DOCSLIB.ORG

(12) Patent Application Publication (10) Pub. No.: US 2011/0023143 A1 Weinstein Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) Patent Application Publication (10) Pub. No.: US 2011/0023143 A1 Weinstein Et Al US 2011 00231.43A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2011/0023143 A1 Weinstein et al. (43) Pub. Date: Jan. 27, 2011 (54) GENOMIC EDITING OF 2010, provisional application No. 61/308,089, filed on NEURODEVELOPMENTAL GENESIN Feb. 25, 2010, provisional application No. 61/336,000, ANMALS filed on Jan. 14, 2010, provisional application No. 61/263.904, filed on Nov. 24, 2009, provisional appli (75) Inventors: Edward Weinstein, St. Louis, MO cation No. 61/263,696, filed on Nov. 23, 2009, provi (US); Xiaoxia Cui, St. Louis, MO sional application No. 61/245,877, filed on Sep. 25, (US); Phil Simmons, St. Louis, MO 2009, provisional application No. 61/232,620, filed on (US) Aug. 10, 2009, provisional application No. 61/228, 419, filed on Jul. 24, 2009, provisional application No. Correspondence Address: 61/200.985, filed on Dec. 4, 2008, provisional appli POLSNELLISHUGHART PC cation No. 61/205,970, filed on Jan. 26, 2009. 700 W. 47TH STREET, SUITE 1000 KANSAS CITY, MO 64112-1802 (US) Publication Classification (51) Int. Cl. (73) Assignee: SIGMA-ALDRICH CO., St. GOIN 33/00 (2006.01) Louis, MO (US) AOIK 67/00 (2006.01) (21) Appl. No.: 12/842,578 CI2N 5/10 (2006.01) (52) U.S. Cl. ................... 800/3; 800/13:800/15; 800/16; (22) Filed: Jul. 23, 2010 800/17: 800/14; 435/325; 435/351; 435/350; 435/366; 435/363; 435/352:435/353 Related U.S. Application Data (57) ABSTRACT (63) Continuation-in-part of application No. 12/592,852, filed on Dec. 3, 2009. The present invention provides genetically modified animals and cells comprising edited chromosomal sequences encod (60) Provisional application No. 61/343.287, filed on Apr. ing proteins that are associated with neurodevelopmental dis 26, 2010, provisional application No. 61/323,702, orders. In particular, the animals or cells are generated using filed on Apr. 13, 2010, provisional application No. a Zinc finger nuclease-mediated editing process. Also pro 61/323,719, filed on Apr. 13, 2010, provisional appli vided are methods of using the genetically modified animals cation No. 61/323,698, filed on Apr. 13, 2010, provi or cells disclosed hereinto Screenagents for toxicity and other sional application No. 61/309.729, filed on Mar. 2, effects. US 2011/0023143 A1 Jan. 27, 2011 GENOMIC EDITING OF nition Such as learning and memory due to their higher intel NEURODEVELOPMENTAL GENESIN ligence, complex behavioral repertoire, and observable ANMALS responses to behavior-modulating drugs, all of which better approximate the human condition. Further, the larger physi CROSS-REFERENCE TO RELATED cal size of rats relative to mice facilitates experimentation that APPLICATIONS requires dissection, in Vivo imaging, or isolation of specific 0001. This application claims the priority of U.S. provi cells or organ structures for cellular or molecular studies of sional application No. 61/343,287, filed Apr. 26, 2010, U.S. these neurodevelopmental diseases. provisional application No. 61/323,702, filed Apr. 13, 2010, 0006. A need exists for animals with modification to one U.S. provisional application No. 61/323,719, filed Apr. 13, or more genes associated with human neurodevelopmental 2010, U.S. provisional application No. 61/323,698, filed Apr. disorders to be used as model organisms in which to study 13, 2010, U.S. provisional application No. 61/309,729, filed these disorders. The genetic modifications may include gene Mar. 2, 2010, U.S. provisional application No. 61/308,089, knockouts including tissue-specific or temporal-specific filed Feb. 25, 2010, U.S. provisional application No. 61/336, knockouts using loxP-flanked (“floxed') alleles in combina 000, filed Jan. 14, 2010, U.S. provisional application No. tion with an inducible Cre-recombinase, as well as under 61/263.904, filed Nov. 24, 2009, U.S. provisional application expression, modified expression, or over-expression of alle No. 61/263,696, filed Nov. 23, 2009, U.S. provisional appli les that either cause or are associated with cation No. 61/245,877, filed Sep. 25, 2009, U.S. provisional neurodevelopmental diseases in humans. Further, a need application No. 61/232,620, filed Aug. 10, 2009, U.S. provi exists for modification of one or more genes associated with sional application No. 61/228,419, filed Jul. 24, 2009, and is human neurodevelopmental disorders in a variety of organ a continuation in part of U.S. non-provisional application Ser. isms in order to develop appropriate animal models of neu No. 12/592,852, filed Dec. 3, 2009, which claims priority to rodevelopmental disorders. U.S. provisional 61/200,985, filed Dec. 4, 2008 and U.S. provisional application 61/205,970, filed Jan. 26, 2009, all of SUMMARY OF THE INVENTION which are hereby incorporated by reference in their entirety. 