Posted on Authorea 20 Jan 2021 | The copyright holder is the author/funder. All rights reserved. No reuse without permission. | https://doi.org/10.22541/au.161073927.77224986/v2 | This a preprint and has not been peer reviewed. Data may be preliminary. unn title: Running mode Keywords: genus the of within breakdown relationships realms, the phylogenetic zoogeographic that conclusion, are single suggest paleogeography. In to dispersal also by mainly results distance restricted Milnesium. determined our long are of Finally, be of species history to time-calibrated cases abilities. evolutionary Milnesium seem although we dispersal the Overall, order limited Additionally, that, influenced ancient. have may show in tardigrades mostly Gondwana results mode. Thus, these and Our and reproductive that rare taxonomically events. and suggests ranges. be which geological both type geographic to dataset major climate seem limited with Milnesium they with suggest it the present, tandem falsely align enlarged general in to to considerably were the phylogeny it we likely date question our analysed here, to are to we published hypothesis, which seem phylogenies and EiE populations, Milnesium geographically, Milnesium, the the of genus test all number eutardigrade comprehensively Nevertheless, limited to a species. a of tardigrade on phylogeny to increasing an hypothesis recent based However, additionally EiE most can wind). the by which the (Tardigrada), selects’ of (e.g. environment bears including applicability dispersion water distance but studies, long limnoterrestrial Everywhere for are of micrometazoans, is potential length, their that ‘Everything number enhance in been the further mm should has to <1 that view cryptobiosis groups, subject enter common such whereas are The of (zones), abilities, One realms understood. dispersal (EiE). zoogeographic excellent poorly hypothesis as putatively still termed their are clusters animals to geographic microscopic thanks form of animals species macroscopic of that distributions evidence ample is There Abstract 2021 20, January 1 Morek Witold (Tardigrada) Milnesium of genus phylogeography the time-calibrated everywhere’: not is ‘Everything ailoinUiest nKrakow in University Jagiellonian pcea i,ln-itnedsesl(D) oeua lc,tateouin reproductive evolution, trait clock, molecular (LDD), dispersal long-distance EiE, Apochela, 1 Milnesium Bart , l 17% 72% 11% me Surmacz omiej widespreadspecies ‘inclusion species’ ‘inclusion with limitedspecies ranges phylogeography central pie chart [data] iue1 RPIA ABSTRACT. GRAPHICAL 1: Figure 1 ljnr L´opez Alejandro , 12% 72% 5% 9% 2% ‘inclusion species’ with LDD species’ ‘inclusion with SDD species’‘inclusion with limitedspecies ranges anthropogenicallywidespreadspecies naturally widespreadspecies 1 middle ring chart [interpretation] 1 n uazMichalczyk Lukasz and , 86% 12% 2% no evidence forno natural LDD evidence for ( evidence for ( outer ring chart [conclusion] ancient recent 1 ) naturalLDD ) naturalLDD Posted on Authorea 20 Jan 2021 | The copyright holder is the author/funder. All rights reserved. No reuse without permission. | https://doi.org/10.22541/au.161073927.77224986/v2 | This a preprint and has not been peer reviewed. Data may be preliminary. yMrke l 21b.Mroe,tems eetpyoeei nlsso h genus the of analysis phylogenetic recent most the Moreover, (2019b). al. et Morek We by Michalczyk, by redescription type integrative the its consequence, is a records as biogeographic and, Therefore, decades of many history for monotypic long considered species, a erroneously was with EiE genus the genera the of portantly, tardigrade favour the in evidence of false One provide distribution may which artificially natural parallel, by species, the In likely some obscure most least to cosmopolitan. 2019b) hypothesis. at likely generally of al. is ranges were et it Rota- geographic Morek species as broadening 2019a; & consideration, tardigrade Vonˇcina, Michalczyk, (Ga˛siorek Rebecchi, into if & species taken Cesari, tardigrade case be McInnes, of has the to Guidetti, animals be has these 1998; dispersal not of Pugh, anthropogenic distribution could & the which Morek, (McInnes on 2017), events Stec, important distribu- geological Stabelli, be 2011; cosmopolitan of to putative impact Cesari, the the hypothesised & Moreover, questioning as pseu- been Giovannini, further species. and be Rebecchi, 2019a), tardigrade complexes not al., of Bertolani, species may et tion Morek many species (e.g. 2018; years, many detected Michalczyk, recent that & been Ga˛siorek, in indicate have Importantly, already species assumed. Morek studies docryptic previously 2020; Sur- initial Ga˛siorek, Michalczyk, as these Stec, & distributed Vonˇcina, Ga˛siorek, Nevertheless, Morek, Degma, widely 2019b; 2016; 2020). Guidetti, al. on Michalczyk et & Ga˛siorek studies & Binda, Rebecchi, 2019a; restricted & Michalczyk, Bertolani, taxonomically J Pilato & McInnes, and/or (e.g. macz, Cesari, (e.g. geographically far 2009; debated of so Machordom, number been on conducted & limited discussion has been the a have hypothesis years, topic only EiE recent par- this but the In en- of 2011), undermine distribution hash 2019b). Guil, or 2018). the al., withstand 2001; Guil, support on et (Ga˛siorek to & do knowledge fragmentary ability Bartels, the tardigrades ubiquitous extremely Nelson, the but whether These usually have cosmopolitan, (e.g. is considered planet that 2018). species the been mm) ticular Schill, have across 1 & environments species of Hengherr tardigrade ca. variety Many wide to (e.g. a (up tardigrades inhabit animals limnoterrestrial invertebrates microscopic are species. of conditions micrometazoan groups vironmental all to the application of universal One undermining its review), least 2017; in Balsamo, at Michalczyk, & animals or Vonˇcina, Ga˛siorek, Garraffoni & Zaja˛c, microscopic hypothesis 2019; 2013; & the in Danielopol, Gonzalez, Baltan´as & hypothesis 2008; Herniou, & Vang, EiE thought al. Kaya, exhibit Kerbl, et the with often Worsaae, (Fontaneto, Fontaneto previously against that However, (e.g. complexes were evidence species accumulate recently, respective to species 2010). that with Therefore, started be al., 2009), animals ranges. Guidetti, et actually microscopic geographic & Heino Rebecchi, to limited of Bertolani, 2006; demonstrated Cesari, which species al., 2009; were taxonomic many studies, Barraclough, et different cosmopolitan, Earlier Martiny tools, across be 1997; molecular hypothesis to Finlay, 2015). EiE of & Ricci, the Naselli-Flores, development Esteban, confirm Chen, & the Fenchel, to Barraclough, Robba, seemed (Fontaneto, (e.g. characters, Barone, distances groups morphological with long Marrone, on groups over to Incagnone, based dispersed long applicable were 2008; especially unlimited easily be have Herniou, be to to can argued & believed was dwelling which were patterns, hypothesis 2004; biogeographical stages, This organisms Finlay, any dormant such show suitable. & not is mm, should Fenchel environment <1 they the therefore 1934; size, wherever Everywhere and small (Baas-Becking, abilities, organisms, is (LDD) ‘Everything their observable postulated dispersal realms the of distance easily was zoogeographic of life, because large, of (EiE) into one forms 2006): on Earth hypothesis and Foissner, microscopic the primarily century, selects’ for of contrast, nineteenth conducted environment In division were the but 1858). the studies since (Sclater, was such studied vertebrates analyses However, mainly been biogeographic has global 1876). World of (Wallace, the results across first animals the of distribution The Introduction insu tardigradum Milnesium .tardigradum M. a eaddcsooia o vr10yas u hsve a encalne by challenged been has view this but years, 170 over for cosmopolitan regarded was o` r,14,wsrpre rmnmru oaiistruhu h globe. the throughout localities numerous from reported was Doy`ere, 1840, ø gne,M rgensen, l iz rhe azae 21a)adfrhrquestioned further and (2012ab) Kaczmarek & Frohme, nicz, 2 ø jr,&Kitne,20;Gi Sanchez-Moreno, Guil 2007; Kristensen, & bjerg, Milnesium Milnesium o` r,14.Im- Doy`ere, 1840. (Morek Posted on Authorea 20 Jan 2021 | The copyright holder is the author/funder. All rights reserved. No reuse without permission. | https://doi.org/10.22541/au.161073927.77224986/v2 | This a preprint and has not been peer reviewed. Data may be preliminary. ofidtems utbesbttto oe o otro hlgntcaayi.A O sapoencoding protein a is COI 2016) As Warren, analysis. & phylogenetic Next, posterior Hua, (COI). for (Lanfear, We bp model 2.1.1 2011). 569 substitution version Meier, and suitable PartitionFinder & most (ITS-2) in Lohman, the 841 (Vaidya, manually Criterion find rRNA), checked RNA, SequenceMatrix to Information (28S were in of Bayesian 887 alignments concatenated structure rRNA), the obtained were secondary (18S Forused The alignments the 1159 2008). used. obtained consider to Toh, was four to trimmed & setting the then applied default Katoh and was the 2002; BioEdit strategy COI, Miyata, in G-INS-I and available & ITS-2 the Kuma, The of for rRNA, Misawa, included. some whereas 28S (Katoh, thus not and 7 sequenced; were rRNA version markers 18S GenBank MAFFT molecular at using four marker, available of each sequences out some three and least um data at literature with the populations only analysed We using (accession pseudogenes GenBank ver. potential in analysis BioEdit deposited for Phylogenetic are in test S2). sequences checked Table to All protocols in manually 2018). acids Tamura, listed PCR amino were & are Knyaz, into and chromatograms numbers Li, translated primers All Stecher, were (Kumar, (2020); 1. sequences X subunit Michalczyk Table MEGA COI c & in 1999). oxidase Kristensen, listed (Hall, cytochrome Stec, are 7.2.5 and large followed references (ITS-2), the protocol relevant 2 rRNA), PCR with Spacer (18S three The Transcribed subunit markers, total). (COI). Internal ribosomal molecular in rRNA), 1 small Four the (28S populations populations). populations) Sanger-sequenced: subunit 40 77 were 10 ribosomal population; 2008; mitochondrial, mothers; same one al., the and sequenced et nuclear from of Pleijel (individuals (offspring mounted paragenophores (hologenophores; were isogenophores/progenophores or specimens vial, were the voucher in vouchers as Stec, found Otherwise, by if slide modifications exoskeletons, with extraction, permanent (2012), After Chelex Gillespie on the (2015). & following Michalczyk Thebaud, population & Casquet, per Kaczmarek, by 4) Smolak, method cases most extraction (in (Bio-Rad) specimens resin 1–12 100 from individually extracted S1). was Table DNA see information detailed for sequencing 1, Afrotrop- DNA realm Fig. sampled: Oceanian in most and the depicted Nearctic from are Panamanian, 2013); localities Madagascan, al., (approximate Australian, et Neotropical, Holt Oriental, to Palaearctic, (according ical, realms zoogeographic nine 127 and of continents total a analysed We specimens and events Sampling historical or 1926. Richters, geological Methods Eutardigrada what and in understand Materials time to to first (compared order the realms of for in distribution zoogeographic analysis Moreover, and clock nine diversification the 2020). from shaped Michalczyk, originating have & may herein), from Morek populations stemming in 127 conclusions six to biogeographic phylogenetic the 2020 the low verify enlarged Michalczyk, suggesting to considerably & we falsely Therefore, (2020), undersampling, genus. Michalczyk & from this Morek resulting within species artefact, reported of an phylogeny distribution with be geography could of of correlation (2020) abilities the dispersal sample Michalczyk words, small are & on other not species based In Morek is if analyses even by patterns. localities hypothesis, Thus, artefactual EiE multiple the produce common/abundant. in to may not conform species size are distributions same species geographic the which their and of in widespread genera detection species-rich the in size, especially sample likely, small with however, Importantly, suggested taxonomy. apochelan (25), given the any species of in and position used (34) phylogenetic traditionally populations a of analysed of predictor of capability better number dispersal limited the the that despite 2020), Michalczyk, & eune,tgte ihtoefo ugoptx seTbeS–2,wr lge neednl for independently aligned were S1–S2), Table (see taxa outgroup from those with together sequences, Milnesium Milnesium pce n rmtrl eetn h i yohsst xli h geographic the explain to hypothesis EiE the rejecting prematurely and species Milnesium ouain,icuig8 el eune.Te rgnt rmfive from originate They sequenced. newly 83 including populations, pce slmtdadta h egahcoii fseisi a is species of origin geographic the that and limited is species 3 Milnesium Milnesium pce hntemrhlgclcharacters morphological the than species edtdorpyoeyuigmolecular using phylogeny our dated we , Milnesium aae fo 4i Morek in 34 (from dataset Milnesi- ® Posted on Authorea 20 Jan 2021 | The copyright holder is the author/funder. All rights reserved. No reuse without permission. | https://doi.org/10.22541/au.161073927.77224986/v2 | This a preprint and has not been peer reviewed. Data may be preliminary. h aeseiswl efudecuieyi igezoegahcram n ( and realm; zoogeographic single a in geographic exclusively however, found If, be diversified). will geographically localities species be same the will the that clades provided (i.e. localities, of collected isolated were distributions they and ( which distant and in geographically conditions; localities ( climate in may similar that: found by species predicts characterised be analysis hypothesis are will second EiE the species the case, in Correspondingly, same first whereas the the populations. required, In single are by conditions. species represented climate same be similar the by representing characterised populations localities hypothesis multiple in EiE ( but the climate realms, Specifically, ways: zoogeographic similar ( different exhibit non-exclusive and methods. that two species; phylogenetic locations individual using in representing geographic analysed tested distant and from be collected samples can be hypothesis, to EiE have the conditions test are to study hypothesis order