This electronic thesis or dissertation has been downloaded from Explore Bristol Research, http://research-information.bristol.ac.uk
Author: Short, Katherine A Title: Life in the extreme when did tardigrades colonise Antarctica?
General rights Access to the thesis is subject to the Creative Commons Attribution - NonCommercial-No Derivatives 4.0 International Public License. A copy of this may be found at https://creativecommons.org/licenses/by-nc-nd/4.0/legalcode This license sets out your rights and the restrictions that apply to your access to the thesis so it is important you read this before proceeding. Take down policy Some pages of this thesis may have been removed for copyright restrictions prior to having it been deposited in Explore Bristol Research. However, if you have discovered material within the thesis that you consider to be unlawful e.g. breaches of copyright (either yours or that of a third party) or any other law, including but not limited to those relating to patent, trademark, confidentiality, data protection, obscenity, defamation, libel, then please contact [email protected] and include the following information in your message:
• Your contact details • Bibliographic details for the item, including a URL • An outline nature of the complaint
Your claim will be investigated and, where appropriate, the item in question will be removed from public view as soon as possible. 1 Life in the Extreme: when did
2 Tardigrades Colonise Antarctica?
3
4
5
6
7
8
9 Katherine Short 10
11
12
13
14
15 A dissertation submitted to the University of Bristol in accordance with the
16 requirements for award of the degree of Geology in the Faculty of Earth
17 Sciences, September 2020.
18 Word Count 33252
i
19 Abstract 20 21 Antarctica has long been isolated from its nearest landmasses and has been at least partially 22 glaciated for the past ~35 million years. This long-term isolation combined with the fragmentation of 23 habitats creates a unique environment for the examination of biogeographic patterns. Previously it 24 was believed that the repeated full glaciation of Antarctica wiped out the pre-existing terrestrial 25 fauna and flora and that the continent was, therefore, subsequently re-colonised after periods of 26 glacial retreat, such as from the particularly extensive Last Glacial Maximum. However, recent 27 molecular studies of a variety of taxonomic groups have shown that much of the current terrestrial 28 life found on the continent is generally ancient and must have survived these glaciation events. The 29 main body of Antarctica (East or continental Antarctica) and West Antarctica and the Antarctic 30 Peninsula show differing geological histories and distinct biogeographic patterns in a variety of 31 invertebrates including mites, springtails and nematodes, indicating distinct evolutionary histories. 32 However, despite tardigrades being the most common and widespread invertebrate within 33 Antarctica there has been limited study of their Antarctic biogeography. This thesis set out to 34 investigate the evolutionary and biogeographic patterns of two eutardigrade species (Acutuncus 35 antarcticus and Mesobiotus furciger). At the initiation of this study, A. antarcticus was believed to be 36 a pan-Antarctic species, with a Gondwanan distribution, and M. furciger a globally common taxon 37 and a Southern hemisphere species with a widespread Antarctic distribution. Individuals were 38 sampled that originated from multiple locations across Antarctica. These individuals were then used 39 to document a range of morphometric characters and underwent molecular extraction targeting the 40 three gene regions of 18S, 28S and COX1. Further sequence data were added from GenBank. 41 Phylogenetic analyses using both Maximum Likelihood and Bayesian methods showed that both 42 species are likely to be species groups, with highly distinct lineages in the maritime and continental 43 Antarctic regions. The levels of divergence detected strongly support cryptic speciation. This 44 conclusion was further supported by morphological analyses, which identified significant differences 45 between material sampled from each of these regions. Ancestral state and molecular clock analyses 46 showed that both of these species groups had ancient Antarctic origins, requiring long-term regional 47 survival within Antarctica, consistent with patterns identified in other invertebrate taxa. 48 Morphological comparisons between individuals within single genetic clades obtained from different 49 habitats also identified significant differences, supporting phenotypic plasticity in response to 50 environmental conditions. This finding, not noted previously in tardigrades, has important 51 taxonomic implications, as species indentification relying on morphological characters alone may 52 now result in miss-identification. 53 54 55 56 57 58 59 60 61 62
ii
63 Author’s Declaration
64
65 I declare that the work in this dissertation was carried out in accordance with 66 the requirements of the University's Regulations and Code of Practice for 67 Research Degree Programmes and that it has not been submitted for any other 68 academic award. Except where indicated by specific reference in the text, the 69 work is the candidate's own work. Work done in collaboration with, or with the 70 assistance of, others, is indicated as such. Any views expressed in the 71 dissertation are those of the author.
72
73
74 SIGNED: ...Katherine A. Short...... DATE:..04/09/2020......
75
76
77
78
79
80
81
82
83
84
85
iii
86 Table of Contents
87 LIST OF FIGURES…………………………………….………………………………………………………………………………………….ix
88 LIST OF TABLES ……………………………………….…………………………….………………………………………………………….xi
89 ACKNOWLEDGMENTS………………………………………………………….…………………………………………………………..xii
90 THESIS INTRODUCTION………………………………………………………………………………………………………………………1
91 - Summary………………………………………………………………………………………………………………………………1
92 - Geological history of Antarctica…………………………………………………………………………………………….4
93 - What makes a species and why is that important?...... 5
94 - Current described biogeography of Antarctica………………………………………………………………………6
95 - Tardigrades in Antarctica………………………………………………………………………………………………………8
96 - Study species- Acutuncus antarcticus and Mesobiotus furciger…………………………………………10
97 - Thesis chapters……………………………………………………………………………………………………………………12
98 CHAPTER 1. PHYLOGEOGRAPHIC ANALYSES OF TWO ANTARCTIC EUTARDIGRADE SPECIES
99 (ACUTUNCUS ANTARCTICUS AND MESOBIOTUS FURCIGER) SHOW ANCIENT, ANTARCTIC-SPECIFIC
100 LINEAGES…………………………………………………………………………………………………………………………………………14
101 - Abstract………………………………………………………………………………………………………………………………14
102 1.1. Introduction………………………..……….…………………………………………..…………………..…………..…..…..15
103 1.2. Methods………………………..……………………………………………………………………………………………………18
104 1.2.1. Material included.……………………..………………….………………………………………………18
105 1.2.2. Tardigrade extraction……………………………………………………………………….…..………20
106 1.2.3. RNA extraction……………………………………………………………………………………………..20
107 1.2.4. Sequence collations and database creation………………………………………………….21
108 1.2.5. Phylogenetic analysis……………………………………………………………………………………22
109 1.2.6. Molecular clock analysis……………………………………………………………………………….22
iv
110 1.2.7. Biogeographic analysis………………………………………………………………………………….23
111 1.3. Results…………………………………………………………………………...... ……………..………………………………..25
112 1.3.1. Mesobiotus furciger…………………..………………….……………………………………………..25
113 1.3.2. Acutuncus antarcticus…………………………………………………………………………………..26
114 1.3.3. Molecular clock analysis……………………………………………………………………………….28
115 1.3.4. Biogeographic analysis………………………………………………………………………………….29
116 1.4. Discussion……………………..……………..…………………...... ……………………………………………………………31
117 1.4.1. Mesobiotus furciger and Acutuncus antarcticus phylogeny…………………………..31
118 1.4.2. Antarctic history and biogeography………………………………………………………………33
119 CHAPTER 2. PAN-ANTARCTIC MOLECULAR ANALYSES OF THE ANTARCTIC EUTARDIGRADE
120 ACUTUNCUS ANTARCTICUS (HYPSIBIOIDEA) SHOW STRONG BIOGEOGRAPHIC PATTERNS AND DEEP
121 ‘INTRA-SPECIFIC’ DIFFERENTIATION…………………………………………………………………………………………………36
122 - Abstract…….....…………………………………………………………………………………………………………………….36
123 2.1. Introduction...... 37
124 2.2. Methods...... 39
125 2.2.1. Definition of Antarctic regions...... 39
126 2.2.2. Collection and identification of material...... 39
127 2.2.3. DNA extraction, amplification and sequencing...... 41
128 2.2.4. Sequence alignment and phylogenetic analysis...... 42
129 2.2.5. Molecular clock analysis...... 43
130 2.2.6. Haplotype network analysis...... 44
131 2.3. Results...... 44
132 2.3.1. Phylogenetic analysis...... 44
v
133 2.3.2. Molecular dating...... 45
134 2.3.3. Haplotype network analysis...... 45
135 2.4. Discussion...... 50
136 2.4.1. Phylogeny and divergence events within Acutuncus antarcticus...... 50
137 2.4.2. Acutuncus antarcticus population within Antarctica and possible refugia...... 51
138 CHAPTER 3. INCREASED GEOGRAPHIC SAMPLING OF THE ANTARCTIC EUTARDIGRADE MESOBIOTUS
139 FURCIGER (MACROBIOTOIDEA) SHOW LARGE MOLECULAR DIVERGENCES BETWEEN MULTIPLE
140 ANTARCTIC LINEAGES INDICATING AN ANTARCTIC-SPECIFIC SPECIES
141 COMPLEX...... 53
142 - Abstract...... 53
143 3.1. Introduction...... 54
144 3.2. Methods...... 55
145 3.2.1. Collection of material...... 55
146 3.2.2. Extraction and identification of tardigrades...... 56
147 3.2.3. DNA extraction, amplification and sequencing...... 57
148 3.2.4. Sequence alignment and phylogenetic analysis...... 58
149 3.2.5. Haplotype network analysis...... 59
150 3.3. Results...... 59
151 3.3.1. Phylogenetic analysis...... 59
152 3.3.2. Haplotype analysis...... 63
153 3.4. Discussion...... 64
154 3.4.1. Mesobiotus furciger as an Antarctic-specific group...... 64
vi
155 3.4.2. Biogeography within Antarctica of Mesobiotus furciger...... 65
156 CHAPTER 4. MORPHOLOGICAL VARIATION BETWEEN GEOGRAPHIC AREAS OF ANTARCTICA AND IN
157 DIFFERENT HABITATS FOR TWO EUTARDIGRADA SPECIES, ACUTUNCUS ANTARCTICUS AND
158 MESOBIOTUS FURCIGER...... 68
159 - Abstract...... 68
160 4.1. Introduction...... 69
161 4.2. Methods...... 71
162 4.2.1. Collection of material...... 71
163 4.2.2. Morphometric analysis...... 73
164 4.2.3. Principal Component Analysis and Factor Analysis of Mixed Data...... 75
165 4.2.4. Statistical analysis...... 76
166 4.3. Results...... 76
167 4.3.1. PCA and FAMD, Acutuncus antarcticus...... 76
168 4.3.2. PCA Mesobiotus furciger...... 78
169 4.4. Discussion...... 80
170 4.4.1. Morphological variation between geographic areas...... 80
171 4.4.2. Influence of habitat type on morphology...... 82
172 CHAPTER 5. THESIS DISCUSSION...... 83
173 REFERENCES...... 89
174 SUPPLEMENTARY MATERIAL...... 102
175 - Chapter 1...... 102
176 - Chapter 2...... 116
vii
177 - Chapter 3...... 122
178 - Chapter 4...... 132
179
180
181
182
183
184
185
186
187
188
189
190
191
192
193
194
195
196
viii
197 List of Figures
198 THESIS INTRODUCTION
199 - Figure 0.1: Map of Antarctica showing biogeographic regions...... 3
200 - Figure 0.2: Picture of Acutuncus antarcticus...... 12
201 - Figure 0.3: Picture of Mesobiotus furciger...... 12
202 CHAPTER 1
203 - Figure 1.1: Locations from which material of Acutuncus antarcticus and Mesobiotus furciger
204 were obtained...... 19
205 - Figure 1.2: Biogeographic ranges used in the BioGeoBears matrix...... 24
206 - Figure 1.3: ASTRAL-III phylogenetic tree...... 27
207 - Figure 1.4: Time tree with ancestral state nodes and major geological events...... 30
208 CHAPTER 2
209 - Figure 2.1: Locations from which material of Acutuncus antarcticus was
210 obtained...... 41
211 - Figure 2.2: Bayesian and Maximum Likelihood consensus phylogenetic tree...... 46
212 - Figure 2.3: Time tree...... 47
213 - Figure 2.4: COX1 haplotype networks...... 48
214 CHAPTER 3
215 - Figure 3.1: Locations from which material of Mesobiotus furciger was
216 obtained...... 56
217 - Figure 3.2: Comparison of 18S and COX1 consensus phylogenetic trees...... 61
218 - Figure 3.3: COX1 haplotype networks...... 63
219
ix
220 CHAPTER 4
221 - Figure 4.1: Locations from which material of Acutuncus antarcticus was
222 obtained...... 72
223 - Figure 4.2: Locations from which material of Mesobiotus furciger was
224 obtained...... 73
225 - Figure 4.3: Diagram of how morphological measurements were collected...... 75
226 - Figure 4.4: PCA Bi-Plot for Acutuncus antarcticus...... 78
227 - Figure 4.5: PCA Bi-Plot for Mesobiotus furciger...... 79
228 SUPPLEMENTARY MATERIAL
229 - CHAPTER 1
230 o S1.1- BioGeoBears DEC model output...... 112
231 o S1.2- BioGeoBears DEC+J model output...... 113
232 o S1.3- BioGeoBears BAYAREALIKE model output...... 114
233 o S1.4- BioGeoBears BAYAREALIKE+J model output...... 115
234 - CHAPTER 2
235 o S2.1- Full Bayesian and Maximum Likelihood COX1 gene tree...... 116
236 - CHAPTER 3
237 o S3.1- Full consensus Bayesian and Maximum likelihood COX1 gene tree...... 130
238 o S3.2- Full consensus Bayesian and Maximum likelihood 18S gene tree...... 131
239
240
241
242
243
x
244 List of Tables
245
246 CHAPTER 2
247 - Table 2.1: Estimates of COX1 divergence in Acutuncus antarcticus...... 47
248 - Table 2.2: Descriptive statistics for Acutuncus antarcticus...... 49
249 CHAPTER 3
250 - Table 3.1: Estimates of 18S divergence in Mesobiotus furciger...... 62
251 - Table 3.2: Estimates of COX1 divergence in Mesobiotus furciger...... 62
252 - Table 3.3: Descriptive statistics for Mesobiotus furciger...... 64
253 CHAPTER 4
254 - Table 4.1: GLM results for Acutuncus antarcticus...... 80
255 - Table 4.2: GLM results for Mesobiotus furciger...... 80
256 SUPPLEMENTARY MATERIAL
257 - CHAPTER 1
258 o Table S1.1: Details of Acutuncus antarcticus and Mesobiotus furciger
259 sequences used...... 102
260 o Table S1.2: Details of all sequences from GenBank used...... 103
261 o Table S1.3: Geographic codes used in BioGeoBears...... 110
262 o Table S1.4: Combined geographic codes used in BioGeoBears...... 111
263 - CHAPTER 2
264 o Table S2.1: Acutuncus antarcticus details from continental Antarctica...... 118
265 o Table S2.2: Acutuncus antarcticus details from maritime Antarctica...... 120
266 o Table S2.3: Details of samples added from GenBank...... 121
xi
267 - CHAPTER 3
268 o Table S3.1: Details of Mesobiotus furciger 18S sequences...... 122
269 o Table S3.2: Details of Mesobiotus sp. 18S sequences...... 124
270 o Table S3.3: Details of outgroup 18S sequences...... 125
271 o Table S3.4: Details of Mesobiotus furciger COX1 sequences...... 127
272 o Table S3.5: Details of Mesobiotus sp. COX1 sequences...... 128
273 o Table S3.6: Details of outgroup COX1 sequences...... 129
274 - CHAPTER 4
275 o Table S4.1: Details of continental Antarctic Acutuncus antarcticus
276 samples...... 132
277 o Table S4.2: Details of maritime Antarctic Acutuncus antarcticus samples...... 134
278 o Table S4.3: Details of continental Antarctic Mesobiotus furciger
279 samples...... 135
280 o Table S4.4: Details of maritime Antarctic Mesobiotus furciger samples...... 136
281 o Table S4.5: TukeyHSD outputs for Acutuncus antarcticus...... 137
282 o Table S4.6: TukeyHSD outputs for Mesobiotus furciger...... 141
283 o Tables S4.7-S4.34: Raw morphometric data for Acutuncus antarcticus...... 150
284 o Tables S4.35-S4.48: Raw morphometric data for Mesobiotus furciger...... 178
285
286
287
288
289
290
xii
291 Acknowledgements
292 Thanks go to Dr Łukasz Kaczmarek of A. Mickiewicz University for his generous provision of the
293 unpublished Mesobiotus furciger sequence from Madagascar used here. Also my kind thanks goes to
294 all of the British Antarctic Survey researchers, field guides and technicians who have collected
295 samples for this study, particularly to Dr Terri Souster who collected the samples for use in Chapters
296 2-4. These samples were collected under a permit for activities under Section 7 of the Antarctic Act
297 1994 (No. 17/2018) granted by the UK Foreign and Commonwealth Office. I am also grateful to the
298 Antarctic Science Bursary, which provided me with additional funding to be able to expand this PhD
299 to continental Antarctica, and to Professor Mark Stevens at the South Australian Museum for
300 hosting me and allowing me to use samples collected from continental Antarctica for use in this
301 study. I am thankful to my supervisors Chester Sands, Sandra McInnes, Davide Pisani and Pete
302 Convey for all their help and guidance in completing this PhD. Thanks also go to MAGIC at the British
303 Antarctic Survey who provided all the maps used here. I would also like to especially thank my fellow
304 students Felipe Simões and Sam Coffin for their guidance with molecular extraction. Last but not
305 least, my forever thanks to my parents for supporting me throughout my studies.
306
307
308
309
310
311
312
313
xiii
314 Thesis Introduction
315
316 Summary
317 Antarctica is a long-isolated (28 My) and progressively glaciated (32 My) continent situated at polar
318 latitudes in the Southern Hemisphere, at minimum 810 km from its nearest neighbour, South
319 America, 2588 km from Australia and 3855 km from South Africa (Fig. 0.1) (Lawver et al., 1998;
320 Lawver & Gahagan, 2003; Tripati et al., 2005; British Antarctic Survey, 2020). Antarctica, including
321 the Scotia Arc South Shetland and South Orkney Island archipelagos, covers 14 million km2 at
322 latitudes of 60o-90oS, but only 0.3% of this area is currently ice-free, and much of this is boulder
323 slopes, cliffs, and exposed mountains (British Antarctic Survey, 2005; Convey & Stevens, 2007;
324 Convey et al., 2008, 2018). Most ice-free areas are seasonally covered in snow, decreasing periods
325 suitable for biological activity to as little as a few days (in parts of inland continental Antarctica) to
326 only a few months (maritime Antarctica) each year (Convey et al., 2008). The associated biotic and
327 abiotic stresses lead to Antarctica being considered to host some of the most extreme environments
328 in the world (Convey et al., 2014). The extreme conditions mean that there are no native terrestrial
329 or freshwater vertebrates (e.g. mammals, reptiles, fish or amphibians), although some terrestrial
330 ecosystems are heavily influenced by marine mammals and birds through guano input and trampling
331 (Convey, 2017; Bokhorst et al., 2019). Soils are generally poorly developed and ecosystems are
332 simple in both their diversity and structure, as well as often being small and (very) isolated (Beyer &
333 Bölter, 2002; Convey & Stevens, 2007; Convey et al., 2008; Van Vuuren et al., 2018).
334 Modelling of glacial extent during the last glacial maximum (~20,000 years ago), one of the
335 most extensive glaciations of the Pleistocene, suggests that all areas of the Antarctic continent,
336 including the maritime Antarctic Scotia Arc archipelagos and sub-Antarctic South Georgia, would
337 have been completely covered by ice sheets. If so, these would have destroyed all life and terrestrial
338 ecosystems present, meaning that all native species currently found within Antarctica must have
1
339 become established, or re-established, from lower latitude refugia, after this time (Convey &
340 Stevens, 2007). However, recent molecular and classical biogeographical studies have consistently
341 suggested that multiple species across all the major taxonomic groups characterising the Antarctic
342 terrestrial fauna show very long-term (hundreds of thousands to multi-million year, and even pre-
343 Gondwana breakup) persistence within Antarctica, therefore requiring in situ survival of the multiple
344 Pleistocene and earlier era glaciations (Convey & Stevens, 2007; Convey et al., 2008, 2020; Carapelli
345 et al., 2017; Guidetti et al., 2017; Biersma et al., 2018; Van Vuuren et al., 2018).
346 Most terrestrial biological studies that have taken place in Antarctica have focussed on
347 biodiversity and on physiological or life history adaptations to extreme environments, and as yet
348 little focus has been placed on the evolution of life within Antarctica (Convey et al., 2008; Convey,
349 2011). The biogeography of Antarctic terrestrial life has been shown to be complex with indications
350 of in situ survival in multiple regions over many millions of years, a paradigm that challenges current
351 understanding and reconstruction of the glaciological history of the continent. With Antarctica
352 undergoing rapid environmental changes today, in some areas amongst the fastest in the world,
353 understanding its biodiversity and biogeographic history is a key area for research (Convey &
354 Stevens, 2007; Convey et al., 2008; Convey, 2011; Van Vuuren et al., 2018).
355 Tardigrades are an essential element of the simple terrestrial faunal communities of
356 Antarctica, and even sometimes almost the only fauna present (Convey & McInnes, 2005). They are
357 widespread and often common throughout the ice-free areas of the continent, raising the possibility
358 of harbouring signals of biogeographic patterns over time. However, to date, studies of the group
359 have been relatively limited (Vecchi et al., 2016). This thesis sets out to study two taxa of
360 eutardigrade (Acutuncus antarcticus and Mesobiotus furciger) that, at the outset, were widely
361 recorded from multiple continental and maritime Antarctic regions. Using both molecular and
362 morphometric approaches, it analyses the phylogeographic and evolutionary patterns of these
2
363 tardigrades within Antarctica, to confirm the hypotheses that these were either ancient survivors or
364 recent colonisers of the continent.
365
366 Figure 0.1; Map of the Antarctic continent with major biogeographic regions highlighted and the
367 distance to the nearest landmasses shown.
368
369
370
3
371 Geological history of Antarctica
372 One hundred and fifty million years ago (My) the ancient landmass of Pangea separated into the two
373 supercontinents Gondwana and Laurasia. During the early Cretaceous period Gondwana further
374 fragmented into East and West Gondwana. East Gondwana comprised what would become Australia
375 and the main craton of Antarctica, while West Gondwana comprised South America, Africa and what
376 are now the two geologically distinct regions of West Antarctica and the Antarctic Peninsula
377 (Vaughan & Pankhurst, 2008; Cantrill & Poole, 2012; Davis et al., 2019). East Gondwana then
378 underwent various periods of thermal uplifting and rifting with associated volcanic activity, leading
379 to what is now recognised as East (continental) Antarctica (Cantrill & Poole, 2012). The multiple
380 microplates which make up West Antarctica and the Antarctic Peninsula and Scotia Arc archipelagos
381 (the latter two comprising the maritime Antarctic) have a complicated history, with post-Gondwanan
382 tectonic activity joining them to East Antarctica along the West Antarctic Rift System (Storey et al.,
383 1988; Convey et al., 2008; Cantrill & Poole, 2012).
384 The final breakup of the elements of Gondwana involved the separation of Antarctica from
385 its nearest land masses; southern South America and Australia, 45-23 My. This eventually allowed
386 the formation of deep oceanic currents and atmospheric circulation effectively isolating the
387 continent and surrounding Southern Ocean from lower latitudes. In combination with decreasing
388 concentrations of atmospheric carbon dioxide in this period, the continent cooled, eventually
389 leading to its current ice-house status (Barker & Thomas, 2004; Convey et al., 2008; Cantrill & Poole,
390 2012).
391 Small ice sheets first formed in Antarctica around 28 My, reaching maximum extent in East
392 Antarctica 15-12 My in the mid Miocene, and concurrently in West Antarctica, although that on the
393 Antarctic Peninsula reached maximum extent somewhat later, at around 5-6 My (Convey et al., 2008;
394 Anderson et al., 2011; Mörs et al., 2020). Work by Lewis et al. (2007, 2008) showed that tundra animal
395 and plant communities were still present in the continental Antarctic until sudden rapid cooling ~14-
4
396 13 My led to a rapid decline and extinction of these communities in concert with further expansion of
397 the ice-sheets. Higher vertebrates were present on the continent even after separation from South
398 America, and survived early glaciations before the formation of continental-scale ice-sheets (Mörs et
399 al., 2020).
400
401 What makes a species and why is that important?
402 Species are often considered as the most basic classification of taxonomic units but can also be more
403 problematically considered as a natural grouping or lineage (Kendig, 2013). The term species is
404 therefore ambiguous and can refer to a taxonomic rank or a category. This means that multiple (over
405 27) species concepts have been designed to be able to provide relationships, characters, patterns or
406 other ranks that are required to be met for an organism to be classed as a species (Wilkins, 2011;
407 Kendig, 2013). One of the most widely used is the biological species concept (Mayr, 1992). The
408 biological species concept defines a species as a biological population that is reproductively and
409 genetically isolated from other populations and with each species being strictly separated, known as
410 ‘protected gene pools’ (Mayr, 1992; Kendig, 2013). Mayr (1992) defined a lineage as an ancestor-
411 descendent series with a species being ‘real’ with a direct linear genetic heritage through this lineage
412 from parent to offspring. However, having a strict genetically based species concept may not provide
413 a thorough understanding of what constitutes a species and, instead, a multidimensional concept
414 taking into account ecology, biogeography and behaviour should be used alongside molecular data
415 (Kendig, 2013).
416 The development of molecular methodologies has increased knowledge of understudied
417 species and, in particular, has identified many cryptic lineages in otherwise morphologically similar
418 ‘species’, which could prove problematic for classifications based only on morphology (Pante et al.,
419 2014). The mitochondrial gene COX1 is commonly chosen as a barcoding gene for animal species
420 identification due to the advantage of having rare incidences of indels (deletion/insertion), having
5
421 fast rates of nucleotide substitution helping to identify cryptic species and phylogenetic structure
422 and having easily available and robust universal primers (Hebert et al., 2003; Pires & Marinoni,
423 2010). However, criticisms of molecular only taxonomy have included insufficient sampling of each
424 proposed species, lack of geographic sampling and effective distinction between intra- and inter-
425 specific variations (Pires & Marinoni, 2010). Rather, the use of molecular distances and phylogenies
426 should be used to identify distinct groups from which further evidence and identifying characteristics
427 can be used to define a species.
428 An important attribute of accurately defining species is to be able to assess the biodiversity
429 of regions and habitats for future conservation efforts. This is particularly important in Antarctica
430 which is one of the last remaining wilderness areas (Coetzee et al., 2017; Leihy et al., 2020). Human
431 impacts are greatly increasing on this continent but with little knowledge of the biodiversity it is
432 difficult to know which areas to protect from human interference (Coetzee et al., 2017; Leihy et al.,
433 2020). Increasing biodiversity sampling of Antarctica would help to identify areas of particular
434 concern. Along with human impacts, climate change due to the warming of Antarctica (including the
435 linked threat of invasive species establishment) provide major threats to Antarctic biodiversity
436 (Convey & Peck, 2019). Knowing the structure of biodiversity throughout Antarctica would help to
437 identify areas that are at particular risk from habitat change and species invasions (Coetzee et al.,
438 2017; Vega et al., 2019; Hughes et al., 2020).
439
440 Current described structure of the biogeography of Antarctica
441 For most of the fifty years after the commencement of detailed studies of terrestrial biology in
442 Antarctica, particularly the early studies of Gressitt and coworkers in the 1960s (Gressitt et al., 1960,
443 1961; Yoshimoto et al., 1962; Yoshimoto & Gressitt, 1963; Gressitt, 1967) and subsequently of the
444 region’s botany (e.g. Smith, 1984), Antarctica was generally separated into three broad regions, the
445 sub-Antarctic, maritime Antarctic (comprising the west coast of the Antarctic Peninsula, Scotia Arc
6
446 archipelagos of the South Shetland, South Orkney and South Sandwich Islands, and the remote Peter
447 I Øya and Bouvetøya), and continental Antarctic (comprising both East and West Antarctica and the
448 eastern side of the Antarctic Peninsula (Figure 0.1) (Smith, 1984; Convey, 2017). In the mid-2000s
449 this formulation started to be modified, with the identification of a clear and strong delineation
450 between the Antarctic Peninsula and the rest of the continent (Chown & Convey, 2007). This was
451 named as the Gressitt Line, and represents a major and ancient biogeographical divide analogous to
452 the much better known Wallace Line of south-east Asia; in all invertebrate groups examined in detail
453 to date (i.e. Acari, Collembola, Nematoda) no species are shared either side of this line, and the
454 strength of this separation increases as further taxa are examined (Chown & Convey 2007; Convey
455 2017; Carapelli et al., 2020). It was also recognised that many of the described invertebrates were
456 not only endemic to Antarctica (as noted by Gressitt et al., 1960, 1961), but to more restricted
457 regions within the continent (Pugh & Convey, 2008). Most recently, based on multilayer analyses of
458 the most thorough spatially-referenced database of Antarctic terrestrial biodiversity yet available, 16
459 distinct ice-free biogeographic regions, known as Antarctic Conservation Biogeographic regions,
460 were identified in the Antarctic Treaty area (the land area south of the 60 degree latitude parallel)
461 (Terauds et al., 2012; Terauds & Lee, 2016).
462 It is known that ice-sheets were thicker during the Last Glacial Maximum (LGM) (and
463 previous maxima) than they are today (Anderson et al., 2002; Heroy & Anderson, 2005; Sugden et
464 al., 2006). This led to a widely-held assumption that the extended ice sheets would have covered all
465 lower altitude terrestrial habitats, effectively wiping out biological life (discussed by Convey &
466 Stevens, 2007; Convey et al., 2009; Carapelli et al., 2017). However, recent molecular studies of
467 multiple terrestrial groups in regions across Antarctica have generated evidence supporting long-
468 term persistence and survival within the continent through multiple glaciation events (Convey et al.,
469 2008, 2009, 2018, 2020). Studies on the South Shetland Islands (Carapelli et al., 2017) and wider
470 Antarctic Peninsula (McGaughran et al., 2019) have shown that springtails (Collembola) have been
471 present throughout the Pleistocene, with the former study proposing that molecular divergence
7
472 timings can be linked with known interglacial periods and are consistent with refugial survival. A
473 similar pattern has also been noted in oribatid mites (van Vuuren et al., 2018). The moss genus
474 Schistidium, one of the most speciose in Antarctica as well as having several endemic species, has
475 similarly ancient origins, with diversification taking place possibly as early as the Miocene (Biersma
476 et al., 2018).
477
478 Tardigrades in Antarctica
479 Tardigrades are common and widespread throughout Antarctica but, as yet, relatively little research
480 attention has been given to identifying biogeographic patterns in this group, although Convey &
481 McInnes (2005) did note biogeographic structure within continental and maritime Antarctica, but
482 with some species at the time being recorded from both areas (e.g. Acutuncus antarcticus).
483 Tardigrades are microscopic ecdysozoans with an ancient history dating back to the Cambrian period
484 (Maas & Waloszek, 2001; Guil & Cabrero-Sañudo, 2007). There are over 1,000 currently described
485 species, with possibly at least as many more yet to be described (Guidetti & Bertolani, 2005; Guil &
486 Cabrero-Sañudo, 2007; Degma et al., 2020). They have been found in every environment known to
487 sustain life, including multiple extreme environments from the abyssal depths of the ocean to the
488 polar regions and high mountains (Guil & Giribet, 2012). Their precise position and relationships in
489 the Ecdysozoa continue to be debated, as do relationships within the phylum (Guil & Cabrero-
490 Sañudo, 2007; Guidetti et al., 2009; Guil & Giribet, 2012).
491 Tardigrades share a basic body plan consisting of a bilaterally symmetrical, cylindrical, body
492 with five distinct segments. The first segment consists of the head and the following four the body,
493 each of the latter having a pair of short lobopodal limbs. The limbs are tipped with discs, toes or
494 claws (Marley et al., 2011; Møbjerg et al., 2018). Three classes of tardigrades are currently
495 recognised, Heterotardigrada (comprising a marine order and a terrestrial ‘armoured’ order),
8
496 Apotardigrada (for the order Apochela), and Eutardigrada (comprising limno-terrestrial and
497 freshwater species) (Møbjerg et al., 2018; Guil et al., 2019).
498 Tardigrades are one of the most abundant and widespread terrestrial groups throughout
499 Antarctica. They have been recorded from all areas hosting biological life, including freshwater, soil,
500 and vegetation (algae, moss and lichen). Their well-developed cryptobiotic abilities, enabling them
501 to survive desiccation and freezing conditions, are believed to be a major contributor to their
502 success in Antarctica (Vecchi et al., 2016; Guidetti et al., 2017). However, they remain very poorly
503 studied and their diversity in Antarctica is probably greatly underestimated (Vecchi et al., 2016).
504 Available studies have shown considerable species-level endemism, hypothesised to be driven by
505 habitat isolation and fragmentation from past and contemporary glaciation (Czechowski et al., 2012;
506 Velasco-Castillón et al., 2014; Cesari et al., 2016; Vecchi et al., 2016). Based on the available data,
507 tardigrade diversity in continental Antarctica is lower than that in the maritime region. Few new
508 species have been described in recent years, although this is likely to be a simple combination of
509 overall lack of sampling, sampling being focused around a limited number of research stations, and
510 lack of access to specialist expertise (Vecchi et al., 2016).
511 To date, a single study has applied molecular approaches for the dating of divergence times
512 of tardigrades within Antarctica (Guidetti et al., 2017). This study examined the heterotardigrade
513 genus Mopsechiniscus and proposed that dates of divergence between South American and
514 Antarctic species lineages broadly coincided with the separation of Antarctica and southern South
515 America 32-48 My. They also showed clear Gondwanan distributions in this genus. Gondwanan
516 distributions have also been proposed in other non-dating molecular studies of Antarctic tardigrades
517 (Czechowski et al., 2012; Cesari at al., 2016).
518
519
9
520 Study species - Acutuncus antarcticus and Mesobiotus furciger
521 The aim of this study was to investigate the biogeographic patterns of tardigrades within Antarctica;
522 are they recent colonisers, ancient relics, or a mixture of both? To address the different hypotheses
523 underlying tardigrade biogeography of Antarctica, two eutardigrade species were selected that at
524 the outset of the study were believed to be found throughout the continent. These were the
525 Antarctic endemic species Acutuncus antarcticus (Richters, 1904) (Fig. 0.2) and Mesobiotus furciger
526 (Murray, 1906) (Fig. 0.3).
527 Acutuncus antarcticus is the most abundant and widespread tardigrade in Antarctica. It is
528 present in a wide variety of terrestrial habitats including moss, algae, lichen, soil and grass (Murray,
529 1910; Dastych, 1991; Cesari et al., 2016). The species has been recorded from the sub-, maritime,
530 and continental Antarctic regions, with one unconfirmed report from Argentina (Rossi et al., 2009;
531 Cesari et al., 2016). Czechowski et al. (2012) proposed that there were two distinct lineages present
532 in Dronning Maud Land (continental Antarctica), further suggesting that the species had survived
533 within that region during periods of glacial maxima and may be a cryptic species complex. Cesari et
534 al. (2016) also reported differences in the COX1 gene region in samples obtained from different
535 continental areas. However, A. antarcticus is still currently considered a pan-Antarctic species. There
536 have been no wider comparisons of material across the species’ continental Antarctic distribution, or
537 between maritime and continental Antarctic regions.
538 Mesobiotus furciger (Murray, 1906) belongs to a globally distributed and common genus.
539 The species was thought to be a ‘recent’ arrival to the maritime Antarctic although, again, some
540 studies have suggested the possibility of a cryptic species group (Dastych, 1984; Binda et al., 2005;
541 Sands et al., 2008a; Czechowski et al., 2012; Vecchi et al., 2016). In particular, Czechowski et al.
542 (2012), working with an unidentified species, demonstrated species-level divergence in the COX1
543 gene region between samples from isolated nunataks and regions within continental Antarctica,
544 again inferring isolation and long-term survival within Antarctica. Vecchi et al. (2016) reported
10
545 distinct lineages of Mesobiotus in continental Antarctica, but attributed these to the M. harmsworthi
546 group. In their re-description of M. furciger, Binda et al. (2005) compared species previously
547 attributed to M. furciger and documented morphological differences in individuals sampled from
548 different maritime Antarctic locations, South Africa, and New Zealand, which they renamed as
549 separate species (M. aradasi from King George Island, M. divergens from South Africa and M. sicheli
550 from New Zealand). They concluded that only material from South Georgia represented M. furciger
551 sensu stricto. This study also postulated that other records of M. furciger would need re-describing
552 and may not represent M. furciger s.s. Indeed, earlier Binda & Rebecchi (1992) had concluded that
553 all previous reports of M. furciger in the Northern Hemisphere are likely to refer to M. pilatoi. This
554 would leave M. furciger as a Southern Hemisphere group, but many of the older records have yet to
555 be confirmed. There has only been a single molecular study of a believed to be non-Antarctic
556 (Norway) member of the M. furciger group to date, finding this to be distinct from Antarctic M.
557 furciger and concluding that the material belonged to a different species, supporting the previous
558 work that M. furciger is a strictly Southern hemisphere group (Kaczmarek et al., 2018).
559 In the current study, the 18S, 28S, and COX1 gene regions were extracted and sequenced
560 from new samples of both species obtained from both maritime and continental Antarctica.
561 Available sequences from GenBank were included, and used to perform the first pan-Antarctic
562 studies of both species. Maximum Likelihood, Bayesian and ASTRAL-III analyses were performed to
563 investigate phylogenetic relationships, carry out molecular clock analyses of divergence timings, and
564 ancestral geographic state analyses (BioGeoBears) were applied to interpret biogeographic history.
565 Haplotype analyses were performed to investigate differences between the sampled areas.
566 Morphological characteristics were documented in order to identify visible distinguishing features
567 between sampled areas and, if present, whether these were also related to sampled habitat type.
568
569
11
570
571 Figure 0.2; An image of Acutuncus antarcticus collected from Antarctica, image from Tsujimoto et al.
572 (2015).
573
574 Figure 0.3; An image of Mesobiotus furciger collected from Antarctica, image from Cromer et al.
575 (2008).
576
577 Thesis chapters
578 Chapter 1 uses two ribosomal gene regions, 18S and 28S, and the mitochondrial gene region COX1,
579 to perform a comprehensive, concatenated gene phylogeographic study of the two eutardigrade
12
580 species. Sequence data were analysed in the context of the wider eutardigrade phylogeny under
581 Maximum Likelihood, Bayesian, and ASTRAL-III models, which were then used under a relaxed, log-
582 normal, birth-death molecular clock and mapped to a geographic range matrix. The study aimed to
583 clarify the position of the two species within the Eutardigrada. The analyses aimed to provide a
584 thorough and robust description of the patterns that these two species show within their complete
585 Antarctic geographical ranges, in particular addressing the question of whether any patterns
586 identified are indicative of long term in situ survival or of more recent colonisation.
587 Chapter 2 focuses on Acutuncus antarcticus, taking advantage of sampling across the most
588 complete Antarctic geographical range acheived to date. Using the COX1 gene region, haplotype
589 networks were constructed in order to assess whether A. antarcticus is a cryptic species complex
590 rather than being a single pan-Antarctic species, and to identify biogeographic patterns and their
591 implications within the species.
592 Chapter 3, focuses on Mesobiotus furciger. Although believed to be a recent arrival to the
593 maritime Antarctic, preliminary analysis of data obtained in Chapter 1 suggested the presence of an
594 Antarctic-specific lineage. Phylogenetic analyses using 18S and COX1 gene regions, and haplotype
595 mapping are used to determine the specific status of Antarctic representatives currently described
596 as M. furciger, and the biogeographic and evolutionary relationships within the species.
597 Chapter 4 focuses on the morphology of both A. antarcticus and M. furciger, using principal
598 component analyses and generalised linear models to determine whether there are significant
599 morphological differences between individuals sampled from the different biogeographic areas of
600 Antarctica. As individuals were sampled from different habitats, a habitat effect was added to the
601 models to test whether this also had an impact on the morphological variation seen.
602
603
13
604 Chapter One
605 Phylogeographic analyses of two Antarctic eutardigrade species (Acutuncus antarcticus and
606 Mesobiotus furciger) show ancient, Antarctic-specific lineages
607
608 Abstract
609 Tardigrades are an ancient and globally distributed lineage of ecdysozoans, famous for their ability
610 to survive extreme environmental challenges. Their distribution includes Antarctica, where they are
611 a common and important member of the terrestrial fauna. Antarctica has been isolated and
612 glaciated for 25-30 million years, with terrestrial life widely believed to have been wiped out during
613 repeated cycles of glaciation. However, recent studies of Antarctic terrestrial invertebrates have
614 shown many to be ancient relics that have survived glaciation in situ, but this is not yet known for
615 tardigrades. This study used two eutardigrade species which are common and widespread in
616 Antarctica, Acutuncus antarcticus and Mesobiotus furciger, to test hypotheses of ancient survival or
617 more recent colonisation. Acutuncus antarcticus is currently believed to be a relictual pan-Antarctic
618 species while M. furciger is from a cosmopolitan genus and thought to be a more recent coloniser.
619 Three genes, the nuclear 18S, 28S, and mitochondrial COX1, were targeted for each species. Material
620 was available for A. antarcticus from seven Antarctic biogeographical regions, and for M. furciger
621 from five Antarctic and two non-Antarctic regions which had been ascribed to the group
622 (Madagascar and Norway). The sequence data obtained were used, in conjunction with sequence
623 data from 101 further eutardigrade species obtained from GenBank, in Maximum Likelihood,
624 Bayesian and ASTRAL-III analyses under GTR+Gamma models. The outputs of these analyses were
625 used to estimate divergence times and generate ancestral geographic range reconstructions to
626 clarify the evolutionary history of these tardigrades in Antarctica. Results suggest that both species
627 should be regarded as species groups, which are distinct from other related non-Antarctic species.
628 Molecular clock analyses indicated that the Antarctic-specific clades emerged after the continent
14
629 became an isolated landmass, from ancestors that were already present in Antarctica before the
630 continent finally separated from the other southern continents. More recent geographical divisions
631 within both groups were consistent with the formation of the continent-wide East and West
632 Antarctic Ice Sheets 10-20 My.
633
634 1.1. Introduction
635 Tardigrades are an ancient lineage with a globally cosmopolitan distribution. They are known for
636 their impressive physiological adaptations enabling them to survive in extreme environments, even
637 including experimental exposure to the stresses of space (Jönsson et al., 2016). Sixty-five species of
638 tardigrade are currently described from Antarctica making them a particularly important component
639 of the depauperate Antarctic terrestrial fauna (Convey & McInnes, 2005; Convey, 2017; Tsujimoto et
640 al., 2014; Vecchi et al., 2016).
641 Antarctica has been geographically isolated since the opening of the South Tasman Rise and
642 the Drake Passage, approximately 50 to 30 million years ago, and subsequently progressively
643 glaciated (Kennet, 1977; Convey et al., 2009; Convey, 2018). With only 0.2%–0.4% of the continental
644 landmass seasonally ice-free, contemporary habitats that are suitable for life are patchy and
645 isolated. Colonisation of these habitats has been hypothesised through either dispersal of invaders
646 from more northern locations following ice retreat, particularly after the Last Glacial Maximum
647 (LGM), which commenced 10-20,000 years ago, or the vicariant presence of relictual populations
648 that survived in refugia (Pugh & Convey, 2008; Czechowski et al., 2016; Convey et al., 2018, 2020).
649 Isolation in fragmented habitats is generally assumed to lead to reduced contact between
650 populations, limiting gene flow and encouraging evolutionary divergence, and ultimately speciation.
651 This creates patchy habitat ‘islands’ with high species endemism but low overall diversity (Pugh,
652 1997; Bergstrom & Chown, 1999; McInnes & Pugh, 2007; Cesari et al., 2016). In Antarctica, isolation
653 is compounded by severe environmental constraints (extreme temperatures, lack of liquid water,
15
654 low nutrient availability, poor soil formation), which also contribute to the low contemporary species
655 diversity in the region (Sohlenius et al., 2004; Convey et al., 2014; Czechowski et al., 2016).
656 The terrestrial fauna of the maritime Antarctic, which includes the major Scotia Arc
657 archipelagos and the western coastal regions of the Antarctic Peninsula, shows evidence of long-
658 term survival through multiple glaciation events (e.g. Maslen & Convey, 2006; van Vuuren et al.,
659 2018; McGaughran et al., 2019). Similarly, continental Antarctic terrestrial biota include many glacial
660 survivors, supported by Gondwanan distribution patterns and high levels of endemism (Adams et al.,
661 2006; Pugh, 2006; Pugh & Convey, 2008; Convey et al., 2008, 2009; Czechowski et al., 2012; Velasco-
662 Castrillon et al., 2014; Cesari et al., 2016; Collins et al., 2019; Carapelli et al., 2020).
663 Bio- and phylogeographic studies of most groups of terrestrial invertebrates currently
664 present in Antarctica have shown them to have survived through multiple glaciation cycles (Convey
665 et al., 2008, 2020). Long-term presence is also reflected in the Antarctic flora, with some mosses also
666 having pre-glaciation origins on the continent (Biersma et al., 2018, 2020). To date, limited attention
667 has been given to understanding the evolutionary history of the continent’s tardigrades. The only
668 study yet to have applied molecular approaches to dating presence on the continent focussed
669 explicitly on the heterotardigrade genus Mopsechiniscus (Guidetti et al., 2017), estimating
670 divergence from non-Antarctic relatives at 32-48 My. This date putatively coincides with the final
671 stages of separation of southern South America and the Antarctic Peninsula, and suggests that this
672 lineage might be of Gondwanan origin, with speciation within Antarctica driven by subsequent
673 glaciation and other isolation events (Guidetti et al., 2017). The findings for the Antarctic dipteran
674 Belgica antarctica, which indicated vicariant survival, are on the same timescale (Allegrucci et al.,
675 2006).
676 To test different hypotheses for the biogeographic history of Antarctic tardigrades, I focus
677 here on two eutardigrade species that are currently thought, based on morphological taxonomy
678 (Binda et al., 2005; Cesari et al., 2016), to occur in Antarctica. The first is the pan-Antarctic species
16
679 Acutuncus antarcticus (Richters, 1904), generally assumed to be a relict species, and the second
680 Mesobiotus furciger (Murray, 1906) thought to be a recent coloniser of Antarctica which has become
681 widespread throught the continent. Acutuncus antarcticus is the most abundant and widespread
682 tardigrade in Antarctica (Cesari et al., 2016). It occurs in a wide range of terrestrial habitats including
683 those dominated by moss, algae, lichen, soil and grass, as well as in freshwater lakes, pools and
684 streams associated with aquatic mosses, algae and sediments (Murray, 1910; Dastych, 1991; Cesari
685 et al., 2016). The species is recorded from the sub-, maritime and continental Antarctic regions, with
686 one unconfirmed report from Argentina (Rossi et al., 2009; Cesari et al., 2016). Czechowski et al.
687 (2012) suggested that there were two distinct lineages present in Dronning Maud Land, continental
688 Antarctica, and that it is perhaps a cryptic species complex. In contrast, M. furciger (Murray, 1906) is
689 from a globally distributed genus which is also widespread in Antarctica, with the original description
690 of the species from the South Orkney Islands. Some studies have again suggested the possibility that
691 this may be a cryptic species group (Dastych, 1984; Binda et al., 2005; Sands et al., 2008a;
692 Czechowski et al., 2012; Vecchi et al., 2016). Czechowski et al. (2012) documented species-level
693 divergence in Mesobiotus from different regions within continental Antarctica, inferring long-term
694 isolation of individuals assigned to this group in Antarctica.
695 This study set out to investigate the timescale of tardigrade presence and divergence in
696 Antarctica. To do this, multiple gene regions (18S, 28S and COX1) were sequenced and the resulting
697 data analysed under multiple phylogenetic models (Maximum Likelihood, Bayesian and ASTRAL-III),
698 and biogeographic analyses performed using BioGeoBears and molecular clock analyses.
699
700
701
702
703
17
704 1.2. Methods and Materials
705
706 1.2.1. Material included
707 Samples were obtained from the Antarctic continent and offshore islands, originating from 10
708 distinct geographical areas. These included locations within five of the currently recognised Antarctic
709 Conservation Biogeographic Regions (South Orkney Islands, North-east Antarctic Peninsula, North-
710 west Antarctic Peninsula, Central South Antarctic Peninsula and the Transantarctic mountains
711 (specifically the Shackleton Mountains); Terauds & Lee, 2016) and the sub-Antarctic island of South
712 Georgia (Figure 1.1). Samples were sourced from frozen material stored at the British Antarctic
713 Survey, Cambridge, with additional sequences obtained from two previous studies, those of
714 Czechowski et al. (2012) and Sands et al. (2008a). Tardigrades were extracted from samples from
715 each biogeographic region and RNA extractions performed, which were used for the creation of
716 cDNA libraries (see Sections 1.2.2-1.2.4).
18
717
718 Figure 1.1; Areas from which material of Acutuncus antarcticus and Mesobiotus furciger was
719 obtained; locations highlighted in red (A. antarcticus) and blue (M. furciger) are from this study and
720 those in yellow (A. antarcticus) and green (M. furciger) are from Czechowski et al. (2012) and Sands
721 et al. (2008a).
722
723
724
19
725 1.2.2. Tardigrade extraction
726 To ensure extraction of tardigrades of varying sizes (including eggs if present), we used a density
727 gradient extraction (flotation) technique (Sands et al., 2008b). A non-ionic and non-toxic medium,
728 OptiPrepTM (SigmaAldrich), was used. In a test tube three layers of medium were added: one of 1 mL
729 pure OptiPrepTM, one of 2 mL of a 50/50 OptiPrepTM and reverse osmosis water mixture, and a final
730 layer of homogenized substrate material to fill to the top of the test tube. The tubes were
731 centrifuged on full power (110 x g) for 2 min. The first layer was then carefully removed and passed
732 through a 32 µm sieve and examined under a microscope (method adapted from Sands et al.,
733 2008b). Prior to tardigrade extraction, frozen or dried samples of moss or algal mats of c. 2 cm3 were
734 de-frosted/re-hydrated at room temperature for 24 h in distilled water. After 24 h they were placed
735 into a small cup with distilled water. The samples were hand crushed until lightly homogenized. The
736 flotation technique described above was then used to extract and remove any tardigrades present.
737
738 1.2.3. RNA extraction
739 Individual tardigrades (and eggs if present) were identified and those belonging to either A.
740 antarcticus or M. furciger were picked out using an Irwin loop and placed onto a cavity slide with
741 distilled water. The slide was then examined using light microscopy to confirm identification. Totals
742 of 50-100 individuals of each species from each sample (depending on numbers present) were then
743 placed into 1.5 mL micro-centrifuge tubes containing RNAlater (ThermoFischer) and stored at -20oC
744 until further use.
745 For each species, transcriptomic RNA extraction was carried out on the pooled samples of
746 50-100 individuals that had been identified using light microscopy. RNA was extracted using the
747 TRIzol® Reagent method following the manufacturer’s instructions (Ambion), with flash freezing in
748 liquid nitrogen before crushing. cDNA libraries were then prepared from the total RNA sample using
20
749 the BIOO Scientific NEXTflex™ Rapid Directional mRNA-Seq bundle following the manufacturer’s
750 instructions, before being run through Illumina next generation sequencing. Transcriptome assembly
751 was carried out using Trinity version 2.0.3 (Grabher et al., 2011; Haas et al., 2013) under default
752 parameters and Trimmomatic. 18S, 28S and COX1 regions were retrieved from the resulting
753 assembled transcriptome.
754
755 1.2.4. Sequence collations and database creation
756 We used the eutardigrade species list and taxonomy of Guidetti & Bertolani (2005), updated with
757 new species described from 2005 to present (Degma et al., 2020). From this species list, sequences
758 for 18S and 28S ribosomal rDNA gene regions and the cytochrome c oxidase subunit I (COX1)
759 mitochondrial DNA gene region were searched for and downloaded from GenBank to create three
760 databases (one for each gene region). The 18S and 28S gene regions were selected due to their slow
761 mutation rates, in order to identify deeper divergence events, while the COX1 gene region was
762 selected owing to its faster mutation rate to help separate more recently diverged lineages. If no
763 sequences were available, the considered species was removed from the database. Poor or
764 duplicated sequences were also removed from the database, manually checking the sequences using
765 codon code aligner version 5.1.5 and removing them if the sequences were very short. Sequences
766 for A. antarcticus and M. furciger were separated by their geographical region of origin (Table S1.1);
767 these sequences were obtained in the current study and from Sands et al. (2008a) and Czechowski
768 et al. (2012). Due to an analytical problem with the sequence of A. antarcticus from the Shackleton
769 Mountains it could not be used for this analysis and was removed. The remaining species used and
770 their GenBank accession numbers are listed in Table S1.2.
771
772
21
773 1.2.5. Phylogenetic analyses
774 Each gene region was aligned using the multiple sequence alignment software MAFFT (Nakamura et
775 al., 2018; Katoh et al., 2017; Kuraku et al., 2013) using the FFT-NS-I iterative refinement method
776 (Katoh et al., 2002). The alignments were manually checked and trimmed using codon code aligner
777 version 5.1.5 (CodonCode Corporation, www.codoncode.com) and BMGE (Criscuolo & Gribaldi,
778 2010), gaps in the alignment were manually removed along with ambiguous regions either side. The
779 three genes were concatenated using FASconCAT (Kück & Meusemann, 2010), and the generated
780 superalignment was subjected to ML and Bayesian analysis, under a GTR+G model of substitution
781 which was shown to be the best fit model when using the best-fit substitution model programme in
782 MEGA 10 (Nei & Kumar, 2000; Kumar et al., 2018). All Bayesian and ML analyses used, respectively,
783 Phylobayes v3.3 (Lartillot & Philippe, 2004, 2006; Lartillot et al., 2007, 2009) and RAxML v7.2.8
784 (Stamatakis, 2006; Ott et al., 2007). The Bayesian analysis was run for 15,000,000 generations, and
785 convergence was tested before stopping the analyses using the Bpcomp and Tracecomp software in
786 Phylobayes. Support values were estimated as posterior probabilities in the Bayesian analyses,
787 while under ML the bootstrap value (100 replicates) was used to estimate support. As population-
788 level effects (incomplete lineage sorting) could affect results of analyses aimed at recovering
789 species-level phylogenies (e.g. Degnan & Rosenberg, 2009), in addition to gene concatenation
790 analyses, we used ASTRAL-III (Zhang et al., 2018) to generate a reconciliated phylogeny for our gene
791 trees under the multispecies coalescent model. To do so, we first generated 100 bootstrapped
792 single gene phylogenies (under ML – GTR+G) for our 18S, 28S, and COX1 sequence data. After that,
793 the bootstrap trees were used as input for ASTRAL-III to generate our reconciliated species tree.
794
795 1.2.6. Molecular clock analyses
796 A relaxed molecular clock approach was used to date the tardigrade phylogeny. For the clock
797 analyses we used the tree obtained from the gene-tree/species-tree (ASTRAL-III) reconciliation
22
798 analysis, as this tree used the same substitution model as the super alignment analyses but also took
799 into consideration the potential effect of coalescent-induced biases on the data obtained (e.g.
800 Degnan & Rosenberg, 2009). However, to evaluate the effect of topological uncertainty, further
801 tests were performed using the ML and Bayesian phylogenies. All analyses used an auto-correlated
802 CIR model (Lepage et al., 2007) with a birth-death prior and soft bounds (0.05% of the probability
803 distribution allocated outside the calibration boundaries) and a relaxed, log-normal birth-death rate.
804 The outgroup for this analysis was Milnesium tardigradum. A minimum of 90 million years was
805 imposed on the root node based on the fossil Milnesium swolenskyi from the Upper Cretaceous
806 (Bertolani & Grimaldi, 2000). Due to the poor fossil record for Tardigrada this was the only
807 calibration imposed on our phylogeny.
808
809 1.2.7. Biogeographic analyses
810 A geographic range data matrix was created for each tardigrade species in our dataset. Each species
811 was given an identifier that corresponded to their biogeographic range as described by Gary et al.
812 (2008) (Fig. 1.2; Table S1.3). In order to reduce noise in the outputs from this analysis, species
813 inhabiting multiple areas were given identifiers that corresponded to a combination of
814 biogeographic areas (Table S1.4). Species ranges were compiled from published geographic ranges
815 for currently described species. The R package BioGeoBears (Matzke, 2013) was used to analyse
816 ancestral geographic ranges and to model the evolution of geographic ranges over time for the
817 eutardigrade phylogeny using biogeographic stochastic mapping to a time-calibrated tree (Dupin et
818 al., 2016). Ancestral geographic ranges were tested under two variations of two different models.
819 The first was the maximum likelihood Lagrange DEC model (Ree & Smith, 2008) of dispersal,
820 extinction and cladogenesis (with or without an added jump/founder dispersal parameter to analyse
821 all possible biogeographic events – DEC and DEC+J). The second model was a Bayesian Inference
822 model, similar to the BayArea model of Landis et al. (2013), with or without a jump/founder
23
823 dispersal parameter (BAYAREALIKE and BAYAREALIKE+J). The two different models were used to test
824 the importance of cladogenesis events to the ancestral states of the tardigrade phylogeny and
825 whether they were impacted by a jump dispersal event. Each model was run through 50
826 evolutionary scenarios and a consensus stochastic map was produced.
827
828
829 Figure 1.2; Biogeographic ranges used for the eutardigrade matrix, as described by Gary et al. (2008).
830 NA= Nearctic, PA= Palearctic, NT= Neotropical, AT= Afrotropical, OL= Oriental, PAC= Pacific, AU=
831 Australasia and ANT= Antarctica.
832
833
834
835
836
837
24
838 1.3. Results
839
840 1.3.1. Mesobiotus furciger
841 Our data provided strong support for the existence of an Antarctic ‘M. furciger’ clade (Fig. 1.3, point
842 B). This clade lies within Mesobiotus as the sister lineage to an M. hilariae/M. polaris species
843 complex that also includes eggs of an unidentified tardigrade from South Georgia (Fig. 1.3, point C).
844 The M. harmsworthi group emerges as the sister group, which includes specimens identified as M.
845 furciger obtained from Alexander Island, which are themselves not included in the Antarctic M.
846 furciger clade. Accordingly, our analyses suggest that M. furciger from Alexander Island should be
847 considered part of a sister lineage to non-Antarctic M. harmsworthi species and form part of a
848 distinct Antarctic M. harmsworthi lineage (Fig. 1.3, point D). This group, including the Alexander
849 Island M. furciger, is sister to the lineage comprising the Antarctic M. furciger group and the M.
850 hilariae/M. polaris complex (Fig. 1.3, point E).
851 In all the phylogenetic analyses, members of the Antarctic M. furciger group were clearly
852 geographically partitioned, with strong support for two lineages. First, a lineage consisting of
853 material from the South Orkney and South Shetland Islands (Signy and King George Islands) and,
854 second, a lineage comprising Litchfield and Charcot Islands (central and southern Antarctic
855 Peninsula), and the Victoria Land (continental Antarctica) species M. mottai. Mesobiotus furciger
856 from Litchfield Island was closely related to M. mottai, which suggests that the latter should be
857 included in the M. furciger group. Based on these analyses, non-Antarctic material previously
858 identified as M. furciger are clearly not part of the Antarctic M. furciger group, but are located within
859 the M. harmsworthi group, with the M. furciger group exclusively present in Antarctica.
860
861
25
862 1.3.2. Acutuncus antarcticus
863 Our phylogenetic analyses indicate that Acutuncus antarcticus constitutes a monophyletic lineage
864 within the Hypsibioidea. Based on our Astral-III analyses (Fig. 1.3), there is a strong sister
865 relationship within Hypsibioidea between the group containing the genera Pilatobius and a lineage
866 containing the A. antarcticus group (Fig. 1.3, point A). Within the lineage that contains A. antarcticus
867 there is a well-resolved sister relationship between Calohypsibidae (which also contained Mixibius
868 and Microhypsibius), and A. antarcticus.
26
869 27
870 Figure 1.3: Tree resulting from ASTRAL-III analysis of 100 bootstrap replicate trees from the three
871 coding regions (18S, 28S and COX1). Labels in red are new sequences from this study and labels in
872 black are sequences from GenBank. Label A shows the sister relationship between A. antarcticus and
873 Calohypsibius/Mixibius/Microhypsibius. Label B shows the M. furciger group, label C the M.
874 polaris/M. hilariae group, label D the M. furciger from Alexander Island as part of an Antarctic sister
875 lineage to M. harmsworthi and label E the non-Antarctic M. harmsworthi group including individuals
876 previously identified as a member of the M. furciger group from non-Antarctic locations.
877
878 1.3.3. Molecular clock analyses
879 Molecular clock analyses of the ASTRAL-III tree (Fig. 1.4) placed the crown of the Antarctic M.
880 furciger group and of the A. antarcticus clades at approximately 26.5 My (HPD 40 - 5 My). The
881 Antarctic M. furciger group separated from its sister M. hilariae/M. polaris lineage approximately 37
882 My (HPD 54 – 7 My), while divergence from the last common ancestor of the M. furciger, M.
883 hilariae/M. polaris and M. harmsworthi lineages took place approximately 39 My (HPD 55 – 7 My).
884 Within the Antarctic M. furciger group, two geographic lineages diverged at approximately 28 My
885 (HPD 42 – 5 My; Fig. 1.4), with further divergence within the groups occurring approximately 10
886 mya. Comparable divergence estimates were found within the Antarctic M. hilariae/M. polaris
887 group, first at approximately 32 My and with further divergences <10 My. Finally, within the M.
888 harmsworthi lineage, the Antarctic M. furciger (Alexander Island) separated from the other (non-
889 Antarctic) species approximately 32 My, with the non-Antarctic M. harmsworthi species diverging
890 between 25 and 10 My.
891 Acutuncus antarcticus separated from its sister lineage (the Diphascon group) approximately
892 40 My (HPD 60 – 7 My). Divergence of geographic lineages within A. antarcticus took place between
893 16 and 7 My.
28
894 3.4. Biogeographic analyses
895 The standard dispersal-extinction-cladogenesis (DEC) model, with or without an added ‘jump
896 dispersal’ (DEC+J), showed that both the Antarctic M. furciger group and A. antarcticus had a purely
897 Antarctic heritage irrespective of the phylogeny used to run the analyses (Figs. 1.4, S1.1, 1.2).
898 Bayesian (BAYAREALIKE and BAYAREALIKE+J) models showed a difference in the ancient
899 geographical states depending on whether a ‘jump dispersal’ component was added to the
900 phylogenetic tree being analysed. BAYAREALIKE found that the ancestral lineages of both A.
901 antarcticus and the Antarctic M. furciger group showed a combined Palearctic and Gondwanan
902 (Antarctic) distribution before becoming Antarctic-specific and separating into the geographically
903 distinct crown groups. BAYAREALIKE +J gave results similar to those obtained using DEC and DEC+J,
904 but with the Antarctic-specific lineages appearing earlier than in the DEC models. (Figs. 1.4, S1.3,
905 1.4).
29
906 30
907 Figure 1.4: Time-tree created using the ASTRAL-III phylogeny using an auto-correlated CIR model
908 with a birth-death prior and soft bounds. Credibility intervals (95% HPD) are shown for nodes of
909 interest with yellow bars, black stars represent Antarctic ancestral state nodes while white stars
910 represent non-Antarctic ancestral state nodes. Time periods are noted at the top of the figure in
911 black and white and major Antarctic geological events are noted below the figure, with major
912 biogeographic events highlighted in dark blue (breaking of South America-Antarctic Peninsula link)
913 and light blue (formation of ice sheets). Species in red are new for this study.
914
915 1.4. Discussion
916 1.4.1. Mesobiotus furciger and Acutuncus antarcticus phylogenies
917 The original descriptions of M. furciger (as Macrobiotus furcatus in Murray, 1906, re-named M.
918 furciger and re-described in Murray, 1907) gives the type locality as the South Orkney Islands (Laurie
919 Island). Murray (1906, 1907) particularly focussed on the very large accessory points of the primary
920 claws, sometimes nearly the length of the claw itself, and on the egg process morphology, to
921 characterise M. furciger. He suggested that M. furciger may be an Antarctic-specific species, noting
922 that all individuals present in Antarctic material differed significantly from individuals sampled in
923 northern and temperate regions. He also noted that there were high levels of morphological
924 variation within Antarctic M. furciger populations. Previously considered a globally cosmopolitan
925 species (e.g. Dastych, 1984), further studies have reduced the distribution of M. furciger sensu
926 stricto, with Mesobiotus pilatoi (Binda & Rebecchi, 1992) now considered to represent most
927 Northern Hemisphere records of M. furciger. Dastych (1984, 1989) and Binda et al. (2005) similarly
928 noted significant variation in morphology between geographically distinct samples, with Binda et al.
929 (2005) assigning new species to some of these variations. Czechowski et al. (2012) was the first
930 study to suggest that M. furciger may represent an Antarctic-specific species complex (see: Figure 3
931 in Czechowski et al. 2012). Most recently, Vecchi et al. (2016) also noted differences between
31
932 Antarctic and non-Antarctic representatives. They identified an Antarctic-specific clade containing
933 M. furciger and M. mottai, which emerged as the sister of the Antarctic M. hilariae/M. polaris group.
934 These two lineages together formed the sister group to the non-Antarctic M. harmsworthi group
935 (See Figure 3 in Vecchi et al., 2016). Our phylogenetic analyses consistently identified M. furciger as
936 an Antarctic-specific lineage, consistent with Czechowski et al. (2012) and Vecchi et al. (2016).
937 However, in our analyses samples identified as M. furciger formed a paraphyletic group, with
938 material sampled from Alexander Island (southern Antarctic Peninsula) emerging as sister to the M.
939 harmsworthi group, rather than belonging to the M. furciger group. We found strong support for all
940 other Antarctic M. furciger constituting an Antarctic-specific clade within Mesobiotus that also
941 contains M. mottai. Alexander Island samples currently referred to M. furciger now require
942 reclassification to reflect their affinity with the M. harmsworthi group. This observation further
943 increases support for Alexander Island being a biodiversity hotspot, indicating a long term refugium,
944 as was also found for the springtail species Friesea topo (Carapelli et al., 2020), which is endemic to
945 the same area of south-east Alexander Island. In agreement with Vecchi et al. (2016), the M.
946 furciger group emerges as sister of the M. hilariae/M. polaris group, with both groups having an
947 exclusively Antarctic distribution. Together, they form a sister group to the M. harmsworthi group. If
948 the example identified from Alexander Island (Maritime Antarctic) as M. furciger proves to be a
949 member of the M. harmsworthi group, it would be the sole Antarctic and oldest representative, with
950 the rest of the group having a non-Antarctic distribution. Our phylogenetic analyses suggest that the
951 recent divergence within the M. harmsworthi group occured beyond Antarctica.
952 Our analyses placed A. antarcticus within the superfamily Hypsibioidea, consistent with
953 previous studies (Sands et al., 2008a; Marley et al., 2011; Czechowski et al., 2012; Guil & Giribet,
954 2012; Bertolani et al., 2014; Cesari et al., 2016). Although this species is morphologically similar to
955 Hypsibius species (Hypsibiidae), and was originally classified as such by Marcus (1928), it was re-
956 classified by Pilato & Binda (1997) and further classified by Pilato & Binda (2010) as the type species
957 of the genus Acutuncus, with its main distinguishing feature being the external claws of Isohypsibius
32
958 type and the internal claws of Hypsibius type and the apophyses of the stylet muscles being acute
959 hooks. Currently considered incerta subfamilia (according to Bertolani et al., 2014), our results are
960 similar to those of previous studies (Sands et al., 2008a; Marley et al., 2011; Guil et al., 2018) that
961 found A. antarcticus to be closely related to Calohypsibius (Calohypsibiidae). However, our results
962 also point to species-level divergences being present within A. antarcticus as currently defined. As
963 noted above, A. antarcticus is currently considered to be a pan-Antarctic species. However,
964 Czechowski et al. (2012), Kagoshima et al. (2013) and Cesari et al. (2016) all noted diversity in the
965 COX1 region in representatives assigned to this species, suggesting that speciation could be
966 happening. Our data support this suggestion, and we propose that A. antarcticus could be a species
967 complex, with a strong relationship to the Calohypsobiidae family.
968
969 1.4.2. Antarctic history and biogeography
970 Our phylogenetic, biogeographic, and molecular clock analyses suggest that the evolutionary
971 histories of both M. furciger and A. antarcticus have been similarly impacted by major tectonic and
972 glaciological events within the Antarctic continent. Biogeographic analyses indicate that the
973 Mesobiotus clade had an Antarctic origin, with molecular clock analyses indicating that the last
974 common ancestor of this lineage might have predated the separation of Australia and Antarctica.
975 Within the Mesobiotus clade, an Antarctic-specific sub-clade can be identified which includes the M.
976 hilariae/M. polaris and M. furciger groups. This lineage comprises entirely Antarctic species,
977 radiating from a last common ancestor that was present in Antarctica approximately 37.5 My (HPD
978 54 – 7 My). This clade most likely diverged after Antarctica separated from Australia, and possibly
979 after it become an isolated landmass. A second lineage within the Mesobiotus clade comprises
980 material currently described as “M. furciger” from Alexander Island and the M. harmsworthi group.
981 Biogeographical reconstructions indicate that these two together had an Antarctic last common
982 ancestor that, similar to the Mesobiotus Antarctic-specific sub-clade, broadly coincided with the
33
983 separation of southern South America from the Antarctic Peninsula (33 My; HPD 49 – 6 My). The
984 main M. harmsworthi group, whose members occur outside Antarctica, had a non-Antarctic
985 common ancestor at 24.2 My (HPD 37 – 5 My). This may suggest that a common ancestor of the M.
986 harmsworthi group, including the Alexander Island member, originated in the Gondwanan region of
987 Antarctica. While the Alexander Island (“M. furciger”) lineage remained in Antarctica the rest of the
988 group diverged after Antarctica became isolated. It is perhaps also notable that the region of
989 Alexander Island, from which this “M. furciger” material was collected, also hosts an exceptionally
990 diverse and apparently endemic nematode community (Maslen & Convey, 2006) and an endemic
991 springtail (Friesea topo; Greenslade, 1995; Carapelli et al., 2020), and has been suggested to be a
992 diversity hotspot consistent with a regional glacial refugium. However, no molecular studies have
993 been carried out on these nematode species and hence no dating estimates are available for
994 comparison. Within the M. furciger group there was a further divergence of two geographic groups
995 at ~ 27.9 My (42 – 5 My – Fig. 1.4), with further divergence events within the groups occurring
996 around 10 My.
997 The biogeographic history of A. antarcticus is more straightforward to interpret than that of
998 the Mesobiotus group. The last common ancestor of the Acutuncus group and of its sister lineage
999 (the Diphascon/Pilatobius group) was a non-Antarctic lineage that existed approximately 40 My
1000 (HPD 60 – 7 My). In our data the last common ancestor of the group combining Calohypsibiidae and
1001 Acutuncus post-dated the separation of Antarctica and Australia, although was broadly coincident
1002 with the separation of Antarctica from South America (27 My; HPD 40 – 5 My). The divergence of
1003 the A. antarcticus ancestral lineage at this time from the common ancestor with Calohypsibiidae
1004 suggests it may have originated in the Antarctic region of Gondwana before the Acutuncus ancestral
1005 lineage became isolated. Geographic divergences within the A. antarcticus clade date to the period
1006 16-7 My.
34
1007 The data and analyses presented here provide strong support for the hypothesis that the
1008 two eutardigrade species groups examined have ancient Antarctic origins, surviving the continent’s
1009 isolation and successive major glaciation events in situ on the continent. This is contrary to the
1010 previous hypothesis that M. furciger was a recent coloniser of Antarctica and indicates that there is a
1011 different evolutionary heritage of this group then previously proposed. Similarly, Guidetti et al.
1012 (2017) reported a divergence time of 32-48 My in the only other study available of tardigrade history
1013 in Antarctica, of the heterotardigrade genus Mopsechiniscus. Similar patterns have been reported in
1014 an increasing number of studies of Antarctic invertebrates, plants, and even microbial groups
1015 (Convey et al., 2008, 2018, 2020).
1016
1017
1018
1019
1020
1021
1022
1023
1024
1025
1026
1027
1028
35
1029 Chapter Two
1030 Pan-Antarctic molecular analyses of the Antarctic eutardigrade Acutuncus antarcticus
1031 (Hypsibioidea) show strong biogeographic patterns and deep ‘intra-specific’ differentiation.
1032
1033 Abstract
1034 Antarctica has been isolated and glaciated for many millions of years and, with extreme conditions
1035 for life and very limited ice-free areas, habitats suitable for biological activity are fragmented and
1036 isolated. This fragmentation drives genetic divergence between populations, which can lead to
1037 speciation. Strong biogeographic differences between continental and maritime Antarctica have
1038 recently been noted in multiple terrestrial taxonomic groups found throughout the continent,
1039 highlighting their long and isolated evolutionary history. Tardigrades are widespread and common
1040 throughout Antarctica, but their biogeography has not received detailed study using modern
1041 molecular biological techniques. This study uses the COX1 gene region of the eutardigrade
1042 Acutuncus antarcticus, currently believed to be a pan-Antarctic species, obtained from multiple
1043 continental and maritime Antarctic locations. Our analyses clearly indicate the presence of three
1044 well-defined and deeply divergent geographic clades within A. antarcticus. These represent material
1045 respectively from the maritime Antarctic, the majority of continental (East) Antarctica, and Dronning
1046 Maud Land specifically. The divergence events separating these clades pre-date the isolation of the
1047 continent during the final stages of Gondwana breakup. At least 26 haplotypes were present, with
1048 no haplotypes shared between the three main clades. The continental Antarctic clade included
1049 greater haplotype diversity than did the maritime, allowing suggestion of possible areas containing
1050 refugia during major glaciation events. The data obtained strongly suggest that A. antarcticus should
1051 no longer be considered a pan-Antarctic species, rather including at least three very distinct and
1052 geographically separated species-level genetic lineages.
36
1053 2.1. Introduction
1054
1055 Antarctica’s long history of isolation and glaciation has led to the fragmentation and adaptation to
1056 extreme environments of its surviving biota (Kennet, 1977; Convey et al., 2009, 2018). The isolation
1057 of Antarctica started with the break-up of Gondwana, which initiated around 180 Ma and continued
1058 to its final separation from South America around 35 Ma and the formation of the Antarctic
1059 Circumpolar Current approximately 18-20 Ma (Kennet, 1977; Storey, 1995; Convey et al., 2009).
1060 Over this period the region underwent profound climatic and environmental changes, particularly
1061 with the first formation of continental-scale ice-sheets during the Miocene. These, as well as leading
1062 to the extinction of the majority of Antarctica’s pre-existing terrestrial biota, further fragmented the
1063 remaining already isolated biota, leading to the high species-level endemism seen in Antarctica
1064 today (Chown & Convey, 2007; Pugh & Convey, 2008; Convey et al., 2018).
1065 The continent of Antarctica is divided into East and West geological regions, separated by
1066 the Transantarctic Mountains. The Antarctic Peninsula and Scotia Arc archipelagos form the
1067 biological region of the maritime Antarctic, separated from the majority of continental Antarctica by
1068 the Gressitt Line at the base of the Antarctic Peninsula (Chown & Convey, 2007; Convey, 2017) (Fig.
1069 2.1). The East Antarctic shield or craton forms the main continental plate of Antarctica, while West
1070 Antarctica has a complicated geological history and is made up of numerous micro-continental
1071 fragments (Storey et al., 1988; Chown & Convey, 2007). The ice-free terrestrial areas of the
1072 continent, Antarctic Peninsula and Scotia Arc archipelagos south of sixty degrees latitude (i.e. within
1073 the area of governance of the Antarctic Treaty) have recently been further divided into Antarctic
1074 Conservation Biogeographic Regions (ACBRs). At present 16 ACBRs are recognised, representing
1075 biologically distinct ice-free areas of Antarctica (Terauds et al., 2012; Terauds & Lee, 2016).
1076 There is a striking difference in terrestrial diversity between the continental and maritime
1077 Antarctic regions, with no or virtually no species overlap in multiple invertebrate groups, including
37
1078 mites, springtails and nematodes (Maslen & Convey, 2006; Chown & Convey, 2007; Greenslade,
1079 2018; Carapelli et al., 2020), supporting a difference in evolutionary origins of species between these
1080 regions (Pugh & Convey, 2008; Czechowski et al., 2012). This division is not currently mirrored in
1081 published studies of Antarctic tardigrades, although studies to date of this group have not generally
1082 applied molecular techniques (Convey & McInnes, 2005). The East and West continental areas are
1083 separated by the Transantarctic Mountains. The Transantarctic Mountains, Victoria Land and Marie
1084 Byrd Land regions experienced considerable volcanic activity over the last 15 million years, isolating
1085 these areas by destroying suitable habitats, creating impassable lava flows and changing the
1086 geological composition of the rock, all contributing to further biological isolation (Kyle & Cole, 1974).
1087 Victoria Land, and specifically the Dry Valley region, today includes some of the largest ice-free areas
1088 in Antarctica. Parts of some of these are known to have been ice-free for at least 12-13 My, and have
1089 been hypothesised to have provided refugia through repeated glacial cycles for the fauna of the
1090 region, much of which is endemic (Fitzgerald, 2002; Adams et al., 2006; Stevens et al., 2007).
1091 Acutuncus antarcticus (Richters, 1904) is a tardigrade belonging to the class Eutardigrada
1092 and the super-family Hypsibioidea. It is one of the most common and widely distributed tardigrades
1093 reported in Antarctica and can be found in a range of habitats including soil, sediment, algae, and
1094 moss in freshwater or terrestrial habitats (Murray, 1910; Dastych, 1991; Cesari et al., 2016).
1095 Acuntuncus antarcticus is found throughout Antarctica and is currently considered to be a pan-
1096 Antarctic species (Cesari et al., 2016). Although two recent studies have noted diversity in the COX1
1097 gene region and have suggested possible speciation across different regions, there have been no
1098 studies with access to material obtained across a wide proportion of the species’ overall range
1099 (Czechowski et al., 2012; Cesari et al., 2016). The species is currently believed to be an ancient relict
1100 species within Antarctica (Czechowski et al., 2012).
1101 This study provides the first analyses of the COX1 gene region in samples of A. antarcticus
1102 obtained from multiple different Antarctic geographical regions, and aims to to provide an improved
38
1103 description of the biogeography of this species and to identify whether there are genetic signals of
1104 differentiation between the different biogeographic regions of Antarctica.
1105
1106 2.2. Methods
1107 2.2.1. Definition of Antarctic regions
1108 For the purposes of this study, Antarctica was divided into two main regions, continental Antarctica
1109 (all areas beyond the Gressitt Line at the base of the Antarctic Peninsula), and maritime Antarctica
1110 (Antarctic Peninsula, South Shetland Islands, South Orkney Islands, and also the South Sandwich
1111 Islands although no material was available from the latter). Continental Antarctic tardigrade material
1112 originated from further sub-areas including, Dronning Maud Land, Victoria Land and multiple areas
1113 along the East continental coast (Fig. 2.1).
1114
1115 2.2.2. Collection and Identification of material
1116 Fresh material from the maritime Antarctic was collected during the period 30th November 2018 to
1117 28th February 2019. Samples (5-10 g dry mass) of moss and algae were carefully removed, using a
1118 small sterilised trowel to avoid cross contamination, from a range of suitable habitat types. Samples
1119 were air-dried before being sealed in paper bags, within a sealed plastic box, and returned to the
1120 British Antarctic Survey, Cambridge, UK, under all required quarantine protocols and licenses.
1121 Further maritime Antarctic samples were sourced from existing frozen (-20°C) substrate material
1122 available at the British Antarctic Survey, Cambridge. Continental Antarctic samples were selected
1123 from the -20°C sample storage collection held by the South Australian Museum, Adelaide, South
1124 Australia. These samples were processed in situ as required by the Australian Quarantine Inspection
1125 Service, with extracted tardigrade individuals stored in RNAlater (ThermoFisher) for transport to the
39
1126 British Antarctic Survey, Cambridge, UK, for further analyses. Details of the collection protocol for
1127 these samples are provided by Velasco-Castrillón et al. (2014).
1128 Each substrate sample was re-hydrated using reverse osmosis (RO) water at room
1129 temperature for 24 h before being homogenised by hand. The homogenised sample was then added
1130 to an OptiPrepTM (SigmaAldrich) density gradient and centrifuged at full power (110 × g) for two
1131 minutes. The supernatant was carefully removed and passed through a 32 µm sieve which was then
1132 rinsed into a Petri dish using RO water for examination under light microscopy. Individual
1133 tardigrades and eggs if present were isolated under a Wild M5 dissection microscope using an Irwin
1134 loop. Each individual collected was then placed into a drop of RO water in a cavity slide for
1135 identification under 40× magnification with an Olympus BX30 microscope. Individuals identified as A.
1136 antarcticus were placed into a tube of RNAlater (ThermoFisher) for further analyses. Individuals (n =
1137 30–50) from each sampling area were mounted onto slides as voucher specimens and for later
1138 morphological analyses. For DNA extraction, tardigrades were removed from the RNAlater using an
1139 Irwin loop and placed individually into 0.5 mL centrifuge tubes in 10 µL of DNA- and RNA-free water
1140 (one individual per tube).
1141
40
1142
1143
1144 Figure 2.1: Areas sampled in this study for Acutuncus antarcticus (in red) and samples added from
1145 GenBank (in yellow). Major regions of Antarctica referred to in the text are also labelled in bold.
1146
1147 2.2.3. DNA extraction, amplification and sequencing
1148 Forty microlitres of a 5% Chelex 100 solution were added to each individual tardigrade tube to give
1149 50 µL in total. The tardigrades were then subjected to six freeze-thaw cycles (-80 to +99 °C) with a
41
1150 short vortex before each event and then boiled at 99 °C for 20 min. Samples were then centrifuged
1151 for 2 min before being stored at -20 °C until DNA amplification (Sands et al., 2008b).
1152 Two microlitres of the DNA extract were added to 19 µL of the master mix and the following
1153 primers for amplification of the COX1 gene region used: LCO_1490 (forward)
1154 (GGTCAACAAATCATAAAGATATTGG) and mtD9_2206 (reverse) (CCCGGTAAAATTAAAATATAAACTTC)
1155 (Sands et al., 2008b). If a low quantity of DNA was detected, then a nested PCR was used; following
1156 the initial amplification 2 µL of the product were added to 19 µl of master mix with the primer
1157 combination of LCO_1490 and HCO_2198 (TAAACTTCAGGGTGACCAAAAAATCA) (Sands et al.,
1158 2008b). This nested PCR was only required for one sample location (Sansom Island). If no DNA was
1159 detected after PCR then the samples were vortexed again and re-boiled at 99 °C for 10 min and the
1160 initial amplification was repeated. Products were sequenced commercially by Macrogen Ltd
1161 (Netherlands).