0007. One aspect of the present disclosure encompasses a genetically modified animal comprising at least one edited FIELD OF THE INVENTION chromosomal sequence encoding a neurodevelopmental pro tein. 0002 The invention generally relates to genetically modi 0008 A further aspect provides a non-human embryo fied animals or cells comprising at least one edited chromo comprising at least one RNA molecule encoding a Zinc finger Somal sequence encoding a neurodevelopmental protein. In nuclease that recognizes a chromosomal sequence encoding a particular, the invention relates to the use of a Zinc finger neurodevelopmental protein, and, optionally, at least one nuclease-mediated process to edit chromosomal sequences donor polynucleotide comprising a sequence encoding an encoding neurodevelopmental proteins in animals or cells. ortholog of the neurodevelopmental protein or an edited neu rodevelopmental protein. BACKGROUND OF THE INVENTION 0009. Another aspect provides a genetically modified cell 0003) A number of genes have been associated with com comprising at least one edited chromosomal sequence encod plex neurodevelopmental disorders, which may adversely ing a neurodevelopmental protein. impact cognitive and social functions in affected individuals. 0010 Yet another aspect provides a method for assessing The progress of ongoing research into the causes and treat the effect of an agent in a genetically modified animal. The ments of these neurodevelopmental disorders is hampered by method includes administering the agent to the genetically the onerous task of developing an animal model, which incor modified animal comprising at least one edited chromosomal porates the genes proposed to be involved in the development sequence encoding a neurodevelopmental protein, and com or severity of the neurodevelopmental disorders. paring a parameter obtained from the genetically modified 0004 Conventional methods such as gene knockout tech animal to the parameter obtained from a wild-type animal nology may be used to edit a particular gene in a potential administered the same agent. The parameter is chosen from model organism in order to develop an animal model of a (a) rate of elimination of the agent or its metabolite(s); (b) neurodevelopmental disorder. However, gene knockout tech circulatory levels of the agent or its metabolite(s); (c) bio nology may require months or years to construct and validate availability of the agent or its metabolite(s); (d) rate of the proper knockout models. In addition, genetic editing via metabolism of the agent or its metabolite(s); (e) rate of clear gene knockout technology has been reliably developed in ance of the agent or its metabolite(s): (f) toxicity of the agent only a limited number of organisms, such as mice. Even in a or its metabolite(s); and (g) ability of the agent to modify an best case scenario, mice typically show low intelligence, incidence or indication of a neurodevelopmental disorder in making mice a poor choice of organism in which to study the genetically modified animal. complex disorders of cognition and behavior. Ideally, the 0011 Still yet another aspect encompasses a method for selection of an organism in which to model a complex neu assessing the therapeutic potential of an agent as a treatment rodevelopmental disorder should be based on the organism’s for a neurodevelopmental disorder. This method includes ability to exhibit the characteristics of the disorder as well as administering the agent to a genetically modified animal, its amenability to existing research methods. wherein the genetically modified animal comprises at least 0005. The rat is emerging as a genetically malleable, pre one edited chromosomal sequence encoding a neurodevelop ferred model organism for the study of neurodevelopmental mental protein, and comparing a selected parameter obtained disorders, particularly because these disorders are not well from the genetically modified animal to the selected param modeled in mice. Rats area Superior choice compared to mice eter obtained from a wild-type animal with no exposure to the as model organisms for the study of human diseases of cog same agent. The selected parameter is chosen from a) spon US 2011/0023143 A1 Jan. 27, 2011 taneous behaviors; b) performance during behavioral testing: mal disclosed herein may be heterozygous for the edited c) physiological anomalies; d) abnormalities in tissues or chromosomal sequence encoding a protein associated with a cells; e) biochemical function; and f) molecular structures. neurodevelopmental disorder. Alternatively, the genetically 0012. Other aspects and features of the disclosure are modified animal may be homozygous for the edited chromo described more thoroughly below. Somal sequence encoding a protein associated with a neu rodevelopmental disorder. DETAILED DESCRIPTION OF THE INVENTION 0015. In one embodiment, the genetically modified animal may comprise at least one inactivated chromosomal sequence 0013 The present disclosure provides a genetically modi encoding a neurodevelopmental protein. The inactivated fied animal or animal cell comprising at least one edited chromosomal sequence may include a deletion mutation (i.e., chromosomal sequence encoding a neurodevelopmental pro deletion of one or more nucleotides), an insertion mutation tein.