present Everywhere’ In the is in ‘Everything were delineated the there and and #64. If identified Phylogeography to species them. number). #1 all between sample from phylogeny, discriminate numbers, and to through running added navigation code designated was given aid country number/letter are additional to (international identified genus an order code be population, the In population same not to the by key could from In followed diagnostic that bPTP. species latest two Species by nov.” the identified 2016). using “sp. species Michalczyk, species putative as & identify the Blagden, com- to verify then Stec, attempted Ga˛siorek, to were we (Morek, me- results delineation, distances, The genetic genetic delimitation MrBayes. to and species in parallel data sequences molecular bPTP morphological COI+ITS-2 the a concatenated with on (2020), on used pared Michalczyk conducted based & 2013), we Morek tree Stamatakis, in dataset, the as & methodology Pavlidis, constructing the same Kapli, the in (Zhang, applied We (PTP) present (http://species.h-its.org/ptp). webserver process species tree Poisson of the number thod, the estimate To v.1.4.3 FigTree in visualised was delineation tree Species lower consensus with The those well and unsupported. considered supported were http://tree.bio.ed.ac.uk/software/figtree). or moderately 1.00 from supported considered and (available were poorly 0.95 0.94 considered between and were (PP) 0.90 probability PP between posterior PP with with recovered those clades supported, four 2. trees, combination Table the the in calculated best for all given factors In rates this are Bayes mutation for TRACER, Additionally, the in tree BEAST). to estimated consensus with according markers, exponential (distributed The selected utilised relaxed TREEANNOTATOR were was http://beast.bio.ed.ac.uk). using which priors, Schwartz, from built prior, tree & (available was and tree Pfeiffer 1.6 clock as (Miller, TRACER of Gateway process combination in Yule Science best with CIPRES The the model steps. in clock 10,000 generations every million sampling ( 100 2010), for and ran (2017), analyses al. The et Guidetti of by calibration, estimates origin genus, reliable the the other for any to for set of according distribution absence were distribution the rates in normal ( clock and points: a clock, and calibration molecular constant models two the with used substitution calibrate (coalescent we to nucleotide tree order Different and In models. partition. relaxed) Additional each Yule) 2012) exponential 2003). Rambaut, versus and & Huelsenbeck relaxed, size Xie, & Suchard, lognormal population exact (Drummond, (Ronquist (strict, same 1.10.4 v3.2 clock BEAST the different MrBayes in utilized out using in one carried (2020) were first analyses The Michalczyk Inference respectively. third approaches. Bayesian & and fit different Morek first two better codon as the using a three of out had methodology the exception carried K81UF+G the was and to with inference SYM+I+G corresponding Phylogenetic partitions, which the blocks for all COI, data for in three GTR+I+G positions was into codon fit-model divided best previously The was positions. alignment the fragment, insu swolenskyi Milnesium Milnesium pce r o ujc oteEEhptei,te:( then: hypothesis, EiE the to subject not are species Milnesium etln rmli 00a oe bound. lower as 2000 Grimaldi, & Bertolani i ecntandtedvrec ewe eeo n uadgaausing Eutardigrada and Hetero- between divergence the constrained we ) ii yteaayi fpyoeei eainhp fseiscletdin collected species of relationships phylogenetic of analysis the by ) sn h siae g fteol nwfsi sindt this to assigned fossil know only the of age estimated the using i ytecmaio fgorpi oaiiso populations of localities geographic of comparison the by ) ii 4 lsl eae pce illkl ie ngeographic in differ likely will species related closely ) ii i ouain representing populations ) ruso lsl related closely of groups ) ii estalognormal a set we ) i ouain of populations ) Posted on Authorea 20 Jan 2021 | The copyright holder is the author/funder. All rights reserved. No reuse without permission. | https://doi.org/10.22541/au.161073927.77224986/v2 | This a preprint and has not been peer reviewed. Data may be preliminary. nlssaeas nihdwt e ouain/pce.Fnly ld bandi hssuyi e and present new the is in study E this and C in In clades obtained study. D, F present and denoted the clade B now Finally, in A, is clades group’ populations/species. (2020) to ‘crown Michalczyk new Similarly the & positions with polytomy. of Morek basal enriched their E part in the also but clade a (A+B) in are is their clades contribution, placed analysis to and study is previous sister and C previous the E and clade the clade C in as in as clade C here whereas as Fig. Specifically, denoted and denoted in is 2). clade E arrows it contrast, solid Fig. clade basal, by in to most (indicated arrows the correspond populations dotted identified was and herein and previously species (dashed E the multiple different to and with are correspond C enriched D are Clades and but B but with D 2). A, 2), and but clades B (Fig. 5) our (2020) A, Specifically, Michalczyk Fig. clades & species exceptions. Morek two by noticeable presented as some relationships classified with the to populations, corresponds species; is three largely D 11 phylogeny (C+D) (PP=1.00; The representing clade F and and populations clade (A+B) small species 21 and between a 19 D, (PP=1.00; split support. to representing clade E the low related populations for clade indicating is Finally, 31 PP=1.00 node 5) that of C, The PP=0.84. clade Fig. consists clade the with species. C for to supported, 7 Clade (PP=0.95 sister moderately representing supported is 4). populations the highly clade 8 whereas Fig. is (A+B) species, include C+D; C+D The 17 and clade Clade representing species. composition for D. populations 10 exact PP=0.96 support and 40 representing the high C groups with populations with clades A A+B), 23 relationship, groups clade Clade sister includes for a B 3. PP=1.00 in clade and Fig. are sister B, in B clade depicted and for being A poorly is PP=1.00 clade relationships A, are topology follows: clade tree as MrBayes for therefore, MrBayes (PP=0.94 whereas is, the topology 2–5, and in BEAST showed Figs is The nodes BEAST in 2–5). with basal (Figs obtained shown multiple detail topology is in the clades As only discussed topology distinct SM.03), six see BEAST SM.03). with (PP=0.56–0.78; Materials convenience; supported/unsupported topologies, Supplementary for similar very in F have available MrBayes to and A BEAST (named with obtained phylogenies The phylogeny Molecular and too facultative was between it biogeography. males thus investigating distinction Results detecting potential, when the not consideration dispersal for of into increase allow probability taken should not parthenogenesis be the there facultative does but should case even females this a was, only Although such parthenogenesis comprised in obligatory population parthenogenesis. as a reproduction identify available, if of to and specimens mode high possible 1998); adult not Nelson, ten was 1978), tested & below culturing was Smith, (Rebecchi were if mode (Maynard possible The unknown whenever abilities as tree. culturing classified phylogenetic dispersal individual was the the and on influence PCM mapped also with to was for hypothesised parthenogenesis) or was a (dioecy reproduction information in werethis of species populations mode such of the if realm. multiple majority LDD As of zoogeographic recent the origin one of geographic ‘inclusion than identification than the an of realm more of for identification in comparison zoogeographic allowed a found an species different parallel, single for a In a allowed LDD). representing in ancient which providedpopulations found suggest analysis clades, species were (such RASP major (2013), that clade Bayesian The given the al. species the (2007). of et The with Holt i.e. McMahon origin clades. Results) to & species’, geographic main (see according Finlayson, the the specified BEAST Peel, on for were follow the type realms information categories with & climate Zoographic climate obtained Blair, the settings. main tree (Yu, as default whereas consensus well 4 the climate as the RASP using as origin, MCMC on utilised well of Binary out we as area Moreover, carried realm the was phylogeny. zoogeographic determine analysis molecular the statistically above. the described of to ways onto level 2020) two the each the He, populations by to at hypothesis analysed similar EiE origin of the localities zoogeographic test type, many to the with able mapped were realms, we we zone. zoogeographic conditions, Specifically, climate different climate of nine same terms from the in came necessarily other samples not our but that zone Given zoogeographic same the share will species 5 Posted on Authorea 20 Jan 2021 | The copyright holder is the author/funder. All rights reserved. No reuse without permission. | https://doi.org/10.22541/au.161073927.77224986/v2 | This a preprint and has not been peer reviewed. Data may be preliminary. fArtoia 41;1% n igeNaci ouain ld ossso otyPlertcpo- Palaearctic mostly of consists B fraction Clade small population. a Nearctic with single 87%) (35/40; a populations and Spe- Palaearctic 2–5). 10%) majority (Figs (4/10; phylogeny vast molecular the Afrotropical with in of correlated comprises populations A analysed clade of cifically, origin geographic the Overall, hypothesis Everywhere’ Geography is ‘Everything the and Phylogeography 2020b). Michalczyk, & Ciosek, Morek, eerh mn h 4dlmtdseis sltl s1 nld rvosydsrbdtx.Teohr49 the other in species The recognised taxa. of described number the previously increase include sharply further 15 would of which as subject science, little a to be as new genus should likely species, species, most delimited of are groups 64 species or the species Among single America, represent research. South populations the American South from and one realm, second Oriental the the from one and species, undescribed two and populations), populations. multiple 56%) were: by (around populations); formed species species (six were the abundant 44% of both most whereas half when (singletons), a The taxa population than distinct single more as Slightly a recognised agreement. by species in represented 64 were were comprises data dataset morphological our and that molecular concluded we Thus, bPTP). the and bPTP); the of bPTP); populations the bPTP), both the bPTP) by the of by entities entities eleven populations two three the as the species: cated 2020a), single Michalczyk, represent Kristensen, populations Blagden, following morphological of the entities of multiple that populations lack into considering concluded species the and oversplit we tardigradum entities, considering usually 2018), sup- M. delimited methods after the Flot, with delimitation of However, approaches, & species some average). tree-based BI (Dellicour among other variance on and and genetic Likelihood (0.97 low bPTP Maximum and that 1.00 shown) the to not both (data 0.65 differences in from entities ranging ranging 76 HPD identified ports 95% analyses with bPTP Mya, The 138 ca. estimate analysis. relatively to place our a difficult took in delimitation suggests is recovered species Species genus, nodes it remaining Mya. the 2), basal the 178 in (Fig. these and to lineages tree for 98 A–D extant the support from the clades of of between between part the lack split split basal of the first The the however stages the in initial clades; after present diversification the particular polytomy rapid with of current the grey correlating ages the to vertical possibly exact transparent with Due thus partly the ascertain 2). 2003; Mya, Fig. to Meyer, K¨onig, 207 likely in & possible Boebel, to most bar Jokat, not 116 it Mya, thus Parachela from is (160–180 Mya, and breakdown ranging period 540 Gondwana of HPD Apochela geological to ancestor 95% between 323 exact common with split from a recent the Mya, ranging The most but as HPD The (2017). Palaeozoic 95% introduced with the data. range al. (Mya) in the ago et place years Guidetti to calibration million available took by corresponds 432 two calculated to only Heterotardigrada date back with and dates the priors Eutardigrada tree on input between Table based limited also split prior, (see the dating The account node into in taking uncertainty points. partly considerable expected HPD; indicating (95% was Density 2), which Posterior Highest Fig. 3), 95% in wide bars relatively horizontal with blue burdened transparent is nodes the of estimation Age estimations clock Molecular samples. new by exclusively formed is Milnesium Milnesium .eurystomum M. ouain idctda w niisb h PP olwn oe ta. 09) h six the 2019a), al., et Morek following bPTP; the by entities two as (indicated populations Milnesium urnl mutn o4 a f2.922;Dga etln,&Giet,2009–2020; Guidetti, & Bertolani, Degma, 23.09.2020; of (as 43 to amounting currently , .inceptum M. p D42I.4,I.1+D90 H04adV.4 rcvrda orette by entities four as (recovered VN.045 and PH.014 ID.711+ID.950, ID.432+ID.940, sp. Milnesium p R47A.7 n F09G.9+F13(niae stoette by entities two as (indicated GF.089+GF.093+GF.193 and AR.437+AR.470 sp. aci 91(eoee streette ytebT;floigMorek, following bPTP; the by entities three as (recovered 1991 Maucci, oe ta. 09 fiepopulations), (five 2019b al., et Morek p Z05 A24adZ.8+A28(niae streette by entities three as (indicated ZA.180+ZA.218 and ZA.204 TZ.075, sp. .tardigradum M. Milnesium Milnesium rpeetdb lvnpopulations), eleven by (represented 6 bevdi u rei siae ohv ie 162 lived have to estimated is tree our in observed .variefidum M. p 5 fieppltos.WehrteOriental the Whether populations). (five #55 sp. .quadrifidum M. Milnesium oe ta. 06(eoee stwo as (recovered 2016 al., et Morek .reductum M. p 5 sxpopulations), (six #54 sp. eesro,11 (indi- Nederstr¨om, 1919 uao,20 (five 2006 Tumanov, .eurystomum M. Posted on Authorea 20 Jan 2021 | The copyright holder is the author/funder. All rights reserved. No reuse without permission. | https://doi.org/10.22541/au.161073927.77224986/v2 | This a preprint and has not been peer reviewed. Data may be preliminary. on ntetmeaeciae(917 9 os;cae –) xettesals ld F,which to (F), (three clade multiple smallest in found