1162
1163 2.2.4. Sequence alignment and phylogenetic analyses
1164 Trace files of the sequences were imported to CodonCode Aligner ver. 5.1.5 (CodonCode Corp.,
1165 Dedham, MA), where they were base-called and quality assessed using the PHRED function in
1166 CodonCode Aligner (Ewing & Green 1998; Ewing et al., 1998). The forward and reverse sequence
1167 fragments for each individual were assembled to form a consensus contig for the COX1 region. Each
1168 contig was then checked by eye and any areas of low quality or of variability between the two
1169 sequences were checked for genuine variability or for base-calling errors. Any contigs which had a
1170 high variability between the two sequence fragments or had poor quality were discarded. Additional
1171 A. antarcticus sequences were retrieved from GenBank from the regions of the Sør Rondane
1172 Mountains and Victoria Land to ensure sampling across the greatest proportion possible of the
1173 recorded distribution range of this species (Fig. 2.1, Table 2.1). All sequences were then aligned,
1174 using an Antarctic Hypsibius sp. as an outgroup, using MUSCLE (Edgar, 2004) in CodonCode aligner.
42
1175 The alignment was checked by eye and any stop codons were removed. Full sequences will be
1176 deposited in GenBank.
1177 The generated alignment was analysed using both Maximum Likelihood and Bayesian
1178 methods under a GTR+G model of substitution using RAxML v7.2.8 (Stamatakis, 2006; Ott et al.,
1179 2007) and MrBayes ver. 3.2.6 (Ronquist et al., 2012), respectively. This model was chosen as the
1180 second best suggested model by the best-fit substitution model programme of MEGA 10 (Nei &
1181 Kumar, 2000; Kumar et al., 2018); the best-fit model (Tamura 3-parameter) was not used due to the
1182 limited amount of models available in RAxML v7.2.8. MrBayes was run for 5,000,000 generations in
1183 two chains, and convergence was tested in TRACER ver. 1.7.1 (Rambaut et al., 2018) before stopping
1184 the analysis. The respective trees from the two analyses were viewed in MEGA v. 10.0.5 (Kumar et
1185 al., 2018), where branches with bootstrap support < 50% or posterior probability < 0.8 were
1186 collapsed. Estimates of divergence between pairs of groups identified in the phylogenetic analyses
1187 were conducted using uncorrected p-distance and Maximum Likelihood GTR+G in MEGA v. 10.0.5
1188 (Tamura et al., 2004; Kumar et al., 2018).
1189
1190 2.2.5. Molecular clock analyses
1191 To give an estimate of divergence dates between the major clades identified in the A. antarcticus
1192 phylogeny a relaxed, log-normal, birth-death molecular clock approach was used in Phylobayes ver.
1193 3.3 (Lartillot & Philippe, 2004) using the species trees produced in the Maximum Likelihood and
1194 Bayesian analyses. The analysis used an auto-correlated CIR model (Lepage et al., 2007) with a birth-
1195 death prior and soft bounds. The outgroup used for this analysis was an Antarctic Hypsibius sp., and
1196 a minimum of 50 million years and a maximum of 60 million years was imposed on the root node
1197 based on the dated divergence within the Hypsibioidea super-family from the molecular clock
1198 analysis described in Chapter 1. Further internal calibrations were imposed, namely a minimum of 10
43
1199 million years and a maximum of 40 million years based on the the internal divergence within
1200 Acutuncus from the molecular clock analysis presented in Chapter 1.
1201
1202 2.2.6. Haplotype network analyses
1203 Haplotype networks were constructed using the TCS statistical parsimony algorithm in the TCS v.
1204 1.21 software (Templeton et al., 1992; Clement et al., 2000) using a 95% connection limit. Results
1205 were visualised using tcsBU (Santos et al., 2016).
1206 Descriptive statistics were produced using the programme DnaSP v. 6.12.03 (Rozas et al.,
1207 2017). Tajima’s D (Tajima, 1989) statistic was used to test whether the COX1 gene region was
1208 evolving randomly (neutral) or through a non-random process such as population expansion or
1209 contraction, and Fu’s Fs (Fu, 1997) statistic was used to assess the observed vs. the expected
1210 haplotype diversity for each geographic area.
1211
1212 2.3. Results
1213 2.3.1. Phylogenetic analysis
1214 Both Bayesian and Maximum Likelihood analyses produced a similar consensus tree (Fig. 2.2), with
1215 three well-supported clades in A. antarcticus. These three clades corresponded to the geographic
1216 regions of the Sør Rondane Mountains (a region within continental Antarctica, see Fig. 2.1, point A),
1217 the maritime Antarctic (Antarctic Peninsula and Scotia Arc) and the remainder of continental
1218 Antarctica (Fig. 2.2, points B-E).
1219 The Sør Rondane Mountains clade was extremely divergent from the continental Antarctic
1220 (20-36%) and the maritime Antarctic clades (19-34%) (Table 2.1). The maritime and continental
1221 Antarctic clades were also significantly divergent from each other (5%). The maritime Antarctic clade
44
1222 also included a small number of samples from the Crater Cirque area of Victoria Land (continental
1223 Antarctica) that were not significantly divergent (0.3%) (Fig. 2.2, point B, Table 2.1). However, they
1224 were very divergent from other Victoria Land samples (5%, Fig. 2.2, point D, Table 2.1) and the
1225 Crater Cirque samples were also very divergent from the continental Antarctic clade (5%, Fig. 2.2,
1226 point E, Table 2.1). The Victoria Land samples that were not from Crater Cirque were divergent from
1227 continental samples (1.2% Fig. 2.2, point D, Table 2.1) and from the maritime samples (5-6%).
1228
1229 2.3.2. Molecular dating
1230 The divergence between the Sør Rondane Mountains clade (Dronning Maud Land ACBR, East
1231 Antarctica) and the remaining A. antarcticus clades occurred approximately 47 My (HPD 56 - 37 My),
1232 with a large period of divergence of crown groups within the clade of between 20 - 5 My (Fig. 2.3).
1233 The divergence between the continental and maritime Antarctic clades, although still ancient, was
1234 more recent at approximately 4 My (HPD 6 – 2 My). Within the continental Antarctic clade further
1235 divergence occurred 6 – 2 My, while divergence within the maritime Antarctic clade took place 5 – 2
1236 My (Fig. 2.3).
1237
1238 2.3.3. Haplotype network analysis
1239 Our analyses identified 26 different haplotypes within the fully sampled range of A. antarcticus (Fig.
1240 2.4; Table 2.2). These haplotypes fell into the three major geographical groupings of continental
1241 Antarctica, maritime Antarctica, and the Sør Rondane Mountains. The continental Antarctic had the
1242 highest number of haplotypes present (18) while the Maritime Antarctic and the Sør Rondane
1243 Mountains had fewer; six and two respectively. Victoria Land had haplotypes that were found in
1244 both continental Antarctica and maritime Antarctica, but no haplotypes were shared between the
1245 latter two regions. The three regions identified within the haplotype network shared no connections
45
1246 and could be considered separate species (Fig. 2.4). The continental Antarctic region had a large and
1247 complex haplotype network compared with the maritime Antarctic and Sør Rondane Mountain
1248 regions.
1249 Tajima’s D and Fu’s F tests of neutrality for the three identified regions did not deviate from
1250 neutrality, while the sampled region as a whole was neutral under Tajima’s D test but was
1251 significantly positive under Fu’s F test (Fs = 2.11653, P < 0.01, Table 2.2).
1252
1253 Figure 2.2: Phylogenetic analysis of Acutuncus antarcticus COX1 sequences using a GTR+G model
1254 under both Maximum Likelihood (bootstrap value below branch) and Bayesian (posterior probability
1255 values above branch) analyses. The width of the clade corresponds to the number of individuals
1256 sampled, and each clade is labelled with the geographic region to which it corresponds. See Fig. S.2.1
1257 for the full tree.
46
1258
1259 Figure 2.3: Relaxed molecular clock produced from the consensus phylogenetic tree, using a birth-
1260 death prior and the CIR clock model. The split between the Sør Rondane Mountains and the rest of
1261 the Antarctic samples occurred between 56-37 million years ago, while that between the maritime
1262 and continental Antarctic occurred more recently, between 6-2 million years ago.
1263
1264 Table 2.1: Estimates of divergence between clades identified in the phylogenetic analyses conducted
1265 using uncorrected p-distance (above diagonal) and Maximum Likelihood GTR+G (below diagonal).
Sør Rondane, Dronning Maud Land A Maritime Antarctic B Crater Cirque, Victoria land C Victoria Land D Continental Antarctic E Outgroup Sør Rondane, Dronning Maud Land A 0.19402 0.19575 0.19847 0.19896 0.24375 Maritime Antarctic B 0.34357 0.00324 0.05152 0.04833 0.26764 Crater Cirque, Victoria land C 0.34811 0.00326 0.04851 0.04606 0.26758 Victoria Land D 0.35502 0.05683 0.05334 0.01223 0.26376 Continental Antarctic E 0.35859 0.05341 0.0508 0.01228 0.26492 1266 Outgroup 0.52891 0.65001 0.6482 0.61581 0.62588
1267
1268
47
1269
1270
1271
48
1272 Figure 2.4: Haplotype networks of the COX1 gene region of 300 individuals of A. antarcticus obtained
1273 from multiple locations in Antarctica. Circles represent haplotypes while circle size represents
1274 haplotype frequency. Area codes are as described in Tables S2.1 and S2.2, with red and pink shades
1275 representing continental Antarctica, line shading representing Victoria Land, black representing Sør
1276 Rondane Mountains and shades of green representing maritime Antarctica. Lines represent
1277 connections, with small open circles denoting missing haplotypes. An absence of connections
1278 between haplotype groups indicates that they are below the 95% connection limit.
1279
1280 Table 2.2: Descriptive statistics for the three main haplotype groups produced using dnaSP, including
1281 the number of individuals sampled (n), number of haplotypes present in each area (No. Haplotypes),
1282 haplotype diversity (HD), number of segregating sites (S), nucleotide diversity (π), Tajima’s D test (Dt)
1283 and Fu’s Fs (Fs) statistics of neutrality, and average number of nucleotide differences (K). Significant
1284 values are shown as ** P < 0.01.
1285
Region n No. HD S π Dt Fs K Haplotypes Continental 191 18 0.752 38 0.00923 -1.0946 -0.54817 4.41268 Antarctic
Maritime Antarctic 77 6 0.445 7 0.00143 -0.9071 -1.38627 0.896
Sør Rondane 37 2 0.405 3 0.00257 1.5392 1.28306 1.216 Mountains All samples 300 26 0.851 115 0.06445 1.62034 2.11653** 30.55
1286
1287
1288
49
1289 2.4. Discussion
1290
1291 2.4.1. Phylogeny and divergence events within Acutuncus antarcticus
1292 Phylogenetic analyses under both Bayesian and Maximum Likelihood models confirmed the
1293 presence of three distinct clades within the species currently referred to as A. antarcticus, present
1294 respectively in maritime Antarctica, continental Antarctica, and the Sør Rondane Mountains
1295 (Dronning Maud Land ACBR, continental Antarctic). A possible fourth Victoria Land clade was
1296 present within the broader continental Antarctic clade. COI divergences were over 5% between the
1297 continental Antarctic and maritime Antarctic clades, and over 20% between these and the Sør
1298 Rondane Mountains. The possible fourth Victoria land clade was divergent from the continental
1299 Antarctic clade by 1.2% and from the maritime Antarctic clade by 5%. While a relatively small
1300 divergence, this could be indicative of the separation of a fourth A. antarcticus species. Although the
1301 Sør Rondane Mountains lie within the larger region of continental Antarctica, the continental
1302 Antarctic clade did not occur in this region. These results support the presence of at least three
1303 previously unrecognised species with distinct regional distributions within the A. antarcticus group in
1304 Antarctica.
1305 Czechowski et al. (2012) also noted the high genetic distinctness in the molecular
1306 operational taxonomic units (MOTUs) of putative Acutuncus specimens from the Sør Rondane
1307 region. The level of differentiation supports the hypothesis that this area has been biologically
1308 isolated for a considerable period, even in comparison with the other continental and maritime
1309 Antarctic regions considered here. These lineages are distinct between the biological regions of the
1310 maritime Antarctic and the continental Antarctic (Fig. 2.1), matching findings reported in other
1311 Antarctic terrestrial invertebrate groups such as springtails, mites and nematodes (Chown & Convey,
1312 2007; Convey et al., 2008; Convey & Stevens, 2007). The molecular clock analysis placed the origin
1313 of the Sør Rondane Mountains clade 56-37 My, during the earliest stages of the isolation of
50
1314 Antarctica and well before the continent started to experience glaciated conditions (Convey et al.,
1315 2018). The divergence between the continental Antarctic and maritime Antarctic clades occurred 6–
1316 2 My, coinciding with the Pliocene warm period, allowing for possible colonisation events before a
1317 further cooling period presented a strong biogeographic barrier and subsequent isolation. This has
1318 also been seen in Collembola, with geographic regions showing genetically distinct populations with
1319 previous dispersal events and connectivity between areas occuring during the Pliocene warm period
1320 (Collins et al., 2020). The clear phylogeographic patterns identified in this study support the
1321 hypothesis that this species group has ancient origins within what is now Antarctica, pre-dating the
1322 breakup of Gondwana.
1323
1324 2.4.2. Acutuncus antarcticus populations within Antarctica and possible refugia
1325 Based on lake sediment studies, A. antarcticus has a confirmed continuous presence within
1326 Antarctica of at least 40,000 years, pre-dating the LGM (Gibson et al., 2007; Cromer et al., 2008). As
1327 described above, our molecular clock analyses extend this period considerably, to tens of millions of
1328 years. Our study has shown the sampled areas contributing to the continental Antarctic clade to
1329 have the highest genetic diversity. The Victoria Land region of continental Antarctica is already
1330 suggested as a possible refuge area on Pleistocene to Miocene timescales during isolation and
1331 glaciation events (Stevens et al., 2007; Cesari et al., 2016) and there are indications of refugia in
1332 other areas of continental Antarctica, in particular the coastal ice-free areas around the Larsemann
1333 Hills (sampled in this study), especially the freshwater lakes which show long-term survival of
1334 freshwater invertebrates, and in Dronning Maud Land (Gibson & Bayly, 2007; Cromer et al., 2008;
1335 Pugh & Convey 2008; Czechowski et al., 2012).
1336 Tajima’s D and Fu’s Fs tests showed that none of the three haplotype networks identified in
1337 this study deviated from neutrality. However, when the entire dataset was tested the outcome was
1338 significantly positive for Fu’s F test, consistent with the presence of separate species. With each of
51
1339 the identified geographic areas showing no difference from neutrality, but combined showing a
1340 significantly positive result, this supports the phylogenetic analysis of distinct species separated by
1341 geographic area.
1342 While no haplotypes were shared between the three identified regions, indicating strong
1343 biogeographic patterning, samples from the Crater Cirque area of Victoria Land were more closely
1344 related to, and shared haplotypes with, individuals sampled in the maritime Antarctic and not with
1345 the other Victoria Land samples that formed part of the continental Antarctic clade. The presence of
1346 a distinct Crater Cirque haplotype not connected to any other Victoria Land haplotypes was also
1347 noted by Cesari et al. (2016), but at that point it was not known whether this haplotype was found
1348 elsewhere in Antarctica. The occurrence of long-range dispersal of tardigrades in Antarctica is
1349 currently undocumented, although tardigrades and their tuns are generally known to have well-
1350 developed cryptobiotic abilities (Guidetti et al., 2011). It is hypothesised that avian or wind dispersal
1351 could be major transport vectors (Nkem et al., 2006; Cesari et al., 2016). Zaccara et al. (2020)
1352 hypothesised the dispersal of the moss species Bryum argenteum during Pliocene warming events in
1353 Antarctica between the Antarctic Peninsula and Victoria Land. If so, this could also have been a
1354 dispersal route for tardigrades linking the Maritime Antarctic with Victoria Land.
1355
1356
1357
1358
1359
1360
1361
52
1362 Chapter Three
1363 Increased geographic sampling of the Antarctic eutardigrade Mesobiotus furciger
1364 (Macrobiotoidea) identifies large molecular divergences between multiple Antarctic lineages and
1365 indicates an Antarctic-specific species complex
1366
1367 Abstract
1368 Antarctica has been isolated and glaciated for about 30 million years, with only approximately 0.3%
1369 of its area ice-free and capable of supporting terrestrial ecosystems. As a result, invertebrate
1370 populations have become isolated and fragmented, in some cases leading to speciation. Terrestrial
1371 species currently found in Antarctica often show Gondwanan heritage, with little evidence of recent
1372 colonisation. Mesobiotus furciger (Tardigrada: Eutardigrada: Macrobiotoidea) is a member of a
1373 globally common genus, and M. furciger represents a species group with reports assigned to this
1374 species from both the Arctic and the Antarctic. This species has been thought, therefore, to be a
1375 more recent coloniser of Antarctica. However, recent studies have shown distinct lineages within
1376 what has been regarded as M. furciger, indicating that this is not a globally widespread species. To
1377 clarify the status of Antarctic representatives, 18S and COX1 gene regions were sampled from
1378 multiple regions of Antarctica (sub-, maritime and continental) and analysed under both Bayesian
1379 and Maximum Likelihood methods. Results indicate that M. furciger is an Antarctic-specific group,
1380 with three further genetically distinct geographic sub-groups within this, comprising a maritime, a
1381 continental and an M. polaris/M. hilariae sub-group. All these sub-groups show large genetic
1382 differences of up to 27.5% in COX1 and 4% in 18S gene regions. Haplotype analyses identified 32
1383 distinct haplotypes with few being shared between regions. These results suggest that Antarctic M.
1384 furciger should be considered a species complex.
1385
53
1386 3.1. Introduction
1387 Mesobiotus furciger (Murray, 1906) is a limno-terrestrial eutardigrade, from a globally widespread
1388 genus, which is well represented within Antarctica. Studies examining Antarctic representatives have
1389 indicated the possibility for divergence and of M. furciger representing a species complex (Dastych,
1390 1984; Binda et al., 2005; Sands et al., 2008a; Czechowski et al., 2012; Vecchi et al., 2016). This was
1391 particularly noted by Czechowski et al. (2012), in which study molecular operational taxonomic units
1392 (MOTUs) of a putative Macrobiotus (now Mesobiotus) were found to form distinct lineages between
1393 isolated nunataks in the Dronning Maud Land area of continental Antarctica, and long term isolation
1394 and survival of these taxa within Antarctica was inferred.
1395 Mesobiotus furciger is a member of a genus that was erected as part of the Macrobiotoidea
1396 super-family by Vecchi et al. (2016). This study noted that all species of Mesobiotus found within
1397 continental Antarctica belonged to the Mesobiotus harmsworthi group, with maritime Antarctic
1398 individuals belonging to M. furciger. However, the data presented in Chapter 1 indicate that all
1399 Antarctic Mesobiotus species are placed in a distinct lineage separate from non-Antarctic
1400 representatives of M. harmsworthi, and should not be classified as part of the latter group. This
1401 study also found further lineages within Antarctic Mesobiotus, particularly an M. furciger lineage and
1402 an M. polaris/hilariae lineage. Mesobiotus furciger as currently recorded was also shown to be
1403 polyphyletic, with evidence for long-term survival within Antarctica.
1404 Antarctica has been permanently isolated and glaciated for at least 30 million years. While
1405 only 0.3% of the land surface is ice-free and suitable for biological life, these areas are also small,
1406 fragmented, and isolated from each other (Convey & Stevens, 2007; Convey et al., 2008). This
1407 isolation and long-term persistence leads to speciation and creates the high endemism seen in
1408 multiple invertebrate groups present in Antarctica, including mites, springtails and nematodes
1409 (Convey & Stevens, 2007; Convey et al., 2008). These lineages have also been shown to have ancient
1410 origins on the continent with no or little evidence for recent colonisation (Convey & Stevens, 2007).
54
1411 The current study analysed two gene regions (18S and COX1) for M. furciger-like individuals
1412 obtained from multiple areas of Antarctica to investigate the colonisation history of this species
1413 within Antarctica. If M. furciger is globally widespread, then the hypothesis would predict little
1414 genetic differentiation between non-Antarctic and Antarctic individuals as well as little intra-
1415 Antarctic differentiation. However, if the M. furciger group has ancient, isolated origins within
1416 Antarctica then there will be greater differentiation and high endemism. The second part of this
1417 study investigated whether there were consistent differences between continental and maritime
1418 Antarctic representatives of M. furciger type material.
1419
1420 3.2. Methods
1421 3.2.1. Collection of Material
1422 Fresh collections of moss were sampled from multiple locations in the maritime Antarctic during the
1423 period 30th November 2018 to 28th February 2019 (Fig. 3.1). Moss samples of approximately 10 g
1424 (dry mass) were carefully removed using a small trowel, which was cleaned between sampling to
1425 prevent cross-contamination. Each sample of moss was air dried before being placed in an individual
1426 paper herbarium bag and sealed inside a plastic box for transport to the British Antarctic Survey,
1427 Cambridge, UK under all required quarantine protocols. Collections of moss from continental
1428 Antarctica were sampled from the -20oC storage collection of the South Australian Museum,
1429 Adelaide, South Australia (Fig. 3.1). These samples were processed in situ as required by South
1430 Australian quarantine protocols and individual tardigrades were stored in RNAlater (ThermoFisher)
1431 for transport to the British Antarctic Survey, Cambridge, UK. Velasco-Castrillón et al. (2014) provide
1432 further information on the collection of this material. Further sequence data were added from
1433 material collected in the Dronning Maud Land area (Czechowski et al., 2012) and from GenBank (Fig.
1434 3.1).
55
1435
1436 Figure 3.1: Sampling locations for Mesobiotus furciger; points in red represent collections analysed
1437 as part of this study and points in yellow represent sequences obtained from GenBank or the
1438 literature (Czechowski et al., 2012).
1439
1440 3.2.2. Extraction and identification of tardigrades
1441 The technique used for extracting individuals from the material was a density gradient, flotation
1442 technique modified from Sands et al. (2008b). Samples of material were re-hydrated in reverse
56
1443 osmosis (RO) water for 24 h at room temperature before being lightly homogenised by hand in a
1444 small beaker. A 1 mL layer of pure OptiPrepTM (SigmaAldrich) density gradient medium was added to
1445 a standard test tube with a 2 mL layer of a 50/50 OptiPrepTM and RO solution added to the top to
1446 create a double layer. The test tube was then filled to the top with the homogenised material to
1447 form a third layer. The tubes were then centrifuged on full power (110 × g) for 1 min. The top layer
1448 was then carefully removed and passed through a 32 µm sieve, which was then rinsed into a Petri
1449 dish. The dish was analysed under a Wild M5 dissection microscope and, if individual tardigrades or
1450 eggs were present, they were removed using an Irwin loop. Each individual collected was then
1451 placed into a drop of RO water in a cavity slide for identification under 40× magnification with an
1452 Olympus BX30 microscope. If they were identified as being of M. furciger type, they were placed
1453 individually into 0.5 mL micro-centrifuge tubes containing 10 µL of RNA/DNA free water for
1454 molecular analyses. Specimens were also mounted onto slides for further morphological analysis.
1455
1456 3.2.3. DNA extraction, amplification and sequencing
1457 DNA extraction protocols followed those of Sands et al. (2008b) and of Chapter 2 and involved
1458 adding 40 µL of 5% Chelex 100 solution to each individual tardigrade tube (50 µL total). Each tube
1459 was subjected to six freeze thaw cycles using dry ice for freezing and a heating block set at 99oC for
1460 the thaw with a short vortex after each cycle. After the cycles were complete the tubes were boiled
1461 at 99oC for 20 min, then vortexed again and then centrifuged for 2 min at 110 × g. Samples were
1462 stored at -20oC until DNA amplification.
1463 Two microlitres of the DNA extraction were added to 19 µL of the master mix (see Sands et
1464 al. 2008b for details) and the following primers for amplification of the COX1 gene region used:
1465 LCO_1490 (forward) (GGTCAACAAATCATAAAGATATTGG) (Folmer et al., 1994) and HCOoutout
1466 (reverse) (GTAAATATATGRTGDGCTC) (Prendini et al., 2005), and amplified using the protocol
1467 described in Sands et al. (2008b). For amplification of the 18S gene region the same procedure was
57
1468 used with the following primers: 18S_Tar_Ff1 (forward) (AGGCGAAACCGCGAATGGCTC) (Stec et al.,
1469 2017) and 18S_Tar_Rr2 (reverse) (CTGATCGCCTTCGAACCTCTAACTTTCG) (Gąsiorek et al., 2017) and
1470 amplified using the first 18S amplification protocol described in Sands et al. (2008b). Products were
1471 sequenced commercially by Macrogen Ltd (Netherlands).
1472
1473 3.2.4. Sequence alignment and phylogenetic analysis
1474 Trace files of both the 18S and COX1 sequences were imported to CodonCode Aligner ver. 5.1.5
1475 (CodonCode Corp., Dedham, MA), where they were base-called and quality assessed using the
1476 PHRED function in CodonCode Aligner (Ewing & Green, 1998; Ewing et al., 1998). The forward and
1477 reverse fragments of each sequence for each individual were paired using the Advanced Assembly
1478 function of CodonCode Aligner to form a consensus contig for each gene region. Every contig was
1479 then checked by eye and any areas of low quality or of variability between the two sequences were
1480 checked for genuine variability or for base-calling errors.
1481 Both 18S and COX1 sequences were aligned using MUSCLE (Edgar, 2004) in CodonCode
1482 aligner with outgroups for COX1 consisting of an Antarctic Dactylobiotus sp., Acutuncus antarcticus
1483 individuals from maritime and continental Antarctica, and Antarctic members of the Macrobiotus
1484 hufelandi group. Sequences of non-Antarctic Mesobiotus species were also added from GenBank.
1485 For 18S, additional outgroups from Apochela (Milnesium tardigradum), Hypsibiidae and
1486 Macrobiotidae were also added to help elucidate the position of M. furciger (Tables S3.1- S3.6). Full
1487 new sequences from this study will be deposited in GenBank.
1488 Phylogenetic analyses of the 18S and COX1 gene regions were performed using Maximum
1489 Likelihood and Bayesian methods under a GTR+G model of substitution using RAxML v7.2.8
1490 (Stamatakis, 2006; Ott et al., 2007) and MrBayes ver. 3.2.6 (Ronquist et al., 2012), respectively.
1491 GTR+G was the best suggested model for 18S in the best-fit substitution model programme in MEGA
58
1492 10, for COX1 it was the second-best suggested model (the best being the Tamura 3-parameter) but
1493 was selected due to the limited number of models available in RAxML (Nei and Kumar, 2000; Kumar
1494 et al., 2018). RAxML was run for 500 generations and MrBayes was run for 10,000,000 generations in
1495 four chains. Convergence for both models was tested in TRACER ver. 1.7.1 (Rambaut et al., 2018).
1496 The respective trees from the two analyses were viewed in MEGA v. 10.0.5 (Kumar et al., 2018),
1497 where branches with bootstrap support of less than 50% or posterior probability of less than 0.8
1498 were collapsed. Estimates of molecular divergence between clades identified by the phylogenetic
1499 analyses were conducted using uncorrected p-distance and the Maximum Likelihood GTR+G in
1500 MEGA v. 10.0.5 (Tamura et al., 2004; Kumar et al., 2018).
1501
1502 3.2.5. Haplotype network analysis
1503 The TCS statistical parsimony algorithm in TCS ver. 1.21 software (Templeton et al., 1992; Clement et
1504 al., 2000) was used to calculate the haplotype networks for the COX1 gene region for the Antarctic
1505 M. furciger individuals using a 95% connection limit. Results were visualised using tcsBU (Santos et
1506 al., 2016).
1507 DnaSP ver. 6.12.03 (Rozas et al., 2017) was used to calculate Tajima’s D (Tajima, 1989) and
1508 Fu’s Fs (Fu, 1996) statistics to assess neutrality of the COX1 gene region and to test the observed vs.
1509 the expected haplotype diversity.
1510
1511 3.3. Results
1512 3.3.1. Phylogenetic analyses
1513 Phylogenies created under both Maximum Likelihood and Bayesian analyses did not differ for each
1514 of the gene regions analysed. Mesobiotus furciger individuals sampled from Antarctica formed a
1515 group distinct from the globally distributed M. harmsworthi groups in both 18S and COX1 datasets,
59
1516 with high levels of sequence divergence (COX1- ~22-41%, 18S- ~4.5-7%) (Fig. 3.2, point D, Tables 3.1,
1517 3.2).
1518 Within the Antarctic M. furciger group there were three main sub-groups defined by
1519 geographic area, a maritime Antarctic group, a continental Antarctic group and an M. polaris/M.
1520 hilariae group (from Dronning Maud Land and Victoria Land areas of continental Antarctica and one
1521 sample from South Georgia). These three groups were strongly divergent with COX1 divergences of
1522 19.9-39.6% and 18S divergences of 3-4% (Fig. 3.2, points A, B and C, Tables 3.1, 3.2).
1523 Data from Alexander Island were only available for the COX1 gene region, but this location
1524 was strongly divergent from the other maritime Antarctic samples (22-36.9%; Fig. 3.2, Table 3.2).
1525 This location was also strongly divergent from both the continental Antarctic (19.9-31.3%) and the
1526 M. polaris/M. hilariae (21-34.3%) clades.
1527 The two tested gene regions showed the same topology within the M. furciger group across
1528 the three geographic regions. In the 18S tree the M. polaris/M. hilariae clade had a well-supported
1529 sister relationship to both the continental and maritime Antarctic clades, with the latter two also
1530 having a strong sister relationship. The M. harmsworthi clade had a well-supported sister
1531 relationship to these three clades (Fig. 3.2). In the COX1 tree, although the same groupings were
1532 identified as for 18S, the relationships between the maritime Antarctic, continental Antarctic,
1533 Alexander Island and M. polaris/M. hilariae clades were not well resolved. The Mesobiotus
1534 harmsworthi group was again a well-supported sister group. Interestingly, and analogous to the
1535 observations in A. antarcticus (Chapter 2), samples from the Crater Cirque area of Victoria Land
1536 (continental Antarctica) grouped with maritime Antarctic samples rather then with the other
1537 continental Antarctic material (Fig. S3.2). The full phylogenies can be found in the supplementary
1538 material (Figs. S3.1, S3.2).
60
1539
1540 Figure 3.2: Phylogenetic tree of the 18S (left) and COX1 (right) gene regions created under Maximum Likelihood and Bayesian methods using GTR+GAMMA
1541 models. Numbers above the nodes are the Bayesian probability support, while beneath are the Maximum Likelihood bootstrap values. All major clades
1542 referred to in the text are highlighted on the figure. See Figs. S3.1-3.2 in the supplementary material for the full gene trees.
1543
1544
1545
61
1546
1547 Table 3.1: Estimates of divergence between clades identified in the phylogenetic analyses conducted using uncorrected p-distance (above diagonal) and the
1548 Maximum Likelihood GTR+G (below diagonal) for 18S.
Maritime Antarctic D Prince Charles Mountains C Mesobiotus polaris/hilariae B Mesobiotus harmsworthi group A Outgroup Maritime Antarctic D 0.0297 0.0384 0.0654 0.0725 Prince Charles Mountains C 0.0322 0.031 0.05152 0.0715 Mesobiotus polaris/hilariae B 0.0415 0.0329 0.0459 0.0624 Mesobiotus harmsworthi group A 0.0734 0.0640 0.0495 0.078 1549 Outgroup 0.0837 0.0817 0.0700 0.0897
1550
1551 Table 3.2: Estimates of divergence between clades identified in the phylogenetic analyses conducted using uncorrected p-distance (above diagonal) and the
1552 Maximum Likelihood GTR+G (below diagonal) for COX1.
Maritime Antarctic D Prince Charles Mountains C Alexander Island Mesobiotus polaris/hilariae B Mesobiotus harmsworthi group A Outgroup Maritime Antarctic D 0.215 0.221 0.229 0.236 0.26 Prince Charles Mountains C 0.347 0.199 0.222 0.221 0.253 Alexander Island 0.369 0.313 0.211 0.223 0.266 Mesobiotus polaris/hilariae B 0.396 0.377 0.343 0.235 0.268 Mesobiotus harmsworthi group A 0.412 0.373 0.378 0.416 0.26 1553 Outgroup 0.503 0.490 0.543 0.532 0.514
1554
62
1555 3.3.2. Haplotype analysis
1556 Haplotype analysis identified 32 distinct haplotypes present in the sampled individuals. While there were
1557 some connecting haplotypes, particularly from the Sør Rondane Mountains and the Prince Charles
1558 Mountains areas, most haplotypes fell below the 95% connection limit (Fig. 3.3). No haplotypes were shared
1559 between geographical regions. The Dronning Maud Land area of continental Antarctica had the highest
1560 number of haplotypes present (16), while the Prince Charles Mountains had the lowest number (7) (Table
1561 3.3).
1562 The Tajima’s D and Fu’s F tests of neutrality for the identified geographic regions did not deviate
1563 from neutrality, except for the maritime Antarctic region which was significantly negative for Tajima’s D test
1564 (Dt = -2.00751, P < 0.05) but was not significant for Fu’s F test (Table 3.3).
1565
1566
1567 Figure 3.3: Haplotype network of the COX1 gene region of 66 individuals from the M. furciger group from
1568 multiple locations in Antarctica. Circles represent haplotypes while circle size represents haplotype
1569 frequency. Area codes are as described in Tables S3.1 and S3.2, with red and orange shades representing the
1570 maritime and sub-Antarctic, green the Sør Rondane Mountains and Dronning Maud Land, and shades of blue
63
1571 representing the Prince Charles Mountains. Lines represent connections, with small white circles denoting
1572 missing haplotypes. An absence of connections between haplotype groups indicates that they fall below the
1573 95% connection limit.
1574
1575 Table 3.3: Descriptive statistics for the three main geographic groups identified using dnaSP, including the
1576 number of individuals sampled (n), number of haplotypes present in each area (No. Haplotypes), haplotype
1577 diversity (HD), number of segregating sites (S), nucleotide diversity (π), Tajima’s D test (Dt) and Fu’s Fs (Fs)
1578 statistics of neutrality, and average number of nucleotide differences (K). Significant
1579 values are shown as * P < 0.05.
Region n No. Haplotypes HD S Pi Dt Fs K
Sub- and Maritime
Antarctic 16 10 0.917 168 0.08413 -1.8317* -2.0075 40.55
Prince Charles Mountains 10 7 0.867 30 0.01829 0.0583 -0.0085 10.7333
Dronning Maud Land 40 16 0.944 428 0.16751 -1.4531 -2.2876 84.0888
Pan-Antarctic 66 32 0.972 364 0.21457 -1.0678 -2.0633 86.6871
1580
1581
1582 3.4. Discussion
1583 3.4.1. Mesobiotus furciger as an Antarctic-specific group
1584 The primary aim of this study was to investigate whether M. furciger is a recent coloniser of Antarctica, with
1585 a wide global distribution. Analysing both 18S and COX1 gene regions under Maximum Likelihood and
1586 Bayesian methods showed that M. furciger is Antarctic-specific and distinct from the globally distributed M.
1587 harmsworthi. Vecchi et al. (2016) similarly noted specific Antarctic M. furciger lineages that were distinct
64
1588 from M. harmsworthi. However, Vecchi et al. (2016) also suggested that all continental Antarctic members
1589 probably belonged to the M. harmsworthi group rather than the M. furciger group. The current study found
1590 that the lineages within the M. furciger group, which included all continental Antarctic samples, while having
1591 a sister relationship to the M. harmsworthi group, were strongly genetically distinct from the latter (4.5-7%
1592 (18S); 26.5-28.5% (COX1)). This result suggests that, although related to the globally widespread M.
1593 harmsworthi group, all individuals in the M. furciger group are Antarctic-specific.
1594 Kaczmarek et al. (2020) also considered that M. furciger was probably an Antarctic-specific lineage,
1595 with any reports from elsewhere likely being miss-identifications. They did note that, based on
1596 morphological characters alone, the two species groups were not distinct. The results presented here also
1597 confirm M. furciger as being a member of Mesobiotus, and sister to the M. harmsworthi group. Combining
1598 the large molecular divergences found within this study and previous results from other studies (Binda et al.,
1599 2005; Vecchi et al., 2016; Kaczmarek et al., 2020; Chapter 1), M. furciger is consistently distinct from M.
1600 harmsworthi.
1601
1602 3.4.2. Biogeographic structure within Antarctic Mesobiotus furciger
1603 The second aim of this study was to investigate the biogeographic patterns of M. furciger (defined as a
1604 distinct Antarctic-specific species) within Antarctica. Analyses of both the 18S and COX1 gene regions
1605 showed that Antarctic M. furciger are further divided into three distinct clades dependent on geographic
1606 region. These clades represent material/sequences obtained respectively from the maritime Antarctic, the
1607 Prince Charles Mountains region, and the Dronning Maud Land and Victoria Land regions of continental
1608 Antarctica (currently described as M. polaris/M. hilariae). These clades were also highly divergent (3-4%
1609 (18S); 21.5-27.5% (COX1)). Such levels of divergence suggest that each of these clades represents a separate
1610 species. The identification of distinct maritime Antarctic and M. polaris/M. hilariae clades supports the
1611 conclusions of Vecchi et al. (2016), and also the data presented in Chapter 1, which also found these two
1612 clades to be distinct. The current study includes the widest range of samples yet achieved in Antarctica. This
65
1613 has allowed identification of more distinct geographic groups within M. furciger. Further expanding the
1614 range of sample locations is likely to lead to identification of more region-specific groups. Geographical
1615 differences between the continental and maritime Antarctic have already been found in multiple
1616 invertebrate groups (mites, springtails and nematodes), and data of the current study further support the
1617 long term geographic separation between these two biogeographic regions of Antarctica (Pugh, 1993;
1618 Andrassy, 1998; Chown & Convey 2007; McGaughran et al., 2011; Convey, 2017; Carapelli et al., 2020).
1619 Haplotype analysis of the three M. furciger clades identified had no overlaps, with no inter-clade
1620 connections and relatively few intra-clade connections above the 95% confidence limit (Fig. 3.3). This
1621 indicates that there has been no gene flow between the regions in which they occur and that each clade is
1622 endemic to its respective region. Binda et al. (2005) concluded that M. furciger was widespread in Antarctica
1623 and sub-Antarctic areas, though admitted that some records might refer to different species. However, the
1624 data presented in the current study lead to the conclusion that the species currently referred to as M.
1625 furciger in Antarctica forms at least three geographically and evolutionarily distinct species. The descriptive
1626 statistic results for each geographic area do not significantly differ from neutrality except for the sub- and
1627 maritime Antarctic clade, which had a significantly negative result for Tajima’s D test (Dt = -1.8317, P < 0.05).
1628 This result suggests that the sub-Antarctic and maritime Antarctic regions contain different species, which is
1629 supported by the South Georgia individual being part of the M. polaris/M. hilariae clade.
1630 This study highlights the lack of tardigrade dispersal over large distances. However, data from the
1631 Crater Cirque area of Victoria Land and the maritime Antarctic indicate that sporadic dispersal events can
1632 happen. The link between these two areas specifically has been also shown in A. antarcticus, and more
1633 generally between Victoria Land and the Antarctic Peninsula in the moss species Bryum argenteum, with the
1634 latter study hypothesising that warming events during the Pliocene allowed dispersal along the coast or
1635 through the Transantarctic Mountains between these two regions (Zaccara et al., 2020; Chapter 2). Further
1636 analyses of tardigrades and other terrestrial fauna from these areas would help to further understand the
1637 link between these areas.
66
1638 The data and analyses presented in this chapter support the conclusion that M. furciger is a relictual
1639 Antarctic species, as postulated in Chapter 1. Molecular clock analyses indicate that the Antarctic-specific M.
1640 furciger clade diverged from its sister clade (M. harmsworthi) approximately 37 million years ago, broadly
1641 coincident with the breaking of the link between South America and the Antarctic Peninsula and the opening
1642 of the Tasman gateway (Convey et al., 2008).
1643
1644
1645
1646
1647
1648
1649
1650
1651
1652
1653
1654
1655
1656
1657
1658
67
1659 Chapter Four
1660 Morphological variation between geographic areas of Antarctica and in different habitats for two
1661 Eutardigrada species, Acutuncus antarcticus and Mesobiotus furciger
1662
1663 Abstract
1664 In tardigrade morphological studies there are a set of specific and commonly used characters that are
1665 particularly important in species identification. These are the buccal apparatus, apophysis for the insertion of
1666 the style muscles, pharynx and claws. It is well known that these characters differ between tardigrade
1667 species that have different modes of feeding (i.e. carnivorous or herbivorous) and between species,
1668 however, little is known of any intraspecific variations between different habitats and geographical areas.
1669 Antarctica has been isolated and at least partially glaciated for the last ~35 million years. The main body of
1670 the continent (East Antarctica) has a distinct geological history to that of West Antarctica and the Antarctic
1671 Peninsula, and terrestrial invertebrate communities are generally distinct at species level between these two
1672 regions. This has been particularly noted in groups including mites, nematodes and springtails, but has been
1673 little investigated in tardigrades. The current study assessed multiple morphological characters from
1674 individuals originating from multiple locations in different regions of Antarctica of the two eutardigrade
1675 species groups Mesobiotus furciger s. lat. and Acutuncus antarcticus s. lat. The primary aim of the study was
1676 to assess whether any morphological variation identified was consistent with the clear molecular
1677 evolutionary divergences reported in previous chapters between different geographic regions of Antarctica
1678 within these two species groups. As a secondary aim we assessed whether there was any evidence for
1679 phenotypic plasticity, through morphology being consistently impacted by habitat type. Principal component
1680 analyses and generalised linear models identified significant differences between maritime and continental
1681 Antarctic regions in each of the studied groups, particularly in body length and buccal tube length. Evidence
1682 for phenotypic plasticity was also present, with habitat being a significant factor in the morphological
1683 variation observed in A. antarcticus, particularly in the stylet support insertion point, buccal tube widths and
68
1684 claw dimensions. The former differences are consistent with the clear molecular divergences reported
1685 previously in material originating from the maritime and continental Antarctic regions. The identification of
1686 phenotypic plasticity in morphology in response to habitat highlights that care is required when analysing
1687 tardigrade specimens obtained from different habitats and basing identification on morphology alone.
1688
1689 4.1. Introduction
1690
1691 In tardigrade morphology, characteristics are commonly expressed as a ratio in comparison to the buccal
1692 tube length known as the pt ratio (Pilato, 1981), which allows samples of multiple body sizes to be
1693 compared. Of particular importance as defining characteristics are the buccal apparatus, stylet muscles
1694 (shape and insertion point), pharynx (particularly number and shape of placoids) and claws (formation and
1695 structure) (Pilato & Binda 2010; Marley et al., 2011; Czechowski et al., 2012). These characteristics are
1696 mainly used as species delimiters (Guidetti et al., 2012), although such morphological assessment can be
1697 difficult due to the small size of tardigrades and the subtlety of their morphological characteristics (Marley et
1698 al., 2011). Differences in development of the buccal apparatus are clear in comparisons between carnivorous
1699 and herbivorous tardigrade species (Guidetti et al., 2012), but to our knowledge no studies have assessed
1700 whether intra-specific variation exists between individuals from different areas and inhabiting different
1701 habitat types (e.g. moss, algae and soil).
1702 Acutuncus antarcticus (Richters, 1904) has until now been considered a pan-Antarctic species, and
1703 the most widespread and abundant tardigrade in Antarctica (Cesari et al., 2016, Velasco-Castrillón et al.,
1704 2014; Tsujimoto et al., 2015). It is found in a range of Antarctic ecosystems, including freshwater, soil, moss,
1705 algae and lichens, where it is often the dominant species (McInnes, 1995; Tsujimoto et al., 2014; Cesari et
1706 al., 2016). The species is recorded from all areas of the continental Antarctic, the maritime Antarctic
1707 (Antarctic Peninsula and the Scotia Arc archipelagos of the South Sandwich, South Orkney and South
69
1708 Shetland Islands), and the sub-Antarctic island of South-Georgia (Czechowski et al., 2012; Cesari et al., 2016).
1709 Czechowski et al. (2012) presented evidence consistent with cryptic speciation within A. antarcticus, and
1710 Cesari et al. (2016), using the COX1 gene, also suggested that speciation could be occurring, with further
1711 strong support for speciation provided in earlier chapters of this thesis.
1712 Mesobiotus furciger (Murray 1906) is a eutardigrade within the super-family Macrobiotoidea.
1713 Previously considered a member of the genus Macrobiotus, it was transferred to the newly-erected genus
1714 Mesobiotus by Vecchi et al. (2016). It is morphologically distinct from other members of Macrobiotoidea due
1715 to its extremely large accessary points on the primary claws, often nearly as long as the claw itself, in a Y-
1716 type formation (2112), and the morphology of the egg processes, which are usually hemispherical or conical
1717 with bifurcated pointed tips (Murray 1906, 1907; Vecchi et al., 2016, Kaczmarek et al., 2020). Mesobiotus
1718 furciger was until recently considered a globally widespread species which is well represented within
1719 Antarctica (Binda et al., 2005). However, multiple studies have reported high levels of morphological
1720 variation between Antarctic and non-Antarctic individuals, indicating the possibility of unrecognised
1721 speciation (Murray 1906, 1907; Dastych, 1984, 1989; Binda et al., 2005; Vecchi et al., 2016). Czechowski et
1722 al. (2012) reported clear genetic differences between populations found on isolated nunataks in the Sør
1723 Rondane Mountain region of continental Antarctica. The data presented in Chapters 1 and 3 of this thesis
1724 confirmed deep molecular divergences between material obtained from different geographic regions of
1725 Antarctica. However, due to older, uncorrected literature, M. furciger remains an apparently globally
1726 occurring species. The detailed molecular analyses presented in Chapters 1-3 demonstrate that the
1727 tardigrades currently described as A. antarcticus and M. furciger have more complex evolutionary histories
1728 in Antarctica than previously thought.
1729 The work described in this chapter compared detailed morphometric measurements of specimens of
1730 both tardigrade species obtained from multiple locations across Antarctica, in order to assess whether
1731 morphological analyses would support the deep molecular divergences now identified between Antarctic
1732 regions within both taxa. Morphological characteristics were also assessed in the context of two different
70
1733 habitats from which the material examined was collected, in order identify whether morphological features
1734 showed any consistent variation between these habitats.
1735
1736 4.2. Methods
1737
1738 4.2.1. Collection of material
1739 Material of Acutuncus antarcticus and Mesobiotus furciger was obtained from a total of 27 and 14 locations
1740 across maritime and continental Antarctica, respectively (Figs. 4.1, 4.2). Habitat information from which the
1741 individuals were isolated from was also collated, these being moss or algae for A. antarcticus, and moss or
1742 soil for M. furciger (Tables S4.1, S4.2). Fresh substrate material was collected from the maritime Antarctic
1743 during the austral summer season of 2018/19, and air dried before transport to the British Antarctic Survey
1744 (BAS), Cambridge, UK. Further maritime Antarctic substrate samples were sourced from stored frozen
1745 material held at BAS. Continental Antarctic samples were sourced from the frozen storage collection of the
1746 South Australia Museum, Adelaide, Australia (see Velasco-Castrillón et al. (2014) for collection details).
1747 Substrate types available from each region included moss, algae and soil.
1748 The most commonly used technique for extracting tardigrades from their substrate is to hand-pick
1749 individuals using a glass pipette under a stereomicroscope (e.g. Bertolani et al., 2014; Vecchi et al., 2016).
1750 While relatively straightforward, this technique is inherently biased towards larger and easier to distinguish
1751 individuals (Sands et al., 2008b). For the purposes of the current study, the maximum range of sizes of
1752 individuals from each sampled population (and eggs if present) was required in order to be able to identify
1753 the range of natural variability and any consistent difference present between source regions or habitats.
1754 Therefore, a protocol using density gradient media with mechanical separation was performed (Sands et al.,
1755 2008b). After rehydrating the samples in reverse osmosis water for 24 h they were gently homogenized by
1756 hand in a small cup and added to OptiPrepTM (SigmaAldrich) density gradient solution in test tubes so that
71
1757 the homogenized sample containing the tardigrades formed the top layer. The tubes were then centrifuged
1758 on full power (110 × g) for 2 min before the supernatant was carefully removed and passed through a 32 µm
1759 sieve. Each sieve was carefully rinsed into a Petri dish using reverse osmosis water before examination under
1760 40× magnification with an Olympus BX30 microscope. Individual tardigrades were removed from the
1761 processed samples using an Irwin loop, with each being placed onto a slide containing a drop of Chick’s Fluid
1762 (Chick, 2010) for morphometric analysis.
1763
1764 Figure 4.1: Locations across Antarctica from which substrate samples were obtained for A. antarcticus; the
1765 regions used in this study and the position of the Gressitt Line are also indicated.
72
1766
1767 Figure 4.2: Locations across Antarctica from which substrate samples were obtained for M. furciger; the
1768 regions used in this study and the position of the Gressitt Line are also indicated.
1769
1770 4.2.2. Morphometric analyses
1771 Following Stec et al. (2016), where possible 30 individuals were assessed from each sampling location.
1772 Where this was not possible due to low numbers all available individuals were measured. Structures were
73
1773 only measured if they were in suitable and clear orientations. Body length was measured between anterior
1774 and posterior extremities, excluding the rear legs, with buccal tube length and stylet support insertion point
1775 measured as described by Pilato (1981) and Kaczmerak & Michalczyk (2017). Macroplacoid length and
1776 sequence were documented as described by Kaczmarek et al. (2014) and Kaczmerak & Michalczyk (2017).
1777 Claws were measured from the top of the claw base to the highest point of the claw (as a straight line),
1778 following Kaczmerak & Michalczyk (2017). In tardigrade morphometrics, ratios of structure length to the
1779 length of the buccal tube (the pt ratio), expressed as a percentage, are used in analyses (Pilato, 1981). This
1780 also negates the need for measuring identical-sized individuals from each population, allowing for a full
1781 range of individuals to be measured. The pt ratio was calculated using the Parachela ver. 1.6 template,
1782 downloaded from the Tardigrada register (Michalczyk & Kaczmarek, 2013). Diagrams of how measurements
1783 were taken are shown in Fig. 4.3. To take into account allometry in the morphometric measurements, the
1784 raw measurement data was Log10 transformed before analysis. All raw morphometric data are provided in
1785 the supplementary material (Tables S4.7-4.48).
1786
1787
74
1788
1789 Figure 4.3: Morphological charcters were measured as follows; A- Body Length, B- Buccal Tube Length, C-
1790 Stylet Support Insertion Point, D- Buccal Tube Internal Width, E- Buccal Tube External Width, F-
1791 Macroplacoid 1, G- Macroplacoid 2 (for M. furciger a 3rd macroplacoid and a microplacoid were also
1792 measured), H- Macroplacoid Row, I- Base of Claw, J- Secondary Claw, K- Primary Claw (measured for all pairs
1793 of claws on each leg).
1794
1795 4.2.3. Principal Component Analysis (PCA)
1796 PCA was performed using the FactoMineR and the factoextra packages in R ver. 3.6.2 (le et al, 2008;
1797 Kassambara and Mundt, 2017 and R Core Team, 2019). As there are a large number of variables used in this
1798 study a corrplot of the cos2 values and a graph of the contributions of the variables to the principal
1799 components was created to analyse which variables were contributing to the variance seen in the data (Wei
1800 and Simko, 2017). Variables that were contributing less than the expected average contribution were
1801 removed from the analysis. To visualise the data a PCA-Biplot was created which coloured the individuals
75
1802 and variables by groups (geographic area and morphological characteristic). Individuals on the same side of a
1803 variable have a high value for that variable but on the opposite side have a low value for that variable. PCA-
1804 Biplots for A. antarcticus were created for a pan-Antarctic comparison, and a comparison of moss or algal
1805 habitat. Geographical regions used for the pan-Antarctic PCA were the Maritime and Continental Antarctic
1806 as shown in figure 1. For M. furciger only geographic area was compared due to the lack of comparative
1807 habitats.
1808
1809 4.2.4. Statistical Differences Between Areas
1810 To test the significance of the differences in morphological characteristics between different areas and
1811 habitat type, a One-Way ANOVA was used in R ver. 3.6.2 (R Core Team, 2019). Areas were analysed as
1812 above, If the output of the ANOVA was significant then a Tukey Honest Significant Differences test was
1813 performed to compare which pairs of areas and habitats were significantly different.
1814
1815 4.3. Results
1816
1817 4.3.1. PCA- Acutuncus antarcticus
1818 Principal component analysis (PCA) identified little evidence of morphological differentiation between the
1819 sampled locations within the continental or maritime Antarctic regions, with the exception of the two
1820 locations in the Transantarctic Mountains ACBR. The data were therefore pooled into the three regions of
1821 continental Antarctic (minus Transantarctic Mountains), maritime Antarctic and Transantarctic Mountains
1822 for further analyses. PCA showed that these regions were all distinct (Fig. 4.4). Continental Antarctic
1823 individuals were characterised by larger buccal tube widths, longer macroplacoid rows and larger buccal
1824 tube length in comparison to body size than both maritime Antarctic and Transantarctic Mountain
1825 individuals. Maritime Antarctic individuals on average had a larger body size than did those from the
76
1826 continental Antarctic, but with a comparatively smaller buccal tube length (Figs. 4.4). Individuals from the
1827 Transantarctic Mountains were distinct from the other two regions due to the placement of the stylet
1828 support insertion point (Figs. 4.4). Within the continental and maritime Antarctic regions there was also
1829 clear separation between specimens sampled from moss or algae (Fig. 4.4) (no moss is present in the
1830 Transantarctic Mountains sampling locations so no comparison was possible). Individuals obtained from
1831 moss generally had larger buccal tube widths, longer buccal tubes and the stylet muscles inserted further
1832 down the buccal tube than those obtained from algae (Figs. 4.4).
1833 Both the Antarctic geographic region (maritime vs. continental) from which individuals were
1834 sampled and the habitat type (algae vs. moss) significantly influenced the morphological characters
1835 measured (Table 4.1, S4.5). The effect of geographical regions was significant for all the tested
1836 morphological characters (all F = 43 – 158.1, P < 0.0001). Habitat type was significant for the tested
1837 characters of body length (P < 0.0001,) except between Transantarctic algae and maritime moss (Table S4.5).
1838 The stylet support insertion point and buccal tube width also showed significant differences between
1839 habitat but macroplacoid row was only significant for geographic region (S4.5).
1840
1841
77
1842
1843 Figure 4.4: PCA- Biplot comparing the morphological variation seen within individuals of A. antarcticus found
1844 within the three areas of maritime Antarctic (green algal habitat, blue moss habitat), continental Antarctic
1845 (red algal habitat, yellow moss habitat) and Transantarctic Mountains.
1846
1847 4.3.2. PCA- Mesobiotus furciger
1848 Principal component analysis (PCA) of M. furciger morphological data showed two major groupings within
1849 the maritime Antarctic region, one including most maritime Antarctic samples with little morphological
1850 difference and a specific Litchfield Island group. In the continental Antarctic there were five distinct groups,
1851 one from the Prince Charles Mountains, one from Mawson Escarpment, one from Mawson station, one from
1852 Reinbolt Hills and one from Dronning Maud Land (Fig. 4.5). The group from Dronning Maud Land clustered
1853 between the Litchfield Island and general maritime Antarctic groups, with some overlap to both groups.
78
1854 These results show a clear separation between maritime and continental Antarctic groups, with the former
1855 having a larger body size but smaller buccal tube length (Fig. 4.5). The Prince Charles Mountains regions
1856 were significantly different from the maritime and the Dronning Maud Land regions (P < 0.0001) for buccal
1857 tube width and stylet support insertion point. The Dronning Maud Land group significantly differed from the
1858 maritime Antarctic region samples in the stylet support insertion point (P < 0.0001) and buccal tube width (P
1859 < 0.0001). The maritime Antarctic and Litchfield Island groups were also significantly different in the stylet
1860 support insertion point (P < 0.0001) and buccal tube width (P < 0.0001) (Tables 4.2, S4.6).
1861
1862 Figure 4.5: PCA biplot showing the morphological variation seen within individuals of M. furciger from
1863 different Antarctic sampling areas.
1864
1865
79
1866 Table 4.1: ANOVA results for different morphological characters for A. antarcticus (full Tukey HSD outputs
1867 are presented in Table S4.5).
Character F Value P Value Body Length 158.1 P < 0.0001 Stylet Support Insertion Point 77.67 P < 0.0001 Buccal Tube External Width 131.3 P < 0.0001
Macroplacoid Row 43 P < 0.0001 1868
1869 Table 4.2: ANOVA results for different morphological characters for M. furciger (full Tukey HSD outputs are
1870 presented in Table S4.6).
Character F Value P Value Body Length 23.69 P < 0.0001 Stylet Support Insertion Point 51.44 P < 0.0001 Buccal Tube External Width 76.25 P < 0.0001
External Primary Branch 1 2.39 P = 0.01
Posterior Primary Branch 4.106 P < 0.0001 1871
1872
1873 4.4. Discussion
1874 4.4.1 Morphological variation between Antarctic geographic regions
1875 The data obtained in this study confirmed significant variation in morphological characteristics of A.
1876 antarcticus sampled from continental and maritime Antarctica, independent of the habitat from which they
1877 were sampled. This is consistent with the previously identified (Chapter 2) deep genetic divergence between
1878 lineages from continental and maritime Antarctica. These data also suggest the presence of a distinct lineage
1879 in the Transantarctic Mountains region of continental Antarctica. As noted previously, such divergence
1880 between maritime and continental Antarctic lineages is found in multiple Antarctic terrestrial invertebrates,
80
1881 including springtails, mites and nematodes (Pugh, 1993; Andrassy, 1998; Chown & Convey 2007;
1882 McGaughran et al., 2011; Convey, 2017; Carapelli et al., 2020). However, the morphological characters
1883 measured, while commonly used in tardigrade taxonomy, are subtle and may not be suitable as defining
1884 characteristics in species description. The morphological differences found were characterised by
1885 significantly different size ratios in comparison to body size. For example, individuals from continental
1886 Antarctica have significantly larger buccal tubes in comparison to body size then those from the maritime
1887 Antarctic, along with differences in macroplacoid row lengths. Small variations in morphological
1888 characteristics in A. antarcticus were also noted by Cesari et al. (2016), who likewise could identify no strict
1889 defining features. Further analyses, perhaps employing scanning electron microscopy, may be required as a
1890 next step in identifying any defining morphological characteristics.
1891 Similarly, patterns of morphological variation in M. furciger also identified significant differences
1892 between the maritime and continental Antarctic, again consistent with the strong genetic divergences
1893 between these two regions for this species reported in Chapter 3, with this high level of variation noted in
1894 multiple previous studies (Murray 1906, 1907; Dastych 1984, 1989; Binda et al., 2005; Vecchi et al., 2016). The
1895 morphological differences were also consistent with the lineages identified in Chapter 3 from the Prince
1896 Charles Mountains, the maritime Antarctic and the M. polaris/hilariae (Dronning Maud Land, Victoria Land
1897 and South Georgia). Individuals from Dronning Maud Land were morphologically more similar to maritime
1898 Antarctic individuals than to those from the continental Antarctic Prince Charles Mountains. These data
1899 combined with the previous molecular work strengthens the support for existence of multiple distinct clades
1900 within M. furciger, and investigation of further regions of Antarctica could reveal more distinct clades.
1901 Kaczmarek et al. (2020) revisited the genus Mesobiotus, placing morphologically similar individuals
1902 into a Southern Hemisphere ‘M. furciger’ clade, even though this grouping was not supported by molecular
1903 data. As shown in Chapter 3, our new molecular data added to the morphological results presented here
1904 support the existence of an Antarctic-specific ‘M. furciger’ clade, with all non-Antarctic species grouping with
1905 a global ‘M. harmsworthi’ clade (Vecchi et al., 2016; Chapters 1, 3).
81
1906 4.4.2 The effects of habitat type on morphological variation
1907 A secondary aim of this study was to investigate whether habitat type can have a significant influence on
1908 morphological variation in tardigrades. The data obtained confirm that habitat type significantly impacted
1909 morphological variation in multiple characters of A. antarcticus in material that is genetically identical and
1910 independent of geographical region of origin. Habitat type significantly impacted all measured morphological
1911 characters in maritime and continental Antarctic individuals. This was particularly apparent in the body length
1912 and macroplacoid lengths. These data provide a first confirmation that habitat type can influence
1913 morphological characteristics within a single species (lineage) of tardigrades, a fact that will need to be taken
1914 into consideration in future taxonomic studies.
1915 Variation in adult tardigrade morphology has not previously been investigated at intra-specific level,
1916 with only comparisons between carnivorous and herbivorous species available (Nelson, 2002; Guidetti et al.,
1917 2012, 2013, 2015). However, intra-specific variation in egg morphology has been noted in tardigrade species.
1918 Kihm et al. (2020) reported high levels of variation in eggs of the Antarctic species Dactylobiotus ovimutans
1919 (Kihm et al. 2020), even under strictly controlled laboratory rearing conditions, inferring an epigenetic factor.
1920 Hansen and Katholm (2002) reported that eggs of the Arctic species Amphibolus nebulosus (Dastych, 1983)
1921 differed depending on the season in which they were laid (winter vs. summer).
1922 The results from this study provide support for environmental factors influencing the adult
1923 morphology of at least some tardigrades. This highlights that relying on morphology alone could lead to
1924 identification errors. Therefore, the identification of species/lineages should be based on an integrated
1925 approach using molecular genetic studies and defining distinct and consistent morphological characters
1926 which are not affected by habitat type.
1927
1928
1929
82
1930 Chapter 5
1931 Thesis Discussion
1932
1933 Antarctica has been isolated from its nearest landmasses for at least 28 million years (My) with progressive
1934 glaciation of the continent occurring from 32 My (Lawver et al., 1998; Lawver & Gahagan, 2003; Tripati et al.,
1935 2005). Modelling of past and present ice-sheet coverage has shown that the thickness and extent has
1936 periodically been far greater than it is today, covering most of the available landmass. These glaciation
1937 events were widely believed to have destroyed most present terrestrial life, leading to an assumption that
1938 most contemporary biota would have become established from lower latitude refugia after the LGM
1939 (Convey & Stevens, 2007). However, recent molecular and biogeographic studies in multiple invertebrate
1940 groups (mites, nematodes and springtails) have shown long-term in situ survival over hundreds of thousands
1941 to millions of years (e.g. Maslen & Convey, 2006; Chown & Convey, 2007; McGaughran et al., 2011;
1942 Greenslade, 2018a, b; Carapelli et al., 2020). This same pattern had not yet been shown within tardigrades,
1943 and the current study aimed to investigate whether they were also ancient survivors or recent colonisers.
1944 Molecular clock results showed that the ancestral nodes of the crown species used in this study (Acutuncus
1945 antarcticus s. lat. and Mesobiotus furciger s.lat.) had ancient origins within Antarctica of 30-40 My,
1946 consistent with the findings in other Antarctic invertebrates, and with previous molecular studies of the two
1947 targeted taxa all of which proposed distinct clades for Antarctic species (Czechowski et al., 2012; Cesari et
1948 al., 2016; Vecchi et al., 2016; Guidetti et al., 2017). Further investigation of these two species confirmed
1949 deep differentiation between individuals sampled from the maritime Antarctic and continental Antarctic,
1950 which also further confirms these two areas as separate biogeographic regions. Within continental
1951 Antarctica different lineages were also identified in further geographic areas. Taken together, these data
1952 provide strong evidence that multiple lineages of tardigrades have survived the successive glaciation events
1953 of the continent. The analysis of COX1 haplotypes showed little or no sharing of haplotypes between
1954 geographic regions and the molecular distances between lineages were also large. This indicates that there
83
1955 has been little movement between regions, perhaps due to large biogeographic barriers such as the
1956 formation of the ice-sheets and the up-lift of the Transantarctic Mountains. However, there was a notable
1957 link between the Crater Cirque area of Victoria Land (continental Antarctica) and maritime Antarctica, raising
1958 the possibility of occasional long-range dispersal events. An analogous suggestion has also been made in the
1959 moss species Bryum argenteum (Zaccara et al., 2020), which is also found in both Victoria Land and the
1960 Antarctic Peninsula. The present study has shown that tardigrades show similar biogeographic patterns to
1961 other invertebrates within Antarctica, particularly in the deep biodiversity divide between continental and
1962 maritime Antarctica. The lack of connectivity between areas of Antarctica and the long-term survival of its
1963 contemporary biodiversity highlights the sensitive nature of life on this continent and that correct protection
1964 and identification of at risk habitats are needed.
1965 There is currently an urgent need for development and application of strategic conservation
1966 planning in Antarctica (Coetzee et al., 2017), where it is now recognised that the current area protection
1967 system (the primary means of biodiversity protection in Antarctica) is inadequate and unrepresentative
1968 (Shaw et al., 2014; Hughes et al., 2015), with several of the continent’s ACBRs currently receiving no formal
1969 protection at all. Recent studies, including that presented here, identifying new endemic biodiversity at
1970 smaller intra-regional scales within the broader regions of Antarctica (e.g. Greenslade 2018a, b; Carapelli et
1971 al., 2019; Collins et al., 2020) serve only to emphasise the urgent need for these critical gaps in conservation
1972 in Antarctica to be rectified. Furthermore, direct human impacts, pollution, global warming and the threat of
1973 invasive species are increasingly threatening both terrestrial and marine habitats and species in Antarctica
1974 (Convey & Peck 2019).
1975 To be able to accurately assess the biodiversity of Antarctica, species first need to be correctly
1976 defined and the full (or as much as possible) suspected range should be sampled to assess inter- or intra-
1977 specific variation (i.e. the presence of cryptic species and endemic populations). How to define a species
1978 remains a contentious topic, often with traditional morphological taxonomists on one side and molecular
1979 phylogeneticists on the other (Pires & Marinoni, 2010; Kendig, 2013). However, taking a multidimensional
84
1980 ‘integrated taxonomic’ approach using molecular data to provide an initial ‘species hypothesis’ to which
1981 further morphological, ecological and biogeographic data can be added can help to create robust species
1982 definitions (Pires & Marinoni, 2010; Kendig, 2013; Pante et al., 2014).
1983 Using such an approach in the current study, based on the molecular data from Chapters 1-3 there
1984 was strong support for the existence of multiple deeply divergent lineages within both studied taxa. The use
1985 of multiple analyses and gene regions clearly placed Antarctic tardigrade lineages distinct from non-
1986 Antarctic. In the genus Mesobiotus, Antarctic and non-Antarctic lineages showed sequence divergence of up
1987 to 41.6% (corrected) in the COX1 gene. The genus Acutuncus has no non-Antarctic members, but clearly the
1988 targeted taxon formed a lineage distinct from other non-Antarctic species of Hypsibidae. These findings are
1989 consistent with previous molecular studies of the two targeted taxa, all of which proposed distinct clades for
1990 Antarctic species obtained from a more restricted geographical range of sampling sites than achieved here
1991 (Czechowski et al., 2012; Cesari et al., 2016; Vecchi et al., 2016; Guidetti et al., 2017).
1992 Within these Antarctic-specific lineages, a greater geographic range than previously possible was
1993 sampled in-order to test whether they were pan-Antarctic or formed geographically distinct groups. Analysis
1994 of the COX1 gene region in A. antarcticus and 18S and COX1 gene regions in M. furciger confirmed that there
1995 were multiple geographic lineages within both groups. Within A. antarcticus there were distinct lineages
1996 from maritime Antarctica, the Sør Rondane mountains (Dronning Maud Land) and from the remainder of
1997 continental Antarctica, with the possibility of fourth less deeply differentiated lineage from Victoria Land. For
1998 M. furciger there was a large maritime Antarctic lineage and a smaller lineage from Alexander Island (also in
1999 the maritime Antarctic), while continental Antarctica had a distinct lineage from the Prince Charles
2000 Mountains and a group consisting of the species M. polaris/M. hilariae from Dronning Maud Land, Victoria
2001 Land and South Georgia. Given the morphometric differences identified and biogeographic patterns
2002 recognised, this study strongly suggests that at least three previously unrecognised species within A.
2003 antarcticus and four within M. furciger are present in Antarctica. As described in Chapters 1-3, these lineages
2004 were well supported in both Maximum Likelihood and Bayesian analyses.
85
2005 Not only do the molecular analyses support the existence of these lineages, but they are also
2006 consistent with the geological and glaciological history of the Antarctic region. The haplotype networks
2007 identified in this study further show that there has been little or no gene flow between the geological areas
2008 of maritime and continental Antarctica, leading to their isolation and speciation of their contained lineages.
2009 These lineages diverged during times of drastic geological change within Antarctica, in particular the
2010 separation of Antarctica from South America and Australia and the subsequent formation of continental-
2011 scale and long-lived ice-sheets, both creating intense biogeographic barriers. Morphometric analyses further
2012 showed significant differences between maritime and continental Antarctic lineages, with further distinct
2013 geographic groups within continental Antarctica detected within M. furciger. The morphological groups
2014 identified correspond to the lineages present in the molecular analyses, although indisputable identifying
2015 characters were not identified in this study. A novel finding of the current study was that individuals of A.
2016 antarcticus showed significant differences in morphological characteristics associated with the habitat from
2017 which they were collected, as distinct from their geographic origin alone. Individuals collected from moss
2018 had larger buccal tubes then those found on algae, and genetically distinct individuals had similar
2019 morphology in the respective habitat types. The observation that habitat has a significant influence on
2020 tardigrade morphology means that caution is required when making taxonomic assessments based on
2021 morphological characters alone.
2022 The use of this integrated taxonomic approach provides multiple lines of support for the presence of
2023 previously unrecognised speciation within both A. antarcticus and M. furciger in Antarctica. This both
2024 highlights the urgent need for further survey work targeting poorly known regions and cryptic groups such as
2025 the tardigrades, in order to better understand Antarctic biodiversity and biogeography, and emphasises the
2026 need for great care to be taken in managing human movement between regions in Antarctica (Hughes et al.,
2027 2019) in order to avoid inadvertent transfer of biota between regions.
2028 Although there is strong support for an increased number of the species of Antarctic tardigrades
2029 based on this work there remain limitations within this study. The main limitation being the single use of the
86
2030 COX1 gene region in Chapter 2. Although this gene region has been used very widely in phylogeographic
2031 studies for many years there can be biases when used alone, especially for species delimitation (Ballard &
2032 Whitlock, 2004). There are often low bootstrap values and, for a single COX1 gene tree, values below 90%
2033 are often disregarded as not a true representation (Ballard & Whitlock, 2004). The use of multiple gene
2034 regions which are then subsequently used in a species tree inferring programme such as ASTRAL-III is a
2035 useful way to infer species trees while also dealing with gene tree discordance. ASTRAL-III takes into account
2036 the discordance in gene trees by searching for the maximum number of quartet topologies in the inputted
2037 gene trees. This is especially useful for groups with incomplete sampling and/or with incomplete lineage
2038 sorting.
2039 In this study 18S, 28S and COX1 were used in Chapter 1, along with ASTRAL-III species tree
2040 programme, and 18S and COX1 used in Chapter 3. The gene regions used in the ASTRAL-III programme in
2041 Chapter 1 were consistent with the lineages reported in Chapter 2. Added to this the COX1 gene tree
2042 presented in Chapter 2 had strong support values and further descriptive statistics to investigate the
2043 relationships between individuals and regions. This together mitigates the issues of using the COX1 gene
2044 region alone and further supports the findings of this study.
2045 Within the morphological study, although multiple characters were used no specific characters could
2046 be identified using light microscopy. Futures studies using scanning electron microscopy may yet identify
2047 discrete morphological characteristics. Analyses did show significant differences between the regions
2048 sampled but these were based on PT ratios of the characters. To be able to define the new species that have
2049 been proposed further investigation will be required to determine if there are measurable defining
2050 characters for each group or if they are cryptic species.
2051 While this study greatly increased the geographic sampling range achieved there are many areas of
2052 Antarctica that are yet to be sampled that could contain further unrecognised diversity. Further sampling
2053 would also help increase knowledge of connectivity (or lack of) between these areas and form the basis of
2054 investigation of how tardigrades disperse over large and small scales. The highly endemic nature of the
87
2055 lineages presented here indicates that long-range dispersal is rare, but the link between the Crater Cirque
2056 area of Victoria Land and the maritime Antarctic shows that connection events do happen but their
2057 mechanisms and frequencies are currently unknown. To be able to place the biogeography of Antarctic
2058 tardigrades into the wider context of Gondwanan history there is also a need to increase sampling from the
2059 nearest regions to Antarctica (Australia, New Zealand, South Africa and South America). Analyses of these
2060 regions would help to clarify the biogeographic history and processes affecting tardigrades during the break-
2061 up of Gondwana, and even whether Antarctica was a core region of their diversification or whether there
2062 were colonisation events from other regions. Finally, there is a need to sample tardigrade species from all of
2063 their known habitats to be able to accurately assess whether the variation documented in Chapter 4
2064 indicates true plasticity to the environment or represents inter-specific variation. If the former, this has
2065 important consequences for future morphological analyses of tardigrades.
2066 In summary, tardigrades within Antarctica show complex biogeographic patterns indicative of
2067 ancient origins within the continent. Molecular clock analyses of the two species groups studied here are
2068 consistent with the origin of both groups coinciding with the final Gondwana breakup events that led to the
2069 formation of an isolated Antarctic continent, where they have persisted through successive and sometimes
2070 intense glaciation events to the present day. Continental and maritime Antarctica have different geological
2071 origins and this is reflected in the biogeography of the tardigrades studied, with large molecular divergences
2072 detected between lineages from these two regions, supported by significant, if subtle, morphological
2073 differences. Some morphological characters, however, showed significant influence of environmental
2074 conditions (source habitat), which cautions against relying on morphological characteristics alone in the
2075 determination of these species. The potential increase in the biodiversity of tardigrades within Antarctica
2076 highlights the need for increased sampling across the continent and increased protection of their sensitive
2077 habitats.
2078
2079
88
2080 References
2081 Adams, B.J., Bardgett, R.D., Ayres, E., Wall, D.H., Aislabie, J., Bamforth, S., Bargagli, R., Cary, C., Cavacini, P., 2082 Connell, L., Convey, P., Fell, J.W., Frati, F., Hogg, I.D., Newsham, K.K., O’Donnell, A., Russell, N., Seppelt, R.D., 2083 and Stevens, M.I., (2006) Diversity and Distribution of Victoria Land biota. Soil Biology and Biochemistry, 38, 2084 3003-3018.
2085 Allegrucci, G., Carchini, G., Todisco, V., Convey, P., and Sbordoni, V. (2006) A molecular phylogeny of 2086 Antarctic Chironomidae and its implications for biogeographical history. Polar Biology, 29, 320-326.
2087 Anderson, J.B., Shipp, S.S., Lowe, A.L., Wellner, J.S., and Mosola, A.B., (2002) The Antarctic ice sheet during 2088 the Last Glacial Maximum and its subsequent retreat: a review. Quaternary Science Reviews, 21, 49-70.
2089 Anderson, J.B., Warny, S., Askin, R.A., Wellner, J.S., Bohaty, S.M., Kirshner, A.E., Livsey, D.N., Simms, A.R., 2090 Smith, T.R., Ehrmann, W., Lawver, L.A., Barbeau, D., Wise, S.W., Kulhanek, D.K., Weaver, F.M., and Majewski, 2091 W., (2011) Progressive Cenozoic cooling and the demise of Antarctica’s last refugium. Proceedings of the 2092 National Academy of Sciences, 108 (28), 11356–11360.
2093 Andrassy, I., (1998) Nematodes in the sixth continent. Journal of Nematode Systematics and Morphology, 1, 2094 107-108.
2095 Ballard, J.W.O., and Whitlock, M.C., (2004) The incomplete natural history of mitochondria. Molecular 2096 Ecology, 13, 729-744.
2097 Barker, P.F., and Thomas, E., (2004) Origin, signature and palaeoclimatic influence of the Antarctic 2098 Circumpolar Current. Earth-Science Reviews, 66, 143-162.
2099 Bergstrom, D.M., and Chown, S.L. (1999) Life at the front: history, ecology and change on Southern Ocean 2100 islands. Trends in Ecology and Evolution, 14, 472-477.
2101 Bertolani, R., and Grimaldi, D. (2000) A new Eutardigrade (Tardigrada: Milnesiidae) in amber from the Upper 2102 Cretaceous (Turonian) of New Jersey. In: Grimaldi, D, eds. Studies on fossils in amber with particular 2103 reference to the cretaceous of New Jersey. Leiden, the Netherlands: Blackburys Publishers, 103-110.
2104 Bertolani, R., Bartels, P.J., Guidetti, R., Cesari, M., and Nelson, D.R. (2014) Aquatic tardigrades in the Great 2105 Smoky Mountains National Park, North Carolina and Tennessee, U.S.A., with the description of a new species 2106 of Thulinius (Tardigrada, Isohypsibiidae). Zootaxa, 3764, 524-536.
2107 Beyer, L., and Bölter M., (2002) Geoecology of Antarctic Ice Free Coastal Landscapes. Berlin: Springer.
2108 Biersma, E.M., Jackson, J.A., Hyvönen, J., Koskinen, S., Linse, K., Griffiths, H., and Convey, P. (2017) Global 2109 biogeographic patterns in bipolar moss species. Royal Society Open Science, 4, 170147.
2110 Biersma, E.M., Jackson, J.A., Stech, M., Griffiths, H., Linse, K., and Convey, P. (2018) Molecular data suggest 2111 long-term in situ Antarctic persistence within Antarctica’s most speciose plant genus, Schistidium. Frontiers 2112 in Ecology and Evolution, 6:77, https://doi.org/10.3389/fevo.2018.00077
2113 Biersma, E.M., Convey, P., Wyber, R., Robinson, S.A., Dowton, M., van de Vijver, B., Linse, K., Griffiths, H., 2114 and Jackson, J.A., (2020) Latitudinal biogeographic structuring in the globally distributed moss Ceratodon 2115 purpureus. Frontiers in Plant Science, 11 (502359), doi: 10.3389/fpls.2020.502359
2116 Binda, M.G., Pilato, G., and Lisi, O., (2005) Remarks on Macrobiotus furciger Murray, 1906 and description of 2117 three new species of the furciger group (Eutardigrada, Macrobiotidae). Zootaxa, 68, 55-68.
89
2118 Bockhorst, S., Convey, P., and Aerts, R., (2019) Nitrogen inputs by marine vertebrates drive abundance and 2119 rischness in Antarctic terrestrial ecosystems. Current Biology, 29 (10), 1721-1727.
2120 Cantrill, D.J., and Poole, I., (2012) The Vegetation of Antarctica through Geological Time, Cambridge 2121 University Press, Cambridge, UK.
2122 Carapelli, A., Convey, P., Frati, F., Spinsanti, G., and Fanciulli, P.P., (2017) Population genetics of three 2123 sympatric springtail species (Hexapoda: Collembola) from the South Shetland Islands: evidence for a 2124 common biogeographic pattern. Biological Journal of the Linnean Society, XX, 1-16.
2125 Carapelli, A., Fanciulli, P., Frati, F., and Leo, C., (2019) Mitogenomic data to study the taxonomy of Antarctic 2126 springtail species (Hexapoda: Collembola) and their adaptation to extreme environments. Polar Biology, 42, 2127 715–732.
2128 Carapelli, A., Greenslade, P., Nardi, F., Leo, C., Convey, P., Frati, F., Fanciulli, P.P., (2020) Evidence for cryptic 2129 diversity in the “pan-Antarctic” springtail Friesea antarctica and the description of two new 2130 species. Insects, 11, 141.
2131 Cesari, M., McInnes, S.J., Bertolani, R., Rebecchi, L., and Guidetti, R., (2016) Genetic diversity and 2132 biogeography of the south polar water bear Acutuncus antarcticus (Eutardigrada : Hypsibiidae)- evidence 2133 that it is a truly pan-Antarctic species. Invertebrate Systematics, 30, 635-649.
2134 Cesari, M., Vecchi, M., Palmer, A., Bertolani, R., Pilato, G., Rebecchi, L., and Guidetti, R. (2016) What if the 2135 claws are reduced? Morphological and molecular phylogenetic relationships of the genus Haplomacrobiotus 2136 May, 1948 (Eutardigrada, Parachela). Zoological Journal of the Linnean Society, 178, 819-827.
2137 Chen, L-J., Sewell, S.M., Romano, F.A., and Murdock, C.A. (2009) Variations in 18s RDNA within tardigrade 2138 individuals, species and populations. Jacksonville, AL: Jacksonville State University Press.
2139 Chown, S.L., and Convey, P., (2007) Spatial and temporal variability across life’s hierarchies in the terrestrial 2140 Antarctica. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences, 362, 2307- 2141 2331.
2142 Clement, M., Posada, D., and Crandall, K.A., (2000) TCS: a computer program to estimate gene genealogies. 2143 Molecular Ecology, 9, 1657-1659.
2144 Coetzee, B.W.T., Convey, P., and Chown, S.L., (2017) Expanding the protected area network in Antarctica is 2145 urgent and readily achievable. Conservation Letters, doi: 10.1111/conl.12342.
2146 Collins, G.E., Hogga, I.D., Convey, P., Sancho, L.G., Cowan, D.A., Lyons, W.B., Adams, B.J., Wall, D.H., and 2147 Green, T.G.A., (2020) Genetic diversity of soil invertebrates corroborates timing estimates for past collapses 2148 of the West Antarctic Ice Sheet. Proceedings of the National Academy of Sciences of the United States of 2149 America, https://doi.org/10.1073/pnas.2007925117.
2150 Convey, P., (2011) Antarctic terrestrial biodiversity in a changing world. Polar Biology, 34, 1629-1641.
2151 Convey, P., (2017) Antarctic Ecosystems. In: Levin SA, eds. Encyclopedia of biodiversity, 3rd edition, Vol. 1. 2152 Waltham, MA: Academic Press, 179-188.
2153 Convey, P., and McInnes, S.J., (2005) Exceptional tardigrade-dominated ecosystems in Ellsworth Land, 2154 Antarctica. Ecological Society of America, 86 (2), 519-527.
2155 Convey, P., and Peck, L.S., (2019) Antarctic environmental change and biological responses. Science 2156 Advances, 11, eaaz0888.
90
2157 Convey, P., and Stevens, M.I., (2007) Antarctic Biodiversity. Science, 317, 1877-1878.
2158 Convey, P., Bowman, V.C., Chown, S.L., Francis, J.E., Fraser, C., Smellie, J.L., Storey, B., and Terauds, A. 2159 (2018). Ice-Bound Antarctica: Biotic Consequences of the Shift from a Temperate to a Polar Climate. In: 2160 Hoorn, C., Perrigo, A., and Antonelli, A, edds. Mountains, Climate and Biodiversity, first edition. John Wiley & 2161 Sons Ltd, 355-374.
2162 Convey, P., Chown, S.L., Clarke, A., Barnes, D.K.A.., Bokhorst, S., Cummings, V., Ducklow, H.W. Frati, F., 2163 Green, T.G.A., Gordon, S., Griffiths, H.J., Howard-Williams, C., Huiskes, A.H.L., Laybourn-Parry, J., Lyons, W.B., 2164 McMinn, A., Morley, S.A., Peck, S.A., Quesada, A., Robinson, S.A., Schiaparelli, S., and Wall, D.H., (2014) The 2165 spatial structure of Antarctic Biodiversity. Ecological Monographs, 84, 203-244.
