences was evaluated by Students t-test or Mann Whitney U test. Significance was set at P values < 0.05.

118 Diosgenin-induced cholesterol secretion requires Abcg8

Table 1. Sequences of primers used for quantitative real-time PCR

Gene Name Accession no Primer Sequences Abca1 NM_013454 forward: GAGATACCAGCATTAAGGAC reverse: GTCAGAAACATCACCTCC Abcg1 NM_009593 forward: GAATCACCTCGCACATTG reverse: AAAGCCGTATCTGACATAGG Abcg5 NM_031884 forward: AGAGTCAGGATGGCCTGTAT reverse: ATGCTGAGCAGGGCCACTAT Abcg8 AF324495 forward: GCACTGGTCATGGCTGAGAA reverse: CACAGGAGTCTTGGCTGCTA Acat2 NM_146064 forward: CTTACCCCAAACAAGACAGA reverse: AGTCAAACTCCAGCATCAAC Cyp7a1 NM_007824 forward: GCATCATCAAGGAGGCTCTGC reverse: GGTGGCAAAAATTCCCAAGCCTG D-site albumin binding protein NM_016974 forward: CCACTACCGTGCTGTGCTTT reverse: ATTGTGTTGATGGAGGCGG Early growth response-1 (Egr-1) NM_007913 forward: CTAGTCAGTGGCCTCGTGAG reverse: AGATAGTCAGGGATCATGGG Gapdh NM_008084 forward: TTCCTACCCCCAATGTGTC reverse: AGCCGTATTCATTGTCATACC Glucose-6-Phosphatase U00445 forward: ACCTTGCTGCTCACTTTCCC reverse: GCTCACACCATCTCTTGGCTT HMG-CoA reductase XM_127496 forward: CATTCCAGCCAAGGTGGTGAG reverse: CAAGATGTCCTGCTGCCAAGG Igfbp1 X81579 forward: CCGTTCCTGATTCTCCTGTC reverse: TGCTCCTCTGTCATCTCTGG Double LIM protein-1 (Limp1) D88792 forward: GCAAATCCTGCTACGGAAAG reverse: TGTCGTGCTTACTGGGTTCA LDL-Receptor NM_010700 forward: AAGATCTACAGCGCCTGATGG reverse: ACCCAATAGAGACGGCCACTG Niemann Pick C1 (Npc1) NM_008720 forward: GATTACCTGCTTTGTGAGCC reverse: TTTGGCATTGAGAGAGACTG Oatp-2 NM_131906 forward: TCCTTGTAGAGATGGGCTGT reverse: CCAATCTTCCCTAAGCAGAG Pregnane X Receptor (Pxr, NR1I2) NM_010936 forward: AAGGGCGTCATCAACTTC reverse: CATCAGCACATACTCCTCCT Sterol carrier protein-2 (Scp2) NM_011327 forward: GACTCAGACTTGCTGGCTTT reverse: ATGCTATTCGGGAGGTGTC NTCP NM_011387 forward: CTTCACTGCCTTGGGCATGATG reverse: TGTTTCCATGCTGATGGTGCG Surfeit gene 5 BC018225 forward: TGGCAGAGACTTAGACCAACCCA reverse: AGGAGAATGGAGGGAAGGCAA

119 Chapter 4

RESULTS

Abcg8(+/+), (+/-) and (-/-) mice were fed a control or a diet containing 1% (w/w) diosgenin for 18 days. Baseline biliary parameters are depicted in Fig 1. On the control diet there was no difference between the three genotypes with respect to bile salt (BS) secretion and this was not influenced by diosgenin (Fig 1A). Basal bile flow (BF) was increased 1.8-fold (P<0.05) in diosgenin-fed Abcg8(-/-) mice compared to diosgenin-fed wild-type mice, but was not affected in any of the other groups (Fig 1B). Basal phospholipid (PL) secretion was decreased by 30% in Abcg8(-/-) mice on the control diet (P= 0.51). Interestingly, diosgenin-feeding normalized PL secretion (Fig 1C). Confirming previous data (8), basal CH secretion was significantly reduced (80%) in Abcg8(-/-) mice compared to (+/+) mice (P< 0.05) (Fig 1D). In Abcg8(+/+) mice, diosgenin induced CH secretion 2.6-fold from 2.7 ± 0.8 to 7.2 ± 2.7 nmol/min.100g (P= 0.08). In (-/-) mice, diosgenin increased CH secretion from 0.6 ± 0.2 to 1.1 ± 0.2 nmol/min.100g (P= 0.11), but note that this is still lower than basal CH secretion in Abcg8(+/+) mice (Fig 1D). Interestingly, diosgenin failed to significantly stimulate CH secretion in Abcg8(+/-) mice (Fig 1D, middle panel).

Figure 1: Effect of dietary diosgenin on endogenous biliary secretion in Abcg8 (+/+), (+/-) and (-/-) mice. Female Abcg8(+/+), (+/-) and (-/-) mice were fed either a control diet or the control diet supplemented with 1% diosgenin for 18 days. Bile was collected for 10 min after cannulation of the gallbladder. Biliary lipids were assayed as described in the method section. Panels depict bile salt secretion (A), bile flow (B), phospholipid secretion (C), cholesterol secretion (D). Data are given as mean ± SE (n ≥ 4 for all groups). *P<0.05 compared to wild-type mice.

120 Diosgenin-induced cholesterol secretion requires Abcg8

Previous experiments in rats revealed that diosgenin induced the expression of Early growth response 1 and Organic anion transporting protein 2 and these results were confirmed in mice by real-time PCR (unpublished results). To ascertain whether diosgenin was also active in the Abcg8(-/-) mice, hepatic expression levels of these genes were determined. Both genes showed upregulation in diosgenin-fed Abcg8 (-/-) mice (data not shown), confirming that diosgenin was active in Abcg8(-/-) mice.

Figure 2: Effect of dietary diosgenin on maximal biliary secretion output following TUDC infusion in Abcg8 (+/+), (+/-) and (-/-) mice. Mice received a control diet or 1% diosgenin-supplemented diet for 18 days. The bile duct was ligated and after depletion of the endogenous bile salt pool for 90 min, mice were infused with TUDC in stepwise increasing rates (600-2400 nmol/min.100g). Maximal secretion rates were determined as the average of the 4 time points with highest bile salt secretion rates. Bile was collected in fractions of 10 min and biliary lipids were determined as mentioned in the method section. Data are given as mean ± SE (n ≥ 4 for all groups). * P<0.05 compared to wild type mice fed the same diet, # P< 0.05 compared to control diet.

To stimulate biliary secretion the hydrophilic bile salt tauroursodeoxycholic acid (TUDC) was infused at increasing concentration rates. Maximal BS output during infusion of TUDC was similar in all groups, and not different between control and diosgenin-supplemented animals, although it was slightly lower in Abcg8(+/-) mice fed the diosgenin diet (Fig 2A). Similarly to endogenous BF, on the control diet maximal BF rates reached after TUDC infusion were significantly increased (1.5 fold, P< 0.05) in Abcg8(-/-) mice compared to (+/+) mice (Fig 2B). In both diosgenin-fed Abcg8(+/+) and (-/-) mice the infusion of TUDC significantly increased BF compared

121 Chapter 4 to their respective control groups. TUDC-induced PL secretion rates were not significantly different between control and diosgenin-fed groups (Fig 2C). TUDC infusion increased biliary CH secretion to maximal rates of 4.5 ± 1.3 nmol/min.100g in Abcg8(+/+) control mice (Fig 2D), whereas this was 13.2 ± 3.7 nmol/min.100g in diosgenin-fed Abcg8(+/+) mice, a 2.9-fold increase (P<0.05). In (-/-) mice, diosgenin increased maximal CH secretion rates after TUDC infusion from 0.9 ± 0.2 to 1.8 ± 0.3 nmol/min.100g (P<0.05). Again, in Abcg8(+/-) mice a striking lack of effect of diosgenin was observed (Fig 2D, middle panel). Figure 3 shows CH secretion as a function of BS secretion and highlights the dramatic differences between the effects of diosgenin in Abcg8(+/+) and Abcg8(-/-) mice. Half-maximal CH secretion was obtained at much lower values of BS output in diosgenin-fed Abcg8(+/+) (Fig 3A) and Abcg8(+/-) (Fig 3B) mice than in control mice. In contrast, in Abcg8(-/-) mice (Fig 3C) only the maximal CH secretion rate was increased by diosgenin, suggesting that diosgenin-feeding affects the transport activity of Abcg8. In general, the influence of a modulator of enzyme or transporter activity surfaces most prominently when the enzyme or transporter is fully rate-controlling.

Figure 3: Bile salt-dependent cholesterol secretion in control and diosgenin-fed Abcg8 mice. TUDC infusion experiments were performed as described in the legends of Figure 1. Diosgenin changed the relation between biliary bile salt secretion and cholesterol secretion in Abcg8(+/+) mice (A) and Abcg8(+/-) mice (B) but had no effect in Abcg8(-/-) mice (C). Half-maximal cholesterol secretion rates were obtained much earlier in diosgenin-fed Abcg8(+/+) and Abcg8(+/-) mice. In mice of all three genotypes diosgenin increased maximal cholesterol secretion rates. Note the difference in scale between the three panels. Values are shown as means ± SE (n ≥ 4 for all groups).

122 Diosgenin-induced cholesterol secretion requires Abcg8

To quantify the control on biliary cholesterol secretion exerted by Abcg8 we applied

Figure 4: Flux control coefficient of Abcg8 on cholesterol secretion in Abcg8(+/-) mice. The flux control coefficient (FCC) of Abcg8 on biliary cholesterol secretion is the fractional change in flux (dJ/J) induced by a fractional change in activity of Abcg8 (dE/E). The values were calculated from the data in Fig. 3B assuming that in heterozygous mice Abcg8 activity was 50%.

Metabolic Control Analysis (21). Rate control by an enzyme or transporter can be quantified by determination of the flux control coefficient (FCC), which is given as the fractional change in flux induced by a fractional change in enzyme or transporter activity. In general, for a fully rate-limiting enzyme or transporter the FCC is 100%. The data in Figure 3 allow calculation of the FCC of Abcg8 on CH secretion in the heterozygous mice and is shown in Figure 4 as function of CH secretion. The FCC is ~50% at low rates of CH secretion and increases to up to ~73% at Vmax. Despite the high FCC, diosgenin-feeding does not result in appreciable increased CH secretion in the Abcg8(+/-) mice, which suggests that the compound does not directly interact with Abcg8. To investigate this hypothesis more directly we investigated the effect of diosgenin on CH efflux in vitro in dog gallbladder epithelial cells which express Abcg5/g8 (22)). Diosgenin affected CH efflux to TUDC only marginally (increase from 2.7 to 3.2%, p<0.01). We have shown previously that, diosgenin was much more effective in FVB mice compared to the C57Bl/6x129Sv mice used in this study. Biliary CH secretion increased about 14-fold (P = 0.002), without affecting BF, BS and PL secretion (Table 2). The hydrophobicity of bile acids secreted into bile has been shown to influence cholesterol secretion (23;24). To investigate whether part of the substantial increase in biliary CH secretion could be explained by differences in bile salt hydrophobicity the bile salt composition in bile from control and diosgenin-fed mice was determined. No significant differences were found (data not shown). The extremely potent effect of diosgenin in FVB mice made this model very attractive for investigation of the effect of diosgenin on gene expression in mouse liver. For this purpose mouse U72Av2 Affymetrix oligonucleotide arrays were used. The complete results are given as

123 Chapter 4

Table 2: Effect of dietary diosgenin on biliary lipid output in FVB mice.