the were Except that A–E). species comprise clades clades pops.; other all 39% category, (49/127, climate climate single a temperate represents the in found the and Neotropic the Neotropic Milnesium in the found in #58 present species #55 new species Climate putative new and 5). putative 5), Fig. found 5); species Fig. #54 E; Fig. E; new species (clade E; (clade new Afrotropic delineated (clade putative realm preliminarily realm 4); Panamanian Fig. Oceanic a the C; the and 3); (clade and realms Fig. Oriental Afrotropic B; the and in (clade Madagascan 3); the realm Fig. from Australian recorded A; #40 the clade and LDD and in 3–5 recent Afrotropic (Figs signify (both realm Palaearctic, species’, Afrotropic one ‘widespread the than as found and here more were Palaearctic termed from species ranges, (74%) recorded geographic 20 were wide set, species events: with data (26%) our species 7 4 in Such and Table population 5). realm Table one (see zoogeographic than single Asia more a by East represented in a Far species and from 27 America; the populations South Among six from details). populations by populations for two represented five by 5 #54 by represented Fig. represented #56 species and #55 species new species new delineated putative new preliminarily type; putative climate species Afrotropic; by Oriental the also from an but comprises geographically lineage only origin ‘basal’ not Neotropic; geographic most ‘inclusions’: in the as the differ in classified that that were found given To lineages species ‘inclusions’. Thus, following as as the relatives. species’ considered (#62), ‘basal’ assumed ‘inclusion be the could is identify closest lineages, origin Neotropic to their other Neotropic the decided from the and or we of all Oriental Oriental problem, species which the clade, this clades of whether the overcome D major mixture characterising depending remaining chiefly clade a Thus, realm the Australian origin. of the to geographic as chiefly contrast mainly defined in the consists straightforward clearly in 5) not a is have embedded (Fig. 4); species’ realm, E (Fig. ‘inclusion Oriental clade C of the identification that clade from Given Afrotropic Palaearctic 4). #53), overwhelmingly mainly (Fig. the species the in (putative in embedded ID.947 embedded nov. both both realm, realm, Madagascan Afrotropic the 3); the (Fig. from B are #23), clade species species delineated Such (putative preliminarily 4). UG.006 a Table nov. events: and LDD 3); 2–4 ancient (Fig. (Figs plausible A clade different suggest a given they in a exclusively and collected in species’ species dataset), species ‘inclusion our as in of delineated here majority species 2, termed the all (Figs of than character (17% realm the pantropical species 11 zoogeographic the in of clade total collected and a the Oriental been are gives the There have species for lineages remaining probability Australian ‘basal’ the 44% the most of and in two origin 45% D 5). the mixed with clade origin, the though and the mixed realm, even support), in Oriental a Thus, (99% originated has respectively. B Afrotropic E and origin, the A clade in Neotropic clades Only suggest Specifically, F which support). realm. and (SM.04), single (97% C analysis a realm clades RASP in originated the support), the E) of (99% between (clade results Palaearctic correlation and one the The except by 5%) clades populations. reflected (1/21; all Afrotropical also Oceanian that three is phylogeny 14%), of and consists (3/21; origin F Afrotropic geographic clade single 14%), Finally, one a 5%). (3/21; except and (1/21; Panamanian all Nearctic (87%) but 29%), realms, realm (6/21; multiple Australian Neotropic representing the 33%), populations is to of C belonging (3/31; consists Clade seven Madagascan E ( and with Clade population. 90%) (13%). populations, Oriental (28/31; population eight single Afrotropic Oriental groups a realms: two D and to Clade Australian belonging 10%). two populations, Afrotropic, African two of composed with 78%), (18/23; pulations insu bohleberi Milnesium Milnesium insu tardigradum Milnesium ouain eefudi l v anciaectgre,wt h ags ubro populations of number largest the with categories, climate main five all in found were populations Milnesium insu matheusi Milnesium p o.U.7 seis#6,fo h ertc meddi h heyPlertcclade Palaearctic chiefly the in embedded Nearctic, the from #16), (species US.071 nov. sp. S05seis#7 oefo rpclo utoia lmt:Oina (7/21; Oriental climate: subtropical a or tropical a from come #57) US.065/species p o.M.2 pttv pce 1) rmteOina el,and realm, Oriental the from #19), species (putative MY.025 nov. sp. insu bohleberi Milnesium seis#)and #1) (species G(pce 3)and #33) (species MG S05(pce 5)fo h ertc aigi tn out stand it making Nearctic, the from #57) (species US.065 insu berladnicorum Milnesium 7 Milnesium insu inceptum Milnesium insu wrightae Milnesium p o.B.0 pttv pce #61) species (putative BR.007 nov. sp. seis#) ohpeeti the in present both #3), (species seis#6,fudi the in found #26), (species G(pce 4) from #46), (species MG Milnesium Milnesium sp. sp. Posted on Authorea 20 Jan 2021 | The copyright holder is the author/funder. All rights reserved. No reuse without permission. | https://doi.org/10.22541/au.161073927.77224986/v2 | This a preprint and has not been peer reviewed. Data may be preliminary. – n al ;seas asoe ta.21a.Tefloigprgah ics hs he ie of lines three these discuss paragraphs following The 2019a). (Figs activity patterns al. human Macroevolutionary by et Ga˛siorek caused ecdemism also detail. of see in examples 5; evidence likely Table being some and least 3–6 at with ( ( realm, and 2), zoogeographic 4), (Fig. Table history evolutionary and their 3–6 along ( clades by of major supported majority is all great conclusion the This of tardigrades. abilities apochelan dispersal limited for evidence sium provide analyses phylogeographic Our specimens of Milnesium number the mode. found, ZA.218, reproduction were ZA.180, the males Discussion TZ.075, assess no and reliably where (ZA.204 to (30%) Tanzania low puta- populations and too and 38 were Africa dioecious remaining from both the they with species In and species respectively). undescribed populations) partheno- of an (17 cases facultatively) and two 13% least were respectively) to (at there up Moreover, likely populations: clades. added parthenogenetic most the tively populations as all dioecious along identified whereas scattered were were populations), populations 57% analysed (72; the genetic of majority sampled The most of the numbers with lowest combinations the all mode whereas Reproductive which climate, in (18) present. types tropical were and climate (temperate) (8) dry+arctic). Thus, the arctic type and #20). mostly i.e. tropical+arctic (sp. concern found, tropical+cool, were cool+arctic pairs (tropical+dry, species and missing absent #18), were the (sp. however, pairs of Importantly, combinations temperate+arctic type dry+cool six #55), climate #58), representing climate #40, possible (sp. #58), two #28, (spp. four #55 dry+temperate in tropical+temperate #40, found #13), #26), #28, were #8, #3, #26 #6, species #20, (spp. #2, 12 #18, (spp. found 28 remaining #13, temperate+cool were #8, the of types: 13 #6, climate dry), out #3, dataset), and Except Thus, hypothesis, #2, our temperate (46%). (species conditions. EiE in (cool, types type climate types the population climate different climate one to different to than one relation three more adapt than in by to more important represented time in species less of (i.e. are species’, amounts species ‘inclusion events, considerable hand, non-singleton LDD other had (97% the ancient they F On widespread represent which clades. clade because in respective temperate they for types their climate B, climate in that compare dominating to dry and assuming interesting types particularly and climate A is with respectively), it clades dwell hypothesis, support, species EiE for the 84% of climate and aspect cool the 94% In for 98%, high (with support by lineages E 88% evidenced that and is and showed which support). D 89% types, (SM.05) C, (11/21, climate states: analysis clades particular climate ‘ancestral’ RASP with for tropical correlated the The clade generally represent of climate. Finally, are climate. populations dry clades supports dry 25%) six of from in (2/8, main single originating majority the temperate and populations within the of 43%) (9/21, of addition E, temperate an consists clade in with F dwelling Clade In 63%), populations each). (5/8, 12%). additional mainly (13% climate with climate (1/8, populations 52%) dry tropical comprises groups type in and C B found tropical dry temperate Clade populations from Clade in and population. of populations collected 3%). tropical chiefly four species single and (1/40, consist of 74%) a D number arctic climate (23/31, and equal climate tropical and 26%), an temperate the 6/23, 20%), with from and (each types: 44%), (8/40, C–F, climates climate (10/23 temperate following arctic and climate the and A 25%) cool in clades from (10/40, found in mainly populations dry present in populations includes exclusively 52%), were A present climate clade (21/40, were Specifically, dry climate cool B–E. in cool clades dwelling and in those recovered arctic was B, both representing and Species A 3–5). clades (Figs types climate four) pce,sgetn hti eea h i yohssde o xli h egahcdsrbto of distribution geographic the explain not does hypothesis EiE the general in that suggesting species, hlgorpyadte‘vrtigi vrwee hypothesis Everywhere’ is ‘Everything the and phylogeography iii h o ecnaeo pce ihgorpi agsicuigmr hnone than more including ranges geographic with species of percentage low the ) .eurystomum M. .tardigradum M. G.4,N.9 n L03 L08 L02 GB.005, GL.052, GL.048, GL.043, and NO.398 (GL.045, 8 i h ooeeu egahccaatro almost of character geographic homogeneous the ) ii h o ecnaeo icuinseis (Figs species’ ‘inclusion of percentage low the ) seis#) hs ouain wl in dwell populations whose #1), (species Milne- Posted on Authorea 20 Jan 2021 | The copyright holder is the author/funder. All rights reserved. No reuse without permission. | https://doi.org/10.22541/au.161073927.77224986/v2 | This a preprint and has not been peer reviewed. Data may be preliminary. orlto ftedvricto ftesxmi ldsrcvrdi u td ihteiiilsae of stages initial the with study our in recovered clades main six the should of ca. we by diversification then separated the subtropics, of capability are and of dispersal tropics America limited correlation hemisphere. the the North northern about to the of hypothesis restricted in coast Our is clades east Nearctic because dispersal and and and America, species latitudinal Palaearctic North Europe tardigrade the distinct extent to however, of Holarctic observe greater Siberia If, some coast a via least western to Europe km. Western sampled at the 3,000 from is observe between be extending Nearctic to distance may masses the expect land when Australia the should continuous south true, and nearly we conservative is further Africa are study, geographically hypothesis the South there the present this words, in Thus, If the other 3,000 reflected D. in pantropically. is In and ca. than which disperse C Orient, or America). to clades and Orient, South of is Africa the of central compositions it of coast than likely the parts isolated east a less between west efficiently Africa and more the (e.g. and tardigrades South Africa winds Africa equator, of between disperse trade northern the coast of distances efficiently of from west rings geographic coast to the the east large westerlies within between the the masses km southern between land 4 to the mass between and due Fig. distances land for C–D see smaller continuous be km) much clades realm; could to 7,800 whereas Australian this compared pantropical, the continents that is and (ca. hypothesise E (Afrotropic Australia We clade realms and only zoogeographic 5). why single for intriguing to (except Fig. is restricted species it mostly subtropical avian are E), and for F clade tropical evidence in exclusively direct #57 comprise that US.065/species C–F note clades species but that for 2018; Considering firewall, McKown, north a a the & between had of Miller, migrating missing). they sort birds Kimball, is by provided barrier, dispersal (Mogle, latitudinally dispersed equator the significant be hemisphere as potentially the a south difficult, could constitute along and more that much preferences may islands be climate areas may and temperate tropical dispersal with continents tropical preferences longitudinal and and any contrast, tropical altitude conditions subtropical In on may exhibiting low climate arranged there. which dwell species that to similar 2013; and arrive tardigrade Given by Wen, to proliferate types), characterised chance & climate eggs). to are Sun, tropics) likely temperate their Meng, in the and are or Deng, observed of tropical tardigrades was Nie, (mainly majority of (as habitats the e.g. stages which manner constitute seeds, pantropical winds dormant propagules (which plant a trade tardigrade to regions or by in drag similar 1997 mediated them could ecologically LDD Gatehouse, disperse that see be by effectively masses My; e.g. explained and several air insects, every be equator subtropical event some may the southern naturally one that E along and (i.e. as suggests clade and northern rare which considered towards of both still zones, character is be channel see clades, pantropical zoogeographic to (but can other The tend single realm in #58 to than zoogeographic 5). species frequent restricted subtropical more only Fig. are or is that species it tropical although suggesting six one dispersal, three remaining details than only The more more E, Oceanic clade in for the pantropical). in found and down delineated pops), were preliminarily subsections from (3 species #58) two realm populations nine Orient and Panamanian the comprises the #55, the among this it in: however, pops), (#54, of Importantly, areas that (3 altitude ancestor considering pop). Afrotropic low the (1 pantropical, also pops), realm of often as (6 and origin Neotropic regarded analysis, latitude (44%) populations), low be RASP Neotropical (7 along the should a distributed in E realms as mirrored zoogeographic clade