2166 Convey, P., Gibson, J., Hillenbrand, C-D., Hodgson, D.A., Pugh, P.J.A., Smellie, J.L., and Stevens, M.I., (2008) 2167 Antarctic terrestrial life- challenging the history of the frozen continent? Biological Reviews, 83, 103-117.
2168 Convey, P., Stevens, M.I., Hodgson, D.A., Smellie, J.L., Hillenbrand, C-D., Barnes, D.K.A., Clarke, A., Pugh, 2169 P.J.A., Linse, K., and Cary S.C., (2009) Exploring biological constraints on the glacial history of Antarctica. 2170 Quaternary Science Reviews, 28, 3035-3048.
2171 Criscuolo, A., and Gribaldo, S. (2010) BMGE (Block Mapping and Gathering with Entropy): selection of 2172 phylogenetic informative regions from multiple sequence alignments. BMC Evolutionary Biology, 10, 210.
2173 Cromer, L., Gibson, J.A.E., McInnes, S.J., and Agius, J.T., (2008) Tardigrade remains from lake sediments. 2174 Journal of Paleolimnology, 39, 143-150.
2175 Czechowski, P., Sands, C.J., Adams, B.J., D’Haese, C.A., Gibson, J.A.E., McInnes, S.J., and Stevens M.I., (2012) 2176 Antarctic Tardigrada: a first step in understanding molecular operational taxonomic units (MOTUs) and 2177 biogeography of cryptic meiofauna. Invertebrate Systematics, 26, 526-538.
2178 Czechowski, P., White, D., Clarke, L., McKay, A., Cooper, A., and Stevens, M.I., (2016) Age-related 2179 environmental gradients influence invertebrate distribution in the Prince Charles Mountains, East Antarctica. 2180 Royal Society Open Science, 3, 160296.
2181 Dabert, M., Dastych, H., Hohberg, K., and Dabert, J. (2014) Phylogenetic position of the enigmatic clawless 2182 eutardigrade genus Apodibius Dastych, 1983 (Tardigrada), based on 18S and 28S rRNA sequence data from 2183 its type species A. confusus. Molecular Phylogenetics and Evolution, 70, 70-75.
2184 Dastych, H., (1983) Apodibius confusus gen. n. sp. n., a new water-bear from Poland (Tardigrada). Bulletin 2185 L’Académie Polonaise des Science, 31, 42-45.
2186 Dastych, H., (1984) The Tardigrada from Antarctic with description of several new species. Acta Zoologica 2187 Cracoviensia, 27, 377–436.
2188 Dastych, H., (1989) An annotated list of Tardigrada from Antarctic. Entomologische Mitteilungen aus dem 2189 Zoologischen Museum Hamburg, 9, 249–257.
2190 Dastych, H., (1991) Redescription of Hypsibius antarcticus (Richters, 1904), with some notes on Hypsibius 2191 arcticus (Murray, 1907) (Tardigrada). Mitteilungenb aus den Hamburgischen Zoologischen Museum und 2192 Institut, 88, 141-159.
2193 Davis, J.K., Lawver, L.A., Norton, I.O., Dalziel, I.W.D., and Gahagan, L.M., (2019) The crustal structure of the 2194 Enderby Basin, East Antarctica. Marine Geophysical Research, 40, 1-16.
91
2195 Degma, P., Bertolani, R. and Guidetti, R., Actual checklist of Tardigrada species. DOI: 2196 10.25431/11380_1178608. Accessed 2020.
2197 Degnan, J.H., and Rosenberg, N.A. (2009) Gene tree discordance, phylogenetic inference and the 2198 multispecies coalescent. Trends in Ecology and Evolution, 24, 332-340.
2199 dos Santos, A.M., Cabezas, M.P., Tavares, A.J., Xavier, R., and Branco, M., (2016) tcsBU: a tool to extend TCS 2200 network layout and visualization. Bioinformatics, 32, 627-628.
2201 Dupin, J., Matzke, N.J., Sarkinen, T., Knapp, S., Olmstead, R., Bohs, L., and Smith, S. (2016) Bayesian 2202 estimation of the global biogeographic history of the Solanaceae. Journal of Biogeography, 44, 887-899.
2203 Edgar, R.C., (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic 2204 Acids Research, 32, 1792-1797.
2205 Ewing, B., and Green, P., (1998) Basecalling of automated sequencer traces using phred. II. Error 2206 probabilities. Genetic Research, 8, 186-194.
2207 Ewing, B., Hillier, L., Wendl, M., and Green, P., (1998) Basecalling of automated sequencer traces using 2208 phred. I. Accuracy assessment. Genetics Research, 8, 175-185.
2209 Faurby, S., Jonsson, K.I., Rebecchi, L., and Funch, P. (2008) Variation in anhydrobiotic survival of two 2210 eutardigrade morphospecies: a story of cryptic species and their dispersal. Journal of Zoology, 275, 139-145.
2211 Fitzgerald, P., (2002) Tectonics and landscape evolution of the Antarctic plate since the breakup of 2212 Gondwana, with an emphasis on the West Antarctic Rift System and the Transantarctic Mountains. Royal 2213 Society of New Zealand Bulletin, 35, 453-469.
2214 Folmer, O., Black, M., Hoeh, W., Lutz, R., and Vrijenhoek, R., (1994) DNA primers for amplification of 2215 mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine 2216 Biology and Biotechnology, 3, 294–299.
2217 Fu, Y-X., (1997) Statistical tests of neutrality of mutations against population growth, hitchhiking and 2218 background selection. Genetics, 147, 915-925.
2219 Garey, J.R., Krotec, M., and Nelson, D.R. (1996) Molecular analysis supports a tardigrade-arthropod 2220 association. Invertebrate Biology, 115, 79-88.
2221 Garey, J.R., McInnes, S.J., and Nichols, P.B. (2008) Global diversity of tardigrades (Tardigrada) in freshwater. 2222 Hydrobiologia, 595, 101-106.
2223 Garey, J.R., Nelson, D.R., Mackey, L.Y., and Li, J. (1999) Tardigrade phylogeny: congruency of morphological 2224 and molecular evidence. Zoologischer Anzeiger, 238, 205-210.
2225 Gąsiorek, P., Stec, D., Morek, W., and Michalczyk, Ł., (2017) An integrative redescription of Echiniscus 2226 testudo (Doyère, 1840), the nominal taxon for the class Heterotardigrada (Ecdysozoa: Panarthropoda: 2227 Tardigrada). Zoologischer Anzeiger, 270, 107–122.
2228 Gasiorek, P., Stec, D., Morek, W., Zawierucha, K., Kaczmarek, Ł., Lachowska-Cierlik, D., and Michalczyk, Ł. 2229 (2016) An integrative revision of Mesocrista Pilato, 1987 (Tardigrada: Eutardigrada: Hypsibiidae). Journal of 2230 Natural History, 50, 2803-2828.
2231 Gibson, J.A.E., and Bayly, I.A.E., (2007) New insights into the origins of crustaceans of Antarctic lakes. 2232 Antarctic Science, 19 (2), 157-164.
92
2233 Gibson, J.A.E., Cromer, L., Agius, J.T., McInnes, S.J., and Marley, N.J., (2007) Tardigrade eggs and exuvia in 2234 Antarctic lake sediments: insights into Holocene dynamics and origins of fauna. Journal of Limnology, 66, 65- 2235 71.
2236 Grabherr, M.G., Haas, B.J., Yassour, M., Levin, J.Z., Thompson, D.A., Amit, I., Adiconis, X., Fan, L., 2237 Raychowdhury, R., Zeng, Q., Chen, Z., Mauceli, E., Hacohen, N., Gnirke, A., Rhind, N., di Palma, F., Birren, 2238 B.W., Nusbaum, C., Lindblad-Toh, K., Friedman, N., and Regev, A. (2011) Full-length transcriptome assembly 2239 from RNA-seq data without a reference genome. Nature Biotechnology, 15, 644-652.
2240 Greenslade, P., (2018a) An Antarctic biogeographical anomaly resolved: the true identity of a widespread 2241 species of Collembola. Polar Biology, 41, 969-981.
2242 Greenslade, P., (2018b) A new species of Friesea (Collembola: Neanuridae) from the Antarctic continent. 2243 Journal of Natural History, 52 (33-34), 2197-2207.
2244 Gressitt, J., Lindsey Maa, T.C., Nakata, S., Mackerras, M., and Quate, L.W., (1961) Problems in the 2245 zoogeography of Pacific and Antarctic insects. In: Bernice P. Bishop Museum, Entomology Department.
2246 Gressitt, J.L., (1967) Introduction. Antarctic Research Series, 10, 1-33.
2247 Gressitt, J.L., Leech, R.E., and O’Brien, C.W., (1960) Trapping of insects in the Antarctic area. Pacific Insects, 2, 2248 245-250.
2249 Guidetti, R., Altiero, T., and Rebecchi, L., (2011) On dormancy strategies in tardigrades. Journal of Insect 2250 Physiology, 57, 567-576.
2251 Guidetti, R., and Bertolani, R. (2005). Tardigrade taxonomy: An updated check list of the taxa and a list of 2252 characters for their identification. Zootaxa, 845, 1-46.
2253 Guidetti, R., Gandolfi, A., Rossi, V., and Bertolani, R. (2005) Phylogenetic analysis of Macrobiotidae 2254 (Eutardigrada, Parachela): a combined morphological and molecular approach. Zoologica Scripta, 34, 235- 2255 244.
2256 Guidetti, R., McInnes, S.J., Cesari, M., Rebecchi, L., and Rota-Stabelli, O., (2017) Evolutionary scenarios for 2257 the origin of an Antarctic tardigrade species based on molecular clock analysis and biogeographic data. 2258 Contributions to Zoology, 86, 97-110.
2259 Guidetti, R., Schill, R.O., Bertolani, R., Dandekar, T., and Wolf, M., (2009) New molecular data for tardigrade 2260 phylogeny, with the erection of Paramacrobiotus gen. nov. Journal of Zoological Systematics and 2261 Evolutionary Research, 47 (4), 315-321.
2262 Guil, N. and Giribet, G. (2012) A comprehensive molecular phylogeny of tardigrades--adding genes and taxa 2263 to a poorly resolved phylum-level phylogeny. Cladistics, 28, 21-49.
2264 Guil, N., and Cabrero-Sañudo, F.J., (2007) Analysis of the species description process for a little known 2265 invertebrate group: the limnoterrestrial tardigrade (Bilateria, Tardigrada). Biodiversity and Conservation, 16, 2266 1063-1086.
2267 Guil, N., Jørgensen, A., and Kristensen, R., (2019) An upgraded comprehensive multilocus phylogeny of the 2268 Tardigrada tree of life. Zoologica Scripta, 48, 120-137.
2269 Guindon, S., Dufayard, J.F., Lefort, V., Anisimova, M., Hordijk, W., and Gascuel, O. (2010) New algorithms and 2270 methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Systematic 2271 biology, 59, 307-321.
93
2272 Haas, B.J., Papanicolaou, A., Yassour, M., Grabherr, M., Blood, P.D., Bowden, J., Couger, M.B., Eccles, D., Li, 2273 B., Lieber, M., Macmanes, M.D., Ott, M., Orvis, J., Pochet, N., Strozzi, F., Weeks, N., Westerman, R., William, 2274 T., Dewey, C.N., Henschel, R., Leduc, R.D., Friedman, N., and Regev, A. (2013) De novo transcript sequence 2275 reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nature 2276 Protocols, 8, 1494-1512.
2277 Hebert, P.D.N., Cywinska, A., Ball, S.L., and deWaard, J.R., (2003) Biologicl identifications through DNA 2278 barcodes. Proceedings of the Royal Society B, 270, 313-321.
2279 Heroy, D.C., and Anderson, J.B., (2005) Ice-sheet extent of the Antarctic Peninsula region during the Last 2280 Glacial Maximum (LGM)- Insights from glacial geomorphology. GSA Bulletin, 117, 1497-1512.
2281 Huelsenbeck, J.P., and Suchard, M.A. (2007) A nonparametric method for accommodating and testing 2282 across-site rate variation. Systematic Biology, 56, 975-987.
2283 Huelsenbeck, J.P., Ronquist, F., Nielsen, R., and Bollback, J.P. (2001) Bayesian inference of phylogeny and its 2284 impact on evolutionary biology. Science, 294, 2310-2314.
2285 Hughes, K.A., Pertierra, L.R., Molina-Montenegro, M.A. and Convey, P., (2015) Biological invasions in 2286 terrestrial Antarctica: what is the current status and can we respond? Biodiversity and 2287 Conservation, 24, 1031–1055.
2288 Hughes, K.A., Convey, P., Pertierra, L.R., Vega, G.C., Aragón P., and Olalla-Tárraga, M.Á., (2019) Human- 2289 mediated dispersal of terrestrial species between Antarctic biogeographic regions: a preliminary risk 2290 assessment. Journal of Environmental Management, 232 (15), 73-89.
2291 Hughes, K.A., Pescott, O.L., Jodey Peyton, J., Adriaens, T., Cottier-Cook, E.J., Key, G., Rabitsch W., Tricarico, 2292 E., Barnes, D.K.A., Baxter, N., Belchier, M., Blake D., Convey, P., Dawson, W., Frohlich, D., Gardiner, L.M., 2293 González-Moreno, P., James, R., Malumphy, C., Martin, S., Martinou, A.F., Minchin, D., Monaco, A., Moore, 2294 N., Morley, S.A., Ross, K., Shanklin, J., Turvey, K., Vaughan, D., Vaux, A.G.C., Werenkraut, V., Winfield, I.J., and 2295 Roy, H.E., (2020) Invasive non-native species likely to threaten biodiversity and ecosystems in the Antarctic 2296 Peninsula region. Global Change Biology, DOI: 10.1111/gcb.14938.
2297 Jönsson K.I., Schill, R.O., Rabbow, E., Rettberg, P., and Harms-Ringdahl, M., (2016) The fate of the TARDIS 2298 offspring: no intergenerational effects of space exposure. Zoological Journal of the Linnean Society, 178, 924- 2299 930.
2300 Jørgensen, A., and Kristensen, R.M. (2004) Molecular phylogeny of Tardigrada—investigation of the 2301 monophyly of Heterotardigrada. Molecular Phylogenetics and Evolution, 32, 666-670.
2302 Jørgensen, A., Faurby, S., Hansen, J.G., Møbjerg, N., and Kristensen, R.M. (2010) Molecular phylogeny of 2303 Arthrotardigrada (Tardigrada). Molecular Phylogenetics and Evolution, 54, 1006-1015.
2304 Kaczmarek, Ł., Bartylak, T., Stec, D., Kulpa, A., Kepel, M., Kepel, A., Roszkowska, M., (2020) Revisiting the 2305 genus Mesobiotus Vecchi et al., 2016 (Eutardigrada, Macrobiotidae) – remarks, updated dichotomous key 2306 and an integrative description of new species from Madagascar. Zoologischer Anzeiger, 2307 https://doi.org/10.1016/j.jcz.2020.05.003
2308 Kaczmarek, Ł., Zawierucha, K., Buda, J., Stec, D., Gawlak, M., Michalczyk, Ł., and Roszkowska, M., (2018) An 2309 integrative redescription of the nominal taxon for the Mesobiotus harmsworthi group (Tardigrada: 2310 Macrobiotidae) leads to descriptions of two new Mesobiotus species from Arctic. PLoS One, 13, 2311 https://doi.org/10.1371/journal.pone.0204756.
94
2312 Katoh, K., Misawa, K., Kuma, K., and Miyata, T. (2002) MAFFT: a novel method for rapid multiple sequence 2313 alignment based on fast Fourier transform. Nucleic Acids Research, 30, 3059-3066.
2314 Katoh, K., Rozewicki, J., and Yamada, K.D. (2017) MAFFT online service: multiple sequence alignment, 2315 interactive sequence choice and visualization. Briefings in Bioinformatics, 2316 bbx108, https://doi.org/10.1093/bib/bbx108.
2317 Kendig, C., (2013) Towards a multidimensional metaconception of species, Ratio (new series), XXVII, 155- 2318 172.
2319 Kennett, J.P., (1977) Cenozoic evolution of Antarctic glaciation, the circum-Antarctic Ocean, and their impact 2320 on global paleoceanography. Journal of Geophysical Research, 82, 3843-3860.
2321 Kiehl, E., Dastych, H., D’Haese, J., and Greven, H. (2007) The 18s rDNA sequences support polyphyly of the 2322 Hypsibiidae (Eutardigrada). Journal of Limnology, 66, 21-25.
2323 Kimura, M. (1981) Estimation of evolutionary distances between homologous nucleotide sequences. 2324 Proceedings of the National Academy of Sciences of the United States of America, 78, 454-458.
2325 Kimura, M., (1980) A simple method for estimating evolutionary rate of base substitutions through 2326 comparative studies of nucleotide sequences. Journal of Molecular Evolution, 16, 111-120.
2327 Kosztyla, P., Stec, D., Morek, W., Gąsiorek, P., Zawierucha, K., Michno, K., Ufir, K., Malek, D., Hlebowicz, K., 2328 Laska, A., Dudziak, M., Frohme, M., Prokop, Z.M., Kaczmarek, Ł. and Michalczyk, Ł. (2016) Experimental 2329 taxonomy confirms the environmental stability of morphometric traits in a taxonomically challenging group 2330 of microinvertebrates. Zoological Journal of the Linnean Society, 178, 765-775.
2331 Kück, P., and Meusemann, K. (2010) FASconCAT: Convenient handling of data matrices. Molecular 2332 Phylogenetics and Evolution, 56, 1115-1118.
2333 Kumar, S., Stecher, G., Li, M., Knyaz, C., and Tamura, K., (2018) MEGA x: Molecular evolutionary genetics 2334 analysis across computing platforms. Molecular Biology and Evolution, 35, 1547-1549.
2335 Kuraku, S., Zmasek, C.M., Nishimura, O., and Katoh, K. (2013) Leaves facilitates on-demand exploration of 2336 metazoan gene family trees on MAFFT sequence alignment server with enhanced interactivity. Nucleic Acids 2337 Research, 41, 22-28.
2338 Kyle, P.R., and Cole, J.W., (1974) Structural control of volcanism in the McMurdo Volcanic Group, Antarctica. 2339 Bulletin Volcanologique, 38, 16-25.
2340 Landis, M.J., Matzke, N.J., and Moore, B.R. (2013) Bayesian analysis of biogeography when the number of 2341 areas is large. Systematic Biology, 62, 789-804.
2342 Lanfear, R., Calcott, B., Ho, S.Y., and Guindon, S. (2012) PartitionFinder: combined selection of partitioning 2343 schemes and substitution models for phylogenetic analyses. Molecular biology and evolution, 29, 1695-1701.
2344 Lartillot, N., and Philippe, H. (2004) A Bayesian mixture model for across-site heterogeneities in the amino- 2345 acid replacement process. Molecular Biology and Evolution, 21, 1095-1109.
2346 Lartillot, N., and Philippe, H. (2006) Computing Bayes factors using thermodynamic integration. Systematic 2347 Biology, 55, 195-207.
2348 Lartillot, N., Brinkmann, H., and Philippe, H. (2007) Suppression of long-branch attraction artefacts in the 2349 animal phylogeny using a site-heterogeneous model. BMC Evolutionary Biology, 7, 2350 https://doi.org/10.1186/1471-2148-7-S1-S4.
95
2351 Lartillot, N., Lepage, T., and Blanquart, S. (2009) PhyloBayes 3: a Bayesian software package for phylogenetic 2352 reconstruction and molecular dating. Bioinformatics, 25, 2286-2288. 2353 https://doi.org/10.1093/bioinformatics/btp368.
2354 Lawver, L.A., and Gahagan, L.M., (2003) Evolution of Cenozoic seaways in the circum-Antarctic region. 2355 Palaeogeography Palaeoclimatology Palaeoecology, 198, 11-37.
2356 Lawver, L.A., Gahagan, L.M., and Dalziel, I.W.D (1998) A tight fit-Early Mesozoic Gondwana, a plate 2357 reconstruction perspective. Memoirs of National Institute of Polar Research, 53, 214-229.
2358 Leihy, R.I., Coetzee, B.W.T., Morgan, F., Raymond, B., Shaw, J.D., Terauds, A., Bastmeijer, K., and Chown, S.L., 2359 (2020) Antarctica’s wilderness fails to capture continents biodiversity. Nature, 567, 567-571.
2360 Lepage, T., Bryant, D., Philippe, H., and Lartillot, N., (2007) A general comparison of relaxed molecular clock 2361 models. Molecular Biology and Evolution, 24, 2669-2680.
2362 Lewis, A.R., Marchant, D.R., Ashworth, A.C., Hedenäs, L., Hemming, S.R., Johnson, J.V., Leng, M.J., Machlus, 2363 M.L., Newton, A.E., Raine, J.I., Willenbring, J.K., Williams, M., and Wolfe, A.P., (2008) Mid-Miocene cooling 2364 and the extinction of tundra in continental Antarctica. Proceedings of the National Acdemy of Sciences, 105, 2365 10676-10680.
2366 Lewis, A.R., Marchant, D.R., Ashworth, A.C., Hemming, S.R., and Machlus, M.L., (2007) Major middle 2367 Miocene global climate change: evidence from East Antarctica and the Transantarctic Mountains. Geological 2368 Society of America Bulletin, 119, 1449-1461.
2369 Maas, A., and Waloszek, D., (2001) Cambrian derivitives of the early arthropod stem lineage, pentastomids, 2370 tardigrades and lobopodians an ‘Orsten’ perspective. Zoologischer Anzeiger- a Journal of Comparative 2371 Zoology, 240 (3-4), 451-459.
2372 Mapalo, M., Stec, D., Mirano-Bascos, D., and Michalczyk, Ł. (2016) Mesobiotus philippinicus sp. nov., the first 2373 limnoterrestrial tardigrade from the Philippines. Zootaxa, 4126, 411-426.
2374 Mapalo, M., Stec, D., Mirano-Bascos, D., and Michalczyk, Ł. (2017) An integrative description of a 2375 limnoterrestrial tardigrade from the Philippines, Mesobiotus insanis, new species (Eutardigrada: 2376 Macrobiotidae: harmsworthi group). The Raffles Bulletin of Zoology, 65, 440-454.
2377 Marley, N.J., McInnes, S.J., and Sands, C.J., (2011) Phylum Tardigrada: A re-evaluation of the Parachela. 2378 Zootaxa, 2819, 51-64.
2379 Maslen, N.R., and Convey, P., (2006) Nematode diversity and distribution in the southern maritime Antarctic- 2380 clues to history? Soil Biology and Biochemistry, 38, 3141-3151.
2381 Matzke, N.J. (2013) Probabilistic historical biogeography: new models for founder-event speciation, 2382 imperfect detection, and fossils allow improved accuracy and model-testing. Frontiers of Biogeography, 5, 2383 https://doi.org/10.21425/F5FBG19694
2384 Matzke, N.J. (2014) Model selection in historical biogeography reveals that founder-event speciation is a 2385 crucial process in island clades. Systematic Biology, 63, 951-970.
2386 Mayr, E., (1992) Species concepts and their application. In: Marc Ereshefsky (eds) The Units of Evolution, MIT 2387 Press, Cambridge.
2388 McGaughran, A., Stevens, M.I., Hogg, I.D., and Carapelli, A., (2011) Extreme glacial legacies: a synthesis of 2389 the Antarctic springtail phylogeographic record. Insects, 2, 62-82.
96
2390 McInnes, S.J. (1994) Zoogeographic distribution of terrestrial/freshwater tardigrades from current literature. 2391 Journal of Natural History, 28, 257-352.
2392 McInnes, S.J., and Convey, P., (2005) Tardigrade fauna of the South Sandwhich Islands, maritime Antarctic. 2393 Zootaxa, 1058 (1), DOI: https://doi.org/10.11646/zootaxa.1058.1.3
2394 McInnes, S.J., and Pugh, P.J.A. (2007) An attempt to revisit the global biogeography of limno-terrestrial 2395 Tardigrada. Journal of Limnology, 66, 90-96.
2396 Møbjerg, N., Halberg, K.A., Jørgensen, A., Persson, D., Bjørn, M., Ramløv, H., and Kristensen, R.M. (2011) 2397 Survival in extreme environments - on the current knowledge of adaptations in tardigrades. Acta 2398 Physiologica, 202, 409-420.
2399 Møbjerg, N., Jørgensen, A., Eibye-Jacobsen, J., Halberg, K.A., Persson, D., and Kristensen, R.M. (2007) New 2400 records on cyclomorphosis in the marine eutardigrade Halobiotus crispae (Eutardigrade: Hypsibiidae). 2401 Journal of Limnology, 66, 132-140.
2402 Møbjerg, N., Jørgensen, A., Kristensen, R.M., and Neves, R.C., (2018) Morphology and Functional Anatomy. 2403 In: Schill R. (eds) Water Bears: The Biology of Tardigrades. Zoological Monographs, vol 2. Springer, Cham.
2404 Mörs, T., Reguero, M., and Vasilyan, D., (2020) First fossil frog from Antarctica: implications for Eocene high 2405 latitude climate conditions and Gondwanan cosmopolitanism of Australobatrachia. Scientific Reports, 10, 2406 5051.
2407 Murray, J., (1906) Scottish National Antarctic Expedition: Tardigrada of the South Orkneys. Transactions of 2408 the Royal Society of Edinburgh, 45 Part 2 (12), 323-338.
2409 Murray, J., (1907) Encystment of Tardigrada. Transactions of the Royal Society of Edinburgh, 45 (4), 836-854.
2410 Murray, J., (1910) Tardigrada. Report of scientific investigation of the British Antarctic Expedition, 1907-1909 2411 (E.H. Shackleton). 1, 81-185. London.
2412 Nakamura, T., Yamada, K.D., Tomii, K., and Katoh, K. (2018) Parallelization of MAFFT for large-scale multiple 2413 sequence alignments. Bioinformatics, 34, 2490-2492.
2414 Nei, M., and Kumar, S., (2000). Molecular Evolution and Phylogenetics. Oxford University Press, New York.
2415 Nkem, J.N., Wall, D.H., Virginia, R.A., Barrett, J.E., Broos, E.J., Porazinska, D.L., and Adams, B.J., (2006) Wind 2416 dispersal of soil invertebrates in the McMurdo Dry Valleys, Antarctica. Polar Biology, 29, 346-352.
2417 Ott, M., Zola, J., Aluru, S., and Stamatakis, A. (2007) Large-scale maximum likelihood-based phylogenetic 2418 analysis on the IBM BlueGene/L. Proceedings of ACM/IEEE Supercomputing conference 2007, DOI: 2419 10.1145/1362622.1362628.
2420 Pante, E., Puillandre, N., Viricel, A., Arnaud-Haond, S., Aurelle, D., Castelin, M., Chenuil, A., Destombe, C., 2421 Forcioli, D., Valero, M., Viard, F., and Samadi, S., (2014) Species are hypotheses: avoid connectivity 2422 assesments based on pillars of sand. Molecular Ecology, 24 (3), 525-544.
2423 Pilato, G., and Binda, M.G., (1997) Acutuncus, a new genus of Hypsibiidae (Eutardigrada). Entomologische 2424 Mitteilungen aus dem Zoologischen, 12, 159-162.
2425 Pires, A.C., and Marinoni, L., (2010) DNA barcoding and traditional taxonomy unified through Integrative 2426 Taxonomy: a view that challenges the debate questioning both methodologies. Biota Neotropica, 10 (2), 2427 339-346.
97
2428 Prendini, L., Weygoldt, P., and Wheeler, W.C., (2005) Systematics of the Damon variegatus group of African 2429 whip spiders (Chelicerata: Amblypygi): evidence from behaviour, morphology and DNA. Organisms, Diversity 2430 and Evolution, 5, 203–236.
2431 Pugh, P.J.A., (1993) A synonymic catalogue of the Acari from Antarctica, the sub-Antarctic Islands and the 2432 Southern Ocean. Journal of Natural History, 27, 323-421.
2433 Pugh, P.J.A., (1997) Acarine colonisation of Antarctica and the islands of the Southern Ocean: the role of 2434 zoohoria. Polar Record, 33(185), 113-122.
2435 Pugh, P.J.A., and Convey, P., (2008) Surviving out in the cold: Antarctic endemic invertebrates and their 2436 refugia. Journal of Biogeography, 35, 2176-2186.
2437 R Core Team (2019). R: A language and environment for statistical computing. R Foundation for Stati-stical C 2438 omputing, Vienna, Austria. https://www.R-project.org/. 2439 2440 Rambaut, A., Drummond, A.J., Xie, D., Baele, G., and Suchard, M.A., (2018) Posterior summarisation in 2441 Bayesian phylogenetics using Tracer 1.7. Systematic Biology. syy032. doi:10.1093/sysbio/syy032
2442 Rebecchi, L., Boschini, D., Cesari, M., Lencioni, V., Bertolani, R., and Guidetti, R. (2009) Stress response of a 2443 boreo-alpine species of tardigrade, Borealibius zetlandicus (Eutardigrada, Hypsibiidae). Journal of Limnology, 2444 68, 64-70.
2445 Ree, R.H., and Smith, S.A. (2008) Maximum likelihood inference of geographic range evolution by dispersal, 2446 local extinction, and cladogenesis. Systematic Biology, 57, 4-14.
2447 Regier, J.C., Shultz, J.W., Kambic, R.E., and Nelson, D.R., (2004) Robust support for tardigrades cl-ades and 2448 their ages from three protein-coding nuclear genes. Invertebrate Biology, 123, 93-100.
2449 Richters, F., (1904) Vorläufiger Bericht über die anktartische Moosfauna. Verhandlungen der Deutschen 2450 Zoologischen Gesellschaft, 14, 236-239.
2451 Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D.L., Darling, A., Höhna, S., Larget, B., Liu, L., Suchard, 2452 M.A., and Huelsenbeck, J.P. (2012). MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice 2453 across a large model space. Systematic Biology, 61, 539-542.
2454 Rossi, G., Claps, M., and Ardohain, D. (2009) Tardigrades from northwestern Patagonia (Neuquén Province, 2455 Argentina) with the description of three new species. Zootaxa, 2095, 21–36.
2456 Roszkowska, M., Stec, D., Gawlak, M., and Kaczmarek, Ł. (2018) An integrative description of a new 2457 tardigrade species Mesobiotus romani sp. nov. (Macrobiotidae: harmsworthi group) from the Ecuadorian 2458 Pacific coast. Zootaxa, 4450, 550-564.
2459 Rozas, J., Ferrer-Mata, A., Sánchez-DelBarrio, J.C., Guirao-Rico, S., Librado, P., Ramos-Onsins, S.E., and 2460 Sánchez-Gracia, A., (2017) DnaSP v6: DNA sequence polymorphism analysis of large datasets. Molecular 2461 Biology and Evolution, 34, 3299-3302.
2462 Sands, C.J., McInnes, S.J., Marley, N.J., Goodall-Copestake, W.P., Convey, P., and Linse, K., (2008a). Phylum 2463 Tardigrada: an “individual” approach. Cladistics, 24, 861-871.
2464 Sands, C.J., Convey, P., Linse, K., and McInnes, S.J., (2008b) Assessing meiofaunal variation among individuals 2465 utilising morphological and molecular approaches: an example using the Tardigrada. BMC Ecology, 8, doi: 2466 10.1186/1472-6785-8-7.
98
2467 Schill, R.O., and Steinbrück, G. (2007) Identification and Differentiation of Heterotardigrada and Eutardigrada 2468 species by riboprinting. Journal of Zoological Systematics and Evolutionary Research, 45, 184-190.
2469 Shaw, J.D., Terauds, A., Riddle, M.J., Possingham, H.P., and Chown, S.L., (2014) Antarctica’s Protected Areas 2470 Are Inadequate, Unrepresentative, and at Risk. PLoS Biology 12(6): e1001888. 2471 https://doi.org/10.1371/journal.pbio.1001888.
2472 Smith, R.I.L.., (1984) Terrestrial plant biology of the sub-Antarctic and Antarctic. In: Laws, R.M., 2473 (ed.) Antarctic Ecology, vol. 1. London, Academic Press, 61-162.
2474 Sohlenius, B., Boström, S., and Jönsson, I., (2004) Occurrence of nematodes, tardigrades and rotifers on ice- 2475 free areas in East Antarctica. Pedobiologica, 48, 395-408.
2476 Stamatakis, A. (2006) RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of 2477 taxa and mixed models. Bioinformatics, 22, 2688-2690.
2478 Stec, D., and Kristensen, R.M. (2017) An integrative description of Mesobiotus ethiopicus sp. nov. 2479 (Tardigrada: Eutardigrada: Parachela: Macrobiotidae: harmsworthi group) from the northern Afrotropic 2480 region. Turkish Journal of Zoology, 41, 800-811.
2481 Stec, D., Roszkowska, M., Kaczmarek, Ł., and Michalczyk, Ł. (2018) An integrative description of a population 2482 of Mesobiotus radiates (Pilato, Binda & Catanzaro, 1991) from Kenya. Turkish Journal of Zoology, 42, 523- 2483 540.
2484 Stec, D., Roszkowska, M., Kaczmarek, Ł., and Michalczyk, Ł. (2018) Paramacrobiotus lachowskae, a new 2485 species of Tardigrada from Colombia (Eutardigrada: Parachela: Macrobiotidae). New Zealand Journal of 2486 Zoology, 45, 43-60.
2487 Stec, D., Smolak, R., Kaczmarek, Ł., and Michalczyk, Ł. (2015) An integrative description of Macrobiotus 2488 paulinae sp. nov. (Tardigrada: Eutardigrada: Macrobiotidae: hufelandi group) from Kenya. Zootaxa, 4052, 2489 501-526.
2490 Stec, D., Zawierucha, K., and Michalczyk, Ł., (2017) An integrative description of Ramazzottius subanomalus 2491 (Biserov, 1985) (Tardigrada) from Poland. Zootaxa, 4300(3), 403–420.
2492 Stevens, M.I., Frati, F., McGaughran, A., Spinsanti, G., and Hogg, I.D., (2007) Phylogeographic 2493 structure suggests multiple glacial refugia in northern Victoria Land for the endemic Antarctic 2494 springtail Desoria klovstadi (Collembola, Isotomidae). Zoologica Scripta, 36, 201-212. 2495 2496 Storey, B.C., (1995) The role of mantle plumes in continental breakup: case histories from Gondwanaland. 2497 Nature, 377, 301-308.
2498 Storey, B.C., Dalziel, I.W.D., Garrett, S.W., Grunow, S.W., Pankhurst, R.J., and Vennum, W.R., (1988) West 2499 Antarctica in Gondwanaland: Crustal blocks, reconstruction and breakup processes. Tectonophysics, 155, 2500 381-390.
2501 Sugden, D.E., Bentley, M.J., and Ó Cofaigh, C., (2006) Geological and geomorphological insights into Antarctic 2502 Ice Sheet evolution. Philosophical Transactions of the Royal Society A, 364, 1607-1625.
2503 Tajima, F., (1989) Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. 2504 Genetics, 123, 585-595.
2505 Tamura K., Nei M., and Kumar S. (2004) Prospects for inferring very large phylogenies by using the neighbor- 2506 joining method. Proceedings of the National Academy of Sciences (USA), 101, 11030-11035.
99
2507 Tavaré, S., (1986) Some probabilistic and statistical problems in the analysis of DNA sequences. Some 2508 Mathematical Questions in Biology: DNA Sequence Analysis, 17, 57-86.
2509 Templeton, A.R., Crandall, K.A., and Sing, C.F., (1992) A cladistic analysis of phenotypic associations with 2510 haplotypes inferred from restriction endonuclease mapping and DNA sequence data. III. Cladogram 2511 estimation. Genetics, 132, 619-633.
2512 Terauds, A., and Lee, J.R., (2016) Antarctic biogeography revisited: updating the Antarctic Biogeographic 2513 Regions. Diversity and Distributions, Biodiversity Letter, 22, 836-840.
2514 Terauds, A., Chown, S.L., Morgan, F., Peat, H.J., Watts, D.J., Keys, H., Convey, P., and Bergstrom, D.M., (2012) 2515 Conservation biogeography of the Antarctic. Diversity and Distributions, 18, 726-741.
2516 Tripati, A., Backman, J., Elderfield, H., and Ferretti, P., (2005) Eocene bipolar glaciation associated with global 2517 carbon cycle changes. Nature, 436, 341-346.
2518 Tsujimoto, M., Mcinnes, S.J., Convey, P., and Imura, S., (2014) Preliminary description of tardigrade species 2519 diversity and distribution pattern around coastal Syowa Station and inland Sør Rondane Mountains, 2520 Dronning Maud Land, East Antarctica. Polar Biology, 37, 1361-1367.
2521 Tsujimoto, M., Suzuki A.C., and Imura, S., (2015) Life history of the Antarctic tardigrade, Acutuncus 2522 antarcticus, under a constant laboratory environment. Polar Biology, 38, 1718-1725.
2523 van Vuuren, B.J., Lee, J.E., Convey, P., and Chown, S.L., (2018) Conservation implications of spatial genetic 2524 structure in two species of oribatid mites from the Antarctic Peninsula and the Scotia Arc. Antarctic Science. 2525 Doi:10.1017/S0954102017000529.
2526 Vaughn, A.P.M., and Pankhurst, R.J., (2008) Tectonic overview of the West Gondwana margin. Gondwana 2527 Research, 13, 150-162.
2528 Vecchi, M., Cesari, M., Bertolani, R., Jönsson, K.I., Rebecchi, L., and Guidetti, R. (2016) Integrative systematics 2529 studies on tardigrades from Antarctica identify new genera and new species within Macrobiotoidea and 2530 Echiniscoidea. Invertebrate Systematics, 30, 303-322.
2531 Vega, G.C., Convey, P., Hughes, K.A., and Olalla –Tárraga, M.A., (2019) Humans and wind, shaping Antarctic 2532 soil arthropod diversity. Insect Conservation and Diversity, doi: 10.1111/icad.12375.
2533 Velasco-Castrillón, A., Gibson, J.A.E., and Stevens, M.I., (2014). A review of current Antarctic limno-terrestrial 2534 microfauna. Polar Biology, 37, 1517-1531.
2535 Velasco-Castrillon, A., Sands, C.J., McInnes, S.J., Schultz, M.B., Arroniz-Crespo, M., D'Haese, C.A., Gibson, 2536 J.A.E., Adams, B.J., Page, T.J., Austin, A.D., Cooper, S.J.B., and Stevens, M.I. (2015) Mitochondrial DNA reveals 2537 hidden diversity for tardigrades from across the Antarctic realm. Invertebrate Systematics, 29, 578-590.
2538 Welnicz, W., Grohme, M.A., Kaczmarek, Ł., Schill, R.O., and Frohme, M. (2011) ITS-2 and 18S rRNA data from 2539 Macrobiotus polonicus and Milnesium tardigradum (Eutardigrada, Tardigrada). Journal of Zoological 2540 Systematics and Evolutionary Research, 49, 34-39.
2541 Wilkins, J., (2011) Philisophically speaking, how many species concepts are there? Zootaxa, 2765, 58-60.
2542 Yang, Z. (1994) Maximum likelihood phylogenetic estimation from DNA sequences with variable rates over 2543 sites: Approximate methods. Journal of Molecular Evolution, 39, 306-314.
2544 Yoshimoto, C.M., Gressitt, J.L., and Mitchell, C.J., (1962) Trapping of air-borne insects in the Pacific-Antarctic 2545 area, 1. Pacific Insects, 4, 847-858.
100
2546 Yoshimoto, C.M., and Gressitt, J.L., (1963) Trapping of air-borne insects in the Pacific-Antarctic area, 2. 2547 Pacific Insects, 5, 873-883.
2548 Zaccara S., Patiño J., Convey P., Vanetti I., Cannone N. (2020) Multiple colonization and dispersal events hide 2549 the early origin and induce a lack of genetic structure for Bryum argenteum in Antarctica. Ecology and 2550 Evolution. doi: 10.1002/ece3.6601.
2551 Zawierucha, K., Kolicka, M., and Kaczmarek, Ł. (2016) Re-description of the Arctic tardigrade Tenuibiotus 2552 voronkovi (Tumanov, 2007) (Eutardigrada; Macrobiotidea), with the first molecular data for the genus. 2553 Zootaxa, 4196, 498-510.
2554 Zawierucha, K., Stec, D., Dorota, Lachowska-Cierlik, D., Takeuchi, N., Li, Z., and Michalczyk, Ł. (2018) High 2555 mitochondrial diversity in a new water bear species (Tardigrada: Eutardigrada) from mountain glaciers in 2556 central Asia, with the erection of a new genus Cryoconicus. Annales Zoologici, 68, 179-201.
2557 Zhang, C., Rabiee, M., Sayyari, E., and Mirarab, S., (2018) ASTRAL-III: polynomial time species tree 2558 reconstruction from partially resolved gene trees. BMC Bioinformatics, 19 (153), 2559 https://doi.org/10.1186/s12859-018-2129-y.
2560
2561
2562
2563
2564
2565
2566
2567
2568
2569
2570
2571
2572
2573
101
2574 Supplementary Material
2575 S1. Chapter One
2576 Table S1.1: Acutuncus antarcticus and Mesobiotus furciger sequences used in this study and their geographic
2577 area of origin.
Species Location Collection Accession Number Coding Region Date
Acutuncus Deception Island 24/02/2010 This Study 18S, 28S, COX1 antarcticus
Acutuncus James Ross Island 18/01/2006 This Study 28S antarcticus
Acutuncus King George Island EF632432 18S antarcticus
Acutuncus Livingston Island 16/01/2008 This Study 18S, 28S, COX1 antarcticus
Acutuncus Shackleton JX865305 COX1 antarcticus Mountains (Dronning Maud Land)
Acutuncus Signy Island 22/03/2006 This Study 18S, 28S, COX1 antarcticus
Acutuncus South Georgia EU266944 18S antarcticus
Mesobiotus Alexander Island JX865314 COX1 furciger
Mesobiotus Charcot Island EU266928, 18S, COX1 furciger JX865306
Mesobiotus King George Island EU266927 18S furciger
Mesobiotus Litchfield Island This Study 18S, 28S furciger
Mesobiotus Signy Island EU266929, 18S, COX1 furciger JX865308
Mesobiotus South Georgia This study COX1 furciger
102
2578 Table S1.2: All species used in this study with their GenBank accession numbers, the coding regions used,
2579 and original reference.
Species Accession Number Coding Reference Region
Adorybiotus granulatus HQ604961 18S Bertolani et al. (2014)
Adropion sp. HQ604931 18S Bertolani et al. (2014)
Apodibius confusus KC582830, KC582834 18S, 28S Dabert et al. (2014)
Astatumen trinacriae FJ435731, FJ435773, 18S, 28S, Guil and FJ435790 COX1 Giribet (2012)
Bertolanius nebulosus GQ849023, GQ849046 18S, 28S Jorgensen et al. (2010)
Bertolanius volubilis HQ604918 18S Bertolani et al. (2014)
Bertolanius weglarskae HQ604920 18S Bertolani et al. (2014)
Borealibius zetlandicus HQ604923, FJ184601 18S, COX1 Bertolani et al. (2014), Rebecchi et al. (2009)
Calohypsibius ornatus HQ604914 18S Bertolani et al. (2014)
Calohypsibius sp. (Antarctic) EU266942 18S Sands et al. (2008a)
Cryobiotus klebelsbergi KC582833, KT901830 18S, 28S Dabert et al. (2014) Dabert et al. (Direct submission, 2015)
Cryoconicus kaczmareki MG432796, MG432797 18S, 28S Zawierucha et al. (2018)
Dactylobiotus ambiguus GQ925676, EF632523 18S, COX1 Chen et al. (2009), Sands et al. (2011)
103
Dactylobiotus octavi GQ849025, GQ849049 18S, 28S Jorgensen et al. (2010)
Dactylobiotus HQ604963, AY598771 18S, COX1 Bertolani et al. parthenogeneticus (2014), Guidetti et al. (2005)
Diaforobiotus islandicus HQ604972, KT778705 18S, 28S Bertolani et al islandicus (2014), Guidetti et al. (2016)
Diphascon higginsi HQ604932 18S Bertolani et al. (2014)
Diphascon pingue HQ604938, FJ435776, 18S, 28S, Bertolani et al. FJ435793 COX1 (2014), Guil and Giribet (2012)
Diphascon puniceum EU266946, KP013597 18S, COX1 Sands et al. (2008a), Velasco- Castrillon et al. (2015)
Doryphoribius flavus HQ604940, KT778610 18S, 28S Bertolani et al. (2014), Cesari et al. (2016)
Doryphoribius macrodon HQ604942, KT778611 18S, 28S Bertolani et al. (2014), Cesari et al. (2016)
Eohypsibius nadjae HQ604921 18S Bertolani et al. (2014)
Eremobiotus alicatai FJ435722, FJ435766, 18S, 28S, Guil and FJ435796 COX1 Giribet (2012)
Grevenius granulifer EF620403, EF620405 18S, 28S Mobjerg et al. (2007)
Grevenius pushkini KU513419 COX1 Kosztyla et al. (2016)
Halobiotus crispae EF620401, EF620408, 18S, 28S, Mobjerg et al. EF620412 COX1 (2007)
104
Halobiotus stenostomus AY582121 18S Jorgensen and Kristensen (2004)
Haplomacrobiotus utahensis KT778601, KT778605 18S, 28S Cesari et al. (2016b)
Hebesuncus conjugens AM500646 18S Kiehl et al. (2007)
Hebesuncus ryani EU266956 18S Sands et al. (2008a)
Hexapodibius micronyx HQ604915, KT778606 18S, 28S Bertolani et al. (2014), Cesari et al. (2016)
Hypsibius convergens FJ435726, FJ435771 18S, 28S Guil and Giribet (2012)
Hypsibius dujardini HQ604943 18S Bertolani et al. (2014)
Hypsibius pallidus HQ604945 18S Bertolani et al. (2014)
Hypsibius scabropygus KC582831 18S Dabert et al. (2014)
Isohypsibius cambrensis AM500652 18S Kiehl et al. (2007)
Isohypsibius dastychi HQ604954, KC776525 18S, 28S Bertolani et al. (2014)
Isohypsibius prosostomus EF620404, EF620406, 18S, 28S, Mobjerg et al. EF620416 COX1 (2007)
Isohypsibius verrucosus MG800855, MG800856 18S, 28S Gasiorek et al. (unpublished 2018)
Itaquascon placophorum HQ604946 18S Bertolani et al. (2014)
Macrobiotus furcatus FJ435747, FJ435758, 18S, 28S, Guil and FJ435802 COX1 Giribet (2012)
Macrobiotus gr.hufelandi HQ604971, FJ435755, 18S, 28S, Bertolani et al. FJ435806 COX1 (2014), Guil and Giribet (2012)
105
Macrobiotus joannae HQ604974 18S Bertolani et al. (2014)
Macrobiotus kristenseni KC193577 18S Guidetti et al. (2013)
Macrobiotus macrocalix HQ604976 18S Bertolani et al. (2014)
Macrobiotus nelsonae HQ604965 18S Bertolani et al. (2014)
Macrobiotus pallarii FJ435741, FJ435756, 18S, 28S, Guil and FJ435807 COX1 Giribet (2012)
Macrobiotus paulinae KT935502, KT935501 18S, 28S Stec et al. (2015)
Macrobiotus persimilis EU244608 COX1 Schill (Direct submission, 2007)
Macrobiotus polonicus HM187580 18S Welnicz et al. (2011)
Macrobiotus sapiens DQ839601 18S Schill and Steinbrück (2007)
Mesobiotus ethiopicus MF678793, MF678792, 18S, 28S, Stec and MF678794 COX1 Kristensen (2017)
Mesobiotus fiedleri MH681693, MH681585 18S, 28S Kaczmarek et al. (2020)
Mesobiotus furciger EU266927, JX865308 18S, COX1 Sands et al. (2008a), Czechowski et al. (2012)
Mesobiotus furciger Norway MH197148, MH197265 18S, 28S Kaczmarek et al. (2018)
Mesobiotus gr.harmsworthi HQ604968 18S Bertolani et al. (2014)
Mesobiotus hilariae KT226068, KT226108 18S, COX1 Vecchi et al. (2016)
Mesobiotus insanis MF441488, MF441489, 18S, 28S, Mapalo et al. MF441491 COX1 (2017)
106
Mesobiotus mottai KT226072, KT226080 18S, 28S Vecchi et al. (2016)
Mesobiotus occultatus MH197147 18S Kaczmarek et al. (2018)
Mesobiotus philippinicus KX129793, KX129794, 18S, 28S, Mapalo et al. KX129796 COX1 (2016)
Mesobiotus polaris KT226075, KT226087 18S, 28S Vecchi et al. (2016)
Mesobiotus radiatus MH197153, MH197152, 18S, 28S, Stec et al. MH195147 COX1 (2018)
Mesobiotus romani MH197158, MH197151, 18S, 28S, Roszkowska et MH195149 COX1 al. (2018)
Mesocrista revelata KU528627, KX347536 18S, 28S Gasiorek et al. (2016)
Mesocrista spitzbergensis KX347532, KX347533 18S, 28S Gasiorek et al. (2016)
Microhypsibius cf.bertolanii HQ604991 18S Bertolani et al. (2014)
Milnesium tardigradum GQ925695, FJ435780, 18S, 28S, Chen et al. EU244603 COX1 (2009), Guil and Giribet (2012), Schill (Direct submission, 2007)
Minibiotus gr.intermedius HQ604979 18S Bertolani et al. (2014)
Minibiotus gumersindoi FJ435748, FJ435761, 18S, 28S, Guil and FJ435803 COX1 Giribet (2012)
Mixibius saracenus HQ604955 18S Bertolani et al. (2014)
Murrayon dianeae FJ435737, FJ435762, 18S, 28S, Guil and FJ435801 COX1 Giribet (2012)
Murrayon pullari GQ849026, GQ849050, 18S, 28S, Jorgensen et AY598772 COX1 al. (2010), Guidetti et al. (2005)
107
Paramacrobiotus areolatus DQ839602 18S Schill and Steinbrück (2007)
Paramacrobiotus lachowskae MF568532, MF568533 18S, 28S Stec et al. (2017)
Paramacrobiotus richtersi DQ839603, FJ435808 18S, COX1 Schill and Steinbrück
(2007), Guil and Giribet (2012)
Paramacrobiotus tonollii U32393, EU244609 18S, COX1 Garey et al. (1996), Schill (Direct submission, 2007)
Pilatobius nodulosus HQ604934 18S Bertolani et al. (2014)
Pilatobius patanei HQ604935 18S Bertolani et al. (2014)
Pilatobius ramazzottii HQ604939 18S Bertolani et al. (2014)
Platicrista angustata HQ604948 18S Bertolani et al. (2014)
Pseudobiotus kathmanae HQ604957, KC776526 18S, 28S Bertolani et al. (2014)
Pseudobiotus megalonyx HQ604959, KT778612 18S, 28S Bertolani et al. (2014), Cesari et al. (2016)
Ramazzottius oberhaeuseri AY582122, FJ435769, 18S, 28S, Jorgensen and EU251379 COX1 Kristensen (2004), Guil and Giribet (2012), Faurby et al. (2008)
Ramazzottius varieornatus HQ604950, MG432818 18S, 28S Bertolani et al. (2014), Zawierucha et al. (2018)
Richtersius coronifer AY582123, GQ849048, 18S, 28S, Jorgensen and AY598780 COX1 Kristensen (2004),
108
Jorgensen et al. (2010), Guidetti et al. (2005)
Tenuibiotus voronkovi KX810045, KX810049, 18S, 28S, Zawierucha et KX810042 COX1 al. (2016)
Thulinius augusti KF360230, KT778613 18S, 28S Bertolani et al. (2014b), Cesari et al. (2016)
Thulinius stephaniae AF056023, EF620407, 18S, 28S, Garey et al. EF620417 COX1 (1999), Mobjerg et al. (2007)
Xerobiotus pseudohufelandi HQ604989, AY598776 18S, COX1 Bertolani et al. (2014), Guidetti et al. (2005)
2580
2581
2582
2583
2584
2585
2586
2587
2588
2589
2590
2591
109
2592 Table S1.3: Geographic codes for the ancestral biogeographic states used in the BioGeoBears analysis.
Area Map Code Geographic Code
Palearctic PA A
Nearctic NA B
Neotropical NT C
Afrotropical AT D
Oriental OL E
Australasian AU F
Pacific Oceanic Islands PAC G
Antarctica ANT H
2593
2594
2595
2596
2597
2598
2599
2600
2601
2602
2603
2604
2605
110
2606 Table S1.4: Geographic codes for combined ancestral biogeographic states to reduce noise in the
2607 BioGeoBears anlaysis.
Combination of Ranges Geographic Code
PA + NA I
NT + AT J
OL +AU K
PA + NA + NT L
PA + NA + NT + AT M
PA + NA + NT + AT + OL N
PA + NA + NT + AT + OL + AU O
PA + NA + NT + AT + OL + AU + PAC P
PA + NA + NT + OL + AU Q
PA + NT R
PA + NA + NT + AU S
PA + NA + AT T
PA + NA + NT + AU U
PA + NA + NT + AU + PAC V
PA + NA + NT + AT + AU W
PA + NA + OL + AU X
PA + NA + NT + OL + PAC Y
PA + AT + AU $
PA + AU £
PA+NT+AT+OL %
Found in all regions (Globally Cosmopolitan) Z
2608
111
2609
2610 Figure S1.1: BioGeoBears DEC model output; the codes are described in Tables S1.3 and S1.4. The green H 2611 represents Antarctic/Gondwanan ancestral state nodes.
2612
112
2613 2614 Figure S1.2: BioGeoBears DEC with Jump parameter model output; the codes are described in Tables S1.3 2615 and S1.4. The green H represents Antarctic/Gondwanan ancestral state nodes.
2616
113
2617
2618 Figure S1.3: BioGeoBears BAYAREALIKE model output; the codes are described in Tables S1.3 and S1.4. The 2619 green H represents Antarctic/Gondwanan ancestral state nodes.
2620
114
2621
2622 Figure S1.4: BioGeoBears BAYAREALIKE with Jump parameter model output; the codes are described in 2623 Tables S1.3 and S1.4. The green H represents Antarctic/Gondwanan ancestral state nodes.
2624
2625
2626
2627
2628
2629
2630
115
2631 S2. Chapter Two
2632
116
2633 Figure S2.1 Phylogenetic analysis of Acutuncus antarcticus COX1 sequences using a GTR+G model under both
2634 Maximum Likelihood (bootstrap value below branch) and Bayesian (posterior probability values above
2635 branch) analyses.
2636
2637
2638
2639
2640
2641
2642
2643
2644
2645
2646
2647
2648
2649
2650
2651
2652
2653
117
2654 Table S2.1: Collection details for samples obtained from continental Antarctica used in this study.
Locality Latitude; No. of Area Code longitude specimens
Larsemann 69⁰35.772'S; 11 LH Hills 76⁰14.304'E (Broknes Peninsula)
Larsemann 69⁰20.184'S'; 4 LH Hills 76⁰56.388'E (Broknes Peninsula) 2
Larsemann 69⁰33.048'S; 21 LH Hills (Island 76⁰8.712'E
1) Larsemann 69⁰15.66'S; 1 LH Hills 76⁰40.392'E (Stornes Peninsula) Larsemann 69⁰6.516'S; 1 LH Hills 76⁰11.616'E (Stornes Peninsula) 2
Hop Island 68⁰48.792'S; 8 HI 77⁰39.624'E
Hop Island 68⁰16.764'S; 6 HI (2) 77⁰19.308'E Mawson 67⁰13.72'S; 13 MS Station 62⁰17.69'E Sansom 69⁰36.216'S; 25 SS Island 73⁰45.996'E
Casey 66⁰54.264'S; 3 CS Station 110⁰8.088'E Casey 66⁰58.692'S; 7 CS Station (2) 110⁰37.812'E Casey 66⁰48.324'S; 1 CS Station (3) 110⁰19.56'E
Mather 68⁰15.372'S; 30 MP Peninsula 77⁰23.928'E
118
Shackleton 80⁰59.5’S; 1 SH Mountains 24⁰59.9’W Dufek 72⁰59.0’S; 5 DM Massif 24⁰00.6’E
Total 137 2655
2656
2657
2658
2659
2660
2661
2662
2663
2664
2665
2666
2667
2668
2669
2670
2671
119
2672 Table S2.2: Collection details for samples obtained from maritime Antarctica used in this study.
2673
Locality Latitude; No. of Area Code longitude specimens
Half-Moon 62⁰35.508'S; 4 HM Island 59⁰54.720'W Kerr Point, 62⁰42.383'S; 4 KP Ronge 62⁰38.252W Island Dutherier, 64⁰48.426'S; 5 DU Palmer Land 62⁰49.09'W
Neko 64⁰50.632'S; 19 NH Harbour 62⁰31.640'W
Cuverville 64⁰41.055'S; 9 CI Island 62⁰37.657'W Livingston 62⁰03.5’S; 3 LI Island 60⁰28.5’W James Ross 64⁰58.45’S; 21 JR Island 57⁰00.8’W
Signy Island 60⁰59.5’S; 1 SI 45⁰00.9’W Total 66 2674
2675
2676
2677
2678
2679
2680
120
2681 Table S2.3: Collection details for samples retrieved from GenBank used in this study.
Locality Latitude; CO1 No. of Area Code longitude GenBank specimens accession number
Sør Rondane 72°2′S; 23°17′E JX296183- 36 SR Mountains and 71° 54′S, 218 24° 33′E
Skarvsnes 69⁰29.571'S; AB753792 1 SK 39⁰37.818'E Bunger Hills 66⁰18.116'S; JX486021, 3 BH 104⁰35.123'E JX486023-4 McMurdo 77⁰49.641'S; JX486022 1 MM Sound 165⁰0.035'E
Chapman 67⁰24.952'S; JX486025 1 CR Ridge 60⁰58.912E Cape Hallet 72⁰19.137'S; KT898827- 10 CH 170⁰13.745'E 36 Crater 72⁰36.206'S; KT898837- 10 CC Cirque 169⁰20.903'E 46
Edmonson 74⁰19.772'S; KY898847- 8 EP Point 165⁰06.069'E 54 Terranova 74⁰42.580'S; KT898855- 10 TB Bay 164⁰06.086 64 Inexpressible 74⁰53.022'S; KT898865- 10 II Island 163⁰43.057'E 74
Granite 75⁰06.264'S; KT898875- 10 GH Harbour 163⁰25.772'E 84 Dry Valley 77⁰36.493'S; KT898885- 7 DV 163⁰15.222'E 91 Total 107
2682
2683
2684
2685
121
2686 S3. Chapter 3
2687 Table S3.1: Mesobiotus furciger 18S sequences used in this study and their geographic area of origin.
Latitude; No. of Locality longitude specimens Acession No. Species 70°14.00'S; Reinbolt Hills 2 72°34.00'E this study M. furciger Prince 70°3.90'S; Charles 3 68°14.2'E Mountains 1 this study M. furciger Prince 70°1.80'S; Charles 4 67°38.8'E Mountains 2 this study M. furciger Litchfield 64⁰58.9’S; 4 Island 64⁰00.3’W this study M. furciger Half-Moon 62⁰35.508'S; 4 Island 59⁰54.720'W this study M. furciger Palmer Station 64⁰27.05’S; 6 (Anvers 64⁰13.6’W Island) this study M. furciger Kerr Point, 64⁰42.383'S; 2 Ronge Island 62⁰38.252W this study M. furciger Almirante Brown 64°54.10'S; 1 (Danco 62°51.5'W Coast) this study M. furciger 64°9.914'S; Cierva Cove 3 60°53.69'W this study M. furciger Edgell Bay 62°14.87'S; (Nelson 2 58°59.2'W Island) this study M. furciger Duthiers Point 64°48.426'S; 1 (Palmer 62°49.09'W Land) this study M. furciger King George 61⁰58.8’S; 1 EU266927 Island 58⁰52.8’W Mesobiotus sp. 60⁰59.5’S; Signy Island 1 45⁰00.9’W EU266929 Mesobiotus sp. Charcot 69°37.65’S; 1 Island 75°22.2’W EU266928 Mesobiotus sp. Charcot 69°37.65’S; 1 Island 75°22.2’W EF632471 Mesobiotus sp. Charcot 69°37.65’S; 1 Island 75°22.2’W EF632470 Mesobiotus sp.
122
Crater Cirque 72°36.207’S; 1 (Victoria 169°20.945’E Land) KT226072 M. mottai Dronning 70°46.557’S; 1 Maud Land 11°48.837’E KT226068 M. hilariae Dronning 70°46.557’S; 1 Maud Land 11°48.837’E KT226069 M. hilariae Dronning 70°46.657’S; 1 Maud Land 11°49.063 KT226070 M. hilariae Dronning 70°45.566’S; 1 Maud Land 11°46.899’E KT226071 M. hilariae Vegetation Island 74°47.033’S; 1 (Victoria 163°38.745’E Land) KT226075 M. polaris Vegetation Island 74°47.033’S; 1 (Victoria 163°38.745’E Land) KT226076 M. polaris Inexpressible Island 74°53.022’S; 1 (Victoria 163°43.057’E Land) KT226077 M. polaris Inexpressible Island 74°53.022’S; 1 (Victoria 163°43.057’E Land) KT226078 M. polaris Sør Rondane 73⁰29.8’S; 1 Mountains 11⁰28.4’W JX296290 Mesobiotus sp. South 54⁰58.15’S; 1 Georgia 36⁰03.4’W EU266926 Mesobiotus sp. 2688
2689
2690
2691
2692
2693
2694
123
2695 Table S3.2: Other Mesobiotus species 18S sequences used in this study and their geographic area of origin.
Locality Acession No. Species Mesobiotus Europe HQ604967 harmsworthi Mesobiotus Europe HQ604968 harmsworthi Mesobiotus Europe HQ604969 harmsworthi Mesobiotus Europe HQ604970 harmsworthi Mesobiotus Italy KT226073 harmsworthi Mesobiotus Italy KT226074 harmsworthi Philippines MF441488 Mesobiotus insanis Mesobiotus Philippines KX129793 philippinicus Ethiopia MF678793 Mesobiotus ethiopicus 2696
2697
2698
2699
2700
2701
2702
2703
2704
2705
2706
2707
124
2708 Table S3.3: Outgroup species 18S sequences used in this study.
Acession No. Species Milnesium HM187581 tardigradum Macrobiotus FJ435741 pallarii Paramacrobiotus FJ435744 richtersi
EF632477 Macrobiotus sp.
Macrobiotus X81442 hufelandi
U49912 Macrobiotus sp.
Paramacrobiotus DQ839605 tonollii Paramacrobiotus DQ839602 areolatus
U32393 Macrobiotus sp.
Macrobiotus HM187580 polonicus Macrobiotus HQ604976 macrocalix Macrobiotus HQ604966 nelsonae Macrobiotus HQ604975 joannae Macrobiotus HQ604974 joannae Macrobiotus MG757132 shonaicus Macrobiotus KC193577 kristenseni Macrobiotus DQ839601 sapiens Macrobiotus KY797265 scoticus Macrobiotus KT935502 paulinae Macrobiotus KX810008 polypiformis Dioforobiotus HQ604973 islandicus islandicus
125
Dioforobiotus HQ604972 islandicus islandicus Acutuncus LC089868 antarcticus Calohypsibius MH279652 ornatus Diphascon EU266949 puniceum Eohypsibius HQ604921 nadjae Isohypsibius AM500652 cambrensis 2709
2710
2711
2712
2713
2714
2715
2716
2717
2718
2719
2720
2721
2722
126
2723 Table S3.4: Mesobiotus furciger type COX1 sequences used in this study, their geographic area of origin and
2724 area code for haplotype analysis.
Latitude; No. of Area Code Locality Acession No. Species longitude specimens Half-Moon 62⁰35.508'S; HMI 1 Island 59⁰54.720'W this study M. furciger Palmer PSAI Station 64⁰27.05’S; 2 (Anvers 64⁰13.6’W Island) this study M. furciger Kerr Point, KPRI 64⁰42.383'S; Ronge 2 62⁰38.252W Island this study M. furciger Almirante ABDC Brown 64°54.10'S; 2 (Danco 62°51.5'W Coast) this study M. furciger Cierva 64°9.914'S; CC 3 Cove 60°53.69'W this study M. furciger Edgell Bay EBNI 62°14.87'S; (Nelson 2 58°59.2'W Island) this study M. furciger Reinbolt 70°14.00'S; RH 1 Hills 72°34.00'E this study M. furciger Prince PCM1 Charles 70°3.90'S; 4 Mountains 68°14.2'E 1 this study M. furciger Prince PCM2 Charles 70°1.80'S; 5 Mountains 67°38.8'E 2 this study M. furciger Droning SR (DML) Maud 73⁰29.8’S; 39 Land (Sør 11⁰28.4’W M. hilariae/M. Rondane) JX296220-312 polaris Dronning DML 70⁰45.566’S; Maud 1 11⁰46.899’E Land KT226108 M.hilariae South 54⁰58.15’S; SG 1 Georgia 36⁰03.4’W JX865310 M. hilariae Signy 60⁰59.5’S; SIG 1 Island 45⁰00.9’W JX865308 M. furciger Charcot 69°37.65’S; CHI 1 Island 75°22.2’W JX865306 M. furciger Alexander 71⁰06.0’S; AI 1 Island 70⁰37.4’W JX865314 M. furciger Total 66
127
2725 Table S3.5: Other Mesobiotus species COX1 sequences used in this study and their geographic area of origin.
Locality Acession No. Species Philippines MN257047 M. dilimanensis Philippines MF441491 M. insanis Philippines KX129796 M. philippinicus Vietnam MK578905 M. datanlanicus Kenya MH195148 M. radiatus Ethiopia MF678704 M. ethiopicus Ecuador MH195149 M. romani M. cf. furciger Norway MH195153 (harmsworthi) Norway MH195152 M. occultatus Russia MH195154 M. harmsworthi 2726
2727
2728
2729
2730
2731
2732
2733
2734
2735
2736
2737
2738
2739
128
2740 Table S3.6: Outgroup species COX1 sequences used in this study and their geographic area of origin.
Locality Acession No. Species South Georgia JX865307 Macrobiotus hufelandi Maritime Antarctic this study Macrobiotus hufelandi Maritime Antarctic this study Macrobiotus sp. Maritime Antarctic this study Acutuncus antarcticus Continental Antarctic AB753792 Acutuncus antarcticus South Shetlands EF632525 Dactylobiotus sp. 2741
2742
2743
2744
2745
2746
2747
2748
2749
2750
2751
2752
2753
129
2754
2755 Figure 3.1: COX 1 gene tree created using GTR+GAMMA under both Maximum Likelihood and Bayesian
2756 analysis. Numbers above the line are the posterior probability and numbers below the line are the bootstrap
2757 support value.
130
2758
2759 Figure 3.2: 18S gene tree created using GTR+GAMMA under both Maximum Likelihood and Bayesian
2760 analysis. Numbers above the line are the posterior probability and numbers below the line are the bootstrap
2761 support value.
2762
2763
2764
2765
131
2766 S4. Chapter 4
2767 Table S4.1: Details of Acutuncus antarcticus continental Antarctic locations sampled.
2768
Locality Latitude; Material No. of longitude specimens Larsemann 69⁰35.772'S; Algae 24 Hills 76⁰14.304'E (Broknes Peninsula) 1 Larsemann 69⁰20.184'S'; Algae 6 Hills 76⁰56.388'E (Broknes Peninsula) 2 Larsemann 69⁰7.548'S; Moss 1 Hills 76⁰33.888'E (Broknes Peninsula) 3 Larsemann 69⁰33.048'S; Moss 22 Hills (Island 76⁰8.712'E 1) Larsemann 69⁰15.66'S; Algae 10 Hills 76⁰40.392'E (Stornes Peninsula) 1 Larsemann 69⁰59.172'S; Algae 1 Hills 76⁰29.976'E (Stornes Peninsula) 2 Hop Island 1 68⁰48.792'S; Algae 16 77⁰39.624'E Hop Island 68⁰16.764'S; Algae 26 (2) 77⁰19.308'E Mawson 67⁰13.72'S; Moss 39 Station 62⁰17.69'E Sansom 69⁰36.216'S; Moss and 13 Island 73⁰45.996'E Algae Casey 66⁰58.692'S; Moss 9 Station 110⁰37.812'E Mather 68⁰15.372'S; Moss 5 Peninsula 1 77⁰23.928'E Mather 68⁰15.372'S; Algae 25 Peninsula 77⁰23.928'E (2)
132
Vestfold 68⁰44.4'S; Moss 3 Hills 78⁰26.76'E Shackleton 80⁰59.5’S; Algae 6 Mountains 24⁰59.9’W Dufek 72⁰59.0’S; Algae 28 Massif 24⁰00.6’E Total 234 2769
2770
2771
2772
2773
2774
2775
2776
2777
2778
2779
2780
2781
2782
2783
2784
2785
133
2786 Table S4.2: Details of Acutuncus antarcticus maritime Antarctic locations sampled.
Locality Latitude; Material No. of longitude specimens Signy Island 60⁰59.5’S; Algae 30 45⁰00.9’W Livingston 62⁰03.5’S; Algae 30 Island 60⁰28.5’W Alexander 71⁰06.0’S; Algae 30 Island 70⁰37.4’W Deception 62⁰56.9’S; Algae 10 Island 60⁰22.9’W James Ross 64⁰58.45’S; Algae 30 Island 57⁰00.8’W Half-Moon 62⁰35.508'S; Moss 20 Island 59⁰54.720'W Damoy, 64⁰49.049'S; Moss 7 Wiencke 63⁰30.284'W Island Dutherier, 64⁰48.426'S; Moss 4 Palmer Land 62⁰49.09'W Kerr Point, 62⁰42.383'S; Moss 3 Ronge 62⁰38.252W Island Neko 64⁰50.632'S; Moss 29 Harbour 62⁰31.640'W Cuverville 64⁰41.055'S; Moss 26 Island 62⁰37.657'W Total 219 2787
2788
2789
2790
2791
2792
2793
2794
134
2795 Table S4.3: Details of Mesobiotus furciger continental Antarctic locations sampled.
Latitude; No. of Locality Material longitude specimens 70°14.00'S; Reinbolt Hills Soil 4 72°34.00'E Lake Terrasovoe 1 70°3.90'S; (Prince Moss 11 68°14.2'E Charles Mountains) Lake Terrasovoe 2 70°1.80'S; (Prince Moss 18 67°38.8'E Charles Mountains) Mawson 72°10.5'S; Escarpment Moss 7 68°30.5'E 1 Mawson 72°25.44'S; Escarpment Moss 10 68°29.4'E 2 Mawson 67°13.72'S; Moss 6 Station 62°17.69'E Droning Maud Land 73⁰29.8’S; Soil 16 (Sør 11⁰28.4’W Rondane) Total 72 2796
2797
2798
2799
2800
2801
2802
2803
135
2804 Table S4.4: Details of Mesobiotus furciger maritime Antarctic locations sampled.
Latitude; No. of Locality Material longitude specimens Litchfield 64⁰58.9’S; Moss 21 Island 64⁰00.3’W Half-Moon 62⁰35.508'S; Moss 30 Island 59⁰54.720'W Palmer Station 64⁰27.05’S; Moss 9 (Anvers 64⁰13.6’W Island) Kerr Point, 64⁰42.383'S; Moss 24 Ronge Island 62⁰38.252W Almirante Brown 64°54.10'S; Moss 22 (Danco 62°51.5'W Coast) 64°9.914'S; Cierva Cove Moss 15 60°53.69'W Edgell Bay 62°14.87'S; (Nelson Moss 2 58°59.2'W Island) Total 123 2805