Bile flow Bile salt secretion Phospholipid secretion Cholesterol secretion (µl/min.100g) (nmol/min.100g) (nmol/min.100g) (nmol/min.100g) Control 8.0 ± 1.2 352 ± 59 28.6 ± 7.7 0.8 ± 0.3 diet (n=4) Diosgenin 8.5 ± 1.1 346 ± 143 31.8 ± 10.3 11.7 ± 1.1a diet (n=4) Data are represented as means ± SD, a: P<0.01 vs control group

supplemental table online (http://www.mrw.interscience.wiley.com/suppmat/0270- 9139/suppmat/2005/41/v41.141.html, Table S1). The number of significantly changed probe sets after analysis of replicated hybridization (Chip A) using the Affymetrix MAS 5.0 software was 130, of which 116 probe sets were upregulated and 14 probe sets were downregulated. In total, ~400 probe sets on chip A, B and C showed a significant change in expression, of which 30 were increased more than 2-fold and 70 decreased more than 2-fold. The expression of most genes encoding enzymes in cholesterol synthesis was increased in livers of diosgenin-fed mice (Table 3). 3- Hydroxy-3-methylglutaryl Coenzyme A reductase mRNA expression was below detection levels and was therefore determined by real-time PCR. Also the expression of this gene was increased in diosgenin-fed mice (data not shown). To confirm the increase in CH synthesis, activity of hepatic HMG-CoA reductase was measured in control and diosgenin-fed FVB mice and found to be increased 4-fold (Fig 5). Table 4 shows that diosgenin also induced the expression of several genes of the Cytochrome P450 family; class 3A (Cyp3a11, Cyp3a16 and Cyp3a25), class 2C (Cyp2C39 and Cyp2C55) and Cyp4A12, whereas Cyp20A1 was 90% downregulated. In addition, the expression of a number of Glutathione-S-transferases (Gsta2, Gstm1, and Gstm3) was significantly increased (Table 4). Table 5 lists other genes whose average expression was altered more than 1.5-fold by diosgenin. Since Chip B and C were hybridized only once a 2-fold or higher threshold was used. A total of 122 genes were changed and some of these changes were validated as shown in Table 5. Expression of Insulin growth factor binding protein 1 (3-fold reduction) and ESTs similar to the transcription factor Math6 (2-fold increase) and Heat Shock Protein 70.2 (2-fold increase) were confirmed (Table 5). Strikingly, in FVB mice diosgenin did not change the expression of genes known to be involved in the uptake and transport of cholesterol or other lipids, (i.e.: Srb1, Ldlr, Abca1, Abcg1, Abcg5, Abcg8, Scp2, Npc1, Caveolin1) and bile acid synthesis (i.e.: Cyp7a1, Cyp27, Cyp8b1) (Table S1). Interestingly, the expression of several cytochrome P450 enzymes was found to be increased. Many of these are known target genes of the nuclear receptors PXR and/or CAR. However, the expression of these or other nuclear receptors known to be involved in lipid metabolism (Lxr, Fxr, Shp, Lrh1, and Ppar) was not changed. Moreover, no change in expression of genes suggested to be involved in apical and/or intracellular vesicle/cholesterol transport in polarized epithelial cells, such as Rab GTPases (25), Cdc42 (26), cytoskeletal components including microtubular proteins and actin (27), were found.

124 Diosgenin-induced cholesterol secretion requires Abcg8

Table 3: Diosgenin induced expression of hepatic genes in FVB mice involved in cholesterol synthesis.

Affymetrix Gene Name Gene Ratio Ratio ID Symbol D/C D/C (Exp1) (Exp2) 94325-at* 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 Hmgcs1 1.5 1.7 96269-at* Isopentenyl-diphosphate delta isomerase Idi1 1.8 1.5 160424-f-at* Farnesyl diphosphate synthetase Fdps 2.5 1.9 99098-at* Farnesyl diphosphate synthetase Fdps 2 2 97518-at* Farnesyl diphosphate farnesyl transferase 1 Fdft1 2 1.9 94322-at* Squalene epoxidase Sqle 1.9 2.3 160737-at Lanosterol synthase Lss 1.7 n.a 109608-at Cytochrome P450, 51 Cyp51 1.7 n.a 137321-at Cytochrome P450, 51 Cyp51 1.7 n.a 94916-at Cytochrome P450, 51 Cyp51 1 2.1 96627-at* Phenylalkylamine Ca2+ antagonist (emopamil) binding protein Ebp 1.3 1.3 160388-at* Sterol-C4-methyl oxidase-like Sc4mol 2 1.7 164998-f-at 7-dehydrocholesterol reductase Dhcr7 1.5 n.a 98989-at* 7-dehydrocholesterol reductase Dhcr7 1.3 1.6 98630-at NAD(P)-dependent steroid dehydrogenase-like Nsdhl 1 1.4 105991-at NAD(P)-dependent steroid dehydrogenase-like Nsdhl 1.4 1.4 98631-g-at* NAD(P)-dependent steroid dehydrogenase-like Nsdhl 1.9 1.5 93868-at NAD(P)-dependent steroid dehydrogenase-like Nsdhl 1.5 1.9 168360-f-at* NAD(P)-dependent steroid dehydrogenase-like Nsdhl 1.9 n.a 162785-at* Insulin-induced gene 1 Insig1 0.5 n.a 111948-at* Insulin-induced gene 2 Insig2 0.5 n.a 107516-at* Insulin-induced gene 2 Insig2 0.46 n.a 109170-at Srebp cleavage-activating protein Scap 0.6 n.a Abbreviation: Ratio D/C, ratio expression levels in livers of diosgenin-fed mice/expression levels in livers of control mice. *Significant change according to Affymetrix MAS 5.0 software.

DISCUSSION

A major finding in this study is that activity of Abcg8 is indispensable for diosgenin- induced biliary CH hypersecretion. Since we have shown in an earlier study (10) that in mice diosgenin stimulated CH secretion without affecting expression of Abcg5 and Abcg8, the lack of effect of diosgenin-feeding in Abcg8(-/-) mice and in particular in heterozygous mice was surprising. One could argue that diosgenin absorption might have been impaired in the Abcg8(-/-) mice. We do not favor this argument for two reasons; firstly loss of Abcg8 results in an accumulation of plant sterols in the body (28;29) and secondly genes increased by diosgenin-feeding in FVB mice were also increased in Abcg8(-/-) mice. Moreover, in heterozygous mice in which cholesterol and phytosterol levels are normal (8), the effect of dietary diosgenin on CH secretion was also severely impaired (Figures 1, 2 and 3), suggesting that even partial loss of Abcg8 negated the effect of diosgenin. Analysis of the kinetics of biliary CH secretion revealed a double effect of diosgenin (Figure 3). Both the maximal secretion and the apparent Km of BS for CH output were changed in diosgenin-fed Abcg8(+/+) mice but there was little effect on the apparent Vmax in diosgenin-fed heterozygous mice, in these mice diosgenin affected only the apparent Km. In Abcg8(-/-) mice no effect on the apparent Km but only an increase in Vmax was observed. At first sight the loss of the diosgenin effect in

125 Chapter 4

Table 4. Diosgenin-regulated genes encoding cytochrome P450s and glutathione-S transferases

Affymetrix ID Gene name Gene Ratio Ratio Symbol D/C D/C (Exp1) (Exp2) Cytochrome P450 98295-at* Cytochrome P450, family 2, subfamily c, polypeptide 39 Cyp2c39 2.0 1.6 134079-f-at* Cytochrome P450, family 2, subfamily c, polypeptide 55 Cyp2c55 13.0 n.a 93770-at* Cytochrome P450, family 3, subfamily a, polypeptide 11 Cyp3a11 2.6 3.0 101638-s-at* Cytochrome P450, family 3, subfamily a, polypeptide 16 Cyp3a16 3.5 4.3 104024-at* Cytochrome P450, family 3, subfamily a, polypeptide 25 Cyp3a25 1.7 2.1 101307-at* Cytochrome P450, family 4, subfamliy a, polypetide 12 Cyp4a12 1.2 1.2 117064-f-at* Cytochrome P450, family 20, subfamily a, polypeptide 1 Cyp20a1 0.1 n.a Glutathion-S-transferases 101872-at* Glutathione S-transferase, alpha 2 (Yc2) Gsta2 2.3 2.6 93543-f-at* Glutathione S-transferase, mu 1 Gstm1 1.5 1.4 102094-f-at* Glutathione S-transferase, mu 1 Gstm1 1.5 1.6 97681-f-at* Glutathione S-transferase, mu 3 Gstm3 1.6 1.6 97682-r-at* Glutathione S-transferase, mu 3 Gstm3 1.7 1.6 99583-at* Glutathione S-transferase, pi 2 Gstp2 1.3 1.3 Abbreviation: Ratio D/C, ratio expression levels in livers of diosgenin-fed mice/expression levels in livers of control mice. *Significant change according to Affymetrix MAS 5.0 software

Abcg8(-/-) mice suggests an interaction of the compound with the Abcg5/g8 heterodimer. On the other hand an important role of an enzyme/transporter in a pathway does not necessarily imply that all control on pathway flux is exerted via that step. The experiments carried out in this study allow a further analysis of this issue. Stimulation of flux through a pathway with a fully rate-limiting step can only occur via stimulation of that step. We therefore determined the flux control coefficient (FCC) of Abcg8 on biliary CH secretion under the conditions where most rate control could be expected, i.e. in the heterozygous mouse. As shown in Fig. 4, the FCC of Abcg8 was indeed high in (+/-) mice, particularly at high rates of CH secretion. The value does not reach 100% because of the presence of an Abcg5/g8-independent pathway of CH secretion, which is obviously not controlled by Abcg8. The fact that diosgenin does not stimulate CH output in Abcg8(+/-) mice when Abcg8 exerts highest control strongly suggests that diosgenin does not act directly on Abcg5/g8 and may act at a step before the heterodimer. To verify whether diosgenin indeed does not interact directly with Abcg5/g8 we have tested the effect of this compound on CH efflux in Abcg5/g8-expressing dog gallbladder epithelial cells. An almost negligible effect of diosgenin on CH efflux to TUDC was noticed, again indicating that diosgenin itself does not directly affect Abcg5/g8 activity. This suggests that diosgenin may affect an as yet unknown step in CH handling between CH synthesis and Abcg5/g8-mediated secretion. The major part of the CH secreted into bile in rodents has been shown to be derived from HDL, whereas the remaining part is supplied by de novo CH synthesis (30;31). Wang et al. have shown that when SR-BI expression is diminished, biliary CH can be derived from chylomicron remnants (32). Microarray analysis revealed that diosgenin increased the expression of genes involved in CH biosynthesis in FVB mice, in which

126 Diosgenin-induced cholesterol secretion requires Abcg8

Figure 5 Figure 5: Effect of dietary diosgenin on hepatic HMG-CoA reductase activity in FVB mice. Male FVB mice received a control diet or 1% diosgenin-supplemented diet for 18 days. HMG-CoA reductase activity in liver was determined as described in the method section. Values are given as means ± SE (n =3 for all groups). *P<0.05 compared to mice fed the control diet.

diosgenin was more effective in stimulating CH secretion compared to Abcg8- C57Bl/6x129Sv mice (15-fold vs. 2.6-fold, respectively). Previous studies in rats showed that although diosgenin did increase CH synthesis, the relative contribution of newly synthesized CH to biliary CH was similar to control rats (33). This suggests that the major part of the increased biliary CH in diosgenin-fed mice might be derived from increased HDL uptake. However, neither the expression of SR-BI or of the LDLR was changed in diosgenin-fed FVB mice, suggesting that also this pathway is not affected by diosgenin. The mechanism by which CH destined for biliary secretion trafficks to the canalicular membrane has not been resolved yet. Vesicle transport has been implicated and diosgenin has been shown to increase the content of intracellular vesicles located near the canalicular membrane (34). However, the genes on the array encoding proteins involved in vesicle transport from and to the apical membrane showed no change in expression. In addition to vesicular transport, cytoplasmic proteins like liver-fatty acid binding protein, Sterol carrier protein-2, Caveolin-1 and - 2, and Niemann Pick C 1 and -2 proteins have been suggested to play a role in the intracellular transport and biliary CH secretion. Despite the enormous effect of diosgenin on biliary CH secretion, no changes were observed in expression of these genes. Diosgenin also induced the expression of Cyp3a11, -16 and –25. The 3a class of Cytochrome P450 has been shown to be involved in the oxidative metabolism of (endogenous) toxic compounds, steroids and bile acids (35), which may include diosgenin. This suggests that diosgenin-induced expression of class Cyp3a may serve to metabolize diosgenin. Another expression pattern that emerged from the microarray analysis suggested that diosgenin or one of its metabolites may act as ligand for the nuclear receptors PXR and/or CAR, since several target genes showed elevated expression levels (e.g. Oatp2, Cyp3a11, Gst, etc). Recently, Horton et al (36) reported gene expression profiles of livers of mice overexpressing the CH synthesis regulating transcription factor Srebp2 (37;38). In these mice biliary CH secretion is increased to a similar extent as in diosgenin-fed FVB mice (21-fold and 15-fold respectively) (10;36). Hence, the pathways involved specifically in biliary CH secretion are probably stimulated in both diosgenin-fed and