also well multiple is fact, as which (45%) In group, Oriental EiE complex clade. supported biogeographically the most equally support the nearly to is with seems 5) evolved 5), have (Fig. to E (Fig. seem clade Clade subtropics contrast, F, and In and extent. tropics most history. A–D some evolutionary across words, clades to their other lineages i.e. during hypothesis In distributed analysis, realm widely our respectively). zoogeographic the in comprising support, single recovered as 45% E, a clades zone to and major restricted (97%–99% zoogeographic also six remained E is single the and This clade a of of except indicated realm. five percentage clades single which in (Fig. a all the analysis, species clade to of RASP with per restricted origin average) the are realms, of on 57/64) of place (89%; (89% zoogeographic results species 100% unequi 9 Milnesium pce sas upre ytetemporal the by supported also is species .bohleberi M. vs Posted on Authorea 20 Jan 2021 | The copyright holder is the author/funder. All rights reserved. No reuse without permission. | https://doi.org/10.22541/au.161073927.77224986/v2 | This a preprint and has not been peer reviewed. Data may be preliminary. fteseisi on nohrlclte rudteWrdta r soitdwt ua settlements. human with associated are that surprising World be the not around would it localities and other activity, human in by found Zealand facilitated Far New is is and and species dispersal Africa (Europe South whose the island and species cases, if 2020, oceanic synanthropic five Michalczyk an a & all and Morek is In continents in it contribution). five Australia highest present 2019b, from the the al. among reported in et is been collected Morek species has were in Interestingly, invasive it Asia species of 2020). East two as number Griffiths these taxon, the & of cosmopolitan where Janion-Scheepers populations a Province, (e.g. African Cape RSA four Western been the all the have in and 2016). in (ZA.040) species roadsides al. invertebrate sample et the single of Janion-Scheepers on as a hundreds see probable, in more as (e.g. even found is surprising, humans were populations by not these Africa of is #3, origin South Africa anthropogenic (#1, to The South species Europe Palaearctic of from of dispersal: Republic introduced presence unintentionally anthropogenic the the Specifically, of in E). result #26) (clade a and #54 human-mediated likely species or are new natural delineated them signify represent preliminarily A), of ranges examples (57%) clade geographic LDD wide four #1, in these with found opinion, (species whether were species our is species Such In (26%) question 5). seven the Table dispersal. set, and but data 3–5 events, our (Figs in LDD SDD zone population recent one zoogeographic potential than one C. a more than clade by of more represented African examples species LDD? South recent rather 27 Another otherwise the for (SDD) the Of evidence dispersal in realm. – embedded short-distance different ranges geographic #46) a a broad and of in with (#33 all example Species which lies species an in Madagascan locality is two realm new Australian the it the the be therefore of though could found, proximity even were the LDD, D in than clade i.e. Oriental in Sulawesi, the in species species’, collected other ‘inclusion was the the it support because of evidence data questionable, constitutes one more current species’ of Thus, ‘inclusion would Nevertheless, classification of species’ the existence events. in hypotheses. the ‘inclusion dispersal occurs although alternative case, LDD recent and these that dispersal a indicating ancient test such ranges, about to In hypothesis geographic more required first populations wide clade. if new is with these the that sampling singletons), species in intense possible are of realm is three examples zoogeographic it except dominating become Specifically, all (currently, Alternatively, the collected undersampling. recently. represent are than from will rather species resulting past these dispersal artefacts deep of the the be populations when in that may know suggest occurred relatives not species’ realms close on do zoogeographic most ‘inclusion Mya, their we new (47 and that Although of Mya species’ Given colonisations 13–91 ‘inclusion dispersal. between the 4). ca. ancient observed Table dataset) divergences of clades; our deep as examples their the in species’ as identified occurred, in ‘inclusion (as them species relatives as interpret other closest species we of their such average), from localities termed diverged zoogeographic the (we species different from clades these a out respective all in stand their collected in localities were that species geographic (17%) of their 11 majority only the identified than we untangling realm species, for delineated 64 data dispersal? the crucial ancient Among sporadic provide for could evidence they – genus. as species’ the whether Antarctic, ‘Inclusion of India, test the diversification as to and such early out fragments, America and carried Gondwanan South origin be former studies, the should of include Further should world, parts origin. areas the southern geographic the of Ideally, the their parts are Thus, maintained. with unsampled is that correlated far correlation strongly clades. so clades this still from the the are populations between clades more of divergence major including age the drive which ancient to between in wedging isolation and pattern oceans out geographic split by ruled below). effective created Gondwana be barriers provided Milnesium lineages’ the the cannot continents main scenario, it between new this six however, Under relationship the error, the clustering. causal estimation geographic of by a considerable ‘Diversification characterised a is subsection with there the burdened that are also dates see both (but Obviously, breakdown Gondwana the iegsgnrlyrrl ipre ewe h rfigcniet,wihrsle nteextant the in resulted which continents, drifting the between dispersed rarely generally lineages Milnesium .berladnicorum M. h o ecnaeo uhicdnssget htLDi ae Moreover, rare. is LDD that suggests incidents such of percentage low the , seis#,caeA), clade #3, (species .inceptum M. 10 a on nubno ua ra,tu possibly thus areas, rural or urban in found was Milnesium .inceptum M. .inceptum M. .tardigradum M. p o.I.4 seis#3 is #53) (species ID.947 nov. sp. seis#6 ld ) n a and B), clade #26, (species em ob neapeof example an be to seems and .berladnicorum M. .tardigradum M. Posted on Authorea 20 Jan 2021 | The copyright holder is the author/funder. All rights reserved. No reuse without permission. | https://doi.org/10.22541/au.161073927.77224986/v2 | This a preprint and has not been peer reviewed. Data may be preliminary. osmu,oraaye icse bv ugs httegetmjrt 7% 66)of 46/64) (72%, majority great is the Everything that that suggest indicating above distributions, discussed restricted have analyses of our distributions up, geographic sum shapes To 6) that widespread (Fig. factor a Everywhere key for not evidence a is of not lack Everything is facultative) the least trait genus, (at the this suggest in that which populations prevails 81%), investigated cryptobiotic suggests indeed (72/89; of LLD until found mode majority been reproductive Therefore, great have this males the If expected. no in parthenogenesis. adults, Furthermore, be in ten evaluated. least should be species at cannot by cryptobiotic – represented other dispersal good trait on onto trait suggests phenotypic this which extrapolated other of of (and habitats, number any easily a xerothermic abilities in be in in cryptobiotic as capabilities cannot found high – are this variation exhibits milnesiids matter), abilities, many 2014) that Although Frohme, genus. for & the suboptimal Schill, distribution and Mali, geographic Although time Grohme, large of dispersion. Wang, terms enhance K¨ohler, 2004; in to & predicted (both survival are Thulin, cryptobiotic parthenogenesis inceptum Macrobiotoidea greater and 2011; Fontaneto, mode (H¨orandl, Specifically, superfamily conditions) reproductive 2009; animals 2015). and environmental the microscopic abilities al., of of cryptobiotic potential also et species dispersal propagules, in Incagnone affect their to and potential (e.g. adult animals hypothesised also dispersal the of eggs been may size have than the their the strategy smaller from of oviposition slightly deposit Apart Thus, only reduction freely 1928). are potential. the that that dispersal exuvia, in genera the the role parachelan determine of that prominent size itself the a egg is have the it so of Moreover, al. cuticle, instead et potential. shed female, average Morek dispersal the on their still inside (e.g. reduce are eggs may length milnesiids which their stage, in genera, tun mm tardigrade cryptobiotic the other 1 enter than exceeding they larger when individuals shrink some tardigrades Although with dispersal tardigrades, limit 2020a). to known likely largest are factors the two represent LLD, passive for requirement of key abilities a is seven size all microscopic that of Considering events hypotheses. dispersal working dispersal recent as and behind treated biology mechanisms be Milnesium thus should 2019a), 5) (Table al. above difficult notoriously et discussed (Ga˛siorek is species should tardigrades anthropogenic SDD. probably or in of natural they test cases are the realm, events as to though 3500 dispersal zoogeographic rather even recent but one Thus, whether (ca. LDD, than determining realm Importantly, case. of more Panamanian latter examples span the the as #55 and in considered and Neotropic barrier be #40 geographic the not species no and of Afrotropic is apart), ranges the there km geographic Moreover, realms: 2000 sample However, (e.g. zoogeographic respectively. Except adjacent tourists apart), (ca. dispersion. in among km realm mediated dispersal. found popular Madagascan human were natural not #55 of the recent are and potential and of #40 #40 that decreasing examples species places species further representing be and/or Argentina), new populations could populated North delineated E), sparsely or preliminarily clade in Guiana French in collected i.e. were (both probably ranges, they #58 most ranges. geographic ZA.360, and as geographic broad #55 species wide with abovementioned their C), this four despite species (clade realm, the hypothesis three Oriental EiE consider the remaining the we in The Thus, supporting locality known not SDD. the closest therefore an natural that the and of be given from dispersed Alternatively, away case to artificially km likely a realm). 650 of also is Oceanic only rates be the population is high to could realm ID.711 with Oriental Oceanic the countries, the the populated islands, in (from analysed densely arranged locality dispersal within most six closely classified anthropogenic the and the are of of numerous of these example one the although is one between ID.950), Indonesia from with travel and that comes human ID.940 taxon, Given (ID.711) (ID.432, Oriental locality realm. do Oceanic Oriental predominately populations the the a however, three Importantly, further be realm. as to Oceanic Indonesia, the seems in E) recorded (cade populations #54 species Finally, h nyseiso h eu nwihcytboi a enivsiae Shl,Steinbr¨uck, (Schill, investigated been has cryptobiosis which in genus the of species only the , Milnesium pce:bd ieadoioiinsrtg.Tegetmjrt faohlnspecies apochelan of majority great The strategy. oviposition and size body species: Milnesium p.udracnrle omngre einaeasse,teeffect the assessed, are design garden common controlled a under spp. 11 not vrweeadta aua D vnsare events LDD natural that and Everywhere Milnesium ncnrs omultiple to contrast in , Milnesium Milnesium Milnesium Milnesium species. deposit species Posted on Authorea 20 Jan 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161073927.77224986/v2 — This a preprint and has not been peer reviewed. Data may be preliminary. l,21b asoe ta. nrve;ti td)rte hndsuc eprt agsi h otenand northern the in Moreover, ranges temperate 2008). disjunct et al., (Ga˛siorek than et distributions rather (Fontaneto pantropical study) have this mediated to review; human wi- found in be be al., often to et to Ga˛siorek more 2019b; found are hypothesised al., were species widespread not many tardigrade species are hypothesis, to widespread many contrast everywhere’ species However, whereas In is rotifer European significant. cosmopolitan. ‘Everything of and a as the classified present ranges with to were being (although The conform some distance 2008). sampling and not by despread al., worldwide do et isolation on generally Fontaneto the species based or with rotifer G´omez, (2008), 2007 that & al. studies Lunt, indicated several et Mills, bias) but Fontaneto nema- nematodes, study, and (e.g. for rotifers influential conducted available lichen-dwelling most yet been and not have moss coexisting are rotifers as ideally analyses ecology, such concerning biogeographic similar habitats, then global with same true, Unfortunately, animals the indeed todes. microscopic in were study. other tardigrades this this to to limnoterrestrial from compared If out with inferred be status. turn should than current may results frequent their our species’ more Finally, lose ‘inclusion is and the LDD species’ of ranges that ‘inclusion some geographic mean of would and wide proportion and it increase taxonomy exhibit the may of example, various that For ranges terms in species in geographic collected conclusions. be both broad key species dataset with current sequenced the the species of enlarging of and number date, some the to alter of genus may terms tardigrade geography in the faunistic any though size of molecular even sample any realms Thus, detailed largest However, zoogeographic tardigrades. whereas the for animals. sampling, offers species limited these of study extremely thorough are delineation present of requires regions accurate LDD a geographic LDD the different for if of because concerning needed datasets stage, detection Moreover, factor range, this suggest and pantropical at key ranges heterotardigrades a premature ranges. the usually geographic be on geographic is be would it works might conclusions and all, general study, winds at abilities categorical trade distribution our dispersal geographic that with broad indicates limited a line which exhibit have to in may happens Thus, species tardigrades tardigrade general, 2019b). in al., that, et (Ga˛siorek character in oeadol w eefudt aepnrpcldsrbtos ial,aogtesvrlkonseisof species known several the among zoogeographic Finally, single to distributions. limited pantropical are have (in species to of al., found echiniscid, majority the were et great Ga˛siorek another an two the Furthermore, only of that of and found species 2020). phylogeny realms) zone 25 (8 al., first continents representing et 6 (Ga˛siorek the from populations Orient 1911, example, 64 the For analysed to who groups. other review) tardigrade the other and Palaearctic in Western also that emerge genus suggest to echiniscid species data seem limiting our paleogeography. factor patterns since by main Similar Thus, mainly the determined type). not that are is climate underlines ranges climate single this geographic ranges, a their words, geographic to limited other have limited In of species not distribution. indicates ranges of (i.e. 3–5), majority geographic (Figs predicts great that clades EiE the main indicates the the this than of way, wider majority Either the (mainly environments. within natural types of for climate evidence multiple be to found that seem we 6). likely there that most (Fig. words, fact and species other The rare In (9/64) generally winds. 