DNA Barcoding of Six Ethnomedicinal and Economically Important Pandanus Parkinson (Pandanaceae) in the Philippines
Total Page：16
File Type：pdf, Size：1020Kb
Philippine Journal of Science 150 (5): 1321-1335, October 2021 ISSN 0031 - 7683 Date Received: 15 Mar 2021 DNA Barcoding of Six Ethnomedicinal and Economically Important Pandanus Parkinson (Pandanaceae) in the Philippines Propa Joy R. Santor1,2*, Jorge Anton D. Ordas1,2, Jay Edneil C. Olivar2, Porferio S. Bangcaya3, Maribel G. Nonato2,4, and Grecebio Jonathan D. Alejandro1,2,4 1Department of Biological Sciences, College of Science University of Santo Tomas, España, Manila, Philippines 2Research Center for the Natural and Applied Sciences University of Santo Tomas, España, Manila, Philippines 3University of Antique–Tario Lim Memorial Campus Poblacion, Tibiao, Antique, Philippines 4The Graduate School University of Santo Tomas, España, Manila, Philippines Members of the genus Pandanus are popularly known for their variety of uses, yet there is difficulty identifying its species since discrimination is dependent on its seasonal reproductive parts. DNA barcoding was utilized to establish an ideal locus for the rapid identification and authentication of six Pandanus species in the Philippines. A total of 17 samples representing six species with three endemic taxa were collected and analyzed. Genomic DNA was extracted from leaf samples and was used as a template to generate the DNA barcodes. The BLAST (Basic Local Alignment Search Tool) method, divergence, and NJ (neighbor-joining) analyses were conducted to determine the efficiency of each barcode. The internal transcribed spacer, a nuclear region, was initially assessed in this study; however, plastid markers showed more universality with better amplification and sequencing success rates. In terms of discriminatory power, trnH-psbA revealed a significantly higher interspecific divergence compared to its intraspecific divergence. Phylogenetic analyses using the NJ approach exhibited that trnH-psbA has a better ability to resolve species identity and exclusive lineages than matK. The concatenated gene trnH-psbA + matK was able to generate better species resolution compared to the single barcodes analyzed. In general, rbcL performed poorly in the NJ analysis and has the lowest species discrimination based on its interspecific and intraspecific distances with close values. We provisionally recommend trnH-psbA as the most efficient single candidate barcode for the molecular authentication of Philippine Pandanus species and the combination of trnH-psbA + matK for a better discriminatory ability. Keywords: DNA barcoding, matK, Pandanaceae, Pandanus, rbcL, trnH-psbA *Corresponding Author: [email protected] [email protected] 1321 Philippine Journal of Science Santor et al.: DNA Barcoding of Philippine Pandanus Vol. 150 No. 5, October 2021 INTRODUCTION Barcode of Life–Plant Working Group (CBOL-PWG 2009) recommended the core plastid loci rbcL and Pandanus Parkinson is the largest genus in the family matK to be supplemented in addition to other suitable Pandanaceae with a predominantly tropical distribution markers. A study involving the DNA barcoding of (Vaughan and Wiehe 1953). Members of this genus are Chinese ethnomedicinal drinks with Pandanus samples generally characterized as woody palm-like trees and revealed high universality among rbcL, trnH-psbA, and shrubs with long sword-like leaves bearing spines on matK barcodes with a high discriminatory ability (Li et the underside and along its margins. Leaves and floral al. 2012). In addition, trnH-psbA has also shown good parts grow in a three-rowed phyllotaxy with pronounced discrimination in many floristic and taxonomic studies twisted stems, giving off a spiral-like appearance. (Kress et al. 2005). Pandanus plants are dioecious, i.e. bearing male and female flowers in separate trees. Pistillate (female) flowers In this study, three candidate plastid regions – namely, produce aggregate fruits comprised of numerous ovaries matK, rbcL, and trnH-psbA gene regions – were tested that develop into drupes. The carpels fuse into syncarps, for their efficiency as single-locus and combined barcodes usually born in a head or cephalium (Hyndman 1984). for six Pandanus species. The criteria of universality, discriminatory power, and species resolution were The Philippines is home to approximately 50 Pandanus assessed for each barcode (Kress et al. 2005; CBOL-PWG species, wherein > 80% are endemic (Pelser et al. 2009; Hollingsworth et al. 2011). This study provides 2011). Many Pandanus species are utilized as sources baseline data and information for further research on of livelihood, food, and medicine in many isolated Pandanus systematics, conservation, the discovery of communities in the country; however, it is poorly natural products, and the emerging