127 Chapter 4

Table 5. Other genes aignificantly regulated by diosgenin

Affymetrix Gene Symbol Ratio Ratio ID Gene name D/C D/C (Exp1) (Exp2) Chip A 93550_at† cysteine-rich protein 2 Csrp2 1.7 2.1 160841_at† D site albumin promoter binding protein Dbp 1.7 2.3 102816_at serine (or cysteine) proteinase inhibitor, clade A, Serpina3m 1.7 2.0 member 3M 103519_at carboxylesterase 1 Ces1 1.6 1.9 95705_s_at actin, beta, cytoplasmic Actb 1.3 2.0 94515_at sulfide quinone reductase-like (yeast) Sqrdl 1.5 1.9 92713_at† hepatic nuclear factor 4 Hnf4 1.4 1.7 103689_at ATP-binding cassette, sub-family C (CFTR/MRP), Abcc3 1.7 1.5 member 3 102662_at asialoglycoprotein receptor 2 Asgr2 1.5 1.7 101060_at glucose regulated protein Grp58 1.6 1.4 101566_f_at major urinary protein 1 Mup1 1.4 1.6 96771_at v-erb-b2 erythroblastic leukemia viral oncogene Erbb3 1.4 1.6 homolog 3 (avian) 93086_at immunoglobulin kappa chain variable 8 (V8) Igk-V8 0.8 0.6 104072_at serum amyloid P-component Apcs 0.6 0.7 95432_f_at DNA segment, Chr 16, Indiana University Medical D16Ium22e 0.6 0.7 22, expressed 103257_at RIKEN cDNA C730036B01 gene C730036B01Rik 0.7 0.7 93500_at aminolevulinic acid synthase 1 Alas1 0.6 0.6 99535_at CCR4 carbon catabolite repression 4-like (S. Ccrn4l 0.6 0.7 cerevisiae) 103333_at† glucose-6-phosphatase, catalytic G6pc 0.5 0.5 93875_at heat shock protein 1A Hspa1a 0.4 0.6 160988_r_at DNA segment, Chr 3, ERATO Doi 330, expressed D3Ertd330e 0.7 0.3 161561_r_at† surfeit gene 5 Surf5 0.4 0.5 103896_f_at insulin-like growth factor binding protein 1 Igfbp1 0.6 0.3 Chip B and C 164603_f_at† HIV-1 Rev binding protein 2 Hrb2 2.6 n.a 163077_at* Heat shock protein 2 HSP70.2 Hspa2 2.1 n.a 166394_at* RIKEN cDNA 4933425C05 gene similar to Basic- XM_132647 2 n.a helix-loop-helix transcription factor Math 6 107516_at* Insulin-induced gene 2 Insig2 0.5 n.a 111948_at* Insulin-induced gene 2 Insig2 0.5 n.a 113261_at† ESTseq BM245957 0.5 n.a 115082_at† Rho guanine nucleotide exchange factor (GEF) 12 Arhgef12 0.5 n.a 116451_at† retinoic acid receptor responder (tazarotene Rarres1 0.5 n.a induced) 1 11476_at† RIKEN cDNA 9030024J15 gene 9030024J15Rik 0.5 n.a NOTE. Genes for which the expression changed more than 1.5-fold (Chip A) or 2-fold (Chips B and C) are shown. For Chips B and C, only genes validated by real-time polymerase chain reaction are shown. Abbreviation: Ratio D/C, ratio expression levels in livers of diosgenin-fed mice/expression levels in livers of control mice. *Change in expression that was confirmed by real-time polymerase chain reaction. †Changed expression could not be confirmed by real-time polymerase chain reaction.

Srebp2-overexpressing mice. As expected, in both diosgenin-fed and Srebp2- overexpressing mice, genes involved in CH synthesis were upregulated although this

128 Diosgenin-induced cholesterol secretion requires Abcg8 was more robust in the Srebp2-overexpressing mice. Interestingly, in both diosgenin- fed and Srebp2-overexpressing mice substantial amounts of CH have to travel to the canalicular membrane, however, no known genes involved in intracellular CH trafficking were increased. Hence, in both diosgenin-fed and Srebp2-overexpressing mice the transport pathway easily accommodates the increased demand for flux. In addition, the expression levels of Cyp3a and Cyp2c55, DBP, and Abcc3 were increased in both diosgenin-fed and Srebp2-overexpressing mice whereas Cyp2c39 was downregulated in Srebp2-overexpressing mice, but upregulated in diosgenin-fed mice. Commonly downregulated genes included the Insulin induced gene 2 (Insig2), another gene involved in regulation of CH synthesis (39). Interestingly, there are a number of genes up or down regulated in both diosgenin-fed and Srebp2- overexpressing mice of which the function is not yet known (Supplemental Table S2, http://www.mrw.interscience.wiley.com/suppmat/0270- 9139/suppmat/2005/41/v41.141.html ). Possibly, one of these genes is involved in regulation of cholesterol transport to the canalicular membrane of the hepatocyte. In summary, diosgenin stimulates both Abcg5/g8-dependent and Abcg5/g8- independent pathways of biliary CH secretion. Since the Abcg5/g8-mediated pathway is by far the most important, the presence of the heterodimer is necessary for full expression of the effect of diosgenin. Yet the compound does not directly activate Abcg5/g8 but exerts its effect on a step involved in supplying Abcg5/g8 with cholesterol.

129 Chapter 4

AKNOWLEDGMENTS:

This study was supported by the Netherlands Organization for Scientific Research (NWO) grants 902-23-193 (AK and RJJMF) and 902-23-262 (EV), by MLDS MS-00- 46 (AKG) and by the National Institutes of Health, NHLBI HL060613 (SBP). Part of this study has been presented at the AASLD meeting 2003, and published as abstract in Hepatology 38 Suppl. 1. 387A

130 Diosgenin-induced cholesterol secretion requires Abcg8

REFERENCES

1. Soccio RE, Breslow JL. Intracellular Cholesterol Transport. Arterioscler Thromb Vasc Biol 2004. 2. Ory DS. The niemann-pick disease genes; regulators of cellular cholesterol homeostasis. Trends Cardiovasc Med 2004; 14(2):66-72. 3. Salen G, Shefer S, Nguyen L, Ness GC, Tint GS, Shore V. Sitosterolemia. J Lipid Res 1992; 33(7):945-955. 4. Bhattacharyya AK, Connor WE. Beta-sitosterolemia and xanthomatosis. A newly described lipid storage disease in two sisters. J Clin Invest 1974; 53(4):1033-1043. 5. Lu K, Lee MH, Hazard S, Brooks-Wilson A, Hidaka H, Kojima H et al. Two genes that map to the STSL locus cause sitosterolemia: genomic structure and spectrum of mutations involving sterolin-1 and sterolin-2, encoded by ABCG5 and ABCG8, respectively. Am J Hum Genet 2001; 69(2):278-290. 6. Yu L, Li-Hawkins J, Hammer RE, Berge KE, Horton JD, Cohen JC et al. Overexpression of ABCG5 and ABCG8 promotes biliary cholesterol secretion and reduces fractional absorption of dietary cholesterol. J Clin Invest 2002; 110(5):671-680. 7. Yu L, Hammer RE, Li-Hawkins J, von Bergmann K, Lutjohann D, Cohen JC et al. Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in biliary cholesterol secretion. Proc Natl Acad Sci U S A 2002; 99(25):16237-16242. 8. Klett EL, Lu K, Kosters A, Vink E, Lee MH, Altenburg M et al. A mouse model of sitosterolemia: absence of Abcg8/sterolin-2 results in failure to secrete biliary cholesterol. BMC Med 2004; 2(1):5. 9. Plosch T, Bloks VW, Terasawa Y, Berdy S, Siegler K, Van Der SF et al. Sitosterolemia in ABC- transporter G5-deficient mice is aggravated on activation of the liver-X receptor. Gastroenterology 2004; 126(1):290-300. 10. Kosters A, Frijters RJ, Schaap FG, Vink E, Plosch T, Ottenhoff R et al. Relation between hepatic expression of ATP-binding cassette transporters G5 and G8 and biliary cholesterol secretion in mice. J Hepatol 2003; 38(6):710-716. 11. Cayen MN, Ferdinandi ES, Greselin E, Dvornik D. Studies on the disposition of diosgenin in rats, dogs, monkeys and man. Atherosclerosis 1979; 33(1):71-87. 12. Cayen MN, Dvornik D. Effect of diosgenin on lipid metabolism in rats. J Lipid Res 1979; 20(2):162-174. 13. Nervi F, Marinovic I, Rigotti A, Ulloa N. Regulation of biliary cholesterol secretion. Functional relationship between the canalicular and sinusoidal cholesterol secretory pathways in the rat. J Clin Invest 1988; 82(6):1818-1825. 14. Nibbering CP, Groen AK, Ottenhoff R, Brouwers JF, vanBerge-Henegouwen GP, van Erpecum KJ. Regulation of biliary cholesterol secretion is independent of hepatocyte canalicular membrane lipid composition: a study in the diosgenin-fed rat model. J Hepatol 2001; 35(2):164- 169. 15. Lee SL, Wang Y, Milbrandt J. Unimpaired macrophage differentiation and activation in mice lacking the zinc finger transplantation factor NGFI-A (EGR1). Mol Cell Biol 1996; 16(8):4566- 4572. 16. Frijters CM, Ottenhoff R, van Wijland MJ, van Nieuwkerk C, Groen AK, Oude Elferink RP. Influence of bile salts on hepatic mdr2 P-glycoprotein expression. Adv Enzyme Regul 1996; 36:351-363. 17. Vreken P, van Lint AE, Bootsma AH, Overmars H, Wanders RJ, van Gennip AH. Rapid diagnosis of organic acidemias and fatty-acid oxidation defects by quantitative electrospray tandem-MS acyl-carnitine analysis in plasma. Adv Exp Med Biol 1999; 466:327-337. 18. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987; 162(1):156-159. 19. Houten SM, Schneiders MS, Wanders RJ, Waterham HR. Regulation of isoprenoid/cholesterol biosynthesis in cells from mevalonate kinase-deficient patients. J Biol Chem 2003; 278(8):5736- 5743. 20. van Wijland MJ, de Waart DR, Groen AK. Biliary anionic peptide fraction/calcium binding protein inhibits apolipoprotein A-I-mediated cholesterol efflux from cultured cells. Biochem Biophys Res Commun 2001; 287(1):1-4.

131 Chapter 4

21. Fell DA. Metabolic control analysis: a survey of its theoretical and experimental development. Biochem J 1992; 286 ( Pt 2):313-330. 22. Tauscher A, Kuver R. ABCG5 and ABCG8 are expressed in gallbladder epithelial cells. Biochem Biophys Res Commun 2003; 307(4):1021-1028. 23. Wang DQ, Tazuma S, Cohen DE, Carey MC. Feeding natural hydrophilic bile acids inhibits intestinal cholesterol absorption: studies in the gallstone-susceptible mouse. Am J Physiol Gastrointest Liver Physiol 2003; 285(3):G494-G502. 24. Marzolo MP, Rigotti A, Nervi F. Secretion of biliary lipids from the hepatocyte. Hepatology 1990; 12(3 Pt 2):134S-141S. 25. Mohrmann K, Gerez L, Oorschot V, Klumperman J, van der SP. Rab4 function in membrane recycling from early endosomes depends on a membrane to cytoplasm cycle. J Biol Chem 2002; 277(35):32029-32035. 26. Rojas R, Ruiz WG, Leung SM, Jou TS, Apodaca G. Cdc42-dependent modulation of tight junctions and membrane protein traffic in polarized Madin-Darby canine kidney cells. Mol Biol Cell 2001; 12(8):2257-2274. 27. Jacob R, Heine M, Alfalah M, Naim HY. Distinct cytoskeletal tracks direct individual vesicle populations to the apical membrane of epithelial cells. Curr Biol 2003; 13(7):607-612. 28. Lee MH, Lu K, Patel SB. Genetic basis of sitosterolemia. Curr Opin Lipidol 2001; 12(2):141- 149. 29. Lu K, Lee MH, Patel SB. Dietary cholesterol absorption; more than just bile. Trends Endocrinol Metab 2001; 12(7):314-320. 30. Robins SJ, Fasulo JM. High density lipoproteins, but not other lipoproteins, provide a vehicle for sterol transport to bile. J Clin Invest 1997; 99(3):380-384. 31. Robins SJ, Fasulo JM. Delineation of a novel hepatic route for the selective transfer of unesterified sterols from high-density lipoproteins to bile: studies using the perfused rat liver. Hepatology 1999; 29(5):1541-1548. 32. Wang DQ, Carey MC. Susceptibility to murine cholesterol gallstone formation is not affected by partial disruption of the HDL receptor SR-BI. Biochim Biophys Acta 2002; 1583(2):141-150. 33. Nervi F, Bronfman M, Allalon W, Depiereux E, Del Pozo R. Regulation of biliary cholesterol secretion in the rat. Role of hepatic cholesterol esterification. J Clin Invest 1984; 74(6):2226- 2237. 34. Puglielli L, Amigo L, Arrese M, Nunez L, Rigotti A, Garrido J et al. Protective role of biliary cholesterol and phospholipid lamellae against bile acid-induced cell damage. Gastroenterology 1994; 107(1):244-254. 35. Rendic S, Di Carlo FJ. Human cytochrome P450 enzymes: a status report summarizing their reactions, substrates, inducers, and inhibitors. Drug Metab Rev 1997; 29(1-2):413-580. 36. Horton JD, Shah NA, Warrington JA, Anderson NN, Park SW, Brown MS et al. Combined analysis of oligonucleotide microarray data from transgenic and knockout mice identifies direct SREBP target genes. Proc Natl Acad Sci U S A 2003; 100(21):12027-12032. 37. Rawson RB. Control of lipid metabolism by regulated intramembrane proteolysis of sterol regulatory element binding proteins (SREBPs). Biochem Soc Symp 2003;(70):221-231. 38. Anderson RG. Joe Goldstein and Mike Brown: from cholesterol homeostasis to new paradigms in membrane biology. Trends Cell Biol 2003; 13(10):534-539. 39. Yabe D, Brown MS, Goldstein JL. Insig-2, a second endoplasmic reticulum protein that binds SCAP and blocks export of sterol regulatory element-binding proteins. Proc Natl Acad Sci U S A 2002; 99(20):12753-12758.