2806
2807
2808
2809
2810
2811
2812
2813
2814
136
2815 S4.5. TukeyHSD outputs for Acutuncus antarcticus.
2816 Tukey multiple comparisons of means
2817 95% family-wise confidence level
2818
2819 Fit: aov(formula = Body.length ~ Area, data = dframe1)
2820
2821 $Area
2822 diff lwr upr
2823 Continental Moss-Continental Algae -0.03990435 -0.07671799 -0.003090704
2824 Maritime Algae-Continental Algae 0.19286391 0.15928117 0.226446639
2825 Maritime Moss-Continental Algae 0.07326952 0.03645588 0.110083168
2826 Transantarctic Algae-Continental Algae 0.13696385 0.08654756 0.187380140
2827 Maritime Algae-Continental Moss 0.23276825 0.19756069 0.267975820
2828 Maritime Moss-Continental Moss 0.11317387 0.07487221 0.151475532
2829 Transantarctic Algae-Continental Moss 0.17686820 0.12535533 0.228381061
2830 Maritime Moss-Maritime Algae -0.11959438 -0.15480195 -0.084386818
2831 Transantarctic Algae-Maritime Algae -0.05590006 -0.10515583 -0.006644290
2832 Transantarctic Algae-Maritime Moss 0.06369433 0.01218146 0.115207189
2833 p adj
2834 Continental Moss-Continental Algae 0.0260341
2835 Maritime Algae-Continental Algae 0.0000000
2836 Maritime Moss-Continental Algae 0.0000008
2837 Transantarctic Algae-Continental Algae 0.0000000
2838 Maritime Algae-Continental Moss 0.0000000
2839 Maritime Moss-Continental Moss 0.0000000
2840 Transantarctic Algae-Continental Moss 0.0000000
2841 Maritime Moss-Maritime Algae 0.0000000
2842 Transantarctic Algae-Maritime Algae 0.0170320
2843 Transantarctic Algae-Maritime Moss 0.0068708
2844
137
2845 Tukey multiple comparisons of means
2846 95% family-wise confidence level
2847
2848 Fit: aov(formula = Stylet.support ~ Area, data = dframe1)
2849
2850 $Area
2851 diff lwr upr
2852 Continental Moss-Continental Algae -0.019079048 -0.047710741 0.009552644
2853 Maritime Algae-Continental Algae 0.047496923 0.021378062 0.073615784
2854 Maritime Moss-Continental Algae -0.074008131 -0.102639824 -0.045376439
2855 Transantarctic Algae-Continental Algae 0.042238778 0.003027671 0.081449884
2856 Maritime Algae-Continental Moss 0.066575971 0.039193402 0.093958541
2857 Maritime Moss-Continental Moss -0.054929083 -0.084718075 -0.025140091
2858 Transantarctic Algae-Continental Moss 0.061317826 0.021253863 0.101381788
2859 Maritime Moss-Maritime Algae -0.121505054 -0.148887624 -0.094122485
2860 Transantarctic Algae-Maritime Algae -0.005258145 -0.043566659 0.033050368
2861 Transantarctic Algae-Maritime Moss 0.116246909 0.076182946 0.156310871
2862 p adj
2863 Continental Moss-Continental Algae 0.3602782
2864 Maritime Algae-Continental Algae 0.0000090
2865 Maritime Moss-Continental Algae 0.0000000
2866 Transantarctic Algae-Continental Algae 0.0274941
2867 Maritime Algae-Continental Moss 0.0000000
2868 Maritime Moss-Continental Moss 0.0000064
2869 Transantarctic Algae-Continental Moss 0.0003213
2870 Maritime Moss-Maritime Algae 0.0000000
2871 Transantarctic Algae-Maritime Algae 0.9957442
2872 Transantarctic Algae-Maritime Moss 0.0000000
2873
2874
2875
138
2876 Tukey multiple comparisons of means
2877 95% family-wise confidence level
2878
2879 Fit: aov(formula = Buccal.tube.external.width ~ Area, data = dframe1)
2880
2881 $Area
2882 diff lwr upr
2883 Continental Moss-Continental Algae -0.01932891 -0.058653586 0.01999577
2884 Maritime Algae-Continental Algae -0.20027708 -0.236150464 -0.16440369
2885 Maritime Moss-Continental Algae -0.11729638 -0.156621053 -0.07797170
2886 Transantarctic Algae-Continental Algae -0.14016310 -0.194018254 -0.08630795
2887 Maritime Algae-Continental Moss -0.18094817 -0.218557217 -0.14333912
2888 Maritime Moss-Continental Moss -0.09796747 -0.138881656 -0.05705328
2889 Transantarctic Algae-Continental Moss -0.12083420 -0.175860715 -0.06580768
2890 Maritime Moss-Maritime Algae 0.08298070 0.045371654 0.12058975
2891 Transantarctic Algae-Maritime Algae 0.06011397 0.007498505 0.11272944
2892 Transantarctic Algae-Maritime Moss -0.02286673 -0.077893248 0.03215979
2893 p adj
2894 Continental Moss-Continental Algae 0.6623158
2895 Maritime Algae-Continental Algae 0.0000000
2896 Maritime Moss-Continental Algae 0.0000000
2897 Transantarctic Algae-Continental Algae 0.0000000
2898 Maritime Algae-Continental Moss 0.0000000
2899 Maritime Moss-Continental Moss 0.0000000
2900 Transantarctic Algae-Continental Moss 0.0000000
2901 Maritime Moss-Maritime Algae 0.0000000
2902 Transantarctic Algae-Maritime Algae 0.0159555
2903 Transantarctic Algae-Maritime Moss 0.7861113
2904
2905
2906
139
2907 Tukey multiple comparisons of means
2908 95% family-wise confidence level
2909
2910 Fit: aov(formula = Macroplacoid.row ~ Area, data = dframe1)
2911
2912 $Area
2913 diff lwr upr
2914 Continental Moss-Continental Algae -0.04179510 -0.07458474 -0.009005456
2915 Maritime Algae-Continental Algae -0.08481663 -0.11472853 -0.054904742
2916 Maritime Moss-Continental Algae -0.14101957 -0.17380921 -0.108229929
2917 Transantarctic Algae-Continental Algae -0.06039099 -0.10529641 -0.015485572
2918 Maritime Algae-Continental Moss -0.04302154 -0.07438065 -0.011662418
2919 Maritime Moss-Continental Moss -0.09922447 -0.13333948 -0.065109467
2920 Transantarctic Algae-Continental Moss -0.01859589 -0.06447802 0.027286235
2921 Maritime Moss-Maritime Algae -0.05620294 -0.08756205 -0.024843818
2922 Transantarctic Algae-Maritime Algae 0.02442564 -0.01944610 0.068297392
2923 Transantarctic Algae-Maritime Moss 0.08062858 0.03474645 0.126510708
2924 p adj
2925 Continental Moss-Continental Algae 0.0047851
2926 Maritime Algae-Continental Algae 0.0000000
2927 Maritime Moss-Continental Algae 0.0000000
2928 Transantarctic Algae-Continental Algae 0.0023906
2929 Maritime Algae-Continental Moss 0.0018120
2930 Maritime Moss-Continental Moss 0.0000000
2931 Transantarctic Algae-Continental Moss 0.8011891
2932 Maritime Moss-Maritime Algae 0.0000127
2933 Transantarctic Algae-Maritime Algae 0.5467284
2934 Transantarctic Algae-Maritime Moss 0.0000201
2935
2936
140
2937 S4.6. TukeyHSD outputs for Mesobiotus furciger.
2938 Tukey multiple comparisons of means 2939 95% family-wise confidence level 2940 2941 Fit: aov(formula = Body.length ~ Area, data = dframe1) 2942 2943 $Area 2944 diff lwr upr p adj 2945 Lake.T.1-Dronning.Maud -0.16828062 -0.25891499 -0.07764625 0.0000011 2946 Lake.T.2-Dronning.Maud -0.15361961 -0.23220957 -0.07502964 0.0000002 2947 Litchfield-Dronning.Maud 0.04018671 -0.03840326 0.11877667 0.7982476 2948 Maritime-Dronning.Maud -0.00364738 -0.06567160 0.05837684 1.0000000 2949 Mawson.Escp.1-Dronning.Maud -0.19496310 -0.30016803 -0.08975816 0.0000011 2950 Mawson.Escp.2-Dronning.Maud -0.12965146 -0.22395941 -0.03534350 0.0009004 2951 Mawson.Station-Dronning.Maud -0.08763573 -0.29136421 0.11609274 0.9128462 2952 Reinbolt.Hills-Dronning.Maud -0.11615604 -0.31988451 0.08757244 0.6856691 2953 Lake.T.2-Lake.T.1 0.01466101 -0.07178795 0.10110997 0.9998275 2954 Litchfield-Lake.T.1 0.20846733 0.12201836 0.29491629 0.0000000 2955 Maritime-Lake.T.1 0.16463324 0.09291124 0.23635523 0.0000000 2956 Mawson.Escp.1-Lake.T.1 -0.02668248 -0.13788103 0.08451608 0.9978134 2957 Mawson.Escp.2-Lake.T.1 0.03862916 -0.06232148 0.13957980 0.9544343 2958 Mawson.Station-Lake.T.1 0.08064488 -0.12624236 0.28753213 0.9493206 2959 Reinbolt.Hills-Lake.T.1 0.05212458 -0.15476266 0.25901183 0.9969206 2960 Litchfield-Lake.T.2 0.19380631 0.12008239 0.26753024 0.0000000 2961 Maritime-Lake.T.2 0.14997223 0.09424218 0.20570227 0.0000000 2962 Mawson.Escp.1-Lake.T.2 -0.04134349 -0.14296490 0.06027793 0.9355386 2963 Mawson.Escp.2-Lake.T.2 0.02396815 -0.06632484 0.11426115 0.9955804 2964 Mawson.Station-Lake.T.2 0.06598387 -0.13591740 0.26788515 0.9825076 2965 Reinbolt.Hills-Lake.T.2 0.03746357 -0.16443770 0.23936485 0.9996620 2966 Maritime-Litchfield -0.04383409 -0.09956413 0.01189596 0.2523325 2967 Mawson.Escp.1-Litchfield -0.23514980 -0.33677122 -0.13352839 0.0000000 2968 Mawson.Escp.2-Litchfield -0.16983816 -0.26013116 -0.07954517 0.0000007
141
2969 Mawson.Station-Litchfield -0.12782244 -0.32972372 0.07407883 0.5508639 2970 Reinbolt.Hills-Litchfield -0.15634274 -0.35824402 0.04555853 0.2718466 2971 Mawson.Escp.1-Maritime -0.19131571 -0.28074464 -0.10188679 0.0000000 2972 Mawson.Escp.2-Maritime -0.12600408 -0.20231558 -0.04969257 0.0000227 2973 Mawson.Station-Maritime -0.08398835 -0.28003617 0.11205946 0.9147093 2974 Reinbolt.Hills-Maritime -0.11250866 -0.30855647 0.08353916 0.6779409 2975 Mawson.Escp.2-Mawson.Escp.1 0.06531164 -0.04890097 0.17952425 0.6821735 2976 Mawson.Station-Mawson.Escp.1 0.10732736 -0.10634487 0.32099959 0.8136352 2977 Reinbolt.Hills-Mawson.Escp.1 0.07880706 -0.13486517 0.29247929 0.9632698 2978 Mawson.Station-Mawson.Escp.2 0.04201572 -0.16650702 0.25053846 0.9993789 2979 Reinbolt.Hills-Mawson.Escp.2 0.01349542 -0.19502732 0.22201816 0.9999999 2980 Reinbolt.Hills-Mawson.Station -0.02852030 -0.30436996 0.24732936 0.9999962 2981 2982 Tukey multiple comparisons of means 2983 95% family-wise confidence level 2984 2985 Fit: aov(formula = Stylet.support.insertion.point ~ Area, data = dframe1) 2986 2987 $Area 2988 diff lwr upr 2989 Lake.T.1-Dronning.Maud -0.0118188904 -0.025140132 0.001502351 2990 Lake.T.2-Dronning.Maud -0.0073491234 -0.018900105 0.004201858 2991 Litchfield-Dronning.Maud -0.0097011646 -0.021252146 0.001849817 2992 Maritime-Dronning.Maud -0.0193245202 -0.028440705 -0.010208335 2993 Mawson.Escp.1-Dronning.Maud -0.0673123818 -0.082775173 -0.051849590 2994 Mawson.Escp.2-Dronning.Maud -0.0011100130 -0.014971191 0.012751165 2995 Mawson.Station-Dronning.Maud -0.1340185800 -0.163962147 -0.104075013 2996 Reinbolt.Hills-Dronning.Maud -0.0101911120 -0.040134679 0.019752455 2997 Lake.T.2-Lake.T.1 0.0044697669 -0.008236313 0.017175847 2998 Litchfield-Lake.T.1 0.0021177257 -0.010588354 0.014823806 2999 Maritime-Lake.T.1 -0.0075056298 -0.018047172 0.003035912 3000 Mawson.Escp.1-Lake.T.1 -0.0554934914 -0.071837212 -0.039149771
142
3001 Mawson.Escp.2-Lake.T.1 0.0107088774 -0.004128627 0.025546382 3002 Mawson.Station-Lake.T.1 -0.1221996896 -0.152607525 -0.091791854 3003 Reinbolt.Hills-Lake.T.1 0.0016277784 -0.028780057 0.032035614 3004 Litchfield-Lake.T.2 -0.0023520412 -0.013187822 0.008483740 3005 Maritime-Lake.T.2 -0.0119753967 -0.020166477 -0.003784316 3006 Mawson.Escp.1-Lake.T.2 -0.0599632584 -0.074899352 -0.045027165 3007 Mawson.Escp.2-Lake.T.2 0.0062391104 -0.007031957 0.019510178 3008 Mawson.Station-Lake.T.2 -0.1266694566 -0.156344466 -0.096994447 3009 Reinbolt.Hills-Lake.T.2 -0.0028419886 -0.032516998 0.026833021 3010 Maritime-Litchfield -0.0096233555 -0.017814436 -0.001432275 3011 Mawson.Escp.1-Litchfield -0.0576112172 -0.072547311 -0.042675123 3012 Mawson.Escp.2-Litchfield 0.0085911516 -0.004679916 0.021862219 3013 Mawson.Station-Litchfield -0.1243174154 -0.153992424 -0.094642406 3014 Reinbolt.Hills-Litchfield -0.0004899474 -0.030164956 0.029185062 3015 Mawson.Escp.1-Maritime -0.0479878616 -0.061131930 -0.034843793 3016 Mawson.Escp.2-Maritime 0.0182145072 0.006998408 0.029430606 3017 Mawson.Station-Maritime -0.1146940598 -0.143508740 -0.085879379 3018 Reinbolt.Hills-Maritime 0.0091334082 -0.019681272 0.037948089 3019 Mawson.Escp.2-Mawson.Escp.1 0.0662023688 0.049415649 0.082989089 3020 Mawson.Station-Mawson.Escp.1 -0.0667061982 -0.098111276 -0.035301121 3021 Reinbolt.Hills-Mawson.Escp.1 0.0571212698 0.025716192 0.088526347 3022 Mawson.Station-Mawson.Escp.2 -0.1329085670 -0.163556785 -0.102260349 3023 Reinbolt.Hills-Mawson.Escp.2 -0.0090810990 -0.039729317 0.021567119 3024 Reinbolt.Hills-Mawson.Station 0.1238274680 0.083283687 0.164371249 3025 p adj 3026 Lake.T.1-Dronning.Maud 0.1262959 3027 Lake.T.2-Dronning.Maud 0.5440337 3028 Litchfield-Dronning.Maud 0.1778587 3029 Maritime-Dronning.Maud 0.0000000 3030 Mawson.Escp.1-Dronning.Maud 0.0000000 3031 Mawson.Escp.2-Dronning.Maud 0.9999995 3032 Mawson.Station-Dronning.Maud 0.0000000
143
3033 Reinbolt.Hills-Dronning.Maud 0.9774423 3034 Lake.T.2-Lake.T.1 0.9723585 3035 Litchfield-Lake.T.1 0.9998486 3036 Maritime-Lake.T.1 0.3849536 3037 Mawson.Escp.1-Lake.T.1 0.0000000 3038 Mawson.Escp.2-Lake.T.1 0.3659466 3039 Mawson.Station-Lake.T.1 0.0000000 3040 Reinbolt.Hills-Lake.T.1 1.0000000 3041 Litchfield-Lake.T.2 0.9989322 3042 Maritime-Lake.T.2 0.0002982 3043 Mawson.Escp.1-Lake.T.2 0.0000000 3044 Mawson.Escp.2-Lake.T.2 0.8632284 3045 Mawson.Station-Lake.T.2 0.0000000 3046 Reinbolt.Hills-Lake.T.2 0.9999979 3047 Maritime-Litchfield 0.0090216 3048 Mawson.Escp.1-Litchfield 0.0000000 3049 Mawson.Escp.2-Litchfield 0.5198848 3050 Mawson.Station-Litchfield 0.0000000 3051 Reinbolt.Hills-Litchfield 1.0000000 3052 Mawson.Escp.1-Maritime 0.0000000 3053 Mawson.Escp.2-Maritime 0.0000333 3054 Mawson.Station-Maritime 0.0000000 3055 Reinbolt.Hills-Maritime 0.9856068 3056 Mawson.Escp.2-Mawson.Escp.1 0.0000000 3057 Mawson.Station-Mawson.Escp.1 0.0000000 3058 Reinbolt.Hills-Mawson.Escp.1 0.0000019 3059 Mawson.Station-Mawson.Escp.2 0.0000000 3060 Reinbolt.Hills-Mawson.Escp.2 0.9907252 3061 Reinbolt.Hills-Mawson.Station 0.0000000 3062 3063 3064
144
3065 Tukey multiple comparisons of means 3066 95% family-wise confidence level 3067 3068 Fit: aov(formula = Buccal.tube.external.width ~ Area, data = dframe1) 3069 3070 $Area 3071 diff lwr upr p adj 3072 Lake.T.1-Dronning.Maud 0.246637628 0.18900629 0.304268966 0.0000000 3073 Lake.T.2-Dronning.Maud 0.196330665 0.14635796 0.246303373 0.0000000 3074 Litchfield-Dronning.Maud -0.045152907 -0.09512561 0.004819802 0.1114926 3075 Maritime-Dronning.Maud 0.122767159 0.08332805 0.162206270 0.0000000 3076 Mawson.Escp.1-Dronning.Maud -0.035365623 -0.10226189 0.031530645 0.7671990 3077 Mawson.Escp.2-Dronning.Maud 0.208456958 0.14848971 0.268424208 0.0000000 3078 Mawson.Station-Dronning.Maud -0.036727518 -0.16627158 0.092816547 0.9930874 3079 Reinbolt.Hills-Dronning.Maud 0.221322294 0.09177823 0.350866359 0.0000100 3080 Lake.T.2-Lake.T.1 -0.050306963 -0.10527694 0.004663016 0.1018220 3081 Litchfield-Lake.T.1 -0.291790534 -0.34676051 -0.236820555 0.0000000 3082 Maritime-Lake.T.1 -0.123870469 -0.16947607 -0.078264872 0.0000000 3083 Mawson.Escp.1-Lake.T.1 -0.282003250 -0.35271066 -0.211295842 0.0000000 3084 Mawson.Escp.2-Lake.T.1 -0.038180670 -0.10237178 0.026010436 0.6338001 3085 Mawson.Station-Lake.T.1 -0.283365146 -0.41491777 -0.151812526 0.0000000 3086 Reinbolt.Hills-Lake.T.1 -0.025315334 -0.15686795 0.106237286 0.9995573 3087 Litchfield-Lake.T.2 -0.241483571 -0.28836213 -0.194605016 0.0000000 3088 Maritime-Lake.T.2 -0.073563506 -0.10900036 -0.038126649 0.0000000 3089 Mawson.Escp.1-Lake.T.2 -0.231696287 -0.29631392 -0.167078658 0.0000000 3090 Mawson.Escp.2-Lake.T.2 0.012126293 -0.04528798 0.069540564 0.9991242 3091 Mawson.Station-Lake.T.2 -0.233058183 -0.36144039 -0.104675972 0.0000020 3092 Reinbolt.Hills-Lake.T.2 0.024991629 -0.10339058 0.153373840 0.9995180 3093 Maritime-Litchfield 0.167920066 0.13248321 0.203356923 0.0000000 3094 Mawson.Escp.1-Litchfield 0.009787284 -0.05483035 0.074404914 0.9999267 3095 Mawson.Escp.2-Litchfield 0.253609865 0.19619559 0.311024135 0.0000000 3096 Mawson.Station-Litchfield 0.008425388 -0.11995682 0.136807600 0.9999999
145
3097 Reinbolt.Hills-Litchfield 0.266475200 0.13809299 0.394857412 0.0000000 3098 Mawson.Escp.1-Maritime -0.158132782 -0.21499762 -0.101267943 0.0000000 3099 Mawson.Escp.2-Maritime 0.085689799 0.03716588 0.134213714 0.0000043 3100 Mawson.Station-Maritime -0.159494678 -0.28415487 -0.034834483 0.0028179 3101 Reinbolt.Hills-Maritime 0.098555134 -0.02610506 0.223215329 0.2460562 3102 Mawson.Escp.2-Mawson.Escp.1 0.243822580 0.17119863 0.316446526 0.0000000 3103 Mawson.Station-Mawson.Escp.1 -0.001361896 -0.13722886 0.134505066 1.0000000 3104 Reinbolt.Hills-Mawson.Escp.1 0.256687916 0.12082095 0.392554878 0.0000007 3105 Mawson.Station-Mawson.Escp.2 -0.245184476 -0.37777705 -0.112591898 0.0000012 3106 Reinbolt.Hills-Mawson.Escp.2 0.012865336 -0.11972724 0.145457914 0.9999977 3107 Reinbolt.Hills-Mawson.Station 0.258049812 0.08264632 0.433453306 0.0002646 3108 3109 Tukey multiple comparisons of means 3110 95% family-wise confidence level 3111 3112 Fit: aov(formula = External.primary.branch.1 ~ Area, data = dframe1) 3113 3114 $Area 3115 diff lwr upr p adj 3116 Lake.T.1-Dronning.Maud -0.050701224 -0.12764980 0.026247349 0.4949985 3117 Lake.T.2-Dronning.Maud -0.054415382 -0.12113826 0.012307492 0.2096163 3118 Litchfield-Dronning.Maud -0.043851577 -0.11057445 0.022871297 0.4986042 3119 Maritime-Dronning.Maud -0.048556155 -0.10121471 0.004102404 0.0963884 3120 Mawson.Escp.1-Dronning.Maud -0.082214619 -0.17153360 0.007104360 0.0976489 3121 Mawson.Escp.2-Dronning.Maud -0.025218303 -0.10528575 0.054849146 0.9861831 3122 Mawson.Station-Dronning.Maud -0.119882079 -0.29284754 0.053083380 0.4230283 3123 Reinbolt.Hills-Dronning.Maud 0.067342136 -0.10562332 0.240307595 0.9496632 3124 Lake.T.2-Lake.T.1 -0.003714159 -0.07710932 0.069681003 1.0000000 3125 Litchfield-Lake.T.1 0.006849647 -0.06654552 0.080244808 0.9999983 3126 Maritime-Lake.T.1 0.002145068 -0.05874690 0.063037035 1.0000000 3127 Mawson.Escp.1-Lake.T.1 -0.031513395 -0.12592096 0.062894167 0.9800136 3128 Mawson.Escp.2-Lake.T.1 0.025482920 -0.06022416 0.111190004 0.9905114
146
3129 Mawson.Station-Lake.T.1 -0.069180855 -0.24482811 0.106466398 0.9462418 3130 Reinbolt.Hills-Lake.T.1 0.118043360 -0.05760389 0.293690613 0.4669450 3131 Litchfield-Lake.T.2 0.010563805 -0.05202780 0.073155409 0.9998336 3132 Maritime-Lake.T.2 0.005859227 -0.04145558 0.053174032 0.9999844 3133 Mawson.Escp.1-Lake.T.2 -0.027799236 -0.11407581 0.058477336 0.9840146 3134 Mawson.Escp.2-Lake.T.2 0.029197079 -0.04746167 0.105855825 0.9556507 3135 Mawson.Station-Lake.T.2 -0.065466697 -0.23688086 0.105947471 0.9549370 3136 Reinbolt.Hills-Lake.T.2 0.121757518 -0.04965665 0.293171686 0.3883021 3137 Maritime-Litchfield -0.004704578 -0.05201938 0.042610227 0.9999972 3138 Mawson.Escp.1-Litchfield -0.038363042 -0.12463961 0.047913531 0.8964314 3139 Mawson.Escp.2-Litchfield 0.018633274 -0.05802547 0.095292020 0.9976052 3140 Mawson.Station-Litchfield -0.076030502 -0.24744467 0.095383666 0.8977443 3141 Reinbolt.Hills-Litchfield 0.111193713 -0.06022045 0.282607881 0.5170170 3142 Mawson.Escp.1-Maritime -0.033658463 -0.10958362 0.042266689 0.8980255 3143 Mawson.Escp.2-Maritime 0.023337852 -0.04145061 0.088126318 0.9680968 3144 Mawson.Station-Maritime -0.071325924 -0.23777051 0.095118658 0.9145835 3145 Reinbolt.Hills-Maritime 0.115898291 -0.05054629 0.282342873 0.4164445 3146 Mawson.Escp.2-Mawson.Escp.1 0.056996316 -0.03997018 0.153962812 0.6487209 3147 Mawson.Station-Mawson.Escp.1 -0.037667460 -0.21907516 0.143740243 0.9992263 3148 Reinbolt.Hills-Mawson.Escp.1 0.149556755 -0.03185095 0.330964458 0.1975896 3149 Mawson.Station-Mawson.Escp.2 -0.094663776 -0.27169957 0.082372015 0.7558891 3150 Reinbolt.Hills-Mawson.Escp.2 0.092560439 -0.08447535 0.269596230 0.7778740 3151 Reinbolt.Hills-Mawson.Station 0.187224215 -0.04697212 0.421420553 0.2326975 3152 3153 3154 3155 3156 3157 3158 3159 3160
147
3161 Tukey multiple comparisons of means 3162 95% family-wise confidence level 3163 3164 Fit: aov(formula = Posterior.primary.branch ~ Area, data = dframe1) 3165 3166 $Area 3167 diff lwr upr p adj 3168 Lake.T.1-Dronning.Maud -0.004832705 -0.082315418 0.07265001 0.9999999 3169 Lake.T.2-Dronning.Maud -0.053195525 -0.120381558 0.01399051 0.2442540 3170 Litchfield-Dronning.Maud -0.017484943 -0.084670975 0.04970109 0.9961436 3171 Maritime-Dronning.Maud -0.014107431 -0.067131521 0.03891666 0.9955104 3172 Mawson.Escp.1-Dronning.Maud -0.066953244 -0.156892232 0.02298574 0.3234941 3173 Mawson.Escp.2-Dronning.Maud 0.013313570 -0.067309669 0.09393681 0.9998589 3174 Mawson.Station-Dronning.Maud -0.073024748 -0.247190850 0.10114135 0.9239943 3175 Reinbolt.Hills-Dronning.Maud 0.199341406 0.025175304 0.37350751 0.0124081 3176 Lake.T.2-Lake.T.1 -0.048362819 -0.122267455 0.02554182 0.5046852 3177 Litchfield-Lake.T.1 -0.012652237 -0.086556873 0.06125240 0.9998148 3178 Maritime-Lake.T.1 -0.009274726 -0.070589376 0.05203992 0.9999274 3179 Mawson.Escp.1-Lake.T.1 -0.062120539 -0.157183433 0.03294236 0.5066841 3180 Mawson.Escp.2-Lake.T.1 0.018146276 -0.068155746 0.10444830 0.9991522 3181 Mawson.Station-Lake.T.1 -0.068192042 -0.245058555 0.10867447 0.9524038 3182 Reinbolt.Hills-Lake.T.1 0.204174112 0.027307599 0.38104062 0.0111980 3183 Litchfield-Lake.T.2 0.035710582 -0.027315503 0.09873667 0.6929717 3184 Maritime-Lake.T.2 0.039088094 -0.008555148 0.08673134 0.2029326 3185 Mawson.Escp.1-Lake.T.2 -0.013757719 -0.100633182 0.07311774 0.9998972 3186 Mawson.Escp.2-Lake.T.2 0.066509095 -0.010681780 0.14369997 0.1525196 3187 Mawson.Station-Lake.T.2 -0.019829223 -0.192433266 0.15277482 0.9999913 3188 Reinbolt.Hills-Lake.T.2 0.252536931 0.079932888 0.42514097 0.0002940 3189 Maritime-Litchfield 0.003377512 -0.044265731 0.05102075 0.9999998 3190 Mawson.Escp.1-Litchfield -0.049468301 -0.136343764 0.03740716 0.6871846 3191 Mawson.Escp.2-Litchfield 0.030798513 -0.046392362 0.10798939 0.9421705 3192 Mawson.Station-Litchfield -0.055539805 -0.228143848 0.11706424 0.9841517
148
3193 Reinbolt.Hills-Litchfield 0.216826349 0.044222306 0.38943039 0.0036792 3194 Mawson.Escp.1-Maritime -0.052845813 -0.129298002 0.02360638 0.4268733 3195 Mawson.Escp.2-Maritime 0.027421001 -0.037817195 0.09265920 0.9229724 3196 Mawson.Station-Maritime -0.058917316 -0.226517277 0.10868264 0.9724762 3197 Reinbolt.Hills-Maritime 0.213448838 0.045848877 0.38104880 0.0030158 3198 Mawson.Escp.2-Mawson.Escp.1 0.080266814 -0.017372777 0.17790641 0.2007255 3199 Mawson.Station-Mawson.Escp.1 -0.006071504 -0.188738453 0.17659545 1.0000000 3200 Reinbolt.Hills-Mawson.Escp.1 0.266294650 0.083627701 0.44896160 0.0003149 3201 Mawson.Station-Mawson.Escp.2 -0.086338318 -0.264603007 0.09192637 0.8423622 3202 Reinbolt.Hills-Mawson.Escp.2 0.186027836 0.007763147 0.36429253 0.0336212 3203 Reinbolt.Hills-Mawson.Station 0.272366154 0.036544137 0.50818817 0.0111316 3204
3205
149
3206 Raw morphometric measurement data for Acutuncus antarcticus used in this study.
3207 Table S4.7: Larsemann Hills, Broknes Peninsula 1
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 260 713 227 619 148 674 184 546 251 679 163 795 197 709 223 747 225 594 177 820 164 728 158 747 196 565 241 628 148 664 159 661 197 609 150 727 130 649 236 595 147 760 187 550 161 554 Buccopharyngeal tube Buccal tube length 36.5 – 34.3 – 36.6 – 22.0 – 33.7 – 36.9 – 20.5 – 27.8 – 29.9 – 37.9 – 21.6 – 22.5 – 21.2 – 34.6 – 38.4 – 22.3 – 24.0 – 32.3 – 20.6 – 20.1 – 39.7 – 19.4 – 34.1 – 29.0 – Stylet support insertion point 23.3 64.0 21.2 61.7 22.7 61.9 14.5 66.1 20.3 60.2 24.8 67.1 12.6 61.5 18.5 66.6 20.2 67.5 24.0 63.3 14.0 64.6 13.6 60.2 15.1 71.3 22.8 65.8 26.7 69.5 14.0 62.7 15.0 62.6 20.9 64.7 12.6 61.2 12.2 60.6 24.3 61.1 12.1 62.3 20.9 61.4 17.9 61.6 Buccal tube external width 5.4 14.9 4.9 14.2 5.4 14.7 2.2 10.2 4.1 12.1 5.0 13.5 2.1 10.3 2.8 10.2 4.5 15.1 4.3 11.3 2.7 12.3 2.2 9.9 2.8 13.0 5.0 14.5 6.5 17.0 1.5 6.7 2.6 10.8 4.8 14.8 2.4 11.6 2.3 11.6 6.1 15.4 2.4 12.6 4.5 13.2 3.7 12.8 Buccal tube internal width 3.9 10.6 3.2 9.4 3.4 9.4 1.3 6.1 2.5 7.4 3.4 9.2 0.9 4.2 1.2 4.3 2.8 9.3 2.3 6.1 1.3 6.2 1.0 4.5 1.1 5.2 3.1 8.8 4.8 12.5 0.8 3.8 1.3 5.5 3.0 9.3 1.0 4.6 0.6 3.1 3.6 9.0 1.1 5.6 2.2 6.5 2.3 7.8 Placoid lengths Macroplacoid 1 10.2 28.0 7.7 22.3 9.0 24.7 5.0 22.6 9.6 28.4 9.6 26.0 5.0 24.5 6.9 25.0 6.7 22.6 12.4 32.8 5.0 23.2 5.9 26.0 4.9 23.3 9.1 26.4 8.5 22.1 5.8 26.2 5.6 23.2 8.8 27.1 4.9 23.6 4.9 24.6 8.4 21.2 5.6 28.7 7.8 22.8 7.7 26.5 Macroplacoid 2 8.2 22.4 6.3 18.3 6.6 18.0 4.0 18.0 6.7 19.9 7.9 21.5 4.0 19.7 5.6 20.3 5.4 18.1 9.7 25.6 3.8 17.6 4.5 20.0 3.5 16.6 5.9 16.9 7.4 19.3 3.9 17.4 4.5 18.8 5.9 18.4 4.1 20.0 4.1 20.5 7.7 19.4 4.0 20.7 6.6 19.4 5.3 18.1 Macroplacoid row 21.3 58.4 15.9 46.4 17.9 48.8 10.4 47.5 18.4 54.6 19.3 52.2 10.5 51.1 14.3 51.6 14.3 47.8 21.9 57.7 10.4 48.3 10.7 47.6 9.3 44.0 17.1 49.4 18.6 48.3 11.0 49.4 11.8 49.3 17.0 52.5 10.0 48.4 10.1 50.2 19.1 48.1 10.4 53.7 16.9 49.6 15.1 52.0 Claw 1 heights External base 7.1 19.4 6.2 17.0 2.6 11.7 6.6 19.7 5.6 15.1 3.4 16.3 3.5 12.6 5.9 15.6 3.2 14.9 4.3 18.9 5.0 23.8 4.3 12.5 5.1 13.3 4.3 17.7 4.8 14.8 4.6 22.8 6.4 16.1 3.6 18.6 4.7 13.8 External primary branch 15.1 41.3 13.5 36.9 6.9 31.2 12.6 37.3 13.0 35.1 6.6 32.3 11.1 39.9 10.8 36.3 13.4 35.3 7.9 36.3 7.2 32.1 8.6 40.5 11.7 33.7 14.3 37.3 7.2 32.2 9.0 37.6 12.6 39.1 7.7 37.2 7.0 34.8 14.6 36.6 6.4 32.9 12.2 35.8 External secondary branch 10.4 28.5 8.6 23.6 5.3 24.0 9.6 28.4 9.9 26.9 5.4 26.1 6.7 24.1 7.0 23.4 8.0 21.1 5.2 24.0 5.2 22.9 5.7 27.0 7.5 21.6 8.9 23.2 5.6 25.3 5.5 22.8 5.9 18.3 4.3 20.7 4.7 23.4 8.5 21.3 5.1 26.6 6.4 18.7 Internal base 5.6 15.5 6.1 17.9 5.1 13.9 3.2 14.7 4.3 12.8 5.8 15.7 3.8 13.8 3.4 11.5 7.3 19.2 4.0 17.8 2.9 14.2 4.0 20.0 3.6 18.6 4.3 12.5 Internal primary branch 9.0 24.7 7.4 21.5 10.5 28.6 6.4 29.3 10.0 29.7 10.9 29.4 8.5 41.5 10.5 37.7 8.6 28.8 11.6 30.6 6.6 29.6 6.1 29.7 7.0 34.7 5.9 30.6 9.1 26.8 Internal secondary branch 6.5 17.9 10.4 30.3 7.2 19.8 4.3 19.4 7.2 21.4 6.5 17.7 5.5 26.7 5.7 20.6 6.1 20.5 7.4 19.4 5.4 24.1 3.4 16.7 4.8 23.7 4.9 25.4 5.9 17.2 Claw 2 heights External base 5.5 15.0 5.4 15.7 6.5 17.7 4.4 19.8 5.1 15.1 6.3 21.0 5.5 14.6 4.6 21.1 5.1 22.6 3.2 15.2 4.7 12.2 6.2 19.2 4.6 22.2 4.0 19.8 5.6 14.1 6.2 18.1 External primary branch 11.2 30.7 8.5 24.8 13.3 36.2 8.7 39.6 13.8 40.8 12.7 34.4 7.9 38.3 10.8 38.9 11.7 39.2 14.5 38.2 8.6 39.6 8.3 36.8 10.1 47.6 13.0 33.8 7.9 35.7 9.2 38.3 9.7 30.0 7.9 38.4 6.8 34.0 13.7 34.5 13.9 40.8 12.3 42.3 External secondary branch 9.2 25.2 5.5 15.9 9.9 27.0 5.8 26.2 9.3 27.5 9.0 24.5 5.2 25.1 6.5 21.7 8.8 23.2 4.8 22.2 7.0 31.2 6.7 31.6 9.0 23.3 5.5 24.7 6.7 28.0 8.7 26.8 5.6 27.2 5.3 26.6 9.1 22.9 7.9 23.3 Internal base 5.0 13.8 5.2 15.1 5.5 14.9 4.8 14.3 5.1 16.9 5.4 14.3 4.7 20.9 4.2 19.7 3.9 17.5 3.7 15.6 5.2 16.1 4.2 20.4 2.9 14.4 4.8 16.6 Internal primary branch 12.0 32.9 10.5 30.6 9.9 26.9 11.0 32.7 11.1 29.9 9.0 43.7 10.5 37.7 9.5 31.8 10.7 28.1 7.7 34.2 6.1 28.8 6.7 30.2 7.0 29.2 9.3 28.8 6.9 33.4 6.3 31.2 10.9 37.5 Internal secondary branch 7.9 21.6 7.8 22.6 8.2 22.5 7.7 22.9 9.4 25.5 5.4 26.4 6.2 16.4 6.7 29.5 5.8 27.6 5.7 25.8 6.1 25.3 7.0 21.7 5.7 27.4 4.2 20.7 7.6 26.1 Claw 3 heights External base 5.2 14.2 6.8 19.9 3.4 15.3 6.3 17.0 3.0 14.7 7.0 18.5 3.6 16.8 4.7 20.7 5.6 26.3 6.3 18.2 5.8 24.1 6.3 19.4 5.9 14.9 6.1 31.6 5.1 15.1 External primary branch 12.1 33.2 14.7 42.9 12.6 34.4 6.8 31.0 14.9 40.3 7.3 35.5 12.0 43.3 12.4 41.4 13.7 36.2 8.9 41.3 10.1 45.0 9.8 46.3 14.5 41.8 12.7 33.1 7.5 33.8 9.7 40.2 12.7 39.4 9.0 43.8 13.2 33.1 9.4 48.8 13.6 39.9 12.0 41.2 External secondary branch 8.2 22.6 8.7 25.3 8.7 23.8 3.6 16.2 9.4 25.5 5.1 24.6 8.0 28.7 7.5 25.1 8.1 21.4 6.6 30.5 7.2 31.7 6.3 30.0 7.2 20.9 10.6 27.6 6.1 27.3 8.0 33.3 8.0 24.7 6.5 31.7 7.5 18.8 4.6 23.9 9.4 27.5 7.2 24.9 Internal base 4.9 13.3 5.7 16.5 2.8 12.9 4.7 12.8 3.3 15.8 3.3 11.0 6.2 16.4 3.5 16.3 3.6 15.9 8.1 20.9 2.8 12.7 3.7 15.4 7.4 18.6 Internal primary branch 10.2 27.9 10.3 30.1 11.4 31.0 6.5 29.4 14.6 39.6 8.7 42.5 9.4 33.8 8.8 29.6 11.1 29.4 6.2 28.6 7.0 31.2 10.8 28.1 6.7 30.0 6.7 27.8 9.6 24.2 Internal secondary branch 8.0 21.9 6.5 19.0 7.5 20.4 5.8 26.4 7.8 21.2 5.1 24.7 6.2 22.3 6.8 22.6 7.0 18.4 6.0 27.8 6.0 26.8 8.7 22.6 6.1 27.5 5.5 23.0 9.1 22.9 Claw 4 lengths Anterior base 6.9 20.3 4.2 20.2 5.0 17.8 4.7 15.6 4.3 19.7 3.3 15.7 2.6 7.6 4.0 18.0 3.1 13.0 3.6 17.2 3.6 17.8 5.5 28.2 5.2 15.3 Anterior primary branch 11.1 30.3 9.5 27.8 7.8 35.3 11.2 33.3 12.4 33.5 6.7 32.6 10.9 39.3 8.9 29.6 11.2 29.6 6.6 30.3 7.4 32.9 8.2 38.8 9.8 28.3 11.8 30.7 8.1 36.3 7.7 32.0 9.8 30.3 8.7 42.3 7.4 36.7 11.6 29.3 8.2 42.4 10.3 30.3 10.0 34.4 Anterior secondary branch 7.1 19.6 7.7 22.4 6.0 27.1 7.5 22.1 8.4 22.8 6.3 30.5 7.0 25.4 6.1 20.3 8.1 21.3 4.7 21.8 5.4 25.7 8.7 25.2 8.3 21.7 4.3 19.1 4.4 18.2 7.3 22.5 6.4 31.2 4.4 21.7 9.7 24.3 4.6 24.0 6.0 17.5 7.2 24.9 Posterior base 4.1 20.0 3.8 12.8 3.9 18.2 2.7 12.0 3.0 14.1 4.4 12.8 5.1 13.1 3.1 13.9 3.9 16.4 4.6 22.2 4.4 22.0 3.7 9.3 4.5 23.5 4.0 11.7 Posterior primary branch 15.2 41.6 13.4 38.9 9.8 44.7 13.5 40.1 13.7 37.1 11.6 56.3 13.2 47.7 11.8 39.4 13.0 34.2 8.9 41.4 8.5 37.5 10.4 49.2 12.1 35.0 15.0 39.1 10.1 45.5 11.9 49.5 13.2 40.9 11.0 53.5 11.1 55.3 15.0 37.6 11.4 58.8 13.4 39.4 13.3 45.9 3208 Posterior secondary branch 11.5 31.4 9.1 26.6 8.3 24.5 8.9 24.0 6.4 30.9 7.7 27.6 7.7 25.7 7.5 19.7 5.8 26.7 5.7 27.0 7.9 22.7 9.6 25.1 6.9 31.2 6.6 27.6 8.0 24.9 6.8 34.0 10.5 26.5 5.9 30.6 7.3 21.4 6.9 23.9
3209
3210
3211
3212
3213 150
3214 Table S4.8: Larsemann Hills, Broknes Peninsula 2
SPECIMEN 1 (HOL) 2 3 4 5 6 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt Body length 209 639 183 609 291 680 287 707 167 895 319 858 Buccopharyngeal tube Buccal tube length 32.7 – 30.1 – 42.9 – 40.7 – 18.7 – 37.2 – Stylet support insertion point 20.4 62.2 19.2 63.9 25.2 58.7 26.5 65.2 10.2 54.5 23.4 62.8 Buccal tube external width 4.0 12.2 2.1 7.1 4.1 9.7 4.9 12.1 2.7 14.5 5.6 15.1 Buccal tube internal width 1.7 5.3 0.8 2.5 2.5 5.9 3.4 8.3 1.0 5.5 3.7 9.9 Placoid lengths Macroplacoid 1 6.6 20.2 5.2 17.3 9.5 22.1 6.8 16.7 5.0 26.5 7.6 20.3 Macroplacoid 2 6.4 19.7 4.9 16.4 6.5 15.2 5.9 14.5 3.3 17.5 7.0 18.8 Macroplacoid row 14.0 42.8 11.4 37.7 16.6 38.8 18.0 44.2 9.8 52.2 20.5 55.0 Claw 1 heights External base 3.3 9.9 3.8 12.5 5.6 15.1 External primary branch 7.7 23.6 9.0 29.8 14.5 39.1 External secondary branch 5.3 16.3 5.7 19.0 8.0 21.4 Internal base 3.3 10.9 Internal primary branch 7.8 26.0 Internal secondary branch 5.1 16.8 Claw 2 heights External base 5.0 15.4 5.0 16.5 External primary branch 10.8 33.0 10.2 34.0 10.6 28.4 External secondary branch 6.3 19.2 8.1 27.0 7.2 19.4 Internal base 3.8 11.6 Internal primary branch 8.2 25.0 Internal secondary branch 4.8 14.6 Claw 3 heights External base 7.7 20.7 External primary branch 8.8 29.1 11.0 29.6 External secondary branch 5.6 18.7 9.7 26.0 Internal base 5.2 13.9 Internal primary branch 8.1 26.8 10.6 28.4 Internal secondary branch 5.6 18.6 6.9 18.5 Claw 4 lengths Anterior base 4.3 13.1 3.9 13.0 7.3 18.0 7.2 19.2 Anterior primary branch 10.0 30.6 10.7 35.4 10.1 24.9 12.2 32.7 Anterior secondary branch 7.5 22.9 6.0 20.0 8.0 19.7 7.4 19.9 Posterior base 4.5 13.8 4.5 15.0 6.2 15.3 5.5 29.6 8.8 23.7 Posterior primary branch 10.9 33.4 11.2 37.1 14.8 34.5 14.1 34.6 8.6 46.2 15.9 42.7 3215 Posterior secondary branch 8.4 25.8 7.3 24.3 9.9 23.1 10.1 24.8 5.6 30.0 9.1 24.5
3216
3217
3218
151
3219 Table S4.9: Larsemann Hills, Broknes Peninsula 3
SPECIMEN 1 (HOL) CHARACTER µm pt Body length 130 558 Buccopharyngeal tube Buccal tube length 23.2 – Stylet support insertion point 13.8 59.4 Buccal tube external width 3.3 14.1 Buccal tube internal width 1.4 6.1 Placoid lengths Macroplacoid 1 4.6 19.8 Macroplacoid 2 3.8 16.2 Macroplacoid row 9.7 41.7 Claw 1 heights External base 3.6 15.5 External primary branch 10.4 44.7 External secondary branch 6.0 25.9 Internal base 3.4 14.8 Internal primary branch 8.3 35.6 Internal secondary branch 5.3 22.9 Claw 2 heights External base 4.3 18.6 External primary branch 12.7 54.5 External secondary branch 6.9 29.5 Internal base 4.1 17.6 Internal primary branch 7.9 34.1 Internal secondary branch Claw 3 heights External base 5.3 23.0 External primary branch 11.9 51.1 External secondary branch 6.6 28.4 Internal base Internal primary branch Internal secondary branch Claw 4 lengths Anterior base 3.7 16.1 Anterior primary branch 8.9 38.3 Anterior secondary branch 6.0 25.6 Posterior base 4.4 19.1 Posterior primary branch 13.3 57.1 3220 Posterior secondary branch 6.0 25.9
3221
3222
3223
152
3224 Table S4.10: Larsemann Hills, Island 1
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 255 838 268 826 220 774 211 693 208 650 200 691 198 731 166 737 246 788 212 669 270 825 193 728 189 675 193 752 169 660 193 707 162 587 263 871 119 477 134 490 147 533 136 702 Buccopharyngeal tube Buccal tube length 30.5 – 32.5 – 28.4 – 30.4 – 32.0 – 29.0 – 27.1 – 22.5 – 31.2 – 31.7 – 32.8 – 26.5 – 28.0 – 25.7 – 25.6 – 27.3 – 27.5 – 30.2 – 24.8 – 27.4 – 27.6 – 19.3 – Stylet support insertion point 19.0 62.2 19.6 60.5 16.8 59.2 18.6 61.2 19.3 60.3 18.4 63.4 17.1 63.2 13.9 61.7 18.2 58.4 19.5 61.6 20.1 61.4 16.1 60.8 18.0 64.4 16.2 63.0 15.0 58.8 15.7 57.4 15.9 57.9 20.6 68.2 15.3 61.5 16.9 61.7 17.3 62.6 12.0 62.3 Buccal tube external width 4.5 14.7 5.3 16.4 3.7 12.9 4.2 13.8 4.2 13.0 3.9 13.3 3.8 13.8 3.3 14.7 4.7 15.0 3.8 11.9 4.7 14.2 3.4 12.8 3.5 12.6 3.9 15.0 3.4 13.3 4.2 15.3 2.7 9.9 3.7 12.4 3.4 13.7 4.6 16.7 4.1 14.8 2.5 13.0 Buccal tube internal width 2.9 9.5 3.6 11.0 1.7 6.1 2.7 9.0 1.8 5.6 2.3 8.1 2.1 7.7 1.8 8.0 2.8 9.1 2.0 6.2 2.9 8.9 1.8 6.8 1.8 6.4 2.7 10.6 1.8 7.0 2.5 9.0 1.1 3.8 2.1 6.8 2.2 9.0 2.7 9.9 2.3 8.3 1.2 6.1 Placoid lengths Macroplacoid 1 5.2 17.2 8.2 25.3 6.8 23.8 6.5 21.3 6.2 19.4 5.8 20.0 5.5 20.2 5.0 22.1 6.3 20.2 6.4 20.3 9.2 28.0 5.6 21.2 6.3 22.4 5.5 21.3 4.6 18.1 6.0 22.1 5.9 21.3 5.1 16.9 5.5 22.1 6.5 23.6 5.1 18.4 4.0 20.9 Macroplacoid 2 4.0 13.0 5.6 17.4 4.5 15.7 4.3 14.2 5.0 15.7 4.8 16.4 3.4 12.6 3.5 15.5 4.8 15.4 5.0 15.8 6.4 19.4 4.2 15.8 4.1 14.5 4.4 17.3 4.0 15.5 3.9 14.3 4.1 15.0 4.5 14.9 3.2 12.9 4.5 16.2 4.2 15.3 3.4 17.7 Macroplacoid row 12.8 42.0 15.6 48.2 12.7 44.5 12.7 41.6 13.7 42.9 11.8 40.9 11.4 42.0 10.5 46.6 13.2 42.2 12.7 39.9 17.3 52.8 12.9 48.6 13.0 46.5 11.0 43.0 9.6 37.7 11.4 41.9 11.7 42.5 11.7 38.8 10.2 40.9 12.1 44.1 12.2 44.2 8.9 46.0 Claw 1 heights External base 3.3 10.7 7.1 21.9 4.6 16.2 3.5 11.6 4.0 12.6 3.3 11.5 6.2 22.8 4.5 20.0 4.2 13.4 3.7 11.8 5.3 16.2 3.9 14.0 3.7 13.4 5.0 18.2 4.2 13.9 3.4 13.9 4.0 14.7 3.7 19.0 External primary branch 9.8 32.0 10.7 33.0 12.5 43.9 9.9 32.4 11.6 36.2 9.5 32.6 9.3 34.3 8.3 37.1 11.1 35.7 10.3 32.6 11.8 36.1 8.4 31.9 10.3 36.6 9.1 33.3 9.9 35.9 11.3 37.5 9.0 36.3 9.4 34.2 7.4 38.3 External secondary branch 5.9 19.4 9.0 27.7 9.3 32.8 6.1 20.0 7.1 22.2 5.4 18.5 6.9 25.4 3.9 17.1 6.4 20.4 6.9 21.7 7.7 23.6 6.4 22.8 5.0 18.2 6.3 23.0 6.6 22.0 5.1 20.3 6.3 23.0 5.3 27.7 Internal base 3.2 10.5 6.0 18.4 4.0 14.2 2.9 9.6 3.1 9.5 2.5 8.5 5.3 23.5 2.8 8.9 3.6 11.3 5.6 16.9 2.9 10.8 4.9 17.3 3.7 13.4 4.9 19.8 3.3 12.1 Internal primary branch 8.1 26.7 9.2 28.4 8.8 30.8 7.6 24.9 9.0 28.1 6.9 23.7 8.0 35.6 8.7 27.8 7.9 25.1 10.2 31.2 7.0 26.5 7.7 27.6 8.2 30.1 8.5 30.9 6.9 27.9 7.5 27.5 6.3 32.4 Internal secondary branch 5.2 17.1 7.7 23.6 5.6 19.7 4.5 14.7 7.2 22.6 5.1 17.6 5.6 24.8 5.7 18.3 4.8 15.1 6.7 20.4 5.7 21.7 6.7 24.1 5.1 18.7 5.0 18.0 4.8 19.2 5.1 18.6 4.5 23.4 Claw 2 heights External base 3.7 12.0 3.5 11.5 6.1 19.1 3.7 12.7 3.7 13.5 5.3 23.7 4.6 14.6 6.5 19.8 5.4 20.6 4.6 16.6 4.2 16.3 3.6 13.9 3.2 11.7 3.6 13.1 4.8 19.4 4.5 23.0 External primary branch 11.5 37.7 13.7 42.1 12.3 43.2 10.5 34.6 13.1 41.1 9.4 32.6 9.5 35.1 9.6 42.6 11.6 37.1 10.8 34.0 14.5 44.4 10.0 37.8 12.8 45.7 10.1 39.2 8.6 33.8 10.7 39.2 10.4 37.7 9.0 36.3 9.7 35.5 7.2 37.0 External secondary branch 7.5 24.7 8.7 26.7 10.0 35.2 5.5 18.0 8.9 27.9 5.3 18.3 5.6 20.6 5.0 22.2 7.9 25.4 7.8 24.6 9.0 27.5 5.5 20.8 8.0 28.4 7.1 27.7 6.4 25.0 5.2 19.2 8.9 32.5 7.1 28.5 6.1 22.1 5.7 29.4 Internal base 3.1 10.1 5.5 19.3 3.6 11.8 5.2 16.3 3.0 10.3 3.6 13.1 5.4 24.2 3.0 9.5 3.9 12.2 5.1 15.6 4.8 17.2 3.7 14.2 4.2 16.3 4.1 15.0 3.5 12.6 3.5 14.1 3.5 18.1 Internal primary branch 9.5 31.0 11.4 40.1 9.3 30.6 10.1 31.6 6.7 23.2 7.7 28.4 7.7 34.3 9.6 30.9 8.3 26.3 10.7 32.8 9.8 35.1 7.6 29.8 5.1 19.9 8.9 32.6 8.5 30.9 6.8 27.4 9.7 35.4 5.2 27.0 Internal secondary branch 4.7 15.5 10.2 35.7 5.0 16.6 7.6 23.7 4.3 14.7 5.6 20.7 5.8 25.9 6.6 21.0 6.0 19.0 7.8 23.7 7.0 24.9 6.2 24.2 5.7 22.3 5.9 21.6 6.5 23.5 5.1 20.6 6.0 21.7 4.9 25.5 Claw 3 heights External base 6.7 22.0 6.6 23.3 5.1 16.7 7.0 21.9 6.3 21.6 5.4 20.1 4.3 19.2 3.5 11.0 6.7 20.3 4.5 16.8 6.8 24.2 4.3 16.6 5.0 19.4 5.2 17.2 5.8 23.3 6.6 24.1 3.6 18.4 External primary branch 10.7 35.2 14.5 50.9 12.5 41.2 12.8 40.1 9.6 33.1 10.5 38.8 8.8 39.2 13.3 42.5 11.9 37.4 14.5 44.3 10.5 39.7 11.2 40.0 10.6 41.1 9.2 36.1 11.0 39.9 11.6 38.4 9.4 37.7 12.1 44.2 7.1 36.9 External secondary branch 7.7 25.4 9.5 33.3 7.9 25.9 9.1 28.5 6.4 22.1 6.9 25.3 5.4 23.9 8.8 28.1 7.8 24.6 9.6 29.3 5.8 21.9 9.2 33.0 6.9 26.8 6.2 24.3 6.4 21.3 5.1 20.7 6.1 22.4 5.4 28.2 Internal base 5.5 18.0 5.8 20.3 4.6 15.1 5.2 16.2 4.1 14.3 3.6 13.2 5.7 25.3 5.6 17.6 6.4 19.4 4.6 17.5 5.8 20.8 4.0 15.6 4.1 16.0 3.6 14.4 3.4 17.8 Internal primary branch 7.4 24.3 7.9 27.9 9.2 30.1 10.2 31.7 6.1 20.9 9.5 35.0 8.0 35.4 9.6 30.9 9.1 28.7 11.5 35.0 7.1 26.7 8.4 29.8 7.4 28.8 5.9 23.1 8.0 29.0 6.4 25.6 7.6 27.6 5.4 28.2 Internal secondary branch 7.0 23.0 7.1 24.9 4.9 16.2 8.5 26.5 5.6 19.3 5.7 20.9 6.6 29.1 7.0 22.3 6.9 21.8 7.7 23.4 6.1 22.9 8.1 28.8 6.5 25.3 5.2 20.5 5.2 27.0 Claw 4 lengths Anterior base 4.7 15.3 5.8 17.7 5.2 18.4 5.7 18.6 4.8 15.0 7.2 24.7 3.7 13.7 4.7 20.7 6.3 20.3 3.3 10.5 5.2 15.9 2.9 10.8 4.1 14.7 6.0 23.4 3.1 12.2 4.6 16.9 6.5 23.6 4.0 13.1 4.9 18.0 3.3 17.1 Anterior primary branch 11.0 36.0 10.0 30.6 10.8 38.0 9.7 31.8 10.7 33.5 9.0 30.9 7.8 28.6 10.7 47.7 8.2 26.3 9.0 28.5 11.5 35.2 8.5 32.1 7.8 27.8 9.4 36.6 7.5 29.2 9.1 33.1 9.5 34.6 8.2 27.0 7.0 28.0 8.1 29.4 11.1 40.3 6.9 35.5 Anterior secondary branch 5.2 17.0 8.8 27.1 7.8 27.6 7.7 25.4 6.1 19.2 7.6 26.1 5.8 21.3 6.4 28.6 7.5 24.1 6.5 20.5 8.4 25.6 5.2 19.5 5.7 20.2 7.5 29.0 4.2 16.6 5.2 19.0 5.2 19.0 5.9 19.5 4.8 19.3 6.4 23.4 4.2 21.8 Posterior base 5.5 18.0 6.1 18.7 5.3 18.7 6.2 20.3 7.8 27.1 3.6 13.1 6.4 20.5 3.7 11.5 2.9 10.8 6.4 25.0 5.4 21.0 4.8 17.7 5.0 16.5 5.5 20.0 3.8 19.8 Posterior primary branch 14.7 48.1 14.4 44.4 12.4 43.6 12.1 39.6 15.0 46.8 11.7 40.4 9.9 36.4 12.3 54.6 9.7 31.1 12.1 38.2 12.8 39.2 11.2 42.5 10.9 39.0 13.9 54.1 11.2 43.9 9.3 34.0 10.7 38.8 15.1 49.9 10.4 41.9 11.1 40.5 15.9 57.6 10.2 52.9 3225 Posterior secondary branch 7.5 24.5 10.6 32.5 6.8 23.9 7.4 24.3 8.5 26.5 6.1 21.2 5.7 21.1 7.3 32.3 13.6 43.5 7.1 22.4 7.9 24.0 6.4 24.1 7.9 28.2 9.5 37.1 7.3 28.7 5.7 20.8 7.3 26.6 6.6 21.7 6.2 25.1 7.8 28.5 4.6 24.0
3226
3227
3228
3229
153
3230 Table S4.11: Larsemann Hills, Stornes Peninsula 1
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 171 508 199 198 630 303 831 227 680 222 667 145 684 164 805 175 580 167 527 165 570 Buccopharyngeal tube Buccal tube length 33.8 – – 31.5 – 36.5 – 33.4 – 33.3 – 21.2 – 20.4 – 30.3 – 31.8 – 28.9 – Stylet support insertion point 20.6 61.0 20.1 63.7 21.1 57.9 20.2 60.6 19.9 59.7 13.0 61.0 12.4 60.5 18.6 61.5 18.0 56.5 17.7 61.1 Buccal tube external width 5.0 14.8 3.6 11.3 6.0 16.4 5.5 16.5 5.2 15.5 2.4 11.4 2.4 11.9 4.6 15.3 5.4 17.1 4.2 14.5 Buccal tube internal width 3.3 9.8 2.0 6.2 4.4 12.1 3.3 10.0 3.6 10.9 0.8 3.8 1.1 5.2 2.9 9.6 3.4 10.8 2.5 8.6 Placoid lengths Macroplacoid 1 8.1 24.1 7.4 23.4 8.4 23.0 6.5 19.4 7.7 23.0 6.4 29.9 6.0 29.5 6.3 20.9 7.9 24.8 7.4 25.7 Macroplacoid 2 6.8 20.3 7.2 22.8 6.4 17.5 5.7 17.2 6.8 20.4 4.7 22.2 4.8 23.4 5.8 19.1 7.5 23.7 5.5 19.0 Macroplacoid row 18.0 53.2 17.6 55.9 17.5 47.9 14.8 44.2 17.3 52.1 12.2 57.4 12.7 62.0 16.0 52.8 18.8 59.2 15.5 53.7 Claw 1 heights External base 4.1 12.1 6.7 3.4 10.6 7.3 20.0 4.5 13.5 6.9 20.8 5.7 26.8 3.7 17.9 5.7 18.7 4.4 15.1 External primary branch 12.4 36.6 8.6 11.6 36.8 13.3 36.3 9.3 28.0 12.7 38.1 9.3 43.5 10.3 50.3 12.2 40.4 10.9 34.2 10.9 37.5 External secondary branch 8.9 26.4 7.7 9.9 31.3 10.0 27.4 6.2 18.5 9.1 27.2 7.1 33.6 7.2 35.3 6.2 20.5 7.2 24.7 Internal base 3.2 9.6 5.3 3.0 9.4 4.8 13.3 4.4 13.2 5.2 24.4 3.2 15.8 4.3 14.3 3.1 10.7 Internal primary branch 10.2 30.3 7.6 10.5 33.3 9.9 27.2 8.1 24.3 7.8 36.7 8.1 39.6 8.4 27.7 8.6 29.7 Internal secondary branch 7.5 22.2 5.1 8.5 27.0 8.5 23.2 6.3 18.8 6.7 31.3 5.5 27.0 6.3 20.9 4.8 16.5 Claw 2 heights External base 7.3 21.6 3.3 4.3 13.5 8.2 22.4 4.3 12.9 4.7 14.1 6.4 30.1 6.1 29.8 6.4 21.1 7.2 22.7 4.4 15.2 External primary branch 13.4 39.7 12.3 12.4 39.3 15.7 43.1 12.8 38.4 12.4 37.2 9.0 42.5 11.9 58.3 10.2 33.8 13.9 43.6 11.3 39.1 External secondary branch 10.2 30.1 7.7 9.1 28.8 10.3 28.2 7.9 23.7 8.1 24.3 7.0 33.1 8.1 39.5 6.9 22.7 8.7 27.4 6.5 22.5 Internal base 4.7 14.0 3.4 3.3 10.5 7.1 19.4 4.7 14.1 3.4 10.3 5.2 24.5 3.6 12.6 Internal primary branch 11.0 32.5 8.8 10.0 31.6 11.6 31.7 8.9 26.6 9.8 29.6 8.0 37.8 9.3 45.4 9.6 30.3 9.5 32.7 Internal secondary branch 7.9 23.3 6.4 7.9 25.2 9.8 26.9 7.7 23.1 7.7 23.0 6.3 29.6 6.8 33.4 5.9 20.5 Claw 3 heights External base 7.1 4.9 15.6 4.7 14.1 6.0 18.8 4.5 15.6 External primary branch 11.7 34.7 11.2 13.1 41.5 11.1 33.3 12.6 37.9 10.4 48.9 12.2 59.5 12.3 38.6 9.9 34.2 External secondary branch 7.7 22.9 7.4 10.0 31.7 7.3 21.9 7.2 21.5 8.3 39.1 7.8 24.6 6.1 21.0 Internal base 5.7 4.9 15.6 4.6 13.8 4.8 22.4 3.8 13.3 Internal primary branch 9.2 27.2 7.5 10.1 32.1 9.1 27.3 9.6 28.9 8.4 39.6 8.6 42.2 10.0 34.6 Internal secondary branch 7.5 22.1 7.5 6.3 20.1 8.0 23.9 7.6 22.8 6.8 32.0 7.8 38.3 5.6 19.3 Claw 4 lengths Anterior base 5.5 16.1 3.0 3.0 9.4 7.2 19.8 4.2 12.5 5.5 16.4 3.5 16.5 4.5 14.7 5.0 15.7 5.8 20.1 Anterior primary branch 10.2 30.3 10.3 10.3 32.6 12.1 33.3 9.7 29.1 9.4 28.1 8.1 38.1 7.9 38.8 11.1 36.7 11.0 34.6 9.3 32.3 Anterior secondary branch 8.3 24.5 9.0 9.0 28.5 8.7 23.8 6.5 19.5 7.8 23.5 6.0 28.2 6.3 31.0 5.4 17.7 8.0 25.2 8.1 27.9 Posterior base 6.8 20.1 6.7 6.7 21.4 8.2 22.4 4.9 14.7 8.6 25.9 3.8 17.7 5.9 19.6 6.8 21.4 6.9 24.0 Posterior primary branch 17.3 51.2 16.4 16.4 52.2 19.7 53.9 11.5 34.4 14.2 42.5 12.2 57.6 10.9 53.1 13.2 43.5 15.9 50.2 13.4 46.4 3231 Posterior secondary branch 6.0 17.8 7.4 7.4 23.5 11.2 30.6 9.3 28.0 10.5 31.6 7.7 36.3 8.5 41.7 6.3 20.9 10.1 31.6 9.3 32.1
3232
154
3233 Table S4.12: Larsemann Hills, Stornes Peninsula 2
SPECIMEN 1 (HOL) CHARACTER µm pt Body length 146 647 Buccopharyngeal tube Buccal tube length 22.6 – Stylet support insertion point 14.2 62.8 Buccal tube external width 2.5 11.1 Buccal tube internal width 1.0 4.6 Placoid lengths Macroplacoid 1 5.6 24.9 Macroplacoid 2 3.4 15.1 Macroplacoid row 10.0 44.4 Claw 1 heights External base 4.1 18.2 External primary branch 6.9 30.7 External secondary branch 5.6 24.6 Internal base 3.5 15.6 Internal primary branch 6.1 27.1 Internal secondary branch 3.9 17.1 Claw 2 heights External base 4.9 21.6 External primary branch 8.4 37.0 External secondary branch 7.3 32.5 Internal base 2.9 12.9 Internal primary branch 6.7 29.5 Internal secondary branch 5.7 25.4 Claw 3 heights External base External primary branch 8.0 35.6 External secondary branch 7.0 31.1 Internal base Internal primary branch 7.0 31.1 Internal secondary branch 5.8 25.6 Claw 4 lengths Anterior base Anterior primary branch Anterior secondary branch Posterior base Posterior primary branch 9.0 39.8 3234 Posterior secondary branch 6.8 30.0
155
3235 Table S4.13: Hop Island 1
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 140 621 96 524 109 535 216 853 159 630 123 672 233 896 138 650 194 979 179 692 147 732 169 619 181 630 Buccopharyngeal tube Buccal tube length 22.6 – 18.3 – 20.4 – 25.3 – 25.2 – 18.3 – 31.2 – 26.0 – 21.2 – 19.8 – 25.9 – 27.6 – 20.0 – 32.6 – 27.2 – 28.7 – Stylet support insertion point 15.0 66.2 11.0 60.3 11.3 55.6 15.2 60.1 15.1 59.8 11.1 60.9 18.9 60.6 15.8 60.7 13.3 62.8 12.5 63.0 15.2 58.7 16.7 60.3 12.9 64.2 21.3 65.5 16.6 60.8 18.0 62.7 Buccal tube external width 3.0 13.4 2.4 12.8 2.6 12.7 2.7 10.7 3.2 12.7 2.6 14.0 3.2 10.1 3.9 14.8 1.9 8.8 3.0 15.2 4.5 17.5 2.7 9.8 2.5 12.2 3.4 10.4 3.8 14.1 3.7 12.8 Buccal tube internal width 1.7 7.7 1.1 5.9 1.1 5.3 1.2 4.8 2.0 8.0 1.3 7.1 1.7 5.3 2.6 10.0 0.7 3.1 1.5 7.3 2.9 11.4 1.4 5.0 1.2 5.9 1.6 4.8 2.2 8.1 2.5 8.6 Placoid lengths Macroplacoid 1 4.8 21.4 4.7 25.8 4.6 22.3 6.6 26.0 5.3 20.8 4.4 23.8 6.2 19.7 8.0 30.6 3.8 18.0 4.4 22.2 7.6 29.3 5.6 20.2 4.8 23.8 6.5 19.8 6.2 22.8 6.8 23.8 Macroplacoid 2 3.1 13.8 2.9 15.6 3.0 14.7 4.1 16.2 3.8 15.1 3.3 17.9 3.9 12.4 5.0 19.2 3.8 17.8 3.4 17.0 5.3 20.5 5.3 19.1 4.2 21.2 5.0 15.3 4.8 17.5 4.8 16.8 Macroplacoid row 9.8 43.3 8.8 47.8 9.1 44.4 13.1 51.6 12.5 49.6 8.5 46.6 11.6 37.2 14.8 56.9 8.9 42.0 9.1 45.7 14.6 56.5 12.5 45.2 9.9 49.5 13.0 39.8 12.4 45.4 12.7 44.1 Claw 1 heights External base 3.8 17.0 4.1 22.3 2.8 13.6 4.4 17.3 4.4 17.4 4.5 24.8 5.5 17.7 6.1 23.5 3.4 17.0 5.8 22.3 4.1 20.3 7.3 22.4 5.7 19.7 External primary branch 8.5 37.7 7.5 40.8 7.4 36.3 8.8 34.9 9.5 37.6 7.2 39.3 12.3 39.3 12.1 46.4 9.0 45.5 11.2 43.2 9.2 33.3 7.8 38.7 14.0 42.9 10.0 36.9 10.1 35.3 External secondary branch 6.4 28.1 4.7 23.0 6.4 25.1 5.9 23.4 4.7 25.9 6.3 20.2 8.4 32.3 8.1 38.1 5.3 26.7 5.5 21.2 7.5 27.1 6.1 30.4 9.2 28.2 6.5 23.8 6.1 21.2 Internal base 3.7 16.3 2.3 11.3 3.9 15.2 4.7 14.9 6.5 24.9 3.6 18.0 7.2 22.0 Internal primary branch 5.6 24.8 7.2 39.4 6.5 31.7 7.1 28.2 7.3 23.2 6.4 30.0 6.4 32.4 8.0 29.0 9.4 28.8 Internal secondary branch 5.4 23.7 4.3 21.0 3.9 15.2 6.2 19.7 8.1 31.3 5.6 26.6 4.7 23.7 5.6 20.1 8.3 25.4 Claw 2 heights External base 4.2 18.7 5.1 27.9 5.0 24.6 5.0 19.7 4.6 18.1 4.4 24.0 6.1 19.6 6.9 26.5 4.2 19.9 4.0 20.0 6.4 24.7 4.6 16.5 4.8 23.9 6.9 25.4 6.4 22.4 External primary branch 9.6 42.6 9.6 52.7 9.9 48.7 7.8 31.0 11.8 46.6 8.3 45.4 13.2 42.1 14.0 53.9 8.8 41.4 9.6 48.6 12.0 46.5 10.7 38.7 8.8 43.9 13.9 42.5 12.1 44.5 10.8 37.7 External secondary branch 6.7 29.7 7.6 29.8 7.2 28.4 5.0 27.1 8.5 27.3 9.2 35.6 5.8 27.2 6.7 34.0 6.8 26.2 7.2 26.2 6.1 30.4 8.8 27.1 8.5 31.3 7.4 25.8 Internal base 3.2 14.1 4.2 22.7 4.1 19.9 5.1 20.1 5.1 16.2 3.8 14.7 3.8 19.1 4.2 15.3 Internal primary branch 6.6 28.9 7.6 41.5 7.5 36.7 6.5 25.6 10.0 31.9 8.5 32.8 8.6 31.1 11.2 34.3 Internal secondary branch 5.6 24.9 4.3 21.1 6.5 25.8 7.7 24.6 6.7 25.9 7.6 38.3 4.9 17.7 7.2 22.0 Claw 3 heights External base 4.3 18.8 2.5 12.2 4.6 18.2 5.6 22.0 5.8 18.6 3.7 14.4 3.7 17.3 4.2 21.3 4.7 17.0 4.7 23.4 External primary branch 10.2 45.2 9.1 44.7 9.3 36.5 10.6 42.2 8.1 44.4 14.3 45.7 13.6 52.2 7.7 36.3 11.4 57.5 10.7 41.3 11.7 42.3 8.2 41.1 11.8 43.3 External secondary branch 5.4 24.0 5.5 27.1 6.4 25.4 6.7 26.5 6.1 33.2 8.2 26.2 9.2 35.4 5.4 25.6 6.1 30.6 7.5 28.8 7.2 26.2 6.2 31.0 7.5 27.4 Internal base 3.7 16.3 2.4 11.6 4.4 17.6 5.6 18.0 3.8 14.5 2.8 13.3 6.1 23.7 3.1 11.2 3.1 15.4 Internal primary branch 8.2 36.1 7.0 34.2 7.2 28.4 7.9 31.4 9.3 29.6 9.3 35.9 6.6 31.1 8.5 30.9 5.8 28.9 Internal secondary branch 6.3 27.6 5.0 24.6 5.0 19.9 7.6 24.4 6.8 26.0 3.9 18.2 7.1 27.6 6.5 23.5 5.2 25.9 Claw 4 lengths Anterior base 2.6 11.4 4.0 21.9 3.2 15.9 4.0 15.8 3.4 13.5 5.4 17.2 5.4 20.7 4.1 19.4 4.2 21.2 5.5 20.0 4.3 13.2 Anterior primary branch 7.4 32.9 6.6 36.2 6.5 31.9 8.4 33.2 8.0 31.6 6.2 34.1 9.1 29.2 10.1 38.7 7.1 33.4 8.6 43.4 9.0 34.8 10.0 36.3 9.1 45.4 9.9 30.3 9.1 33.5 9.4 32.8 Anterior secondary branch 5.6 24.9 5.5 29.8 5.5 26.8 5.7 22.3 7.3 28.9 4.4 23.9 7.8 24.9 7.4 28.6 5.6 26.5 4.9 24.9 5.4 19.4 4.0 20.2 6.6 20.2 6.8 25.0 Posterior base 3.7 20.2 3.8 18.6 5.0 19.6 4.6 18.1 3.1 16.7 8.1 25.8 5.2 20.0 4.0 18.8 3.4 17.1 6.4 23.3 4.0 12.1 Posterior primary branch 9.9 43.7 9.8 53.3 10.0 49.2 12.0 47.5 12.3 48.9 8.9 48.6 14.4 46.2 15.7 60.5 10.4 49.3 11.3 57.2 11.0 42.6 13.5 48.8 10.0 49.8 13.6 41.6 11.0 40.4 12.7 44.3 3236 Posterior secondary branch 5.1 22.5 5.9 32.0 6.4 31.3 5.5 21.8 7.2 28.3 5.4 29.4 9.9 31.8 10.1 38.8 5.8 27.1 6.2 31.4 6.6 23.8 4.5 22.6 9.6 29.4 8.6 31.7 9.1 31.6