Load more

Recommended publications
  • Hypoxia and Hormone-Mediated Pathways Converge at the Histone Demethylase KDM4B in Cancer
    International Journal of Molecular Sciences Review Hypoxia and Hormone-Mediated Pathways Converge at the Histone Demethylase KDM4B in Cancer Jun Yang 1,* ID , Adrian L. Harris 2 and Andrew M. Davidoff 1 1 Department of Surgery, St. Jude Children’s Research Hospital, 262 Danny Thomas Place, Memphis, TN 38105, USA; [email protected] 2 Molecular Oncology Laboratories, Department of Oncology, Weatherall Institute of Molecular Medicine, University of Oxford, Oxford OX3 9DS, UK; [email protected] * Correspondence: [email protected] Received: 19 December 2017; Accepted: 9 January 2018; Published: 13 January 2018 Abstract: Hormones play an important role in pathophysiology. The hormone receptors, such as estrogen receptor alpha and androgen receptor in breast cancer and prostate cancer, are critical to cancer cell proliferation and tumor growth. In this review we focused on the cross-talk between hormone and hypoxia pathways, particularly in breast cancer. We delineated a novel signaling pathway from estrogen receptor to hypoxia-inducible factor 1, and discussed the role of this pathway in endocrine therapy resistance. Further, we discussed the estrogen and hypoxia pathways converging at histone demethylase KDM4B, an important epigenetic modifier in cancer. Keywords: estrogen receptor alpha; hypoxia-inducible factor 1; KDM4B; endocrine therapy resistance 1. Introduction A solid tumor is a heterogeneous mass that is comprised of not only genetically and epigenetically distinct clones, but also of areas with varying degree of hypoxia that result from rapid cancer cell proliferation that outgrows its blood supply. To survive in hostile hypoxic environments, cancer cells decelerate their proliferation rate, alter metabolism and cellular pH, and induce angiogenesis [1].
    [Show full text]
  • Synergistic Interplay Between PHF8 and HER2 Signaling Contributes to Breast Cancer Development and Drug Resistance
    bioRxiv preprint doi: https://doi.org/10.1101/682476; this version posted June 25, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Synergistic interplay between PHF8 and HER2 signaling contributes to breast cancer development and drug resistance Qi Liu1, Nicholas Borcherding2, Peng Shao1,3, Peterson Kariuki Maina1,4, Weizhou Zhang5, and Hank Heng Qi1,6 1 Department of Anatomy and Cell Biology, Carver College of Medicine, University of Iowa, Iowa City, IA 52242, USA, 2 Department of Pathology, Carver College of Medicine, University of Iowa, Iowa City, IA 52242, USA, 3 Current address: Department of Microbiology and Immunology, Carver College of Medicine, University of Iowa, Iowa City, IA 52242, USA, 4 Current Address: Albert Einstein College of Medicine, Bronx, NY 10461, USA 5 Department of Pathology, Immunology and Laboratory Medicine, College of Medicine, University of Florida, Gainesville, FL, 32610-0275, USA 6 To whom correspondence should be addressed. Tel: 1-319-335-3084; Fax: 1-319-335-7198; Email: [email protected] Key words: PHF8, HER2, IL-6, breast cancer, drug resistance 1 bioRxiv preprint doi: https://doi.org/10.1101/682476; this version posted June 25, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract HER2 plays a critical role in tumorigenesis and is associated with poor prognosis of HER2- positive breast cancers. Although, anti-HER2 drugs show benefits in breast cancer therapy, de novo or acquired resistance often develop.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Anxiety Disorders of Childhood and Adolescence Jesse C
    Anxiety Disorders of Childhood and Adolescence Jesse C. Rhoads, DO & Craig L. Donnelly, MD 1. Background, EpidEmiology and rElEvancE Anxiety symptoms are ubiquitous in youth. Clinicians need to be familiar with the normal developmental course of anxieties in youth and their consequent mastery by children in order to differentiate normative versus pathological anxiety. Anxiety symptoms do not necessarily constitute an anxiety disorder. Fear and anxiety are common experiences across childhood and adolescence. The clinician evaluating childhood anxiety disorders faces the task of differentiating the normal, transient and developmentally appropriate expressions of anxiety from pathological anxiety. Adept assessment and management of anxiety symptoms through reassurance, anticipatory guidance and psychoeducation of parents may forestall the development of full blown anxiety syndromes. Anxiety disorders are among the most common psychiatric disorders in children and adolescents affecting from 7-15% of individuals under 18 years of age. Anxiety disorders are not rare and often mimic or are comorbid with other childhood disorders. Symptoms such as