132

Chapter 5

The mechanism of biliary cholesterol secretion

Astrid Kosters, Cindy Kunne, Norbert Looije, Shailendra B. Patel, Ronald P.J. Oude Elferink, Albert K. Groen. Submitted

Chapter 5

136 Mechanisms of cholesterol secretion

ABSTRACT The heterodimer Abcg5/g8 is involved in cholesterol secretion into bile. Two molecular mechanisms have been proposed in literature: a) flopping of cholesterol from the inner leaflet to the outer leaflet (1), or lowering the activation energy for cholesterol desorption from the membrane (2). In this study we studied these mechanisms by infusing Abcg8(+/+), (+/-) and (-/-) mice with hydrophilic and hydrophobic bile salts. Our results showed that infusion of hydrophobic bile salts could not elicit cholesterol secretion in Abcg8(-/-) mice suggesting absence of cholesterol in the outer leaflet of the membrane. In agreement with this hypothesis, infusion of TDC resulted in cholestasis, which was induced much earlier in (-/-) mice than compared to (+/-) and (+/+) mice. Feeding the mice the plant sterol diosgenin prevented bile salt-induced cholestasis but did not increase TDC-induced cholesterol secretion in Abcg8(-/-) mice. In conclusion, our results suggest that Abcg5/g8 primarily are involved in making available of cholesterol for both vesicle secretion and micellar extraction.

137 Chapter 5

INTRODUCTION

The ABC half-transporters Abcg5 and Abcg8 have been identified as key proteins in biliary cholesterol secretion and mutations in either of these genes underlie the disease sitosterolemia (3-5). In patients having this disorder the intestinal absorption of plant /non-cholesterol sterols is increased, resulting in high plasma levels and accumulation of these sterols in tissue and organs (6). In healthy individuals the low percentage of plant sterols that is absorbed in the intestine is secreted very efficiently into bile by the liver. This process is also impaired in case of sitosterolemia (7). These phenotypic observations in patients suggested that the role of Abcg5/g8 in the intestine is to efflux back sterols into the lumen whereas in the liver they mediate excretion of sterols into bile. Moreover, both genes are highly expressed in the liver, small intestine and gallbladder (3;8), the main organs involved cholesterol handling in the enterohepatic circulation. In accordance with this hypothesis, mice overexpressing the human ABCG5/G8 showed reduced intestinal absorption of sterols and an increased cholesterol concentration in gallbladder bile (9), whereas absence of Abcg5/g8 in mice resulted in increased intestinal absorption of plant sterols and a 90% decrease in gallbladder cholesterol concentration compared to wild type mice. In concordance with the human phenotype and the suggested heterodimerization of the two proteins, mice lacking only Abcg5 or only Abcg8 showed a similar sitosterolemia phenotype as mice lacking both Abcg5 and Abcg8 mice (10-12). Furthermore, the hepatic expression levels of Abcg5 and Abcg8 have been shown to correlate with cholesterol secretion in most studied models thus far (13-16) although some exceptions have been reported as well. In particular, in mice fed a diosgenin-containing diet a 16-fold increase in cholesterol secretion was shown whereas no change in expression of both genes was observed (16). However, the effect of diosgenin on cholesterol secretion proved to be dependent on Abcg8 (Chapter 4). In Abcb11(-/-) (or Bsep) mice fed a cholate-containing diet (17), cholesterol secretion was increased whereas hepatic Abcg5/g8 expression was decreased. Tauscher et al. (8) have shown that regulation does not have to take place at the RNA expression level: upon stimulation with an LXR-agonist the Abcg5/g8 proteins seemed to translocate to the apical membrane of the gallbladder cells whereas RNA expression levels did not change. By QTL analysis comparing gallstone-resistant and gallstone-susceptible mice, Abcg5/g8 have also been found as a locus which would contribute to cholesterol gallstone formation (18) and the hepatic expression of these genes was higher in the gallstone-susceptible mice. This finding correlated with the higher cholesterol secretion levels found in these susceptible mice. Although the importance of Abcg5/g8 has been established, the exact mechanism of cholesterol release into bile has not been elucidated. The major driving force for biliary lipid secretion is bile salt (BS) secretion (19-22). Cholesterol (CH) and phospholipid (PL) secretion are coupled under most (non)physiological conditions and lipid secretion is mainly bile salt-dependent (23). Several mechanisms have been suggested for cholesterol secretion, among which exocytosis, membrane shedding, fusion and budding of pre-formed vesicles (24-27) and direct extraction of lipids by simple or mixed micelles (19). With the discovery of Abcg5/g8 ideas have been put forward about how these proteins would act to transport sterols and in particular cholesterol across the membrane into bile.

138 Mechanisms of cholesterol secretion

Wittenburg and Carey (1) suggested that Abcg5 and Abcg8 might be involved in translocation of cholesterol from the inner to outer leaflet of the canalicular membrane similarly to what has been shown for Abcb4 (Mdr2/MDR3) in translocation of PC (28-30). After translocation of cholesterol, Abcg5/g8 would be involved in extrusion of cholesterol as monomers from the extracellular leaflet of the canalicular membrane into the canalicular space. Afterwards cholesterol would diffuse to mixed micelles and phospholipid vesicles to be solubilized. An argument against the role of ABCG5/G8 as flippase would be that cholesterol has been shown to be able to flip/flop rapidly between membrane layers spontaneously. Several studies have reported very fast flip- flop rates for cholesterol in PC and PC:C vesicles and in erythrocyte membranes (t1/2 ranging from less than 50 min (31) to less than 1 second (32), depending on the method used to quantify the flip-flop rate). Therefore the participation of a specific protein for translocation of cholesterol would seem unlikely. Whether, however, the above mentioned spontaneous translocation rates are fast enough to result in the physiological amounts of cholesterol secreted into bile, might be questionable. Furthermore, spontaneously translocation in protein-free (model) membranes may be different compared to physiological membranes containing proteins and other lipids with distinct affinities for cholesterol. The canalicular membrane of hepatocytes has been shown to be high in sphingomyelin. Since sphingomyelin has a high affinity for cholesterol this may influence cholesterol translocation. The spontaneous translocation activity of cholesterol led Donald Small to propose another role for Abcg5/g8 in cholesterol secretion (2). He suggested that Abcg5/g8 might be involved in decreasing the energy required to release cholesterol from the canalicular membrane which activates cholesterol so that part of the molecule would stick out or be lifted out of the outer leaflet of the canalicular membrane. According to this proposal, the proteins would form a channel which binds cholesterol and which would “push” cholesterol partially into the lumen when ATP is hydrolyzed. Under these circumstances, the accessibility of cholesterol to be extracted by BS/PL micelles would be enhanced. In his opinion, this mechanism would be more favorable as opposed to cholesterol flippase-activity of Abcg5/g8. However, micellar extraction of cholesterol is not the only mechanism. Vesicles consisting of cholesterol and phospholipids have been observed in bile (33-35) and vesiculation of the outer leaflet as mechanism for lipid secretion has been proposed as well. Abcb4-mediated translocation of PC would result in the accumulation of PC in the outer leaflet and would induce vesicle formation on the outer leaflet. In this model cholesterol was proposed to get into these vesicles by lateral diffusion (36;37). However, vesicle secretion as mechanism for lipid secretion is not taken into account in the proposal of Small. In previous studies we have shown that the hydrophilic bile salt TUDC is only slightly able to induce cholesterol secretion in Abcg8(-/-) mice (Chapter 4). In the study presented here experiments were performed to further investigate the mechanism and role of Abcg5/

139 Chapter 5

MATERIAL and METHODS

Animals and diets Male Abcg8(+/+), Abcg8(+/-) and Abcg8(-/-) were used and were fed a control diet (AM-II, Hope Farms, Woerden, The Netherlands). Abcg8 mice (C57Bl/6x129Sv) were generated as described (10), and further bred in the animal facility of the Academic Medical Center. Diosgenin-feeding experiments were performed as described before (Chapters 3 and 4). All studies were approved by animal ethic committee of the Academic Medical Center.

Bile sampling Mice were anaesthetized by i.p injection of 1 ml/kg Hypnorm (fentalnyl/fluanisine) and 10 mg/kg diazepam. The abdomen was opened and the gallbladder was cannulated after distal ligation of the common bile duct. Directly after cannulation bile was collected for 10 min. Bile samples were immediately frozen at -20° C. The body temperature was maintained by placing the animals on a thermostatted heating pad and covering them with a piece of thin foil. Bile flow was determined gravimetrically assuming a density of 1 g/ml for bile. To determine maximal secretion rates of biliary lipid secretion, first bile fractions were collected for 90 min to deplete the endogenous bile salt pool. Subsequently, Tauroursodeoxycholate (TUDC, 45 mM stock solution), Taurocholate (TC, 30 mM stock solution) or Taurodexycholate (TDC, 10 mM stock solution) (Sigma Chemical Co., MO, USA) dissolved in PBS were infused into the jugular vein at stepwise increasing concentration rates as indicated in the figures and tables. During infusion bile was collected in 10 min fractions and analyzed for bile salt and lipid content.

Cholesterol, bile salts and phospholipid measurements Bile samples were analyzed on cholesterol, phospholipid and bile salt concentrations. Cholesterol content was assayed enzymatically with cholesterol oxidase (38). Total bile salt concentration was measured spectrophotometrically with 3-α-hydroxysteroid dehydroxygenase (39) and total phospholipid concentrations were determined according to Gurantz et al. (40).

Statistical analysis Data are shown as mean ± SD of at least 4 animals per group. Statistical significance of differences was evaluated by Students t-test or Mann Whitney U test. Significance was set at P values < 0.05.

140 Mechanisms of cholesterol secretion

RESULTS

To investigate whether cholesterol secretion could be induced by hydrophobic bile salts in absence of Abcg8 experiments were performed in which Abcg8(+/+), (+/-) and (-/-) mice were infused with increasing concentrations of the hydrophobic bile salts Taurocholic acid (TC) and Taurodeoxycholic acid (TDC). TC is less hydrophobic than TDC and has less capacity to solubilize cholesterol (41). The results were compared to previous experiments in which Abcg8 mice were infused with TUDC (Table 1). Endogenous bile flow (BF) and bile salt (BS) secretion rates were similar in the different genotypes and no significant changes were observed between wild-type, heterozygote and knockout mice (data not shown and Chapter 3). Biliary phospholipid (PL) secretion was 40% reduced (not significant) in Abcg8(-/-) mice compared to wild-type mice. Cholesterol (CH) secretion was on average 70% reduced in Abcg8(-/- ) mice, similar to previous results (data not shown and Chapter 3). Prior to starting the infusion, the mice were depleted of endogenous bile salts for 90 min to obtain maximal replacement by the infused bile salt. Tables 1, 2 and 3 show that maximal BS secretion rates after infusion of the bile salts were not significantly different between wild-type, heterozygote and knockout mice for each of the three infused bile salts. Note that the maximal BS secretion rates reached after TC- and TUDC-infusion were considerably higher compared to those reached after TDC infusion. No significant differences in BF were observed between genotypes per infused bile salt. In general, significantly lower BF rates were measured after infusion with TDC compared to TC and TUDC, however. In Abcg8(+/+) mice, infusion of TDC, TC and TUDC did not result in significant differences in maximal CH secretion rates (3.9 ± 1.5, 4.8 ± 1.7 and 4.6 ± 1.5 nmol/min.100g, respectively, Tables 1, 2 and 3). In Abcg8(-/-) mice, bile salt infusion induced slight elevation of CH secretion but maximal CH secretion rates were significantly lower when compared to wild-type mice (P< 0.05). No significant differences in bile salt-induced CH secretion were noticed in Abcg8(-/-) mice after TUDC, TC or TDC infusion. Moreover, in Abcg8(+/-) mice, infusion of the three bile salts solutions differing in hydrophobicity resulted in similar maximal biliary CH secretion rates. Interestingly, maximal PL secretion after infusion with each of the three bile salts was consistently lower in Abcg8(-/-) mice compared to wild-type and heterozygote mice (Tables 1, 2 and 3), although no significance was reached.

Table 1: Maximal biliary secretion rates after Tauroursodeoxycholate infusion in Abcg8(+/+), (+/-) and (-/-) mice

Genotype Bile flow Bile salt Phospholipid Cholesterol (µl/min) (nmol/min.100g) (nmol/min.100g) (nmol/min.100g) Abcg8(+/+) 9.24 ± 3.13 1517 ± 486 53.1 ± 19.6 4.59 ± 1.50 Abcg8(+/-) 9.57 ± 2.68 1677 ± 498 45.3 ± 16.3 3.20 ± 1.34 Abcg8(-/-) 14.30 ± 2.05 # 1802 ± 311 39.4 ± 13.4 0.95 ± 0.18*

Tauroursodeoxycholate was infused via the jugular vein at stepwise increasing concentration rates (600-2400 nmol/min.100g body weight). Maximal secretion rates were calculated as average from 4 consecutive time points at maximal secretion for each mouse. Data represent mean ± SD for n = 4-6 mice per group. * P= 0.002 vs wild-type mice. # P = 0.028 vs wild-type mice.