14% is dispersal trade only ancient LDD by that of in evidence affected meaning examples LDD with we for subtropics, are zones ancient) species evidence then and cases the (1/64) tropics LDD with in #55), 2% the these occur species and in and of to happened #61) (8/64) majority #53, them great and 12% #46, of the #57, LDD: half Thus, #40, #56, and #58). natural #55, #33, realms) (species in likely #54, LDD (species Oriental #23, exhibiting realm recent of LDD #19, and for species Madagascan #16, results than Australian (9/64) the (species rather the the 14% LDD and SDD and ancient only be Afrotropic of America, with to the examples South up localities likely as (i.e. in end between are them zones realms dispersal Panamanian treat of that zoogeographic cases and and 7/64); examples adjacent and Neotropic (11%; discarding LDD), of the recent all borders after Africa, #54, or Moreover, the and 11/64) #26, to details. (17%, #3, close ancient for #1, either (species 5 LDD, dispersal and anthropogenic indicate 4 species Tables (18/64) see 28% only Overall, rare. ciicsvirginicus Echiniscus Milnesium pce a ucl dp onwciae raecpbeo wligi iespectrum wide a in dwelling of capable are or climates new to adapt quickly may species Bryodelphax ign 92cmlx nyoehsawd itiuinad gi,i spantropical is it again, and, distribution wide a has one only complex, 1962 Riggin, hln 98(eeoadgaa noee w lds n etitdt the to restricted one clades: two uncovered (Heterotardigrada) 1928 Thulin, Milnesium 12 pce xii iie ipra blte and abilities dispersal limited exhibit species Milnesium Pseudechiniscus Milnesium pce hudb even be should species pce,wide species, Thulin, Posted on Authorea 20 Jan 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161073927.77224986/v2 — This a preprint and has not been peer reviewed. Data may be preliminary. e ilo er;SM slwrta h rvosycluae on 8 n 8 RArt o h entire the for rate 1.05 rRNA indicated 28S rate and mutation 18S mutates rRNA joint fragment (2.37 28S calculated COI rate the previously the mutation of the whereas rRNA than rate lower 18S (1.56 lowest is the Ecdysozoa the SSM) of by years; estimation characterised million markers our molecular is per utilised Importantly, rRNA four all 18S fastest. for expected, rates the mutation As data estimate needs to genetic 3). us and more allowed (Table also expected encompassing analysis is analysis, clock phylogenetic ages molecular The robust node more exact lineages. a the eutardigrade parachelan by of numerous two down uncertainty the the narrowed for Cambrian the for between and early data 2017), event Mya; verified not al., fossil divergence 323 be et are available to this to (Guidetti (540 and of scarce general HPD, estimation the genera, in 95% ever tardigrades given valid wide first very However, are the a three is has orders. but This all (Silurian) that remaining Mya Carboniferous). 432 the assumption to for that the dated suggest requires is recognised this Parachela however, which currently Moreover, the 2020), This, analysis. possibly within Michalczyk, older, our nested & even older). in Morek be observed or 2012; should split ancient 1962 Giribet, Jurassic first hypothesised Ramazzotti, & the Milnesiidae previously Guil within than the 2000; genera older confirms Grimaldi, even analysis & be the (Bertolani may Therefore, genus the ago. of (My) origin years within million split 162 first Jurassic, the of estimations clock vs Molecular 200 (ca. dating size clock body Molecular be could obvious most but exuviae). tardigrades, Importantly, apochelan than Zealand. 700–1000 potential New LDD and in greater Africa ently distributions Europe, temperate in disjunct 2018), e.g., such Maiphae, subsection found, identified & were not Pholpunthin, Meksuwan, species have found Fontaneto, we widespread been Jaturapruek, temperate not 2008; has some al., distributions et as pantropical Fontaneto of (see precedence rotifers the in 2019a), al., et (Ga˛siorek hemisphere southern iesfiainwti h eu.O h te ad uhaptencudb natfc eutn from resulting artefact widest an are be study could present pattern the rapid in a and sampling ancient such suggest geographic hand, may and tree the other taxonomic the in both the of data Although part On new basal sampling. genus. the of fragmentary in the portion nodes nodes. within large currently supported deep a weakly diversification the the and and of of one in branches divergence inclusion of short shallow position the The therein the their given consisting and and changed 2020, surprising 2) B Michalczyk, not slightly (Fig. (A, & are analysis and herein Morek current changes presented composition in These analysis C comprehensive their tree. the and first changed presented in (E respectively) recovered the clades also smallest species, with two were two line the paper only previous in and the overall D), in are obtained contribution clades main this genus in the orders. of and/or obtained phylogeny classes relationships the of phyletic each lineages The for to main independently consideration into or six taken phylum, the entire be of the should to Diversification points for belonging calibration rates taxa also of these so concerning lineage number of analyses is this larger values Therefore, a that the This tardigrades. and assess possible tardigrades. lineages other it tardigrade than of is evolution major thus genus groups of all and the pace other parachelans, slower in the to a to they estimated exhibits applied compared tardigrades, been when for stasis have exclusively morphological especially calculated rates considerable caution, been substitution However, have extreme rate. the rates mutation with substitution because lower are that used the tardigrades time in that be first mirrored indicate is the should analysis which is our evolution, this of in that pace obtained given slower rates by mutation characterised lower likely much most The Ecdysozoa. for rRNA μ areouinr patterns Macroevolutionary )adoioiinsrtg eg adfel noteenvironment the into freely laid (eggs strategy oviposition and m) × 10 -3 S;Rt-tbli ae,&Psn,21)b nodro antd.Teestimation The magnitude. of order an by 2013) Pisani, & Daley, Rota-Stabelli, SSM; Milnesium Mrk&Mcacy,22;seas i.2hri) he u ftefive the of out Three herein). 2 Fig. also see 2020; Michalczyk, & (Morek bv) ti rmtr oepanwybeli oieshv appar- have rotifers bdelloid why explain to premature is It above). Milnesium × 10 -3 iegs h g fsltbtenteAohl n the and Apochela the between split of age The lineages. Milnesium 13 S,wihi lolwrta h ond1Sad28S and 18S joined the than lower also is which SSM, Milnesium iegspeeti u aae sdtdfrthe for dated is dataset our in present lineages Milnesium Milnesium Broai&Giad,20)and 2000) Grimaldi, & (Bertolani htaelkl ob aua (see natural be to likely are that > 0 yod(aeTriassic/early (late old My 200 hc scaatrsdb a by characterised is which , vs × 10 gsli ncuce into clutches in laid eggs -4 usiuin e site per substitutions Posted on Authorea 20 Jan 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161073927.77224986/v2 — This a preprint and has not been peer reviewed. Data may be preliminary. 4 o5%.Atog pce eieto nti td speiiayadtxnmciett fteanaly- the of identity taxonomic (from decreased and preliminary population single is by study species represented delineated this species of in species of number delineation of number the species the times), number Although and (3.7 the 56%). times), 127 to in (2.5 to 84% 64 growth 34 to from substantial 25 increased a from populations recent raised in of most number resulted the the with dataset 2020), compared zyk, the Specifically, study. to this populations in analysed new to of likely addition is it The that meaning verified, be to Milnesium time. evidence breakdown long fossil Gondwana a require the for may Similarly, untested tested. and remain currently speculation be a cannot remains hypothesis hypothesis this available, are 1999 Claxton, hudhv curderirto.Mroe,teohrtreaohlngnr wihaepoal also probably are (which of genera lineages ‘basal’ divergence apochelan the the three as then time time other earlier, for of similar appeared data the a period it cular at Moreover, (if short diverged lineage too). relatively have apochelan must a earlier the carnivorous) within of occurred evolved history have carnivory natural the should that in that assumption late tardigrades bold relatively other and a than requires older hypothesis is this genus omnivorous My the the (162 that 2009 as Wolf, suggests time such the also micrometazoans, at on analysis unoccupied feed our was scenario, predator parsimonious microscopic most a genus of by niche the that exclusively ecological (Crame, of Assuming the the occupied time diversification than is for geological the likely habitats over hunt more grows lichen of other would even biodiversity and In is global that moss that 2020). it in apochelans consideration 2001), al. predator Bryndov´a into by et microscopic pre- taking tardigrades; a occupied Moreover, no non-apochelan of apochelans. habitats are and niche in rotifers ecological there dwelling the nematodes, tardigrades, words, mainly range from (i.e. size and/or Apart prey herbi- omnivorous. body same bacteri-, mostly this are 2020). Devetter, eutardigrades being within & many macrobiotids dators Michalczyk, and Schill, with heterotardigrades (Bryndov´a, Stec, diet limnoterrestrial only herbivorous all fungivorous, a time, con- on same hypothesis reproduce the carnivory to At the able phylogeny factor, not and are abiotic of and external, geology property an physioecological between concerns a correlation hypothesis cerns split analysis time Gondwana clock accidental. the the molecular be Whereas our that may and study meaning isolation present geographic error, the immediate in an considerable breakdown observed in Gondwana with the the result temporal order that not for same burdened stressed did sister responsible the be is that roughly to be the process needs see to hand, long it to Moreover, supposed a other parachelans. expect was was and should the drift apochelans we continental On both as general, in if hypothesis. apochelans, in pattern and, tardigrades this of earlier limnoterrestrial abilities support My of 83 to dispersal diversification force diversify low seem the to scenario, study, apparent started this present The Parachela Under the isolation. 2). Fig. in geographic (see was demonstrated breakdown Gondwana diversification and extant the divergence of Gondwana behind the ancestor of of breakdown common coincidence the the scenario: the of a from carnivory question such to for the switch However, explanations the genus, hypothesis. analysis. possible and a the non-exclusive our mutually for of in two calls history are recovered divergence there There evolutionary possible diversification rapid is that the the the it suggests reflects case, caused than the 2) accurately have later indeed may tree Fig. is what or phylogenetic see this If earlier our long; time. also that My present the assuming diversified (187–270 new to Apochela-Parachela genus ingroup from persist the the not the the Apart from did on that in branch yet. that light lineages observed long detected strong ancient relatively diversification some were been the shed probably first Moreover, not to the family. likely have details) entire to are for but and genera split below genus there, apochelan also the three (see out remaining of time be the evolution first for could the sequences for lineages DNA sequenced phyletic species, were that new species that of suggests number considerable the date, to pce diversity species Bergtrollus Milnesium vs 3 y epciey,frhrlnigceec oti yohss nteohrhand, other the On hypothesis. this to credence lending further respectively), My, 138 atc,2011, Dastych, a anvru ttetm fteosre ieg iesfiain hc sthe is which diversification, lineage observed the of time the at carnivorous was Milnesium Milnesium Limmenius noee noraayi c.10M g ree earlier). even or ago My 160 (ca. analysis our in uncovered tef l nw pce ntegnsaesrcl carnivorous strictly are genus the in species known All itself. Paramacrobiotus 14 onn,Shse rgrc,17 and 1978 Grigarick, & Schuster Horning, Milnesium Milnesium udti cil etln,Dnea,& Dandekar, Bertolani, Schill, Guidetti, pce.Tefis yohssstems hypothesis first The species. Milnesium hlgn Mrk&Michalc- & (Morek phylogeny ie htn mole- no that Given . Milnesioides Posted on Authorea 20 Jan 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161073927.77224986/v2 — This a preprint and has not been peer reviewed. Data may be preliminary. o e naubehl ihtefil apigi ot fia h td a upre ytePolish the by supported was study RSA) The University, (Stellenbosch Africa. Simon South Carol in to sampling the grateful the field the of via deeply the Centre phylogeny are with UNESCO Science the We a National help of WM. RSA, invaluable “Reconstruction to Park, her Wetland project