school refusal, tantrums, or irritability may be less reflective of oppositional behavior than an underlying social phobia or generalized anxiety disorder. Given the uniqueness of each child and the complex interplay among the internal and external variables that drive anxiety, a multimodal approach to diagnosis and treatment is warranted. Anxiety disorders are a heterogeneous group of disorders that vary in their etiology, treatment, and prognosis. Given these differences, we will discuss each condition individually to help the primary care clinician in parsing out the necessary details of each disorder. Separation anxiety disorder The estimated prevalence of SAD is 4-5%, making it one of the most common childhood psychiatric disorders.
    [Show full text]
  • Neuroinflammation Triggered by Β-Glucan/Dectin-1 Signaling Enables CNS Axon Regeneration
    Neuroinflammation triggered by β-glucan/dectin-1 signaling enables CNS axon regeneration Katherine T. Baldwina,b,1, Kevin S. Carbajalc,d,1, Benjamin M. Segalc,d,2, and Roman J. Gigera,b,c,d,2 aDepartment of Cell and Developmental Biology, bCellular and Molecular Biology Graduate Program, cNeuroscience Graduate Program, and dHoltom-Garrett Program in Neuroimmunology, Department of Neurology, University of Michigan School of Medicine, Ann Arbor, MI 48109 Edited by Ben A. Barres, Stanford University School of Medicine, Stanford, CA, and approved January 22, 2015 (received for review December 22, 2014) Innate immunity can facilitate nervous system regeneration, yet growth can be undermined by concurrent toxicity (9). A deeper the underlying cellular and molecular mechanisms are not well understanding of these opposing effects will be important for understood. Here we show that intraocular injection of lipopoly- exploiting immunomodulatory pathways to promote neural re- saccharide (LPS), a bacterial cell wall component, or the fungal cell pair while minimizing bystander damage. wall extract zymosan both lead to rapid and comparable intravi- In the present study, we investigated the pathways that drive treal accumulation of blood-derived myeloid cells. However, when innate immune-mediated axon regeneration after ONC. We in- combined with retro-orbital optic nerve crush injury, lengthy duced sterile inflammation in the vitreous on the day of injury by growth of severed retinal ganglion cell (RGC) axons occurs only i.o. administration of zymosan or constituents of zymosan clas- in zymosan-injected mice, and not in LPS-injected mice. In mice sified as pathogen-associated molecular patterns (PAMPs). PAMPs dectin-1 deficient for the pattern recognition receptor but not are highly conserved microbial structures that serve as ligands for TLR2 , Toll-like receptor-2 ( ) zymosan-mediated RGC regeneration pattern recognition receptors (PRRs).
    [Show full text]
  • Tumor Mutation Burden and JARID2 Gene Alteration Are Associated with Short Disease-Free Survival in Locally Advanced Triple-Negative Breast Cancer
    1052 Original Article Page 1 of 13 Tumor mutation burden and JARID2 gene alteration are associated with short disease-free survival in locally advanced triple-negative breast cancer Xiangmei Zhang1#^, Jingping Li2#, Qing Yang1, Yanfang Wang3, Xinhui Li1, Yunjiang Liu2, Baoen Shan1 1Research Center, 2Breast Cancer Center, 3Medical Center, Fourth Hospital of Hebei Medical University, Shijiazhuang, China Contributions: (I) Conception and design: Y Liu, B Shan; (II) Administrative support: X Zhang, J Li; (III) Provision of study materials: X Zhang, J Li; (IV) Collection and assembly of data: Y Wang, Q Yang, X Li; (V) Data analysis and interpretation: X Zhang, J Li, Y Liu, B Shan; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. #These authors have contributed equally to this work. Correspondence to: Yunjiang Liu. Breast Cancer Center, Fourth Hospital of Hebei Medical University, Shijiazhuang, China. Email: [email protected]; Baoen Shan. Research Center, Fourth Hospital of Hebei Medical University, Shijiazhuang, China. Email: [email protected]. Background: In locally advanced triple-negative breast cancer (TNBC), patients who did not achieve pathologic complete response (non-pCR) after neoadjuvant chemotherapy develop rapid tumor metastasis. Tumor mutation burden (TMB) is a potential biomarker of cancer therapy, though whether it is applicable to TNBC is still unclear. Methods: A total of 14 non-pCR TNBC patients were enrolled, and tissue samples from radical operation were collected. Of these, 7 cases developed disease progression within 12 months after operation [short disease-free survival (short DFS)], while others showed longer DFS over 1 year (long DFS). Next generation sequencing (NGS) analysis targeting 422 cancer-related genes and in vitro studies were performed.