141 Chapter 5

Table 2: Maximal biliary secretion rates after Taurocholate infusion in Abcg8(+/+), (+/-) and (-/-) mice

Genotype Bile flow Bile salt Phospholipid Cholesterol (µl/min) (nmol/min.100g) (nmol/min.100g) (nmol/min.100g) Abcg8(+/+) 10.16 ± 3.05 1043 ± 298 92.7 ± 44.6 4.84 ± 1.71 Abcg8(+/-) 10.73 ± 2.14 1171 ± 209 69.5 ± 10.6 3.12 ± 0.64 Abcg8(-/-) 9.70 ± 2.74 857 ± 230 51.1 ± 19.7 0.87 ± 0.30*

Taurocholate was infused via the jugular vein at stepwise increasing concentration rates (100-400 nmol/min.100g body weight). Maximal secretion rates were calculated as described at Table 1. Data represent mean ± SD for n = 4-6 mice per group. * P < 0.01 vs wild-type mice.

The maximal BS secretion rates observed after TDC, TC and TUDC infusion differed tremendously. For a more direct comparison of the effect of the infused bile salts on CH secretion and to normalize for these differences in BS secretion rates, CH/BS ratios were calculated to determine the amount of cholesterol secreted in bile per amount of secreted bile salt. The results are shown in Table 4. As expected, in wild- type mice infusion of the hydrophobic bile salt TDC resulted in a 5-fold increase of the biliary CH/BS ratio compared to the hydrophilic bile salt TUDC (from 0.003 ± 0.0005 to 0.017 ± 0.004). This indicated that indeed per secreted µmol of TDC more cholesterol is secreted than per µmol of TUDC. Also in Abcg8(-/-) mice, the CH/BS ratio for TDC was increased compared to the CH/BS ratio for TUDC (from 0.00053 ± 0.00006 to 0.0072 ± 0.002), indicating, that TDC infusion also in Abcg8(-/-) mice elicited more cholesterol per bile salt than TUDC. Moreover, when directly compared, TDC induced cholesterol secretion more in Abcg8(-/-) mice than in wild-type mice ( 5.7-fold for wild-type and 13.7-fold for knockout), despite lower maximal absolute CH secretion levels in Abcg8(-/-) mice. Also in heterozygote mice the CH/BS ratio was 13.6-fold increased in TDC-infused mice compared to TUDC infused mice (0.002 ± 0.0005 to 0.025 ± 0.015). TC-infusion resulted in similar ratios as after TUDC-infusion in wild-type mice whereas in knockout mice significantly more CH per BS was secreted compared to TUDC-infusion (Table 4). Previous experiments have shown that feeding mice the plant sterol diosgenin induced CH secretion and that Abcg8 was required for this increase (Chapter 4). The results of TUDC-infusion experiments in these diosgenin-fed mice also suggested that diosgenin affected a step of cholesterol handling before Abcg5/g8. When indeed diosgenin increases the supply of cholesterol to the canalicular membrane it can be

Table 3: Maximal biliary secretion rates after Taurodeoxycholate infusion in Abcg8(+/+), (+/-) and (-/-) mice.

Genotype Bile flow Bile salt Phospholipid Cholesterol (µl/min) (nmol/min.100g) (nmol/min.100g) (nmol/min.100g) Abcg8 (+/+) 4.67 ± 0.99 229 ± 79 67.0 ± 33.5 3.9 ± 1.5 Abcg8(+/-) 4.74 ± 0.76 167 ± 53 43.8 ± 10.1 3.6 ± 1.5 Abcg8(-/-) 4.43 ± 0.62 181 ± 59 45.4 ± 17.3 1.2 ± 0.3*

Taurodexycholate was infused via the jugular vein at stepwise increasing concentration rates (100- 400 nmol/min.100g body weight). Maximal secretion rates were calculated as described at table 1. Data represent mean ± SD for n = 4-6 mice per group. * P= 0.011 vs wild-type mice.

142 Mechanisms of cholesterol secretion

Table 4: Cholesterol/bile salt ratios in bile of Abcg8(+/+), (+/-) and (-/-) mice infused with Tauroursodeoxycholate, Taurocholate and Taurodeoxycholate.

Genotype CH/BS TUDC CH/BS TC CH/BS TDC Ratio TDC/TUDC Abcg8 (+/+) 0.003 ± 0.0005 0.005 ± 0.002 0.017 ± 0.004 5.68 (P= 0.002) Abcg8(+/-) 0.002 ± 0.0005 0.003 ± 0.0006 0.025 ± 0.015 13.55 (P=0.02) Abcg8(-/-) 0.0005 ± 5.78E-05 0.001 ± 0.0002 0.007 ± 0.0025 13.68 (P=0.001)

The cholesterol/bile salt ratio was calculated as the average of maximal cholesterol secretion rates divided by the average of maximal bile salt secretion of each individual mouse and the average of these ratios was taken for each group (n>4). TUDC: Tauroursodeoxycholate, TC: Taurocholate, TDC: Taurodeoxycholate, CH: cholesterol, BS: bile salt.

anticipated that more cholesterol may be available in the membrane for direct extraction by hydrophobic BS in the Abcg8(-/-) mice compared to knockout mice on the control diet. Abcg8(+/+), (+/-) and (-/-) mice fed a 1% diosgenin-supplemented diet for 18 days were infused with increasing rates (100-400 nmol/min.100 g body weight) of the hydrophobic bile salt TDC and biliary CH secretion rates were determined. These values were compared to the values of the mice fed the control diet as well as to mice fed the diosgenin diet and infused with the hydrophilic bile salt TUDC. Endogenous BF, BS and PL secretion were not affected by diosgenin (data not shown). The endogenous CH secretion rates were induced 3.7-fold (P<0.0001) in Abcg8(+/+) mice fed the diosgenin-diet, and a small increase in Abcg8(-/-) mice (1.4-fold, not significant) was observed. TDC infusion led to increased maximal BF in all three genotypes fed the diosgenin diet when compared to mice fed the control diet (compare Tables 3 and 6). In contrast to when mice were fed the control diet (Table 1 vs 3), in diosgenin-fed Abcg8(-/-) mice, TDC and TUDC infusion resulted in maximal PL secretion rates which were similar to wild-type mice (Table 5 vs 6). TDC-infusion in diosgenin-fed wild-type mice further increased the maximal CH secretion rates (2.9-fold, P= 0.007, Table 5 vs 6) and these levels were similar to those obtained after TUDC infusion in diosgenin-fed wild type mice. Interestingly, diosgenin had no effect on TDC-induced CH output in Abcg8(-/-) mice (compare Table 6 to Table 3). In contrast, in diosgenin- fed heterozygote mice, maximal CH secretion was 2.4-fold induced (P=0.003) by

Table 5: Maximal secretion rates after Tauroursodeoxycholate infusion in Abcg8(+/+), (+/-) and (-/-) mice fed a 1% diosgenin-supplemented diet.

Genotype Bile flow Bile salt Phospholipid Cholesterol (µl/min) (nmol/min.100g) (nmol/min.100g) (nmol/min.100g) Abcg8(+/+) 14.34 ± 1.56 * 1833 ± 400 55.05 ± 10.36 13.37 ± 3.67# Abcg8(+/-) 9.70 ± 4.84 1190 ± 726 40.24 ± 26.35 3.80 ± 2.65 + Abcg8(-/-) 18.66 ± 1.81 2164 ± 358 54.66 ± 12.73 1.87 ± 0.21+^

Mice were fed a 1% diosgenin-supplemented diet for 18 days. Thereafter Tauroursodeoxycholate was infused via the jugular vein at stepwise increasing concentration rates (600-2400 nmol/min.100g body weight). Maximal secretion rates were calculated as average from 4 consecutive time points at maximal secretion for each mouse. Data represent mean ± SD for n = 4-6 mice per group. * P < 0.05 vs wild-type mice fed the control diet (Table 1). # P < 0.002 vs wild-type mice fed the control diet (Table 1). + P<0.001 vs diosgenin-fed wild-type mice. ^ P < 0.001 vs knockout mice fed the control diet (Table 1).

143 Chapter 5

Table 6: Maximal biliary secretion rates after Taurdeoxycholate infusion in Abcg8(+/+), (+/-) and (-/-) mice fed a 1% diosgenin-supplemented diet

Genotype Bile flow Bile salt Phospholipid Cholesterol (µl/min) (nmol/min.100g) (nmol/min.100g) (nmol/min.100g) Abcg8(+/+) 6.46 ± 0.89 308 ± 79 61.01 ± 16.33 11.33 ± 4.47* Abcg8(+/-) 6.22 ± 1.24 256 ± 64 57.73 ± 19.64 8.69 ± 2.13 * Abcg8(-/-) 6.87 ± 0.40 244 ± 60 57.90 ± 9.21 1.53 ± 0.14#

Mice were fed a 1% diosgenin-supplemented diet for 18 days. Taurodeoxycholate was infused via the jugular vein at stepwise increasing concentration rates (100-400 nmol/min.100g body weight). Maximal secretion rates were calculated as average from 4 consecutive time points at maximal secretion for each mouse. Data represent mean ± SD for n = 4-6 mice per group. * P < 0.01 vs mice fed the control diet of the same genotype (Table 3). # P < 0.005 vs diosgenin-fed wild-type mice.

TDC infusion compared to the same genotype fed the control diet, whereas in TUDC- infused Abcg8(+/-) mice maximal CH secretion was not induced by diosgenin. When compared to mice of the same genotype fed the control diet, in the diosgenin- fed wild-type and heterozygote mice, the CH/BS ratio after TDC infusion increased 2.4-fold and 1.5-fold respectively (Table 7), indicating that per µmol of TDC more cholesterol was secreted in diosgenin-fed wild-type and heterozygous mice. In contrast, in diosgenin-fed knockout mice the CH/BS ratio remained similar (0.0073 ± 0.002 vs 0.0065 ± 0.001) compared to control mice infused with TDC, indicating that diosgenin did not affect cholesterol availability in the canalicular membrane of Abcg8-knockout mice. Finally, we observed that during the infusion of TC and TDC nearly all mice became cholestatic at higher infusion rates. Interestingly, especially the Abcg8(-/-) mice were more susceptible to bile salt-induced cholestasis than the wild-type and heterozygote mice (Fig 1). Intriguingly, when similar TDC-infusion experiments were performed in Abcg8(+/+), (+/-) and (-/-) mice fed the 1% diosgenin-supplemented diet none of the mice (including Abcg8(-/-) mice) became cholestatic (Fig 2), indicating that dietary diosgenin protected against bile salt-induced cholestasis.

Table 7: Cholesterol/bile salt ratio in bile of mice fed a 1% diosgenin-supplemented diet infused with the indicated bile salts.

Genotype CH/BS TUDC CH/BS TDC Ratio TDC/TUDC Ratio D/C Ratio D/C TUDC TDC Abcg8(+/+) 0.0073 ± 0.002 0.041 ± 0.02 5.6 (P= 0.019) 2.4 2.4 Abcg8(+/-) 0.0048 ± 0.005 0.037 ± 0.01 7.7 (P=0.014) 2.6 1.5 Abcg8(-/-) 0.0009 ± 0.001 0.0065 ± 0.001 7.4 (P=0.0002) 1.7 0.9

144 Mechanisms of cholesterol secretion

DISCUSSION

Several studies (9;12) have shown that Abcg5/g8 play a very important role in the regulation of biliary sterol secretion and the purpose of this study was to investigate the mechanism of action of Abcg5/8 in this process. Wittenburg and Carey (1) proposed Abcg5/g8 to be involved in flopping cholesterol from the inner leaflet to the outer leaflet of the canalicular membrane. However, cholesterol has been shown to flip-flop very fast in several studies (42-45) which questions the necessity for a protein in translocation of cholesterol. Recently, Steck et al (32) showed that the flip- flop rate of cholesterol is very fast in erythrocyte membranes. These membranes are high in sphingomyelin, which may be similarly to the composition of the canalicular membrane, which is high in sphingomyelin as well (46;47). Moreover, all cholesterol present in the erythrocyte membranes could be extracted by cyclodextrin in this study. The studies from Steck et al. also showed that the cyclodextrin-mediated cholesterol extraction was more likely to occur via an activation-collision mechanism and not by simple desorption of cholesterol into the aqueous phase. Previously the same group has shown that cholesterol transport between two membranes occurs by the same activation-collision mechanism, in which collision of two membranes, or a particle to a membrane, generates (part of) the energy required for cholesterol to be released out of the membrane (activation) (48).The activation energy required to release cholesterol from the membrane as calculated by Steck et al. is 28 kcal/mol (32). This amount of energy would require a very long time span (hrs) to result in spontaneous release of cholesterol. It has been suggested that BS molecules can decrease the activation energy required for desorption of lipids from membranes (25;49;50). The activation/collision process might therefore also take place in the canalicular space to release cholesterol. In that case, the collision of bile salt or mixed micelles to the canalicular membrane might be able to generate the energy required to activate cholesterol, resulting in a decrease of the energy required for cholesterol to be released from the membrane/captured by bile salt micelles. According to Small, the collision of bile salt micelles to the canalicular membrane fails to result in enough energy to release cholesterol from the membrane. He therefore postulated a role for Abcg5/g8 in lowering the activation energy for cholesterol efflux. The hypothesis of Small largely ignores the formation of CH/PL vesicles in the canalicular space which has been suggested as mechanism of cholesterol secretion (27;33;35;37). BS micelles would in that case extract CH form these vesicles. Studies from Crawford et al. (36;37) indicated that vesicles are secreted from the outer leaflet of the canalicular membrane. In this study the maximal CH secretion rates were determined in Abcg8 (+/+), (+/-) and (-/-) mice after infusion with the hydrophobic bile salts TC and TDC and compared with TUDC-infusion (hydrophilic bile salt) experiments from previous studies (Chapter 4). Our results showed that TDC could not elicit CH secretion in Abcg8(-/-) mice to higher absolute levels compared to TC or TUDC (Tables 1, 2 and 3). Infusion of TDC induced cholestasis in the (-/-) mice earlier than in (+/-) and (+/+). These results might suggest that either cholesterol is absent in the outer leaflet of canalicular membrane of Abcg8(-/-) mice or at a greatly reduced concentration so that TDC is not