all for iSimangaliso a Site; within under within collected Heritage carried were and World Eutardigrada)” Australia/Plant samples 3570/2018 (Tardigrada: University, The the Apochela OP (Curtin Kiosya. of order CN35-285316, Yevgen Christenhusz some and USA), No: University, Maarten Germany) with (SBiK-F, permits State USA), us Barczyk Tennessee M. providing College, Maciej Reinhardt (East UK), Poland), for Wilson Nelson University, Gateway, (Warren colleagues (Jagiellonian Diane Stec and Bartels Denmark), Daniel friends Paul Copenhagen, and following Gasiorek of Piotr (University the study: Kristensen to this in grateful used very samples are authors The Acknowledgments species. nlss rprdfiue,datdtemnsrp n rvddpr ftefunding. the of part provided and manuscript the drafted figures, prepared analyses, – WM Initiative “Excellence programme the Krak´ow, contributions under Poland. in Area publication Author University Research Open-access Priority Jagiellonian BioS the Centre). the at Science by University” funded Research National was Polish article the this by of funded (2020/36/T/NZ8/00306, stipend the in species new putative of number overwhelming taxonomic apparently greater the a least, describe not but to clock Last the molecular phylum. made of the this genus verification of to be evolution enhancement the the should important Furthermore, understand provide major effort analysed. the better could the us be tardigrades date between help of should and relationships to groups analysis, genomes phylogenetic characterised other framework entire the is for phylogenetic resolving or tree rates the for mutation markers a of allow molecular in part not new basal included does the clades, which as be the Moreover, branching, reliably. on to shallow more breakdown by need group Gondwana this the genera within of events milnesiid diversification effect remaining the understand the encompass us Crucially, to help seem to Hemisphere likely Southern of the are diversification in genus and areas early the lineages the this of basal as then Zealand, evolution most New clades, would early the and separate the clades Australia Antarctica, uncover form mixed in to species types, focus or order that Palaearctic climate B, in evidence and same Furthermore, and the the Nearctic abilities. A only however, strengthen share have clades If, Palaearctic they further within the hypothesis. but would Palaearctic, and EiE strait, Nearctic the the Bering the from that the support Given only through clade(s). known connection separate currently own, limited their species constitute the they with whether mixed are region on research Michalczyk, Future & Morek, Surmacz, 2016; al., directions et de- Future Morek species see of (e.g. resolution genus applied high the are the of provide investigated tools 2019). taxonomy to molecular poorly the analyses essential or in ontogenetic the unexplored required and provided given lineation morphological species, any detailed new with of multiple tandem survey uncover in each certainly that than almost rather suggests will hundreds species, region are currently apochelan there of the that majority of indicating the underestimated, number grossly the extant is of than genus tens this number in greater diversity genus a species analyses, the that constitute ontogenetic in species and species unknown morphological described putative detailed identified a including 49 investigation, the further requires populations sed Preludium Milnesium ocie h td,cletdmrhlgcldt n ato oeua aa a phylogenetic ran data, molecular of part and data morphological collected study, the conceived : Milnesium rn n.21/5NN8047t M uevsdb L) Mi eiin fthe of recipient a is WM by LM). supervised WM, to 2019/35/N/NZ8/04487 (no. grant ihu elcigtene oitgaieyrdsrb h ubro lsial delineated classically of number the redescribe integratively to need the neglecting without , Milnesium Milnesium pce.Ti rdcin obndwt h paetlmtdgorpi agsof ranges geographic limited apparent the with combined prediction, This species. Milnesium hudcnetaeo h ertcramt eiywehrtx rmthis from taxa whether verify to realm Nearctic the on concentrate should oaaBis Sonata . ie 3 oe ta. 00) hsepiil eosrtsthat demonstrates explicitly This 2020b). al., et Morek 43; (i.e. rgam gatn.21/2EN8047t L)advia and LM) to 2016/22/E/NZ8/00417 no. (grant programme Milnesium 15 pce eeal xii iie aua dispersal natural limited exhibit generally species Milnesium apigogtto ought sampling , Etiuda Posted on Authorea 20 Jan 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161073927.77224986/v2 — This a preprint and has not been peer reviewed. Data may be preliminary. elcu,S,&Fo,J .(08.Tehthie’ ud osnl-ou pce delimitation. species single-locus to guide hitchhiker’s The (2018). F. J. Resources Flot, Ecology & S., Dellicour, R. Guidetti, 2020.09.23. & Accessed R., 1178608. Milnesiidae). Bertolani, (Tardigrada: Hamburg P., Norway Museum Degma, Zoologischen Alps, und Lyngen Staatsinstitut the Zoologischen dem of aus zone nival the from (2011). H. Dastych, 10.1111/j.1472-4642.2001.00106.x time doi: geological through –189. gradients 175 diversity , Taxonomic and (2001). diversity J.A. Crame, Genetic (2016). R. Milnesiidae). Guidetti, (1999). & S.K. species. L., Claxton, pan-Antarctic truly Rebecchi, a bear R., is water it polar Bertolani, first that south The J., the S. Tardigrada: of biogeography in McInnes, barcoding M., DNA Macrobiotidae). Cesari, (Eutardigrada, (2009). 1993 Rebecchi R. & Guidetti, Bertolani Resources & macrocalix Ecology Macrobiotus L., on Rebecchi, to study technique R., case easy Bertolani, and M., rapid 2011.03073.x spiders. Cesari, a ethanol-stored 10.1111/j.1755-0998. boiling, of doi: without amounts Chelex 136–141. small 12, (2012). from , G. DNA R. amplifiable Gillespie, stable & obtain C., Thebaud, J., preferences Casquet, dietary Tardigrade traits. (2020) history M. life 10.1093/zoolinnean/zlz146 Devetter, tardigrade & doi: on L., Michalczyk, effects O., diet R. Nota). Schill, and (IV D., Sicilia Stec, 4 di M., Catania Bryndova, muscicoli in Tardigradi Naturali Scienze (1972). di G. Gioenia Pilato, Accademia & taxonomy M.G., integrative Binda, and barcoding DNA (2011). M. species. Cesari, & I., the Giovannini, from of L., Amber Rebecchi, in R., Milnesiidae) Bertolani, (Tardigrada: Eutardigrade Jersey. Jersey New New New of A of Cretacous (Turonian) non- (2000). Cretaceous D. in Upper Grimaldi, patterns & biogeographical R., and Bertolani, distribution Body-size (2013). Ostracoda). 10.1111/bij.12041 L. (Crustacea: ostracods D. marine Danielopol, & A., Baltan´as. Zoon. & Stockum Van (1934). W.P. M. G. L. Baas-Becking, References funding. the of part provided ALL manuscript. BS LM arbou hufelandi Macrobiotus olce eann oeua aa a nta hlgntcaayi,peae grsaddatdthe drafted and figures prepared analysis, phylogenetic initial ran data, molecular remaining collected : ocie h td,sprie h niepoes rfe h aucit rprdfiue and figures prepared manuscript, the drafted process, entire the supervised study, the conceived : a hlgntcaaye,peae grsaddatdtemanuscript. the drafted and figures prepared analyses, phylogenetic ran : Zootaxa olgshrAnzeiger Zoologischer , 2997 , , 18 9 egrlu dzimbowski Bergtrollus 9–0.di 10.1111/j.1755-0998.2009.02538.x doi: 699–706. , insodsexsertum Milnesioides 2414.di 10.1111/1755-0998.12908. doi: 1234–1246. , 93.di 10.11646/zootaxa.2997.1.2 doi: 19–36. , ...Shlz 84 h rttrird pce ob ecie,adsm related some and described, be to species tardigrade first the 1834, Schultze C.A.S. 103–110. , ebooi filiigttd milieukunde de tot inleiding of Geobiologie , 238 netbaeSystematics Invertebrate 183–190. , ilgclJunlo h ina Society Linnean the of Journal Biological culcekito adgaaspecies Tardigrada of checklist Actual ctnu antarcticus Acutuncus e.n,s.n,armral e adgaegnsadspecies and genus tardigrade new remarkable a n., sp. n., gen. e.n p . e adgaefo utai (Tardigrada: Australia from tardigrade new a n., sp. n. gen. tde nFsisi me,wt atclrRfrneto Reference Particular with Amber, in Fossils on Studies olgclJunlo h ina Society Linnean the of Journal Zoological 16 , 11 47–60. , , 30 Etrird:Hpiide Evidence – Hypsibiidae) (Eutardigrada: 3–4.di 10.1071/IS15045 doi: 635–649. , , 15 iest n Distributions and Diversity . h au,teNetherlands: the Hague, The . 335–359. , noooiceMitteilungen Entomologische oeua clg Resources Ecology Molecular oltiodlesdt della sedute delle Bollettino o:10.25431/11380 doi: . , 109 0–2.doi: 409–423. , , 188 865–877. , Molecular Molecular , 7 - Posted on Authorea 20 Jan 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161073927.77224986/v2 — This a preprint and has not been peer reviewed. Data may be preliminary. 2 Tardigrades. les M´emoire sur (1840). Doy`ere, M. arffn,A .S,&Blao .(07.I h bqiosdsrbto elfrmrn gastrotrichs? marine for real distribution ubiquitous the (PAE). Is Endemicity of (2017). Washington Analysis Parsimony M. of using Society endemism Balsamo, Cicindelini). of & areas (Coleoptera: of S., Gibraltar Detection R. of A. strait Garraffoni, the ti- of two sides of France both de patterns at entomologique Phylogeographic species (2014). beetle diversity Gali´an, J. ger hidden & of J., levels L´opez-L´opez, Serrano, Extreme Garc´ıa-Reina, A., A., (2009). G. taxonomy. T. DNA 10.1016/j.ympev.2009.04.011 by Barraclough, doi: revealed widespread. & 182–189. (Rotifera) very A., animals are E. microscopic things Herniou, in M., most Kaya, but D., everywhere Fontaneto, not broad- is for evidence everything of Molecular (2008). rotifers: Ecology amplification A. Molecular bdelloid E. Herniou, for in & C., primers distributions Ricci, K., DNA scale Chen, G., (1994). T. Barraclough, R. D., Fontaneto, Vrijenhoek, & invertebrates. R., metazoan diverse Biotechnology Lutz, from and I W., subunit oxidase Hoeh, c cytochrome M., mitochondrial diversity. Black, global O., Protists. and Emphasizing Folmer, local Review A of Micro-organisms: patterns of Dispersal species: Protozoologica and small Biogeography of (2006). W. ubiquity Foissner, The (2004). J. B. BioScience Finlay, Cryptic Microorganisms: & of T., Diversity Global Fenchel, versus Local (1997). Protozoa. J. and Ciliated B. BEAUti Finlay, of with & Diversity F., phylogenetics G. Bayesian Esteban, (2012). T., Fenchel, A. Rambaut, & D., 1.7. Xie, BEAST A., the M. Suchard, A., Drummond, airk . oˇia . em,P,&Mcacy, .(00.Sali euiu:tefis phylogenetic first the beautiful: is Small (2020). L. Michalczyk, L. Michalczyk, & & of M., P., analysis R. Degma, Vonˇcina, Kristensen, K., P., R., Gasiorek, D. Nelson, K., Zajac, tardigrades. A., in H. Meyer, J., (2019b). K. Jackson, P., Gasiorek, hypothesis? Everywhere’ is ‘Everything the for Zoology evidence (2019a). or dispersal L. Michalczyk, anthropogenic & Vonˇcina, K., P., Gasiorek, of Revision (2018). Michalczyk, L. & Zootaxa M., R. Kristensen, K., cus Zawierucha, D., Stec, P., Gasiorek, insects. by migration wind-borne of genetics Entomology ecological and of Behavior (1997). G. A. Gatehouse, xds uui o aieivrertsadapiaini l-aaboi surveys. biotic all-taxa in application and cytochrome invertebrates mitochondrial for marine primers PCR for of Redesign I morphological (2013). subunit H. and Hawk, oxidase Phylogeography & c M., Parker, review). C., Meyer, (In J., Geller, L. Michalczyk, & K., of evolution Zajac, Vonˇcina, K., P., Gasiorek, 10.3897/zse.96.50821 doi: 217–236. , , 14 rsesn 97(eeoadgaa ciicde eue h oatmeaedsrbto ftegenus. the of distribution polartemperate the refutes Echiniscidae) (Heterotardigrada: 1987 Kristensen, 269–362. , , , ciicsvirginicus Echiniscus 46 4472 Bryodelphax , Pseudechiniscus 54 7–8.di 10.1080/03014223.2018.1503607 doi: 174–181. , , , ilgclJunlo h ina Society Linnean the of Journal Biological 6–9.di 10.11646/zootaxa.4472.2.3 doi: 261–297. , 45 7–8.di 10.1641/0006-3568(2004)054[0777:TUOSSP]2.0.CO;2 doi: 777–784. , 42 oeua ilg n Evolution and Biology Molecular , ,294–299. 3, , 111–136. , 7–0.di 10.1146/annurev.ento.42.1.475 doi: 475–502. , 17 , 1634.di 10.1111/j.1365-294X.2008.03806.x doi: 3136–3146. , hln 98(eeoadgaa Echiniscidae). (Heterotardigrada: 1928 Thulin, 3 (1) 130 , 50 Htrtrird:Echiniscidae). (Heterotardigrada: 9–0.di 10.1080/00379271.2014.984954 doi: 399–406. , ope:tefis aeo suorpi loar n atoia distribution pantropical and allopatry pseudocryptic of case first the complex: Oikos 9–1.di 10.2988/17-00011 doi: 198–211. , , 80 2–2.di 10.2307/3546589 doi: 220–225. , nae e cecsNaturalles Sciences des Annales , 22 17 1519.di 10.1093/molbev/mss075 doi: 1185–1192. , ciicstestudo Echiniscus , 128 cetfi Reports Scientific oeua hlgntc n Evolution and Phylogenetics Molecular 8–0.di 10.1093/biolinnean/blz147 doi: 789–805. , osseaisadEvolution and Zoosystematics Dye e 80 nNwZealand: New in (Doy`ere, 1840) rceig fteBiological the of Proceedings . oeua aieBiology Marine Molecular , e eln ora of Journal Zealand New olga ai,Series Paris, Zoologia, nae el Soci´et´e la de Annales oeua Ecology Molecular nulReview Annual Testechinis- , Acta 53 , 96 , Posted on Authorea 20 Jan 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161073927.77224986/v2 — This a preprint and has not been peer reviewed. Data may be preliminary. ora fGohsclResearch Geophysical cosmopolitan and of K of Journal Planktonic T., combination (2018). a Boebel, with W., S. Jokat, assemblage Maiphae, species & a P., 10.1007/978-3-030- reveal species. tropical Thailand Pholpunthin, doi: and Africa. from P., Cham. rotifers South Meksuwan, Springer, bdelloid in D., periphytic 14. Invasions Fontaneto, Biological vol R., Ecology, (eds) Jaturapruek, Invasion T. in Zengeya J., Series Wilson Springer 32394-3 D., - Richardson Nature (2020). J., Invading L. Measey C. Soil B., (2016). Griffiths, Wilgen U. & R. C., J. Wilson, Janion-Scheepers, Africa. on South . in focus . directions . research special L., future a and Coetzee, knowledge L., , with current country: S. megadiverse processes Chown, a B., colonization in Braschler, biota and J., Measey, dispersal C., passive Janion-Scheepers, organisms on freshwater do review How A (2015). ponds. L. ocean”? Naselli-Flores, temporary & “dry L., the Robba, R., cross 161–186. Barone, F., pp Marrone, Dordrecht. G., Springer: Incagnone, Parthenogenesis. of Biology Evolutionary An the (2013). Sex: C. Zealand. Rahbek, New & of H Tardigrada . (1978). . A. . A. B., Grigarick, Ara´ujo, & Zoology M. O., A., of R. S. Schuster, S., Fritz, D. K., 295–310 Horning, World. M. the pp. of Borregaard, 2 Regions P., Monographs Zoogeographic Wallace’s Zoological J. of Tardigrades. Lessard, Update A. of G., Biology J. The B. Diniz-Filho Bears: Holt, Water & (2018). (ed.) O. C., Schill R. L. O. R. dis- Schill, Vieira, Ecology. ubiquitously & Galli diatoms S., J., are Hengherr, Soininen, structure: Mykra community streams? micro-organismal M., boreal of S. across patterns for tributed Karjalainen, Geographical program M., analysis (2010). L. and F. editor Bini, alignment J., sequence Heino, biological user-friendly a taxa BioEdit: and 95/98/NT. genes Windows (1999). adding A. tardigrades T. of phylogeny Hall, phylogeny. molecular phylum-level comprehensive resolved A poorly (2012). a G. to Giribet, Everywhere? & Small N., Everything Guil, Is Organisms: Microscopic of Biogeography in Are (2011). micrometazoans: N. in patterns Guil, biodiversity Local data. (2009). biogeographic S. everywhere? Machordom, and scenarios tardigrades & analyses Evolutionary S., clock Sanchez-Moreno, (2017). molecular N., O. on Guil, based Rota-Stabelli, species & tardigrade Zoology L., Antarctic to Rebecchi, an Contributions M., tardi- of Cesari, origin for the J., data for S. molecular McInnes, New nov. R., (2009). Guidetti, gen. M. Paramacrobiotus Wolf, of & erection Research T. Dandekar, Evolutionary the R., with phylogeny, Bertolani, grade R.O., Schill, R., Guidetti, Resources 59 rnl .