3237
3238
3239
3240
156
3241 Table S4.14: Hop Island 2
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 158 689 171 714 257 868 269 923 169 592 218 769 212 663 239 790 269 918 243 890 219 752 215 789 244 899 179 738 220 755 161 678 125 503 185 808 189 944 176 749 221 797 198 764 193 784 238 799 193 664 218 821 Buccopharyngeal tube Buccal tube length 23.0 – 24.0 – 29.6 – 29.2 – 28.6 – 28.3 – 32.0 – 30.3 – 29.3 – 27.3 – 29.1 – 27.3 – 27.2 – 24.2 – 29.2 – 23.8 – 24.9 – 22.9 – 20.0 – 23.5 – 27.7 – 25.9 – 24.6 – 29.8 – 29.0 – 26.6 – Stylet support insertion point 13.5 58.8 16.5 68.6 18.9 63.9 19.6 67.3 18.0 62.9 17.8 62.7 20.7 64.8 18.8 62.2 17.4 59.5 16.3 59.6 17.4 59.8 16.5 60.6 16.9 62.0 14.6 60.4 19.1 65.3 14.8 62.2 16.3 65.3 13.9 60.7 12.6 63.1 14.6 62.3 16.1 58.3 15.3 59.1 15.5 63.2 16.5 55.4 16.8 57.9 16.6 62.3 Buccal tube external width 2.8 12.2 2.6 10.9 4.5 15.0 4.3 14.7 3.4 11.9 4.6 16.2 5.0 15.5 3.7 12.1 4.4 14.9 4.1 15.1 4.0 13.8 4.3 15.9 4.5 16.4 2.7 11.0 4.8 16.4 3.4 14.4 2.5 9.8 2.6 11.2 2.2 11.2 3.1 13.4 4.2 15.0 2.7 10.6 2.9 11.7 4.1 13.9 3.7 12.9 3.5 13.2 Buccal tube internal width 1.6 7.0 1.2 5.2 3.2 10.6 2.6 8.8 2.3 8.1 2.5 8.8 3.0 9.3 1.9 6.1 2.8 9.5 2.7 9.9 2.3 7.9 2.5 9.2 3.0 11.1 1.6 6.4 3.2 10.9 1.8 7.3 1.1 4.3 1.1 4.7 0.8 4.0 1.5 6.2 2.8 10.0 1.0 3.9 1.6 6.7 2.6 8.8 1.7 6.0 1.7 6.4 Placoid lengths Macroplacoid 1 4.6 20.0 5.0 20.9 6.6 22.3 7.2 24.8 5.8 20.4 6.2 21.9 6.2 19.5 9.1 30.1 7.2 24.6 6.1 22.2 5.2 17.8 7.2 26.4 7.4 27.2 5.1 21.2 7.3 25.1 5.5 23.0 5.4 21.6 5.7 25.1 4.8 24.2 5.7 24.1 8.0 28.7 5.3 20.6 5.2 21.3 6.2 20.9 7.2 25.0 5.1 19.0 Macroplacoid 2 3.5 15.1 3.9 16.4 5.8 19.7 6.0 20.4 5.2 18.0 5.3 18.6 5.9 18.5 6.2 20.6 5.6 19.1 3.9 14.2 4.8 16.6 5.4 20.0 5.4 19.8 3.8 15.8 5.6 19.3 4.0 16.9 3.4 13.8 4.5 19.9 3.8 19.1 3.4 14.5 6.1 22.1 3.9 15.1 3.4 13.7 4.8 16.1 4.8 16.7 4.9 18.5 Macroplacoid row 10.2 44.2 10.6 44.0 14.4 48.6 15.0 51.5 12.8 44.8 13.6 48.2 13.6 42.5 17.4 57.3 14.4 49.2 12.1 44.1 12.6 43.3 14.3 52.4 15.0 55.3 11.1 45.7 14.2 48.6 12.1 50.9 9.9 39.8 12.1 52.9 10.4 52.0 10.9 46.2 15.3 55.4 10.8 41.5 11.1 45.1 13.0 43.5 14.1 48.7 13.2 49.5 Claw 1 heights External base 4.5 19.4 6.7 22.8 5.8 20.2 5.5 19.3 5.8 18.2 5.1 16.9 6.2 22.8 7.0 25.9 4.2 17.2 7.2 24.5 3.9 16.4 3.9 16.5 7.5 27.2 4.8 18.5 5.3 21.5 6.2 20.9 External primary branch 10.1 44.0 9.1 38.1 11.6 39.2 10.0 34.1 13.3 46.6 9.7 34.2 13.6 42.4 12.4 40.9 12.5 42.7 14.1 51.6 11.0 38.0 14.0 51.4 12.7 46.9 10.5 43.5 14.4 49.2 9.7 40.8 9.8 39.4 8.5 37.2 8.6 42.8 9.4 40.1 12.9 46.7 9.6 37.1 8.8 35.9 11.5 38.7 11.4 39.5 12.1 45.3 External secondary branch 7.8 33.8 6.4 26.6 10.4 35.2 6.8 23.4 9.6 33.8 8.2 25.7 8.8 29.2 7.8 26.5 10.5 38.5 8.8 30.2 8.1 29.7 9.8 36.1 6.1 25.1 8.8 30.2 5.4 22.6 7.6 30.6 7.5 33.0 5.9 29.5 6.1 26.1 8.8 31.9 6.8 26.3 5.2 21.0 10.1 33.9 9.8 33.7 7.6 28.4 Internal base 4.1 17.9 4.8 16.2 6.2 21.7 5.8 20.5 6.3 23.1 5.1 18.7 3.5 14.3 4.6 15.7 4.6 20.0 3.8 16.3 5.7 20.7 3.8 14.7 3.8 15.3 6.1 20.4 Internal primary branch 9.5 32.0 8.5 29.2 10.1 35.2 8.5 30.2 9.4 29.5 10.0 33.1 10.7 39.1 9.3 31.9 9.3 33.9 9.1 33.4 7.9 32.6 11.2 38.5 8.5 35.5 7.2 29.0 7.2 31.6 7.4 36.9 6.2 26.2 10.4 37.5 8.6 33.0 5.9 23.8 9.4 31.4 8.8 30.5 9.5 35.7 Internal secondary branch 6.5 28.3 7.8 26.3 6.0 20.7 8.8 30.9 6.4 22.6 7.2 23.7 6.7 23.0 8.5 31.1 8.5 29.3 6.2 22.7 8.3 30.5 5.2 21.6 6.7 23.1 6.5 26.1 6.1 26.6 6.2 30.8 4.8 20.3 6.6 23.8 5.9 22.8 7.7 26.0 7.5 26.0 7.2 26.9 Claw 2 heights External base 5.7 24.6 5.3 21.9 7.8 26.4 5.5 18.8 6.2 21.6 7.4 23.2 5.6 19.2 5.8 21.1 8.4 28.9 7.8 26.7 4.0 17.7 5.6 27.8 3.2 13.8 5.9 21.2 4.8 18.4 5.9 23.9 8.1 27.3 External primary branch 11.3 49.1 11.3 46.9 15.6 52.5 14.2 48.6 14.8 51.7 13.6 42.3 13.5 46.1 16.0 58.6 13.1 45.1 15.1 55.4 12.1 44.6 10.8 44.4 15.8 54.2 10.9 45.6 7.9 31.6 9.2 40.3 11.0 55.1 9.4 40.1 13.2 47.7 10.3 39.6 9.2 37.5 15.3 51.4 15.2 57.3 External secondary branch 7.6 33.0 6.3 26.2 7.9 27.0 9.0 31.6 11.5 35.9 7.3 24.9 8.2 30.0 8.1 27.7 11.1 40.8 7.6 27.8 8.9 36.9 11.3 38.7 7.6 32.1 5.5 21.9 6.9 30.3 7.9 39.6 7.6 32.2 7.1 25.7 7.1 27.5 5.7 23.2 9.6 32.3 8.2 30.7 Internal base 4.2 18.3 5.1 21.3 3.9 13.1 5.3 18.1 7.1 22.2 6.1 20.9 5.2 19.0 6.2 21.1 3.9 16.3 4.7 20.7 4.2 21.1 4.1 17.4 4.5 17.3 6.9 23.0 Internal primary branch 6.7 29.0 8.8 36.4 11.2 37.6 10.0 34.2 8.3 29.1 9.4 29.4 11.5 39.3 11.4 42.0 10.1 37.1 9.8 40.3 10.5 36.1 7.5 31.6 8.1 35.4 7.7 38.4 7.3 31.1 11.3 40.9 8.7 33.6 10.2 34.3 11.3 42.4 Internal secondary branch 5.8 25.4 7.6 25.8 9.0 30.9 7.2 25.3 8.9 27.8 6.5 22.1 9.9 36.2 8.0 29.2 7.3 30.0 8.7 29.8 5.8 24.1 7.9 34.4 5.9 29.3 5.7 24.4 5.0 18.2 5.9 22.8 9.2 30.9 8.0 30.1 Claw 3 heights External base 5.9 25.7 5.9 24.6 6.7 23.4 6.7 23.6 5.1 15.9 5.5 18.8 5.1 18.5 7.0 24.1 8.0 29.4 6.1 25.3 6.1 25.6 4.2 16.7 6.8 33.9 3.6 15.4 6.4 24.7 8.2 27.5 15.6 53.8 External primary branch 9.7 42.0 10.6 44.1 11.4 38.6 14.1 49.2 13.1 46.3 12.6 39.5 13.7 45.2 14.1 48.1 13.8 50.4 13.6 47.0 14.0 51.2 14.9 54.7 11.1 45.8 12.3 42.0 11.4 47.9 8.1 32.7 11.3 49.5 9.2 46.3 8.9 37.8 15.2 54.9 10.4 39.9 10.2 41.6 13.7 46.0 13.8 47.6 13.0 48.7 External secondary branch 6.9 30.0 7.3 30.5 8.9 31.1 9.8 34.5 8.3 25.8 10.9 36.1 9.4 31.9 8.1 29.7 7.9 27.3 11.7 42.8 10.7 39.4 9.1 37.6 7.8 26.6 7.6 30.5 6.5 28.5 7.7 38.3 8.2 34.7 7.8 28.3 8.6 33.2 7.0 28.4 9.4 31.6 8.4 28.9 8.9 33.3 Internal base 4.4 19.3 5.6 18.9 4.7 16.5 5.3 18.9 4.5 14.2 5.2 17.8 4.5 16.6 5.0 17.3 6.6 24.3 4.5 18.6 4.8 20.1 5.3 26.6 3.5 14.7 5.9 21.2 5.0 19.1 3.0 12.1 5.6 18.8 5.9 20.4 5.9 22.2 Internal primary branch 7.5 32.4 8.5 35.3 10.9 36.9 9.4 32.9 10.8 38.1 10.7 33.5 10.0 32.9 11.2 38.3 8.7 31.8 9.4 32.4 10.0 36.6 10.5 38.5 706.0 2913.7 8.5 35.5 8.8 44.0 9.6 34.6 9.0 34.7 8.1 32.9 10.2 34.2 10.8 37.3 9.8 36.8 Internal secondary branch 6.9 30.1 8.9 31.0 9.2 32.6 6.0 18.8 8.8 28.9 6.0 20.5 7.0 25.5 9.2 31.6 8.6 31.4 6.5 23.8 6.7 27.7 6.9 34.4 5.8 24.6 8.9 32.0 7.2 27.6 4.6 18.7 7.5 25.1 6.8 25.7 Claw 4 lengths Anterior base 3.9 16.1 6.0 20.3 7.7 27.3 9.6 29.9 3.9 12.9 6.4 23.3 3.5 14.2 7.2 24.5 2.9 12.3 4.5 18.2 4.4 19.2 4.0 20.1 3.5 14.9 4.9 17.6 4.9 19.7 5.0 16.6 Anterior primary branch 8.3 36.0 8.8 36.4 10.9 36.9 10.6 36.2 12.0 42.1 13.0 46.0 11.6 36.1 10.5 34.8 8.0 27.2 11.5 42.0 8.8 30.4 11.1 40.8 10.2 37.6 8.8 36.4 9.9 33.9 9.2 38.4 9.3 37.5 10.3 45.1 8.9 44.4 7.7 32.7 11.5 41.5 9.6 36.8 10.6 35.6 11.3 39.1 10.0 37.4 Anterior secondary branch 6.0 25.9 7.2 30.1 8.8 29.6 9.0 31.0 8.3 29.2 9.6 29.8 6.4 21.0 7.3 25.0 7.9 28.8 6.4 22.0 7.9 29.1 5.5 22.6 6.0 20.6 5.1 21.5 5.2 20.8 7.6 33.0 6.0 29.9 5.4 22.8 6.9 25.0 6.6 25.5 7.0 28.4 5.4 18.2 8.5 29.3 7.3 27.3 Posterior base 3.6 15.4 4.4 18.2 6.2 20.9 6.1 21.0 9.7 30.3 4.0 13.2 6.1 20.7 5.3 19.3 4.9 20.1 5.5 19.0 4.7 19.7 7.0 30.5 5.5 27.6 5.4 23.1 6.2 22.4 6.1 24.6 6.4 22.1 Posterior primary branch 12.7 55.1 10.9 45.5 16.0 54.0 14.3 49.0 15.9 55.5 15.9 56.0 15.4 48.3 14.2 46.9 12.0 41.0 15.3 56.0 15.9 54.7 16.8 61.8 14.4 53.1 14.0 57.8 12.1 41.5 12.1 50.7 13.6 54.6 13.2 57.9 12.4 62.2 12.4 53.0 8.3 29.9 12.6 48.7 15.5 52.1 15.7 54.2 13.0 49.0 3242 Posterior secondary branch 4.9 21.3 8.6 35.6 8.8 29.7 7.2 24.5 9.3 32.6 7.2 25.4 10.5 32.7 8.8 29.2 8.1 27.6 8.3 30.4 11.1 38.3 10.6 39.0 6.5 26.8 8.0 27.3 5.8 24.2 10.8 47.4 8.3 41.8 6.0 25.5 17.5 63.1 9.7 37.5 8.4 34.2 8.5 28.5 8.7 30.1 8.5 32.1
3243
3244
3245
3246
3247
3248
157
3249 Table S4.15: Mawson Station 1
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 128 665 183 598 156 606 209 759 222 729 171 631 192 559 193 614 173 614 130 704 192 618 172 586 130 490 140 665 164 550 164 657 143 496 116 504 133 562 183 742 143 605 242 953 160 579 216 657 132 437 176 650 120 464 Buccopharyngeal tube Buccal tube length 19.3 – 30.6 – 25.7 – 27.5 – 30.4 – 27.0 – 34.4 – 31.5 – 28.1 – 18.5 – 31.1 – 29.4 – 26.6 – 21.1 – 29.8 – 24.9 – 28.8 – 23.1 – 23.6 – 24.7 – 23.6 – 25.3 – 27.6 – 32.9 – 30.3 – 27.1 – 25.9 – Stylet support insertion point 10.6 55.3 18.9 61.6 15.4 59.9 15.9 57.9 16.8 55.4 16.4 60.7 18.4 53.5 18.0 57.3 17.5 62.0 11.6 62.9 18.9 60.7 18.1 61.5 17.0 63.8 13.1 62.0 17.0 57.2 15.0 60.2 16.8 58.4 14.9 64.4 15.4 64.9 15.4 62.5 15.0 63.4 14.1 55.6 15.9 57.8 17.7 53.7 18.0 59.2 16.0 59.0 16.0 61.5 Buccal tube external width 3.1 16.1 4.3 14.1 3.3 12.9 3.6 13.2 5.0 16.5 3.7 13.8 4.8 14.0 3.2 10.3 2.4 8.6 3.0 16.5 4.4 14.2 4.1 14.0 3.3 12.3 2.7 12.9 3.6 12.0 3.3 13.1 3.6 12.5 3.0 12.9 3.2 13.4 2.8 11.4 3.4 14.3 3.9 15.5 3.3 11.9 4.7 14.3 3.2 10.5 3.3 12.3 2.2 8.3 Buccal tube internal width 1.2 6.2 1.8 6.0 1.9 7.3 1.4 5.0 3.5 11.6 2.4 8.9 3.1 8.9 1.6 5.0 1.1 3.9 1.6 8.8 2.6 8.2 2.4 8.2 1.5 5.7 1.2 5.9 2.0 6.9 1.8 7.2 2.2 7.5 1.4 5.9 1.8 7.6 1.5 6.2 1.6 6.6 2.2 8.8 1.8 6.6 2.7 8.3 1.6 5.3 1.9 7.0 0.9 3.4 Placoid lengths Macroplacoid 1 5.7 29.7 7.5 24.4 5.4 20.9 7.6 27.6 7.8 25.5 6.2 22.8 8.4 24.5 6.6 21.0 6.0 21.1 3.2 17.2 5.5 17.6 7.2 24.3 4.9 18.6 5.0 23.7 5.6 18.9 5.4 21.7 6.3 21.8 3.8 16.6 4.5 19.0 6.2 25.0 4.4 18.7 5.5 21.7 6.2 22.3 9.6 29.0 6.5 21.3 6.9 25.5 5.6 21.5 Macroplacoid 2 4.1 21.2 5.8 18.8 4.0 15.7 5.1 18.4 5.2 17.0 4.1 15.0 6.4 18.7 6.0 18.9 4.5 16.0 3.3 18.0 5.1 16.5 4.9 16.7 4.0 15.0 4.3 20.4 4.6 15.3 4.3 17.1 4.5 15.6 3.3 14.4 4.2 17.8 3.7 15.0 4.1 17.2 4.9 19.3 5.8 21.1 6.0 18.3 5.5 18.2 5.4 19.8 3.7 14.2 Macroplacoid row 11.3 58.8 15.7 51.3 12.2 47.5 15.0 54.6 14.8 48.8 11.7 43.3 17.5 50.9 14.8 46.9 12.8 45.4 8.0 43.4 13.0 41.7 12.9 43.8 10.4 39.2 11.0 51.9 11.7 39.4 10.8 43.5 13.4 46.7 8.7 37.7 11.0 46.7 11.0 44.5 10.3 43.8 12.7 50.1 12.0 43.6 19.0 57.7 14.5 47.8 14.6 54.0 11.3 43.4 Claw 1 heights External base 4.2 21.9 6.0 19.4 6.0 23.3 5.4 19.8 7.7 25.4 3.8 14.1 5.3 18.7 2.5 13.5 4.3 16.1 3.3 15.7 4.0 13.3 3.6 14.5 3.8 13.2 3.3 14.2 4.5 19.0 2.9 12.4 4.9 19.3 3.3 11.8 6.4 19.6 4.4 14.4 5.4 19.8 External primary branch 9.6 49.7 10.6 34.5 7.2 28.2 10.7 38.8 12.3 40.6 8.9 33.0 8.6 30.7 8.1 43.9 9.8 33.5 10.8 40.8 8.0 37.7 11.1 37.4 8.5 34.1 10.1 34.9 6.6 28.4 8.0 33.9 7.6 32.0 9.0 35.4 7.2 25.9 14.1 42.9 10.3 33.9 10.9 40.4 6.8 26.3 External secondary branch 6.9 35.7 10.5 40.7 8.3 30.0 9.3 30.5 5.1 18.7 6.6 23.5 4.3 23.1 8.9 30.4 5.6 21.1 5.2 24.7 6.9 23.3 7.0 28.2 6.7 23.4 4.6 19.8 5.0 21.2 5.5 23.1 7.0 27.5 6.0 21.7 10.6 32.1 5.8 19.1 6.6 24.2 5.1 19.6 Internal base 4.4 22.8 4.7 15.4 4.0 15.7 4.6 16.7 3.9 12.8 4.2 15.5 4.1 14.5 3.2 17.5 3.8 12.8 2.2 10.3 4.7 15.8 3.5 14.0 3.1 10.7 2.7 11.6 2.9 12.1 2.5 10.4 4.1 16.3 3.4 12.3 4.2 12.9 3.7 12.3 4.8 17.7 3.8 14.5 Internal primary branch 7.0 36.2 8.3 27.1 7.1 27.5 8.1 29.4 7.6 25.0 7.6 28.0 7.9 27.9 7.9 42.8 8.6 29.1 5.5 26.3 7.5 25.2 7.7 31.1 8.4 29.3 3.6 15.7 6.6 28.1 5.6 23.7 7.2 28.4 6.5 23.7 10.1 30.8 7.2 23.7 8.0 29.5 5.6 21.6 Internal secondary branch 6.1 31.9 8.0 26.0 6.3 24.4 7.6 27.7 6.5 21.3 4.6 17.2 6.1 21.8 4.4 23.6 7.5 25.3 5.4 25.5 5.8 19.5 6.3 25.3 6.3 21.9 5.0 21.6 5.4 23.0 4.2 17.6 6.0 23.5 5.0 18.0 7.9 23.9 5.1 16.7 5.5 20.4 6.6 25.6 Claw 2 heights External base 2.6 13.5 7.0 23.0 6.0 23.2 4.2 15.1 6.1 19.9 8.0 29.4 6.5 18.8 6.2 19.6 4.0 14.3 6.0 32.3 5.6 18.0 5.8 21.7 5.9 19.8 3.3 13.3 3.9 13.5 4.4 18.7 3.1 13.3 4.6 18.3 7.4 22.5 3.0 9.8 6.1 22.4 6.0 23.2 External primary branch 9.9 51.6 14.5 47.4 11.8 45.8 11.0 40.1 13.7 45.2 10.6 39.1 12.8 37.1 11.6 36.9 9.2 32.7 9.9 53.3 11.4 36.5 11.9 40.5 9.9 37.1 10.6 50.1 11.0 36.9 6.9 27.7 9.7 33.6 9.1 38.7 10.0 40.6 6.9 29.2 12.2 48.2 9.9 35.9 15.6 47.3 12.3 40.4 12.4 45.7 10.6 40.8 External secondary branch 8.0 41.5 10.9 35.7 8.9 34.4 7.3 26.7 7.6 24.9 7.8 28.7 10.6 30.9 8.8 27.9 6.0 21.4 6.9 37.2 8.1 26.2 7.4 25.0 4.9 18.5 6.6 31.4 9.6 32.4 5.4 21.6 7.8 27.1 5.8 24.5 7.1 28.8 5.2 21.8 9.2 36.2 8.4 30.5 10.6 32.3 5.7 18.9 9.1 33.7 7.6 29.3 Internal base 3.3 16.9 4.9 18.9 5.8 21.1 5.7 18.7 4.6 16.9 5.4 15.6 4.2 22.6 5.2 16.8 4.7 17.6 3.5 16.5 4.9 16.5 3.8 15.3 3.1 10.7 3.7 15.5 3.0 12.7 5.0 19.6 4.9 17.8 7.4 22.5 3.2 10.6 4.3 15.8 Internal primary branch 7.5 38.8 9.0 35.1 10.9 39.6 11.3 37.2 8.1 29.9 9.5 27.7 11.2 35.7 8.4 45.3 7.8 24.9 8.3 31.0 7.5 35.6 9.5 31.8 6.3 25.4 8.2 28.6 7.8 33.0 6.2 26.3 9.0 35.4 9.0 32.7 11.0 33.3 8.7 28.7 8.7 32.3 Internal secondary branch 6.4 33.4 6.5 25.4 7.6 27.7 8.7 28.6 6.3 23.1 7.6 21.9 5.0 27.3 7.7 24.6 5.7 21.2 5.1 24.2 7.6 25.5 5.6 22.6 6.0 20.8 4.4 18.7 5.3 22.4 7.5 29.7 6.8 24.7 9.2 28.0 6.0 19.9 7.4 27.4 Claw 3 heights External base 6.1 31.5 4.9 16.0 5.4 21.2 7.0 25.4 7.2 23.6 5.1 18.9 7.3 23.2 4.9 17.3 5.6 17.9 6.3 21.6 7.7 28.8 5.8 27.4 5.8 19.6 5.2 20.8 4.9 17.1 3.9 15.8 4.8 20.3 6.0 23.8 7.2 21.7 3.6 11.8 6.0 22.2 External primary branch 11.9 61.8 13.1 42.8 13.4 52.0 12.6 45.9 13.7 45.2 10.2 37.7 12.5 36.4 12.7 40.3 11.7 41.5 7.7 41.4 12.6 40.6 11.3 38.4 11.4 42.9 9.4 44.6 10.2 34.4 9.5 38.0 9.4 32.6 7.8 33.7 10.2 43.3 10.0 40.4 10.5 44.6 11.5 45.3 16.8 51.1 9.1 30.1 9.7 35.7 External secondary branch 6.9 35.8 8.0 26.2 7.5 29.2 9.3 33.7 7.7 25.4 6.8 25.1 9.9 28.8 10.4 32.9 7.0 24.9 6.2 33.5 8.4 26.9 8.2 27.8 6.3 23.6 7.0 33.4 9.2 30.8 7.4 29.8 6.4 22.3 6.8 29.3 5.4 22.7 7.2 29.2 6.5 27.5 8.2 32.5 10.3 31.3 6.4 21.2 7.4 27.2 Internal base 5.2 16.9 4.6 17.8 4.2 15.2 6.3 20.8 4.1 15.1 3.8 11.9 5.3 18.0 6.0 22.6 5.0 23.5 5.6 18.8 3.4 13.6 4.9 17.0 3.4 14.2 3.1 12.7 2.4 10.3 5.0 19.5 5.9 17.9 4.0 13.2 5.3 19.5 Internal primary branch 9.3 30.4 7.6 29.5 8.8 32.0 10.2 33.4 7.3 27.0 10.2 29.6 9.6 30.6 6.6 35.8 8.2 27.9 7.2 27.2 8.3 39.5 9.3 31.3 6.6 26.6 7.7 26.8 5.1 22.1 7.6 32.3 7.5 30.2 8.3 35.0 8.4 33.2 10.0 30.3 7.6 25.2 8.1 29.9 Internal secondary branch 5.9 19.3 6.7 26.2 7.5 27.3 8.0 26.3 4.7 17.2 8.3 24.2 6.5 20.7 4.3 23.4 7.5 25.6 5.2 19.7 6.4 30.5 7.4 24.9 4.6 18.3 5.3 18.4 3.7 16.1 5.7 24.1 4.6 18.7 4.8 20.3 6.8 26.9 8.7 26.6 6.0 19.7 7.3 27.0 Claw 4 lengths Anterior base 6.3 20.5 3.7 14.4 5.0 18.0 4.9 16.1 4.8 17.8 5.2 15.0 5.7 18.1 3.3 11.8 4.0 21.5 3.6 11.4 3.9 13.2 6.0 22.5 3.5 16.6 4.2 13.9 4.0 16.1 4.6 16.0 2.9 12.5 4.4 17.9 4.2 17.7 6.1 23.9 6.5 23.6 5.0 15.0 4.7 15.6 4.8 17.7 3.0 11.7 Anterior primary branch 8.0 41.7 10.2 39.6 10.8 39.4 11.9 39.1 8.6 31.9 11.6 33.8 11.0 35.0 8.6 30.5 7.0 37.8 9.5 30.5 8.5 29.0 7.1 26.7 8.6 40.9 8.6 28.8 7.5 30.0 7.6 26.2 6.8 29.6 7.3 31.0 7.6 30.8 6.9 29.1 9.8 38.8 9.2 33.4 11.5 34.9 9.1 30.1 10.6 39.0 7.9 30.4 Anterior secondary branch 6.8 35.3 9.0 29.4 6.2 24.1 5.8 21.1 7.9 29.2 6.9 20.2 7.9 25.2 6.0 21.4 6.8 36.9 5.9 19.0 7.6 25.7 6.4 23.9 5.6 26.7 6.3 21.1 4.9 19.6 7.3 25.2 4.0 17.5 3.8 16.2 5.5 22.3 4.7 19.7 7.1 27.9 7.7 27.7 7.6 23.0 4.8 15.7 7.1 26.2 5.4 21.0 Posterior base 4.1 21.4 3.5 13.6 4.5 16.5 4.3 15.7 4.9 14.3 6.1 19.4 3.2 11.4 4.6 24.7 3.8 12.1 6.4 21.9 4.8 18.0 3.3 15.5 6.1 20.3 2.0 8.1 4.2 14.7 4.9 21.3 3.1 12.5 4.5 19.2 5.5 21.7 5.7 20.6 4.7 14.3 5.2 17.1 6.2 22.9 4.4 16.8 Posterior primary branch 10.9 56.7 13.2 42.9 12.2 47.5 14.8 53.9 12.7 41.9 12.6 46.5 13.7 39.8 15.6 49.7 12.2 43.4 10.1 54.8 14.6 46.8 9.5 32.3 12.0 45.2 10.9 51.6 12.2 41.0 11.4 45.8 12.3 42.9 8.7 37.7 11.5 48.8 11.1 44.8 10.3 43.5 13.6 53.7 13.1 47.6 16.4 49.8 12.9 42.6 16.1 59.4 10.4 40.1 3250 Posterior secondary branch 6.4 33.4 12.7 41.5 6.9 26.8 8.6 31.4 8.9 29.4 6.5 24.2 8.7 25.4 9.1 28.8 7.1 25.3 6.2 33.7 8.3 26.5 8.7 29.4 7.8 29.1 5.8 27.6 8.9 29.9 5.5 22.1 8.0 27.8 5.7 24.9 7.5 31.9 5.0 20.3 5.2 22.1 7.6 30.1 9.7 35.1 11.2 34.1 7.9 26.0 8.2 30.4 6.7 25.9
3251
3252
3253
3254
3255
3256
158
3257 Table S4.16: Mawson Station 2
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 12 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 254 801 175 563 153 582 149 567 132 515 181 786 149 561 129 526 165 516 188 755 151 652 160 726 Buccopharyngeal tube Buccal tube length 31.7 – 31.1 – 26.2 – 26.2 – 25.6 – 23.0 – 26.6 – 24.5 – 31.9 – 24.9 – 23.2 – 22.0 – Stylet support insertion point 18.1 57.2 18.2 58.4 10.3 39.1 15.7 59.8 15.3 59.9 13.6 59.2 15.2 57.2 14.8 60.3 19.0 59.6 15.7 63.0 14.6 63.1 12.9 58.6 Buccal tube external width 4.4 13.9 3.6 11.5 3.2 12.3 3.0 11.5 2.7 10.7 2.2 9.6 3.2 11.9 3.2 13.0 3.6 11.2 3.7 14.8 2.6 11.1 2.7 12.1 Buccal tube internal width 2.8 8.7 1.8 5.6 1.7 6.6 2.0 7.7 1.1 4.3 0.9 3.7 1.6 6.0 1.7 6.9 1.1 3.5 2.2 8.9 1.3 5.6 1.5 6.9 Placoid lengths Macroplacoid 1 9.6 30.2 8.0 25.6 5.3 20.0 5.8 22.2 5.8 22.5 5.7 24.6 6.1 23.1 5.0 20.4 5.6 17.7 6.0 24.1 3.8 16.6 3.8 17.1 Macroplacoid 2 5.7 17.9 5.3 16.9 4.1 15.6 3.7 14.3 4.5 17.4 3.8 16.5 5.2 19.5 4.2 17.0 4.5 14.2 4.3 17.1 3.3 14.2 3.1 14.0 Macroplacoid row 17.6 55.6 14.3 46.0 11.0 42.0 11.3 43.2 11.9 46.3 11.0 47.7 12.8 48.3 10.5 42.8 12.1 37.9 12.2 48.9 9.1 39.1 7.9 36.0 Claw 1 heights External base 6.4 20.2 4.9 18.5 2.9 11.0 4.3 18.5 5.7 17.8 3.5 14.2 2.8 12.1 3.1 14.2 External primary branch 11.8 37.1 8.1 30.8 7.3 28.0 8.5 33.0 9.7 42.3 9.8 36.8 9.1 37.0 8.4 26.2 7.5 30.0 6.2 26.9 8.9 40.4 External secondary branch 7.9 24.8 5.9 22.6 4.8 18.4 6.0 23.3 7.0 30.4 8.1 30.6 6.7 20.9 5.2 20.9 4.9 21.2 4.5 20.3 Internal base 5.6 17.6 4.3 16.2 3.2 12.0 2.8 11.0 3.0 13.1 3.3 10.2 3.1 13.2 Internal primary branch 7.8 24.5 6.4 24.4 5.2 19.7 7.1 27.7 7.9 34.2 7.3 27.5 6.5 20.2 5.9 25.5 Internal secondary branch 7.2 22.7 4.7 17.9 4.9 18.5 5.2 20.3 5.0 21.6 7.2 27.0 5.4 17.0 4.3 18.7 Claw 2 heights External base 7.8 24.6 4.7 15.1 5.5 20.9 3.3 12.5 4.7 20.6 3.7 13.9 5.2 21.3 5.1 16.0 7.7 30.8 3.2 13.8 2.8 12.7 External primary branch 11.3 35.6 11.8 37.8 9.7 37.1 9.1 34.6 9.6 37.5 9.0 39.0 11.2 42.3 7.7 31.5 10.2 32.0 13.4 53.7 8.3 35.7 7.7 35.0 External secondary branch 9.5 30.1 7.8 25.0 7.2 27.3 5.4 20.5 5.6 21.9 7.2 31.2 6.5 24.6 6.5 26.7 7.8 24.3 6.9 27.8 5.5 23.5 4.9 22.5 Internal base 6.6 20.9 3.5 11.2 3.8 14.5 3.3 12.5 3.8 16.5 4.8 18.0 2.2 9.2 3.6 15.5 2.3 10.3 Internal primary branch 8.1 25.6 8.2 26.4 7.1 27.2 6.3 23.9 9.0 35.3 7.3 31.6 8.0 30.1 5.4 22.2 4.9 21.3 6.2 28.4 Internal secondary branch 8.4 26.4 6.7 21.4 5.9 22.5 6.1 23.3 5.6 24.3 6.0 22.6 5.3 21.7 4.7 20.3 3.9 17.8 Claw 3 heights External base 8.3 26.0 5.3 17.0 4.9 18.6 5.0 19.2 3.4 13.3 6.0 26.2 4.1 15.5 4.8 19.7 5.0 15.8 5.0 21.6 4.0 18.2 External primary branch 10.5 33.1 11.7 37.6 9.4 35.8 9.1 35.4 9.9 43.2 10.9 40.9 8.5 34.7 11.1 34.7 7.9 34.3 8.2 37.1 External secondary branch 8.8 27.7 7.4 23.8 6.2 23.7 7.4 28.3 7.6 29.5 7.3 31.7 7.4 27.9 5.8 23.6 8.6 26.8 6.7 28.9 6.4 29.1 Internal base 7.2 22.7 4.5 14.4 3.5 13.3 3.6 13.8 4.6 19.8 4.2 15.7 3.4 13.9 3.4 14.8 2.6 12.0 Internal primary branch 8.9 27.9 8.6 27.7 7.8 29.7 8.2 31.3 7.9 30.6 7.7 33.3 9.8 36.9 5.0 20.6 5.5 23.9 6.0 27.1 Internal secondary branch 7.7 24.2 6.8 21.9 5.3 20.1 6.2 23.5 7.1 27.9 5.9 25.4 6.1 22.8 4.5 18.5 5.0 21.5 4.6 20.7 Claw 4 lengths Anterior base 7.1 22.3 3.1 10.1 5.2 19.9 4.8 18.1 3.6 14.1 5.9 25.5 7.8 29.2 3.3 13.6 4.8 14.9 5.2 20.9 3.5 15.8 Anterior primary branch 12.4 39.2 9.2 29.6 7.1 27.0 10.5 40.0 10.2 40.0 8.0 34.6 9.8 36.8 8.7 35.5 9.8 30.7 7.2 29.0 6.5 28.2 6.5 29.4 Anterior secondary branch 7.8 24.5 7.5 24.1 6.5 24.9 7.5 28.6 7.3 28.5 7.1 30.8 8.4 31.7 5.5 22.3 8.2 25.6 4.8 19.2 5.7 24.6 4.5 20.7 Posterior base 7.2 22.8 4.3 16.5 4.5 17.4 6.9 29.8 4.6 17.2 4.7 19.1 6.2 19.3 4.5 17.9 4.8 20.8 3.6 16.4 Posterior primary branch 15.7 49.4 14.5 46.7 15.1 57.5 12.0 45.7 11.0 42.9 12.7 55.2 13.9 52.4 9.9 40.3 13.7 42.8 11.5 46.3 10.2 43.8 9.1 41.2 3258 Posterior secondary branch 8.9 28.2 8.8 28.3 7.6 28.9 6.7 25.7 7.6 29.8 9.4 40.9 8.3 31.2 6.6 26.9 9.4 29.4 6.2 24.9 4.6 19.9 4.3 19.7
3259
3260
159
3261 Table S4.17: Sansom Island
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 12 13 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 172 776 184 667 154 790 120 705 156 723 179 768 191 785 189 783 277 914 160 639 162 714 180 713 235 912 Buccopharyngeal tube Buccal tube length 22.1 – 27.5 – 19.5 – 17.0 – 21.6 – 23.3 – 24.3 – 24.2 – 30.3 – 25.1 – 22.7 – 25.3 – 25.8 – Stylet support insertion point 13.5 60.9 17.1 62.0 10.5 53.8 11.0 64.6 12.8 59.1 13.8 59.0 13.6 56.0 14.6 60.5 19.1 63.2 15.9 63.2 14.3 63.2 15.2 60.0 15.1 58.7 Buccal tube external width 2.7 12.3 4.0 14.4 2.6 13.1 2.4 14.1 2.4 11.0 3.1 13.2 3.5 14.4 3.0 12.2 4.2 13.7 3.2 12.6 2.7 11.7 3.5 13.8 3.8 14.7 Buccal tube internal width 1.1 5.0 2.1 7.5 1.0 5.2 1.2 7.0 1.1 5.1 1.9 8.1 1.8 7.5 1.5 6.2 2.6 8.7 1.6 6.5 1.3 5.6 1.9 7.5 2.4 9.3 Placoid lengths Macroplacoid 1 5.9 26.6 6.3 23.0 4.4 22.4 3.5 20.4 4.1 18.8 3.9 16.7 4.2 17.3 5.0 20.6 4.3 14.2 4.3 17.0 4.6 20.4 4.6 18.3 5.3 20.5 Macroplacoid 2 4.6 20.8 3.7 13.4 4.0 20.5 3.4 20.2 3.9 17.8 3.7 16.1 3.4 13.9 3.9 15.9 4.2 13.9 3.2 12.9 3.7 16.4 3.6 14.3 4.3 16.8 Macroplacoid row 12.1 54.5 11.9 43.2 11.0 56.2 8.6 50.4 9.7 44.9 9.9 42.7 9.5 39.1 10.7 44.3 11.4 37.5 9.6 38.4 9.7 42.9 10.6 41.9 11.3 43.9 Claw 1 heights External base 4.1 20.9 1.8 10.3 3.4 15.5 5.8 25.0 4.3 17.5 3.0 9.8 5.5 21.8 2.9 11.3 External primary branch 9.1 41.3 8.3 30.1 7.2 36.9 7.4 43.5 7.1 32.9 9.0 38.4 7.2 29.5 8.3 34.3 10.3 33.8 6.8 27.0 8.5 33.4 8.2 31.6 External secondary branch 7.4 33.5 6.2 22.6 6.0 30.7 4.5 26.5 6.2 28.5 7.1 30.4 5.8 24.0 7.6 31.6 5.8 19.1 4.9 19.3 6.4 25.1 5.8 22.4 Internal base 3.3 15.0 4.5 23.0 1.8 10.5 2.7 11.5 4.9 20.1 3.1 12.3 2.7 10.4 Internal primary branch 8.1 36.5 6.4 23.3 6.5 33.4 5.9 34.8 6.8 31.6 7.5 32.2 6.6 27.0 7.4 30.5 5.9 23.3 6.8 26.4 Internal secondary branch 5.3 23.8 5.8 21.2 4.5 23.0 3.6 21.0 6.2 28.5 6.1 26.3 5.3 21.7 7.0 28.7 5.3 20.9 5.3 20.7 Claw 2 heights External base 3.4 12.4 2.6 15.3 3.7 17.0 4.2 17.8 4.5 18.6 3.4 13.8 4.5 17.7 3.2 12.6 External primary branch 10.6 48.0 7.9 28.6 10.5 53.8 7.6 44.9 10.1 46.5 9.1 39.0 9.3 38.1 10.3 42.5 6.7 26.6 8.8 39.0 7.9 31.2 9.9 38.4 External secondary branch 5.5 24.8 6.5 23.8 7.5 38.2 4.7 27.8 6.0 27.6 7.1 30.3 6.5 26.8 6.4 26.6 7.7 34.0 5.9 23.4 5.8 22.4 Internal base 3.6 16.1 4.5 23.2 1.5 9.0 2.8 12.9 2.8 11.9 3.0 12.4 3.1 12.0 Internal primary branch 8.3 37.3 6.4 23.1 7.0 35.6 6.4 37.5 7.7 35.8 7.3 31.2 7.5 31.0 8.8 36.4 6.5 25.9 7.0 27.3 Internal secondary branch 5.0 22.5 4.5 16.4 5.2 26.6 4.1 24.1 4.5 20.8 5.9 25.5 4.5 18.7 6.6 27.2 5.3 21.1 5.5 24.2 6.1 23.4 Claw 3 heights External base 5.5 24.8 5.2 18.9 4.5 23.0 2.7 15.7 4.6 21.2 3.2 13.8 4.9 20.0 5.5 21.9 4.1 15.9 External primary branch 10.0 45.2 9.3 34.0 7.5 38.3 8.9 52.6 10.9 50.3 9.2 39.3 9.2 38.1 9.8 40.6 10.6 35.1 9.9 39.4 9.5 42.0 7.2 28.4 7.2 28.0 External secondary branch 7.2 32.4 7.0 25.3 5.7 28.9 4.8 28.0 6.7 31.2 7.8 33.4 5.4 22.2 7.3 30.0 9.9 32.6 6.8 27.0 8.6 38.0 6.6 26.2 5.1 19.9 Internal base 4.1 18.6 4.3 15.6 5.1 26.0 2.0 11.5 3.5 16.3 2.5 10.9 Internal primary branch 8.0 36.1 6.7 24.2 6.0 30.9 6.6 39.0 6.6 30.5 7.5 32.2 6.5 26.9 9.0 37.1 8.1 35.8 6.9 27.3 Internal secondary branch 6.4 28.8 5.4 19.7 4.5 23.1 3.7 21.6 5.9 27.1 6.1 26.1 6.4 26.3 7.2 23.6 6.5 28.6 Claw 4 lengths Anterior base 3.1 11.2 3.7 18.8 2.0 12.0 3.3 15.2 2.9 12.2 2.6 10.8 3.7 15.2 3.8 12.4 3.9 17.0 2.8 10.8 Anterior primary branch 11.3 51.2 8.7 31.5 8.0 41.0 6.2 36.5 8.0 37.1 8.9 38.3 7.6 31.2 8.3 34.1 9.0 29.6 7.9 34.9 6.7 26.3 7.7 29.8 Anterior secondary branch 7.3 33.1 6.1 22.3 5.8 29.7 3.8 22.6 6.3 29.3 5.2 22.3 5.5 22.7 7.7 31.6 5.7 18.7 5.1 22.5 6.0 23.6 5.2 20.1 Posterior base 3.4 12.5 4.1 21.0 2.8 16.3 6.2 28.5 3.9 16.7 2.9 12.0 3.5 14.4 4.5 14.7 4.6 18.2 3.7 16.2 3.8 15.1 3.2 12.2 Posterior primary branch 13.4 60.6 11.9 43.1 11.0 56.5 9.3 55.0 11.6 53.6 11.0 47.2 10.5 43.4 9.7 40.0 13.7 45.3 11.8 46.9 10.0 44.3 9.5 37.6 9.6 37.1 3262 Posterior secondary branch 8.0 36.1 7.5 27.4 5.8 29.9 5.7 33.4 8.1 37.4 6.2 26.6 6.1 24.9 6.2 25.6 6.5 21.4 7.3 29.1 6.8 29.8 6.5 25.6 6.7 26.0
3263
3264
3265 160
3266 Table S4.18: Casey Station
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 12 13 14 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 142 639 153 163 640 173 568 109 592 160 585 205 639 216 144 695 202 109 590 122 721 176 181 Buccopharyngeal tube Buccal tube length 22.3 – – 25.4 – 30.4 – 18.3 – 27.4 – 32.0 – – 20.7 – – 18.4 – 16.9 – – – Stylet support insertion point 14.4 64.7 17.0 66.7 18.4 60.5 16.9 61.6 19.2 60.0 11.9 57.5 12.4 67.1 11.3 66.6 Buccal tube external width 2.8 12.4 3.6 14.0 4.5 14.7 2.4 13.0 3.5 12.8 3.8 11.9 1.6 7.6 1.5 9.0 Buccal tube internal width 1.3 6.0 2.0 7.9 2.9 9.5 0.6 3.4 2.1 7.7 2.4 7.6 0.7 3.5 0.5 3.0 Placoid lengths Macroplacoid 1 3.9 17.4 5.5 21.6 7.5 24.7 5.1 18.6 5.8 18.1 3.4 16.6 3.6 19.6 3.4 20.2 Macroplacoid 2 3.2 14.3 4.2 16.3 5.2 17.1 3.9 14.4 5.3 16.5 3.0 14.5 3.1 16.6 2.7 15.9 Macroplacoid row 8.8 39.7 10.5 41.4 15.1 49.6 10.8 39.5 14.4 45.0 7.1 34.1 7.2 39.3 7.0 41.3 Claw 1 heights External base 3.3 14.9 6.3 24.8 5.2 17.2 6.2 5.6 External primary branch 5.6 25.2 6.6 10.3 40.5 9.8 32.2 5.2 28.4 8.9 32.3 10.5 33.0 8.7 5.7 30.9 5.5 32.7 6.6 9.3 External secondary branch 3.9 17.7 6.1 24.1 7.4 24.4 5.8 31.4 7.6 27.8 6.9 21.7 5.5 5.5 30.0 4.5 7.9 Internal base 3.6 16.1 3.5 18.9 3.9 14.3 Internal primary branch 4.8 21.4 4.7 5.1 20.1 4.9 26.9 6.5 23.7 7.6 23.9 6.4 Internal secondary branch 3.9 21.4 5.1 18.7 6.1 19.1 Claw 2 heights External base 5.4 21.3 4.2 15.2 3.9 12.2 3.7 5.3 External primary branch 7.8 35.0 10.6 41.8 11.9 39.1 6.1 33.2 10.2 37.3 11.8 36.8 8.5 5.4 29.5 7.2 42.8 7.9 9.3 External secondary branch 3.7 16.6 5.4 21.1 7.9 25.9 4.6 25.1 7.8 28.6 5.6 17.6 6.3 5.8 31.7 4.6 27.3 5.9 7.5 Internal base 4.3 16.7 4.0 3.4 4.0 Internal primary branch 5.0 22.6 7.6 30.0 6.1 33.1 7.8 28.4 7.6 6.7 6.9 8.3 Internal secondary branch 3.4 15.3 3.7 20.0 7.1 26.0 5.6 4.2 7.6 Claw 3 heights External base 3.1 4.5 14.8 4.4 23.8 4.1 6.3 3.4 20.3 External primary branch 7.4 33.3 7.9 10.5 41.1 11.5 37.8 7.7 41.8 9.9 36.2 13.5 42.2 9.6 10.0 7.9 42.6 7.5 44.1 8.9 11.0 External secondary branch 5.0 22.4 4.7 5.8 22.7 5.2 17.1 3.4 18.3 8.0 29.4 7.4 23.0 5.9 5.2 5.1 27.4 4.6 27.4 6.4 8.0 Internal base 3.1 12.3 4.3 14.1 3.7 4.3 4.0 Internal primary branch 5.4 24.1 6.7 26.4 10.5 34.6 7.3 26.5 7.7 6.5 7.3 Internal secondary branch 4.5 17.7 7.4 24.2 6.9 25.2 5.0 5.2 Claw 4 lengths Anterior base 2.9 12.9 2.5 3.4 11.3 1.3 7.3 4.5 2.8 13.6 3.9 Anterior primary branch 6.5 29.2 6.4 7.1 28.0 7.9 26.0 7.2 39.2 7.5 27.2 9.9 30.9 7.9 7.2 34.8 7.4 5.7 30.7 5.8 34.4 6.8 9.3 Anterior secondary branch 2.8 12.4 3.3 5.0 19.8 5.7 18.9 2.9 16.0 6.2 22.8 7.3 22.8 4.7 4.8 3.8 22.5 4.5 7.1 Posterior base 3.7 16.4 3.1 3.6 11.8 2.2 11.7 6.4 19.9 3.3 2.5 12.2 4.1 Posterior primary branch 7.7 34.7 10.1 11.2 43.8 11.7 38.6 8.3 45.1 9.6 35.1 14.9 46.6 11.6 10.6 51.1 12.3 6.2 33.5 9.1 53.5 8.4 9.9 3267 Posterior secondary branch 3.8 17.0 5.7 6.9 26.9 5.1 16.7 4.2 22.7 6.8 24.7 10.5 32.7 7.1 6.4 30.9 5.8 3.8 20.6 6.1 36.3 6.7 7.9
3268
3269
3270
161
3271 Table S4.19: Mather Peninsula 1
SPECIMEN 1 (HOL) 2 3 4 5 CHARACTER µm pt µm pt µm pt µm pt µm pt Body length 131 476 184 611 253 923 166 673 146 600 Buccopharyngeal tube Buccal tube length 27.5 – 30.2 – 27.5 – 24.6 – 24.3 – Stylet support insertion point 17.6 64.1 18.4 61.0 16.2 58.8 15.0 61.0 14.0 57.5 Buccal tube external width 2.7 9.6 3.2 10.5 4.0 14.6 3.6 14.5 3.4 13.8 Buccal tube internal width 1.2 4.3 1.5 5.1 1.8 6.7 1.9 7.6 2.1 8.8 Placoid lengths Macroplacoid 1 4.9 17.9 5.3 17.6 7.2 26.4 5.0 20.4 4.8 19.7 Macroplacoid 2 3.2 11.6 4.5 14.9 5.0 18.2 3.6 14.7 3.5 14.4 Macroplacoid row 9.4 34.4 13.1 43.3 14.0 50.8 10.3 41.6 10.2 41.9 Claw 1 heights External base 4.0 14.5 5.6 20.2 4.9 20.0 6.4 26.3 External primary branch 8.5 31.1 10.9 36.1 11.5 41.9 11.1 45.2 9.1 37.4 External secondary branch 6.3 22.9 7.9 28.8 6.9 28.1 5.9 24.4 Internal base 3.9 14.0 3.9 14.1 3.9 15.9 4.3 17.5 Internal primary branch 6.3 22.9 8.9 29.5 9.7 35.5 8.4 33.9 6.6 27.2 Internal secondary branch 4.9 17.9 7.7 25.6 7.0 28.6 5.3 21.9 Claw 2 heights External base 4.0 14.7 5.0 18.1 4.6 18.8 External primary branch 10.4 37.8 13.8 50.4 12.4 50.5 External secondary branch 6.7 24.5 9.2 33.5 7.4 29.9 Internal base 3.3 11.9 3.8 13.7 3.3 13.3 Internal primary branch 6.7 24.3 12.1 44.0 8.8 35.6 Internal secondary branch 6.1 22.1 6.0 21.7 6.1 24.6 Claw 3 heights External base 5.4 19.7 4.7 15.6 External primary branch 8.6 31.4 14.2 47.0 9.6 39.6 External secondary branch 7.3 26.5 8.5 28.3 6.3 25.7 Internal base 2.7 9.8 3.9 16.2 Internal primary branch 8.0 29.2 10.9 36.2 7.3 30.2 Internal secondary branch 5.8 21.2 7.3 24.1 7.3 29.9 Claw 4 lengths Anterior base 5.0 18.3 4.8 15.7 Anterior primary branch 8.8 32.1 10.4 34.6 14.0 50.9 9.6 38.8 Anterior secondary branch 6.1 22.3 8.4 27.8 9.5 34.6 6.6 26.7 Posterior base 4.0 13.3 5.3 21.9 Posterior primary branch 11.0 39.9 15.2 50.5 15.8 57.6 13.3 54.1 13.4 55.2 3272 Posterior secondary branch 6.9 25.1 8.6 28.5 7.2 29.4 5.9 24.3
3273
162
3274 Table S4.20: Mather Peninsula 2
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 156 671 174 620 179 675 174 689 202 778 160 693 187 660 245 892 196 783 218 840 202 653 212 905 230 805 182 674 246 838 362 1141 203 927 145 707 154 618 225 727 195 737 180 732 294 1076 173 670 215 750 Buccopharyngeal tube Buccal tube length 23.2 – 28.1 – 26.5 – 25.3 – 25.9 – 23.2 – 28.4 – 27.5 – 25.1 – 26.0 – 30.9 – 23.4 – 28.6 – 26.9 – 29.4 – 31.7 – 21.9 – 20.5 – 24.9 – 30.9 – 26.5 – 24.6 – 27.3 – 25.9 – 28.7 – Stylet support insertion point 13.5 58.4 18.5 65.6 17.3 65.2 14.1 55.8 15.5 59.6 14.2 61.3 17.0 59.8 16.2 59.1 15.1 60.3 15.2 58.5 18.3 59.2 14.5 61.9 17.6 61.6 16.7 62.0 17.7 60.1 18.3 57.9 12.6 57.5 12.6 61.4 15.5 62.0 16.8 54.4 15.8 59.7 15.3 62.1 16.8 61.6 16.3 62.9 16.9 58.7 Buccal tube external width 3.3 14.0 3.5 12.4 3.9 14.6 3.3 13.2 3.6 14.0 3.2 13.9 3.2 11.2 3.4 12.4 3.2 12.8 4.0 15.3 3.4 11.1 3.2 13.7 4.9 17.0 3.6 13.3 4.6 15.7 5.0 15.7 4.1 18.5 3.1 14.9 3.2 13.0 4.3 14.0 4.0 15.0 3.3 13.3 4.2 15.5 3.3 12.6 4.0 13.7 Buccal tube internal width 1.5 6.5 2.2 7.9 2.0 7.5 1.8 7.1 1.7 6.6 1.8 7.9 1.5 5.1 1.7 6.2 1.6 6.4 2.2 8.3 2.0 6.4 1.3 5.6 3.2 11.3 2.0 7.4 2.7 9.3 3.0 9.4 2.2 10.2 1.4 6.6 1.5 6.1 2.5 8.1 2.4 9.1 1.7 6.9 2.6 9.6 1.7 6.6 2.3 7.9 Placoid lengths Macroplacoid 1 4.7 20.3 5.4 19.3 6.0 22.5 5.5 21.6 5.0 19.4 4.9 21.1 5.6 19.6 6.6 23.9 5.6 22.2 6.6 25.3 5.1 16.5 4.4 18.6 6.0 21.1 6.1 22.7 5.6 18.9 6.0 18.9 5.8 26.3 4.5 22.0 5.2 20.9 6.7 21.5 4.6 17.4 5.0 20.4 6.5 23.6 4.3 16.6 5.2 18.2 Macroplacoid 2 3.6 15.6 3.8 13.7 3.8 14.5 4.9 19.4 4.0 15.4 3.4 14.5 3.9 13.7 3.4 12.3 4.5 17.8 4.7 17.9 4.7 15.2 3.9 16.8 5.2 18.1 4.2 15.5 4.5 15.3 4.9 15.3 4.0 18.4 3.7 18.1 3.8 15.3 5.2 16.8 3.5 13.2 4.2 17.2 4.8 17.4 3.7 14.1 4.6 16.1 Macroplacoid row 9.9 42.7 11.7 41.5 11.6 43.6 11.8 46.8 10.8 41.5 9.4 40.8 11.4 40.3 12.4 45.3 13.3 52.9 12.9 49.7 11.9 38.5 9.9 42.5 12.8 44.9 12.0 44.5 13.7 46.6 15.2 48.0 11.8 53.9 9.3 45.2 10.9 43.7 15.8 51.1 11.4 43.0 10.6 43.0 13.5 49.3 10.5 40.5 12.0 41.6 Claw 1 heights External base 5.1 22.1 5.1 18.2 6.7 25.1 6.6 28.3 5.0 17.6 5.6 20.5 4.0 15.8 5.3 17.1 3.4 14.7 6.8 23.6 6.1 20.9 5.8 26.4 5.7 27.6 3.5 13.9 5.7 18.4 6.2 25.0 5.2 18.0 External primary branch 9.4 40.7 9.0 32.0 11.9 44.8 7.9 30.4 10.4 45.0 10.7 37.7 10.6 38.7 10.2 40.6 11.0 42.3 11.8 38.2 7.7 32.9 9.7 33.9 9.9 36.6 11.3 38.6 13.4 42.2 11.2 51.1 10.7 52.3 9.1 36.3 11.4 36.7 11.1 45.2 10.7 39.3 10.9 38.0 External secondary branch 5.9 25.5 5.2 18.6 6.7 25.3 6.2 24.1 6.1 26.3 7.4 26.1 6.9 25.1 7.8 31.1 7.4 28.6 8.3 26.8 6.0 25.7 5.3 18.7 5.6 20.6 10.1 34.5 8.4 38.4 6.7 32.7 5.8 23.1 8.0 25.9 6.7 27.2 8.7 31.7 6.4 22.1 Internal base 3.1 13.5 5.1 18.1 4.9 18.4 4.0 15.3 3.6 12.5 4.5 16.5 3.8 15.0 5.8 18.7 6.1 21.5 5.0 18.7 5.9 20.0 5.4 17.1 5.5 25.0 4.6 22.4 3.2 13.0 3.7 12.1 3.7 13.5 3.5 12.2 Internal primary branch 6.1 26.4 7.0 24.9 9.2 34.6 6.8 26.2 8.1 28.5 8.8 32.2 9.5 38.0 10.2 33.0 8.8 30.8 7.0 25.8 8.1 27.7 9.2 29.1 8.1 36.9 7.2 35.1 7.1 28.5 9.9 32.1 8.4 34.3 10.0 36.7 7.9 27.4 Internal secondary branch 5.6 24.3 5.9 21.0 6.2 23.4 4.8 18.5 5.5 19.4 7.1 25.8 6.2 24.9 7.1 23.0 7.3 25.7 5.2 19.2 6.6 22.3 8.6 27.0 7.1 32.3 4.3 21.2 5.4 21.6 7.6 24.4 6.8 24.9 4.9 16.9 Claw 2 heights External base 6.4 27.5 4.8 18.2 6.2 24.3 5.8 25.0 5.5 19.2 5.3 19.4 5.5 21.7 7.0 22.6 8.0 28.1 4.2 15.6 7.2 24.4 7.3 23.0 6.6 30.0 5.3 25.8 4.5 18.1 6.6 21.3 4.0 16.1 6.7 24.5 4.6 17.9 6.3 22.0 External primary branch 10.9 47.0 9.5 33.7 10.0 37.7 11.3 44.5 9.0 34.7 10.1 43.6 9.5 33.6 11.1 40.5 12.9 51.6 15.1 57.9 11.7 37.8 14.4 50.3 8.9 33.0 12.2 41.6 16.5 52.1 13.9 63.6 9.0 43.9 10.4 41.7 15.7 50.9 9.8 39.6 12.5 45.8 9.7 37.6 11.1 38.5 External secondary branch 6.3 27.0 4.7 17.9 9.1 35.8 7.1 30.8 8.7 30.8 7.3 26.7 7.8 31.2 9.5 36.4 8.3 26.9 8.9 31.1 7.9 29.2 9.4 31.9 10.6 33.5 8.5 38.7 7.0 34.0 7.9 31.7 11.0 35.7 6.8 27.8 6.9 26.5 7.5 26.2 Internal base 4.3 18.6 5.7 20.3 5.2 19.7 5.3 20.9 4.0 15.5 5.9 20.7 4.1 15.0 5.7 22.6 5.9 19.1 5.7 20.0 5.2 19.4 5.8 19.8 4.7 15.0 5.5 25.3 4.3 20.8 4.7 19.0 2.8 11.5 3.8 13.9 5.1 17.9 Internal primary branch 6.1 26.4 7.1 25.4 7.2 27.0 8.5 33.7 6.6 25.5 6.9 29.6 9.2 32.5 8.8 31.9 9.8 39.1 8.7 28.3 10.1 35.2 9.4 32.0 11.1 35.1 8.7 39.8 8.1 39.3 8.2 32.8 10.7 34.7 7.4 30.0 9.2 33.6 8.6 29.8 Internal secondary branch 5.4 23.5 5.7 20.1 7.5 29.6 6.4 24.6 5.9 25.3 6.6 23.3 6.9 25.3 5.7 22.6 7.7 24.8 7.1 26.5 7.9 27.0 9.0 28.3 7.7 35.3 7.8 38.1 6.4 25.6 7.2 23.2 6.3 25.7 7.6 28.0 5.3 18.4 Claw 3 heights External base 5.5 23.7 5.6 20.0 6.9 27.2 5.4 20.7 4.7 20.1 5.1 17.8 6.9 25.2 6.4 23.8 7.4 25.2 7.4 23.2 7.0 32.2 3.7 17.9 5.4 21.5 7.7 25.0 5.4 20.3 3.3 13.5 6.1 22.1 5.1 19.7 7.1 24.6 External primary branch 10.5 45.5 10.6 37.6 13.1 49.6 12.0 47.4 7.0 27.1 9.1 39.1 10.7 37.8 10.3 37.4 10.6 42.3 9.8 37.7 10.9 40.5 12.2 41.5 16.3 51.3 12.0 54.6 9.5 46.3 10.6 42.4 16.6 53.7 10.1 38.0 12.1 49.3 14.8 54.0 7.7 29.9 12.0 41.9 External secondary branch 6.6 28.5 7.2 25.5 6.5 24.6 5.9 23.1 6.0 23.0 6.7 28.8 8.3 29.1 8.7 31.6 7.5 29.9 9.3 35.8 7.9 29.4 9.9 33.8 10.2 32.3 8.5 38.9 5.9 28.6 7.6 30.3 11.5 37.0 7.3 27.6 6.3 25.5 8.8 32.2 5.7 22.1 8.4 29.4 Internal base 4.2 18.0 5.5 19.5 5.4 20.5 5.6 22.3 4.8 18.4 3.6 15.3 4.3 16.0 7.1 24.1 5.0 15.7 6.0 27.6 4.4 21.7 4.5 18.2 5.5 17.8 4.1 15.5 3.1 12.5 3.7 12.8 Internal primary branch 6.4 27.8 10.5 39.6 9.4 37.0 5.8 22.3 7.3 31.7 9.0 31.8 7.8 28.5 10.5 41.9 8.9 32.9 11.2 38.1 10.1 31.7 8.9 40.7 7.9 38.6 8.0 32.2 12.8 41.4 7.2 27.3 9.1 36.9 9.4 32.6 Internal secondary branch 6.0 25.8 6.5 23.2 5.3 20.2 7.5 29.8 5.5 21.2 4.4 19.2 7.9 27.9 7.0 25.4 7.5 30.1 6.5 24.2 6.8 23.3 9.5 30.1 7.5 34.4 5.5 26.7 6.6 26.5 7.6 24.7 5.9 23.9 6.0 20.8 Claw 4 lengths Anterior base 4.4 18.8 3.4 12.1 4.5 16.8 5.5 21.7 4.6 17.8 3.9 16.9 4.2 14.6 4.8 17.4 4.7 16.4 5.4 18.3 4.3 13.5 5.5 25.3 3.4 16.8 3.1 12.5 7.1 22.8 3.2 12.0 4.9 18.0 4.6 16.1 Anterior primary branch 9.2 39.9 9.1 32.3 9.1 34.4 10.1 39.8 7.7 29.6 9.0 38.9 9.3 32.7 9.2 33.6 11.8 47.0 9.7 37.3 11.2 36.3 9.0 38.6 10.5 36.7 8.8 32.5 10.7 36.4 12.0 37.8 10.2 46.4 8.4 41.1 5.2 21.0 12.7 41.2 6.8 25.6 8.9 36.0 10.3 37.7 9.7 33.8 Anterior secondary branch 4.8 20.9 6.6 23.6 7.7 28.9 9.0 35.5 4.9 18.9 5.8 24.9 5.4 18.9 5.5 20.1 9.5 37.9 7.1 27.1 7.9 25.6 5.2 22.2 8.7 30.5 8.3 30.7 6.9 23.6 9.1 28.7 9.8 44.9 5.0 24.3 4.3 17.2 9.9 32.2 5.1 19.2 7.1 28.7 7.7 28.1 4.6 15.9 Posterior base 3.9 17.0 5.0 17.7 5.4 20.2 7.2 28.5 3.5 13.6 4.0 17.4 4.5 16.0 7.8 27.4 5.6 19.1 4.9 15.5 7.7 35.2 8.8 28.5 4.7 17.2 5.4 18.8 Posterior primary branch 12.3 53.0 11.3 40.1 13.7 51.7 14.9 58.9 10.6 40.7 9.6 41.6 15.0 52.8 14.0 51.1 15.4 61.6 13.4 51.6 13.7 44.3 10.4 44.3 16.3 57.2 14.4 53.4 16.3 55.7 15.5 48.9 17.5 80.2 10.0 49.0 8.7 35.0 18.3 59.1 10.3 38.7 12.5 50.9 14.4 52.7 13.0 45.3 3275 Posterior secondary branch 6.5 28.0 8.2 29.1 8.8 33.1 9.9 39.1 5.8 22.5 5.5 23.8 7.5 26.3 8.7 31.6 8.2 32.7 9.1 35.1 9.0 29.1 7.4 31.7 12.7 44.6 9.5 35.3 6.8 23.2 9.5 29.8 9.6 43.9 7.5 36.6 5.6 22.6 11.4 36.9 7.7 29.0 8.3 33.6 6.4 23.5 6.5 22.6
3276
3277
3278
3279
3280
3281
3282 163
3283 Table S4.21: Vestfold Hills
SPECIMEN 1 (HOL) 2 3 4 CHARACTER µm pt µm pt µm pt µm pt Body length 195 801 262 938 121 239 876 Buccopharyngeal tube Buccal tube length 24.3 – 27.9 – – 27.2 – Stylet support insertion point 13.4 55.0 16.5 58.9 19.4 71.1 Buccal tube external width 3.1 12.7 3.7 13.4 3.4 12.6 Buccal tube internal width 1.5 6.2 2.7 9.7 2.0 7.4 Placoid lengths Macroplacoid 1 6.8 27.8 5.5 19.8 4.6 16.7 Macroplacoid 2 4.0 16.5 4.1 14.6 5.0 18.2 Macroplacoid row 12.0 49.3 10.7 38.3 12.4 45.5 Claw 1 heights External base 2.7 11.2 4.4 15.9 4.5 16.4 External primary branch 7.9 32.5 10.1 36.1 5.6 7.9 29.0 External secondary branch 5.1 21.1 6.3 22.5 4.2 6.1 22.4 Internal base 2.7 10.9 2.2 3.8 14.0 Internal primary branch 7.9 32.5 4.8 6.9 25.3 Internal secondary branch 4.9 20.1 3.6 5.1 18.7 Claw 2 heights External base 5.0 20.5 6.2 22.3 5.2 5.1 18.8 External primary branch 8.7 36.0 9.1 32.7 7.3 9.6 35.1 External secondary branch 7.4 30.5 5.8 20.7 3.8 6.8 24.9 Internal base 2.6 10.9 Internal primary branch 7.4 30.6 Internal secondary branch 5.4 22.4 Claw 3 heights External base 4.0 16.5 4.7 16.9 2.3 6.4 23.6 External primary branch 9.2 37.7 9.4 33.6 6.8 9.4 34.4 External secondary branch 5.8 24.0 6.8 24.4 4.6 7.5 27.3 Internal base 3.1 12.6 1.8 Internal primary branch 7.6 31.3 5.3 Internal secondary branch 5.1 20.9 3.7 Claw 4 lengths Anterior base 3.0 4.2 15.2 Anterior primary branch 8.9 31.7 6.0 8.4 30.7 Anterior secondary branch 7.3 26.3 3.5 5.9 21.7 Posterior base 5.1 18.3 2.3 Posterior primary branch 12.6 51.8 10.7 38.3 7.7 10.8 39.7 3284 Posterior secondary branch 6.3 25.9 5.5 19.6 4.5 6.5 23.8
3285
3286
164
3287 Table S4.22: Shackleton Mountains
SPECIMEN 1 (HOL) 2 3 4 5 6 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt Body length 250 1029 215 1200 312 1281 274 1386 289 1149 256 1049 Buccopharyngeal tube Buccal tube length 24.3 – 17.9 – 24.4 – 19.8 – 25.2 – 24.4 – Stylet support insertion point 14.6 60.2 12.1 67.5 15.0 61.6 12.5 62.9 15.5 61.7 16.4 67.0 Buccal tube external width 2.7 10.9 1.9 10.8 2.7 11.2 1.9 9.6 2.9 11.6 3.3 13.3 Buccal tube internal width 1.2 5.0 0.6 3.4 1.3 5.5 0.8 4.2 1.2 4.8 1.2 5.0 Placoid lengths Macroplacoid 1 5.8 23.7 3.3 18.6 5.4 22.2 4.5 23.0 5.5 21.9 4.3 17.6 Macroplacoid 2 4.2 17.3 2.6 14.7 4.2 17.1 4.0 20.2 4.1 16.3 3.5 14.4 Macroplacoid row 11.4 47.1 7.2 40.4 12.3 50.6 9.2 46.5 12.8 50.9 10.4 42.6 Claw 1 heights External base 4.8 19.6 2.4 13.3 5.9 24.1 5.0 25.1 5.5 21.7 6.1 25.1 External primary branch 10.5 43.1 5.4 29.9 8.6 35.3 8.6 43.7 8.9 35.3 10.1 41.2 External secondary branch 7.6 31.1 5.0 27.6 7.0 28.7 7.6 38.4 4.9 19.3 4.7 19.4 Internal base 3.3 13.6 3.2 18.1 5.0 20.4 4.5 22.5 5.5 21.8 5.7 23.3 Internal primary branch 8.0 33.0 4.8 26.5 7.5 30.6 6.0 30.1 7.3 29.0 7.0 28.5 Internal secondary branch 5.7 23.5 4.4 24.7 5.9 24.3 4.6 23.3 4.0 15.9 4.9 20.2 Claw 2 heights External base 5.4 22.3 4.2 23.5 6.0 24.8 5.5 27.7 6.0 23.8 6.2 25.5 External primary branch 10.0 41.2 6.1 34.0 9.5 39.2 8.9 44.8 11.4 45.5 10.6 43.3 External secondary branch 7.2 29.5 4.0 22.4 8.8 36.0 7.4 37.6 6.9 27.3 7.0 28.6 Internal base 3.3 13.7 3.3 18.3 5.8 23.9 5.1 25.6 4.9 19.4 4.3 17.7 Internal primary branch 7.5 30.8 5.7 31.6 9.1 37.5 7.0 35.5 8.4 33.2 6.8 27.8 Internal secondary branch 6.1 25.3 4.8 26.6 7.0 28.9 5.9 29.7 6.9 27.4 6.7 27.6 Claw 3 heights External base 5.2 21.4 4.9 27.1 6.9 28.1 5.2 26.5 5.4 21.3 6.3 25.8 External primary branch 10.0 41.2 6.9 38.5 10.5 43.0 7.5 37.9 11.5 45.5 12.1 49.4 External secondary branch 7.7 31.6 4.2 23.2 8.6 35.3 6.3 32.0 7.3 29.1 7.2 29.3 Internal base 4.0 16.5 3.6 20.2 5.8 23.7 4.9 24.9 5.7 22.8 6.1 25.1 Internal primary branch 6.8 28.1 5.3 29.7 8.7 35.6 6.9 35.0 8.1 32.3 7.4 30.3 Internal secondary branch 5.7 23.3 4.9 27.2 6.0 24.7 6.0 30.3 6.8 27.1 Claw 4 lengths Anterior base 4.6 18.8 3.6 20.3 6.2 25.4 5.1 25.5 5.1 20.3 4.3 17.5 Anterior primary branch 9.7 39.9 6.5 36.0 10.2 42.0 8.9 44.7 8.9 35.2 9.7 39.7 Anterior secondary branch 6.3 25.8 4.6 25.6 4.9 20.0 6.7 34.0 8.2 32.4 5.1 20.7 Posterior base 4.6 18.7 3.9 21.8 6.6 27.1 6.3 32.0 5.8 22.9 4.5 18.2 Posterior primary branch 13.0 53.5 8.9 49.8 14.1 57.9 9.8 49.3 11.9 47.3 13.4 54.8 3288 Posterior secondary branch 6.4 26.3 4.4 24.7 7.4 30.4 9.3 46.8 7.5 29.6 6.0 24.5
3289 165
3290 Table S4.23: Dufek Massif
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 311 960 477 1157 337 1104 222 720 225 1065 243 1030 240 837 234 860 224 1023 228 1015 327 972 297 862 234 920 272 891 266 930 296 1085 189 842 235 1007 313 875 272 987 233 811 255 882 323 878 227 1035 247 806 315 942 166 767 255 818 Buccopharyngeal tube Buccal tube length 32.5 – 41.2 – 30.5 – 30.8 – 21.2 – 23.6 – 28.6 – 27.2 – 21.9 – 22.4 – 33.6 – 34.5 – 25.4 – 30.5 – 28.7 – 27.3 – 22.4 – 23.4 – 35.7 – 27.5 – 28.8 – 28.9 – 36.8 – 22.0 – 30.7 – 33.5 – 21.6 – 31.2 – Stylet support insertion point 21.1 65.1 26.8 65.0 20.9 68.7 20.9 67.7 14.3 67.3 16.1 68.2 18.9 65.9 18.2 66.8 14.6 66.8 15.1 67.5 25.1 74.8 24.1 70.0 17.9 70.4 20.3 66.6 19.0 66.5 18.6 68.0 15.4 68.7 15.9 68.1 27.2 76.0 19.3 70.3 19.0 65.9 19.5 67.4 23.9 65.0 14.6 66.6 20.7 67.4 22.1 65.9 14.7 68.0 21.9 70.2 Buccal tube external width 2.9 9.0 4.8 11.6 2.9 9.4 2.6 8.6 1.6 7.4 2.1 8.7 2.1 7.4 2.0 7.5 1.6 7.1 1.7 7.7 3.6 10.7 3.5 10.1 2.4 9.3 2.9 9.5 2.6 8.9 3.1 11.5 2.7 11.9 2.3 10.0 3.6 10.0 2.1 7.8 2.6 8.9 2.6 9.1 3.4 9.4 2.2 10.1 2.6 8.6 2.8 8.4 1.9 8.7 3.0 9.6 Buccal tube internal width 1.8 5.5 3.0 7.3 1.9 6.1 1.5 5.0 0.6 2.8 0.9 4.0 1.0 3.4 1.0 3.6 0.7 3.0 0.7 3.1 2.0 5.9 2.2 6.3 1.0 3.9 1.9 6.3 1.0 3.6 1.0 3.8 1.3 5.8 1.1 4.7 2.3 6.4 1.0 3.7 1.4 4.8 1.5 5.2 2.3 6.2 1.0 4.6 1.4 4.7 1.3 3.9 0.8 3.7 1.6 5.0 Placoid lengths Macroplacoid 1 5.7 17.6 7.4 18.0 4.4 14.5 5.2 16.9 3.3 15.6 3.7 15.6 4.9 17.2 4.8 17.7 3.5 15.8 4.3 19.3 4.8 14.3 5.8 16.8 3.8 15.1 4.7 15.4 3.9 13.7 5.6 20.4 3.8 16.9 3.7 16.0 5.1 14.2 5.6 20.2 5.5 19.0 4.9 16.9 6.1 16.7 2.9 13.3 5.4 17.5 6.1 18.1 3.4 15.5 5.1 16.4 Macroplacoid 2 5.5 17.0 7.1 17.1 3.8 12.6 3.9 12.6 2.8 13.4 3.3 13.9 3.6 12.5 3.6 13.1 2.8 12.9 3.6 16.0 4.6 13.6 5.2 15.1 3.2 12.5 3.9 12.9 4.1 14.5 4.7 17.2 3.0 13.3 2.8 11.9 4.3 11.9 3.9 14.2 4.6 16.0 3.6 12.6 5.3 14.3 2.8 12.5 4.3 14.0 5.4 16.1 3.0 13.7 4.6 14.7 Macroplacoid row 14.8 45.6 20.5 49.7 14.2 46.6 12.1 39.1 8.4 39.9 8.1 34.4 10.9 38.1 10.4 38.3 8.2 37.7 8.9 39.6 12.2 36.4 15.4 44.8 9.7 38.4 11.4 37.5 12.3 42.8 13.4 49.2 8.3 36.8 9.2 39.6 13.2 36.9 11.5 41.7 12.5 43.3 10.6 36.8 14.8 40.3 8.1 37.1 11.9 38.9 14.4 42.9 8.6 39.7 12.0 38.4 Claw 1 lengths External base 4.4 13.6 8.8 21.4 6.6 21.5 4.8 15.6 3.7 17.3 2.9 12.3 4.6 16.0 4.7 17.4 3.9 18.0 3.7 16.4 5.4 16.1 5.1 14.9 4.4 17.3 5.3 17.2 5.9 20.5 6.0 21.9 4.1 17.5 4.3 12.0 4.0 14.6 4.6 16.1 6.7 18.3 4.7 21.3 5.8 18.9 5.5 16.3 4.6 14.6 External primary branch 12.8 39.5 12.3 29.8 10.2 33.5 9.5 30.8 6.8 32.1 6.3 26.5 6.5 22.8 9.0 33.0 6.5 29.8 6.4 28.6 9.4 28.1 12.4 35.9 8.6 33.8 10.1 33.0 8.3 28.8 10.2 37.3 8.7 37.3 10.3 28.8 8.3 30.3 8.1 28.1 10.3 27.9 6.4 29.2 8.7 28.4 8.7 25.9 7.4 34.3 9.1 29.2 External secondary branch 9.4 28.9 11.8 28.6 7.2 23.7 5.6 18.1 5.2 24.4 7.8 28.6 6.0 27.2 5.0 22.3 6.4 19.1 5.2 20.5 6.2 20.3 6.7 23.2 9.5 34.7 6.0 25.6 6.6 18.4 5.4 19.6 5.0 17.4 9.3 25.4 5.7 25.9 8.0 26.1 8.2 24.5 4.7 21.9 4.7 14.9 Internal base 5.0 15.3 7.8 19.0 5.6 18.4 5.4 17.4 3.2 15.3 3.9 16.5 4.1 14.3 3.7 13.6 3.1 14.3 3.6 16.0 4.1 14.4 4.7 17.3 3.8 16.1 4.0 14.6 4.3 15.0 6.3 17.2 3.3 14.9 4.6 15.1 5.0 14.9 4.0 18.7 3.9 12.6 Internal primary branch 9.6 29.7 11.4 27.8 7.1 23.4 8.0 26.0 5.5 25.7 6.1 26.0 5.5 19.3 7.1 26.1 6.0 27.6 5.1 22.9 6.9 24.2 8.1 29.7 6.6 28.0 11.0 39.8 6.9 23.8 9.6 26.0 5.8 26.2 8.8 28.7 7.3 21.8 6.0 27.5 5.4 17.3 Internal secondary branch 6.8 20.9 9.6 23.2 7.0 23.1 3.8 12.2 4.8 22.6 4.5 19.2 4.7 16.5 6.0 21.9 5.3 24.1 4.2 18.7 7.5 26.1 7.4 27.1 4.5 19.4 6.5 23.4 5.8 20.1 8.3 22.6 3.9 17.8 4.5 14.8 5.9 17.6 4.7 21.8 4.8 15.4 Claw 2 lengths External base 5.9 18.1 8.2 19.8 5.9 19.2 4.3 20.3 5.0 18.3 4.0 18.4 4.2 18.7 6.5 19.4 6.2 18.0 3.9 15.2 4.3 14.1 5.0 17.4 6.0 21.9 4.5 19.3 6.4 18.0 3.9 14.1 3.2 11.2 5.2 18.0 7.3 19.8 3.6 16.4 5.4 17.7 6.3 18.9 4.1 18.7 5.2 16.6 External primary branch 10.2 31.5 16.2 39.2 6.5 30.8 6.6 28.1 9.2 32.0 8.3 30.4 7.3 33.2 6.0 26.5 10.3 30.7 12.3 35.6 9.3 36.8 11.0 36.0 9.0 31.3 11.0 40.4 8.1 34.6 11.6 32.5 10.6 38.7 9.4 32.8 9.0 31.1 10.7 29.0 7.0 31.7 11.9 38.9 10.3 30.6 8.0 37.0 9.2 29.5 External secondary branch 10.0 30.8 12.1 29.3 9.5 31.2 6.2 29.4 4.6 19.6 4.6 15.9 5.3 19.6 5.5 25.2 5.8 26.0 8.8 26.3 6.4 18.7 5.4 21.3 6.4 21.1 7.3 25.5 8.7 32.0 5.5 23.7 8.0 22.4 4.0 14.7 6.1 21.1 6.4 22.1 9.2 25.0 5.4 24.7 8.4 27.4 8.2 24.5 4.8 22.3 5.6 18.0 Internal base 5.7 17.4 6.0 14.5 5.4 17.6 3.4 16.2 3.1 12.9 5.3 18.4 4.4 16.0 4.0 18.1 3.5 15.6 5.1 17.7 5.1 18.5 3.6 15.5 4.8 17.4 4.0 13.9 4.6 15.9 6.5 17.7 3.3 14.8 4.2 13.8 4.9 14.7 3.7 17.1 3.4 10.7 Internal primary branch 8.9 27.3 14.1 34.1 9.3 30.4 5.3 24.8 6.6 28.1 8.3 29.1 7.5 27.5 5.5 25.0 4.8 21.5 8.6 29.9 7.8 28.6 5.7 24.4 11.0 40.1 7.3 25.3 8.5 29.5 10.3 27.9 6.4 28.9 9.6 31.3 7.5 22.5 5.9 27.1 5.2 16.7 Internal secondary branch 8.2 25.4 9.6 23.4 7.4 24.3 4.3 20.1 5.1 21.6 5.8 20.3 5.0 18.5 4.6 21.0 4.7 21.0 6.5 22.7 7.1 25.9 5.0 21.4 5.4 19.4 4.4 15.4 5.6 19.5 7.3 19.7 4.9 22.3 6.7 21.7 6.5 19.3 4.6 21.4 4.9 15.6 Claw 3 lengths External base 5.6 17.3 8.7 21.0 5.9 19.3 4.5 14.7 3.5 16.6 3.6 13.2 3.3 15.2 4.0 18.0 6.6 19.7 6.6 19.0 4.9 19.3 5.6 18.3 5.1 17.9 6.1 22.5 3.2 14.1 4.5 19.3 5.2 14.6 4.3 15.0 6.8 18.6 4.0 18.2 5.7 18.7 5.9 17.6 4.5 20.6 5.1 16.2 External primary branch 11.2 34.4 16.5 40.1 13.7 45.1 10.9 35.5 7.8 36.7 6.6 28.1 9.1 31.9 11.6 42.8 7.6 34.6 6.4 28.4 10.5 31.4 11.9 34.5 9.0 35.6 11.7 38.2 8.8 30.9 9.0 33.1 8.5 37.9 8.7 37.1 11.0 30.8 8.3 28.6 10.7 29.2 7.5 34.2 10.2 33.2 9.3 27.6 8.9 40.9 9.0 28.9 External secondary branch 9.7 29.9 13.7 33.2 9.1 29.8 8.5 27.6 4.0 18.9 4.8 20.2 5.8 20.4 7.5 27.4 5.4 24.9 5.6 25.0 9.3 27.5 6.8 19.6 5.8 22.8 6.8 22.3 6.5 22.6 7.8 28.5 5.4 23.9 6.1 26.2 7.0 19.6 5.7 19.7 9.3 25.3 5.4 24.7 7.0 22.9 8.6 25.7 5.3 24.7 4.4 14.1 Internal base 5.1 15.6 7.1 17.2 5.2 17.0 4.7 15.2 4.6 21.7 4.5 16.7 3.2 14.4 3.2 14.1 5.0 17.3 5.7 21.0 3.2 14.3 3.6 15.5 4.9 16.8 5.9 16.1 2.9 13.4 4.8 15.8 6.1 18.1 3.6 16.5 Internal primary branch 9.8 30.2 14.0 33.9 11.1 36.4 6.4 20.9 11.3 53.1 8.1 28.1 7.2 26.7 5.0 22.6 5.9 26.5 7.0 24.4 7.6 27.8 5.3 23.8 8.2 35.1 8.3 28.9 8.4 22.9 6.3 28.5 9.1 29.7 7.6 22.8 5.9 27.3 Internal secondary branch 6.6 20.4 5.6 13.6 7.8 25.7 5.3 17.2 6.0 28.5 5.4 19.0 3.8 17.3 5.4 23.9 6.6 22.9 6.6 24.2 4.9 21.6 5.9 25.1 5.9 20.3 9.3 25.4 5.1 23.0 8.1 26.4 6.6 19.6 4.8 22.0 Claw 4 lengths Anterior base 5.3 16.2 7.6 18.5 5.1 16.8 2.7 11.3 3.2 11.3 3.7 13.7 3.6 16.3 3.6 15.9 4.7 14.0 3.6 10.5 3.5 13.7 4.0 13.0 5.0 17.5 5.3 19.3 3.7 16.0 3.4 9.4 4.4 16.0 5.3 18.4 4.2 14.7 6.6 18.0 2.9 13.2 4.4 14.4 5.2 15.5 2.7 12.5 4.0 12.7 Anterior primary branch 11.7 36.0 11.6 38.1 6.5 27.7 7.9 27.5 9.7 35.8 7.0 32.2 7.3 32.6 10.7 31.8 9.1 26.3 7.6 29.8 9.1 29.6 8.9 30.9 11.3 41.6 8.8 37.8 11.0 30.8 8.3 30.2 9.2 31.8 10.2 35.3 12.1 32.9 4.6 20.9 10.7 34.8 8.4 25.2 6.5 30.2 8.1 26.1 Anterior secondary branch 6.8 20.9 13.4 32.6 4.8 15.9 3.7 15.6 5.1 18.0 4.3 15.9 4.2 19.2 4.5 20.1 5.5 16.4 3.8 15.1 4.3 14.0 5.7 19.9 6.4 23.3 5.0 21.3 6.7 18.6 6.1 22.3 7.9 27.5 4.5 15.4 7.6 20.5 7.3 33.0 5.6 18.2 7.5 22.3 5.0 23.1 4.3 13.7 Posterior base 4.5 14.0 10.2 24.8 7.0 23.1 3.7 15.8 5.5 19.4 4.7 17.3 4.5 20.7 4.9 22.0 4.0 11.8 3.8 11.0 3.1 12.1 3.8 12.3 6.1 21.3 6.5 23.9 3.1 14.0 4.8 20.4 5.0 14.0 5.1 18.6 7.3 25.4 4.6 16.1 6.1 16.6 4.1 18.6 4.4 14.4 6.6 19.6 3.8 17.6 4.4 14.2 Posterior primary branch 17.0 52.3 17.9 43.3 15.7 51.6 10.8 45.8 11.9 41.6 13.8 50.7 10.6 48.6 8.8 39.4 5.2 15.5 10.0 29.0 11.0 43.5 15.5 50.6 11.8 41.2 15.9 58.4 10.8 48.1 9.0 38.4 16.0 44.8 11.5 41.7 12.4 43.2 6.5 22.5 17.5 47.6 10.0 45.6 14.9 48.6 11.1 33.2 8.5 39.2 11.9 38.0 3291 Posterior secondary branch 8.0 24.7 14.2 34.3 7.3 23.8 4.9 20.6 6.1 21.2 8.3 30.4 5.3 24.1 6.0 26.7 14.0 41.5 5.0 19.5 6.4 20.9 8.7 30.3 10.4 38.1 3.9 17.2 7.4 31.6 7.6 21.3 7.9 28.9 8.2 28.5 12.6 43.5 11.3 30.7 6.5 29.5 7.2 23.5 9.6 28.6 6.3 29.2 4.9 15.8