145 Chapter 5

A 18 G8 +/+ 16 G8 +/- ) ) G8 -/- 14

6 Bile flow (µl/min.100g Bile flow (µl/min.100g 4

0 0 50 100 150 200 250 B Time (min) 15 G8 +/+ G8 +/- 12 G8 -/- ) )

6 Bile flow (µl/min.100g Bile flow (µl/min.100g 3

0 0 50 100 150 200 250 C Time (min) 10 G8 +/+ 9 G8 +/- G8 -/- 8 ) ) 7

3 Bile flow (µl/min.100g flow Bile Bile flow (µl/min.100g flow Bile 2

0 0 50 100 150 200 250 Time (min)

146 Mechanisms of cholesterol secretion

Figure 1: Infusion of hydrophobic bile salts Taurocholate and Taurodeoxydeoxycholate induces cholestasis in Abcg8(+/+), (+/-) and (-/-) mice. Bile duct ligation was performed and the gallbladder was cannulated. After depletion of the endogenous bile salt pool for 90 min, mice were infused with (A) TUDC (600-2400 nmol/min.100g), (B) TC (100- 400 nmol/min.100g) and (C) TDC (100-400 nmol/min.100g) in stepwise increasing rates. Bile was collected in fractions of 10 min. Data are given as mean ± SE (n ≥ 4 for all groups). Arrow: start of bile salt infusion. able to extract it. Relative to wild-type mice, however, the maximal CH secretion in Abcg8(-/-) mice was 20% of wild-type mice after TUDC-infusion but 31.5% after TDC-infusion. This may suggests that there is a relative increase in CH secretion after TDC-infusion in Abcg8(-/-) mice compared to TUDC-infused knockout mice. Moreover, these results may indicate that although less CH is secreted in Abcg8(-/-) mice, it is extracted more rapidly than in wild-type mice. In heterozygous mice the infusion of TUDC and TC led to maximal CH secretion rates were 70% and 65% respectively of wild type mice whereas infusion of TDC in heterozygous mice resulted in 90% of wild-type mice. This suggests again that Abcg5/g8 may play a less important role in CH secretion when more hydrophobic bile salts are secreted. When CH/BS ratios were calculated, to normalize for differences in BS secretion rates, this showed that in wild-type mice on the control diet, infusion of the hydrophobic bile salt TDC indeed resulted in more CH secreted per amount of TDC, as expected (51-53), when compared to TUDC-infused wild-type mice (5.6-fold). However, in Abcg8(-/-) mice TDC increased the CH/BS ratio compared to TUDC as well and this effect of TDC seemed to be even stronger than in wild-type mice (13.7- fold increase). It can be argued that this effect is caused by solubilization of the canalicular membrane, however the CH/BS ratio is also higher at low concentrations of TDC infusion (data not shown) at which no damaging effect yet of TDC is assumed. However this possibility cannot completely be excluded. A potential confounding factor in these studies is the presence of high levels of plant sterols (mainly sitosterol and campesterol) in livers of Abcg8(-/-) mice (Chapter 3). One might expect that also the membranes, of particular importance the canalicular membrane, of hepatocytes of Abcg8(-/-) mice contain more of these phytosterols than the membranes of the Abcg8(+/+) mice. The lipid composition of the canalicular membrane differs from that of the basolateral membrane in that it contains a higher percentage of sphingomyelin (SM) and cholesterol compared to basolateral membranes (46;47). Several studies have shown that cholesterol has a high affinity for SM (54-59) and that SM is probably located together with cholesterol in detergent- resistant liquid-ordered microdomains within the membrane. It can be argued that the plant sterols might affect extraction of cholesterol since plant sterols have been shown to be able to change the fluidity and ordering of membranes in vitro (60-62). Due to the high concentration of plant sterols in the canalicular membrane of (-/-) mice, cholesterol may be differently packed which may possibly affect extraction by TDC. In Abcg8(+/-) mice the hepatic levels of plant sterols are only slightly increased and the cholesterol concentrations are normal (10). Therefore the composition of the canalicular membranes of Abcg8(+/-) mice is likely to be comparable to those of Abcg8(+/+). In this end, heterozygous mice, which have normal sterol levels, could be more informative. A similar increase in CH/BS ratio as in Abcg8(-/-) mice was

147 Chapter 5

0 7

Bile flow (µl/min.10 3

0 0 50 100 150 200 250 Time (min)

Figure 2: Dietary diosgenin prevents cholestasis following TDC infusion in Abcg8(+/+), (+/-), and (-/-) mice. Mice received a control diet or 1% diosgenin-supplemented diet for 18 days. The bile duct was ligated and after depletion of the endogenous bile salt pool for 90 min, mice were infused with TDC in stepwise increasing rates (100-400 nmol/min.100g). Bile was collected in fractions of 10 min. Data are given as mean ± SE (n ≥ 4 for all groups). Triangles: mice fed the control diet, circles: mice fed the diosgenin-supplemented diet. Black symbols: Abcg8(+/+) mice, grey symbols: Abcg8(+/-) mice, white symbols: Abcg8(-/-) mice. Arrow: start of bile salt infusion. found in Abcg8(+/-) mice (13.6-fold), suggesting that a 50% reduction in expression of Abcg8 resulted in a similar effect on availability of CH as the absence of Abcg8. This might be explained by a change in the mechanism of CH secretion. Under physiological conditions in wild-type mice both vesicle secretion and micellar extraction probably are being used, with vesicle secretion as the major pathway. This may vary depending on the hydrophobicity of the acceptor and on the availability of cholesterol. Previous studies indicated that diosgenin is involved in increasing the supply of cholesterol to Abcg5/g8. It is not clear whether the step activated by diosgenin interacts directly with Abcg5/g8 or delivers the cholesterol first to the inner leaflet of the canalicular membrane. Since TDC has a higher capacity to solubilize cholesterol than TUDC, an increased membrane content of cholesterol should surface on comparing the efficacy of TDC to TUDC in eliciting cholesterol secretion of the membrane. Following the reasoning presented above only (+/-) mice should be considered. In the heterozygous mice infused with TUDC, diosgenin fails to induce cholesterol secretion. In a previous study (Chapter 4) we showed this to be due to the full rate control exerted by Abcg5/g8 under these conditions. Interestingly, as shown in Table3 and 6, diosgenin does stimulate CH secretion in Abcg8(+/-) mice when

148 Mechanisms of cholesterol secretion

TDC is infused. Apparently, when TDC is the cholesterol acceptor Abcg5/g8 is less rate-controlling and diosgenin stimulates the Abcg5/g8-independent pathway of cholesterol secretion. Another interesting observation in this study was that the secretion of phospholipids tended to be decreased in Abcg8(-/-) mice compared to Abcg8(+/+) mice, regardless which bile salt was infused. PL secretion was normalized in mice fed the diosgenin diet before application of both TUDC and TDC infusion. PL secretion is mediated by Abcb4 (Mdr2) resulting in vesiculation of the outer leaflet of the canalicular membrane. This is thought to be the only mechanism for PL secretion and would not be mediated by micellar extraction (30;36;37). Since PL secretion is decreased in Abcg8(-/-) mice, Abcg5/8 might play a role in the formation of these vesicles. Alternatively, the decrease in PL secretion might indicate a change in the membrane lipid domain organization in Abcg8(-/-) mice, which might affect the activity of Abcb4, or the presence of plant sterols might inhibit the formation of the membrane vesicles in the outer leaflet in Abcg8(-/-) mice. Infusion of TUDC, TC and TDC induced cholestasis at higher infusion rates, and the onset of cholestasis correlated with the hydrophobicity of the infused bile salts in each genotype (Fig 1). Remarkably, Abcg8(-/-) mice were more susceptible to cholestasis than wild-type and heterozygous mice. Although the exact mechanisms or causes of cholestasis are currently unknown, the experiments in this study indicate a role for Abcg8, either directly or indirectly. Alternatively, the high intracellular concentration of plant sterols and their presence in the outer leaflet might be important in this process. Cholestasis did not occur when the mice were fed a diosgenin-supplemented diet before the infusion protocol was applied. The exact mechanism by.which cholestasis is induced by the infused bile salts is not known, nor the mechanism by which diosgenin does prevent cholestasis is clear to us at this moment. In conclusion, the data in this study confirm that the majority of biliary CH secretion is mediated by Abcg5 and Abcg8 and suggest that Abcg5/g8 plays a role making available of cholesterol in both vesicle secretion and micellar extraction. Which pathway dominates may be depending on the hydrophobicity of the bile salt pool in bile. Additionally, Abcg8 and/or cholesterol may play a role in bile-salt induced cholestasis but further studies are required to elucidate this.

149 Chapter 5

AKNOWLEDGMENTS:

This study was supported by the Netherlands Organization for Scientific Research (NWO) grants 902-23-193 Part of this study has been presented at the AASLD meeting 2003, and published as abstract in Hepatology 38 Suppl. 1. 387A

150 Mechanisms of cholesterol secretion

REFERENCES

1. Wittenburg H, Carey MC. Biliary cholesterol secretion by the twinned sterol half-transporters ABCG5 and ABCG8. J Clin Invest 2002; 110(5):605-609. 2. Small DM. Role of ABC transporters in secretion of cholesterol from liver into bile. Proc Natl Acad Sci U S A 2003; 100(1):4-6. 3. Berge KE, Tian H, Graf GA, Yu L, Grishin NV, Schultz J et al. Accumulation of dietary cholesterol in sitosterolemia caused by mutations in adjacent ABC transporters. Science 2000; 290(5497):1771-1775. 4. Lu K, Lee MH, Hazard S, Brooks-Wilson A, Hidaka H, Kojima H et al. Two genes that map to the STSL locus cause sitosterolemia: genomic structure and spectrum of mutations involving sterolin-1 and sterolin-2, encoded by ABCG5 and ABCG8, respectively. Am J Hum Genet 2001; 69(2):278-290. 5. Lu K, Lee MH, Yu H, Zhou Y, Sandell SA, Salen G et al. Molecular cloning, genomic organization, genetic variations, and characterization of murine sterolin genes Abcg5 and Abcg8. J Lipid Res 2002; 43(4):565-578. 6. Bhattacharyya AK, Connor WE. Beta-sitosterolemia and xanthomatosis. A newly described lipid storage disease in two sisters. J Clin Invest 1974; 53(4):1033-1043. 7. Gregg RE, Connor WE, Lin DS, Brewer HB, Jr. Abnormal metabolism of shellfish sterols in a patient with sitosterolemia and xanthomatosis. J Clin Invest 1986; 77(6):1864-1872. 8. Tauscher A, Kuver R. ABCG5 and ABCG8 are expressed in gallbladder epithelial cells. Biochem Biophys Res Commun 2003; 307(4):1021-1028. 9. Yu L, Li-Hawkins J, Hammer RE, Berge KE, Horton JD, Cohen JC et al. Overexpression of ABCG5 and ABCG8 promotes biliary cholesterol secretion and reduces fractional absorption of dietary cholesterol. J Clin Invest 2002; 110(5):671-680. 10. Klett EL, Lu K, Kosters A, Vink E, Lee MH, Altenburg M et al. A mouse model of sitosterolemia: absence of Abcg8/sterolin-2 results in failure to secrete biliary cholesterol. BMC Med 2004; 2(1):5. 11. Plosch T, Bloks VW, Terasawa Y, Berdy S, Siegler K, Van Der SF et al. Sitosterolemia in ABC- transporter G5-deficient mice is aggravated on activation of the liver-X receptor. Gastroenterology 2004; 126(1):290-300. 12. Yu L, Hammer RE, Li-Hawkins J, von Bergmann K, Lutjohann D, Cohen JC et al. Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in biliary cholesterol secretion. Proc Natl Acad Sci U S A 2002; 99(25):16237-16242. 13. Bloks VW, Bakker-Van Waarde WM, Verkade HJ, Kema IP, Wolters H, Vink E et al. Down- regulation of hepatic and intestinal Abcg5 and Abcg8 expression associated with altered sterol fluxes in rats with streptozotocin-induced diabetes. Diabetologia 2004; 47(1):104-112. 14. Kamisako T, Ogawa H. Effect of obstructive jaundice on the regulation of hepatic cholesterol metabolism in the rat. Disappearance of abcg5 and abcg8 mRNA after bile duct ligation. Hepatol Res 2003; 25(2):99-104. 15. Kamisako T, Ogawa H. Regulation of biliary cholesterol secretion is associated with abcg5 and abcg8 expressions in the rats: effects of diosgenin and ethinyl estradiol. Hepatol Res 2003; 26(4):348-352. 16. Kosters A, Frijters RJ, Schaap FG, Vink E, Plosch T, Ottenhoff R et al. Relation between hepatic expression of ATP-binding cassette transporters G5 and G8 and biliary cholesterol secretion in mice. J Hepatol 2003; 38(6):710-716. 17. Wang R, Lam P, Liu L, Forrest D, Yousef IM, Mignault D et al. Severe cholestasis induced by cholic acid feeding in knockout mice of sister of P-glycoprotein. Hepatology 2003; 38(6):1489- 1499. 18. Wittenburg H, Lyons MA, Li R, Churchill GA, Carey MC, Paigen B. FXR and ABCG5/ABCG8 as determinants of cholesterol gallstone formation from quantitative trait locus mapping in mice. Gastroenterology 2003; 125(3):868-881. 19. Hardison WG, Apter JT. Micellar theory of biliary cholesterol excretion. Am J Physiol 1972; 222(1):61-67. 20. Hofmann AF, Hoffman N. Measurement of bile and acid kinetics by isotope dilution in man. Gastroenterology 1974; 67(2):314-323.