(2009). E. ¨ orandl, 2–7.di 10.1016/j.pedobi.2016.03.004 doi: 129–175. , 7 , , 13 5 185–280. , 5–6.di 10.1111/1755-0998.12138. doi: 851–861. , oeua praht irmtzas r hyhr,teeadeverywhere? and there here, they Are micrometazoans. to approach Molecular Hydrobiologia egahclprhngnss potnte o asexuality for opportunities parthenogenesis: Geographical uli cd ypsu Series Symposium Acids Nucleic ytmtc n Biodiversity and Systematics , ytmtc n Biodiversity and Systematics 47 ng . ee,U 20) iigadgoer feryGnwn breakup. Gondwana early of geometry and Timing (2003). U. Meyer, & M., ¨ onig, , 86 1–2.di 10.1111/j.1439-0469.2009.00526.x doi: 315–321. , 97–110. , Oikos , , 750 108 0–2.di 10.1007/s10750-014-2110-3. doi: 103–123. , , 48 o:10.1029/2002JB001802 doi: 2428. , niomna dpain:cryobiosis adaptations: Environmental 119 2–3.di 10.1111/j.1600-0706.2009.17778.x doi: 129–137. , Cladistics le ersra netbae nSuhAfrica South in Invertebrates Terrestrial Alien , 16 18 , , 7 2,1811 o:10.1080/14772000.2017.1353554 doi: 128–141. (2), 41 , Science 5–6.di:10.1017/S1477200009003016 doi 259–268. , 28 95–98. , 14.di 10.1111/j.1096-0031.2011.00364 doi: 21–49. , , 339 ora fZooia ytmtc and Systematics Zoological of Journal 47.di 10.1126/science.1228282 doi: 74–78. , n Sch In: . hpe 1 Tardigrade 11: Chapter . nIe l es.Lost (eds). al. et I ¨ on e eln Journal Zealand New Pedobiologia hpe 14 Chapter n van In: . Posted on Authorea 20 Jan 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161073927.77224986/v2 — This a preprint and has not been peer reviewed. Data may be preliminary. oe,W,Gsoe,P,Se,D,Badn . ihlzk L 21) xeietltxnm exposes in taxonomy configuration Experimental long claw avian-mediated (2016). 08502003 of Apochela). of value L. Michalczyk, taxonomic Evidence Eutardigrada: & the (2018). (Tardigrada: B., elucidates Blagden, D. and D., R. variability Stec, ontogenetic McKown, P., & Gasiorek, W., R., Morek, W. tardigrades. Miller, American A., in S. dispersal Kimball, distance J., genus M. the Mogle, of species mite Tit feather data. Long-tailed new barcode taxa.3253.1.2 DNA the A with (2012). from description morphological M. Proctophyllodidae) Aegithalidae): Dabert, (Astigmata: & 1877 J., Robin, Dabert, V., S. phylogeography regional Mironov, strong despite distance metazoan. by small isolation Global a of (2007) G´omez,in inference A. & for D.H. Lunt, Gateway S., Science 2010, Mills, LA, CIPRES Orleans, the New 10.1109/GCE.2010.5676129. Creating (GCE), doi: Workshop (2010). Environments 1-8, T. Computing pp. Gateway Schwartz, 2010 & trees. phylogenetic W., large Pfeiffer, 1–20. A., 3154: M. Miller, Zootaxa of genus. the Corrigenda for (2012b). species nominal L. Kaczmarek, three three & of of M., Redescriptions Redescriptions Frohme, W., We lnicz, L., (2012a). Michalczyk, particular L. with Kaczmarek, Tardigrada, & genus. limno-terrestrial M., of Frohme, Biogeography sium W., (1998). We lnicz, A. L., Michalczyk, J. fauna. P. Press Antarctic University Pugh, the Cambridge to & York: reference New J., Cambridg; S. sex. of McInnes, evolution The (1978). Meridionale J. Groenlandia Smith, Maynard della Verona Eutardigradi di Naturale di Storia specie di nuove Civico Tre Micro- (1991). (2006). W. Maucci, T. J. Staley, italiana. fauna 576–585. . della . , . nuovi Tardigradi A., (1954). W. J. Maucci, Fuhrman, map. K., the from R. on topologies Colwell, microorganisms tree 10.1038/nrmicro1341 J., of putting Brown, size biogeography: sample B., bial effective Bohannan, the J., Estimating Martiny, (2016). L. D. Warren, analyses. phylogenetic & Bayesian X., Hua, R., Lanfear, Genetics Evolutionary Molecular X: MEGA (2018). K. bev/msy096 Tamura, platforms. program. & computing C., alignment Knyaz, across sequence M., Analysis multiple Li, G., MAFFT Stecher, the S., Kumar, in developments Recent (2008). Bioinformatics H. sequence Brief Toh, multiple rapid & for K., method novel Katoh, a transform. MAFFT: Fourier (2002). fast T. on Miyata, & based K., alignment Kuma, K., Misawa, K., tardigrade Katoh, the of study molecular A (2007). , M. R. Kristensen, & studo N., Møbjerg, A., Jørgensen, 66 78.di 10.4081/jlimnol.2007.s1.77 doi: 77–83. , Ehnsia)rvaslwDAsqec iest vralregorpia area. geographical large a over diversity sequence DNA low reveals (Echiniscidae) o` r,14 aa(adgaa uadgaa insia) nldn h oia pce o the for species nominal the including Milnesiidae), Eutardigrada: (Tardigrada: taxa Doy`ere, 1840 Zootaxa , 3154 M vltoayBiology Evolutionary BMC , 1–20. , Milnesium 9 8–9.di 10.1093/bib/bbn013 doi: 286–298. , Zootaxa eoeBooyadEvolution and Biology Genome ora fBiogeography of Journal o` r,14 aa(adgaa uadgaa insia) nldn the including Milnesiidae), Eutardigrada: (Tardigrada: taxa Doy`ere, 1840 , oeua ilg n Evolution and Biology Molecular 15 , 3393 otiuin oZoology to Contributions 279–289. , uli cd Resources Acids Nucleic PeerJ 66–68. , , 7 , 6 19 2.di 10.1186/1471-2148-7-225 doi: 225. , 53.di 10.7717/peerj.5035 doi: e5035. , tidlaSce` tlaad cez Naturali Scienze di Societ`a Italiana della Atti aueRvesMicrobiology Reviews Nature , 25 31–36. , , 8 Zootaxa , 3923.di 10.1093/gbe/evw171 doi: 2319–2332. , , 85 30 , eihlscaudatus Aegithalos 7–0.di 10.1163/18759866- doi: 173–200. , 096.di 10.1093/nar/gkf436 doi: 3059–66. , 35 , 3253 5714.di 10.1093/mol- doi: 1547–1549. , 46.di 10.11646/zoo- doi: 54–61. , Milnesium oltiodlMuseo del Bollettino . ora fLimnology of Journal , 4 Proctophyllodes (Passeriformes: 0–1.doi: 102–112. , ciicste- Echiniscus Doy`ere, 1840 Milne- , 93 Posted on Authorea 20 Jan 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161073927.77224986/v2 — This a preprint and has not been peer reviewed. Data may be preliminary. oe,W,Coe,J . ihlzk L 22b.Dsrpinof Description (2020b). Michalczyk, L. & A., J. Ciosek, intrapop- W., and Apochela. Morek, inter- order of the analysis in The variation 10.1080/14772000.2020.1771469 ontogenetic (2020a). of L. Michalczyk, type of R.M., variability Kristensen, genus B., ulation the Blagden, of W., phylogeny Morek, traits. extensive morphological First and Society markers Linnean genetic (2020). the between congruence no L. Michalczyk, reveals (Tardigrada) & W., Morek, 10.11646/zootaxa.4586.1.2 oaSael,O,Dly .. iai .(03.MlclrTmtesRva abinColoni- Cambrian Evolution. a Ecdysozoan Reveal for Timetrees Scenario Molecular New (2013). a D. and Pisani, 10.1016/j.cub.2013.01.026 Land & of A.C., zation Daley, models. mixed O., under inference Rota-Stabelli, marine phylogenetic Bayesian new 3: a MrBayes of (2003). P. description Bioinformatics J. a Huelsenbeck, of & addition F., the Ronquist, with Virginia: southwest Florida. of from Tardigrada species (1962). T. G. Riggin, eutardigrades. Tardigrada. in (1926). character sex F. Richters, secondary a of di Evaluation naturale varieta. nuova (1998). storia una R. di D. di Biology civico Nelson, e Museo & specie del nuove L., e quattro Rebecchi, naturali di scienze descrizione con di Phylogenies Societ`a - italiana (2008). della Cile Atti del M. Tardigradi Thollesson, (1962). studies. G., . phylogenetic Ramazzotti, . molecular . in B., vouchers of Oxelman, use A., the Nygren, Evolution for plea E., A Norlinder, roots? U., without Incom- Jondelius, Truly They F., Are Pleijel, Tardigrades: Limno-terrestrial and Biogeography K (2001). Binomials? the G. of patible M. map Binda, world & Updated G., Pilato, (2007). A. T. pantro- McMahon, the & explain L., dispersals classification. B. Post-Boreotropical Finlayson, (2013). C., J. M. Wen, Peel, & H., Sun, in M., Meng, disjunction T., pical Deng, L, Z. (ed.) Nie, Schill R.O. Ecology. Tardigrade 7: Fennica Chapter (2018). Monographs Nederstr N. Zoological Tardigrades. Guil, of & Biology J., The P. (Tardigrada).Bears: Bartels, Apotardigrada R., class the D. of Nelson, abolition and Apochela order the Anzeiger of Zoologischer diagnosis the of amendment an L. Michalczyk, & J., N. Marley, M., Yankova, D., Georgiev, O., R. of Schill, of tion C., Redescription A. (2019b). Suzuki, species. W., tardigrade Morek, a in variability Research (2019a). interpopulation Evolutionary L. Michalczyk, of and & study Systematics integrative B., first Surmacz, P., The Gasiorek, 1840: D., Stec, W., Morek, , insu inceptum Milnesium m .(99.DebsjttauFnln eane Tardigraden. bekannten Finnland asu jetzt bis Die (1919). P. ¨ om, , 117 46 , 48 (8). yrlg n at ytmSciences System Earth and Hydrology 194–198. , 6–7.di 48:369-71.10.1016/j.ympev.2008.03.024 doi: 369–371. , , 19 Paederia olgshrAnzeiger Zoologischer 5217.di 10.1093/bioinformatics/btg180 doi: 1572–1574. , , ignaArclua xeietlSain ehia Bulletin Technical Station, Experimental Agricultural Virginia 188 insu eurystomum Milnesium , 288 8–9.di 10.1093/zoolinnean/zlz040 doi: 681–693. , insu alpigenum Milnesium 0–1.di 10.1016/j.jcz.2020.07.002 doi: 107–117. , (Rubiaceae). p o. adgaelbrtr model. laboratory tardigrade a nov., sp. aduhdrZoologie der Handbuch , 57 , naso Botany of Annals 240 –3 o:10.1111/jzs.12233 doi: 1–23. , aci 91rvashg eei iegneadanovel a and divergence genetic high reveals 1991 Maucci, 1–1.di 10.1078/0044-5231-00061 doi: 511–516. , hebr,15 Trird:Aohl)adadescrip- a and Apochela) (Tardigrada: 1853 Ehrenberg, , 20 11 ytmtc n Biodiversity and Systematics , III 6314.di 10.5194/hess-11-1633-2007 doi: 1633–1644. , p 163–210. pp. 2 , 58–61. , 111 insu pentapapillatum Milnesium 7–8.di 10.1093/aob/mct053 doi: 873–886. , urn Biology Current caSceai r an tFlora et Fauna pro Societatis Acta insu tardigradum Milnesium otx,4586, Zootaxa, oeua hlgntc and Phylogenetics Molecular Milnesium , 152 Milano, , pe-egrclimate ¨ oppen-Geiger ora fZoological of Journal olgclJunlof Journal Zoological , 18 2 1–145. , 1–3.doi: 614–632. , 9–9.doi: 392–398. , 101 p o. with nov., sp. Doy`ere, 1840 56.doi: 35–64. Invertebrate 275–287. , Doy`ere, Water Posted on Authorea 20 Jan 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161073927.77224986/v2 — This a preprint and has not been peer reviewed. Data may be preliminary. ada . omn .D,&Mir .(01.SqecMti:cnaeainsfwr o h atassembly fast meio- the information. for a codon software and concatenation of 0031.2010.00329.x set SequenceMatrix: character distribution (2011). with Atlantic R. datasets multigene Meier, north of & Broad D., J. (2019). Lohman, C. living G., Vaidya, odds. B. of all Gonzalez, relations against & – the A., annelid Vang, of benthic A., study surface. Kerbl, a Earth’s K., the Worsaae, with of animals: changes past of the distribution elucidating Scotland. geographical as faunas The extinct cryptobiosis (1876). and decrypting Towards R. (2014). A. M. Wallace, Frohme, & O., tardigrade R. the Schill, in ONE B., anhydrobiosis Mali, analyzing A., – M. Grohme, C., genus Wang, the of species new Five Zootaxa (2006). V. D. Tumanov, 10.1111/j.1601-5223.1928.tb02488.x (1928). Schwedens. Tardigradenfauna G. der Thulin, Kenntnis zur Beitrage A (1911). in G. Present Thulin, Are of Configurations Description Claw the Multiple Variability. with If Developmental Study What Unique Case (2019). A L. Michalczyk, & Sample? W., family Morek, the the B., reorganises Surmacz, of phylogeny evolution multilocus morphological New complex (202?) unveils group. L. Michalczyk, and & (Eutardigrada) S. on Calhim, Macrobiotidae M., of notes Vecchi, description with D., integrative Africa Stec, An South of (2020). Republic the Macrobiotidae). L. Michalczyk, (Tardigrada: from & nov. M., R. sp. Kristensen, D., Stec, the within diversity Parachela). species 10.1080/14772000.2018.1424267 hidden Eutardigrada: Unmasking (Tardigrada: (2018). Ramazzottiidae L. Michalczyk, & P., oberhaeuseri Gasiorek, Ramazzottius W., taxonomic Morek, and D., Determinants Stec, in (2017). variability L. Michalczyk, shell & egg Zootaxa L. Kaczmarek, extreme P., of Gasiorek, consequences W., Morek, of D., description Stec, integrative 10.11646/zootaxa.4052.5.1 An doi: (2015). 501–526. L. , Michalczyk, & L., Kaczmarek, Aves. paulinae R., Class Smolak, the of D., Members Stec, 2 the Society, of Linnean Distribution Geographical the general of the Journal On tab. (1858). 1 L. P. 8, Sclater, etc. potens, aridiatem et (1834). asphixiam diuturnam S. A. C. Schultze, Biology in on Steinbr O., R. Schill, insu tardigradum Milnesium , oeua hlgntc Evolution & Phylogenetics Molecular 9 , , , p o.(adgaa uadgaa Macrobiotidae: Eutardigrada: (Tardigrada: nov. sp. 207 3,e26.di 10.1371/journal.pone.0092663 doi: e92663. (3), 1122 4208 6711.di 10.1242/jeb.00935 doi: 1607–1613. , 1–23. , 10.11646/zootaxa.4208.2.5 doi: 176–188. , brdePyoei n a ytmdrTardigraden. der System das und Phylogenie die Uber ¨ c,G,&K & G., uck, ¨ ope,wt nitgaierdsrpino h oia pce o h family the for species nominal the of redescription integrative an with complex, arbou Hufelandii Macrobiotus Trird)drn cieadcytboi stages. cryptobiotic and active during (Tardigrada) olgshrAnzeiger Zoologischer he,H .