3292
3293
3294
3295
3296
3297
3298
166
3299 Table S4.24: Signy Island
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 291 1077 314 1166 355 1196 312 1062 269 1059 214 1011 367 1299 307 1145 173 838 358 1195 335 1111 318 1152 338 1112 292 1071 329 1125 370 1250 286 1100 254 1243 315 1070 266 1197 291 1088 308 1097 273 1314 235 1042 316 1094 273 1280 326 1416 361 1409 266 1116 Buccopharyngeal tube Buccal tube length 27.0 – 26.9 – 25.4 – 29.7 – 29.4 – 25.4 – 21.2 – 28.3 – 26.8 – 20.7 – 30.0 – 30.2 – 27.6 – 30.4 – 27.3 – 29.2 – 29.6 – 26.0 – 20.4 – 29.5 – 22.2 – 26.7 – 28.0 – 20.8 – 22.6 – 28.9 – 21.4 – 23.0 – 25.6 – 23.8 – Stylet support insertion point 17.5 64.9 18.3 68.0 16.4 64.5 20.3 68.4 19.3 65.6 15.7 61.9 13.5 63.9 18.7 66.0 17.3 64.7 13.5 65.2 20.3 67.7 19.9 65.9 19.6 71.1 19.0 62.6 17.7 65.0 20.6 70.4 21.2 71.6 17.4 66.7 14.4 70.5 20.4 69.1 14.8 66.6 18.2 68.0 19.0 67.7 12.7 61.0 15.5 68.8 18.0 62.3 13.7 64.1 14.1 61.4 15.9 62.0 15.8 66.5 Buccal tube external width 2.7 10.0 3.0 11.3 3.1 10.3 2.6 9.0 2.2 8.5 1.8 8.5 3.3 11.6 2.2 8.1 1.6 7.9 2.6 8.7 2.4 8.0 2.6 9.4 2.9 9.5 2.1 7.8 2.6 8.8 2.7 9.2 2.3 8.8 1.9 9.5 1.9 6.4 2.1 9.6 2.3 8.5 2.4 8.6 1.7 8.2 1.4 6.2 2.9 10.1 2.0 9.3 2.2 9.4 2.5 9.7 2.5 10.3 Buccal tube internal width 1.4 5.3 1.5 5.5 2.2 7.3 1.7 5.7 1.0 3.8 1.0 4.5 1.6 5.5 1.1 4.3 0.9 4.3 1.4 4.7 1.3 4.4 1.6 5.7 1.2 4.0 1.1 4.0 1.5 5.1 1.5 5.2 1.1 4.2 0.9 4.2 0.8 2.7 1.5 6.7 1.2 4.4 1.5 5.4 1.0 4.9 0.7 3.2 1.5 5.1 1.4 6.7 1.3 5.5 1.4 5.5 1.4 5.9 Placoid lengths Macroplacoid 1 5.1 18.7 4.9 18.3 3.9 15.3 5.9 19.9 4.2 14.4 4.2 16.4 3.1 14.8 5.5 19.5 4.5 16.7 2.9 14.0 5.2 17.3 5.0 16.6 5.7 20.6 6.3 20.7 5.0 18.3 5.2 17.7 5.5 18.7 6.7 25.5 4.6 22.7 6.6 22.3 4.1 18.3 4.9 18.4 5.9 21.2 4.3 20.9 3.9 17.2 6.5 22.4 3.9 18.4 4.9 21.1 5.9 23.0 4.7 19.8 Macroplacoid 2 3.9 14.3 4.1 15.2 3.2 12.7 4.2 14.0 3.8 12.8 2.6 10.2 2.5 11.7 4.8 16.9 3.3 12.4 2.3 11.2 3.9 13.0 3.7 12.2 4.4 15.9 4.9 16.0 4.1 15.0 3.6 12.4 4.8 16.1 5.5 21.1 3.4 16.6 4.4 14.9 3.5 15.5 3.7 13.7 4.3 15.2 3.3 15.7 3.0 13.5 5.1 17.5 2.9 13.5 3.9 17.0 4.6 17.9 2.6 10.7 Macroplacoid row 10.2 37.8 10.2 38.0 8.2 32.2 10.7 36.1 10.1 34.5 8.6 34.0 7.1 33.7 10.5 37.2 9.4 35.1 6.7 32.4 11.2 37.2 10.0 33.2 10.8 39.2 12.2 40.2 10.2 37.3 10.9 37.3 13.1 44.4 12.9 49.4 8.9 43.6 12.2 41.5 9.5 42.9 10.6 39.6 12.4 44.3 9.2 44.0 7.8 34.7 12.7 44.1 9.3 43.5 10.8 46.8 12.1 47.1 10.0 41.8 Claw 1 lengths External base 3.3 12.3 5.1 17.1 3.7 13.9 5.6 18.6 5.5 18.1 4.4 16.0 3.6 13.1 5.8 19.7 5.8 22.2 3.2 15.6 4.6 15.7 3.6 16.0 3.7 13.1 5.8 27.8 4.8 16.5 4.3 18.9 3.2 13.6 External primary branch 10.3 38.3 10.0 33.6 10.1 37.8 7.2 34.7 9.9 33.0 9.0 29.8 8.3 30.1 9.8 35.8 11.7 39.5 7.8 29.8 8.6 42.3 10.0 33.9 8.1 36.3 11.9 42.4 9.4 44.9 7.1 31.5 12.5 43.3 9.9 43.0 10.0 42.0 External secondary branch 6.8 25.3 8.0 26.9 6.8 25.5 4.8 23.1 7.0 23.2 8.1 26.9 6.0 21.9 6.1 22.2 8.5 28.8 6.3 24.4 5.8 28.4 8.9 30.2 5.2 23.5 8.8 31.3 7.4 35.5 4.3 19.0 6.7 23.3 5.1 22.0 5.7 23.9 Internal base 4.6 15.4 4.3 15.4 3.0 11.1 4.6 15.9 4.1 15.7 2.6 12.5 4.1 13.9 2.8 12.5 4.7 16.7 4.4 19.5 4.3 14.7 3.2 13.5 Internal primary branch 5.8 21.5 8.1 27.4 8.0 26.6 7.8 26.0 6.9 24.9 7.6 27.7 7.7 26.2 8.0 30.6 7.0 34.3 9.3 31.6 6.5 29.1 9.6 34.3 6.8 30.2 9.4 32.7 7.3 30.5 Internal secondary branch 7.9 29.1 7.0 23.7 6.0 22.3 6.0 20.0 6.1 20.2 6.0 21.8 4.8 17.6 5.8 22.4 5.1 25.1 6.8 23.0 4.1 18.5 5.0 22.0 6.4 22.0 5.0 20.9 Claw 2 lengths External base 4.0 14.9 3.6 14.1 5.7 19.3 6.0 20.4 5.0 23.4 5.7 20.3 6.3 21.0 6.9 22.7 6.3 23.2 4.0 19.5 4.9 16.7 3.2 14.6 5.3 20.0 6.0 29.0 6.0 20.9 4.6 21.4 3.5 15.1 5.5 21.5 5.1 21.3 External primary branch 11.5 42.7 9.9 38.8 9.3 31.2 9.2 31.4 10.6 37.4 6.7 32.3 11.7 39.1 11.1 36.5 9.6 35.0 9.2 45.1 12.0 40.7 9.7 43.8 11.8 44.0 10.1 48.4 8.9 39.6 13.9 48.3 9.5 44.5 10.9 47.5 13.1 51.3 10.7 44.9 External secondary branch 6.5 24.0 6.1 24.2 7.3 24.6 7.8 26.5 6.3 29.8 8.0 28.3 4.1 19.8 8.6 28.6 10.0 32.9 7.2 26.5 5.6 27.3 8.7 29.6 7.0 31.4 6.9 25.9 8.5 40.9 4.1 18.3 8.4 28.9 6.5 30.4 8.4 36.5 8.9 34.8 Internal base 3.6 13.5 3.9 15.4 5.0 16.8 4.3 14.5 4.2 19.7 4.8 17.0 5.6 18.7 4.9 17.8 5.0 18.3 4.6 15.6 3.7 17.9 3.6 12.2 3.2 14.2 3.6 13.5 4.4 21.3 4.9 23.0 4.0 17.3 3.8 15.0 3.8 16.1 Internal primary branch 8.8 32.6 7.5 29.3 10.1 33.9 8.0 27.1 5.5 26.0 8.0 28.3 6.5 31.3 9.3 31.1 8.8 31.8 6.2 22.7 8.6 29.3 6.8 33.1 9.2 31.1 7.7 34.8 8.9 33.1 7.4 35.6 6.8 30.1 12.3 42.7 6.4 30.0 9.1 39.7 9.9 38.5 8.4 35.3 Internal secondary branch 5.8 21.4 5.6 18.8 5.2 17.6 7.2 25.4 7.3 24.4 7.5 27.3 4.9 17.8 3.9 19.2 6.9 23.2 5.1 23.1 6.1 22.7 6.0 28.8 4.4 19.5 5.3 24.9 6.2 26.9 5.8 22.6 4.7 19.8 Claw 3 lengths External base 5.0 18.4 6.6 22.1 6.0 20.5 6.3 22.4 5.1 19.2 6.5 21.6 5.5 18.4 7.4 24.4 6.1 22.5 7.2 24.3 4.9 18.9 4.4 21.6 4.9 16.7 4.2 18.8 7.1 26.4 6.8 24.3 6.3 30.3 3.8 17.0 5.4 18.6 4.4 20.7 4.8 18.7 5.9 24.7 External primary branch 12.0 44.4 11.5 38.7 9.0 33.7 8.3 40.3 11.9 39.6 11.4 37.9 10.1 33.2 10.2 37.4 12.0 40.7 11.3 43.2 9.0 44.0 12.8 43.3 8.7 39.0 11.0 41.1 11.3 40.3 10.0 48.1 8.0 35.3 13.8 47.8 10.2 47.8 9.1 35.5 10.6 44.5 External secondary branch 6.7 24.9 7.2 28.1 8.9 30.0 7.8 26.4 8.6 30.2 8.3 31.1 5.4 26.1 7.7 25.8 8.6 28.5 8.7 28.5 7.3 26.8 7.8 26.5 8.4 32.3 6.2 30.4 8.1 27.5 7.6 34.2 8.6 32.1 8.0 28.4 8.5 40.9 4.0 17.6 8.3 28.7 6.8 31.8 8.2 31.9 5.7 24.0 Internal base 4.5 15.4 4.7 16.5 4.2 15.6 6.2 20.2 4.5 15.5 3.8 14.8 3.7 18.0 4.4 14.9 3.3 15.0 5.1 19.0 6.3 22.5 3.3 15.9 2.6 11.4 4.4 15.3 4.4 20.6 6.0 23.3 3.7 15.5 Internal primary branch 7.9 29.4 7.3 28.5 9.4 31.5 7.5 25.5 7.5 26.4 6.0 22.4 6.6 31.7 5.0 16.7 7.8 25.7 7.8 26.8 8.5 32.7 6.8 33.4 8.7 29.6 7.1 31.8 8.2 30.7 9.5 33.9 7.1 34.2 5.1 22.6 9.9 34.1 7.4 34.6 8.9 34.6 8.6 36.0 Internal secondary branch 6.5 24.2 6.9 23.1 5.8 19.7 7.5 26.6 6.7 25.1 5.4 26.0 7.6 25.4 6.7 22.1 6.4 21.8 5.9 22.7 4.4 21.5 6.4 21.9 5.3 23.8 7.4 27.8 5.9 21.2 5.5 26.3 5.1 22.4 6.3 21.8 5.1 23.7 8.1 31.7 5.0 20.8 Claw 4 lengths Anterior base 5.3 19.7 4.4 14.7 3.4 13.5 5.3 19.6 5.4 17.9 5.5 18.1 6.0 21.7 5.5 18.2 5.2 19.1 5.9 20.2 5.4 18.2 5.6 21.7 4.1 20.0 4.7 15.9 5.4 24.1 4.3 16.0 6.7 23.9 4.2 20.3 3.9 17.2 6.5 22.6 5.0 23.3 5.9 25.6 5.0 19.6 4.3 18.2 Anterior primary branch 9.6 35.6 7.3 28.7 11.3 38.1 8.3 32.5 7.3 34.6 9.7 34.3 9.4 35.3 7.0 34.0 11.0 36.8 10.2 33.8 9.5 34.5 10.3 33.8 9.3 34.0 9.0 30.9 10.6 35.8 9.5 36.5 9.2 45.1 9.6 32.6 8.4 37.9 9.8 36.6 9.7 34.5 8.8 42.0 7.4 32.8 12.0 41.5 9.0 42.0 9.0 39.0 11.7 45.6 8.6 36.0 Anterior secondary branch 4.4 16.3 4.9 19.4 7.2 24.4 3.4 13.5 4.3 20.1 4.3 20.7 8.0 26.6 6.6 24.0 4.8 15.9 4.9 17.8 3.8 12.7 5.8 22.4 6.4 31.6 7.7 26.2 5.8 26.0 7.1 26.5 7.3 26.2 5.5 26.3 4.0 17.9 4.8 20.8 5.8 22.6 6.5 27.4 Posterior base 6.4 23.8 6.4 21.4 7.5 25.4 4.3 17.0 6.0 21.1 5.6 20.9 6.8 22.5 6.2 20.5 6.1 22.1 6.6 21.7 5.8 21.3 7.1 24.4 3.5 11.8 6.5 24.9 4.6 22.5 6.9 23.4 5.9 26.4 6.1 22.8 6.3 22.3 4.9 23.3 4.8 21.1 7.1 24.5 6.0 27.9 6.1 26.4 5.5 21.6 6.3 26.6 Posterior primary branch 13.9 51.6 11.5 45.1 15.2 51.1 15.8 53.8 11.5 45.2 10.9 51.3 15.9 56.0 12.4 46.3 9.7 46.6 15.3 50.9 14.8 49.2 12.0 43.5 13.7 45.0 14.1 51.6 13.6 46.6 15.8 53.3 13.6 52.1 12.2 59.6 14.8 50.2 11.8 53.2 16.5 61.7 17.1 61.1 12.5 60.1 11.0 48.6 16.1 55.7 12.7 59.4 15.5 67.4 17.3 67.5 13.2 55.5 3300 Posterior secondary branch 6.6 26.0 8.7 29.4 8.3 28.1 6.8 26.6 5.7 26.7 7.6 26.9 7.1 26.6 6.3 30.4 9.0 29.9 9.1 30.1 9.0 32.7 9.2 30.3 7.5 27.4 6.2 21.1 6.7 22.7 9.9 38.1 7.4 36.3 9.2 31.1 8.4 37.6 6.8 25.4 10.3 36.7 7.1 34.2 5.8 25.8 7.7 26.7 6.1 28.4 5.5 23.8 6.7 26.3 7.3 30.8
3301
3302
3303
3304
3305
3306
167
3307 Table S4.25: Livingston Island
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 226 961 366 1141 389 1277 294 1110 328 1159 417 1333 369 1454 224 1129 358 1136 396 1344 260 954 372 1227 323 1087 345 1081 354 1183 376 1223 342 1096 331 1294 288 1026 327 1079 356 1191 347 1205 254 944 217 1015 299 1148 237 896 354 1177 280 1082 314 1084 380 1314 Buccopharyngeal tube Buccal tube length 23.6 – 32.1 – 30.4 – 26.5 – 28.3 – 31.3 – 25.4 – 19.8 – 31.5 – 29.5 – 27.3 – 30.3 – 29.7 – 31.9 – 30.0 – 30.7 – 31.3 – 25.6 – 28.0 – 30.3 – 29.9 – 28.8 – 26.9 – 21.4 – 26.1 – 26.5 – 30.0 – 25.9 – 29.0 – 28.9 – Stylet support insertion point 16.5 70.2 21.7 67.7 19.8 65.1 17.0 64.4 19.9 70.4 20.9 66.8 17.9 70.7 14.6 73.7 21.2 67.2 19.1 64.9 17.9 65.6 19.7 64.9 19.5 65.6 21.1 66.3 20.8 69.5 20.8 67.8 20.5 65.5 17.8 69.5 18.8 67.1 20.6 68.1 19.1 63.9 19.8 68.9 18.8 69.9 15.1 70.4 17.5 67.0 17.7 66.8 19.7 65.7 17.7 68.4 17.0 58.6 19.0 65.5 Buccal tube external width 2.1 8.9 3.0 9.5 3.0 10.0 2.1 7.8 2.2 7.7 2.1 6.8 1.9 7.6 1.8 9.1 3.1 9.9 2.2 7.5 2.1 7.7 2.9 9.4 2.6 8.8 2.5 7.7 2.8 9.2 3.0 9.7 2.7 8.7 2.1 8.4 2.5 9.0 2.3 7.7 1.9 6.4 2.4 8.2 2.1 7.8 1.6 7.5 1.6 6.2 1.9 7.1 2.2 7.2 2.2 8.5 2.1 7.2 2.4 8.3 Buccal tube internal width 1.0 4.2 1.7 5.3 1.6 5.4 1.0 3.7 1.4 4.9 1.0 3.3 1.0 3.7 1.3 6.4 2.1 6.7 1.3 4.5 1.4 5.1 1.7 5.6 1.2 4.0 1.4 4.3 1.7 5.6 1.8 5.9 1.6 5.2 1.2 4.7 1.3 4.5 1.4 4.5 1.3 4.3 1.5 5.0 1.0 3.9 0.7 3.0 0.7 2.6 0.9 3.4 1.2 3.9 1.1 4.1 1.2 4.2 1.6 5.4 Placoid lengths Macroplacoid 1 3.4 14.3 5.9 18.5 5.0 16.4 4.2 15.8 5.7 20.0 5.4 17.3 4.9 19.4 3.1 15.8 5.0 15.7 6.1 20.8 4.7 17.3 5.8 19.0 5.6 18.9 5.5 17.3 5.5 18.3 5.8 18.9 5.3 17.0 4.5 17.7 5.2 18.7 5.7 18.8 4.6 15.5 4.9 17.2 4.4 16.2 3.1 14.4 4.1 15.7 5.1 19.1 5.1 16.8 3.7 14.4 4.1 14.2 4.5 15.5 Macroplacoid 2 2.9 12.1 4.3 13.3 4.2 13.8 3.4 12.9 4.8 17.0 4.4 14.0 4.0 15.7 2.4 12.1 3.9 12.2 4.6 15.5 3.9 14.4 4.9 16.2 4.2 14.0 4.4 13.9 4.1 13.5 4.8 15.7 4.7 14.9 3.8 14.9 4.5 16.1 4.5 14.9 4.6 15.4 3.8 13.1 3.6 13.3 2.7 12.7 2.7 10.4 3.5 13.1 3.3 11.0 3.4 13.2 3.8 13.0 4.0 13.7 Macroplacoid row 7.4 31.4 11.1 34.5 11.1 36.5 8.6 32.5 11.0 38.8 11.2 35.7 10.3 40.6 6.7 33.5 10.8 34.3 11.8 40.0 10.2 37.4 13.3 44.0 11.1 37.3 11.4 35.6 11.4 38.2 13.2 43.1 11.6 37.1 10.1 39.6 11.1 39.6 10.8 35.7 10.3 34.6 10.1 34.9 10.2 37.9 7.9 36.9 8.1 31.0 10.4 39.4 10.9 36.2 8.7 33.4 8.9 30.7 10.8 37.2 Claw 1 lengths External base 2.3 9.7 6.0 19.7 5.2 18.2 6.3 20.0 5.4 21.3 4.7 14.8 4.7 15.4 5.2 16.3 4.8 15.7 4.7 14.9 5.0 19.6 3.1 11.2 5.2 18.1 2.2 8.2 3.5 16.2 4.1 15.6 5.4 18.6 6.0 20.6 External primary branch 4.5 18.9 8.2 27.0 7.8 27.4 7.7 24.5 6.3 24.8 5.9 29.8 8.8 27.9 9.2 30.4 7.9 26.4 9.8 30.8 8.4 28.1 8.7 28.4 10.8 34.6 8.9 34.8 5.6 20.1 5.6 18.6 6.8 23.7 5.2 19.3 6.4 29.9 7.2 27.4 8.0 26.5 6.6 22.9 7.3 25.4 External secondary branch 6.2 26.3 6.4 20.9 6.5 23.1 5.8 22.9 4.3 21.7 7.2 22.8 7.1 23.4 6.2 20.9 6.7 21.1 6.1 20.5 7.1 23.2 7.0 22.4 6.3 24.7 5.3 18.9 5.0 16.6 6.5 22.5 5.1 19.0 4.4 20.6 4.9 18.6 5.4 18.6 Internal base 4.5 14.6 4.7 16.6 4.9 15.7 4.7 18.5 4.7 15.0 3.2 10.4 4.7 15.6 3.4 11.1 4.6 18.0 2.3 8.3 3.6 11.8 2.0 7.4 3.7 17.0 4.2 16.0 2.9 9.7 Internal primary branch 5.5 23.3 7.5 24.5 6.8 24.0 6.2 24.3 7.0 22.1 8.2 26.9 7.1 23.5 7.6 24.6 7.6 24.2 6.5 25.5 5.5 19.8 4.1 13.5 5.1 19.1 5.2 24.3 4.7 17.9 6.3 20.9 Internal secondary branch 3.2 13.7 5.5 18.0 5.6 19.6 5.2 16.6 4.9 19.4 6.4 20.2 5.9 19.4 6.8 22.8 6.1 20.0 4.7 18.3 4.3 15.4 3.7 12.1 3.9 14.6 4.8 22.4 4.4 16.9 Claw 2 lengths External base 2.8 11.8 5.4 17.0 2.7 10.4 5.2 18.3 5.8 18.6 6.4 21.8 4.9 17.9 5.4 17.9 6.5 20.3 6.1 20.4 6.3 20.4 6.0 19.1 3.7 13.3 5.2 17.3 4.2 14.6 4.5 21.2 5.4 20.8 4.8 18.1 4.6 15.2 4.9 19.0 4.9 16.9 External primary branch 5.7 24.0 7.7 23.9 6.5 24.7 9.1 32.2 9.5 30.2 6.6 33.5 10.9 37.0 6.9 25.4 10.5 34.6 7.5 25.2 9.6 30.0 10.8 35.9 10.7 34.7 10.1 32.3 7.7 30.1 8.5 30.3 10.6 35.4 11.1 38.4 7.5 35.1 7.5 28.8 8.8 33.3 9.1 30.3 8.6 33.3 9.6 33.1 8.5 29.5 External secondary branch 4.1 17.3 6.3 19.6 5.0 18.8 6.6 23.2 6.2 19.9 3.5 17.4 7.9 26.8 6.1 22.2 7.8 25.7 8.0 25.0 7.5 25.0 7.6 24.8 7.6 24.4 5.4 21.2 5.5 19.7 8.0 26.9 6.8 23.6 5.3 24.5 5.3 20.4 7.1 26.7 6.4 21.4 6.2 23.8 6.6 22.7 Internal base 4.0 12.3 5.6 18.5 2.7 10.0 4.6 16.4 6.1 19.3 5.5 18.6 3.3 12.1 5.3 17.5 5.5 18.2 5.6 18.1 3.7 13.1 5.5 18.5 3.3 15.5 4.3 16.3 3.7 13.9 4.8 15.9 3.4 13.2 Internal primary branch 6.7 20.9 9.2 30.2 5.3 19.8 6.2 21.8 7.1 22.7 8.4 28.6 6.6 24.1 9.1 29.9 8.4 27.9 9.3 30.4 7.1 27.6 6.8 24.2 7.3 24.6 5.6 26.2 7.1 27.3 7.0 26.3 6.5 21.7 6.7 25.7 Internal secondary branch 4.4 18.5 5.0 15.7 6.7 22.1 4.9 18.6 5.4 18.9 6.8 21.8 6.3 21.5 5.9 21.6 5.3 17.3 6.7 22.4 5.1 16.6 5.5 21.6 5.2 18.6 6.3 20.9 4.6 21.5 5.6 21.4 5.6 21.3 6.0 19.8 5.2 20.0 Claw 3 lengths External base 7.0 21.9 5.5 18.1 4.1 14.6 6.4 20.3 6.3 20.7 6.0 18.7 5.6 18.2 6.0 19.2 5.8 22.7 4.6 16.5 5.4 17.9 5.5 18.5 5.0 19.3 5.3 20.0 4.7 15.6 6.1 23.5 3.2 11.1 6.2 21.6 External primary branch 5.5 23.5 7.4 23.1 12.5 40.9 9.1 32.0 9.4 30.0 8.2 32.3 5.6 28.1 11.1 36.7 8.7 29.4 9.2 28.9 11.2 36.4 10.1 32.2 11.2 43.7 9.5 33.8 11.0 36.2 11.5 38.6 6.9 32.2 7.9 30.1 8.0 30.3 9.0 30.1 10.5 40.7 8.5 29.3 9.4 32.6 External secondary branch 6.2 19.4 9.0 29.6 6.8 24.1 8.4 26.7 3.8 19.2 7.3 26.6 7.9 26.1 7.7 24.1 7.4 24.1 8.5 27.3 7.4 28.8 6.8 24.3 8.0 26.4 7.4 24.8 5.7 21.9 7.2 27.3 6.5 21.7 7.7 29.7 6.4 22.1 8.5 29.3 Internal base 4.2 13.0 2.4 8.4 6.0 19.1 6.7 26.5 6.2 22.7 5.9 19.5 4.0 12.6 6.0 19.5 5.2 16.5 5.5 21.4 4.3 15.2 5.6 18.5 5.4 18.0 3.8 17.6 4.6 17.6 3.7 14.0 3.7 12.4 4.2 16.1 4.6 15.8 Internal primary branch 7.5 23.5 6.3 22.3 8.3 26.4 9.5 31.3 8.0 25.1 9.4 30.4 7.3 23.4 8.1 31.7 7.8 27.6 8.1 26.6 8.3 27.9 6.7 25.6 7.2 27.0 6.7 22.2 7.5 28.8 7.5 25.8 Internal secondary branch 4.0 16.9 5.7 17.9 8.5 27.8 5.6 19.9 6.3 20.0 6.7 24.5 5.9 19.4 6.1 19.2 4.1 13.3 6.4 20.6 7.6 29.8 4.9 17.3 6.8 22.4 6.3 21.2 4.4 20.3 5.5 21.2 6.2 23.6 5.7 18.9 5.9 22.7 6.6 22.9 Claw 4 lengths Anterior base 4.6 14.2 6.2 20.3 2.9 11.0 5.8 20.5 5.3 16.9 4.7 18.6 2.5 12.5 4.4 13.9 4.1 13.8 4.2 15.5 6.4 21.1 4.0 13.4 4.9 15.5 6.0 19.9 6.4 20.7 5.0 16.0 4.8 18.7 4.4 15.7 4.8 15.9 5.0 16.8 4.6 15.9 3.2 11.7 3.3 15.5 3.6 13.7 3.5 13.2 5.9 19.5 3.8 14.8 5.5 18.9 5.8 20.0 Anterior primary branch 6.5 27.8 8.9 27.9 9.3 30.6 6.8 25.9 9.0 31.8 8.7 27.7 7.6 29.8 4.9 24.6 9.3 29.5 8.0 27.0 7.1 26.0 9.4 31.0 8.4 28.1 9.3 29.3 9.9 33.1 9.1 29.6 9.5 30.3 8.6 33.6 7.7 27.5 9.2 30.4 9.0 30.3 7.1 24.5 6.4 23.9 6.2 28.9 6.1 23.4 7.8 29.6 8.4 27.8 6.9 26.7 8.1 28.0 9.7 33.7 Anterior secondary branch 5.0 21.2 5.2 16.3 5.7 18.7 4.9 18.5 6.5 22.9 6.5 20.8 3.6 14.1 3.1 15.7 5.7 18.2 6.8 22.9 5.8 21.3 7.0 23.0 5.6 18.7 5.6 17.4 4.7 15.6 7.0 22.8 5.4 17.2 5.2 20.2 4.7 16.9 6.8 22.5 6.9 23.2 6.2 21.6 3.0 11.0 5.3 24.7 6.0 23.2 5.7 21.6 5.4 18.1 4.4 16.9 4.0 13.8 Posterior base 5.1 15.8 7.5 24.7 3.1 11.6 6.7 23.7 6.4 20.4 4.3 16.9 2.9 14.6 2.8 8.9 5.3 17.9 4.3 15.9 6.7 22.0 4.0 13.4 5.4 16.8 6.5 21.7 7.5 24.3 5.0 16.0 5.5 21.4 4.7 16.7 5.6 18.4 7.6 25.3 6.0 20.9 4.5 16.6 4.6 21.6 4.7 17.8 4.4 16.6 5.9 19.6 4.0 15.5 5.4 18.5 5.5 19.0 Posterior primary branch 8.4 35.7 13.7 42.6 14.0 45.8 8.3 31.3 12.7 44.9 14.1 45.1 11.5 45.2 8.7 44.1 12.6 40.0 11.0 37.5 10.0 36.6 14.3 47.3 11.4 38.2 14.2 44.5 13.1 43.7 14.0 45.4 15.0 47.9 10.7 41.9 11.3 40.1 14.4 47.3 12.6 42.1 12.4 43.2 10.0 37.3 9.5 44.3 11.8 45.4 10.9 41.3 13.0 43.4 11.4 43.9 12.1 41.6 14.3 49.5 3308 Posterior secondary branch 5.2 22.0 7.0 21.8 8.8 28.8 6.4 24.1 7.0 24.7 7.7 24.5 5.2 20.3 3.7 18.6 8.5 27.0 8.2 27.8 7.3 26.8 8.4 27.8 6.2 21.0 7.6 24.0 6.8 22.6 8.0 26.1 7.9 25.2 8.5 33.4 6.6 23.4 7.7 25.3 7.8 26.2 7.4 25.7 4.6 17.0 5.1 24.0 6.6 25.1 6.9 26.2 7.0 23.2 5.9 22.6 6.3 21.8 6.7 23.3
3309
3310
3311
3312
3313
3314
3315 168
3316 Table S4.26: Alexander Island
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 370 1204 335 1249 301 1139 382 1344 257 1086 377 1440 230 1159 168 915 301 1170 264 1123 235 904 260 1038 271 1116 271 1116 215 990 266 1063 465 1537 397 1287 374 1302 312 1318 323 1182 221 899 232 1000 273 1132 257 1009 268 1126 315 1151 252 1095 336 1316 192 814 Buccopharyngeal tube Buccal tube length 30.8 – 26.8 – 26.5 – 28.4 – 23.6 – 26.2 – 19.9 – 18.4 – 25.8 – 23.5 – 26.0 – 25.1 – 24.3 – 24.3 – 21.8 – 25.0 – 30.3 – 30.9 – 28.8 – 23.7 – 27.3 – 24.6 – 23.2 – 24.1 – 25.5 – 23.8 – 27.3 – 23.1 – 25.5 – 23.6 – Stylet support insertion point 20.4 66.3 17.9 66.8 18.6 70.2 19.8 69.7 17.0 72.1 18.4 70.3 14.5 73.0 13.1 71.5 17.7 68.8 16.4 69.6 17.3 66.7 17.9 71.6 16.8 69.4 17.1 70.5 15.9 72.9 17.2 68.9 20.4 67.3 20.4 66.2 20.1 69.9 16.9 71.5 18.1 66.4 17.0 69.2 16.5 71.4 17.2 71.4 17.6 69.0 16.4 69.0 18.1 66.3 15.9 68.9 17.4 68.3 16.3 69.2 Buccal tube external width 2.9 9.5 2.4 9.0 2.5 9.3 2.9 10.1 1.7 7.0 2.7 10.1 1.6 8.3 1.4 7.5 2.3 8.9 1.9 8.1 2.0 7.9 2.3 9.1 2.1 8.5 2.6 10.7 2.1 9.6 1.9 7.6 2.6 8.6 2.6 8.5 2.4 8.2 1.9 7.9 2.3 8.4 2.0 8.2 1.9 8.4 2.4 9.8 1.7 6.6 2.2 9.3 2.5 9.1 1.9 8.2 2.5 9.6 1.8 7.5 Buccal tube internal width 1.6 5.2 1.4 5.1 1.0 3.9 1.8 6.5 1.1 4.6 1.3 5.0 0.9 4.4 0.6 3.3 1.3 4.9 1.1 4.8 1.3 5.1 1.3 5.0 1.0 4.2 1.8 7.2 1.2 5.6 1.0 4.1 1.3 4.3 1.6 5.2 1.4 4.8 1.1 4.6 1.3 4.6 1.0 4.2 1.1 4.9 1.5 6.1 0.8 3.2 1.3 5.4 1.6 5.8 1.1 4.6 1.2 4.8 1.1 4.7 Placoid lengths Macroplacoid 1 5.5 17.9 6.7 25.1 4.3 16.2 5.3 18.6 4.9 20.7 5.7 21.6 3.1 15.8 2.9 15.7 5.4 20.9 4.8 20.3 4.7 18.3 4.9 19.5 4.6 18.9 4.7 19.4 4.4 20.0 5.0 20.0 6.2 20.5 7.0 22.6 5.6 19.4 4.2 17.8 6.3 23.2 4.8 19.4 4.5 19.5 4.9 20.2 4.6 17.9 4.1 17.4 5.1 18.5 4.4 19.0 5.0 19.7 4.2 17.8 Macroplacoid 2 4.9 15.8 4.6 17.3 3.8 14.4 4.3 15.2 3.3 13.8 4.4 16.6 3.1 15.5 2.2 11.7 4.3 16.8 3.6 15.2 4.0 15.4 3.7 14.8 3.2 13.3 3.8 15.8 3.2 14.7 3.9 15.6 5.9 19.3 5.6 18.1 5.2 18.1 3.8 16.0 4.5 16.5 4.2 16.9 3.6 15.4 4.2 17.2 3.9 15.3 3.6 15.0 4.2 15.3 3.4 14.8 3.8 15.0 3.1 12.9 Macroplacoid row 13.2 42.8 12.9 48.2 10.3 38.8 12.0 42.2 9.5 40.3 11.9 45.5 7.6 38.1 6.4 34.7 11.1 43.1 9.8 41.6 9.7 37.2 10.4 41.3 9.1 37.5 10.9 44.8 9.0 41.3 10.2 40.7 13.4 44.2 13.8 44.8 12.0 41.8 9.2 38.8 11.8 43.2 10.0 40.7 10.0 43.0 10.6 43.7 9.8 38.4 8.8 36.9 11.1 40.8 9.3 40.3 11.6 45.6 8.9 37.9 Claw 1 lengths External base 3.0 11.2 7.2 27.3 4.0 20.3 3.0 11.5 5.4 22.9 4.8 19.3 5.3 21.9 7.0 23.0 6.3 22.0 2.7 9.7 3.9 15.8 5.4 21.3 4.7 19.9 7.2 26.3 4.8 18.8 External primary branch 11.7 38.1 8.2 30.4 12.4 43.5 9.0 38.3 13.5 51.5 7.5 37.9 9.2 35.8 10.3 43.9 9.2 35.2 9.6 38.4 6.9 28.2 8.5 35.2 8.8 40.4 11.6 38.5 13.1 42.6 12.4 43.2 9.1 38.5 8.4 30.7 7.1 29.1 8.1 33.7 7.5 29.2 7.8 32.8 9.8 35.8 8.8 34.5 6.2 26.3 External secondary branch 6.2 23.2 9.3 35.4 4.3 21.6 5.8 22.6 5.9 25.1 7.1 28.4 6.7 27.6 6.0 27.4 10.1 33.3 8.0 26.1 8.8 30.7 4.2 17.9 6.6 24.3 4.1 16.5 6.0 23.5 6.1 25.5 7.8 28.4 6.3 24.7 Internal base 2.9 10.6 4.9 18.7 5.5 19.2 6.1 23.4 4.2 21.3 2.3 9.0 3.9 16.6 3.8 15.2 4.5 18.5 4.1 16.5 5.4 17.8 6.4 20.6 5.4 18.7 5.6 20.5 3.3 13.3 4.5 18.5 4.4 17.3 4.1 17.2 3.9 14.2 3.1 13.5 4.4 17.3 Internal primary branch 7.8 29.0 8.0 30.2 8.4 29.4 9.6 36.7 6.6 33.4 7.4 28.5 6.9 29.5 7.5 28.7 7.3 29.2 7.8 32.2 6.4 29.3 5.8 23.3 9.9 32.7 10.6 34.3 10.1 35.0 5.3 22.5 9.1 33.2 6.1 25.0 7.8 32.1 6.6 26.0 7.5 31.4 7.3 26.6 5.6 24.4 5.8 22.6 5.3 22.4 Internal secondary branch 7.9 25.7 5.9 22.0 7.0 26.4 5.1 18.0 7.2 27.3 5.1 25.5 5.1 19.8 4.7 20.0 5.4 21.6 5.2 21.3 4.7 21.6 5.6 22.4 4.9 16.1 8.2 26.7 7.5 26.2 4.5 19.1 8.8 32.2 3.8 15.6 5.6 23.0 5.6 21.9 5.9 24.8 3.9 14.1 4.6 19.8 5.1 19.9 4.8 20.4 Claw 2 lengths External base 8.4 27.2 3.0 11.1 7.0 26.3 5.0 21.0 7.9 30.2 3.9 19.4 1.8 9.7 4.9 20.6 5.6 22.4 5.8 23.8 5.9 24.3 3.5 16.1 5.1 20.4 9.2 30.4 7.2 25.0 6.8 25.1 4.6 18.8 6.0 24.7 5.2 20.5 5.6 23.4 4.9 21.4 External primary branch 10.9 35.5 10.1 37.8 13.4 50.6 12.0 42.1 10.1 42.8 14.2 54.1 9.7 48.9 6.3 34.2 9.5 40.2 10.6 42.2 8.6 35.4 11.5 47.3 10.2 47.1 9.8 39.0 11.9 39.3 14.7 47.5 13.6 47.2 9.9 42.0 13.2 48.5 6.6 27.0 11.9 49.2 8.5 33.5 8.7 36.4 12.1 44.3 7.0 30.4 7.8 33.1 External secondary branch 10.9 35.3 7.8 29.0 8.5 32.2 7.4 25.9 6.0 25.3 10.0 38.3 4.4 22.1 4.7 25.5 7.5 31.7 7.7 30.6 7.1 29.3 8.5 34.9 7.4 34.1 7.1 28.5 9.4 31.1 8.8 28.4 10.5 36.6 7.1 29.9 9.7 35.4 5.9 24.0 9.0 37.4 7.0 27.3 7.0 29.5 6.2 26.9 5.6 23.8 Internal base 6.8 22.2 5.2 19.7 6.4 22.4 4.7 19.8 5.9 22.4 4.3 21.4 1.6 8.5 4.6 19.7 4.8 19.0 4.3 17.4 6.8 22.5 7.3 23.5 6.0 20.8 4.9 20.8 3.8 14.0 3.7 15.2 4.3 17.7 4.5 17.5 3.8 15.8 5.4 19.8 2.9 12.5 Internal primary branch 8.4 27.4 9.6 36.4 8.2 28.8 7.3 31.0 10.6 40.4 7.2 36.0 5.2 28.4 7.6 32.1 7.6 30.3 7.3 30.1 6.6 26.2 11.3 37.5 13.3 43.0 10.6 36.7 8.7 36.6 7.2 26.5 6.4 25.9 7.1 29.5 7.3 28.5 6.4 26.9 8.2 29.9 6.5 28.3 5.9 25.1 Internal secondary branch 7.1 23.0 6.6 24.9 6.8 24.1 5.2 22.0 8.1 30.9 5.2 26.1 4.0 21.8 6.7 28.4 6.3 25.1 6.9 28.3 5.3 21.2 8.3 27.4 9.4 30.6 8.1 28.2 6.6 27.7 6.0 21.9 4.6 18.9 6.7 27.5 5.6 22.1 5.9 24.6 6.9 25.3 4.9 21.4 3.3 13.9 Claw 3 lengths External base 6.3 23.8 7.6 26.6 4.9 20.5 7.6 29.1 4.1 20.5 3.1 16.7 5.3 20.6 5.2 22.2 4.9 19.7 5.6 23.0 6.4 26.4 5.2 21.0 5.2 16.7 5.6 19.6 7.3 26.9 4.9 20.1 5.1 22.1 6.7 27.6 5.0 19.7 5.9 24.8 6.7 24.5 4.6 19.9 5.8 22.8 4.4 18.5 External primary branch 13.4 50.1 13.7 51.9 12.1 42.5 10.1 42.7 14.5 55.5 9.7 48.7 7.2 38.9 12.4 48.1 10.6 45.0 10.5 40.5 11.6 46.3 8.4 34.5 8.1 33.3 8.7 39.8 9.1 36.5 15.9 51.4 14.6 50.6 13.0 47.5 8.8 35.7 8.7 37.4 12.2 50.7 10.4 40.7 11.4 47.8 11.0 40.2 8.0 34.7 11.5 44.9 8.5 35.9 External secondary branch 8.1 30.1 9.4 35.5 9.6 33.6 6.3 26.4 10.4 39.7 5.4 27.0 4.3 23.6 8.1 31.6 5.6 23.9 7.2 28.7 7.4 30.4 11.9 49.1 6.1 28.1 7.2 28.9 9.4 30.4 8.6 29.9 9.5 34.9 4.2 17.0 6.4 27.5 8.5 35.1 6.7 26.1 7.8 33.0 9.8 35.8 7.7 33.5 9.7 37.9 5.8 24.6 Internal base 5.5 20.8 5.5 19.4 3.4 14.4 5.5 20.8 3.3 16.7 2.4 13.1 4.9 18.8 5.2 22.2 4.3 17.0 5.3 22.0 5.4 22.4 4.6 18.4 4.7 15.4 3.6 12.6 5.4 22.7 4.9 18.0 2.7 11.1 5.2 21.5 4.7 18.5 4.6 19.2 6.1 22.3 4.1 17.9 6.0 23.3 2.9 12.1 Internal primary branch 8.8 32.8 9.9 37.5 9.2 32.4 7.3 30.9 9.7 36.9 7.1 35.5 4.7 25.5 6.4 24.8 7.4 31.6 8.2 31.7 8.1 32.2 5.9 24.2 8.4 34.6 6.3 28.9 7.8 31.1 12.3 40.0 9.2 31.8 8.1 34.2 7.0 25.6 6.2 25.4 8.6 35.5 7.2 28.4 7.8 32.9 8.6 31.3 6.7 28.9 9.0 35.4 6.0 25.5 Internal secondary branch 6.8 25.7 7.1 24.9 4.3 18.2 6.9 26.3 3.7 18.8 3.0 16.5 5.5 21.2 3.6 15.1 5.6 22.4 5.4 22.4 7.2 29.7 4.7 21.6 6.3 25.3 6.7 21.8 7.7 26.9 6.3 26.5 6.7 24.5 5.0 20.2 7.6 31.3 6.2 24.3 6.4 26.9 8.4 30.6 6.0 26.1 7.6 29.9 5.0 21.2 Claw 4 lengths Anterior base 6.1 19.9 4.0 14.9 6.0 22.8 7.6 26.9 4.9 20.9 6.2 23.7 3.3 16.7 2.5 13.5 6.1 23.8 3.6 15.4 4.7 17.9 4.2 16.6 4.0 16.4 3.5 14.4 3.7 17.0 5.9 23.8 5.8 19.1 5.4 17.5 4.8 16.8 4.0 16.7 6.7 24.6 4.6 18.9 3.9 16.2 4.7 18.3 5.2 21.7 6.7 24.6 5.5 23.8 7.0 27.4 3.3 13.9 Anterior primary branch 12.6 40.9 9.9 36.8 11.4 42.9 11.0 38.7 9.1 38.5 12.9 49.3 8.3 41.6 5.9 31.8 9.6 37.4 8.5 36.2 10.2 39.2 9.6 38.1 8.2 33.9 10.0 41.0 9.8 44.9 9.7 38.6 13.5 44.6 14.1 45.6 12.4 43.0 9.6 40.6 10.0 36.6 7.8 31.8 10.0 41.3 8.4 33.1 9.6 40.3 12.1 44.3 9.3 40.3 10.4 40.6 7.7 32.8 Anterior secondary branch 7.2 23.3 6.0 22.2 7.3 27.5 7.7 27.2 6.4 26.9 5.8 22.2 4.6 23.3 4.5 24.5 7.7 29.9 4.5 19.1 6.3 24.1 5.3 21.1 4.9 20.1 6.3 25.8 6.5 29.8 6.7 26.7 5.1 17.0 6.4 20.8 6.0 21.0 4.9 20.6 9.1 33.5 5.3 21.5 6.1 25.3 6.9 26.9 7.4 31.1 5.8 21.3 6.5 28.2 8.5 33.3 5.7 24.3 Posterior base 7.0 22.9 5.8 21.5 7.2 27.0 7.0 24.5 5.2 22.1 7.1 26.9 3.9 19.4 3.3 18.0 6.0 23.1 4.2 17.7 5.3 20.3 4.6 18.2 4.3 17.9 3.5 16.1 5.9 23.6 6.7 22.2 6.3 20.4 5.8 20.2 4.9 20.7 6.3 23.1 5.9 24.0 4.1 17.7 3.3 13.8 4.9 19.1 5.9 24.6 7.8 28.7 6.1 26.4 6.4 25.2 3.9 16.7 Posterior primary branch 18.3 59.6 15.1 56.3 17.6 66.7 17.4 61.1 13.8 58.3 19.6 75.0 14.3 72.1 9.2 50.1 15.2 58.9 12.1 51.4 14.2 54.7 12.8 51.2 14.4 59.4 14.7 60.4 12.0 55.1 13.6 54.4 20.4 67.5 21.2 68.7 19.7 68.6 15.7 66.1 17.0 62.1 11.7 47.5 12.7 54.8 12.4 51.2 12.1 47.5 16.4 69.1 20.2 73.8 14.2 61.7 16.0 62.7 10.5 44.7 3317 Posterior secondary branch 9.4 30.5 7.1 26.6 8.7 32.7 13.5 47.5 9.2 38.7 8.4 31.9 5.4 27.2 4.8 26.2 7.9 30.5 4.9 21.0 6.3 24.2 6.7 26.7 6.9 28.5 10.4 42.8 4.6 21.0 9.0 35.9 9.1 30.2 10.4 33.8 9.2 32.0 7.3 30.7 6.8 25.1 6.9 28.3 5.0 21.7 6.8 28.0 8.0 31.2 9.4 39.6 8.8 32.2 8.5 36.8 9.3 36.3 6.5 27.4
3318
3319
3320
3321
3322
3323
3324
169
3325 Table S4.27: Deception Island
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 300 1065 274 1094 277 976 313 1145 284 1038 354 1227 279 1157 271 1096 363 1180 319 1126 Buccopharyngeal tube Buccal tube length 28.1 – 25.1 – 28.4 – 27.3 – 27.3 – 28.8 – 24.1 – 24.7 – 30.8 – 28.3 – Stylet support insertion point 18.1 64.3 16.8 67.1 19.4 68.3 18.7 68.3 18.3 67.0 19.6 68.1 16.2 67.0 16.3 66.0 21.1 68.5 19.7 69.7 Buccal tube external width 2.1 7.6 1.8 7.1 2.2 7.8 2.2 7.9 2.2 8.1 2.3 8.0 1.9 7.8 2.0 8.1 2.5 8.2 2.1 7.5 Buccal tube internal width 1.0 3.6 0.8 3.0 1.2 4.2 1.5 5.4 1.3 4.6 1.2 4.0 1.0 4.2 0.9 3.8 1.0 3.1 1.3 4.7 Placoid lengths Macroplacoid 1 4.9 17.5 5.0 19.9 4.8 16.7 5.1 18.5 4.6 16.8 5.5 19.0 4.8 19.8 4.5 18.2 5.7 18.6 5.1 18.2 Macroplacoid 2 3.6 12.7 3.7 14.9 4.0 14.2 4.3 15.6 3.9 14.2 4.5 15.7 4.1 17.0 3.8 15.4 5.0 16.1 4.1 14.4 Macroplacoid row 10.3 36.6 10.7 42.7 9.9 35.0 10.6 38.8 10.0 36.5 12.2 42.2 10.0 41.6 8.8 35.6 11.7 38.0 10.3 36.5 Claw 1 lengths External base 5.7 20.1 3.5 12.3 4.0 14.5 4.4 16.2 6.3 21.8 5.2 21.1 5.9 19.1 6.1 21.7 External primary branch 10.6 37.6 8.1 32.1 9.8 34.6 9.4 34.5 8.2 30.1 9.1 36.7 12.7 41.2 8.4 29.8 External secondary branch 7.6 27.1 6.5 22.9 7.5 27.2 6.0 22.1 8.9 31.0 7.1 28.9 8.2 26.7 7.6 26.7 Internal base 3.7 13.3 3.5 12.3 5.9 20.6 4.6 18.9 4.2 17.2 5.0 16.2 5.0 17.5 Internal primary branch 8.7 30.9 6.0 23.7 7.0 24.6 8.1 29.6 7.2 26.2 6.7 23.1 5.1 21.2 8.5 34.6 9.7 31.6 7.7 27.4 Internal secondary branch 5.8 20.8 5.2 18.2 4.3 15.7 6.7 23.4 5.1 21.0 5.1 20.5 6.9 22.3 5.3 18.7 Claw 2 lengths External base 5.6 19.9 4.5 17.8 3.9 13.8 6.7 24.6 5.6 20.6 6.1 21.1 5.4 22.6 5.5 22.2 7.3 23.8 6.1 21.5 External primary branch 12.4 43.9 10.0 39.8 10.6 37.3 9.9 36.2 9.4 34.2 11.6 40.3 9.4 38.9 11.4 46.1 13.3 43.4 12.0 42.3 External secondary branch 8.3 29.4 7.6 30.3 6.8 23.9 8.3 30.2 6.5 23.6 9.8 33.9 7.2 29.0 10.0 32.5 6.8 24.2 Internal base 4.8 17.0 4.7 18.9 3.1 10.9 5.3 19.4 3.9 14.4 6.1 21.0 5.2 21.6 4.4 17.9 5.0 16.1 Internal primary branch 9.8 34.7 7.7 30.8 8.1 28.4 8.1 29.6 7.1 25.8 7.9 27.3 9.4 38.1 9.8 32.0 Internal secondary branch 6.9 24.5 4.9 19.5 5.7 20.0 6.5 23.9 6.1 22.3 7.5 26.1 5.6 23.2 6.1 24.9 9.1 29.5 Claw 3 lengths External base 5.8 20.7 5.6 22.5 5.9 20.8 6.1 22.2 5.3 19.3 6.6 22.7 5.6 23.1 4.4 17.8 7.3 23.8 6.2 21.8 External primary branch 13.0 46.2 10.1 40.1 8.1 28.7 12.1 44.4 9.3 34.0 12.9 44.8 9.2 38.0 12.4 50.1 12.3 40.0 10.8 38.3 External secondary branch 8.1 28.8 7.3 25.9 7.4 26.9 5.4 19.9 8.7 30.2 7.8 31.4 10.0 32.4 7.9 28.0 Internal base 4.2 15.1 4.0 15.9 4.9 17.8 4.2 17.4 4.5 18.4 4.5 14.6 Internal primary branch 9.3 33.0 7.8 30.9 8.2 29.9 6.2 25.8 9.6 38.7 10.7 34.9 Internal secondary branch 6.2 22.1 6.2 22.7 5.1 21.2 6.1 24.6 6.1 19.7 Claw 4 lengths Anterior base 5.8 20.6 3.8 15.0 3.6 12.8 5.7 20.9 3.6 13.0 6.8 23.5 4.6 19.0 5.5 22.4 5.3 17.1 4.6 16.1 Anterior primary branch 11.0 38.9 8.9 35.5 9.5 33.3 10.1 36.8 8.7 31.7 10.9 37.8 9.0 37.1 9.2 37.4 12.0 38.8 9.7 34.2 Anterior secondary branch 7.2 25.5 4.3 17.3 6.3 22.3 7.7 28.1 3.7 13.7 6.5 26.9 7.4 29.9 6.9 22.3 5.9 20.9 Posterior base 6.7 24.0 4.5 17.8 4.5 15.7 7.4 27.1 4.7 17.0 8.1 28.1 4.9 20.2 6.0 24.1 6.0 19.5 5.5 19.3 Posterior primary branch 13.8 49.2 13.1 52.0 13.7 48.1 14.1 51.7 12.5 45.8 15.6 54.0 12.5 52.0 10.5 42.4 17.9 58.3 14.9 52.6 3326 Posterior secondary branch 9.4 33.3 6.5 26.0 9.3 32.9 9.2 33.7 5.3 19.2 7.1 29.3 8.8 35.5 6.7 21.7 7.4 26.1
3327
3328
3329
3330
170
3331 Table S4.28: James Ross Island
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 259 924 298 1057 330 1061 347 1217 240 869 289 1028 268 912 320 1123 349 1154 308 982 215 851 367 1163 342 1103 356 1257 374 1153 259 921 311 971 331 1136 305 1035 315 1070 273 917 208 828 270 1005 286 965 260 887 249 986 224 678 257 768 288 991 313 1088 Buccopharyngeal tube Buccal tube length 28.0 – 28.2 – 31.1 – 28.5 – 27.6 – 28.1 – 29.4 – 28.5 – 30.2 – 31.4 – 25.3 – 31.6 – 31.0 – 28.3 – 32.5 – 28.1 – 32.1 – 29.2 – 29.4 – 29.4 – 29.7 – 25.2 – 26.9 – 29.6 – 29.3 – 25.3 – 33.1 – 33.4 – 29.1 – 28.8 – Stylet support insertion point 18.9 67.6 19.7 70.0 22.4 72.0 19.2 67.5 19.0 68.6 18.5 65.8 20.2 68.6 19.7 68.9 21.0 69.6 21.9 69.8 17.9 70.9 22.6 71.6 22.8 73.6 19.4 68.5 23.0 71.0 21.2 75.3 22.2 69.1 20.5 70.3 20.8 70.7 21.1 71.5 21.3 71.7 18.1 72.0 19.9 74.1 19.6 66.0 20.2 68.8 18.4 72.8 22.0 66.3 23.0 68.9 20.9 71.9 20.0 69.3 Buccal tube external width 2.2 7.8 2.2 7.9 2.4 7.8 2.3 8.1 1.6 5.8 2.1 7.5 2.3 7.9 2.5 8.9 2.6 8.7 2.1 6.8 1.8 7.3 2.4 7.5 2.3 7.5 2.3 8.1 2.4 7.3 2.1 7.5 2.6 8.0 2.3 7.8 2.3 7.7 2.3 7.7 2.4 7.9 1.5 5.8 2.2 8.3 2.2 7.6 1.7 5.7 1.7 6.8 2.3 7.0 2.4 7.1 2.5 8.5 2.0 7.0 Buccal tube internal width 1.0 3.7 1.2 4.3 1.6 5.2 1.4 5.1 1.0 3.7 1.2 4.1 1.5 5.0 1.8 6.4 1.4 4.5 1.0 3.2 0.9 3.4 1.2 3.7 1.2 3.8 1.2 4.2 1.2 3.6 1.2 4.2 1.4 4.3 1.5 5.1 1.4 4.7 1.2 4.0 1.4 4.6 0.5 2.0 1.4 5.1 1.4 4.7 0.9 3.0 0.8 3.0 1.4 4.4 1.0 3.1 1.4 4.8 0.8 2.9 Placoid lengths Macroplacoid 1 4.7 16.7 5.7 20.2 5.4 17.4 4.9 17.3 4.3 15.7 5.0 17.7 4.8 16.4 5.1 18.0 6.4 21.1 5.6 17.8 4.3 17.2 6.1 19.1 5.7 18.3 5.5 19.4 4.8 14.7 4.9 17.3 6.2 19.4 4.6 15.8 5.0 17.1 5.2 17.7 4.8 16.0 4.6 18.2 5.4 20.1 5.2 17.5 5.2 17.6 4.3 17.0 5.7 17.2 6.2 18.4 5.2 18.0 5.5 19.2 Macroplacoid 2 4.3 15.5 4.6 16.2 4.6 14.8 4.0 14.0 3.4 12.4 3.7 13.1 3.9 13.3 3.6 12.5 5.0 16.5 4.7 15.0 3.1 12.4 4.3 13.7 5.5 17.8 4.1 14.4 4.3 13.2 4.1 14.5 5.2 16.1 4.1 13.9 4.2 14.3 4.5 15.4 3.6 12.0 3.8 15.1 4.2 15.5 4.4 14.9 4.1 14.0 3.1 12.2 5.2 15.6 5.0 15.0 4.6 15.7 4.5 15.7 Macroplacoid row 10.6 37.9 11.6 41.3 12.3 39.7 12.4 43.6 9.9 35.9 10.0 35.6 12.0 40.8 11.4 39.8 13.1 43.5 12.1 38.5 9.0 35.7 12.9 40.7 12.3 39.8 11.3 40.1 12.8 39.5 10.4 36.8 13.4 41.8 11.8 40.5 11.6 39.5 11.6 39.3 10.7 35.9 9.4 37.5 10.7 39.8 11.7 39.4 11.1 37.8 9.5 37.4 13.2 39.9 12.8 38.4 12.3 42.1 11.9 41.1 Claw 1 lengths External base 3.2 11.5 5.1 17.9 6.8 21.7 8.5 30.0 4.7 16.9 6.0 21.1 6.4 21.0 4.8 15.3 2.7 10.5 6.3 19.8 4.0 12.8 5.9 20.9 6.7 20.5 3.7 13.3 7.4 23.1 6.6 22.6 6.0 20.5 5.1 17.0 5.6 21.0 6.3 21.1 6.2 21.2 4.1 16.2 4.8 14.5 3.8 11.4 5.5 19.0 External primary branch 8.9 31.8 9.8 34.7 12.5 40.3 8.6 31.2 8.8 31.3 10.2 35.9 11.8 39.1 11.1 35.2 7.1 28.3 11.6 36.8 11.7 37.8 10.5 37.1 11.0 34.0 8.4 30.0 10.5 32.8 9.5 32.6 11.0 37.3 9.7 32.7 7.6 30.0 8.9 33.1 9.5 32.0 9.7 33.0 7.6 30.1 6.7 20.3 8.2 24.6 10.3 35.6 9.1 31.5 External secondary branch 6.0 21.3 5.9 21.1 8.9 28.6 8.5 29.7 6.8 24.7 7.3 26.0 6.4 22.6 8.8 29.1 6.1 19.3 4.1 16.3 7.3 23.2 7.3 23.5 5.9 20.8 5.9 18.3 6.6 23.6 6.0 18.6 8.8 30.0 6.6 22.3 5.4 21.5 5.5 18.6 6.0 20.6 6.1 24.0 5.1 15.4 6.7 19.9 6.0 20.5 7.8 27.2 Internal base 3.4 12.0 4.8 17.0 5.8 18.6 4.5 15.7 3.2 11.6 5.3 18.8 5.0 16.4 4.2 13.3 3.4 13.3 6.4 20.3 4.6 14.9 5.5 19.5 6.7 20.7 3.5 12.5 5.3 16.4 6.0 20.3 5.3 17.8 2.9 11.5 5.2 19.3 4.9 16.6 2.6 10.3 4.3 12.8 5.2 18.2 Internal primary branch 6.6 23.7 8.0 28.3 9.9 31.8 7.3 25.7 6.0 21.6 7.1 25.1 8.4 27.8 8.3 26.5 6.0 23.5 8.5 26.9 9.2 29.5 7.0 24.6 7.7 27.3 9.0 28.1 8.1 27.5 6.5 21.8 5.7 22.7 6.1 22.6 6.7 22.5 5.4 21.5 7.0 20.9 9.1 31.2 8.1 28.0 Internal secondary branch 5.2 18.6 5.4 19.1 7.9 25.5 6.8 24.0 4.8 17.2 5.8 19.2 6.3 20.1 4.2 16.6 6.8 21.4 6.0 19.4 5.8 20.6 7.7 23.9 4.2 14.9 5.5 17.0 7.2 24.5 5.5 18.5 3.2 12.6 5.2 17.5 4.7 18.8 6.5 19.6 6.2 21.5 Claw 2 lengths External base 3.6 12.9 6.2 22.0 7.2 25.1 5.0 18.0 5.2 18.7 4.3 14.5 3.6 12.7 6.3 20.8 7.7 24.7 4.4 17.5 6.3 19.9 5.0 16.0 6.9 24.5 7.2 22.0 4.3 15.3 8.6 26.9 5.9 20.2 4.2 14.3 7.1 24.1 6.3 21.2 4.3 17.2 4.4 16.4 5.6 19.1 5.4 21.2 4.0 12.2 4.1 12.2 7.5 25.7 4.2 14.5 External primary branch 9.8 35.1 12.2 43.2 6.0 19.3 10.6 37.3 8.5 30.9 10.4 37.1 10.4 35.5 9.5 33.2 10.6 35.1 12.1 38.4 9.0 35.5 12.9 40.9 12.8 41.3 11.7 41.3 12.6 38.8 8.7 31.0 11.2 34.9 13.1 44.9 8.9 30.3 11.5 39.2 10.7 35.9 8.4 33.2 10.4 38.6 10.4 35.5 9.0 35.8 10.9 33.0 10.6 31.8 9.5 32.7 9.6 33.4 External secondary branch 6.9 24.7 8.8 31.0 9.4 30.2 9.1 32.0 6.9 24.8 7.8 27.7 7.8 26.4 6.1 21.4 8.4 27.9 7.1 22.6 6.4 25.3 8.3 26.1 8.7 28.1 7.6 26.7 7.0 21.6 5.8 20.7 7.7 24.0 7.7 26.4 6.3 21.4 7.1 24.0 8.9 30.0 5.6 22.1 7.7 28.5 7.9 26.9 4.2 16.6 8.0 24.2 7.8 23.4 6.7 23.1 Internal base 4.3 15.4 4.7 16.5 5.3 17.0 6.0 21.0 4.0 14.5 3.8 13.7 3.3 11.3 4.4 15.5 3.8 12.6 5.3 16.7 3.7 14.7 6.3 19.9 5.6 18.1 6.5 22.9 6.4 19.7 4.3 15.1 6.7 21.0 6.2 21.2 6.1 20.7 2.8 9.4 3.5 13.7 4.8 17.9 4.2 14.3 6.1 20.6 4.5 17.9 3.8 11.3 3.8 11.3 5.0 17.3 5.1 17.5 Internal primary branch 7.4 26.5 9.0 32.0 9.8 31.6 9.8 34.3 6.5 23.5 8.7 31.0 8.7 29.4 8.0 28.1 8.3 27.6 8.3 26.4 6.3 25.0 9.3 29.5 8.2 26.4 7.3 25.6 9.3 28.8 7.8 27.6 8.4 26.2 10.5 36.1 7.1 24.0 8.4 28.2 7.5 29.6 6.3 23.6 7.9 26.7 7.9 27.0 5.5 21.7 8.7 26.4 8.8 26.3 9.0 30.8 7.6 26.3 Internal secondary branch 4.6 16.6 6.3 22.4 7.8 25.0 7.7 27.2 5.5 19.9 4.8 17.1 5.6 19.1 5.5 19.1 6.8 22.5 6.1 19.3 5.2 20.6 8.0 25.3 7.1 24.9 7.7 23.8 6.3 22.4 7.8 24.4 7.0 23.9 6.2 21.2 6.0 20.2 5.2 20.5 5.6 20.9 6.2 21.0 6.4 21.8 4.5 17.6 7.3 22.2 6.2 18.4 5.2 18.0 6.6 22.8 Claw 3 lengths External base 3.9 13.9 8.5 27.3 6.8 23.9 3.8 13.7 4.0 14.2 3.5 11.9 7.1 24.8 7.2 22.8 3.7 14.6 6.9 21.9 8.0 25.9 7.4 26.2 7.1 21.8 5.3 18.8 8.6 26.7 6.9 23.7 7.2 24.5 4.6 18.3 4.5 16.9 5.7 19.1 3.8 13.0 5.8 22.8 6.8 20.6 6.8 23.5 4.9 17.1 External primary branch 10.4 37.1 13.0 41.7 10.0 35.1 10.1 36.5 9.9 35.1 11.0 37.3 10.1 35.5 9.4 31.2 10.6 33.7 8.9 35.3 13.6 43.1 15.4 49.9 11.9 41.9 13.9 42.8 9.8 34.9 11.5 35.9 12.1 41.5 12.5 42.3 8.2 32.5 10.3 38.3 10.2 34.6 10.4 35.5 8.2 32.3 11.1 33.5 10.0 29.9 11.6 40.0 10.0 34.7 External secondary branch 5.9 21.0 10.5 33.6 8.6 30.2 6.8 24.5 6.7 23.7 8.3 28.0 7.7 26.8 6.1 20.3 7.7 24.6 6.4 25.4 9.4 29.7 9.6 31.1 6.9 24.2 7.9 24.4 7.8 27.8 9.2 28.7 7.8 26.7 6.1 20.6 5.2 20.5 6.6 24.6 7.8 26.2 5.5 18.6 6.1 24.1 7.9 23.8 6.4 19.2 8.1 27.8 6.7 23.3 Internal base 4.3 15.3 3.4 12.2 5.2 18.3 3.4 12.4 3.1 11.1 3.4 11.5 5.5 19.4 5.9 18.7 3.2 12.6 6.3 19.9 6.1 19.7 6.0 21.1 6.2 19.2 3.8 13.4 5.8 17.9 6.1 20.9 5.7 19.4 3.9 15.5 3.6 13.4 3.8 12.7 5.2 17.6 4.2 16.7 4.8 14.5 6.6 22.6 4.3 14.8 Internal primary branch 7.5 26.9 7.8 27.7 12.3 39.6 9.1 31.9 7.0 25.2 7.3 25.9 8.8 29.8 7.3 24.3 8.5 27.0 6.8 26.8 9.7 30.5 10.2 33.1 8.1 28.7 12.4 38.1 8.2 29.2 10.5 32.7 7.0 23.7 6.1 24.4 7.3 27.0 7.8 26.4 7.7 26.3 6.0 23.7 8.6 25.8 8.2 24.4 10.6 36.5 7.2 24.9 Internal secondary branch 4.6 16.3 5.5 19.3 8.3 26.7 6.9 24.4 6.4 23.0 5.4 19.1 7.8 26.6 7.5 26.1 6.1 20.2 6.9 22.0 4.8 18.9 7.1 22.6 7.6 24.5 7.3 25.9 8.1 24.9 6.1 21.8 7.5 23.3 6.9 23.8 6.9 23.5 4.8 19.0 4.2 15.5 6.4 21.7 6.1 20.8 5.9 23.2 6.0 18.2 5.2 15.6 6.1 21.1 6.1 21.1 Claw 4 lengths Anterior base 3.4 12.3 4.3 15.1 8.0 25.7 6.9 24.1 3.7 13.3 4.8 17.1 4.6 15.8 3.7 12.8 5.4 17.7 4.2 13.3 4.2 16.8 7.7 24.2 4.9 15.9 5.8 20.3 5.3 16.2 3.6 12.7 5.4 16.8 4.7 16.0 3.4 11.7 4.4 14.9 3.8 12.7 3.4 13.6 4.8 16.3 4.7 16.1 3.9 15.2 3.8 11.5 4.5 13.4 5.6 19.2 4.9 17.0 Anterior primary branch 8.8 31.6 9.3 32.9 9.6 30.7 10.4 36.6 8.7 31.4 9.0 32.2 10.9 37.2 8.8 30.8 11.4 37.9 10.0 31.9 8.2 32.4 11.9 37.6 11.0 35.4 10.5 37.1 10.8 33.4 8.6 30.7 10.8 33.6 10.7 36.7 8.4 28.6 9.5 32.3 8.7 29.3 7.6 30.0 7.4 27.5 9.0 30.5 9.4 31.9 7.9 31.2 10.7 32.2 10.1 30.3 9.8 33.8 10.4 35.9 Anterior secondary branch 6.5 23.1 6.0 21.2 7.6 24.6 7.7 27.2 5.5 20.0 6.5 23.0 7.9 26.7 5.9 20.7 7.0 23.1 7.0 22.2 5.2 20.7 9.3 29.4 6.9 22.3 8.2 29.0 6.3 19.3 6.7 23.9 6.4 20.0 7.4 25.4 6.3 21.5 8.0 27.1 5.8 19.6 4.5 18.0 7.1 26.3 5.2 17.4 4.6 15.6 4.8 19.2 7.5 22.8 6.5 19.4 9.3 32.1 6.1 21.3 Posterior base 5.7 20.3 4.4 15.6 10.7 34.4 8.2 28.8 4.5 16.2 7.1 25.4 6.6 22.4 8.1 26.9 5.6 17.9 4.5 17.6 8.5 27.0 5.4 17.3 8.8 31.1 5.0 15.5 3.9 13.9 4.7 14.6 4.4 15.2 3.9 13.3 8.1 27.6 4.4 14.6 3.0 11.8 4.3 16.0 4.7 15.8 4.9 16.7 3.6 14.2 7.2 21.8 3.8 11.3 5.1 17.6 7.1 24.5 Posterior primary branch 13.6 48.4 13.2 46.8 20.7 66.5 15.8 55.3 14.3 51.7 15.2 54.1 14.9 50.5 17.3 60.8 18.7 61.8 15.6 49.6 10.9 43.1 16.1 51.0 17.2 55.4 15.4 54.5 15.4 47.5 12.8 45.4 16.0 49.7 13.2 45.3 12.3 41.9 17.6 59.9 11.7 39.3 11.8 46.8 12.3 45.9 15.0 50.5 12.9 44.1 11.4 45.0 15.3 46.3 13.0 38.8 13.4 46.0 15.5 53.6 3332 Posterior secondary branch 9.2 32.7 7.3 25.9 11.6 37.3 10.0 34.9 9.0 32.5 9.4 33.5 9.9 33.8 7.8 27.5 10.6 35.1 7.2 23.0 7.0 27.6 11.4 35.9 9.6 31.1 10.3 36.3 9.2 28.5 7.5 26.8 7.3 22.8 9.2 31.6 5.9 19.9 9.7 33.1 7.2 24.1 7.0 27.9 7.3 27.1 6.5 21.9 5.8 19.7 6.9 27.4 9.9 29.9 8.2 24.5 7.0 24.0 10.4 36.3
3333
3334
3335
3336
3337
3338
171
3339 Table S4.29: Half-Moon Island
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 259 1023 202 949 177 769 179 753 169 694 258 921 210 649 270 865 270 809 149 653 197 981 195 867 192 889 251 970 334 1255 181 1102 193 974 170 955 188 914 196 930 Buccopharyngeal tube Buccal tube length 25.3 – 21.3 – 23.0 – 23.8 – 24.3 – 28.0 – 32.4 – 31.2 – 33.3 – 22.9 – 20.1 – 22.5 – 21.6 – 25.8 – 26.6 – 16.5 – 19.8 – 17.9 – 20.6 – 21.1 – Stylet support insertion point 15.8 62.6 12.6 59.3 14.8 64.2 15.4 64.8 16.9 69.3 17.0 60.9 22.8 70.5 20.0 64.1 22.4 67.1 14.1 61.8 12.3 61.4 13.6 60.5 14.2 65.8 16.5 63.8 15.0 56.3 10.3 62.4 11.6 58.7 10.3 57.8 12.4 60.4 12.2 57.6 Buccal tube external width 2.9 11.3 2.3 10.9 2.7 11.9 3.0 12.8 2.5 10.4 3.1 10.9 3.1 9.7 3.1 9.8 3.8 11.3 2.5 11.1 2.4 12.1 2.7 12.1 2.7 12.5 2.9 11.2 3.9 14.6 1.8 10.9 2.6 12.9 2.0 11.4 2.5 11.9 2.3 11.0 Buccal tube internal width 1.3 5.0 0.6 2.8 1.4 6.0 1.9 8.1 1.1 4.6 1.3 4.5 1.7 5.3 1.5 4.6 2.1 6.2 1.5 6.4 1.1 5.7 1.3 6.0 1.5 7.0 1.3 4.9 1.3 4.9 0.6 3.6 0.8 3.9 0.7 4.1 1.0 4.7 1.1 5.1 Placoid lengths Macroplacoid 1 5.6 22.2 4.6 21.6 5.6 24.2 4.0 16.8 4.0 16.5 4.5 16.2 5.3 16.5 5.6 18.0 6.2 18.7 4.1 17.9 5.2 25.8 4.4 19.6 3.6 16.6 4.6 17.9 5.9 22.3 2.9 17.3 4.3 21.5 3.6 20.0 3.9 18.8 3.8 18.1 Macroplacoid 2 4.1 16.3 3.8 17.7 4.1 17.8 3.4 14.4 3.3 13.5 4.8 17.0 4.0 12.2 4.3 13.7 4.9 14.8 3.7 16.4 3.3 16.4 3.0 13.2 3.2 14.6 3.3 12.8 4.6 17.1 2.4 14.4 3.0 15.3 3.4 19.2 3.8 18.3 3.1 14.5 Macroplacoid row 11.1 43.8 9.9 46.5 13.8 60.1 9.3 39.1 8.8 36.3 10.2 36.6 11.4 35.2 11.4 36.5 12.1 36.4 10.9 47.7 9.6 47.6 9.0 40.1 8.6 39.7 9.0 34.9 12.2 45.9 7.2 44.0 8.6 43.6 7.9 44.0 9.1 44.3 8.2 38.7 Claw 1 heights External base 5.1 20.1 2.8 13.2 4.9 21.5 3.7 15.4 4.4 18.1 7.2 25.7 8.0 24.7 3.9 12.6 6.1 18.3 4.4 19.3 2.9 14.6 4.9 21.5 3.5 16.0 3.5 13.4 3.1 11.8 2.8 16.8 2.6 13.2 3.4 18.9 3.2 15.6 3.4 16.1 External primary branch 10.2 40.5 8.4 39.3 9.3 40.4 8.3 34.9 8.4 34.7 9.5 34.1 10.3 31.7 8.7 27.9 12.6 37.9 7.3 32.1 8.0 39.7 7.2 32.0 7.8 36.2 9.0 34.9 10.2 38.4 6.6 39.8 6.5 33.0 6.8 38.3 6.0 29.4 8.8 41.8 External secondary branch 7.6 30.1 5.4 25.5 5.6 24.2 3.2 13.5 6.6 27.3 6.6 23.6 8.0 24.7 6.8 21.6 8.6 25.8 4.9 21.6 4.1 20.2 6.0 26.4 6.0 27.6 6.9 26.8 6.3 23.7 4.3 26.0 4.3 21.9 4.3 23.9 4.5 21.9 4.3 20.5 Internal base 5.0 19.7 2.4 11.0 4.3 18.6 4.4 18.5 2.9 11.7 4.2 14.8 3.5 11.1 6.2 18.7 3.0 13.2 3.8 18.9 2.4 11.0 2.6 10.0 3.6 13.5 1.7 10.3 2.9 14.5 2.3 12.8 2.3 11.1 3.2 15.0 Internal primary branch 8.3 32.7 6.3 29.8 7.7 33.5 7.0 29.6 5.6 22.8 6.4 22.9 7.5 24.1 10.6 31.7 5.9 25.9 6.2 31.1 6.2 27.4 5.9 27.5 6.5 25.2 7.7 28.8 4.6 28.2 5.3 26.7 5.6 31.4 4.9 23.7 6.3 29.8 Internal secondary branch 7.1 28.0 4.2 19.6 5.4 23.6 5.0 20.8 5.4 22.3 5.4 19.3 6.1 19.6 4.6 20.2 3.3 16.5 4.0 17.6 4.3 19.7 5.1 19.7 5.9 22.0 3.6 21.6 3.9 19.7 4.2 23.4 4.2 20.5 3.8 18.2 Claw 2 heights External base 5.0 19.6 2.8 13.0 6.6 28.9 4.7 19.7 4.9 20.1 6.9 24.8 6.2 19.1 4.3 13.8 5.6 16.9 3.6 15.8 3.1 15.5 4.0 17.8 4.7 21.8 4.2 16.2 3.5 13.2 3.9 23.7 3.7 18.7 2.8 15.7 3.8 18.1 External primary branch 12.9 50.8 9.4 44.2 8.7 37.9 8.6 36.3 8.4 34.4 12.8 45.8 10.5 32.3 9.0 28.9 11.0 33.1 8.5 37.1 7.9 39.2 7.5 33.4 8.7 40.3 9.3 35.9 11.4 43.0 7.1 43.2 7.2 36.4 7.2 40.3 9.1 43.2 External secondary branch 8.8 34.9 5.1 24.1 8.1 35.4 4.3 18.2 6.5 26.6 7.5 26.6 7.6 23.4 6.4 20.5 9.6 28.7 5.0 21.8 6.0 30.1 7.2 31.7 7.1 32.8 6.6 25.4 6.9 25.8 4.3 26.1 4.0 20.4 5.3 29.7 5.1 24.3 Internal base 5.6 22.0 2.7 12.9 5.1 22.2 4.0 16.9 4.2 17.2 4.8 17.0 6.0 18.7 4.8 15.3 5.2 15.5 3.5 15.3 2.6 12.8 3.7 16.3 3.6 16.6 3.7 14.3 4.0 15.0 3.4 20.4 3.1 15.6 2.2 12.3 4.1 19.4 Internal primary branch 9.5 37.7 7.5 35.0 7.4 32.2 6.5 27.2 6.4 26.3 8.0 28.7 8.9 28.4 10.6 31.9 6.0 26.2 6.6 32.6 5.7 25.1 5.3 24.5 7.5 28.9 9.6 36.0 4.5 27.3 4.8 24.0 6.1 33.9 8.0 38.0 Internal secondary branch 7.5 29.5 4.6 21.5 6.7 29.1 4.9 20.5 4.6 18.9 6.4 22.8 7.0 21.5 7.5 24.0 7.6 22.9 4.5 19.6 4.7 23.3 5.7 25.4 5.0 23.3 5.8 22.3 6.4 24.0 4.2 25.6 4.0 20.4 4.5 24.9 3.5 16.8 Claw 3 heights External base 7.1 28.2 3.0 14.0 4.9 20.4 3.7 15.1 5.8 20.6 6.1 18.7 6.1 19.5 6.5 19.4 4.7 20.6 3.0 14.8 3.9 17.3 4.7 21.8 3.4 13.2 3.7 13.9 3.3 20.2 2.8 14.0 3.9 21.6 4.0 19.6 4.5 21.1 External primary branch 12.6 50.0 8.0 37.8 11.0 47.9 9.9 41.5 8.6 35.2 11.9 42.7 10.5 32.4 10.5 33.5 12.8 38.5 6.9 30.0 9.1 45.2 10.1 44.9 9.5 44.1 10.8 41.8 10.9 40.9 7.0 42.8 7.7 38.8 7.8 43.8 6.6 32.2 11.0 52.0 External secondary branch 9.2 36.4 5.0 23.6 7.4 32.4 4.8 20.2 5.8 23.8 8.6 30.7 8.7 26.8 8.5 27.1 9.1 27.4 5.8 25.6 6.6 33.1 6.0 26.4 7.1 32.9 6.8 26.4 7.1 26.5 4.4 26.5 3.7 18.7 6.0 33.4 5.3 25.9 7.4 35.1 Internal base 4.5 17.6 2.3 10.8 4.4 19.1 4.8 20.1 3.9 16.1 4.4 15.8 5.4 16.7 5.6 17.9 6.4 19.2 3.2 13.9 2.8 13.9 3.9 17.4 4.0 18.6 3.4 13.0 3.8 14.3 3.8 23.2 2.7 13.8 2.2 10.5 3.9 18.2 Internal primary branch 10.4 41.2 5.2 24.5 8.7 37.8 6.9 29.2 7.2 29.7 10.1 36.0 7.3 22.5 8.3 26.4 5.8 25.5 6.5 32.2 6.2 27.6 5.6 26.0 7.3 28.3 9.0 33.7 4.2 25.6 6.0 30.5 6.3 30.6 7.1 33.7 Internal secondary branch 8.1 31.9 3.9 18.2 4.8 21.0 5.3 22.1 4.3 17.8 8.0 28.6 6.9 21.2 7.3 23.5 8.6 25.9 4.8 21.1 4.7 23.2 4.2 18.8 5.4 24.9 5.8 22.4 6.2 23.3 4.2 25.3 4.0 20.4 3.7 17.8 5.4 25.4 Claw 4 lengths Anterior base 5.7 22.4 3.6 17.0 4.2 18.3 3.3 13.8 3.1 12.6 4.9 17.4 3.4 10.4 3.7 11.9 3.7 11.0 3.0 13.0 3.7 18.6 2.4 10.8 2.9 13.3 3.5 13.6 3.5 13.3 2.3 13.7 2.8 15.6 3.6 17.6 4.7 22.1 Anterior primary branch 9.5 37.6 6.8 31.9 10.0 43.4 6.2 26.1 7.5 30.7 9.6 34.4 10.0 30.7 10.6 34.0 8.1 24.2 6.5 28.5 6.9 34.4 8.0 35.6 7.6 35.1 6.8 26.1 9.7 36.5 6.4 39.1 5.1 25.5 6.2 34.6 7.1 34.5 6.7 31.9 Anterior secondary branch 8.5 33.6 3.4 15.8 5.2 22.5 5.3 22.2 5.0 20.4 5.3 19.1 5.4 16.7 6.1 19.4 6.5 19.4 5.9 29.3 5.1 22.7 5.3 24.5 5.7 22.1 6.1 22.9 4.2 25.2 3.7 18.7 4.1 23.1 4.2 20.3 6.1 28.7 Posterior base 6.8 26.8 4.3 20.1 4.7 20.4 4.4 18.6 3.8 15.7 8.0 28.6 3.8 11.9 3.5 11.2 7.5 22.4 3.3 14.6 5.0 24.9 3.2 14.2 2.9 13.4 4.5 17.5 4.6 17.2 3.6 21.6 3.8 19.2 3.4 18.9 3.1 14.9 5.5 26.0 Posterior primary branch 15.1 59.5 9.4 43.9 12.1 52.8 9.1 38.3 12.9 53.0 15.3 54.7 11.8 36.3 13.1 41.9 11.2 33.7 9.9 43.2 12.1 60.2 10.1 44.8 12.0 55.4 13.3 51.5 13.2 49.5 8.4 51.1 9.8 49.3 9.8 55.0 10.7 52.0 11.4 54.1 3340 Posterior secondary branch 9.7 38.5 5.4 25.3 7.2 31.4 7.5 31.6 6.6 27.2 8.1 28.9 7.5 23.2 7.0 22.4 5.6 24.6 7.2 35.8 6.5 28.9 5.7 26.2 6.2 24.0 7.9 29.6 5.3 32.2 4.8 24.2 4.9 27.3 7.3 35.7 6.8 32.3
3341
3342
3343
3344
3345
3346
172
3347 Table S4.30: Damoy, Wiencke Island,
SPECIMEN 1 (HOL) 2 3 4 5 6 7 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 204 874 175 868 241 986 296 1125 163 838 322 1240 254 1060 Buccopharyngeal tube Buccal tube length 23.3 – 20.1 – 24.4 – 26.3 – 19.5 – 26.0 – 24.0 – Stylet support insertion point 13.7 58.9 11.9 59.1 14.9 61.0 15.5 58.9 12.3 63.1 15.3 58.9 15.0 62.6 Buccal tube external width 2.6 10.9 2.5 12.5 2.7 10.9 2.8 10.7 2.2 11.2 3.2 12.3 2.6 11.0 Buccal tube internal width 0.8 3.3 1.2 5.8 1.1 4.6 1.4 5.3 0.9 4.6 2.0 7.6 1.4 5.7 Placoid lengths Macroplacoid 1 4.4 18.9 3.5 17.3 4.5 18.6 5.0 19.0 3.0 15.5 4.6 17.6 3.8 15.6 Macroplacoid 2 3.7 15.7 3.1 15.3 3.1 12.8 4.4 16.6 2.4 12.2 4.1 15.9 3.1 12.9 Macroplacoid row 9.2 39.7 8.7 43.0 9.5 38.9 12.1 46.2 7.5 38.4 11.9 45.7 8.7 36.2 Claw 1 heights External base 4.4 18.8 3.2 15.9 5.8 23.7 4.0 15.3 4.1 20.9 6.0 23.1 4.4 18.4 External primary branch 8.6 36.8 7.8 38.5 9.9 40.8 9.4 35.6 6.3 32.3 8.8 34.0 7.9 33.0 External secondary branch 6.5 27.7 5.4 26.7 6.7 27.3 4.8 18.1 4.7 24.2 7.1 27.2 5.0 20.9 Internal base 3.0 12.8 3.0 15.0 3.7 15.0 4.2 16.1 3.3 17.1 4.9 20.3 Internal primary branch 6.0 25.6 6.6 32.7 6.4 26.3 7.1 27.2 4.8 24.6 5.4 22.6 Internal secondary branch 4.9 21.2 3.6 18.1 5.4 22.0 5.5 21.1 3.7 18.9 Claw 2 heights External base 6.0 25.5 4.0 20.1 6.9 28.1 7.5 28.4 4.3 21.9 6.5 25.1 4.7 19.5 External primary branch 10.0 43.1 7.4 37.0 10.6 43.3 11.0 42.0 7.5 38.5 11.3 43.3 9.4 39.1 External secondary branch 5.9 25.3 5.1 25.1 6.5 26.7 7.8 29.8 4.3 22.2 7.4 28.4 5.3 22.0 Internal base 4.8 20.7 4.7 23.1 4.3 17.6 6.5 24.8 3.1 16.1 4.9 18.8 4.2 17.5 Internal primary branch 7.9 34.0 6.9 34.2 8.1 33.3 8.2 31.1 5.8 29.8 6.4 24.7 5.9 24.4 Internal secondary branch 5.5 23.7 3.5 17.5 5.6 22.8 7.6 29.1 4.1 21.0 Claw 3 heights External base 5.7 24.3 3.5 17.5 7.0 28.5 5.8 22.0 3.9 19.8 5.2 21.5 External primary branch 10.9 46.8 9.4 46.6 10.2 41.9 11.4 43.4 6.2 32.1 9.8 40.6 External secondary branch 6.0 25.5 4.2 21.0 6.6 27.2 8.3 31.5 5.4 27.9 5.6 23.4 Internal base 4.3 18.6 2.3 11.5 5.8 22.0 3.1 15.9 4.8 20.0 Internal primary branch 7.3 31.3 7.7 38.3 9.3 35.5 4.6 23.7 6.8 28.4 Internal secondary branch 5.7 24.5 4.9 24.6 7.5 28.4 4.4 22.4 5.4 22.5 Claw 4 lengths Anterior base 4.8 20.6 2.9 14.2 3.6 14.7 5.0 18.9 2.9 14.8 4.2 16.1 3.2 13.2 Anterior primary branch 8.3 35.5 7.6 37.7 8.4 34.2 9.6 36.6 5.1 26.2 8.8 33.8 6.8 28.4 Anterior secondary branch 5.6 24.1 4.9 24.4 5.0 20.5 7.5 28.4 3.4 17.3 6.2 23.7 4.9 20.2 Posterior base 4.9 21.0 3.2 15.7 3.6 14.6 7.9 30.1 3.3 16.8 4.1 15.8 3.2 13.4 Posterior primary branch 13.5 57.8 9.0 44.6 10.4 42.5 14.6 55.7 8.9 46.0 11.6 44.7 10.8 44.8 3348 Posterior secondary branch 9.2 39.4 6.3 31.5 6.6 26.9 10.1 38.5 4.1 21.0 6.6 25.4 4.3 17.9