151 Chapter 5

21. Lindblad L, Lundholm K, Schersten T. Influence of cholic and chenodeoxycholic acid on biliary cholesterol secretion in man. Eur J Clin Invest 1977; 7(5):383-388. 22. Poupon R, Poupon R, Grosdemouge ML, Dumont M, Erlinger S. Influence of bile acids upon biliary cholesterol and phospholipid secretion in the dog. Eur J Clin Invest 1976; 6(4):279-284. 23. Mazer NA, Carey MC. Mathematical model of biliary lipid secretion: a quantitative analysis of physiological and biochemical data from man and other species. J Lipid Res 1984; 25(9):932- 953. 24. Coleman R, Rahman K. Lipid flow in bile formation. Biochim Biophys Acta 1992; 1125(2):113- 133. 25. Cohen DE, Leonard MR, Carey MC. In vitro evidence that phospholipid secretion into bile may be coordinated intracellularly by the combined actions of bile salts and the specific phosphatidylcholine transfer protein of liver. Biochemistry 1994; 33(33):9975-9980. 26. Marzolo MP, Rigotti A, Nervi F. Secretion of biliary lipids from the hepatocyte. Hepatology 1990; 12(3 Pt 2):134S-141S. 27. Rigotti A, Nunez L, Amigo L, Puglielli L, Garrido J, Santos M et al. Biliary lipid secretion: immunolocalization and identification of a protein associated with lamellar cholesterol carriers in supersaturated rat and human bile. J Lipid Res 1993; 34(11):1883-1894. 28. Ruetz S, Gros P. Phosphatidylcholine translocase: a physiological role for the mdr2 gene. Cell 1994; 77(7):1071-1081. 29. Ruetz S, Gros P. Enhancement of Mdr2-mediated phosphatidylcholine translocation by the bile salt taurocholate. Implications for hepatic bile formation. J Biol Chem 1995; 270(43):25388- 25395. 30. Smit JJ, Schinkel AH, Oude Elferink RP, Groen AK, Wagenaar E, van Deemter L et al. Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a complete absence of phospholipid from bile and to liver disease. Cell 1993; 75(3):451-462. 31. Lange Y, Cohen CM, Poznansky MJ. Transmembrane movement of cholesterol in human erythrocytes. Proc Natl Acad Sci U S A 1977; 74(4):1538-1542. 32. Steck TL, Ye J, Lange Y. Probing red cell membrane cholesterol movement with cyclodextrin. Biophys J 2002; 83(4):2118-2125. 33. Gilat T, Somjen GJ. Phospholipid vesicles and other cholesterol carriers in bile. Biochim Biophys Acta 1996; 1286(2):95-115. 34. Somjen GJ, Marikovsky Y, Lelkes P, Gilat T. Cholesterol-phospholipid vesicles in human bile: an ultrastructural study. Biochim Biophys Acta 1986; 879(1):14-21. 35. Somjen GJ, Gilat T. Contribution of vesicular and micellar carriers to cholesterol transport in human bile. J Lipid Res 1985; 26(6):699-704. 36. Crawford AR, Smith AJ, Hatch VC, Oude Elferink RP, Borst P, Crawford JM. Hepatic secretion of phospholipid vesicles in the mouse critically depends on mdr2 or MDR3 P-glycoprotein expression. Visualization by electron microscopy. J Clin Invest 1997; 100(10):2562-2567. 37. Crawford JM, Mockel GM, Crawford AR, Hagen SJ, Hatch VC, Barnes S et al. Imaging biliary lipid secretion in the rat: ultrastructural evidence for vesiculation of the hepatocyte canalicular membrane. J Lipid Res 1995; 36(10):2147-2163. 38. Allain CC, Poon LS, Chan CS, Richmond W, Fu PC. Enzymatic determination of total serum cholesterol. Clin Chem 1974; 20(4):470-475. 39. Turley SD, Dietschy JM. Re-evaluation of the 3 alpha-hydroxysteroid dehydrogenase assay for total bile acids in bile. J Lipid Res 1978; 19(7):924-928. 40. Gurantz D, Laker MF, Hofmann AF. Enzymatic measurement of choline-containing phospholipids in bile. J Lipid Res 1981; 22(2):373-376. 41. Armstrong MJ, Carey MC. The hydrophobic-hydrophilic balance of bile salts. Inverse correlation between reverse-phase high performance liquid chromatographic mobilities and micellar cholesterol-solubilizing capacities. J Lipid Res 1982; 23(1):70-80. 42. Lange Y, Dolde J, Steck TL. The rate of transmembrane movement of cholesterol in the human erythrocyte. J Biol Chem 1981; 256(11):5321-5323. 43. Schroeder F, Jefferson JR, Kier AB, Knittel J, Scallen TJ, Wood WG et al. Membrane cholesterol dynamics: cholesterol domains and kinetic pools. Proc Soc Exp Biol Med 1991; 196(3):235-252. 44. Leventis R, Silvius JR. Use of cyclodextrins to monitor transbilayer movement and differential lipid affinities of cholesterol. Biophys J 2001; 81(4):2257-2267. 45. Backer JM, Dawidowicz EA. Transmembrane movement of cholesterol in small unilamellar vesicles detected by cholesterol oxidase. J Biol Chem 1981; 256(2):586-588.

152 Mechanisms of cholesterol secretion

46. Kremmer T, Wisher MH, Evans WH. The lipid composition of plasma membrane subfractions originating from the three major functional domains of the rat hepatocyte cell surface. Biochim Biophys Acta 1976; 455(3):655-664. 47. Meier PJ, Sztul ES, Reuben A, Boyer JL. Structural and functional polarity of canalicular and basolateral plasma membrane vesicles isolated in high yield from rat liver. J Cell Biol 1984; 98(3):991-1000. 48. Steck TL, Kezdy FJ, Lange Y. An activation-collision mechanism for cholesterol transfer between membranes. J Biol Chem 1988; 263(26):13023-13031. 49. Phillips MC, Johnson WJ, Rothblat GH. Mechanisms and consequences of cellular cholesterol exchange and transfer. Biochim Biophys Acta 1987; 906(2):223-276. 50. McLean LR, Phillips MC. Cholesterol desorption from clusters of phosphatidylcholine and cholesterol in unilamellar vesicle bilayers during lipid transfer or exchange. Biochemistry 1982; 21(17):4053-4059. 51. Carulli N, Loria P, Bertolotti M, Ponz dL, Menozzi D, Medici G et al. Effects of acute changes of bile acid pool composition on biliary lipid secretion. J Clin Invest 1984; 74(2):614-624. 52. Heuman DM, Hernandez CR, Hylemon PB, Kubaska WM, Hartman C, Vlahcevic ZR. Regulation of bile acid synthesis. I. Effects of conjugated ursodeoxycholate and cholate on bile acid synthesis in chronic bile fistula rat. Hepatology 1988; 8(2):358-365. 53. Gurantz D, Hofmann AF. Influence of bile acid structure on bile flow and biliary lipid secretion in the hamster. Am J Physiol 1984; 247(6 Pt 1):G736-G748. 54. Lund-Katz S, Laboda HM, McLean LR, Phillips MC. Influence of molecular packing and phospholipid type on rates of cholesterol exchange. Biochemistry 1988; 27(9):3416-3423. 55. Lange Y, D'Alessandro JS, Small DM. The affinity of cholesterol for phosphatidylcholine and sphingomyelin. Biochim Biophys Acta 1979; 556(3):388-398. 56. Slotte JP. Enzyme-catalyzed oxidation of cholesterol in mixed phospholipid monolayers reveals the stoichiometry at which free cholesterol clusters disappear. Biochemistry 1992; 31(24):5472- 5477. 57. Demel RA, Jansen JW, van Dijck PW, van Deenen LL. The preferential interaction of cholesterol with different classes of phospholipids. Biochim Biophys Acta 1977; 465(1):1-10. 58. Bar LK, Barenholz Y, Thompson TE. Dependence on phospholipid composition of the fraction of cholesterol undergoing spontaneous exchange between small unilamellar vesicles. Biochemistry 1987; 26(17):5460-5465. 59. Yeagle PL, Young JE. Factors contributing to the distribution of cholesterol among phospholipid vesicles. J Biol Chem 1986; 261(18):8175-8181. 60. Xu X, London E. The effect of sterol structure on membrane lipid domains reveals how cholesterol can induce lipid domain formation. Biochemistry 2000; 39(5):843-849. 61. Xu X, Bittman R, Duportail G, Heissler D, Vilcheze C, London E. Effect of the structure of natural sterols and sphingolipids on the formation of ordered sphingolipid/sterol domains (rafts). Comparison of cholesterol to plant, fungal, and disease-associated sterols and comparison of sphingomyelin, cerebrosides, and ceramide4. J Biol Chem 2001; 276(36):33540-33546. 62. Halling KK, Slotte JP. Membrane properties of plant sterols in phospholipid bilayers as determined by differential scanning calorimetry, resonance energy transfer and detergent- induced solubilization. Biochim Biophys Acta 2004; 1664(2):161-171.

153 Chapter 5

154

Summary

158 Summary

Summary

Cholesterol gallstone disease affects 10% -15% of the population in the USA (1). In addition to the environmental factors, like diet composition and physical exercise (2) genetic factors seem to play an important role in the formation of these stones. Cholesterol gallstone formation is a multifactorial process involving a multitude of metabolic pathways. A primary pathogenic factor affecting cholesterol gallstone formation is hypersecretion of biliary cholesterol. The majority of biliary secretion of cholesterol is driven by bile salt secretion; however the molecular mechanism of cholesterol secretion was not elucidated at the time of starting the work presented in this study. The purpose of the present thesis was therefore to elucidate the molecular mechanism of biliary cholesterol secretion.

In Chapter One a general overview is given of the genes that have been suggested to be involved in biliary cholesterol secretion. This collection includes genes involved in regulation of cholesterol homeostasis, for example cholesterol biosynthesis, intestinal and hepatic transport proteins and transcription factors. Furthermore, an overview of the human gene defects known to be associated with cholesterol gallstone formation is given. In Chapter Two the role of the two newly identified ABC-half transporters and heterodimeric partners, Abcg5 and Abcg5 was investigated. Mutiations in either of these two genes underlie the disease Sitosterolemia. In this rare disease the intestinal absorption of plantsterols which under normal circumstances are hardly absorbed, is highly increased. This results in increased plasma levels of the plant sterols and accumulation in tissue. In addition the absorption of cholesterol is reported to be increased and is the biliary secretion of sterols impaired. These features made these proteins good candidates to be involved in biliary cholesterol secretion. The study described in this section was performed in a number of mouse models varying in biliary cholesterol secretion rates. In this study we found a linear correlation between the hepatic expression levels of Abcg5 and Abcg8 and the biliary cholesterol secretion rates. Among these models there was one exception to this correlation: feeding mice a 1% diosgenin-containing diet resulted in an increase of biliary cholesterol secretion of ~16-fold, without affecting the hepatic expression of Abcg5 and Abcg8. These studies showed that the heterodimer Abcg5/g8 was important for cholesterol secretion but it also implied the existence of Abcg5/g8-independent pathways of biliary cholesterol secretion, and suggested that diosgenin might exert its effect via this pathway. In Chapter Three the characterization of mice lacking the Abcg8 gene is reported. Increased levels of plant sterols in liver and plasma were shown in these Abcg8(-/-) mice. The most important feature of these mice for this thesis is that biliary cholesterol output is decreased to 80% of the rate found in wild-type mice. Furthermore the localization of Abcg5 was retained to the ER in Abcg8(-/-) mice, making this a good model to further study the mechanism of biliary cholesterol secretion. The stimulating effect of diosgenin on biliary cholesterol secretion was further investigated in Chapter Four. In this study the 1% diosgenin-supplemented diet was fed to the Abcg8(-/-) mice as described in Chapter three, to study the hypothesis that