field of forensic botany. documented. Decoction of dried or fresh roots of Precise species identification is significant in the scientific Pandanus luzonensis Merr. is used to increase urine community and equally important in the non-scientific, output; the roots of Pandanus tectorius Parkinson are economic world. utilized to strengthen the gums, and its water from the base of the trunk is used to stimulate urination (Quisumbing 1951). Pandanus amaryllifolius Roxb., commonly known as “pandan,” is widely used as a flavoring for savory and MATERIALS AND METHODS sweet dishes in Southeast Asian countries. The aromatic leaves containing 2-acetyl-1-pyrroline are used as a rice fragrance, air freshener, and food wrapper (Laksanalamai Taxon Sampling and Ilangantileke 1993). The leaves are also used to A total of 17 samples representing six Pandanus species help reduce fever and relieve indigestion and excessive were obtained from eight different localities in the intestinal gas (Cheeptham and Towers 2002). Pandanus Philippines. Voucher specimens were provided with luzonensis, Pandanus simplex Merr., and Pandanus accession numbers and are deposited in the University of radicans Blanco are commonly made into baskets, bags, Santo Tomas Herbarium (Appendix Table I). Leaf samples and other woven products (Quisumbing 1951; Brink et for DNA extraction were stored in re-sealable plastic bags al. 2016). with silica gel (Chase and Hills 1991) for preservation. The endemic species are represented by two accessions of P. Pandanus identification is often problematic since species luzonensis, two P. radicans, and three P. simplex, whereas discrimination heavily relies on their seasonal fruits and non-endemic species are represented by four accessions flowers. The vegetative morphology of Pandanus species of P. amaryllifolius, one P. odorifer (Forssk.) Kuntze, and alone is insufficient in species identification due to the five P. tectorius (Figure 1). highly similar characters (Aganda et al. 2017). Species identification requires a large set of phenotypic data that will allow discrimination and in Pandanus, even a Morphological Identification single species may have variation in morphology due Specimens were identified utilizing original written to environmental stress; hence, more accurate methods descriptions and taxonomic keys available in Biodiversity in identification are required (Nadaf et al. 2012). DNA Heritage Library (http://www.biodiversitylibrary.org). The samples were also compared with the field photographs barcoding emerged as a significant advancement in molecular biology, which promises rapid and reliable available in online resources such as philippineplants.org species identification utilizing standardized short genome (Pelser et al. 2011) and type specimen images available segments (Hebert et al. 2003). Unlike animals, finding a in Missouri Botanical Garden (https://science.mnhn.fr) and standard DNA barcode for plants is difficult due to the Journal Storage (https://plants.jstor.org). varying barcoding efficiency for different taxonomic groups (Fazekas et al. 2008). The Consortium for the 1322 Philippine Journal of Science Santor et al.: DNA Barcoding of Philippine Pandanus Vol. 150 No. 5, October 2021 Figure 1. Field photographs of Pandanus spp. Fruits of (A–B) Pandanus luzonensis, (C–D) Pandanus tectorius, (E–F) Pandanus radicans, fruit of (G) Pandanus simplex, and (H) Pandanus amaryllifolius. Generation of DNA Barcodes psbA. The nuclear region ITS was initially included but Total genomic DNA was extracted from the silica gel-dried resulted in repeated failures in an attempt to amplify the leaf samples following the protocols of the DNeasy Plant marker. Primers used for the amplification and sequencing Minikit (Qiagen, Germany). KapaTaq PCR Kit (Kapa, are provided in Table 1, including the polymerase chain USA) and Biometra® T-Gradient thermocycler were reaction (PCR) conditions. A 25 μL reaction contained the utilized to amplify the regions matK, rbcL, and trnH- following reagents: 17.35 μL water, 2.5 μL 10x buffer, 1.0 1323 Philippine Journal of Science Santor et al.: DNA Barcoding of Philippine Pandanus Vol. 150 No. 5, October 2021 Table 1. Primers used for amplification of the analyzed gene regions. Marker Primer Sequence (5' > 3') Authors PCR conditions (°C) matK 3F_Kim f CGTACAGTACTTTTGTGTTTACGAG CBOL-PWG (2009) 98a, 98b, 35c, 52d, 72e, 72f 1R_Kim r ACCCAGTCCATCTGGAAATCTTGGTTC rbcL 1F ATGTCACCACAAACAGAAAC 94a, 94b, 35c, Kress et al. (2005) 724R TCGCATGTACCTGCAGTAGC 55 d, 72e, 72f trnHf_05 CGCGCATGGTGGATTCACAATCC trnH-psbA Kress et al. (2005) 94a, 95b, 35c, 55d, 72e, 72f psbA3'f GTTATGCATGAACGTAATGCTC aInitial denaturation; bdenaturation; cno. of cycles; dannealing; eextension; ffinal extension μL 25 mM MgCl2, 2 μL 2 mM dNTP, 1.0 μL of 10 μM generated from MEGA X. To further evaluate