3349
3350
3351 173
3352 Table S4.31: Dutherier, Palmer Land
SPECIMEN 1 (HOL) 2 3 4 CHARACTER µm pt µm pt µm pt µm pt Body length 193 763 203 821 233 940 170 629 Buccopharyngeal tube Buccal tube length 25.3 – 24.7 – 24.8 – 27.1 – Stylet support insertion point 15.4 60.9 15.0 60.6 14.6 59.0 18.1 67.1 Buccal tube external width 3.2 12.5 2.7 11.1 3.4 13.8 2.9 10.5 Buccal tube internal width 2.1 8.4 1.1 4.5 2.1 8.6 1.3 5.0 Placoid lengths Macroplacoid 1 5.4 21.3 5.8 23.6 5.8 23.2 4.0 14.7 Macroplacoid 2 5.2 20.5 4.0 16.1 3.9 15.5 3.5 12.8 Macroplacoid row 11.6 45.8 11.3 45.9 12.3 49.6 9.3 34.3 Claw 1 heights External base 4.1 16.1 4.7 19.1 4.3 17.2 4.2 15.5 External primary branch 10.9 43.2 8.6 34.7 7.8 31.6 9.0 33.1 External secondary branch 7.2 28.4 6.7 27.2 4.0 16.3 6.7 24.6 Internal base 3.4 13.6 3.7 14.9 5.1 20.7 3.0 11.1 Internal primary branch 8.9 35.2 7.2 29.3 5.9 23.8 6.9 25.4 Internal secondary branch 5.8 22.8 6.0 24.2 4.9 19.8 4.9 18.2 Claw 2 heights External base 3.5 13.7 3.7 15.1 4.1 16.5 4.0 14.8 External primary branch 11.8 46.6 10.8 43.5 9.6 38.6 7.5 27.6 External secondary branch 7.3 28.7 7.3 29.4 7.3 29.6 4.7 17.5 Internal base 4.0 15.8 3.4 13.9 4.4 17.7 4.0 14.8 Internal primary branch 9.6 38.1 7.6 30.9 8.2 33.2 5.5 20.2 Internal secondary branch 4.9 19.3 5.8 23.4 5.5 22.0 4.9 18.2 Claw 3 heights External base 3.9 15.5 5.4 21.7 5.6 22.8 5.6 20.5 External primary branch 12.9 51.2 10.5 42.6 10.0 40.5 10.1 37.2 External secondary branch 6.9 27.2 7.7 31.3 7.1 28.8 6.6 24.3 Internal base 3.7 14.6 5.4 21.9 5.2 21.1 4.5 16.6 Internal primary branch 9.3 36.8 7.6 30.7 7.9 31.8 6.4 23.5 Internal secondary branch 6.9 27.1 5.5 22.3 6.0 24.1 Claw 4 lengths Anterior base 7.3 29.1 5.7 23.1 3.3 13.4 3.3 12.0 Anterior primary branch 10.2 40.5 9.0 36.5 8.9 36.0 8.5 31.6 Anterior secondary branch 6.9 27.4 6.0 24.3 6.1 24.7 5.0 18.6 Posterior base 6.9 27.1 6.1 24.7 3.1 12.6 3.7 13.8 Posterior primary branch 14.3 56.6 14.3 57.7 12.0 48.4 11.6 43.0 3353 Posterior secondary branch 8.9 35.1 8.1 32.6 6.7 27.0 6.4 23.5
3354
3355
3356
174
3357 Table S4.32: Kerr Point, Ronge Island
SPECIMEN 1 (HOL) 2 3 CHARACTER µm pt µm pt µm pt Body length 182 691 243 947 150 906 Buccopharyngeal tube Buccal tube length 26.3 – 25.6 – 16.5 – Stylet support insertion point 17.4 66.3 17.4 67.7 10.8 65.3 Buccal tube external width 2.1 8.1 2.5 9.8 1.8 10.6 Buccal tube internal width 1.1 4.2 1.3 4.9 0.8 4.8 Placoid lengths Macroplacoid 1 4.4 16.9 4.3 16.9 3.0 18.3 Macroplacoid 2 3.2 12.3 3.3 13.0 2.4 14.4 Macroplacoid row 8.5 32.5 8.7 33.8 7.1 42.9 Claw 1 heights External base 3.8 14.4 4.0 15.6 1.9 11.7 External primary branch 7.6 29.0 11.1 43.1 5.2 31.4 External secondary branch 3.6 13.9 5.1 20.0 3.8 22.9 Internal base 3.5 13.3 3.0 11.7 2.1 12.9 Internal primary branch 5.8 21.9 5.9 23.1 3.9 23.3 Internal secondary branch 3.7 13.9 4.4 17.2 3.4 20.4 Claw 2 heights External base 3.9 14.7 5.0 19.4 2.5 14.9 External primary branch 7.8 29.8 7.5 29.3 7.3 44.0 External secondary branch 5.6 21.4 4.4 17.2 3.9 23.3 Internal base 3.3 12.4 3.2 19.1 Internal primary branch 6.7 25.3 5.9 35.8 Internal secondary branch 4.8 18.4 4.2 25.1 Claw 3 heights External base 5.5 20.8 4.8 18.6 4.1 24.7 External primary branch 8.9 33.8 9.9 38.5 7.1 42.7 External secondary branch 6.4 24.4 5.2 20.1 5.5 33.1 Internal base 4.6 17.4 2.3 13.8 Internal primary branch 8.2 31.1 4.0 24.2 Internal secondary branch 6.2 23.4 4.3 25.9 Claw 4 lengths Anterior base 3.7 13.9 2.9 11.3 3.7 22.6 Anterior primary branch 7.6 29.1 7.8 30.5 5.8 35.3 Anterior secondary branch 5.9 22.6 4.1 15.8 3.4 20.4 Posterior base 3.9 14.8 4.0 15.5 4.0 23.9 Posterior primary branch 10.2 38.7 10.7 41.7 8.2 49.6 3358 Posterior secondary branch 6.9 26.2 4.9 19.3 4.8 28.7
3359
3360
3361
175
3362 Table S4.33: Neko Harbour
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 266 1255 178 1025 297 1062 177 876 239 1101 356 1467 250 1055 359 1427 347 1423 161 930 245 1053 293 1202 187 1050 248 1177 186 971 309 1256 343 1431 194 1004 345 1349 196 1057 196 1241 436 1724 302 1243 268 1187 360 1396 319 1246 292 1168 276 1239 173 935 Buccopharyngeal tube Buccal tube length 21.2 – 17.3 – 27.9 – 20.2 – 21.7 – 24.3 – 23.7 – 25.2 – 24.4 – 17.3 – 23.3 – 24.4 – 17.8 – 21.1 – 19.1 – 24.6 – 24.0 – 19.3 – 25.6 – 18.5 – 15.8 – 25.3 – 24.3 – 22.6 – 25.8 – 25.6 – 25.0 – 22.3 – 18.5 – Stylet support insertion point 12.5 59.1 11.0 63.5 17.4 62.3 12.0 59.6 13.2 61.0 15.1 62.0 13.9 58.6 15.5 61.4 14.7 60.3 11.8 68.2 14.3 61.5 14.9 61.1 11.9 66.7 12.5 59.1 11.8 61.7 15.1 61.4 13.9 58.1 12.7 65.8 14.2 55.3 11.7 63.2 9.0 57.0 16.5 65.1 15.5 63.9 14.3 63.1 16.2 62.9 16.4 64.1 14.9 59.8 13.0 58.3 11.6 62.7 Buccal tube external width 3.0 14.0 1.9 10.7 3.5 12.7 2.4 11.7 2.6 12.0 3.1 12.9 2.6 11.2 3.5 13.8 3.1 12.6 1.6 9.0 2.6 11.0 2.7 11.2 2.0 11.5 2.5 12.0 2.3 12.1 3.3 13.5 3.2 13.3 2.2 11.5 3.8 14.8 2.2 11.7 1.9 12.3 4.1 16.3 3.2 13.2 2.6 11.6 3.3 12.6 3.5 13.5 3.6 14.3 3.0 13.5 2.0 10.6 Buccal tube internal width 1.2 5.8 1.0 5.6 2.1 7.5 0.8 3.8 1.0 4.4 1.7 6.9 1.2 5.2 1.5 6.0 1.8 7.3 0.5 3.1 1.2 5.2 1.3 5.3 0.7 4.1 1.3 6.2 1.0 5.3 1.5 6.0 1.6 6.5 0.7 3.6 2.1 8.0 0.8 4.3 0.5 3.4 2.4 9.6 1.7 6.9 1.1 4.8 1.7 6.7 1.6 6.1 2.0 7.8 1.4 6.1 0.9 4.7 Placoid lengths Macroplacoid 1 4.2 19.6 3.3 18.8 6.3 22.4 3.0 15.1 4.1 18.8 4.5 18.5 4.9 20.6 5.1 20.2 4.8 19.7 3.5 20.0 4.9 20.8 4.9 20.0 3.6 20.2 4.7 22.4 3.3 17.3 5.6 22.7 5.5 22.8 3.7 19.1 5.3 20.6 3.0 16.0 3.0 19.3 5.3 20.9 4.6 19.0 4.7 20.6 5.5 21.4 5.2 20.4 4.8 19.3 3.8 16.9 3.4 18.5 Macroplacoid 2 2.8 13.2 2.7 15.8 5.0 17.8 2.6 13.1 3.4 15.8 4.0 16.6 3.6 15.3 4.2 16.5 3.5 14.5 2.5 14.3 3.8 16.4 4.4 18.1 2.4 13.6 3.5 16.6 2.5 13.2 4.0 16.3 3.9 16.4 3.2 16.5 4.7 18.5 3.0 16.0 2.2 14.1 4.0 15.7 3.4 13.9 3.3 14.7 4.7 18.1 4.4 17.3 3.8 15.2 3.3 14.9 2.5 13.4 Macroplacoid row 8.6 40.5 7.4 42.6 13.4 48.1 7.1 35.1 9.1 42.2 11.8 48.6 10.0 42.4 11.7 46.6 11.7 48.0 7.2 41.7 9.8 41.9 10.4 42.7 7.1 40.1 9.0 42.4 7.4 38.7 11.0 44.7 10.6 44.2 7.3 38.0 11.7 45.8 6.7 36.0 6.8 43.4 11.1 43.8 10.5 43.1 9.9 43.6 11.4 44.3 12.6 49.4 10.8 43.1 9.3 41.6 6.8 36.9 Claw 1 heights External base 3.8 17.7 2.5 14.4 3.7 13.4 2.6 12.6 2.9 13.5 6.3 26.1 3.6 15.0 6.5 25.8 4.7 19.3 2.5 14.3 4.3 18.3 4.3 17.8 4.2 23.4 3.9 18.6 3.3 17.5 2.7 10.9 7.0 29.1 3.7 19.0 5.5 21.6 4.0 21.4 4.1 26.3 5.7 22.7 4.5 18.4 4.2 18.7 4.5 17.3 5.0 19.7 6.9 27.5 4.2 18.6 3.4 18.1 External primary branch 9.1 42.9 6.3 36.2 11.1 39.8 6.9 34.2 8.0 36.8 12.7 52.1 7.9 33.4 12.4 49.4 10.8 44.4 6.7 38.6 9.0 38.7 10.8 44.4 6.9 38.8 8.3 39.1 7.3 38.0 8.1 32.8 11.7 48.6 5.9 30.5 12.1 47.4 7.1 38.4 6.3 40.0 11.7 46.3 8.7 35.6 8.4 37.0 9.5 36.7 12.4 48.3 9.4 37.5 7.9 35.4 6.8 36.8 External secondary branch 5.3 24.8 4.7 27.1 7.8 27.9 4.1 20.3 5.9 27.2 8.0 32.9 5.0 21.1 7.1 28.4 6.8 27.7 4.1 23.9 4.9 21.2 5.7 23.4 4.2 23.4 5.9 27.7 5.1 26.9 5.6 22.7 8.7 36.3 5.0 25.7 8.3 32.5 4.5 24.1 4.3 27.2 7.6 29.9 5.8 23.9 7.3 32.2 6.6 25.5 7.2 28.1 7.6 30.3 5.6 25.0 5.2 28.3 Internal base 3.2 15.1 2.2 12.8 3.1 11.0 2.3 11.6 3.0 13.9 4.4 18.0 4.3 17.2 4.9 20.0 2.0 11.3 3.6 15.3 3.3 13.7 3.0 16.9 3.2 15.1 2.9 15.4 4.9 20.0 5.2 21.6 3.3 17.0 3.7 14.6 3.1 16.5 2.9 18.5 4.8 18.8 5.0 20.4 3.0 13.3 3.8 14.7 6.0 23.4 3.8 15.2 3.7 16.6 3.5 19.1 Internal primary branch 7.6 35.8 5.3 30.5 10.2 36.3 5.2 25.6 7.2 33.0 8.2 33.6 7.7 30.4 7.5 30.8 4.9 28.2 6.3 27.1 9.4 38.5 5.7 32.1 5.9 27.8 5.2 27.1 7.6 31.0 9.3 38.9 5.0 26.1 8.8 34.2 4.8 25.9 4.9 30.8 9.5 37.6 6.8 28.0 7.3 32.2 7.3 28.3 10.0 39.0 8.7 34.8 5.3 23.9 5.2 28.2 Internal secondary branch 5.2 24.3 3.6 20.6 6.9 24.7 3.7 18.5 4.6 21.2 5.5 22.5 5.7 22.5 5.3 21.9 3.5 20.2 4.9 20.8 4.9 20.2 3.5 19.9 4.4 21.0 3.5 18.5 4.9 20.1 8.3 34.7 4.3 22.2 7.8 30.3 3.5 19.1 3.7 23.5 5.2 20.7 4.5 18.3 5.9 26.0 5.6 21.6 7.6 29.6 5.8 23.1 4.8 21.3 4.1 22.0 Claw 2 heights External base 5.6 26.5 3.9 22.6 4.4 15.6 2.5 12.1 2.9 13.5 6.7 27.6 4.0 16.9 5.5 21.9 4.8 19.5 1.6 9.2 3.5 15.2 4.3 17.4 2.7 14.9 4.3 20.2 3.7 19.6 7.3 29.6 7.1 29.6 3.3 17.1 5.0 19.5 4.3 23.2 3.4 21.3 6.4 25.3 5.1 20.8 5.5 24.2 6.5 25.1 5.1 20.0 5.1 20.5 4.7 21.0 3.8 20.2 External primary branch 9.9 46.7 7.3 42.2 13.2 47.1 8.4 41.6 8.8 40.5 12.5 51.5 8.2 34.5 13.2 52.4 12.3 50.4 7.0 40.6 10.5 45.1 11.0 45.2 8.4 47.0 7.3 34.4 7.6 39.8 11.9 48.3 14.0 58.3 6.9 35.8 12.8 50.0 7.7 41.5 6.8 43.1 14.5 57.4 10.6 43.8 9.9 43.9 12.0 46.5 11.3 44.2 11.1 44.4 10.0 45.0 7.5 40.3 External secondary branch 5.7 26.9 4.5 26.0 7.8 27.8 4.0 19.9 6.3 29.1 7.8 31.9 5.5 23.3 8.4 33.5 7.1 29.0 4.2 24.1 6.2 26.5 5.5 22.4 4.8 26.8 6.4 30.3 4.5 23.7 8.0 32.7 10.2 42.4 4.5 23.3 9.0 35.1 4.4 23.7 4.5 28.6 6.4 25.2 6.2 25.4 7.3 32.3 9.0 34.9 7.7 30.2 8.8 35.3 6.6 29.5 4.4 23.8 Internal base 4.6 21.8 3.3 19.1 3.0 10.8 1.6 8.1 2.7 12.5 4.9 20.0 4.1 17.3 4.8 19.2 6.1 24.9 2.0 11.7 3.5 15.2 3.3 13.7 2.5 14.1 2.9 13.6 2.9 15.2 5.5 22.5 5.0 20.9 3.0 15.4 5.0 19.4 3.4 18.4 2.8 17.8 5.0 19.9 5.1 20.9 4.4 19.4 4.7 18.1 4.2 16.5 4.8 19.1 3.8 17.0 3.0 16.1 Internal primary branch 7.5 35.3 5.8 33.7 11.0 39.4 5.7 28.0 7.6 34.8 9.2 37.7 6.3 26.4 9.0 35.7 9.9 40.5 4.8 27.9 8.0 34.1 9.0 36.7 6.2 35.1 7.0 33.0 5.9 30.9 9.8 39.9 10.8 44.9 5.8 29.7 10.9 42.4 5.4 29.2 5.9 37.7 13.4 53.1 7.8 32.1 8.4 37.2 7.8 30.1 9.9 38.6 8.8 35.2 6.7 30.0 5.4 28.9 Internal secondary branch 5.7 26.8 3.9 22.2 8.0 28.5 3.2 15.8 5.7 26.2 5.8 23.8 4.9 20.7 5.6 22.2 7.4 30.4 3.0 17.6 5.4 23.1 5.2 21.2 3.6 20.1 4.7 22.4 4.0 20.8 7.0 28.5 7.4 30.8 2.7 14.1 7.3 28.5 3.7 19.8 3.9 24.8 6.7 26.4 5.0 20.5 6.7 29.4 6.7 26.1 6.8 26.5 6.4 25.6 5.7 25.3 3.8 20.6 Claw 3 heights External base 3.7 17.3 6.2 22.3 3.6 17.7 3.9 18.0 6.7 27.5 5.4 23.0 6.1 24.1 3.9 16.1 2.8 16.2 3.2 13.7 6.5 26.6 2.6 14.9 4.9 23.1 2.7 14.2 6.2 25.4 6.6 27.6 2.9 15.1 5.5 21.5 3.7 20.0 2.3 14.6 7.5 29.6 6.2 25.6 6.2 27.5 6.4 24.7 6.8 26.7 6.5 26.1 3.9 17.4 3.7 19.9 External primary branch 8.3 38.9 7.9 45.8 15.3 54.9 7.9 39.4 10.1 46.7 14.2 58.5 8.3 35.2 14.1 55.9 10.4 42.5 7.2 41.4 10.0 43.0 13.0 53.5 7.5 42.0 9.5 45.1 8.3 43.2 10.8 43.8 13.1 54.7 7.8 40.4 14.0 54.6 7.9 42.5 7.6 48.2 13.1 51.8 9.9 40.9 9.9 43.9 12.3 47.5 16.3 63.7 12.0 48.2 9.7 43.7 8.1 43.5 External secondary branch 4.2 19.8 5.1 29.7 8.8 31.4 4.5 22.3 6.6 30.6 8.0 32.7 5.8 24.6 8.5 33.6 6.8 27.7 4.1 23.6 6.0 25.6 6.8 28.0 4.3 24.4 6.9 32.9 5.1 26.5 8.7 35.5 9.1 38.2 4.8 25.0 8.4 32.8 4.7 25.3 3.9 24.8 8.8 34.8 7.3 30.1 7.7 34.0 9.0 35.0 9.8 38.3 9.6 38.3 6.1 27.4 4.7 25.2 Internal base 4.0 18.8 2.9 16.6 5.1 18.3 2.1 10.4 4.2 19.4 5.0 20.8 4.2 17.8 4.4 17.6 3.4 14.1 3.2 18.3 3.9 16.7 3.6 14.7 2.5 14.0 4.0 18.9 3.9 20.6 4.4 18.0 5.7 23.6 2.7 14.1 5.1 19.7 3.2 17.1 2.1 13.5 4.7 18.5 5.0 20.7 4.6 20.5 4.7 18.2 5.3 20.8 5.0 19.9 4.0 18.1 3.1 16.6 Internal primary branch 7.0 32.8 6.4 36.8 10.7 38.2 6.0 29.9 7.9 36.3 9.8 40.4 7.4 31.2 9.6 38.0 8.1 33.2 5.6 32.3 8.2 35.3 9.1 37.3 6.3 35.4 7.5 35.3 4.0 21.0 9.2 37.4 9.0 37.5 4.3 22.1 9.0 35.1 4.9 26.4 5.3 33.6 10.4 41.2 7.9 32.3 9.3 41.1 9.3 36.1 10.9 42.7 8.1 32.3 6.2 27.7 6.3 33.9 Internal secondary branch 4.1 19.1 3.7 21.1 5.9 21.2 3.7 18.5 6.7 30.7 7.3 30.1 4.5 18.9 7.3 29.2 5.9 24.1 3.8 21.8 5.1 21.8 4.5 18.3 3.7 20.5 5.1 23.9 3.5 18.3 6.7 27.4 7.7 32.0 2.6 13.2 7.0 27.4 4.0 21.5 4.1 25.7 6.9 27.3 5.8 23.7 6.2 27.6 6.7 26.0 7.5 29.3 7.3 29.1 4.9 22.1 4.2 22.5 Claw 4 lengths Anterior base 4.6 21.5 2.1 11.9 7.6 27.4 2.7 13.2 5.2 23.8 5.3 21.9 4.4 18.7 5.8 23.1 6.4 26.4 4.1 23.6 3.7 16.0 5.8 23.7 2.5 14.0 4.1 19.5 3.3 17.0 7.3 29.9 7.8 32.4 3.3 17.2 7.2 28.2 2.2 12.1 3.7 23.7 4.5 17.7 3.7 15.2 4.6 20.5 5.7 22.0 8.1 31.6 5.3 21.3 3.2 14.1 2.1 11.3 Anterior primary branch 7.9 37.0 5.8 33.4 15.1 54.0 6.4 31.6 8.6 39.8 10.2 42.0 7.2 30.2 10.1 40.1 10.1 41.5 5.7 33.1 8.7 37.2 10.0 40.9 7.2 40.3 8.6 40.5 4.9 25.4 9.8 39.8 10.1 42.0 5.9 30.7 12.2 47.8 6.6 35.4 6.0 38.3 12.1 47.7 9.9 40.9 9.5 42.1 10.9 42.3 14.1 54.9 11.3 45.1 8.0 35.7 6.4 34.7 Anterior secondary branch 5.3 24.8 3.8 21.8 9.0 32.0 4.7 23.2 7.1 32.6 8.0 32.9 4.9 20.6 7.7 30.6 7.8 32.2 4.6 26.6 6.6 28.2 7.7 31.4 4.5 25.4 5.9 27.9 3.1 16.0 4.4 18.0 7.8 32.4 3.5 18.3 7.9 30.8 3.3 17.7 4.3 27.3 4.9 19.5 6.6 27.0 5.0 21.9 5.3 20.4 10.8 42.0 6.6 26.2 3.7 16.7 4.1 21.9 Posterior base 5.9 27.6 2.5 14.5 9.6 34.2 4.3 21.1 6.1 28.2 7.3 30.1 4.8 20.2 6.8 27.0 7.0 28.6 4.3 24.9 5.5 23.7 7.0 28.5 5.0 28.2 5.0 23.7 3.3 17.4 7.7 31.3 7.5 31.3 4.2 21.7 7.8 30.6 2.2 11.7 3.4 21.6 6.7 26.7 5.8 23.8 4.6 20.2 6.8 26.2 9.0 35.0 5.4 21.7 3.6 16.1 2.0 10.6 Posterior primary branch 14.3 67.2 7.6 43.9 22.6 80.8 10.0 49.5 12.3 56.5 16.9 69.6 11.5 48.4 17.4 69.3 14.9 61.1 9.6 55.2 12.7 54.7 16.6 68.3 10.4 58.4 10.1 47.6 9.3 48.6 14.8 60.3 17.0 70.8 10.0 51.8 15.6 60.7 10.4 56.0 9.3 58.9 16.8 66.3 13.1 54.0 12.8 56.5 15.8 61.3 19.3 75.5 15.5 62.0 13.0 58.1 9.1 49.1 3363 Posterior secondary branch 7.6 35.6 4.5 25.7 10.0 35.8 6.2 30.6 8.0 36.9 8.5 35.0 5.9 24.9 8.4 33.3 9.5 39.0 5.6 32.5 8.5 36.4 8.1 33.3 5.8 32.9 6.9 32.6 4.5 23.5 7.9 32.0 9.6 39.9 3.8 19.4 8.2 31.9 3.6 19.5 4.9 31.2 6.8 26.8 6.5 26.9 6.8 30.1 9.3 35.9 11.4 44.6 7.7 31.0 5.6 24.9 5.4 29.0
3364
3365
3366
3367
3368
3369 176
3370 Table S4.34: Cuverville Island
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 185 978 191 1022 289 1269 169 751 204 907 195 945 205 949 185 863 237 824 231 1049 233 982 223 1062 248 1091 235 1204 248 1105 288 1179 201 905 210 961 224 1037 146 814 226 970 224 894 217 908 230 911 206 888 176 903 Buccopharyngeal tube Buccal tube length 19.0 – 18.6 – 22.8 – 22.5 – 22.5 – 20.7 – 21.6 – 21.4 – 28.7 – 22.1 – 23.8 – 21.0 – 22.8 – 19.5 – 22.5 – 24.4 – 22.2 – 21.9 – 21.6 – 17.9 – 23.3 – 25.1 – 23.9 – 25.3 – 23.2 – 19.5 – Stylet support insertion point 11.8 62.4 11.9 63.7 12.8 56.0 13.7 61.0 12.9 57.1 13.5 65.6 12.4 57.4 13.6 63.4 18.8 65.5 14.5 65.7 14.3 60.2 13.1 62.5 13.2 57.9 11.6 59.5 12.7 56.7 15.3 62.7 13.3 59.7 13.7 62.7 13.3 61.4 11.4 63.4 14.1 60.5 14.2 56.8 13.9 58.4 15.6 61.7 13.7 59.1 11.2 57.5 Buccal tube external width 2.1 11.1 2.3 12.2 2.7 11.6 2.5 11.1 1.3 5.7 2.8 13.7 2.6 11.8 2.6 12.0 3.4 11.9 3.3 14.7 2.9 12.2 3.2 15.1 3.7 16.0 2.3 11.7 2.9 13.0 4.3 17.5 2.4 10.8 2.5 11.4 3.0 14.1 2.1 12.0 3.0 12.7 2.7 10.9 2.8 11.7 2.8 11.1 2.6 11.0 2.7 13.7 Buccal tube internal width 0.6 3.3 0.8 4.5 1.3 5.5 1.1 5.0 2.7 11.8 1.3 6.3 0.9 4.3 1.2 5.7 1.6 5.6 1.4 6.3 1.3 5.6 1.4 6.8 2.0 8.6 0.7 3.4 1.3 6.0 2.8 11.3 1.0 4.3 1.0 4.4 1.6 7.3 0.7 3.8 1.1 4.9 1.2 4.7 0.9 3.9 1.0 3.8 1.3 5.4 0.8 4.0 Placoid lengths Macroplacoid 1 3.6 18.8 3.3 17.9 4.1 17.8 3.6 15.9 4.2 18.7 3.9 19.0 3.8 17.6 3.8 17.6 3.7 12.7 4.6 21.0 5.2 21.9 3.9 18.8 3.6 15.8 3.1 16.0 3.4 15.3 5.7 23.3 4.1 18.5 4.1 18.8 3.5 16.1 3.1 17.5 4.0 17.2 5.2 20.9 4.2 17.4 4.9 19.3 4.7 20.1 3.4 17.3 Macroplacoid 2 2.3 12.2 2.8 14.9 3.5 15.2 3.7 16.4 3.8 16.8 3.4 16.2 3.3 15.2 3.0 13.9 3.3 11.4 3.8 17.2 4.0 16.9 3.2 15.2 3.1 13.5 3.3 16.7 3.0 13.4 4.0 16.2 3.0 13.6 2.8 12.7 3.0 13.9 2.2 12.1 3.9 16.8 3.4 13.6 3.5 14.7 3.7 14.8 3.4 14.6 2.6 13.4 Macroplacoid row 7.1 37.4 7.3 38.9 8.8 38.5 8.6 38.1 9.4 41.6 7.9 38.3 8.8 40.5 7.5 35.0 10.6 36.7 9.6 43.7 10.4 43.6 8.1 38.7 8.2 36.2 7.8 40.0 7.9 35.0 10.0 41.1 9.1 41.0 8.4 38.3 8.3 38.4 6.9 38.6 8.6 37.0 9.5 37.9 9.3 39.1 9.6 37.8 10.0 43.0 7.2 37.0 Claw 1 heights External base 2.6 13.9 3.4 18.0 4.5 19.7 2.1 9.5 2.7 11.8 2.2 10.7 2.4 11.2 3.8 17.9 3.1 10.7 2.7 12.1 6.2 26.2 3.2 15.0 2.6 11.4 3.1 16.1 2.4 10.6 5.1 20.7 2.0 9.1 1.8 8.4 3.4 15.7 2.6 14.2 2.8 11.9 3.3 13.0 2.6 10.9 4.5 19.5 2.7 14.0 External primary branch 5.7 30.1 6.6 35.4 8.3 36.4 7.3 32.5 5.7 25.2 6.1 29.5 6.5 30.0 6.6 30.8 9.0 31.2 7.5 33.8 9.1 38.3 7.2 34.2 7.2 31.8 6.9 35.4 7.5 33.2 8.1 33.1 7.5 33.8 5.9 27.0 7.7 35.4 5.8 32.6 8.0 34.4 8.0 32.0 7.1 29.7 7.1 30.7 6.0 30.6 External secondary branch 3.7 19.7 4.6 24.9 6.4 28.2 4.9 21.6 4.2 18.7 4.0 19.5 3.6 16.7 4.7 21.8 5.7 19.7 3.8 17.0 6.2 26.1 5.1 24.1 4.8 20.9 4.0 20.2 4.7 21.0 5.4 22.3 4.9 21.9 3.8 17.6 5.5 25.3 3.7 20.8 5.4 23.2 4.9 19.6 4.8 20.0 5.4 23.2 4.6 23.5 Internal base 2.4 12.7 2.5 13.5 2.8 12.4 2.0 9.0 2.2 9.7 2.0 9.6 2.1 9.8 2.5 11.5 3.8 13.1 3.6 16.2 4.6 19.4 2.5 11.7 2.4 10.4 3.1 16.0 2.3 10.1 5.6 22.8 2.2 10.1 2.4 10.8 3.1 14.3 2.1 11.6 3.9 16.8 2.8 11.2 2.6 11.0 4.2 16.4 3.4 14.5 3.0 15.5 Internal primary branch 4.8 25.3 4.9 26.1 6.6 29.0 6.1 27.0 4.6 20.5 5.7 27.6 6.2 28.8 5.9 27.5 5.9 20.6 6.3 28.4 7.4 31.3 5.6 26.7 5.9 26.0 6.7 34.0 6.6 29.4 7.9 32.3 5.8 26.3 5.2 23.6 6.1 28.1 4.9 27.6 6.3 27.2 6.0 23.8 6.2 25.8 7.0 27.5 5.6 24.1 5.0 25.8 Internal secondary branch 2.6 13.5 3.5 18.8 5.6 24.5 4.1 18.3 3.5 15.6 3.3 16.1 3.4 15.9 3.1 14.3 4.6 15.9 3.2 14.3 5.0 20.9 3.0 14.0 4.0 17.5 4.2 21.6 3.7 16.3 4.5 18.3 4.4 19.6 3.3 15.1 4.3 19.9 2.8 15.5 4.2 17.9 3.7 14.7 5.3 22.0 5.1 20.3 4.7 20.4 3.9 19.9 Claw 2 heights External base 3.1 16.2 4.2 22.3 4.6 20.1 3.7 16.3 2.5 11.0 2.6 12.5 3.2 14.7 3.3 15.3 4.5 15.5 2.2 10.0 5.8 24.5 3.1 14.7 4.7 20.4 3.2 16.1 4.0 18.0 5.5 22.3 2.7 12.0 4.4 19.9 3.5 16.1 2.8 15.7 2.7 11.6 1.9 7.7 3.4 14.4 3.4 13.4 3.3 14.2 3.3 17.2 External primary branch 7.7 40.3 8.6 46.1 10.7 47.0 7.6 33.8 7.5 33.4 7.1 34.5 9.2 42.7 8.3 38.6 9.9 34.5 8.0 36.4 9.4 39.7 8.5 40.3 8.6 37.6 7.7 39.4 8.2 36.3 8.0 32.6 7.0 31.7 7.8 35.9 8.7 40.4 6.3 35.3 8.1 34.8 8.2 32.6 8.9 37.3 8.9 35.1 8.7 37.4 7.3 37.5 External secondary branch 4.2 22.3 3.9 20.7 6.6 28.9 4.9 21.6 4.0 17.8 3.9 19.0 5.3 24.4 3.2 14.9 5.5 19.1 5.8 26.4 7.9 33.2 5.1 24.2 6.4 28.1 4.9 25.2 5.9 26.1 6.2 25.5 6.3 28.5 4.9 22.3 5.5 25.3 4.7 26.0 5.8 24.9 5.4 21.3 5.6 23.4 4.9 19.5 6.0 25.6 4.5 23.1 Internal base 3.4 18.0 3.9 17.0 4.3 19.0 2.3 10.0 2.3 11.0 2.9 13.2 2.5 11.5 4.1 14.4 2.9 13.2 4.8 20.0 2.2 10.7 3.2 14.1 4.0 20.6 3.1 13.9 5.6 22.9 2.6 11.5 2.8 12.6 3.9 17.9 1.9 10.4 2.5 10.7 2.3 9.0 3.3 13.7 3.2 12.5 3.6 15.6 2.7 13.7 Internal primary branch 5.4 28.7 7.7 33.7 6.0 26.8 5.9 26.2 6.3 30.6 6.7 31.0 5.9 27.7 6.8 23.8 6.6 30.0 8.9 37.4 6.4 30.4 5.2 23.0 6.5 33.5 6.3 27.9 6.7 27.3 6.6 29.8 6.0 27.6 7.3 33.8 4.8 26.6 7.1 30.3 6.9 27.5 7.4 30.8 6.6 26.2 6.3 27.3 6.1 31.1 Internal secondary branch 3.4 17.7 3.5 15.5 4.0 18.0 4.2 18.7 3.9 19.1 4.5 20.6 3.1 14.6 3.7 12.8 5.2 23.7 4.8 20.0 4.3 20.4 3.4 15.1 4.3 22.0 4.4 19.7 4.4 18.0 4.6 20.5 4.1 18.6 5.0 23.0 3.4 18.8 5.0 21.6 4.6 18.3 5.1 21.2 5.1 20.0 5.3 22.8 3.7 19.1 Claw 3 heights External base 3.3 17.2 3.1 16.6 2.8 12.3 4.2 18.6 2.8 12.6 2.6 12.7 5.7 26.2 3.3 15.3 5.7 19.8 3.3 15.0 6.3 26.4 4.8 22.6 2.6 11.3 4.8 24.6 4.8 21.6 6.4 26.3 5.5 24.9 3.8 17.2 4.7 21.7 3.1 17.5 5.6 24.0 3.1 12.2 2.9 12.0 2.9 11.4 5.2 22.5 1.9 9.8 External primary branch 7.5 39.5 7.0 37.7 9.7 42.7 8.7 38.9 8.1 35.8 6.9 33.6 9.1 42.2 8.6 40.1 9.2 31.9 9.0 40.7 10.2 43.1 8.8 41.7 6.5 28.5 8.0 40.8 8.7 38.6 7.0 28.8 9.8 44.1 7.8 35.7 8.6 40.0 6.5 36.4 7.6 32.8 7.6 30.1 9.6 40.4 8.5 33.5 8.9 38.5 5.7 29.0 External secondary branch 4.3 22.9 4.4 23.8 5.6 24.7 5.1 22.8 4.0 17.9 3.6 17.5 7.0 32.3 5.3 24.9 7.0 24.3 6.2 28.2 7.6 32.0 5.9 28.1 3.4 14.9 6.1 31.1 5.0 22.0 5.7 23.5 6.8 30.8 6.1 27.7 3.2 14.6 3.9 21.9 6.0 25.8 5.9 23.4 5.7 23.8 5.5 21.7 6.4 27.3 3.8 19.5 Internal base 2.5 13.3 3.3 17.5 3.8 16.9 3.5 15.5 2.6 11.7 2.2 10.7 3.5 16.2 3.2 14.8 4.3 14.8 3.6 16.2 3.9 16.4 2.7 12.7 2.5 10.8 3.8 19.2 3.1 13.7 5.1 20.7 2.9 13.0 2.7 12.4 4.3 19.9 3.0 16.8 2.9 11.5 2.8 11.7 3.1 12.2 4.1 17.8 1.6 8.3 Internal primary branch 5.2 27.4 6.0 32.3 7.8 34.4 7.2 32.1 6.7 29.6 6.5 31.5 6.2 28.7 5.8 27.2 7.4 25.8 6.8 30.9 8.0 33.8 6.7 31.8 6.2 27.0 6.3 32.2 6.2 27.6 5.9 24.1 7.0 31.5 5.7 25.9 5.2 23.9 5.0 27.8 6.3 25.1 7.0 29.3 6.2 24.5 7.2 30.8 5.5 28.4 Internal secondary branch 3.7 19.6 4.1 21.9 4.3 18.8 4.7 21.0 4.1 18.3 3.2 15.4 4.5 20.9 4.6 21.4 6.0 21.0 4.3 19.5 5.5 23.2 3.8 17.9 3.6 15.6 5.1 26.3 4.9 21.6 5.3 21.7 4.4 19.6 5.2 23.8 3.2 17.7 4.9 19.6 5.5 23.1 5.2 20.4 5.4 23.3 3.6 18.5 Claw 4 lengths Anterior base 2.2 11.7 3.4 18.4 4.9 21.5 3.4 15.3 3.3 14.6 2.7 13.2 2.7 12.5 3.0 14.1 3.3 11.6 4.9 22.3 5.0 20.9 2.5 11.8 3.8 16.9 2.8 14.4 4.6 20.5 3.5 14.4 3.3 15.0 4.5 20.4 3.4 15.7 2.3 13.0 3.0 12.9 3.4 13.7 3.4 14.4 3.8 15.2 3.9 16.9 3.0 15.3 Anterior primary branch 5.8 30.5 6.6 35.2 8.5 37.1 6.7 29.9 7.0 31.1 6.4 30.9 7.6 35.3 7.2 33.5 7.5 26.0 7.7 34.9 8.2 34.5 6.6 31.5 6.6 28.9 7.7 39.2 7.0 31.0 7.5 30.8 7.5 33.7 6.8 31.1 7.0 32.2 5.4 30.2 6.9 29.5 7.4 29.3 7.7 32.3 6.7 26.4 7.6 32.6 5.9 30.1 Anterior secondary branch 4.1 21.7 2.9 15.6 5.6 24.4 4.9 21.9 4.6 20.3 4.0 19.4 4.0 18.5 3.1 14.4 4.0 13.8 4.6 21.0 6.4 27.1 3.8 17.9 3.8 16.7 4.2 21.2 3.7 16.4 5.1 20.8 5.2 23.4 4.1 18.8 3.7 17.1 3.4 18.9 4.6 19.7 4.9 19.4 4.8 20.1 4.4 17.5 6.3 27.2 3.1 15.9 Posterior base 3.3 17.5 3.0 16.0 4.4 19.4 3.7 16.3 4.5 20.1 3.1 14.8 4.9 22.4 3.3 15.2 4.5 15.6 4.4 19.9 7.4 31.2 3.6 17.2 4.5 19.7 3.5 17.8 5.6 24.9 2.7 11.1 4.2 18.9 3.4 15.7 3.5 16.2 2.7 15.1 3.5 15.0 4.9 19.4 3.3 13.8 2.6 10.4 4.6 20.0 3.5 18.2 Posterior primary branch 9.9 52.3 9.7 52.1 11.8 51.6 10.2 45.4 10.5 46.5 10.3 50.0 11.5 53.0 9.5 44.4 11.1 38.8 9.8 44.6 13.0 54.6 10.5 49.9 10.2 44.8 10.3 52.8 10.1 44.8 11.3 46.4 11.6 52.1 9.6 44.0 10.3 47.5 8.1 45.2 9.7 41.8 10.4 41.4 11.3 47.3 10.1 40.0 10.2 44.1 8.8 44.9 3371 Posterior secondary branch 4.0 20.9 2.6 14.2 8.5 37.4 6.0 26.5 6.1 27.2 4.2 20.2 6.0 27.6 3.7 17.2 4.5 15.8 6.8 30.8 7.8 33.0 5.3 25.4 3.2 14.0 5.4 27.5 5.0 22.0 5.7 23.2 6.0 26.9 6.1 27.7 4.9 22.5 4.0 22.3 7.0 30.1 6.3 25.0 5.8 24.1 5.2 20.7 5.1 21.8 4.8 24.7
3372
3373
3374
3375
3376
177
3377 Raw morphometric measurement data for Mesobiotus furciger used in this study.
3378 Table S4.35: Reinbolt Hills
SPECIMEN 1 (HOL) 2 3 4 CHARACTER µm pt µm pt µm pt µm pt Body length 233 695 274 764 241 565 268 721 Buccopharyngeal tube Buccal tube length 33.5 – 35.8 – 42.7 – 37.2 – Stylet support insertion point 26.1 77.9 28.7 80.3 33.2 77.8 28.7 77.0 Buccal tube external width 5.9 17.7 6.8 18.9 6.6 15.4 6.9 18.4 Buccal tube internal width 3.8 11.5 5.0 14.0 5.2 12.3 5.4 14.4 Ventral lamina length 14.4 43.0 16.8 46.9 26.1 61.2 14.2 38.2 Placoid lengths Macroplacoid 1 6.3 18.8 7.9 22.1 6.3 14.7 8.6 23.1 Macroplacoid 2 6.0 17.8 3.9 10.8 4.9 11.5 5.7 15.4 Macroplacoid 3 5.5 16.5 5.2 14.4 5.5 12.8 6.0 16.0 Microplacoid 2.7 8.0 2.6 7.1 2.5 5.8 2.3 6.2 Macroplacoid row 20.1 60.1 19.4 54.2 18.8 44.0 23.3 62.5 Placoid row 23.6 70.3 21.9 61.2 22.9 53.6 26.3 70.7 Claw 1 lengths External base 4.0 12.0 3.4 9.5 3.4 7.9 External primary branch 9.0 26.8 8.8 24.5 7.5 17.6 External secondary branch 5.1 15.3 6.8 19.1 4.5 10.6 Internal base 3.0 8.9 4.8 13.5 Internal primary branch 6.9 20.6 7.7 21.4 Internal secondary branch 5.4 16.1 4.0 11.2 Claw 2 lengths External base 5.3 15.8 5.0 13.8 4.9 11.4 5.9 15.9 External primary branch 9.0 26.8 6.6 18.4 8.2 19.2 8.4 22.5 External secondary branch 6.6 19.6 5.6 15.7 4.4 10.4 5.8 15.6 Internal base 3.9 10.3 Internal primary branch 7.5 22.4 7.9 21.2 Internal secondary branch 4.7 14.0 5.4 14.5 Claw 3 lengths External base External primary branch External secondary branch Internal base Internal primary branch Internal secondary branch Claw 4 lengths Anterior base 3.2 9.0 Anterior primary branch 13.1 39.2 7.9 22.2 Anterior secondary branch 8.1 24.2 5.0 14.1 Posterior base 4.1 11.5 6.3 14.7 Posterior primary branch 13.5 40.3 9.6 26.7 9.4 22.0 9.7 26.1 3379 Posterior secondary branch 7.4 22.2 6.5 18.1 5.6 13.2 5.3 14.3
3380 178
3381 Table S4.36: Mawson Escarpment 1
SPECIMEN 1 (HOL) 2 3 4 5 6 7 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 201 638 197 579 188 639 132 490 172 597 164 550 264 717 Buccopharyngeal tube Buccal tube length 31.5 – 34.0 – 29.4 – 26.9 – 28.9 – 29.8 – 36.9 – Stylet support insertion point 21.2 67.3 23.9 70.3 19.4 65.9 19.1 71.1 19.3 66.9 20.9 70.3 24.0 64.9 Buccal tube external width 3.2 10.1 3.8 11.3 3.2 10.9 2.2 8.1 3.1 10.7 2.9 9.7 3.7 10.0 Buccal tube internal width 1.5 4.6 2.3 6.7 1.5 4.9 0.8 2.9 1.5 5.3 1.6 5.3 1.8 4.9 Ventral lamina length 16.8 53.2 17.7 52.2 13.6 46.4 13.3 49.4 12.1 40.5 17.4 47.1 Placoid lengths Macroplacoid 1 3.8 12.2 3.7 10.8 3.6 12.3 2.8 10.6 3.6 12.4 3.2 10.6 3.6 9.7 Macroplacoid 2 2.6 8.1 2.8 8.2 3.0 10.2 2.7 10.2 2.6 9.1 2.8 9.3 3.0 8.1 Macroplacoid 3 3.8 12.0 2.7 7.9 3.1 10.5 2.2 8.1 3.0 10.3 2.6 8.8 3.5 9.5 Microplacoid 2.0 6.3 1.9 5.5 2.1 7.1 1.7 6.3 1.6 5.5 1.5 5.1 2.1 5.7 Macroplacoid row 12.0 38.1 11.5 33.8 10.7 36.5 8.3 30.8 11.1 38.5 9.7 32.7 13.3 36.1 Placoid row 14.1 44.6 13.4 39.4 13.2 45.0 9.3 34.7 12.9 44.6 12.1 40.6 15.2 41.3 Claw 1 lengths External base 3.5 10.9 3.1 9.0 3.7 12.5 3.6 13.5 3.9 13.4 4.3 14.3 External primary branch 5.9 18.6 4.2 12.3 7.1 24.3 4.3 15.9 7.2 24.7 4.2 13.9 External secondary branch 3.7 11.6 4.3 14.8 3.3 12.4 5.0 17.2 3.0 10.1 Internal base 3.7 11.7 3.3 11.3 2.1 7.8 3.4 11.8 3.4 11.3 Internal primary branch 4.9 15.6 5.2 17.7 3.3 12.2 6.1 21.2 3.3 11.0 Internal secondary branch 3.6 11.4 4.6 15.6 2.6 9.6 4.9 16.9 2.9 9.9 Claw 2 lengths External base 3.9 12.3 2.6 7.7 3.2 11.0 2.7 10.1 2.6 8.8 2.4 8.1 External primary branch 4.4 14.1 4.8 14.0 6.6 22.6 3.9 14.4 6.8 23.7 6.1 20.5 External secondary branch 4.2 13.4 4.9 16.8 3.4 12.8 5.3 18.2 4.4 14.7 Internal base 3.8 12.0 3.0 8.8 2.9 9.7 2.7 9.9 3.6 12.4 2.1 6.9 Internal primary branch 4.5 14.2 3.7 11.0 6.6 22.4 3.2 12.1 5.7 19.6 5.7 19.2 Internal secondary branch 3.6 11.5 3.5 10.3 5.1 17.5 3.0 11.1 4.7 16.2 3.7 12.3 Claw 3 lengths External base 3.6 11.5 3.1 9.1 3.8 13.0 2.8 10.3 3.1 10.6 3.3 11.1 3.5 9.4 External primary branch 4.4 14.0 5.1 14.9 6.4 21.9 3.8 14.1 6.3 21.8 6.3 21.2 7.8 21.2 External secondary branch 3.7 11.9 3.4 10.1 4.9 16.6 2.9 10.8 4.7 16.1 4.5 15.1 5.2 14.2 Internal base 3.5 11.0 3.3 9.7 2.8 9.7 2.8 10.3 2.9 10.0 2.0 6.9 3.0 8.2 Internal primary branch 4.0 12.7 4.8 14.0 5.8 19.9 3.3 12.4 5.8 19.9 4.7 15.9 9.0 24.4 Internal secondary branch 3.6 11.3 4.0 11.7 4.5 15.2 2.9 10.8 5.3 18.2 4.2 13.9 7.3 19.7 Claw 4 lengths Anterior base 3.2 10.3 2.6 7.8 3.6 12.3 4.1 15.2 4.0 13.8 3.1 10.3 4.1 11.1 Anterior primary branch 6.0 18.9 5.2 15.2 5.9 20.0 5.0 18.6 5.3 18.2 7.0 23.5 9.1 24.6 Anterior secondary branch 4.3 13.8 3.8 11.3 4.0 13.6 3.8 14.1 4.2 14.6 5.4 18.1 6.6 17.8 Posterior base 3.9 12.2 3.2 9.3 4.4 15.0 4.3 16.0 4.3 14.9 3.1 10.3 3.7 10.1 Posterior primary branch 7.2 22.9 5.2 15.2 6.2 21.0 5.2 19.5 5.7 19.8 8.0 26.8 9.2 24.8 3382 Posterior secondary branch 4.7 14.9 3.9 11.3 4.9 16.8 4.4 16.5 5.6 19.3 5.7 19.3 6.7 18.0
3383 179
3384 Table S4.37: Mawson Escarpment 2
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 328 771 253 586 462 972 271 648 139 503 278 658 310 703 246 564 180 560 150 446 Buccopharyngeal tube Buccal tube length 42.5 – 43.1 – 47.5 – 41.8 – 27.7 – 42.2 – 44.1 – 43.6 – 32.2 – 33.7 – Stylet support insertion point 32.6 76.7 34.9 81.1 37.9 79.7 32.5 77.7 21.7 78.5 33.0 78.2 35.7 80.9 35.2 80.8 25.7 79.9 26.6 78.8 Buccal tube external width 8.3 19.6 7.2 16.7 9.3 19.6 6.2 14.9 4.8 17.3 6.8 16.1 7.8 17.7 7.6 17.4 4.9 15.2 5.1 15.1 Buccal tube internal width 6.2 14.6 5.6 13.0 6.7 14.2 4.7 11.3 3.2 11.4 4.7 11.2 6.1 13.8 5.4 12.4 3.2 9.9 3.3 9.8 Ventral lamina length 22.8 53.7 28.0 65.1 26.5 55.7 24.7 59.2 16.6 59.9 22.9 54.3 27.1 61.4 25.9 59.4 16.8 52.1 17.6 52.1 Placoid lengths Macroplacoid 1 6.6 15.6 7.2 16.7 7.5 15.7 5.9 14.0 4.1 14.8 5.9 13.9 8.0 18.2 7.6 17.4 4.0 12.3 4.8 14.1 Macroplacoid 2 5.6 13.1 5.1 11.7 7.4 15.5 4.7 11.3 3.3 12.0 5.3 12.6 5.7 12.9 6.1 14.1 3.3 10.3 4.4 13.1 Macroplacoid 3 7.7 18.2 6.3 14.6 9.3 19.6 5.9 14.0 4.0 14.5 6.3 15.0 6.3 14.2 5.3 12.2 4.0 12.3 3.3 9.9 Microplacoid 3.5 8.2 4.0 9.2 4.6 9.7 3.7 8.7 2.0 7.1 3.7 8.4 3.3 7.6 2.0 6.3 2.4 7.0 Macroplacoid row 21.9 51.6 21.2 49.3 27.6 58.1 19.5 46.7 12.3 44.3 18.9 44.9 22.5 51.0 20.8 47.6 13.8 42.9 14.1 41.7 Placoid row 26.3 61.8 25.8 59.9 33.2 69.9 23.5 56.2 14.7 53.2 27.0 61.3 24.7 56.6 16.8 52.3 16.8 50.0 Claw 1 lengths External base 4.4 10.4 4.8 11.1 4.0 9.5 4.3 9.7 5.0 11.5 3.8 11.8 3.4 10.0 External primary branch 8.2 19.3 8.9 20.6 13.2 27.8 9.1 21.8 9.8 22.2 9.4 21.6 6.3 19.6 6.8 20.2 External secondary branch 5.8 13.6 6.8 15.8 12.0 25.3 6.7 16.0 6.5 14.8 7.6 17.4 4.5 13.8 4.1 12.1 Internal base 4.0 9.5 4.3 10.1 3.7 7.9 3.9 9.3 4.0 9.2 3.7 8.4 4.0 12.5 4.8 14.2 Internal primary branch 7.1 16.6 7.8 18.2 10.6 22.2 8.7 20.9 8.3 18.9 7.1 16.3 6.3 19.6 6.5 19.2 Internal secondary branch 5.4 12.8 5.1 11.9 8.5 17.8 6.7 16.1 5.3 12.2 4.7 14.5 4.5 13.4 Claw 2 lengths External base 4.2 9.8 5.1 11.9 3.7 7.7 2.8 6.6 3.0 10.7 3.6 8.2 3.6 8.1 2.7 8.2 3.4 10.1 External primary branch 9.6 22.6 9.5 22.1 12.2 25.6 7.0 16.7 6.0 21.5 11.6 26.2 8.6 19.6 6.7 20.7 7.7 22.9 External secondary branch 7.1 16.6 6.8 15.7 8.4 17.6 6.3 15.0 3.8 13.6 7.0 15.9 6.8 15.5 5.0 15.6 5.8 17.1 Internal base 4.0 9.3 4.5 10.5 4.0 8.4 3.8 9.0 4.7 17.1 3.9 8.7 3.1 7.1 Internal primary branch 8.7 20.6 8.9 20.6 10.9 22.9 6.9 16.5 5.8 21.0 9.4 21.4 7.7 17.8 5.8 18.2 Internal secondary branch 7.4 17.5 4.9 11.3 7.8 16.3 5.3 12.6 3.5 12.6 6.5 14.7 5.8 13.3 Claw 3 lengths External base 4.2 9.8 5.2 12.1 4.9 10.4 4.8 11.4 4.3 9.8 4.2 9.7 3.5 10.8 3.1 9.2 External primary branch 10.2 24.0 9.8 22.7 11.1 23.4 9.2 22.1 11.0 24.8 8.3 19.1 6.4 20.0 6.9 20.4 External secondary branch 7.4 17.4 8.3 19.2 9.8 20.7 6.0 14.3 7.3 16.5 6.8 15.5 5.5 17.2 4.7 13.9 Internal base 3.9 9.2 4.7 10.9 4.2 8.9 6.0 14.3 3.2 7.4 Internal primary branch 8.1 19.0 9.0 20.9 10.6 22.3 8.6 20.6 9.0 20.4 7.1 16.3 Internal secondary branch 5.6 13.3 5.6 12.9 8.4 17.6 6.4 15.3 5.7 13.1 Claw 4 lengths Anterior base 5.2 12.1 4.1 9.5 4.2 8.8 4.5 10.8 4.3 15.7 4.3 9.8 5.3 12.1 3.0 9.2 3.7 11.1 Anterior primary branch 12.6 29.8 9.4 21.9 12.5 26.3 9.4 22.6 6.7 24.2 11.8 26.7 9.9 22.6 7.5 23.3 7.6 22.6 Anterior secondary branch 8.1 19.0 7.1 16.4 8.8 18.6 5.6 13.5 4.0 14.5 7.4 16.8 7.4 17.0 5.0 15.4 4.5 13.5 Posterior base 7.6 17.8 5.1 11.7 5.7 11.9 3.5 8.4 3.9 13.9 5.8 13.2 5.3 12.1 2.9 8.9 4.0 12.0 Posterior primary branch 12.7 29.8 9.7 22.6 13.7 28.8 10.8 25.8 6.9 25.1 12.8 29.0 10.5 24.0 8.0 24.7 9.3 27.5 3385 Posterior secondary branch 8.7 20.4 7.0 16.2 12.1 25.4 7.0 16.7 4.5 16.1 8.7 19.8 7.2 16.4 5.0 15.5 6.5 19.4
3386
3387 180
3388 Table S4.38: Lake Terrasovoe, Prince Charles Mountains 1
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 272 730 222 592 94 426 132 490 378 878 384 878 123 436 272 601 154 547 251 641 233 611 Buccopharyngeal tube Buccal tube length 37.3 – 37.6 – 22.0 – 27.0 – 43.0 – 43.7 – 28.3 – 45.4 – 28.1 – 39.2 – 38.2 – Stylet support insertion point 29.5 78.9 28.6 76.0 16.8 76.4 20.9 77.5 34.1 79.4 33.5 76.7 21.7 76.9 34.7 76.4 22.0 78.0 31.3 80.0 29.8 78.0 Buccal tube external width 7.1 19.0 7.0 18.7 4.4 20.1 5.1 18.8 8.6 20.0 7.8 17.9 5.0 17.8 8.7 19.3 5.0 17.6 6.4 16.4 7.2 18.8 Buccal tube internal width 5.0 13.4 5.1 13.4 2.7 12.1 3.3 12.3 6.6 15.3 5.9 13.4 3.7 13.1 5.3 11.6 3.3 11.6 4.5 11.4 5.3 13.8 Ventral lamina length 22.0 58.8 18.9 50.4 10.5 47.6 14.1 52.1 23.7 55.1 24.2 55.4 13.2 46.8 21.6 47.7 15.3 54.5 19.8 50.6 19.8 51.9 Placoid lengths Macroplacoid 1 4.8 12.8 5.9 15.8 3.6 16.3 3.5 12.9 7.7 17.8 6.5 14.9 4.0 14.0 7.7 17.0 3.8 13.6 5.6 14.4 6.2 16.2 Macroplacoid 2 3.9 10.4 4.8 12.8 3.3 15.1 3.6 13.2 6.5 15.0 5.3 12.0 3.9 13.9 5.7 12.6 3.9 14.0 5.4 13.8 5.5 14.3 Macroplacoid 3 4.9 13.2 5.4 14.5 3.0 13.6 2.8 10.3 7.7 18.0 6.3 14.3 3.7 13.1 6.6 14.6 4.0 14.1 5.6 14.2 5.8 15.3 Microplacoid 2.9 7.7 3.1 8.1 1.4 6.2 1.8 6.6 3.9 9.0 2.7 6.2 2.3 8.1 3.1 6.7 1.7 6.0 3.0 7.6 3.4 8.9 Macroplacoid row 18.5 49.6 18.3 48.6 10.7 48.8 12.5 46.3 25.1 58.4 21.0 47.9 12.8 45.3 21.8 48.1 14.5 51.5 18.7 47.8 19.2 50.3 Placoid row 22.8 61.1 22.2 59.0 12.4 56.6 14.8 54.8 30.0 69.7 25.9 59.2 15.5 54.9 26.1 57.6 17.2 61.2 22.1 56.4 23.7 61.9 Claw 1 lengths External base 6.1 16.2 5.8 13.4 3.9 8.6 2.3 8.3 4.3 11.1 External primary branch 8.0 21.5 4.7 21.3 7.3 17.0 10.1 23.2 5.5 19.6 10.7 23.5 5.6 19.8 6.8 17.2 7.1 18.6 External secondary branch 4.7 12.6 3.2 14.7 5.0 11.7 6.0 13.8 7.1 15.6 4.2 15.0 5.1 13.0 5.3 13.8 Internal base 4.6 12.4 4.9 11.2 2.5 8.7 4.0 8.8 3.8 13.5 4.4 11.5 Internal primary branch 6.7 18.0 3.7 16.9 6.5 15.2 8.2 18.6 4.5 15.7 10.2 22.5 4.5 16.1 6.6 17.4 Internal secondary branch 3.2 8.6 2.7 12.1 4.7 11.0 5.4 12.3 3.0 10.7 7.3 16.1 3.0 10.5 6.1 16.0 Claw 2 lengths External base 4.2 11.1 3.2 8.6 3.0 13.6 2.9 10.7 5.8 13.4 5.0 11.5 2.5 8.9 3.2 7.1 3.6 12.6 5.5 14.0 5.0 13.2 External primary branch 9.4 25.2 6.0 16.1 4.8 21.9 7.0 25.8 12.6 29.3 9.1 20.8 5.5 19.3 10.9 23.9 7.1 25.3 8.8 22.6 8.7 22.8 External secondary branch 7.5 20.1 4.2 11.2 3.4 15.6 4.3 16.0 8.6 20.0 6.1 13.9 4.1 14.4 6.5 14.4 3.8 13.6 7.6 19.5 5.2 13.5 Internal base 4.5 11.9 3.0 13.8 3.2 11.7 5.7 13.2 4.5 10.4 2.9 10.2 2.9 6.5 2.7 9.5 6.3 16.1 4.1 10.8 Internal primary branch 7.7 20.5 4.2 19.1 5.3 19.8 10.9 25.3 8.1 18.5 5.0 17.8 9.7 21.5 5.7 20.1 7.3 18.6 7.1 18.6 Internal secondary branch 3.8 10.1 3.5 15.8 6.3 14.6 6.0 13.8 4.0 14.1 5.8 12.8 3.2 11.5 5.7 14.5 5.0 13.1 Claw 3 lengths External base 6.0 16.0 3.5 12.9 2.3 5.0 2.2 7.9 5.4 13.9 4.6 12.0 External primary branch 9.6 25.8 4.6 20.7 7.3 27.2 6.7 23.8 9.1 20.1 6.5 23.1 9.7 24.8 8.0 21.0 External secondary branch 6.3 16.7 3.5 15.8 4.1 15.1 5.1 17.9 7.6 16.8 4.5 16.0 7.5 19.1 5.8 15.3 Internal base 3.8 10.1 3.5 13.0 2.5 5.5 3.7 13.3 4.8 12.3 5.1 13.3 Internal primary branch 9.2 24.6 4.4 20.1 5.8 21.5 7.3 16.1 6.5 23.0 9.5 24.2 6.6 17.4 Internal secondary branch 4.9 13.0 2.8 12.6 4.6 16.9 5.9 13.0 4.3 15.3 7.2 18.3 5.8 15.1 Claw 4 lengths Anterior base 5.8 15.6 4.2 11.1 3.0 13.5 4.3 15.9 4.1 9.5 4.6 10.5 2.8 10.0 6.4 14.0 3.8 13.4 4.6 12.1 Anterior primary branch 8.6 22.9 6.3 16.8 6.6 30.1 6.0 22.2 10.4 24.2 8.5 19.3 7.0 24.9 10.0 21.9 6.2 21.9 11.4 29.1 8.2 21.4 Anterior secondary branch 5.3 14.1 5.7 15.1 4.5 20.7 4.2 15.5 7.0 16.3 5.3 12.1 3.9 13.8 7.4 16.3 4.0 14.1 6.0 15.4 5.5 14.5 Posterior base 4.0 10.7 3.7 9.9 3.9 17.8 3.7 13.6 5.4 12.6 4.6 10.4 3.4 12.0 4.2 9.2 4.2 11.0 Posterior primary branch 9.0 24.1 8.2 21.7 7.8 35.5 7.9 29.1 10.9 25.2 8.8 20.1 7.1 25.2 10.2 22.6 7.8 27.8 14.0 35.8 9.0 23.6 3389 Posterior secondary branch 5.7 15.3 6.3 16.7 3.9 17.9 4.5 16.7 7.0 16.3 7.7 17.6 4.1 14.6 7.2 16.0 4.8 17.1 7.8 19.9 6.3 16.4
3390
3391
181
3392 Table S4.39: Lake Terrasovoe, Prince Charles Mountains 2
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 261 778 200 566 259 728 217 650 250 701 184 565 211 628 226 621 233 674 247 715 194 478 221 661 222 689 210 617 162 485 160 573 170 596 233 666 Buccopharyngeal tube Buccal tube length 33.6 – 35.3 – 35.6 – 33.4 – 35.7 – 32.6 – 33.6 – 36.4 – 34.6 – 34.6 – 40.6 – 33.5 – 32.3 – 34.1 – 33.3 – 27.9 – 28.6 – 34.9 – Stylet support insertion point 26.9 80.0 26.8 76.0 28.9 81.4 26.9 80.5 27.9 78.3 25.6 78.5 26.5 79.0 27.9 76.7 27.6 79.7 27.7 80.1 31.8 78.3 25.8 76.8 25.4 78.6 27.0 79.1 26.4 79.3 20.6 73.8 22.1 77.4 27.1 77.5 Buccal tube external width 6.3 18.9 5.9 16.8 5.4 15.0 5.3 15.8 5.5 15.5 5.2 15.9 5.4 16.1 6.4 17.5 5.3 15.3 5.8 16.8 6.6 16.3 6.2 18.4 5.8 17.9 5.8 17.1 5.4 16.3 4.3 15.4 4.9 17.0 5.9 16.9 Buccal tube internal width 4.3 12.7 4.3 12.3 4.0 11.1 3.6 10.8 3.8 10.7 3.3 10.1 3.5 10.5 4.6 12.8 3.9 11.3 3.7 10.8 4.6 11.4 4.5 13.4 3.8 11.9 4.2 12.3 3.9 11.8 2.5 9.1 3.5 12.2 4.5 12.9 Ventral lamina length 13.3 39.6 19.2 54.3 16.0 44.9 15.9 47.6 20.0 56.1 13.5 41.4 13.5 40.1 20.1 55.3 15.4 44.6 15.9 46.0 23.6 58.2 18.4 55.0 18.1 56.1 17.1 50.2 16.8 50.3 17.2 61.6 15.5 54.4 17.2 49.1 Placoid lengths Macroplacoid 1 5.3 15.7 5.5 15.5 5.9 16.6 5.9 17.6 6.2 17.4 5.2 16.1 4.0 12.0 5.0 13.7 5.5 15.8 5.4 15.7 6.4 15.8 6.0 18.0 4.7 14.6 5.4 15.8 5.9 17.6 3.9 13.9 4.8 16.8 5.8 16.6 Macroplacoid 2 5.4 15.9 5.1 14.3 4.7 13.3 4.6 13.8 4.5 12.7 4.6 14.2 4.2 12.4 5.0 13.6 4.6 13.4 4.0 11.6 5.0 12.4 5.0 14.9 3.9 12.1 4.0 11.8 4.3 13.0 3.6 12.7 3.6 12.5 5.2 14.8 Macroplacoid 3 4.6 13.8 5.5 15.6 4.9 13.7 5.3 15.9 5.5 15.3 4.4 13.4 4.2 12.6 4.9 13.6 5.5 15.8 4.7 13.6 5.3 13.1 5.0 14.8 5.3 16.4 4.8 14.0 4.6 13.7 4.3 15.4 3.6 12.6 4.0 11.5 Microplacoid 3.2 9.6 2.9 8.2 2.9 8.1 2.9 8.6 3.7 10.5 2.8 8.6 2.7 8.2 3.4 9.3 2.7 7.7 2.7 7.7 3.1 7.6 3.5 10.4 2.6 8.1 2.9 8.6 2.6 7.8 2.7 9.3 2.8 8.1 Macroplacoid row 17.0 50.8 16.3 46.3 16.1 45.3 17.2 51.7 18.0 50.4 16.7 51.2 14.6 43.3 17.3 47.6 17.9 51.6 15.2 44.0 20.3 49.9 18.2 54.3 17.0 52.5 15.6 45.7 16.1 48.3 12.6 45.2 12.8 44.7 16.6 47.5 Placoid row 20.7 61.8 18.9 53.4 19.3 54.3 21.2 63.4 21.6 60.7 20.1 61.5 18.3 54.5 21.6 59.5 21.0 60.8 19.0 55.0 24.2 59.6 22.6 67.5 20.0 62.1 18.8 55.1 20.6 61.7 15.6 54.5 18.7 53.6 Claw 1 lengths External base 3.5 10.3 4.0 11.3 3.3 9.2 3.7 11.1 4.4 12.4 4.0 12.4 3.8 11.4 3.5 9.7 3.0 8.5 3.7 10.7 4.4 10.9 4.9 14.6 3.5 10.9 2.9 8.7 2.9 10.1 3.7 10.7 External primary branch 7.3 21.7 6.7 19.1 8.3 23.4 7.8 23.2 6.5 18.1 6.0 18.3 8.0 23.8 7.1 19.5 5.8 16.8 6.9 19.9 7.4 18.2 7.7 22.9 6.4 19.7 7.7 23.2 7.0 24.5 7.0 20.1 External secondary branch 5.3 15.8 4.6 13.0 5.3 14.9 5.0 14.8 3.3 9.4 4.4 13.4 6.2 18.5 5.0 13.7 3.6 10.5 4.5 13.1 5.7 13.9 5.7 17.0 5.0 15.6 5.1 15.1 4.8 16.6 5.9 17.0 Internal base 3.4 10.2 4.1 11.6 3.3 10.0 2.6 7.3 3.0 9.1 3.6 10.8 4.3 11.9 3.0 8.5 3.8 11.1 3.8 9.4 2.5 7.7 2.4 7.3 3.0 10.5 2.1 6.0 Internal primary branch 6.8 20.2 6.4 18.0 5.8 17.4 5.3 14.9 5.7 17.4 6.3 18.8 6.8 18.6 5.3 15.4 5.7 16.5 7.2 17.8 6.6 19.7 5.4 16.6 6.6 19.7 5.7 19.9 5.4 15.4 Internal secondary branch 4.6 13.7 5.2 14.8 4.9 14.5 4.0 11.2 4.1 12.6 4.5 13.3 5.0 13.7 4.8 13.9 4.6 13.2 4.4 10.8 5.3 15.8 4.3 13.4 4.8 16.8 4.6 13.0 Claw 2 lengths External base 3.3 9.8 3.2 9.0 3.0 8.4 3.6 10.6 3.9 10.9 3.4 10.3 4.9 14.7 3.9 10.7 3.5 10.2 3.5 10.1 4.0 10.0 3.7 11.1 4.1 12.6 2.3 6.8 3.1 9.3 2.7 9.6 4.4 12.5 External primary branch 7.4 22.1 5.2 14.7 7.8 22.0 7.6 22.7 7.5 21.1 8.0 24.5 9.0 26.7 6.9 19.0 6.0 17.3 6.9 19.9 8.3 20.3 8.2 24.4 6.7 20.7 6.5 19.2 8.1 24.4 6.2 21.5 6.6 18.8 External secondary branch 5.3 15.9 3.4 9.7 5.9 16.6 5.8 17.4 6.2 17.3 6.0 18.5 5.1 15.2 4.7 13.0 5.1 14.6 5.4 15.7 6.3 15.6 5.9 17.5 5.2 16.0 4.8 14.1 5.8 17.3 4.7 16.6 5.6 16.0 Internal base 3.7 10.9 3.5 9.9 2.9 8.7 3.9 11.0 4.4 13.5 5.2 15.4 5.2 14.2 4.5 13.1 3.3 9.6 3.8 9.4 3.8 11.2 3.4 10.7 2.3 6.7 2.6 9.0 Internal primary branch 6.5 19.3 4.8 13.5 6.7 20.1 7.0 19.7 6.6 20.3 7.1 21.1 6.1 16.6 5.9 16.9 5.0 14.3 8.2 20.3 7.9 23.6 6.3 19.5 5.8 17.1 5.4 19.1 6.1 17.5 Internal secondary branch 4.8 14.2 3.8 10.9 5.6 16.8 4.4 12.2 4.7 14.5 5.4 16.0 3.8 10.4 4.5 12.9 4.9 14.1 6.2 15.3 5.6 16.6 4.7 14.6 4.6 13.5 3.8 13.3 4.6 13.1 Claw 3 lengths External base 4.6 13.8 3.4 9.7 3.8 10.7 4.2 12.6 3.8 10.7 3.9 12.1 5.7 16.8 4.0 11.0 3.1 8.9 3.8 10.9 3.2 8.0 4.0 11.8 3.7 11.4 5.1 15.0 4.7 14.0 3.7 10.7 External primary branch 7.5 22.4 7.8 22.0 7.3 20.5 7.8 23.2 7.1 19.8 6.1 18.8 8.3 24.8 7.1 19.6 6.9 20.0 6.7 19.3 8.1 20.1 7.2 21.5 6.6 20.3 8.4 24.8 8.7 26.0 6.3 18.0 External secondary branch 5.0 15.0 5.9 16.7 4.9 13.7 5.6 16.9 5.2 14.7 5.6 17.1 5.9 17.6 5.9 16.1 5.7 16.4 5.7 16.6 7.0 17.3 5.4 16.2 5.1 15.7 6.5 19.1 6.6 19.8 4.7 13.4 Internal base 4.9 14.6 4.7 14.1 4.0 11.2 3.2 9.9 4.4 13.0 3.8 10.6 3.5 10.1 3.6 8.9 3.9 11.8 4.0 12.0 4.0 11.4 Internal primary branch 5.9 17.5 7.0 20.9 5.2 14.7 5.4 16.5 7.5 22.4 6.6 18.1 5.9 16.9 7.5 18.5 5.8 17.3 7.3 22.0 5.5 15.7 Internal secondary branch 3.6 10.6 4.9 14.6 4.4 12.4 4.3 13.3 5.3 15.6 4.4 12.1 4.3 12.5 6.9 17.0 4.2 12.6 6.6 19.7 3.5 10.0 Claw 4 lengths Anterior base 3.5 10.4 3.1 8.6 5.1 15.2 5.4 15.2 4.3 13.3 5.0 14.9 3.6 9.9 3.3 9.5 3.2 9.1 3.4 8.4 4.3 12.8 4.1 12.1 2.6 7.8 4.1 14.5 2.4 8.4 4.2 12.1 Anterior primary branch 6.3 18.9 6.6 18.6 7.1 20.1 7.7 23.0 7.2 20.2 7.6 23.3 9.0 26.9 9.7 26.7 6.9 19.9 6.6 19.0 5.5 13.6 6.2 18.4 8.5 24.8 6.6 19.6 6.4 22.9 6.6 23.2 6.3 17.9 Anterior secondary branch 3.8 11.3 4.9 13.7 4.9 14.5 5.1 14.3 5.0 15.3 6.4 19.1 6.0 16.6 4.5 13.1 4.7 13.4 4.4 10.8 4.9 14.5 6.0 17.5 5.2 15.5 4.1 14.8 4.8 16.7 3.6 10.3 Posterior base 5.4 16.1 5.3 14.9 4.1 12.3 6.1 17.0 4.4 13.6 5.4 16.2 4.8 13.2 3.6 10.4 4.2 12.3 4.0 9.8 4.0 11.8 3.0 9.1 3.6 10.5 4.3 12.8 2.6 9.4 3.2 11.0 4.6 13.2 Posterior primary branch 7.0 21.0 6.8 19.2 7.7 21.7 8.6 25.7 7.9 22.2 7.8 23.9 9.8 29.3 10.1 27.8 7.8 22.6 7.4 21.5 7.3 18.0 7.3 21.8 6.2 19.2 8.9 26.0 7.0 21.0 7.2 25.7 7.3 25.7 7.3 20.8 3393 Posterior secondary branch 5.1 15.3 5.5 15.4 6.3 18.8 5.1 14.4 5.7 17.5 6.9 20.4 6.6 18.1 4.8 13.8 5.2 15.1 5.2 12.8 5.3 15.8 4.8 14.8 5.4 15.9 5.0 15.0 5.0 17.9 5.3 18.5 4.6 13.2
3394
3395
3396
3397
3398
182
3399 Table S4.40: Mawson Station
SPECIMEN 1 (HOL) 2 3 4 5 6 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt Body length 149 605 156 657 171 716 156 743 136 600 114 521 Buccopharyngeal tube Buccal tube length 24.6 – 23.7 – 23.9 – 21.0 – 22.6 – 21.9 – Stylet support insertion point 19.2 78.2 16.0 67.6 15.0 62.7 12.3 58.6 14.7 65.2 13.8 63.1 Buccal tube external width 3.2 13.1 2.3 9.6 2.6 11.1 2.1 9.8 2.6 11.3 1.9 8.6 Buccal tube internal width 1.7 6.9 1.2 5.0 1.5 6.2 1.0 4.8 1.2 5.2 1.0 4.7 Ventral lamina length 10.2 41.3 12.0 50.6 8.0 33.6 8.9 42.2 9.0 39.7 7.6 34.6 Placoid lengths Macroplacoid 1 2.3 9.5 2.4 10.3 2.7 11.2 2.3 10.8 2.8 12.5 2.6 12.0 Macroplacoid 2 2.6 10.5 3.0 12.7 2.4 10.2 2.0 9.7 1.9 8.3 2.1 9.4 Macroplacoid 3 2.7 10.8 2.8 11.6 2.1 8.6 2.1 10.2 2.3 10.3 2.4 10.9 Microplacoid 0.9 3.8 2.0 8.6 1.6 6.7 1.2 5.7 1.3 5.8 1.2 5.6 Macroplacoid row 10.5 42.7 9.4 39.6 8.8 36.8 7.8 37.2 8.5 37.7 7.2 33.0 Placoid row 11.7 47.6 10.9 46.1 10.6 44.3 9.9 46.9 10.0 44.1 9.2 41.9 Claw 1 lengths External base 2.7 11.1 2.5 10.6 2.0 9.6 3.4 14.9 2.9 13.2 External primary branch 4.9 20.0 3.9 16.3 4.6 19.2 3.7 17.4 3.9 17.3 3.4 15.6 External secondary branch 3.8 15.5 2.9 12.2 2.9 12.3 2.5 12.1 2.6 11.6 3.3 14.9 Internal base 3.1 12.6 1.9 8.1 2.0 9.5 Internal primary branch 4.6 18.6 3.5 14.7 4.5 18.7 3.5 16.6 Internal secondary branch 4.0 16.2 3.1 13.0 3.7 15.7 Claw 2 lengths External base 3.0 14.1 3.0 13.1 External primary branch 4.1 17.3 4.7 22.3 3.2 14.0 External secondary branch 3.3 15.6 2.8 12.5 Internal base 2.6 12.5 2.8 12.3 Internal primary branch 4.0 16.7 4.6 22.1 3.1 13.7 Internal secondary branch 2.9 12.1 3.5 16.5 2.5 10.9 Claw 3 lengths External base 3.4 13.7 3.0 12.8 4.1 19.6 3.0 13.1 3.0 13.8 External primary branch 6.1 24.7 7.2 30.2 5.2 21.8 4.8 23.0 3.8 16.9 3.5 16.0 External secondary branch 4.5 18.2 5.1 21.6 3.9 16.3 3.8 17.8 2.9 12.8 2.9 13.2 Internal base 3.0 12.6 2.8 13.4 2.5 10.9 2.8 12.7 Internal primary branch 5.9 24.9 4.0 18.9 3.1 13.6 3.3 14.9 Internal secondary branch 4.9 20.6 3.3 15.7 2.6 11.6 2.6 11.7 Claw 4 lengths Anterior base 3.4 13.7 3.1 13.0 3.0 12.5 3.4 16.1 2.1 9.4 Anterior primary branch 6.1 24.9 5.8 24.4 4.3 18.1 4.2 20.1 3.7 16.2 3.8 17.2 Anterior secondary branch 5.2 20.9 3.7 15.5 3.3 13.9 3.9 18.7 2.6 11.7 3.1 14.2 Posterior base 4.0 16.3 3.2 13.4 3.5 14.7 3.9 18.3 2.2 10.0 Posterior primary branch 7.3 29.7 6.3 26.5 4.6 19.4 4.5 21.5 4.0 17.7 3.9 17.8 3400 Posterior secondary branch 5.0 20.2 3.7 15.5 4.3 18.1 4.4 21.0 3.0 13.2 3.2 14.4
3401
3402
183
3403 Table S4.41: Dronning Maud Land, Sør Rondane Mountains
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 397 1079 328 935 224 833 363 1050 397 1153 337 962 334 940 334 793 314 919 430 1177 260 809 265 883 442 1049 331 1051 226 864 262 910 Buccopharyngeal tube Buccal tube length 36.8 – 35.1 – 26.9 – 34.6 – 34.4 – 35.0 – 35.6 – 42.1 – 34.2 – 36.5 – 32.2 – 30.0 – 42.1 – 31.5 – 26.2 – 28.8 – Stylet support insertion point 29.5 80.1 25.6 73.0 22.0 81.8 28.0 80.9 27.4 79.5 28.1 80.3 28.3 79.4 33.6 79.7 27.2 79.5 29.1 79.6 25.1 78.0 23.2 77.3 33.1 78.7 24.9 79.0 21.1 80.7 22.8 79.2 Buccal tube external width 4.0 11.0 3.7 10.5 3.0 11.3 3.6 10.3 3.8 11.1 3.4 9.8 3.4 9.7 5.2 12.5 3.8 11.0 3.5 9.5 3.2 10.0 2.9 9.7 4.2 9.9 3.9 12.3 2.9 11.0 3.2 11.3 Buccal tube internal width 2.9 7.9 2.8 8.1 2.2 8.2 2.8 8.2 2.9 8.3 2.6 7.4 2.4 6.6 4.3 10.1 2.9 8.5 2.7 7.3 2.4 7.5 2.1 6.9 3.3 7.8 2.5 8.1 1.6 5.9 2.2 7.7 Ventral lamina length 18.8 53.7 15.5 57.6 19.5 56.5 18.4 52.6 18.4 51.8 22.5 53.5 18.4 53.7 15.1 57.6 Placoid lengths Macroplacoid 1 4.9 13.2 5.0 14.2 4.2 15.4 5.8 16.8 4.7 13.7 4.7 13.4 5.0 13.9 5.6 13.2 4.8 14.0 5.2 14.2 3.8 11.7 3.6 11.9 6.5 15.5 5.0 15.9 3.9 15.0 3.7 12.8 Macroplacoid 2 3.8 10.4 4.0 11.4 3.1 11.6 4.5 13.1 3.7 10.6 3.7 10.7 4.2 11.7 4.4 10.5 4.3 12.7 5.0 13.8 3.6 11.2 3.7 12.2 4.9 11.7 3.8 12.0 3.0 11.6 3.3 11.4 Macroplacoid 3 4.4 11.9 4.8 13.7 4.3 16.0 4.2 12.0 3.5 10.2 4.0 11.3 4.3 12.0 5.8 13.9 3.8 11.2 4.3 11.8 3.8 11.8 3.4 11.3 5.7 13.4 3.8 12.2 3.1 11.9 3.7 13.0 Microplacoid 2.5 6.7 3.0 8.6 2.1 7.7 2.3 6.7 3.0 8.7 2.1 5.9 1.8 5.0 2.6 6.2 2.2 6.5 2.4 6.7 1.8 5.6 2.3 7.7 2.7 6.5 2.2 6.9 2.0 7.5 1.9 6.7 Macroplacoid row 16.6 45.0 16.3 46.6 13.5 50.3 16.7 48.4 15.6 45.4 15.4 44.1 15.8 44.3 19.8 47.1 16.0 46.8 16.3 44.5 15.4 47.8 12.6 41.8 20.9 49.5 15.0 47.7 11.4 43.5 12.7 44.0 Placoid row 20.0 54.4 20.1 57.4 16.3 60.7 19.5 56.5 19.3 56.1 18.5 52.9 18.5 51.9 23.7 56.2 20.0 58.6 19.0 52.0 17.5 54.4 15.3 51.1 24.6 58.4 17.9 57.0 14.0 53.6 14.7 50.9 Claw 1 lengths External base 3.9 11.2 3.5 10.1 2.4 7.1 2.5 7.1 2.8 7.8 2.9 7.0 2.9 8.5 2.1 6.6 2.1 6.9 2.7 6.5 2.7 8.6 2.5 9.5 1.9 6.6 External primary branch 10.0 27.2 9.0 25.7 5.6 20.9 9.0 25.9 8.8 25.7 7.6 21.6 7.9 22.1 9.0 21.3 7.0 20.4 7.8 24.1 6.2 20.6 8.7 20.6 6.0 19.2 7.4 28.2 6.4 22.2 External secondary branch 6.7 19.1 6.6 19.0 5.5 15.8 6.6 18.9 7.0 19.6 6.7 15.9 5.5 16.0 6.1 19.0 4.8 16.0 6.0 14.1 5.2 19.9 4.2 14.6 Internal base 3.7 10.5 2.1 7.9 3.0 8.7 3.0 8.6 2.2 6.3 2.0 5.7 3.0 7.2 2.9 8.4 2.3 7.1 2.3 7.6 2.5 5.9 Internal primary branch 9.1 24.8 7.6 21.7 4.8 17.8 6.6 19.2 8.4 24.5 6.7 19.2 6.8 19.2 8.3 19.8 7.8 22.7 6.9 21.3 5.5 18.4 7.8 18.4 7.3 28.0 5.5 18.9 Internal secondary branch 5.6 15.3 4.7 13.5 3.8 14.1 5.2 15.0 4.7 13.7 6.4 18.2 6.5 18.2 5.1 12.1 6.3 18.4 5.0 15.6 4.2 14.0 5.6 13.2 Claw 2 lengths External base 2.8 10.4 3.3 9.4 3.0 8.7 2.1 5.9 2.1 6.0 3.2 7.5 2.3 6.6 3.2 9.8 2.4 8.0 2.7 6.3 3.2 10.3 2.8 10.8 2.2 7.7 External primary branch 11.0 30.0 7.4 27.6 9.8 28.2 8.8 25.6 7.8 22.1 8.6 24.1 9.8 23.3 6.9 20.1 8.1 25.1 5.9 19.7 7.3 17.4 6.8 21.7 7.0 26.8 6.9 23.8 External secondary branch 7.2 19.7 4.7 17.6 6.8 19.7 5.0 14.6 6.4 18.3 6.6 18.6 6.6 15.8 6.8 19.9 6.6 20.6 4.6 15.3 4.9 18.9 4.0 14.0 Internal base 2.3 8.5 3.4 9.8 2.4 6.8 2.2 6.2 2.8 6.8 2.9 8.5 3.1 9.5 2.1 6.9 2.2 7.5 Internal primary branch 8.5 23.0 5.8 21.4 8.3 23.9 7.4 21.2 7.2 20.1 9.5 22.6 6.3 18.4 6.9 21.5 5.3 17.6 6.7 25.7 5.1 17.6 Internal secondary branch 5.8 15.8 3.4 12.6 5.3 15.4 5.2 14.7 6.0 16.8 7.4 17.6 6.3 18.3 5.5 17.2 4.7 15.6 3.0 10.5 Claw 3 lengths External base 3.5 10.0 2.4 8.8 3.8 11.0 3.1 8.9 1.6 4.6 2.6 7.4 2.8 6.6 3.1 8.9 2.4 7.5 2.6 6.1 2.2 7.1 2.6 10.1 2.2 7.7 External primary branch 9.2 25.0 7.7 22.0 7.4 27.4 9.5 27.4 8.8 25.5 7.9 22.6 7.4 20.8 9.6 22.9 8.6 25.1 6.4 20.0 8.3 27.7 6.6 15.6 7.0 22.3 6.9 26.3 7.1 24.7 External secondary branch 6.7 18.3 7.2 20.6 5.7 21.1 6.7 19.3 5.2 15.1 7.1 20.4 5.1 14.2 6.6 15.6 6.1 17.9 5.1 15.7 6.0 19.9 5.4 20.5 4.7 16.5 Internal base 4.7 12.9 3.3 9.3 2.7 7.9 2.0 5.6 2.8 7.8 3.0 7.0 3.0 8.8 2.6 8.0 2.8 6.6 2.2 7.6 Internal primary branch 6.4 17.5 7.8 22.3 5.5 20.6 7.9 22.8 7.3 20.8 6.9 19.5 8.2 19.5 6.8 19.9 5.1 16.0 5.6 13.4 5.8 22.2 5.3 18.5 Internal secondary branch 6.2 16.8 5.5 15.7 5.8 16.7 5.2 14.8 5.9 16.5 6.1 14.6 5.3 15.4 4.6 14.3 3.8 9.0 3.6 12.4 Claw 4 lengths Anterior base 3.2 8.6 3.5 10.0 2.0 7.5 2.5 7.2 3.1 9.1 2.2 6.4 2.4 6.8 2.2 5.1 2.1 6.2 2.6 7.2 3.1 9.7 2.0 6.5 3.7 8.9 3.4 10.6 2.4 9.3 2.1 7.2 Anterior primary branch 7.7 20.8 8.8 25.0 6.9 25.6 9.2 26.7 8.1 23.5 8.1 23.3 8.3 23.2 6.8 16.0 9.2 26.8 8.6 23.4 7.9 24.6 9.3 22.1 7.0 22.3 7.3 27.7 6.7 23.3 Anterior secondary branch 4.7 12.7 7.1 20.2 5.2 19.3 6.4 18.4 5.4 15.7 5.9 16.9 5.8 16.4 5.0 12.0 6.7 19.7 5.8 15.8 6.0 18.6 5.6 18.7 7.4 17.6 5.2 16.6 4.9 18.6 5.5 19.2 Posterior base 4.0 10.9 3.4 9.6 2.6 9.6 2.0 5.9 3.1 9.0 2.9 8.2 2.9 8.2 3.1 7.2 2.9 8.4 3.4 9.3 2.0 6.1 2.1 6.9 2.8 6.5 2.5 7.8 2.1 8.0 2.4 8.2 Posterior primary branch 8.2 22.2 9.4 26.9 7.1 26.4 9.5 27.4 10.1 29.2 9.5 27.1 9.1 25.5 9.5 22.6 9.4 27.5 9.6 26.3 8.3 25.9 6.9 23.1 10.4 24.6 7.4 23.4 7.7 29.2 7.0 24.2 3404 Posterior secondary branch 6.1 16.5 6.3 18.0 5.7 21.2 6.6 19.1 7.5 21.9 6.2 17.7 6.2 17.3 5.5 13.0 7.2 20.9 6.9 18.8 6.8 21.1 4.8 15.9 5.7 13.5 4.8 15.2 4.5 17.3 5.4 18.8