159

the diosgenin-induced effect on biliary cholesterol secretion was independent of Abcg5/g8, as suggested in chapter two. This study showed that diosgenin-induced biliary cholesterol secretion does require the presence of Abcg8. An alternative explanation for the observed effect of diosgenin on cholesterol secretion is that diosgenin increased Abcg5/g8 protein activity. This could be either by direct interaction with the proteins or by an indirect manner. In vivo experiments in which the hydrophilic bile salt Tauroursodeoxycholic acid was infused to stimulate cholesterol secretion and in vitro cholesterol efflux experiments indicated that diosgenin did not directly affect the activity of Abcg5/g8. To further investigate this, Metabolic Control Analysis was applied in heterozygote Abcg8 mice. This indicated that in the case of high control of Abcg8 on biliary cholesterol secretion diosgenin did not affect the cholesterol secretion rates, which would have been expected if diosgenin interacted with the proteins directly. In addition, diosgenin affected Abcg5/g8-independent cholesterol secretion rates (in Abcg8(-/-) mice) to a similar extent as was observed in wild-type mice. This indicates and supports the idea that diosgenin not directly interacts with the Abcg5/g8 proteins. For further elucidation of the intracellular effect of diosgenin, hepatic gene expression profiling was performed. This analysis showed that the expression of genes involved in cholesterol biosynthesis were upregulated, as well as the expression of a number of genes encoding for Cytochromes P450 and Gluthation transferases. However, gene profiling did not reveal further information about the mechanism by which diosgenin increased biliary cholesterol output. This analysis together with the in vivo and in vitro cell culture experiments, suggested that diosgenin did not interact directly with Abcg8 but increased the availability of cholesterol to be secreted into bile. In Chapter Five the mechanism of cholesterol secretion and the role of Abcg8 therein was further investigated. Two mechanisms for Abcg5/g8 are proposed in literature. The first one is a translocation-mechanism, in which Abcg5/g8 would translocate cholesterol from the inner leaflet of the canalicular membrane to the outer leafet, whereas the second proposal suggests that Abg5/g8 would play a role in decreasing the activation energy required for cholesterol to leave the outer leaflet of the canalicular membrane (3;4). To investigate this, Abcg8 wild-type, heterozygote and knock-out mice were infused with the bile salts Taurodeoxycholic acid (TDC), Taurocholic acid and Tauroursodeoxcycholic acid and Taurodeoxycholate. In addition, the same TDC infusion experiments were performed in mice fed the 1% diosgenin-diet to further elucidate whether diosgenin increased the presence of cholesterol in the canalicular membrane. Infusion of the most hydrophobic bile salt included in this study, TDC, did not induce cholesterol secretion in Abcg8(-/-) mice. The results from this study suggest that Abcg5/g8 plays a role making available of cholesterol for both vesicle secretion and micellar extraction. Which pathway dominates may be depending on the hydrophobicity of the bile salt pool in bile. The bile salt infusion studies also showed that Abcg8 might play a role in bile salt-induced cholestasis, since Abcg8(-/-) became cholestatic at a much lower dose of TDC than wild-type mice when infused with this bile salt, whereas feeding the mice diosgenin prevented the bile acid-induced cholestasis.

160 Summary

REFERENCES

1. Browning JD, Horton JD Gallstone disease and its complications. Semin Gastrointest Dis. 2003; 14(4):165-77. 2. Cuevas A, Miquel JF, Reyes MS, Zanlungo S, Nervi F. Diet as a risk factor for cholesterol gallstone disease. J Am Coll Nutr. 2004; 23(3):187-96. 3. Wittenburg H, Carey MC. Biliary cholesterol secretion by the twinned sterol half-transporters ABCG5 and ABCG8. J Clin Invest 2002; 110(5):605-609. 4. Small DM. Role of ABC transporters in secretion of cholesterol from liver into bile. Proc Natl Acad Sci USA 2003; 100(1):4-6.

161

Samenvatting

164 Samenvatting

Samenvatting

10%-15% van de westerse bevolking wordt getroffen door cholesterolgalstenen. Naast omgevingsfactoren zoals diet en beweging, lijken ook genetische factoren een rol te spelen in de vorming van deze stenen. De vorming van cholesterolgalstenen is een multifactorieel proces en er zijn een veelvoud van metabole paden bij betrokken. Een van de voornaamste pathogene factoren in het ontstaan van cholesterol galstenen is hypersecretie van cholesterol naar de gal. Het grootste gedeelte van de secretie van cholesterol naar de gal wordt bepaald door de secretie van galzouten, maar bij de start van deze studie was niet bekend wat de moleculaire mechanismen van de secretie van cholesterol naar de gal waren. Het doel van de studies beschreven in dit proefschrift was daarom ook om uit te zoeken wat deze moleculaire mechanismen zijn die betrokken zijn bij de secretie van cholestol naar de gal.

In Hoofdstuk Een wordt een algemeen overzicht gegeven van de genen waarvan in de literatuur gesuggereerd wordt dat deze betrokken kunnen zijn bij de secretie van cholesterol naar de gal. Deze verzameling bevat genen die betrokken zijn bij de regulatie van de cholesterolhomeostase, bijvoorbeeld de synthese van cholesterol, darm- en levertransporteiwitten en transcriptiefactoren. Verder wordt een overzicht gegeven van de humane gendefecten die geassocieerd worden met de vorming van cholesterol galstenen. In Hoofstuk Twee wordt een rol de voor twee recentelijk geidentificeerde ABC- halftransporters en heterodimere partners, Abcg5 en Abcg8, bestudeerd. Deze twee genen waren beschreven als de genen die gemuteerd zijn in de ziekte Sitosterolemie. Dit is een zeldzame ziekte waarbij de absorptie van plantsterolen in darm, die normaal gesproken nauwelijks worden opgenomen, verhoogd is. Dit resulteert in hoge waarden van plantsterolen in plasma en accumulatie in weefsels. Ook de absorptie van cholesterol is verhoogd en is er een defect in de galsecretie van sterolen in patienten met deze ziekte. Dit maakt deze genen goede kandidaten om betrokken te zijn bij de secretie van cholesterol naar de gal. De studie werd uitgevoerd in een aantal muismodelen waarin de secretie van cholesterol naar de gal sterk varieert. Er werd een positieve lineare correlatie gevonden tussen de RNA expressieniveaus van Abcg5 en Abcg8 in de lever van deze muizen en de snelheden van cholesterolsecretie naar de gal, wat suggereerde dat deze eiwitten inderdaad bij de cholesterolsecretie betrokken waren. Er was een uitzondering op deze correlatie: in muizen die gevoerd waren met een diet waaraan dat 1% diosgenine, een plantsterol, was toegevoegd, was de secretie van cholesterol naar de gal ongeveer 16-voudig verhoogd, maar de expressieniveaus van Abcg5 en Abcg8 in de lever van deze diosgenine gevoerde muizen was niet veranderd. Deze studies toonde aan dat de heterodimeer Abcg5/g8 belangrijk was voor de secretie van cholesterol naar de gal, maar impliceerde ook dat er een alternatieve manier voor cholesterolsecretie was, onafhankelijk van Abcg5/g8, en dat diosgenine effect had op deze route van cholesterol secretie In Hoofstuk Drie wordt de characterizatie van muizen deficient voor het Abcg8 gen beschreven. De concentraties van plantsterolen in de lever en plasma waren verhoogd in muizen deficient voor Abcg8, terwijl de concentraties van cholesterol verlaagd waren. De belangrijkste waarneming in deze muizen voor dit proefschrift was dat in

165

de muizen deficient voor het Abcg8 gen de cholesterolsecretie 80% verlaagd was vergeleken met wild-type muizen. Bovendien was de localizatie was Abcg5, de heterodimer partner van Abcg8, en gesuggereerd nodig te zijn voor volledige activiteit van de heterodimer, beperkt tot het Endoplasmatisch Reticulum, wat dit een goed model maakt om de rol van deze eiwitten in cholesterolsecretie te onderzoeken. Het stimulerende effect van diosgenine op de cholesterolsecretie werd verder bestudeerd en is beschreven in Hoofdstuk Vier. In deze studie werd het diet dat diosgenine bevatte gevoerd aan muizen deficient voor het Abcg8 gen (beschreven in hoofdstuk drie). Dit werd gedaan om de hypothese te onderzoeken dat het effect van diosgenine op de cholesterolsecretie onafhankelijk was van Abcg5/8 zoals gesuggereerd werd in hoofdstuk twee. Deze studie toonde echter aan dat in tegenstelling tot de gestelde hypothese, Abcg8 wel degelijk nodig was voor het effect van diosgenine op de cholesterolsecretie. Een alternatieve verklaring voor het effect van diosgenine is dat diosgenine de activiteit van de Abcg5/g8 eiwitten verhoogt. Dit zou kunnen plaatsvinden door directe interactie van diosgenine met de eiwitten of via een indirecte manier. In vivo experimenten waarbij de muizen met het hydrofiele galzout Tauroursodeoxycholaat geinfundeerd werden om de cholesterolsecretie te stimuleren en in in vitro cholesterol efflux experimenten suggeerden dat diosgenine de activiteit van Abcg5/g8 niet direct beinvloedt. Om dit verder te bestuderen werd Metabole Controle Analyse toegepast in heterozygote Abcg8 muizen. De resultaten van deze analyse toonde aan dat wanneer Abcg8 de snelheden van cholesterolsecretie in hoge mate controleerde, deze niet beinvloed werden door diosgenine. Dit zou wel verwacht worden als diosgenine een directe interactie zou aangaan met de Abcg5/g8 eiwitten. Verder was het effect van diosgenine op Abcg5/g8-onafhankelijke cholesterolsecretie (in muizen defient voor het Abcg8 gen) ongeveer gelijk aan het totale effect gemeten in wild-type muizen. Dit geeft aan dat ook de Abcg5/g8- onafhankelijke cholesterolsecretie gestimuleerd wordt door diosgenine en ondersteunt de suggestie dat diosgenine geeft directe interactie aangaat met Abcg5/g8. In een poging om het effect van diosgenine op intracellulair niveau te verduidelijken werd een genexpressieprofiel van de levers van diosgenine-gevoerde en controle muizen opgesteld. Deze analyse toonde aan dat de expressie van de meeste genen die betrokken zijn bij de synthese van cholesterol verhoogd was in de lever van diosgenine-gevoerde muizen vergeleken met controle muizen. Ook de expressie van aantal genen die coderen voor cytochrome P450 enzymen en Gluthationtransferases was verhoogd. De analyse van het effect van diosgenine op de genexpressie in de lever leverde geen extra informatie op over het mechanisme waarbij diosgenine de cholesterolsecretie verhoogt. Deze analyse samen met de in vivo en in vitro experimenten suggereren dat diosgenine geen directe interactie aangaat met Abcg8, maar dat diosgenine de beschikbaarheid van cholesterol voor secretie naar de gal verhoogt. In Hoofdstuk Vijf wordt het mechanisme van de secretie van cholesterol en de rol van Abcg8 hierin verder onderzocht. In de literatuur werden twee specfieke werkingsmechanismen voor de Abcg5/g8-eiwitten in de cholesterolsecretie gesuggereerd. Een van deze mechanismen suggereerde dat Abcg5/g8 zouden werken als translocators van cholesterol van de binnenmembraan naar de buitenmembraan, terwijl de tweede voorstelde dat Abcg5/g8 betrokken zouden zijn bij het reduceren

166 Samenvatting van de activeringsenergie die nodig is voor het verlaten van cholesterol van de buitenmembraan. Om dit te onderzoeken werden Abcg8 wildtype, heterozygote, en knockout muizen geinfundeerd met de galzouten Taurodeoxycholaat (TDC), Taurocholaat en Tauroursodeoxycholaat. Verder werden de TDC-infusie experimenten gedaan in muizen die 18 dagen gevoerd waren met het diosgenine dieet voordat het infuus uitgevoerd werd. Dit werd gedaan om verder te onderzoeken of diosgenine de concentratie van cholesterol in de canaliculaire membraan verhoogt. Infusie van de meest hydrofobe galzout in deze studie, TDC, in Abcg8(-/-) muizen resulteerde niet in een inductie van de cholesterolsecretie, terwijl het wel effect had in wildtype muizen. De resultaten van deze studie geven ook aan dat Abcg5/g8 waarschijnlijk een rol spelen in het beschikbaar maken van cholesterol in de canaliculaire membraan voor secretie naar de gal. De mechanismen die hier bij betrokken zijn, zijn vesicle-secretie en micellaire extractie. Welk mechanisme domineert zal waarschijnlijk afhankelijk zijn van de hydrofobiciteit van de totale galzout-pool in de gal. Deze galzoutinfusie experimenten toonde ook aan dat Abcg8 waarschijnlijk een role speelt in galzout-geinduceerde cholestase omdat Abcg8(-/-) muizen veel eerder cholestatisch werden dan de wild-type muizen wanneer zij geinfundeerd werden met TDC. Wanneer de muizen eerst gevoerd waren met het diosgenine bevattende diet voordat de infusie met TDC uitgevoerd werd was er geen sprake van cholestase, nog in de wild-type muizen, nog in de knockout muizen.

167

Dankwoord

170 Dankwoord

Geen pagina’s lang dankwoord. Ik hou het kort. Iedereen waar mee ik gewerkt heb en die mij, op welke manier dan ook, geholpen heeft zodat dit proefschrift er heeft kunnen komen: Bedankt voor alle hulp, de gezellige sfeer en plezierige tijd.

Astrid

171