(04.Srs ee(s7)sqecsadqatttv expressi- quantitative and sequences (hsp70) gene Stress (2004). R. H. ¨ ohler, cetfi Reports Scientific 3–3.di 10.1111/j.1096-3642.1858.tb02549.x doi: 130–136. , olgclStudies Zoological o:10.1016/j.ympev.2020.106987 doi: . insu tardigradum Milnesium insu pseudotardigradum Milnesium aaztissubanomalus Ramazzottius nmlecutcou lsenvm eiicnipost reviviscendi novum, classe crustaceorum e animal 21 , , 286 , 9 58 Milnesium 59 o:10.1038/s41598-019-51765-x doi: 15497 , .Crh,Bri,6p. Table. I pp., 6 Berlin, Curths, C. ytmtc n Biodiversity and Systematics 1–3.di 10.1016/j.jcz.2020.03.007 doi: 117–134. , 2 doi:10.6620/ZS.2019.58-32 32. , iiitspentannulatus Minibiotus hufelandi Cladistics Trird,Etrird,Milnesiidae). Eutardigrada, (Tardigrada, sn rncitm sequencing. transcriptome using ru)fo Kenya. from group) , amla n opn:Troon, Company: and Macmillan 27 ri f Arkiv Hereditas 7–8.di 10.1111/j.1096- doi: 171–180. , Bsrv 95 (Tardigrada). 1985) (Biserov, h ora fExperimental of Journal The p o.(adgaa with (Tardigrada) nov. sp. ¨ rzoologi or arbou hufelandi Macrobiotus od˜ oe l,2017 al., Londo˜no et , , iiitsioculator Minibiotus 16 11 5–7.doi: 357–376. , 0–6.doi: 207–266. , Zootaxa , 7 Macrobiotus 1–60. , Zoological , PLoS 4052 Posted on Authorea 20 Jan 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161073927.77224986/v2 — This a preprint and has not been peer reviewed. Data may be preliminary. 8 rRNA 28S pcea&Prcea3342540 548 432 547 ago. #Species years millions = Mya Density; Posterior 3 Table 323 [Mya] Milnesium HPD) (95% age Estimated Milnesium [Mya] Milnesium HPD) (95% age all 545 Estimated Parachela & Apochela [Mya] Heterotardigrada HPD) & (95% Eutardigrada age Deviation. Estimated Standard = SD ancestor years, common million recent per site Most per substitutions of number the indicate values The 2 Table study. the in 1 Table programme PCR source Primer COI ITS-2 (5’-3’) sequence Primer direction Primer rRNA name 18S Primer with method fragment delimitation DNA species general A legends (2013). Figure A. and Tables Stamatakis, & pp. placements. P., 105 phylogenetic Pavlidis, Wildau, to P., Hochschule applications und Technische Kapli, rDNA Thesis, 18S MSc J., Genabschnitte I). Zhang, der (COX and anhand 1 Genes Tardigraden Untereinheit Multiple von Oxidase for Phylogenie c Tool der Cytochrom Reconstruction Untersuchung State (2010). Ancestral C. 4: Zeller, RASP (2020). J. X. He, Characters. & C., Blair, Y., Yu, Milnesium rmr n eeecsfrseicpooosfrapicto ftefu N rget sequenced fragments DNA four the of amplification for protocols specific for references and Primers . siae gsfrtemi iegneeet ntepyoeei re(i.2.HD=Highest = HPD 2). (Fig. tree phylogenetic the in events divergence main the for ages Estimated . siae enmtto ae o h orue oeua akr acltdi h BEAST. the in calculated markers molecular used four the for rates mutation mean Estimated . ld 018165 148 178 128 115 138 90 81 D & C clade 98 B & A clade (C+D) & (A+B) clade oeua ilg n Evolution and Biology Molecular D3.00 2.37 COI ITS-2 rRNA 28S SD rRNA mean 18S rate mutation 28S HCO2198 18S C19 owr GCAAACTAGTTG omre l 94Fle ta.1994 al. et Folmer 1994 al. et Folmer TAAACTTCAGGGTGACCAAAAAATCA GGTCAACAAATCATAAAGATATTGG (2012) al. et Mironov reverse CCTTGGTCCGTGTTTCAAGAC forward LCO1490 HCO2198 LCO1490 COI reverse COI ITS2 ITS2 28SR0990 18S Eutar Tar Tar Mil.tar Mil.tar Eutar Eutar f owr GCAACCATGT Stec GCCGCAGGCTCCACTCCTGG AGGCGAAACCGCGAATGGCTC reverse forward Rr1 Ff1 JfradCAWACTAGTTG elre l 03Fle ta.1994 al. et Folmer 2013 al. et Geller CHACWAAYCATAAAGATATYGG forward JJ JrvreAWACTTCVGGRTGVCCAAARAATCA reverse JJ owr CCCGATAGAA airke l(08 ioo ta.(2012) al. et Mironov al.(2018) et Gasiorek ACCCGCTGAACTTAAGCATAT forward F ffradGACAGAACCG tce l 21)Se ta.(2018) al. et Stec (2018) al. et Stec TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC reverse forward Rr Ff ffradTTTATTGTTTAGG oe ta.(09)Mrke l (2019a) al. et Morek (2019a) al. et CCTCCCCCTGCAGGATC Morek TATTTTATTTTTGGTATTTGATGTGC reverse forward Rr Ff 1 6 207 Maximal 162 Mean 116 Minimal Bioinformatics × × 10 10 -5 -4 , 37 2,6466 o:10.1093/molbev/msz257 doi: 604–606. (2), 1.49 1.05 22 × × , 10 10 29 -4 -3 2869–2876. , 4.65 3.64 × × 10 10 -4 -3 8.78 5.69 × × 10 10 -4 -3 tal et 21)Zle (2010) Zeller (2017) . Posted on Authorea 20 Jan 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161073927.77224986/v2 — This a preprint and has not been peer reviewed. Data may be preliminary. Milnesium (E) 55 Orient/Neotropic Vietnam) Philippines, (Indonesia, Orient/Oceanic Milnesium (E) 54 Australian (Indonesia) Orient Milnesium (D) 53 Afrotropic (Madagascar) Madagascan wrightae Milnesium (C) 46 Afrotropic (Madagascar) Madagascan matheusi Milnesium (C) 33 Palaearctic (Uganda) Afrotropic Milnesium (B) 23 Palaearctic (Malaysia) Orient Milnesium (B) 19 Palaearctic (USA) Nearctic Milnesium (A) 16 origin Clade origin Species species Inclusion (clade) p nov. sp. nov. sp. nov. sp. nov. sp. nov. sp. nov. sp. 23 Posted on Authorea 20 Jan 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161073927.77224986/v2 — This a preprint and has not been peer reviewed. Data may be preliminary. al 5. Table (E) 58 (E) 55 (E) 54 (C) 40 (B) 26 PanamanianOceanic Orient Australian MadagascanNeotropic (A) Palaearctic 3 Afrotropic Species (A) 1 (clade) LDD). ancient suggest #Species species (such clade given a in species of 4. Table Orient/Neotropic (Brazil) Neotropic Milnesium (E) 61 Orient/Neotropic (USA) Nearctic bohleberi Milnesium (E) 57 Orient/Neotropic (RSA) Afrotropic Milnesium (E) 56 Orient/Neotropic Guiana) French (Argentina, Neotropic/Panamanian Icuinseis,ie pce htwr on nadffrn ogorpi el hntemajority the than realm zoogeographic different a in found were that species i.e. species’, ‘Inclusion p nov. sp. nov. sp. pce eoddfo oeta n ogorpi el,ie vdnefrrcn D – ( LDD recent for evidence i.e. realm, zoogeographic one than more from recorded Species nov. sp. Milnesium nov. sp. Milnesium nov. sp. Milnesium nov. sp. Milnesium tum incep- Milnesium rum nico- berlad- Milnesium gradum tardi- Milnesium 24 / / / Posted on Authorea 20 Jan 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161073927.77224986/v2 — This a preprint and has not been peer reviewed. Data may be preliminary. uaieseissgetdb h PPaayi ln n htddntarewt h nertv species on integrative details the more with for Results agree (see not the numbers did and species that running supports are and codes (PP) bars population alone black indicate the Probability analysis vertical lines to Posterior bPTP within vertical right numbers grey the represent bars delineation; thin by vertical nodes whereas Black suggested morphology, at and years. species phylogeny Values BEAST of putative both Millions using with in delineated tree). present obtained species entire before encompass sequences time the the nucleotide for indicates rRNA+ITS-2+COI 2 scale rRNA+28S 5. Fig. 18S Fig. (see in concatenated explained on are based coding indicated number are and species mode 5. on Colour integrative reproductive Figure details squares. the and more codes coloured type with for differently population Results climate agree and (see origin, the not numbered numbers zoogeographic did scale by to species right, that running the Further right are and and delineation). bars bars alone species black supports vertical indicate analysis vertical lines (PP) Black bPTP within vertical numbers Probability grey the delineation; thin years. Posterior by whereas suggested represent morphology, of and species nodes Millions phylogeny putative both at in using Values present delineated species before encompass tree). time (see entire BEAST the the with indicates obtained for sequences 2 nucleotide rRNA+ITS-2+COI Fig. rRNA+28S 18S concatenated Fig. on in based legend the in 4. explained Figure are indicated coding are number species mode on and integrative reproductive details Colour the and more codes squares. 5. type with for coloured population Results climate differently agree (see origin, and the not numbers numbered zoogeographic did scale by to species right, that running the Further right are and and delineation). bars bars alone species black supports vertical indicate analysis vertical lines (PP) Black bPTP within vertical numbers Probability grey the delineation; thin years. Posterior by whereas suggested represent morphology, of and species nodes Millions phylogeny putative both at in using Values present delineated species before encompass tree). time (see entire BEAST the the with indicates obtained for sequences 2 nucleotide rRNA+ITS-2+COI Fig. rRNA+28S 18S detected concatenated on species based new putative undescribed 3. – Figure The yellow described unknown; classically (2020). is – study). Michalczyk position green this framework; phylogenetic & genus taxonomy in which Morek the integrative relationship of the in by the i.e. under detected phylogeny show described species, species trees the species the of both – in and number between (blue of supports the and arrows categories PP each indicates contribution The represent within below this nodes site. chart relationships at in pie per values detailed substitutions obtained for tree: of clades side 3–5 number given right between Figs in the The ancestor shows See study. the bar this of details). scale in origin uncovered the more clades for phylogenetic for main support both Results the the in within clade indicate (see clades each clades main within realm collapsed six populations breakup the zoogeographic The of within Gondwana number ago. percentages the the years The indicate of Million sizes trees. time for circles their indicate estimated stands Yellow and branches Mya collapsed the dashed The are as supports. The (A–F) marked. well (PP) are priors. as Probability presented bar) tree eras grey Posterior as graphically geological (vertical used the is main points which provide The calibration Density, values two uncertainty. Posterior the phylogenetic lower Highest indicate the nodes 95% whereas on to the superimposed bar, indicate relation blue nodes its the at and values as (left) upper of BEAST the phylogeny with published tree: obtained recent sequences most nucleotide the rRNA+ITS-2+COI whereas rRNA+28S (N=83), 18S (N=44). populations literature 2. analysed the newly from Figure the retrieved indicate data anthropogenic circles for probably Yellow stand most circles details). red – for SM.01 dispersion; Materials natural tary probably 1. most Figure – origin; of realm dispersion). probable most the Milnesium Milnesium Milnesium prxmt oaiiso h 127 the of localities Approximate ipie aeinIfrnetm airtdpyoeei rebsdo concatenated on based tree phylogenetic calibrated time Inference Bayesian Simplified hlgn:cae n eosrce sn h ieclbae aeinInference Bayesian calibrated time the using reconstructed D and C clades phylogeny: hlgn:cae n eosrce sn h ieclbae aeinInference Bayesian calibrated time the using reconstructed B and A clades phylogeny: hlgn:cae n eosrce sn h ieclbae aeinInference Bayesian calibrated time the using reconstructed F and E clades phylogeny: Milnesium Milnesium 25 yMrk&Mcacy 22)(ih) h etside left The (right). (2020) Michalczyk & Morek by ouain nlsdi hssuy(e Supplemen- (see study this in analysed populations Milnesium odt iie nothree into divided date to Milnesium Posted on Authorea 20 Jan 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161073927.77224986/v2 — This a preprint and has not been peer reviewed. Data may be preliminary. hlgntcte ae ncnaeae 8 RA2SrN+T-+O uloiesqecsobtained sequences nucleotide rRNA+ITS-2+COI rRNA+28S 18S BEAST. concatenated with on based tree phylogenetic SM.05. sequences nucleotide rRNA+ITS-2+COI rRNA+28S BEAST. 18S with concatenated obtained on based tree phylogenetic site. (PP) Inference per probability substitutions posterior of represent SM.04. number nodes the at shows Values bar MrBayes. Scale with supports. obtained sequences nucleotide 2+COI SM.03. bolded. are SM.02. rarely SM.01. only species ancient, 86% (mostly were LDD there Materials natural Overall, Supplementary suggesting species realms). species 14% to zoogeographic (refers and Dispersal, adjacent of Dispersal LDD of Distance majority Distance natural recent). the borders Short for Long = than the evidence recent SSD realm no to dispersal); suggesting zoogeographic showing close ancient different localities suggesting a (i.e. in (i.e. in species realm found clade found widespread given were zoogeographic realm; a that in one zoogeographic species species single than = a species’ more in ‘inclusion only in LDD); found found species species = ranges = limited with the at Species legend study. the in 6. explained are Figure indicated coding are number tree. mode and the Colour reproductive of and squares. bottom type coloured climate differently and origin, numbered zoogeographic by right, Further delineation). species h eut fteRS nlsso lmt yeo h ancae,bsdo h aeinInference Bayesian the on based clades, main the of type climate of analysis RASP the of results The eBn ceso ubr o all for numbers accession GenBank nomto bu olcindt f127 of data collection about Information h eut fteRS nlsso egahcoii fteacso,bsdo h Bayesian the on based ancestor, the of origin geographic of analysis RASP the of results The h aeinIfrnepyoeei rebsdo octntd1SrN+8 rRNA+ITS- rRNA+28S 18S concatenated on based tree phylogenetic Inference Bayesian The h umr n nepeaino itiuinpten of patterns distribution of interpretation and summary The Milnesium Milnesium 26 p.sqecsue nteaaye.Nwsequences New analyses. the in used sequences spp. p.ppltosuiie ntestudy. the in utilised populations spp. Milnesium pce eoee nthis in recovered species Posted on Authorea 20 Jan 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161073927.77224986/v2 — This a preprint and has not been peer reviewed. Data may be preliminary. 27 Posted on Authorea 20 Jan 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161073927.77224986/v2 — This a preprint and has not been peer reviewed. Data may be preliminary. 28 Posted on Authorea 20 Jan 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161073927.77224986/v2 — This a preprint and has not been peer reviewed. Data may be preliminary. 29 Posted on Authorea 20 Jan 2021 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.161073927.77224986/v2 — This a preprint and has not been peer reviewed. Data may be preliminary. 30