3405
3406
3407
3408
184
3409 Table S4.42: Almirante Brown, Danco Coast
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 317 904 395 932 323 835 470 988 373 925 348 863 362 883 385 861 337 867 302 881 395 942 378 904 283 895 236 696 314 854 372 881 294 843 317 969 344 794 401 1045 300 906 379 934 Buccopharyngeal tube Buccal tube length 35.0 – 42.4 – 38.7 – 47.6 – 40.3 – 40.3 – 41.0 – 44.7 – 38.9 – 34.3 – 41.9 – 41.8 – 31.6 – 33.8 – 36.7 – 42.2 – 34.9 – 32.8 – 43.3 – 38.4 – 33.1 – 40.6 – Stylet support insertion point 26.7 76.4 32.2 75.9 29.5 76.2 35.9 75.5 31.1 77.1 30.7 76.3 32.1 78.4 31.8 71.2 30.7 78.8 26.3 76.6 32.1 76.7 32.0 76.5 23.9 75.5 25.8 76.4 27.9 76.0 32.3 76.5 26.7 76.7 24.3 74.1 33.7 77.7 29.2 76.2 25.4 76.5 32.0 78.7 Buccal tube external width 4.4 12.6 5.4 12.8 5.7 14.7 5.9 12.3 5.6 14.0 5.3 13.1 5.9 14.3 5.8 12.9 5.1 13.0 4.6 13.3 6.1 14.6 6.2 14.8 5.0 15.9 4.4 13.0 4.9 13.4 6.2 14.7 4.6 13.2 4.5 13.6 6.2 14.3 5.0 13.0 4.7 14.2 5.8 14.2 Buccal tube internal width 3.1 8.8 3.6 8.4 3.1 8.1 3.7 7.8 3.7 9.1 3.6 9.0 4.2 10.2 4.0 9.0 3.4 8.7 3.2 9.3 4.1 9.8 3.9 9.2 3.3 10.5 2.9 8.5 3.1 8.4 3.9 9.3 2.6 7.4 2.6 8.0 4.3 10.0 3.2 8.4 2.9 8.8 3.8 9.4 Ventral lamina length 19.6 56.0 21.8 51.6 22.5 58.0 28.8 60.4 24.5 60.7 22.8 56.6 23.8 58.1 29.5 66.0 24.1 61.9 21.6 62.9 26.1 62.3 25.9 62.0 16.8 53.0 18.1 53.4 20.6 56.1 26.3 62.3 21.5 61.6 19.5 59.5 27.1 62.4 20.8 54.3 18.1 54.6 24.1 59.4 Placoid lengths Macroplacoid 1 4.8 13.6 6.3 14.8 5.5 14.2 6.2 13.0 6.1 15.0 7.6 18.8 5.8 14.1 7.6 16.9 5.8 14.8 5.4 15.7 7.1 17.0 7.0 16.8 5.5 17.4 4.8 14.2 5.7 15.6 7.3 17.2 5.1 14.5 4.7 14.3 7.8 18.0 4.9 12.6 3.6 10.7 6.8 16.8 Macroplacoid 2 3.7 10.5 3.9 9.2 4.2 10.9 4.7 9.9 5.1 12.6 4.1 10.2 5.2 12.6 4.8 10.7 4.7 12.1 4.1 11.9 6.2 14.8 4.8 11.5 4.1 12.8 3.4 10.1 3.9 10.6 4.2 9.9 4.3 12.4 3.7 11.4 5.0 11.4 4.4 11.4 3.1 9.3 5.8 14.2 Macroplacoid 3 4.2 12.1 6.1 14.3 5.2 13.4 5.5 11.5 4.5 11.1 5.0 12.3 5.9 14.3 5.4 12.1 4.4 11.3 4.5 13.2 5.9 14.2 6.1 14.6 4.4 13.9 3.6 10.7 4.7 12.8 5.4 12.8 4.3 12.4 4.0 12.2 5.9 13.6 5.1 13.3 3.6 10.9 5.4 13.3 Microplacoid 2.7 7.8 3.0 7.0 2.7 6.9 3.1 6.4 3.3 8.2 2.9 7.3 3.6 8.8 3.6 7.9 3.1 8.1 3.1 8.9 4.1 9.8 3.8 9.0 2.2 6.9 2.2 6.4 3.0 8.2 3.2 7.5 2.2 6.2 2.7 8.1 3.1 7.2 3.2 8.4 2.3 6.9 3.0 7.4 Macroplacoid row 14.6 41.6 18.7 44.1 18.2 47.0 19.0 39.9 19.4 48.3 20.1 49.9 18.5 45.1 19.7 44.0 18.0 46.2 16.5 47.9 21.2 50.7 24.5 58.6 15.6 49.3 14.2 42.0 18.1 49.3 20.8 49.2 17.1 49.0 15.3 46.6 21.6 49.8 17.3 45.1 14.2 42.8 20.2 49.7 Placoid row 18.1 51.7 23.3 54.9 21.6 55.7 23.3 48.9 23.1 57.4 23.6 58.7 22.5 54.9 24.6 55.0 22.2 57.1 20.0 58.3 26.3 62.8 28.9 69.3 18.2 57.4 16.3 48.3 21.6 58.7 24.5 58.2 19.7 56.6 18.5 56.4 25.8 59.6 20.0 52.2 16.7 50.2 23.3 57.4 Claw 1 lengths External base 2.9 8.2 4.7 11.1 2.5 6.4 3.9 8.2 3.9 9.6 2.5 6.1 3.6 8.8 4.5 10.0 3.2 8.3 2.9 8.4 2.8 6.6 3.5 8.3 2.4 7.6 2.5 7.5 3.8 10.4 2.9 7.0 3.0 8.7 3.7 11.3 3.1 7.1 4.0 10.4 3.8 11.5 2.6 6.4 External primary branch 6.7 19.2 9.1 21.4 7.9 20.3 9.3 19.5 8.1 20.0 8.6 21.3 7.9 19.3 9.6 21.5 6.8 17.4 7.4 21.5 8.6 20.5 8.4 20.0 6.1 19.3 7.0 20.7 7.9 21.4 7.4 17.5 6.6 18.9 6.3 19.3 8.6 19.8 8.0 20.9 6.5 19.5 8.6 21.0 External secondary branch 4.7 13.5 6.8 16.1 6.4 16.4 9.0 18.8 6.5 16.1 7.0 17.5 6.5 15.9 7.9 17.6 5.6 14.4 5.7 16.5 7.6 18.1 6.5 15.6 4.5 14.4 5.4 16.0 6.0 16.3 6.4 15.2 5.9 16.8 5.5 16.8 5.8 13.4 5.4 14.0 4.7 14.1 7.0 17.3 Internal base 2.7 7.8 3.6 8.5 3.4 8.8 3.9 8.2 3.1 7.6 2.4 6.0 3.2 7.8 2.9 6.4 3.1 7.9 2.2 6.5 3.8 9.1 2.8 6.7 2.8 8.9 2.4 7.0 2.9 8.0 3.2 7.5 2.6 7.5 3.5 10.6 3.5 8.0 2.8 7.2 3.4 10.3 3.8 9.5 Internal primary branch 6.7 19.1 8.2 19.4 7.6 19.6 8.6 18.1 7.7 19.0 8.5 21.0 6.4 15.7 8.3 18.5 5.4 13.9 7.2 20.9 7.8 18.5 7.0 16.8 6.0 19.0 5.8 17.1 7.2 19.7 6.9 16.4 6.2 17.7 5.8 17.5 6.2 14.3 7.9 20.6 5.9 17.8 8.1 19.9 Internal secondary branch 4.6 13.2 6.6 15.6 6.1 15.7 7.2 15.2 5.8 14.4 7.7 19.0 5.6 13.7 5.7 12.7 4.8 12.4 6.3 18.3 6.7 16.0 7.0 16.7 4.1 12.8 4.7 13.8 5.8 15.8 5.9 13.9 4.9 14.1 4.0 12.3 6.1 14.2 6.5 17.0 3.8 11.3 6.6 16.3 Claw 2 lengths External base 2.7 7.8 3.9 9.3 3.5 8.9 4.3 9.0 3.6 8.9 3.0 7.4 4.0 9.7 4.7 10.5 3.5 8.9 4.1 11.9 3.0 7.2 5.0 12.0 2.3 7.3 2.8 8.2 3.9 10.5 2.8 6.7 3.8 11.0 3.1 9.3 4.0 9.2 2.5 6.5 3.7 11.2 3.1 7.6 External primary branch 7.2 20.4 10.0 23.7 7.1 18.4 10.4 21.8 8.5 21.1 8.3 20.6 9.4 22.9 10.1 22.6 7.3 18.7 8.6 25.2 8.6 20.5 9.8 23.5 5.7 17.9 6.0 17.9 8.1 22.1 8.8 20.8 7.5 21.5 6.8 20.7 9.0 20.8 8.2 21.5 8.5 25.8 9.6 23.7 External secondary branch 5.6 15.9 7.9 18.6 5.6 14.4 8.6 18.1 7.4 18.4 7.0 17.4 7.5 18.3 8.2 18.3 5.9 15.1 5.9 17.3 7.2 17.1 7.8 18.7 4.7 14.8 5.3 15.8 6.7 18.1 6.6 15.5 6.9 19.7 5.9 17.9 7.9 18.3 6.0 15.7 5.4 16.3 7.9 19.5 Internal base 3.8 10.7 3.7 8.6 4.0 10.4 4.0 8.4 3.2 7.8 3.2 7.9 3.8 9.4 3.6 7.9 3.6 9.3 3.7 10.6 4.0 9.5 3.1 7.3 2.9 9.0 2.4 7.0 3.6 9.7 3.0 7.1 4.1 11.7 2.4 7.4 3.5 8.1 3.7 9.5 3.6 10.9 2.9 7.1 Internal primary branch 7.0 19.9 7.3 17.3 6.9 17.7 8.6 18.0 6.9 17.1 7.4 18.4 8.3 20.3 9.7 21.6 6.4 16.5 7.4 21.6 8.2 19.5 8.3 19.8 5.2 16.3 5.6 16.6 7.7 21.1 7.7 18.2 6.6 19.0 5.4 16.6 7.0 16.2 7.4 19.2 7.0 21.1 8.4 20.7 Internal secondary branch 5.8 16.5 5.6 14.6 7.0 14.8 6.4 15.9 6.8 16.9 7.4 18.1 7.5 16.7 4.8 12.4 6.4 18.7 7.4 17.7 6.6 15.7 4.0 12.7 4.5 13.4 6.1 16.6 5.3 12.5 6.1 17.5 4.0 12.1 4.7 10.9 6.3 16.5 5.3 15.9 7.5 18.4 Claw 3 lengths External base 3.7 10.5 4.0 9.4 3.6 9.4 5.6 11.7 3.8 9.5 3.8 9.4 4.3 10.5 4.2 9.3 2.9 7.4 3.1 8.9 3.5 8.4 4.5 10.8 2.7 8.6 3.6 10.6 3.8 10.4 4.0 9.6 3.9 11.2 4.1 12.4 4.6 10.6 4.0 10.4 3.0 9.0 4.0 9.8 External primary branch 7.8 22.3 9.2 21.6 7.5 19.3 10.8 22.8 8.7 21.7 8.9 22.2 9.6 23.4 9.9 22.1 7.0 17.9 7.9 23.0 8.2 19.5 9.8 23.5 5.8 18.4 6.9 20.3 9.0 24.4 8.0 18.9 8.0 22.9 6.8 20.7 11.0 25.5 8.8 22.9 6.8 20.5 9.0 22.2 External secondary branch 6.0 17.2 6.9 16.3 6.2 16.1 9.2 19.3 6.0 14.9 7.4 18.3 8.6 21.0 8.7 19.4 5.9 15.1 6.2 18.1 7.8 18.7 7.6 18.2 4.7 14.8 5.9 17.4 7.1 19.4 6.4 15.2 7.2 20.7 5.6 17.0 9.0 20.7 7.0 18.3 5.8 17.5 7.0 17.1 Internal base 3.9 11.2 3.3 7.7 3.3 8.6 4.1 8.6 3.7 9.1 3.1 7.7 3.4 8.3 4.1 9.2 2.6 6.8 3.9 11.4 3.4 8.2 3.8 9.0 2.8 8.8 2.9 8.5 3.2 8.6 3.2 7.5 4.3 12.2 3.1 9.4 3.2 7.5 3.8 9.9 2.2 6.5 2.9 7.1 Internal primary branch 7.3 20.8 7.4 17.4 7.1 18.4 10.6 22.2 6.5 16.1 8.7 21.6 7.9 19.4 8.3 18.5 6.5 16.7 7.7 22.4 7.9 18.9 8.1 19.3 5.2 16.5 5.8 17.0 7.7 20.9 6.8 16.0 7.8 22.4 5.7 17.5 9.1 21.0 8.1 21.1 6.4 19.4 8.4 20.8 Internal secondary branch 5.5 15.7 6.6 15.6 6.1 15.7 8.7 18.3 5.9 14.6 7.5 18.5 6.3 15.4 7.1 15.9 6.0 15.5 6.0 17.4 7.3 17.4 7.1 17.1 4.6 14.7 4.7 14.0 6.0 16.5 6.7 15.8 6.4 18.2 4.9 14.8 7.7 17.8 6.0 15.6 5.1 15.3 6.4 15.7 Claw 4 lengths Anterior base 3.3 9.4 2.9 6.8 3.7 9.5 3.9 8.2 2.7 6.8 3.5 8.6 3.7 9.0 5.4 12.1 1.9 4.9 3.7 10.9 5.7 13.7 4.5 10.8 3.0 9.5 3.0 8.9 3.5 9.5 3.1 7.3 3.7 10.7 3.8 11.4 4.4 10.2 3.4 8.8 3.8 11.4 2.6 6.5 Anterior primary branch 6.5 18.5 10.0 23.7 7.6 19.5 8.4 17.7 8.3 20.5 8.0 19.8 8.1 19.9 7.7 17.1 6.6 16.9 6.3 18.4 8.5 20.3 9.3 22.3 7.8 24.7 6.9 20.3 7.3 19.9 7.2 17.1 7.5 21.6 6.2 18.9 6.8 15.6 8.3 21.6 6.5 19.5 7.9 19.3 Anterior secondary branch 4.7 13.5 6.1 14.5 7.1 18.2 7.7 16.1 6.8 17.0 6.4 15.8 7.1 17.2 6.7 14.9 5.5 14.1 5.5 16.1 6.8 16.2 8.9 21.3 5.3 16.6 5.5 16.1 6.0 16.2 6.0 14.1 6.8 19.6 5.0 15.2 5.1 11.7 5.5 14.3 4.7 14.0 7.1 17.4 Posterior base 3.9 11.2 3.9 9.3 5.5 14.2 3.4 7.2 4.0 9.9 4.2 10.5 4.3 10.4 3.6 7.9 3.8 9.7 3.8 11.0 6.5 15.5 5.8 13.8 4.3 13.5 4.7 13.9 5.5 14.8 5.8 13.7 5.0 14.4 2.1 6.4 4.0 9.2 4.5 11.7 5.2 15.5 3.7 9.0 Posterior primary branch 7.5 21.4 12.0 28.4 9.7 25.0 10.2 21.4 9.3 23.0 9.3 23.1 9.0 22.0 9.8 21.9 7.7 19.7 8.4 24.5 10.7 25.6 13.1 31.2 9.5 30.1 8.1 24.1 10.3 28.2 10.5 25.0 9.6 27.6 7.2 22.1 8.3 19.2 9.4 24.4 8.1 24.4 9.4 23.1 3410 Posterior secondary branch 5.3 15.3 8.6 20.2 6.2 16.0 7.1 14.9 6.9 17.1 6.3 15.5 5.8 14.1 7.8 17.3 5.1 13.1 6.1 17.6 7.7 18.3 8.7 20.8 7.7 24.5 5.8 17.3 7.8 21.1 5.9 14.0 5.8 16.7 5.6 17.0 5.2 12.1 6.4 16.7 6.0 18.0 7.6 18.7
3411
3412
3413
3414
3415
185
3416 Table S4.43: Cierva Cove
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 12 13 14 15 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 224 945 324 971 371 1028 480 1127 508 1123 276 727 509 1131 405 1015 367 1098 362 985 309 870 435 1063 434 1067 357 1052 352 919 Buccopharyngeal tube Buccal tube length 23.7 – 33.4 – 36.1 – 42.6 – 45.3 – 38.0 – 45.0 – 39.9 – 33.4 – 36.7 – 35.5 – 40.9 – 40.7 – 34.0 – 38.3 – Stylet support insertion point 17.8 75.0 26.1 78.0 27.9 77.2 32.6 76.6 34.4 76.1 29.4 77.3 33.9 75.2 30.0 75.2 25.0 75.0 28.1 76.5 27.2 76.6 32.1 78.4 32.2 79.1 26.1 76.8 29.8 78.0 Buccal tube external width 3.1 13.0 4.7 14.0 5.4 15.0 6.4 15.0 6.6 14.5 5.0 13.2 7.5 16.6 6.6 16.5 5.4 16.1 5.8 15.7 5.6 15.8 6.7 16.3 6.4 15.7 4.5 13.1 6.2 16.2 Buccal tube internal width 1.6 6.8 3.1 9.4 3.4 9.5 3.8 9.0 4.5 9.8 3.6 9.5 5.3 11.7 4.3 10.7 3.4 10.3 3.7 10.1 3.9 11.0 4.4 10.7 4.3 10.5 2.8 8.3 4.4 11.4 Ventral lamina length 14.8 62.3 19.9 59.6 21.2 58.8 22.0 51.7 30.1 66.4 24.6 64.6 27.8 61.8 26.8 67.1 22.0 65.9 23.3 63.4 22.3 62.8 25.1 61.3 26.3 64.7 19.3 56.8 24.9 65.0 Placoid lengths Macroplacoid 1 3.3 14.0 4.9 14.6 5.4 15.1 7.1 16.7 10.1 22.3 5.7 15.0 6.9 15.3 5.1 12.8 4.7 13.9 4.8 13.0 3.8 10.8 6.0 14.7 6.3 15.5 4.6 13.4 7.2 18.7 Macroplacoid 2 2.7 11.5 3.6 10.7 4.6 12.8 6.0 14.0 5.5 12.1 4.2 11.1 6.3 13.9 5.0 12.6 4.8 14.3 3.8 10.3 3.6 10.0 4.7 11.4 4.6 11.3 4.0 11.7 4.6 12.1 Macroplacoid 3 3.2 13.6 5.1 15.2 4.4 12.2 5.8 13.6 6.4 14.1 5.0 13.0 6.1 13.6 4.7 11.7 4.3 13.0 4.2 11.4 4.2 11.9 5.5 13.4 5.7 14.0 4.2 12.2 4.7 12.2 Microplacoid 2.2 9.4 2.9 8.7 2.5 7.0 4.1 9.7 4.8 10.7 3.4 9.0 3.8 8.4 3.3 8.3 3.0 9.0 2.3 6.3 3.0 8.4 3.5 8.5 3.1 7.7 3.0 8.9 3.0 7.7 Macroplacoid row 12.0 50.7 15.8 47.2 17.1 47.5 23.3 54.7 25.5 56.4 19.3 50.8 23.8 52.8 22.1 55.3 17.1 51.1 17.9 48.7 17.5 49.3 20.6 50.4 21.9 53.7 17.7 52.0 18.9 49.5 Placoid row 14.7 62.2 19.0 57.0 20.8 57.6 28.8 67.7 30.9 68.3 22.9 60.1 28.4 63.0 27.1 67.8 20.7 62.0 21.7 59.0 21.2 59.8 25.2 61.7 26.1 64.2 20.7 60.9 22.9 59.9 Claw 1 lengths External base 2.2 9.2 2.6 7.8 4.0 11.0 4.0 9.4 3.3 7.2 2.6 6.7 4.5 10.0 3.4 8.6 3.5 10.6 3.1 8.4 2.4 6.7 3.9 9.5 4.6 11.3 3.0 8.9 5.0 13.0 External primary branch 4.9 20.6 6.9 20.7 8.1 22.5 9.2 21.5 10.4 23.0 6.2 16.3 10.0 22.3 7.5 18.8 7.2 21.7 7.8 21.2 6.6 18.4 8.8 21.6 9.2 22.5 6.3 18.5 8.1 21.3 External secondary branch 3.9 16.5 5.0 15.0 7.1 19.5 7.0 16.5 8.4 18.6 5.3 13.8 7.8 17.2 6.7 16.9 5.3 15.9 6.1 16.5 5.8 16.3 7.3 17.9 7.1 17.4 4.8 14.0 6.3 16.5 Internal base 1.7 7.3 3.3 9.8 4.0 11.1 2.9 6.7 5.0 11.1 2.2 5.8 4.5 9.9 3.5 8.7 3.7 11.2 4.0 10.8 2.5 7.0 4.9 11.9 4.6 11.3 3.4 9.9 4.1 10.8 Internal primary branch 4.1 17.4 6.8 20.3 8.1 22.4 8.9 20.8 8.8 19.5 5.8 15.2 9.9 22.0 6.3 15.7 6.1 18.2 6.4 17.4 6.6 18.4 8.0 19.5 8.4 20.6 6.0 17.5 7.5 19.7 Internal secondary branch 3.2 13.3 5.0 14.9 7.3 20.2 6.5 15.1 6.9 15.2 5.1 13.3 8.1 18.0 5.6 13.9 5.0 14.9 5.8 15.8 5.2 14.6 6.9 16.8 6.6 16.2 5.2 15.2 6.6 17.3 Claw 2 lengths External base 2.4 10.2 3.3 10.0 3.8 10.4 2.9 6.8 4.1 9.1 3.1 8.1 3.9 8.7 3.7 9.3 4.0 12.0 3.9 10.5 2.1 6.0 4.9 12.0 5.3 13.1 4.0 11.8 3.6 9.5 External primary branch 5.4 22.8 7.2 21.6 9.0 25.0 9.7 22.7 10.8 23.9 7.6 19.9 11.2 24.9 8.7 21.8 7.1 21.3 7.5 20.5 6.7 18.8 8.6 21.0 8.9 21.8 6.5 19.1 8.5 22.3 External secondary branch 4.1 17.2 6.1 18.3 7.9 22.0 7.7 18.2 9.0 19.9 6.0 15.8 8.4 18.7 7.1 17.7 5.9 17.5 5.8 15.9 6.0 17.0 6.7 16.4 6.7 16.5 5.0 14.8 6.1 15.9 Internal base 2.2 9.2 3.1 9.4 4.2 11.6 2.7 6.4 4.6 10.1 2.9 7.6 5.1 11.2 3.4 8.5 4.0 12.1 4.0 10.8 2.8 8.0 5.2 12.7 4.2 10.3 2.6 7.6 3.5 9.2 Internal primary branch 5.0 20.9 7.0 20.8 7.8 21.6 9.0 21.1 10.1 22.3 7.1 18.8 10.1 22.5 8.1 20.3 7.0 21.1 7.3 19.8 5.8 16.3 8.2 20.0 8.6 21.2 6.3 18.5 7.9 20.5 Internal secondary branch 3.9 16.4 5.9 17.5 6.4 17.8 7.3 17.1 8.8 19.3 5.7 15.1 8.6 19.1 7.0 17.6 5.6 16.7 5.7 15.5 4.8 13.4 6.8 16.6 6.5 16.1 5.0 14.7 6.2 16.1 Claw 3 lengths External base 2.2 9.4 3.2 9.5 4.3 12.0 3.3 7.8 3.5 7.7 3.5 9.1 3.5 7.7 4.5 11.2 4.0 12.1 4.0 10.9 2.3 6.6 54.0 131.9 4.7 11.5 4.0 11.9 2.8 7.3 External primary branch 5.8 24.6 7.7 23.2 8.7 24.1 9.2 21.6 10.8 23.8 7.7 20.2 9.9 21.9 10.0 25.0 7.6 22.7 7.6 20.8 5.4 15.3 9.1 22.3 9.3 22.9 6.7 19.8 8.9 23.3 External secondary branch 4.6 19.6 6.3 19.0 6.5 18.1 6.8 16.0 9.4 20.9 5.3 13.8 7.8 17.3 8.3 20.7 5.4 16.1 5.5 15.1 4.6 13.0 6.7 16.4 6.8 16.6 6.0 17.7 8.0 20.8 Internal base 2.0 8.6 3.8 11.5 4.4 12.1 4.9 11.5 3.2 7.1 3.3 8.6 4.7 10.4 4.9 12.2 4.8 14.4 3.8 10.5 2.3 6.4 5.0 12.3 4.7 11.5 3.0 8.7 3.0 7.9 Internal primary branch 5.3 22.3 7.2 21.6 8.5 23.6 9.1 21.3 9.4 20.8 7.2 18.8 9.5 21.1 8.2 20.6 6.8 20.2 6.9 18.8 4.9 13.7 8.4 20.5 9.1 22.4 6.4 18.9 8.1 21.2 Internal secondary branch 3.7 15.4 5.8 17.3 7.2 19.8 6.3 14.9 8.5 18.7 5.9 15.5 7.8 17.2 7.2 18.1 6.1 18.4 5.3 14.3 4.3 12.2 7.5 18.2 7.7 18.8 5.3 15.5 6.1 16.1 Claw 4 lengths Anterior base 3.2 13.5 3.0 9.1 4.9 13.6 3.3 7.7 4.1 9.0 2.5 6.6 5.2 11.6 2.8 7.1 5.5 16.4 3.7 10.0 3.2 8.9 3.1 7.5 2.7 6.7 4.5 13.2 3.2 8.4 Anterior primary branch 5.2 21.9 7.7 23.0 9.4 26.2 10.2 23.9 10.5 23.2 6.7 17.6 11.2 25.0 8.3 20.8 8.8 26.2 6.3 17.1 7.1 20.1 7.2 17.7 7.5 18.3 7.7 22.7 6.7 17.5 Anterior secondary branch 4.2 17.9 6.2 18.4 7.7 21.4 6.0 14.1 8.8 19.4 5.8 15.2 7.9 17.6 6.5 16.2 6.6 19.7 5.6 15.3 4.4 12.4 5.9 14.3 4.1 10.2 6.0 17.6 6.3 16.5 Posterior base 2.6 11.1 4.4 13.2 5.1 14.0 6.6 15.4 3.6 7.9 4.5 11.9 3.7 8.3 4.2 10.4 5.3 15.9 4.4 11.9 2.4 6.8 5.8 14.2 6.2 15.1 3.6 10.5 3.0 7.8 Posterior primary branch 5.9 25.1 9.5 28.5 10.5 29.1 10.5 24.7 13.2 29.1 7.6 19.9 11.9 26.4 9.6 24.0 9.1 27.3 8.9 24.2 7.2 20.3 10.6 26.0 10.6 26.2 8.4 24.7 8.8 23.1 3417 Posterior secondary branch 4.0 16.8 6.1 18.3 7.6 21.0 7.0 16.4 10.8 23.8 6.7 17.6 8.6 19.1 7.2 18.1 6.2 18.7 5.5 15.0 4.8 13.6 7.2 17.6 7.5 18.4 5.5 16.2 6.5 16.9
3418
3419
3420
186
3421 Table S4.44: Litchfield Island
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 415 1040 328 964 481 1070 466 1085 402 984 366 941 293 855 305 903 555 1162 254 743 409 1017 386 1017 311 908 194 764 362 1040 344 969 317 939 329 941 313 961 380 1113 428 1172 Buccopharyngeal tube Buccal tube length 39.9 – 34.0 – 45.0 – 43.0 – 40.9 – 38.9 – 34.3 – 33.8 – 47.8 – 34.1 – 40.3 – 37.9 – 34.2 – 25.4 – 34.8 – 35.5 – 33.8 – 35.0 – 32.6 – 34.1 – 36.5 – Stylet support insertion point 31.0 77.7 25.8 75.7 31.6 70.3 33.3 77.5 32.0 78.3 30.7 79.0 27.2 79.3 26.2 77.5 37.3 78.0 26.0 76.2 34.0 84.4 29.8 78.5 25.6 74.7 18.4 72.5 27.3 78.5 27.5 77.3 25.3 74.9 27.0 77.2 25.0 76.5 28.0 82.1 28.9 79.1 Buccal tube external width 3.7 9.3 3.0 8.8 4.0 8.8 4.9 11.4 3.5 8.5 3.8 9.8 3.2 9.3 3.3 9.8 4.5 9.5 3.1 9.1 4.3 10.8 3.5 9.3 3.1 9.0 2.4 9.4 3.1 9.0 2.8 8.0 2.9 8.7 3.2 9.1 3.1 9.4 4.2 12.3 3.6 9.8 Buccal tube internal width 2.2 5.5 2.0 6.0 2.9 6.4 3.5 8.1 2.3 5.6 2.0 5.0 1.8 5.3 2.2 6.4 3.5 7.4 2.2 6.4 2.6 6.3 2.1 5.5 2.0 5.7 1.6 6.3 2.4 6.8 1.5 4.1 1.8 5.2 2.1 6.0 2.4 7.3 2.6 7.6 3.0 8.2 Ventral lamina length 17.0 49.6 12.5 49.2 16.3 46.7 16.5 46.4 17.1 50.5 16.5 47.2 14.1 43.1 Placoid lengths Macroplacoid 1 6.1 15.2 4.7 13.8 5.3 11.8 7.3 17.0 5.7 14.0 6.7 17.2 3.7 10.6 4.4 12.9 6.2 13.0 3.7 10.9 6.1 15.1 5.0 13.2 3.6 10.6 2.6 10.2 4.5 12.8 4.3 12.1 4.8 14.1 4.3 12.3 4.6 14.1 4.8 14.0 5.4 14.8 Macroplacoid 2 4.1 10.3 4.1 12.0 4.8 10.7 4.1 9.6 5.4 13.2 4.9 12.6 3.6 10.5 4.3 12.8 5.9 12.3 3.4 10.1 4.3 10.6 3.8 10.1 3.7 10.7 2.9 11.4 4.1 11.8 3.6 10.2 3.8 11.3 3.8 10.9 4.3 13.1 4.1 12.1 4.3 11.9 Macroplacoid 3 4.4 11.1 3.7 11.0 4.9 10.9 5.4 12.5 6.5 16.0 4.5 11.6 4.9 14.3 4.2 12.4 4.2 8.7 3.8 11.2 5.5 13.6 4.9 12.8 3.2 9.4 2.7 10.7 4.2 12.0 4.1 11.6 3.6 10.7 3.8 10.8 4.5 13.7 4.0 11.7 4.8 13.0 Microplacoid 2.5 6.3 2.8 8.3 3.9 8.6 3.9 9.0 2.8 6.8 3.4 8.7 2.2 6.4 2.8 8.2 3.0 6.3 2.5 7.3 2.7 6.8 2.8 7.3 2.6 7.5 1.8 7.0 2.9 8.3 2.3 6.5 2.0 6.0 2.3 6.5 1.9 5.7 2.7 8.0 2.7 7.4 Macroplacoid row 17.5 43.7 13.5 39.5 17.9 39.8 20.4 47.5 18.2 44.5 18.0 46.3 14.3 41.8 15.2 44.8 19.1 40.0 12.5 36.5 17.1 42.5 15.4 40.7 12.4 36.1 9.8 38.3 14.9 42.8 14.0 39.4 13.8 40.8 14.4 41.0 14.3 43.8 14.8 43.5 17.8 48.6 Placoid row 20.8 52.2 16.5 48.5 22.3 49.5 25.5 59.3 21.9 53.6 21.7 55.9 16.6 48.5 18.0 53.2 23.8 49.8 15.7 45.9 20.5 51.0 18.4 48.6 16.2 47.3 11.8 46.5 18.3 52.4 17.2 48.4 16.6 49.2 17.1 48.8 16.6 50.8 18.1 53.1 19.9 54.6 Claw 1 lengths External base 3.3 7.7 2.9 7.2 2.9 8.5 3.1 9.3 3.9 8.1 2.3 6.8 3.2 7.9 3.3 8.8 2.6 7.5 2.3 9.2 2.9 8.4 3.1 8.7 2.5 7.6 2.3 6.8 2.6 7.1 External primary branch 9.0 20.9 9.2 22.4 7.1 20.7 6.9 20.5 8.6 17.9 6.6 19.5 9.0 22.3 7.8 20.5 6.5 19.1 6.5 25.5 7.8 22.3 6.4 18.1 7.3 21.0 6.2 18.9 7.1 20.9 8.0 21.9 External secondary branch 6.9 16.1 6.9 16.9 5.9 17.1 5.7 16.8 7.0 14.6 5.3 15.4 7.5 18.6 6.2 16.4 5.2 15.1 4.2 16.4 6.4 18.5 5.7 16.3 4.8 14.6 5.4 15.7 4.6 12.6 Internal base 3.0 8.8 4.4 9.8 4.0 9.2 3.1 7.7 2.5 7.2 3.3 9.7 3.6 7.5 1.6 4.8 4.0 9.9 3.1 8.2 3.0 8.8 2.4 9.3 2.8 8.0 2.6 7.2 2.4 7.4 2.6 7.6 2.5 6.8 Internal primary branch 6.0 17.5 8.6 19.0 7.1 16.4 8.1 19.8 6.6 19.3 6.4 18.9 8.6 18.0 6.0 17.6 8.4 21.0 5.8 15.2 6.2 18.1 5.4 21.3 7.2 20.6 5.2 14.7 7.2 20.6 5.9 18.0 6.3 18.4 6.3 17.2 Internal secondary branch 4.7 13.9 5.6 12.5 5.5 12.8 6.3 15.5 4.7 13.6 4.6 13.6 6.4 13.4 4.3 12.5 6.1 15.1 3.9 10.3 4.2 12.1 3.1 12.0 5.5 15.9 4.6 13.1 4.5 12.9 4.3 13.1 5.4 15.7 5.7 15.7 Claw 2 lengths External base 3.3 8.2 4.0 9.3 4.2 10.2 4.0 11.9 5.4 11.2 4.8 11.9 3.7 9.7 2.8 8.3 2.1 8.3 3.2 9.2 2.6 7.6 2.3 6.7 2.3 6.9 2.6 7.6 3.3 9.1 External primary branch 9.0 22.5 8.0 18.6 9.1 22.3 8.1 24.0 12.0 25.0 9.0 22.2 8.2 21.7 7.3 21.3 5.1 20.1 8.0 23.1 7.6 21.3 8.1 24.0 8.1 23.1 6.3 19.2 7.7 22.6 7.6 20.7 External secondary branch 7.1 17.8 6.8 15.8 7.6 18.5 6.0 17.7 9.4 19.7 7.1 17.6 6.4 17.0 6.3 18.4 3.2 12.7 6.3 18.2 5.9 16.5 6.0 17.9 6.0 17.3 5.1 15.5 6.9 20.3 6.1 16.6 Internal base 4.5 11.3 3.5 10.2 3.8 8.8 3.5 8.5 3.5 8.9 3.6 10.6 4.6 9.7 3.8 9.4 3.3 8.8 2.7 7.8 1.8 7.1 2.9 8.3 2.3 6.9 2.5 7.0 2.8 8.6 3.2 9.3 3.3 9.1 Internal primary branch 7.4 18.5 6.2 18.1 7.3 17.0 9.0 22.0 9.1 23.4 7.7 22.8 8.7 18.1 8.1 20.1 7.5 19.7 7.2 21.1 4.4 17.3 7.9 22.8 6.9 19.4 8.0 23.8 7.2 20.5 6.0 18.5 7.5 22.0 7.6 20.7 Internal secondary branch 6.4 16.1 4.2 12.3 5.9 13.8 6.6 16.1 6.7 17.2 5.7 16.7 5.7 12.0 6.0 14.9 5.2 13.7 5.3 15.3 3.6 14.2 5.9 16.9 5.1 14.4 6.1 18.0 5.4 15.5 4.7 14.3 6.6 19.4 5.4 14.7 Claw 3 lengths External base 4.5 11.3 4.8 11.2 2.8 6.9 4.2 12.5 2.5 7.4 3.8 9.5 3.1 8.1 2.6 7.7 2.1 8.4 3.2 9.3 2.5 7.4 2.3 6.6 2.5 7.8 2.9 8.4 2.9 7.9 External primary branch 8.6 21.6 9.2 21.5 8.6 21.0 7.0 20.6 5.3 15.7 8.3 20.6 7.8 20.5 6.5 18.8 5.4 21.2 7.1 20.4 7.3 20.4 8.7 25.7 8.0 22.7 6.6 20.3 7.5 21.8 7.9 21.5 External secondary branch 6.6 16.6 8.2 19.0 7.3 18.0 5.4 16.1 3.9 11.4 7.8 19.3 6.9 18.3 5.3 15.5 4.0 15.6 5.4 15.4 5.5 15.6 6.0 17.9 5.3 15.1 5.3 16.2 7.1 20.8 6.0 16.5 Internal base 4.7 11.7 4.0 9.2 3.4 8.3 3.7 10.9 2.2 6.6 3.1 7.8 4.0 10.6 3.1 9.0 1.8 7.2 2.4 7.0 2.3 6.7 2.9 8.1 2.7 8.1 3.0 8.9 2.7 7.5 Internal primary branch 8.3 20.8 8.0 18.6 8.4 20.6 6.8 20.1 5.4 15.7 7.4 18.4 6.0 15.8 6.6 19.4 5.6 21.9 6.8 19.6 6.7 18.9 6.5 19.4 7.5 21.4 6.5 19.8 7.3 21.3 6.2 17.1 Internal secondary branch 6.4 16.1 6.5 15.1 6.5 15.9 5.2 15.4 3.8 11.0 5.1 12.5 4.5 11.9 4.8 14.0 3.9 15.1 4.8 13.8 5.2 14.7 6.3 18.5 6.6 18.7 5.0 15.4 5.9 17.2 5.2 14.4 Claw 4 lengths Anterior base 2.9 7.3 2.4 7.1 3.6 8.0 4.5 10.4 3.8 9.2 3.8 9.9 3.2 9.6 3.0 6.2 2.6 7.5 3.6 8.9 3.1 8.2 2.6 7.6 2.2 8.7 2.5 7.1 2.7 7.7 2.5 7.5 2.4 6.7 2.7 8.3 2.2 6.3 2.8 7.6 Anterior primary branch 6.7 16.7 4.9 14.4 6.1 13.5 8.9 20.7 10.6 25.8 7.7 19.7 7.9 23.3 8.9 18.7 6.9 20.2 10.1 25.2 6.8 17.9 8.1 23.7 5.7 22.2 10.1 28.9 8.5 24.0 6.9 20.4 7.5 21.5 8.0 24.6 8.3 24.2 9.2 25.2 Anterior secondary branch 6.0 14.9 4.5 13.2 5.9 13.1 7.4 17.1 8.5 20.9 6.0 15.5 5.4 16.1 8.0 16.7 4.2 12.4 7.7 19.1 6.0 15.9 6.4 18.8 4.2 16.4 7.1 20.4 5.7 16.0 5.2 15.4 5.7 16.2 5.4 16.6 6.3 18.4 7.5 20.4 Posterior base 3.9 9.7 2.9 8.6 3.4 7.4 5.9 13.6 3.2 7.8 3.0 7.6 3.3 9.5 2.7 7.9 3.5 7.4 2.2 6.5 3.4 8.5 5.2 13.6 2.5 7.2 2.1 8.3 2.0 5.8 3.2 9.1 2.1 6.1 2.9 8.2 3.0 9.2 3.1 9.0 3.0 8.3 Posterior primary branch 8.1 20.4 6.0 17.5 7.7 17.2 11.3 26.4 10.7 26.2 7.8 20.1 5.1 15.0 8.4 24.9 10.0 20.9 7.2 21.0 10.7 26.7 7.6 20.1 8.4 24.6 5.8 22.9 10.6 30.4 8.8 24.7 7.5 22.2 7.7 22.0 8.0 24.5 8.4 24.5 9.4 25.6 3422 Posterior secondary branch 6.2 15.5 5.0 14.8 5.7 12.7 8.4 19.7 7.1 17.3 6.7 17.1 4.4 12.9 5.8 17.1 8.5 17.7 5.5 16.1 7.5 18.6 5.7 15.0 6.0 17.4 4.4 17.3 6.8 19.5 6.3 17.8 5.5 16.1 5.4 15.3 6.2 19.0 7.0 20.6 6.6 18.2
3423
3424
3425
3426
3427 187
3428 Table S4.45: Half-Moon Island
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 201 835 354 1011 302 957 288 814 296 799 374 980 399 1031 192 695 305 909 314 855 186 748 219 770 197 743 276 871 262 850 201 753 226 716 276 823 360 993 381 916 200 887 211 804 184 755 274 833 202 704 413 898 283 798 218 803 233 751 204 794 Buccopharyngeal tube Buccal tube length 24.0 – 35.0 – 31.5 – 35.4 – 37.0 – 38.2 – 38.7 – 27.7 – 33.6 – 36.7 – 24.9 – 28.4 – 26.5 – 31.7 – 30.8 – 26.7 – 31.6 – 33.5 – 36.2 – 41.6 – 22.6 – 26.2 – 24.4 – 32.9 – 28.8 – 46.0 – 35.5 – 27.1 – 31.0 – 25.6 – Stylet support insertion point 18.3 76.2 26.8 76.7 23.9 75.7 27.7 78.3 27.6 74.6 29.4 76.9 29.2 75.3 20.9 75.6 24.6 73.1 28.1 76.5 18.5 74.4 22.2 78.1 20.2 76.5 23.8 74.9 22.8 74.0 20.3 75.9 24.3 76.9 25.7 76.7 27.2 75.0 31.8 76.4 17.3 76.8 18.6 70.8 18.2 74.6 26.0 79.1 21.8 75.6 35.8 77.9 27.1 76.4 20.6 76.1 23.5 75.8 19.5 76.0 Buccal tube external width 3.4 14.0 4.8 13.8 4.9 15.5 5.1 14.3 4.5 12.1 5.1 13.4 5.0 12.8 3.5 12.7 4.4 13.1 5.0 13.7 3.4 13.6 3.8 13.3 3.7 13.9 4.3 13.6 4.5 14.7 3.8 14.3 4.5 14.3 4.3 12.8 5.7 15.7 5.4 13.1 3.7 16.3 4.0 15.3 3.9 16.0 4.5 13.7 3.4 11.9 6.7 14.5 4.7 13.2 3.4 12.4 4.5 14.5 3.8 14.7 Buccal tube internal width 2.5 10.3 3.2 9.2 3.8 12.0 3.5 9.9 3.4 9.1 3.5 9.1 3.2 8.4 2.1 7.5 2.7 7.9 3.4 9.2 1.9 7.7 2.3 8.0 2.1 8.0 2.7 8.6 3.2 10.5 2.2 8.4 2.7 8.6 2.7 8.1 3.5 9.7 3.9 9.4 2.1 9.1 2.6 9.8 2.3 9.4 3.2 9.7 1.9 6.5 4.0 8.7 2.8 8.0 1.9 6.9 2.9 9.5 2.3 8.8 Ventral lamina length 11.0 45.6 17.2 49.2 16.2 51.3 16.9 47.8 19.9 53.7 19.1 50.1 21.5 55.5 15.8 57.1 16.7 49.7 18.6 50.6 11.3 45.5 16.8 59.0 14.7 55.4 16.1 50.6 16.2 52.5 14.8 55.5 20.4 64.4 17.2 51.3 19.3 53.1 21.9 52.7 9.7 43.2 14.4 55.0 12.6 51.6 18.6 56.4 14.3 49.8 24.9 54.2 19.7 55.7 16.2 59.8 19.8 63.9 14.0 54.5 Placoid lengths Macroplacoid 1 4.1 17.0 5.8 16.6 3.7 11.7 5.5 15.5 6.0 16.1 6.0 15.6 5.1 13.0 3.5 12.6 5.5 16.3 4.3 11.8 3.0 11.9 3.3 11.5 3.7 13.8 5.2 16.4 3.9 12.5 3.3 12.2 4.2 13.2 4.7 13.9 4.9 13.5 5.6 13.5 3.2 14.4 3.7 14.0 3.1 12.7 5.2 15.9 3.8 13.2 7.7 16.8 4.6 13.0 3.1 11.5 4.2 13.5 3.7 14.2 Macroplacoid 2 3.5 14.4 3.8 10.8 3.9 12.2 4.1 11.6 4.3 11.6 4.3 11.3 5.4 14.0 3.0 10.8 3.7 10.9 5.0 13.5 2.2 8.7 2.9 10.3 3.2 12.2 3.3 10.5 3.8 12.4 3.0 11.0 3.9 12.5 3.8 11.3 4.9 13.4 5.3 12.7 3.0 13.2 3.3 12.4 3.2 13.3 4.6 13.9 2.6 9.0 6.3 13.6 3.9 10.9 3.2 11.7 3.2 10.3 2.7 10.4 Macroplacoid 3 3.5 14.5 5.0 14.2 3.9 12.3 4.1 11.7 4.5 12.1 4.5 11.9 4.4 11.4 2.8 10.2 3.7 10.9 4.8 13.0 2.6 10.3 2.8 9.9 3.2 12.2 3.5 11.2 3.8 12.5 3.4 12.6 3.7 11.8 3.7 11.1 4.6 12.6 4.4 10.5 3.3 14.6 3.6 13.8 3.4 14.1 3.8 11.7 3.0 10.5 5.7 12.4 4.0 11.2 3.3 12.2 3.2 10.2 3.0 11.8 Microplacoid 2.2 9.1 3.0 8.5 2.7 8.5 3.0 8.6 2.6 7.1 2.3 5.9 2.6 6.8 1.5 5.5 2.2 6.6 3.4 9.2 1.7 6.9 1.9 6.8 2.1 7.8 2.0 6.2 3.8 12.5 1.6 6.1 2.7 8.4 2.3 7.0 3.3 9.0 3.2 7.8 2.0 8.7 2.8 10.7 2.1 8.4 2.4 7.3 2.0 6.8 3.3 7.2 2.2 6.3 2.2 8.0 2.1 6.6 1.7 6.7 Macroplacoid row 12.7 53.0 16.9 48.2 14.7 46.5 15.8 44.5 16.4 44.2 17.5 45.9 17.9 46.3 11.3 40.8 14.9 44.4 17.3 47.2 10.8 43.3 11.5 40.5 11.6 44.0 15.3 48.3 16.2 52.8 11.5 42.9 14.1 44.6 15.9 47.3 18.6 51.3 20.0 48.0 11.9 52.7 13.4 51.2 11.6 47.4 15.6 47.2 12.2 42.4 21.9 47.7 15.1 42.7 11.5 42.6 12.6 40.6 11.1 43.2 Placoid row 15.4 63.9 20.4 58.4 17.9 56.7 20.1 56.7 19.2 51.9 21.2 55.4 21.8 56.2 13.5 48.7 17.9 53.1 21.2 57.7 13.1 52.8 13.7 48.0 14.3 54.1 18.1 56.9 19.8 64.4 13.0 48.7 17.1 53.9 18.8 56.2 22.2 61.3 23.4 56.3 14.7 65.3 16.7 63.5 13.8 56.7 18.5 56.1 14.5 50.4 26.4 57.4 17.8 50.1 13.6 50.3 15.4 49.8 12.7 49.7 Claw 1 lengths External base 3.3 13.9 2.8 8.0 2.4 7.6 3.6 10.2 3.2 8.6 3.7 9.6 4.0 10.4 2.9 10.5 3.3 9.9 2.3 6.1 2.7 10.9 2.3 8.2 3.2 12.2 3.4 10.6 3.4 10.9 3.0 11.0 2.9 9.2 2.4 7.0 3.9 10.7 4.0 9.7 3.6 16.0 2.9 11.1 2.7 11.1 3.6 10.8 2.0 6.8 5.0 10.9 3.5 9.8 2.6 9.6 2.5 7.9 2.9 11.3 External primary branch 5.6 23.3 7.9 22.6 5.2 16.4 4.8 13.5 7.2 19.5 7.6 19.8 8.9 23.0 5.0 18.1 6.6 19.7 6.9 18.7 6.4 25.8 6.8 23.7 6.0 22.8 7.2 22.6 5.8 18.7 5.5 20.5 6.0 19.0 6.1 18.3 7.7 21.1 7.4 17.8 6.0 26.7 5.7 21.5 6.4 26.3 7.4 22.5 5.2 18.0 7.3 15.9 5.4 15.3 5.6 20.7 5.1 16.6 6.0 23.2 External secondary branch 4.2 17.6 5.7 16.3 4.6 14.7 4.3 12.2 5.8 15.8 6.3 16.5 7.0 18.1 4.3 15.7 5.1 15.3 5.7 15.6 4.7 19.1 5.7 19.9 4.9 18.6 5.9 18.7 4.4 14.4 4.0 15.0 5.1 16.1 5.9 17.7 5.9 16.3 6.5 15.6 4.5 19.8 5.1 19.2 4.2 17.2 6.5 19.6 4.7 16.5 6.0 13.0 4.0 11.4 4.1 15.2 4.6 14.9 4.3 16.9 Internal base 2.9 12.2 2.8 8.1 2.2 7.0 2.8 7.8 3.5 9.5 3.5 9.3 3.0 7.7 2.6 9.4 2.7 8.0 2.7 7.3 2.0 8.0 2.9 10.2 1.7 6.4 3.3 10.3 2.7 8.8 3.2 11.9 2.4 7.6 2.6 7.6 3.1 8.7 3.6 8.6 3.2 14.0 2.1 8.0 3.2 13.1 3.0 9.1 2.0 6.9 3.8 8.2 1.9 6.9 2.9 9.3 2.8 10.7 Internal primary branch 5.3 22.1 7.7 22.0 4.7 14.9 4.8 13.4 6.8 18.3 6.9 18.0 8.7 22.4 4.8 17.3 6.5 19.4 6.8 18.4 5.9 23.7 5.7 20.1 5.5 20.9 6.6 20.7 5.1 16.6 5.1 18.9 5.9 18.6 5.9 17.5 7.5 20.8 6.9 16.6 5.5 24.5 5.6 21.4 5.0 20.6 7.2 21.9 5.0 17.2 6.4 13.9 4.3 15.9 4.1 13.2 5.1 19.9 Internal secondary branch 3.8 15.7 6.2 17.7 4.6 14.7 3.9 11.1 6.3 16.9 5.7 14.8 6.7 17.3 3.8 13.9 5.1 15.3 5.7 15.5 4.0 16.2 4.4 15.4 3.7 14.1 5.2 16.4 4.1 13.2 3.7 14.0 5.0 15.7 4.4 13.2 5.1 14.1 5.6 13.5 3.8 17.0 4.9 18.8 3.4 14.1 5.9 17.8 4.2 14.7 4.4 9.6 3.6 13.1 3.9 12.7 4.4 17.2 Claw 2 lengths External base 3.6 14.8 3.0 8.5 3.7 11.6 2.9 8.3 3.4 9.2 4.0 10.4 3.7 9.7 1.9 6.9 3.9 11.7 3.8 10.3 3.1 12.6 3.1 10.9 3.1 11.7 3.8 11.9 3.4 11.1 2.5 9.3 3.4 10.6 3.4 10.2 3.9 10.8 4.1 9.8 3.1 13.9 3.5 13.3 3.0 12.2 3.9 11.7 2.7 9.5 3.9 8.4 3.0 8.5 2.2 8.0 2.3 7.5 2.3 9.0 External primary branch 6.3 26.1 9.6 27.6 6.4 20.4 6.9 19.4 6.8 18.4 8.7 22.7 8.8 22.8 5.0 18.2 7.2 21.4 7.8 21.1 5.2 21.1 6.1 21.4 5.4 20.4 8.1 25.6 8.2 26.5 5.4 20.1 6.4 20.1 6.6 19.6 8.8 24.2 8.0 19.2 6.4 28.5 6.0 23.0 6.4 26.4 7.7 23.3 5.0 17.5 8.8 19.2 6.0 17.0 5.9 21.8 5.3 17.0 4.4 17.2 External secondary branch 5.0 20.7 6.8 19.4 4.7 14.8 5.6 15.8 5.5 14.8 6.4 16.7 7.2 18.6 4.0 14.3 6.1 18.3 6.6 17.9 4.0 15.9 4.9 17.3 4.3 16.1 7.4 23.2 6.6 21.4 4.0 15.1 4.1 13.1 5.9 17.6 7.1 19.7 6.7 16.2 5.0 22.0 5.6 21.3 4.6 19.0 6.7 20.2 4.3 15.0 7.1 15.3 4.0 11.4 5.2 19.1 4.4 14.1 4.1 16.1 Internal base 2.8 11.7 3.4 9.6 2.9 9.0 3.1 8.7 4.1 11.0 3.7 9.8 3.2 8.4 2.4 8.6 2.6 7.9 3.5 9.5 3.3 13.3 3.1 10.9 2.6 10.0 2.6 8.2 3.5 11.4 2.1 7.7 2.3 7.3 2.9 8.7 3.6 9.9 3.6 8.7 3.3 14.7 3.4 13.9 2.6 8.0 1.9 6.7 2.9 6.3 2.9 8.0 2.9 10.7 2.6 8.4 2.5 9.7 Internal primary branch 5.4 22.6 8.1 23.2 5.4 17.0 6.4 18.2 6.4 17.2 8.3 21.8 8.4 21.7 4.8 17.3 6.7 20.0 7.0 19.1 5.0 20.0 4.9 17.3 5.3 19.8 6.7 21.1 7.9 25.6 4.8 17.8 5.8 18.3 6.2 18.6 8.1 22.3 7.6 18.3 5.7 25.3 5.2 21.3 7.2 21.8 4.9 17.0 7.5 16.2 5.9 16.6 5.8 21.5 4.7 15.2 4.2 16.3 Internal secondary branch 4.4 18.3 6.8 19.4 5.2 16.5 5.6 15.7 4.8 12.9 7.3 19.0 7.0 18.1 4.4 15.9 5.2 15.4 5.6 15.3 3.7 14.8 4.5 15.8 4.0 15.0 6.1 19.2 6.5 21.0 3.8 14.4 4.4 13.9 5.1 15.2 6.6 18.3 6.3 15.1 4.4 19.3 3.9 16.1 6.0 18.1 4.4 15.4 5.7 12.3 4.8 13.6 4.5 16.7 3.7 12.1 3.5 13.8 Claw 3 lengths External base 3.1 12.9 3.8 10.9 3.6 11.4 4.1 11.4 3.2 8.8 3.9 10.1 4.7 12.2 1.9 6.9 3.5 10.4 3.4 9.2 3.0 11.9 2.5 8.6 2.7 10.1 4.0 12.5 3.5 11.3 3.6 13.5 4.0 12.5 3.3 9.9 4.3 11.7 4.9 11.7 3.1 13.7 3.5 13.2 3.0 12.2 2.5 7.5 3.4 11.8 4.8 10.4 3.5 10.0 2.4 8.8 2.6 8.4 2.8 11.0 External primary branch 6.5 27.2 8.9 25.3 6.4 20.3 7.2 20.3 7.3 19.8 8.5 22.2 9.1 23.4 5.2 18.6 7.3 21.8 8.5 23.0 5.9 23.9 6.1 21.5 5.9 22.2 7.6 23.9 8.4 27.4 6.1 22.9 6.6 20.9 7.0 21.0 8.8 24.3 8.9 21.4 6.4 28.4 6.6 25.1 6.1 25.2 8.3 25.2 5.8 20.2 8.8 19.1 6.2 17.5 4.8 17.6 5.3 17.2 6.2 24.2 External secondary branch 4.9 20.4 6.8 19.4 4.8 15.1 5.8 16.2 4.8 12.9 6.5 16.9 7.4 19.0 4.2 15.2 5.5 16.4 6.9 18.6 4.4 17.9 5.7 19.9 4.2 15.7 7.1 22.2 7.6 24.8 4.9 18.3 4.7 14.9 5.7 17.0 7.5 20.8 7.5 17.9 4.4 19.5 5.7 21.7 4.6 18.7 6.7 20.4 4.7 16.3 7.4 16.0 4.5 12.6 4.0 14.7 4.3 13.8 4.3 16.7 Internal base 2.5 10.6 3.1 8.8 2.6 8.2 3.3 9.2 3.1 8.3 3.5 9.1 4.3 11.1 1.6 5.9 3.4 10.2 3.2 8.7 2.8 11.4 1.9 6.7 1.9 7.3 2.5 7.7 3.7 12.0 3.5 13.1 3.2 9.4 2.7 7.5 4.0 9.6 2.6 11.5 3.5 13.3 2.9 11.9 3.1 9.3 2.3 7.8 4.3 9.2 2.6 9.4 2.0 6.3 2.7 10.3 Internal primary branch 5.2 21.5 8.4 24.1 6.0 18.9 6.8 19.2 6.5 17.7 8.2 21.5 7.5 19.4 5.0 18.0 6.2 18.5 7.4 20.0 4.8 19.2 5.8 20.3 5.6 21.2 7.3 23.0 7.4 24.2 5.4 20.1 6.6 19.6 8.7 23.9 6.7 16.2 5.3 23.6 5.6 21.4 5.8 23.9 7.8 23.6 5.2 18.2 8.1 17.6 4.6 17.0 4.9 15.9 4.8 18.7 Internal secondary branch 4.1 17.0 6.6 18.8 4.6 14.6 5.3 14.9 5.8 15.8 6.5 17.0 6.6 17.0 3.8 13.7 5.3 15.8 6.0 16.4 4.2 16.7 4.1 14.4 4.5 16.8 6.3 19.8 6.0 19.4 3.3 12.2 4.6 13.7 6.3 17.4 6.4 15.3 4.0 17.5 3.9 14.9 3.3 13.6 5.8 17.5 4.2 14.6 6.1 13.2 3.8 13.8 4.2 13.4 4.0 15.7 Claw 4 lengths Anterior base 2.8 11.8 3.0 8.6 3.1 10.0 4.4 12.4 3.2 8.5 3.8 9.9 3.3 8.6 3.3 12.0 3.7 10.9 4.9 13.3 2.6 10.5 2.5 8.7 3.0 11.2 4.1 12.9 4.1 13.3 2.4 8.8 2.9 9.0 3.3 10.0 4.9 13.4 3.4 8.2 3.9 17.4 3.3 12.5 3.0 12.3 3.5 10.5 3.6 12.6 5.7 12.3 2.4 6.7 2.6 9.7 2.7 8.7 2.3 9.0 Anterior primary branch 6.5 26.9 6.7 19.2 6.0 18.9 6.8 19.2 7.1 19.2 9.1 23.8 8.6 22.1 5.5 19.8 6.9 20.5 8.9 24.3 5.5 22.1 5.6 19.8 5.5 20.7 5.8 18.3 6.9 22.4 4.2 15.8 6.9 21.8 6.1 18.1 8.7 23.9 8.7 20.9 5.2 23.0 5.3 20.2 6.5 26.7 8.1 24.4 5.9 20.4 11.2 24.3 6.2 17.4 4.8 17.8 5.0 16.0 5.3 20.5 Anterior secondary branch 4.6 19.2 5.9 17.0 5.3 16.7 6.3 17.7 6.3 17.0 7.8 20.4 7.3 18.7 4.5 16.2 5.3 15.7 6.9 18.7 4.8 19.1 4.7 16.4 4.3 16.1 4.5 14.2 6.5 21.2 3.8 14.3 5.1 16.1 5.1 15.1 7.1 19.7 6.7 16.1 4.6 20.4 4.4 16.9 5.9 24.0 6.5 19.6 4.0 14.0 9.6 20.8 4.9 13.8 3.7 13.7 3.8 12.3 4.3 16.6 Posterior base 2.7 11.2 3.3 9.5 4.2 13.4 4.3 12.0 4.8 13.1 4.0 10.4 4.0 10.3 2.6 9.5 4.8 14.3 3.8 10.2 3.8 15.5 2.5 8.7 4.3 16.1 4.2 13.2 3.3 10.6 2.0 7.6 2.8 8.8 3.2 9.6 5.5 15.1 3.6 8.5 4.1 18.0 3.0 11.5 3.2 13.1 5.0 15.2 3.4 11.6 5.7 12.5 3.1 8.7 3.4 12.6 3.7 12.0 3.7 14.6 Posterior primary branch 6.6 27.5 8.0 22.9 6.2 19.6 8.3 23.5 8.4 22.7 9.2 24.2 9.3 24.1 6.5 23.4 8.7 25.8 9.2 24.9 6.4 25.8 5.9 20.6 6.9 25.9 6.9 21.7 8.0 26.0 4.4 16.4 8.7 27.3 6.6 19.8 9.5 26.3 8.9 21.4 5.4 23.8 6.7 25.4 7.0 28.6 8.4 25.4 6.5 22.5 12.8 27.8 7.4 21.0 6.1 22.6 6.6 21.3 6.8 26.5 3429 Posterior secondary branch 5.3 22.1 6.4 18.3 4.1 12.9 5.8 16.5 7.7 20.7 7.5 19.6 7.1 18.3 4.7 16.9 6.2 18.5 6.8 18.4 4.0 16.0 4.0 14.0 5.3 20.2 6.7 21.1 5.0 16.2 3.5 12.9 6.7 21.1 5.5 16.5 7.2 19.7 7.0 16.7 5.0 22.2 5.5 20.8 5.2 21.3 6.7 20.3 6.1 21.2 10.1 21.9 5.6 15.8 4.4 16.4 5.2 16.7 4.5 17.5
3430
3431
3432
3433
3434
188
3435 Table S4.46: Kerr Point, Ronge Island
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 344 758 364 891 327 840 366 791 357 919 447 1051 359 789 281 780 440 1011 340 853 365 891 405 994 504 1118 319 844 353 960 187 622 356 838 218 808 440 962 289 909 255 945 488 1181 391 916 328 906 Buccopharyngeal tube Buccal tube length 45.3 – 40.9 – 39.0 – 46.3 – 38.9 – 42.6 – 45.5 – 36.1 – 43.5 – 39.8 – 41.0 – 40.7 – 45.1 – 37.9 – 36.8 – 30.2 – 42.4 – 27.0 – 45.7 – 31.7 – 27.0 – 41.3 – 42.7 – 36.3 – Stylet support insertion point 34.5 76.0 30.7 75.0 29.4 75.4 36.2 78.3 29.8 76.8 32.2 75.7 34.6 76.1 26.1 72.2 33.1 76.0 30.2 75.9 31.6 77.0 30.7 75.3 35.9 79.5 29.2 77.0 28.4 77.3 21.9 72.5 32.2 75.8 21.1 78.2 35.1 76.7 23.8 74.9 20.5 76.1 30.6 74.0 32.6 76.2 26.9 74.1 Buccal tube external width 6.3 13.9 5.1 12.5 5.3 13.6 5.7 12.4 5.6 14.5 5.7 13.3 6.4 14.2 5.4 14.9 5.5 12.6 5.4 13.4 5.3 12.9 6.0 14.6 6.5 14.5 4.6 12.0 6.2 16.9 3.7 12.4 6.6 15.4 4.4 16.1 6.5 14.3 4.3 13.5 3.5 12.8 5.8 14.1 6.4 15.0 4.7 13.0 Buccal tube internal width 4.1 8.9 3.1 7.7 3.2 8.2 3.5 7.6 3.2 8.1 3.5 8.2 4.3 9.5 3.3 9.1 3.9 8.9 3.2 8.0 3.6 8.9 4.1 10.0 4.0 8.9 2.9 7.7 4.1 11.1 2.0 6.6 3.6 8.4 2.3 8.5 4.3 9.4 2.4 7.4 2.3 8.6 4.0 9.6 4.5 10.5 3.2 8.9 Ventral lamina length 28.8 63.5 23.3 56.9 23.4 60.1 27.2 58.8 21.1 54.4 24.3 57.2 26.7 58.6 22.6 62.6 26.1 59.9 23.5 58.9 24.2 59.1 24.9 61.2 28.2 62.5 23.3 61.5 22.6 61.5 18.1 60.2 26.9 63.3 17.0 63.0 27.8 60.8 17.0 53.4 16.8 62.2 24.8 60.1 26.4 61.7 19.1 52.8 Placoid lengths Macroplacoid 1 4.8 10.5 5.4 13.3 6.4 16.4 7.7 16.5 5.9 15.2 7.3 17.1 7.5 16.5 4.9 13.7 5.4 12.3 5.4 13.4 5.6 13.7 5.1 12.5 6.6 14.6 6.4 16.9 5.7 15.5 3.4 11.1 8.0 18.9 4.2 15.6 6.4 13.9 4.8 15.2 3.1 11.4 6.8 16.5 7.9 18.4 4.3 12.0 Macroplacoid 2 3.8 8.5 4.5 10.9 4.1 10.4 5.6 12.1 4.7 12.0 3.8 8.9 5.8 12.8 3.9 10.8 4.2 9.6 3.7 9.4 4.2 10.2 4.6 11.2 4.9 10.9 4.4 11.6 5.2 14.1 3.0 9.8 5.5 13.0 3.8 14.1 5.4 11.7 4.1 12.9 3.1 11.3 4.7 11.3 4.8 11.3 4.3 11.7 Macroplacoid 3 5.9 13.0 4.4 10.7 4.7 12.0 5.3 11.3 4.0 10.2 5.0 11.8 5.9 13.0 4.1 11.3 4.6 10.5 4.5 11.2 4.9 11.8 5.0 12.4 6.7 14.9 4.4 11.7 5.6 15.3 3.2 10.6 6.5 15.2 3.9 14.4 5.6 12.3 4.3 13.4 3.2 12.0 5.5 13.4 7.0 16.4 4.7 13.0 Microplacoid 2.9 6.5 3.4 8.3 3.2 8.3 3.3 7.0 3.6 9.3 3.2 7.4 4.0 8.9 3.1 8.6 3.1 7.1 3.3 8.2 3.1 7.5 3.5 8.7 3.2 7.1 2.5 6.7 2.8 7.5 1.8 6.0 3.1 7.3 2.3 8.5 3.9 8.4 2.4 7.5 2.0 7.3 3.3 7.9 4.2 9.8 2.8 7.7 Macroplacoid row 20.4 45.1 18.1 44.3 19.3 49.5 21.8 47.1 17.1 44.0 21.1 49.6 21.4 47.2 15.4 42.7 20.2 46.5 19.4 48.6 17.5 42.7 19.8 48.6 22.7 50.3 17.5 46.3 18.6 50.6 13.5 44.6 21.4 50.5 14.1 52.3 19.9 43.6 15.4 48.5 11.8 43.8 19.9 48.3 23.6 55.2 15.4 42.5 Placoid row 24.9 54.9 22.8 55.7 22.6 57.9 25.6 55.2 21.6 55.6 26.3 61.7 26.9 59.2 19.2 53.4 24.3 55.8 22.7 57.0 22.1 53.8 23.9 58.8 27.6 61.1 20.7 54.6 22.2 60.4 15.6 51.8 26.5 62.5 17.2 63.8 24.3 53.1 18.8 59.3 13.9 51.6 24.8 60.0 29.1 68.1 18.9 52.1 Claw 1 lengths External base 4.1 9.0 3.3 8.0 4.2 10.6 3.7 7.9 2.3 6.0 3.9 9.1 3.0 6.6 2.6 7.1 3.5 8.1 2.7 6.7 3.6 8.7 3.7 8.1 3.7 9.8 3.0 8.3 2.2 7.2 4.6 10.9 3.5 12.8 4.0 8.7 2.8 8.9 2.8 10.5 4.1 9.8 3.4 8.0 3.3 9.0 External primary branch 9.6 21.2 7.2 17.5 8.0 20.5 8.6 18.6 7.5 19.2 10.4 24.3 10.2 22.3 6.2 17.1 10.2 23.5 7.9 19.9 8.7 21.1 10.8 23.8 7.0 18.6 7.2 19.6 5.2 17.1 9.4 22.2 6.7 24.9 8.5 18.5 6.1 19.3 5.6 20.7 9.9 24.0 9.6 22.4 6.6 18.2 External secondary branch 7.9 17.5 6.0 14.6 7.1 18.2 7.5 16.3 5.6 14.3 7.9 18.7 6.8 15.0 5.1 14.1 6.4 14.6 5.9 14.9 6.5 15.9 7.1 15.8 5.0 13.3 6.0 16.2 4.2 13.9 7.0 16.4 4.6 17.0 7.3 15.9 5.4 17.0 4.4 16.1 8.9 21.5 8.4 19.6 5.2 14.3 Internal base 3.9 8.5 2.7 6.6 3.6 9.3 3.7 8.1 2.2 5.7 3.9 9.2 2.2 6.1 2.8 6.5 3.6 9.0 2.9 7.1 3.3 7.3 4.6 12.0 3.5 9.6 1.9 6.3 2.9 6.8 3.1 11.5 3.3 7.2 2.5 7.9 2.5 9.4 4.7 11.4 2.6 6.1 2.7 7.4 Internal primary branch 8.9 19.6 6.7 16.3 7.7 19.7 8.5 18.5 7.2 18.5 9.5 22.3 7.1 15.6 6.1 17.0 7.4 17.1 6.7 16.7 7.9 19.3 8.4 18.6 6.5 17.0 6.3 17.1 4.3 14.4 8.9 20.9 5.3 19.5 7.9 17.4 6.0 18.7 5.0 18.5 9.6 23.2 9.1 21.3 5.4 15.0 Internal secondary branch 7.3 16.0 5.4 13.2 6.4 16.4 7.4 15.9 4.9 12.7 8.3 19.5 5.5 15.2 6.0 13.8 5.3 13.3 6.3 15.3 7.7 17.1 4.6 12.1 5.9 16.0 3.6 12.0 7.0 16.6 3.8 14.2 6.4 14.0 5.0 15.8 3.2 11.8 8.8 21.4 7.9 18.6 5.0 13.7 Claw 2 lengths External base 4.8 10.5 3.7 9.0 3.7 9.6 4.9 10.6 3.7 9.6 3.9 9.2 3.7 8.2 3.8 8.8 4.6 11.5 4.4 10.7 4.6 11.3 4.7 10.4 3.4 8.9 3.0 8.0 2.3 7.7 4.4 10.4 3.6 13.4 4.9 10.7 3.7 11.8 2.9 10.8 3.7 9.0 5.6 13.1 3.9 10.7 External primary branch 9.5 21.0 7.8 19.0 9.8 25.0 9.1 19.6 8.9 22.8 9.8 23.0 10.5 23.0 10.7 24.6 9.2 23.1 8.9 21.7 9.7 23.9 10.0 22.1 8.1 21.4 6.8 18.4 5.7 18.9 10.1 23.8 6.6 24.5 8.6 18.8 7.1 22.4 5.7 21.1 10.6 25.6 9.7 22.7 5.8 16.0 External secondary branch 8.3 18.3 6.7 16.4 7.4 19.0 8.1 17.6 6.6 17.0 7.8 18.4 7.4 16.3 9.7 22.3 6.5 16.4 8.0 19.4 6.2 15.3 7.8 17.3 5.9 15.6 5.5 14.9 4.1 13.7 7.4 17.3 4.9 18.0 7.2 15.7 5.4 17.0 4.6 16.9 9.2 22.3 8.0 18.6 4.8 13.2 Internal base 4.9 10.8 3.3 8.0 3.7 9.4 4.2 9.0 3.8 9.7 4.6 10.7 3.5 7.8 5.1 11.7 3.8 9.6 3.1 7.4 3.5 8.7 5.9 13.1 3.9 10.4 3.5 9.6 2.6 8.5 3.3 12.1 3.5 7.7 4.2 13.3 2.5 9.2 5.7 13.7 3.4 8.0 3.9 10.6 Internal primary branch 8.7 19.1 6.2 15.2 9.2 23.6 8.8 19.0 8.0 20.7 9.5 22.3 9.6 21.1 8.8 20.3 9.1 22.8 7.3 17.8 8.9 21.8 9.3 20.6 7.4 19.6 6.0 16.4 4.7 15.7 7.9 18.7 6.0 22.0 8.5 18.6 7.1 22.2 5.6 20.8 9.0 21.8 9.5 22.3 5.1 14.0 Internal secondary branch 7.6 16.7 5.2 12.7 6.9 17.6 8.0 17.2 6.3 16.2 8.0 18.7 7.0 15.4 5.9 13.5 6.2 15.4 6.5 15.9 7.5 18.5 6.9 15.3 6.4 16.9 5.6 15.3 3.7 12.2 6.5 15.2 4.1 15.1 7.2 15.7 5.5 17.3 4.3 16.1 8.7 21.0 7.6 17.7 5.2 14.4 Claw 3 lengths External base 4.3 9.5 4.2 10.2 3.8 9.7 4.5 9.7 4.0 10.2 3.5 8.2 2.8 6.2 2.0 5.6 5.9 13.5 3.1 7.9 3.2 7.7 5.4 13.4 4.0 9.0 2.0 5.3 3.0 8.2 2.3 7.6 3.4 8.0 2.6 9.8 3.8 8.4 2.8 8.9 2.8 10.5 6.2 15.0 4.9 11.6 3.2 8.7 External primary branch 9.3 20.5 8.3 20.4 10.3 26.3 9.5 20.6 8.5 21.9 10.5 24.6 10.3 22.7 7.0 19.3 11.6 26.7 8.9 22.4 9.0 22.0 9.6 23.7 10.6 23.5 10.0 26.3 7.4 20.0 6.1 20.4 10.5 24.8 6.0 22.0 8.8 19.1 7.2 22.6 5.7 21.0 10.9 26.4 10.6 24.8 6.3 17.4 External secondary branch 7.3 16.0 6.4 15.7 7.9 20.3 9.2 19.9 7.5 19.2 7.6 17.9 7.3 16.0 5.4 15.0 8.7 19.9 6.8 17.1 7.1 17.3 7.8 19.3 6.9 15.3 5.9 15.7 7.0 19.1 4.5 15.0 8.9 20.9 4.9 18.0 7.9 17.3 5.9 18.5 4.0 14.7 9.3 22.6 9.1 21.3 5.7 15.6 Internal base 3.5 7.8 3.8 9.3 3.6 9.2 4.4 9.5 4.3 11.1 5.2 12.2 3.5 7.7 2.8 7.7 5.9 13.6 3.7 9.4 4.5 11.0 4.1 10.1 2.9 6.5 3.1 8.2 3.6 9.7 1.9 6.3 4.3 10.2 3.1 11.3 3.7 8.0 2.5 8.0 2.7 10.0 4.7 11.4 5.0 11.7 3.5 9.7 Internal primary branch 8.5 18.7 7.4 18.2 9.0 23.0 8.2 17.7 8.5 21.9 10.0 23.4 9.7 21.2 6.5 18.1 10.8 24.9 8.4 21.1 7.6 18.5 8.3 20.3 8.9 19.7 8.7 23.0 6.6 18.0 4.5 14.8 10.1 23.8 5.5 20.3 7.8 17.1 6.7 21.0 5.5 20.3 9.0 21.8 9.2 21.6 5.7 15.8 Internal secondary branch 8.0 17.7 4.3 10.4 6.8 17.4 7.6 16.4 7.0 18.0 6.6 15.6 6.4 14.0 5.7 15.7 7.5 17.2 6.8 17.1 6.3 15.3 7.5 18.3 5.9 13.1 6.9 18.1 5.7 15.4 4.1 13.5 8.5 20.0 4.0 14.9 7.4 16.2 5.2 16.4 4.0 14.7 8.7 21.2 7.9 18.4 5.7 15.8 Claw 4 lengths Anterior base 5.0 11.1 4.6 11.2 3.5 9.1 3.9 8.3 3.4 8.8 6.3 14.8 3.0 6.6 4.5 12.4 4.3 9.9 3.9 9.8 3.4 8.3 5.7 13.9 6.0 13.2 3.4 9.1 3.7 10.0 3.1 10.1 3.3 7.7 3.9 14.2 4.3 9.5 3.4 10.7 2.3 8.4 4.6 11.1 4.8 11.3 3.2 8.8 Anterior primary branch 11.5 25.4 8.5 20.8 8.4 21.7 11.1 24.0 8.5 21.8 10.7 25.0 9.6 21.0 8.3 23.1 10.3 23.6 8.6 21.6 10.6 26.0 10.7 26.3 10.4 22.9 8.5 22.5 8.0 21.7 5.8 19.1 8.8 20.6 7.3 26.9 9.0 19.6 6.5 20.5 5.0 18.6 10.6 25.6 11.3 26.5 5.9 16.4 Anterior secondary branch 8.4 18.5 6.4 15.6 6.8 17.3 8.4 18.1 6.4 16.6 8.5 20.0 7.9 17.3 5.4 15.1 9.1 20.9 6.8 17.1 6.7 16.4 6.6 16.1 7.1 15.7 5.9 15.7 6.6 18.0 4.7 15.6 7.7 18.2 5.2 19.1 8.5 18.6 5.8 18.3 3.6 13.3 8.8 21.3 9.1 21.4 5.5 15.2 Posterior base 5.7 12.6 4.0 9.7 4.0 10.2 2.9 6.2 4.6 11.9 5.5 12.8 3.7 8.1 4.4 12.1 6.6 15.1 4.3 10.7 5.5 13.5 7.0 17.1 6.4 14.1 2.8 7.3 6.0 16.3 3.2 10.7 4.8 11.2 5.3 19.6 4.0 8.7 3.2 10.0 2.1 7.9 6.3 15.2 7.2 16.8 4.7 13.0 Posterior primary branch 12.8 28.3 8.8 21.5 9.3 23.7 12.0 26.0 9.9 25.4 11.2 26.3 10.7 23.5 8.3 23.1 12.4 28.5 9.9 24.8 10.2 24.8 11.2 27.5 11.2 24.8 9.6 25.3 9.5 25.9 6.9 23.0 10.8 25.3 7.7 28.6 10.3 22.5 8.1 25.6 5.9 21.8 13.2 31.9 12.3 28.8 8.7 23.9 3436 Posterior secondary branch 7.9 17.4 6.4 15.6 7.8 20.1 9.4 20.2 7.9 20.4 7.8 18.3 8.0 17.5 6.0 16.6 8.1 18.5 8.3 20.7 8.8 21.5 8.6 21.0 7.5 16.6 6.6 17.3 7.0 19.0 4.6 15.4 7.9 18.6 5.2 19.3 7.9 17.2 5.7 18.0 4.2 15.6 8.8 21.4 8.7 20.4 6.5 17.8
3437
3438
3439
3440
3441
3442 189
3443 Table S4.47: Nelson Island, Edgell Bay
SPECIMEN 1 (HOL) 2 CHARACTER µm pt µm pt Body length 443 957 413 944 Buccopharyngeal tube Buccal tube length 46.3 – 43.8 – Stylet support insertion point 35.5 76.5 33.9 77.3 Buccal tube external width 7.6 16.5 6.7 15.2 Buccal tube internal width 5.2 11.2 4.0 9.1 Ventral lamina length 29.5 63.6 27.3 62.2 Placoid lengths Macroplacoid 1 7.6 16.4 7.4 17.0 Macroplacoid 2 4.4 9.5 5.2 11.8 Macroplacoid 3 7.1 15.3 5.8 13.2 Microplacoid 3.2 6.9 4.3 9.8 Macroplacoid row 25.8 55.6 23.5 53.6 Placoid row 30.0 64.8 28.2 64.3 Claw 1 lengths External base 4.2 9.0 4.3 9.8 External primary branch 10.6 22.8 9.2 21.0 External secondary branch 6.9 15.0 7.8 17.9 Internal base 4.3 9.2 4.2 9.6 Internal primary branch 10.2 22.1 8.7 19.8 Internal secondary branch 7.8 17.8 Claw 2 lengths External base 4.9 10.6 3.5 8.1 External primary branch 9.7 21.0 10.4 23.7 External secondary branch 8.1 17.5 9.2 21.1 Internal base 3.3 7.1 3.0 6.9 Internal primary branch 9.6 20.8 10.4 23.7 Internal secondary branch 7.5 16.2 8.2 18.7 Claw 3 lengths External base 5.1 10.9 4.1 9.3 External primary branch 10.9 23.5 9.6 22.0 External secondary branch 8.3 18.0 7.5 17.1 Internal base 3.9 8.4 3.3 7.6 Internal primary branch 9.9 21.4 9.1 20.8 Internal secondary branch 7.4 15.9 8.1 18.5 Claw 4 lengths Anterior base 4.2 9.1 4.2 9.5 Anterior primary branch 9.8 21.1 11.8 26.8 Anterior secondary branch 8.8 19.0 9.4 21.4 Posterior base 6.2 13.3 4.5 10.3 Posterior primary branch 11.9 25.8 12.2 27.9 3444 Posterior secondary branch 8.1 17.4 9.4 21.4
3445
190
3446 Table S4.48: Palmer Station, Anvers Island
SPECIMEN 1 (HOL) 2 3 4 5 6 7 8 9 CHARACTER µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt µm pt Body length 222 948 606 1332 488 1146 226 710 416 975 407 981 371 1034 403 1013 380 1030 Buccopharyngeal tube Buccal tube length 23.5 – 45.5 – 42.6 – 31.9 – 42.7 – 41.5 – 35.8 – 39.8 – 36.9 – Stylet support insertion point 17.4 74.2 34.6 76.2 32.6 76.7 24.3 76.1 33.7 79.0 31.2 75.0 27.2 75.9 30.5 76.6 27.9 75.5 Buccal tube external width 3.5 14.9 8.0 17.7 6.5 15.2 4.6 14.3 7.3 17.0 5.8 14.0 5.3 14.8 5.5 13.7 6.3 16.9 Buccal tube internal width 2.1 9.0 5.8 12.8 4.3 10.2 2.9 8.9 4.9 11.5 4.1 9.9 2.9 8.0 3.4 8.4 3.7 10.0 Ventral lamina length 12.6 53.9 25.7 56.4 27.5 64.7 18.9 59.5 25.7 60.2 23.5 56.5 22.5 62.8 23.8 60.0 23.3 63.1 Placoid lengths Macroplacoid 1 3.0 12.6 7.6 16.6 7.3 17.1 4.5 14.1 7.1 16.6 5.3 12.6 6.1 16.9 7.2 18.2 5.2 14.2 Macroplacoid 2 2.5 10.5 6.2 13.7 5.3 12.5 3.7 11.5 5.5 13.0 4.5 10.8 4.6 12.7 4.9 12.4 4.2 11.4 Macroplacoid 3 3.2 13.5 6.8 14.9 5.5 13.0 3.5 11.0 5.5 12.8 4.5 10.9 5.0 13.9 5.1 12.8 4.4 11.8 Microplacoid 2.0 8.6 3.4 7.5 3.8 8.8 2.5 8.0 3.3 7.7 2.8 6.8 3.1 8.7 2.8 7.1 3.9 10.6 Macroplacoid row 10.0 42.7 22.3 49.1 19.9 46.7 13.9 43.5 20.4 47.8 18.4 44.2 17.1 47.8 18.9 47.4 17.1 46.3 Placoid row 12.5 53.3 27.1 59.6 24.1 56.6 16.9 53.2 24.4 57.1 22.3 53.7 20.8 58.1 22.3 56.2 21.6 58.5 Claw 1 lengths External base 2.7 11.6 4.6 10.1 3.6 8.4 2.5 7.9 3.8 8.9 3.3 7.9 4.5 12.4 5.1 12.9 5.8 15.6 External primary branch 5.4 23.1 10.3 22.6 8.8 20.7 5.7 18.0 9.2 21.6 9.8 23.5 8.4 23.5 9.4 23.7 8.8 23.9 External secondary branch 4.6 19.7 7.8 17.1 6.2 14.5 4.6 14.5 8.1 18.9 8.5 20.4 7.0 19.6 7.7 19.4 7.2 19.6 Internal base 2.8 11.9 5.4 11.8 3.3 7.6 2.5 7.9 3.7 8.6 3.3 8.0 3.6 10.0 2.8 7.0 5.3 14.3 Internal primary branch 5.1 21.6 9.2 20.2 8.7 20.4 4.9 15.4 8.0 18.6 8.7 21.0 6.4 17.8 9.4 23.5 8.3 22.6 Internal secondary branch 4.1 17.3 7.7 17.0 6.3 14.8 4.7 14.7 6.9 16.2 7.3 17.5 6.0 16.7 5.8 14.6 6.6 18.0 Claw 2 lengths External base 3.8 16.0 5.1 11.2 5.3 12.5 3.0 9.5 4.1 9.6 3.3 8.0 3.9 10.8 2.9 7.4 3.4 9.2 External primary branch 5.5 23.4 11.5 25.3 10.2 23.9 6.5 20.4 9.9 23.2 8.2 19.8 7.7 21.5 8.6 21.6 6.4 17.5 External secondary branch 3.9 16.6 9.6 21.2 7.8 18.2 5.2 16.3 8.6 20.1 7.0 16.8 6.0 16.6 7.5 18.8 6.0 16.2 Internal base 3.4 14.5 5.1 11.2 4.9 11.4 3.0 9.5 4.2 9.9 3.1 7.3 2.3 6.3 3.5 8.8 3.1 8.4 Internal primary branch 4.7 19.8 10.7 23.5 9.5 22.2 5.5 17.2 9.2 21.6 8.2 19.7 7.1 19.9 7.8 19.5 5.9 15.9 Internal secondary branch 3.8 16.1 10.0 21.9 7.0 16.4 4.9 15.3 7.7 18.1 8.0 19.4 6.0 16.9 7.2 18.2 4.9 13.2 Claw 3 lengths External base 3.3 14.2 4.6 10.1 6.4 15.1 3.1 9.7 5.1 12.0 3.6 8.6 3.6 9.9 4.5 11.3 5.0 13.6 External primary branch 5.4 23.1 10.8 23.8 9.7 22.7 6.6 20.6 11.3 26.5 8.3 20.1 7.6 21.1 10.3 25.8 5.8 15.8 External secondary branch 3.8 16.2 10.1 22.2 6.5 15.3 5.2 16.2 7.8 18.3 7.5 17.9 6.6 18.4 7.0 17.6 4.4 12.0 Internal base 3.0 12.7 3.6 8.0 5.7 13.3 2.7 8.5 4.1 9.5 3.5 8.4 3.4 9.4 4.8 12.0 3.4 9.2 Internal primary branch 5.0 21.3 10.0 21.9 9.5 22.2 5.9 18.5 9.9 23.3 7.2 17.4 6.2 17.3 9.6 24.2 5.2 14.1 Internal secondary branch 4.5 19.0 8.6 18.9 7.5 17.6 4.8 15.2 8.3 19.5 6.9 16.7 4.5 12.7 7.4 18.7 4.2 11.4 Claw 4 lengths Anterior base 2.3 9.9 5.9 13.0 5.1 12.0 3.0 9.3 3.7 8.7 5.4 12.9 4.0 11.2 4.9 12.4 3.9 10.5 Anterior primary branch 5.3 22.4 12.0 26.4 9.9 23.3 5.4 16.8 9.2 21.5 7.7 18.5 7.2 20.1 11.0 27.5 8.9 24.2 Anterior secondary branch 4.2 17.9 9.8 21.5 7.4 17.3 5.1 16.0 7.9 18.5 6.9 16.7 4.6 12.7 8.2 20.6 7.0 18.8 Posterior base 2.5 10.8 7.6 16.7 4.9 11.4 3.3 10.4 5.3 12.5 5.8 14.1 3.7 10.4 6.3 15.8 4.5 12.3 Posterior primary branch 6.0 25.7 12.2 26.8 12.0 28.1 6.3 19.7 12.1 28.3 10.0 24.1 10.7 29.8 11.7 29.3 9.4 25.4 3447 Posterior secondary branch 4.6 19.6 9.8 21.6 8.1 19.0 5.6 17.5 6.6 15.5 8.5 20.4 6.5 18.1 9.5 23.9 8.7 23.5
191