    [Show full text]
  • Addison's Disease Elucidating PANDAS
    PRACTICE BUILDING Naturopathic Specialty Practice: Keys to NATUROPATHIC DOCTOR NEWS & REVIEW Making It Successful ..........................>>10 Darin Ingels, ND VOLUME 10 ISSUE 4 April 2014 | Autoimmune / ALLER gy Medicine Sometimes specialty practices happen by accident. A case study and some tips help pave the way for Tolle Causam success. TOLLE CAUSAM Autoimmunity and the Gut: Elucidating PANDAS How Intestinal Inflammation Contributes to Autoimmune Disease .....................>>12 Follow-Up Discussion of an Immune-Mediated Jenny Berg, ND, LAc Kelly Baker, ND, LAc Intestinal flora influences our immune system’s Mental Illness ability to differentiate self from non-self. Steven Rondeau, ND, BCIA-EEG VIS MEDICATRIX NATURAE Allergy Elimination Technique: Simplified ANDAS is an acronym for “Pediatric Treatment of Difficult Cases ..............>>15 PAutoimmune Neuropsychiatric Sheryl Wagner, ND Disorder Associated with Streptococcus.” A few case studies illustrate the surprisingly broad This condition, which was initially application of NAET with patients. identified by Sue Swedo, MD, and DOCERE described in the American Journal of Autoimmune Infertility in Women: Psychiatry in 1998,1 is characterized by Part 2 ...................................................>>16 abrupt-onset obsessive-compulsive Fiona McCulloch, BSc, ND disorder (OCD) and/or other Intestinal support, autoimmune diet, and neuropsychiatric symptoms in a child. (See nutraceuticals help reverse a common cause of Table 1 for Swedo’s original diagnostic female infertility. criteria.) In my previous NDNR paper NATUROpaTHIC NEWS from 2010,2 I described the presentation, history and controversy surrounding this Association Spotlight: An Introduction newly identified syndrome. Since that to the ANRI and NORI .........................>>20 time, several other groups have sought Colleen Huber, NMD to better redefine this condition, and the Dr Huber introduces ANRI & NORI, organizations committed to the advancement of research & acronym, PANS, or Pediatric Acute-Onset education on chronic disease.
    [Show full text]
  • Human ADAM12 Quantikine ELISA
    Quantikine® ELISA Human ADAM12 Immunoassay Catalog Number DAD120 For the quantitative determination of A Disintegrin And Metalloproteinase domain- containing protein 12 (ADAM12) concentrations in cell culture supernates, serum, plasma, and urine. This package insert must be read in its entirety before using this product. For research use only. Not for use in diagnostic procedures. TABLE OF CONTENTS SECTION PAGE INTRODUCTION .....................................................................................................................................................................1 PRINCIPLE OF THE ASSAY ...................................................................................................................................................2 LIMITATIONS OF THE PROCEDURE .................................................................................................................................2 TECHNICAL HINTS .................................................................................................................................................................2 MATERIALS PROVIDED & STORAGE CONDITIONS ...................................................................................................3 OTHER SUPPLIES REQUIRED .............................................................................................................................................3 PRECAUTIONS .........................................................................................................................................................................4
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Mutations in PHF8 Are Associated with X Linked Mental Retardation And
    780 J Med Genet: first published as 10.1136/jmg.2004.029439 on 30 September 2005. Downloaded from LETTER TO JMG Mutations in PHF8 are associated with X linked mental retardation and cleft lip/cleft palate F Laumonnier*, S Holbert*, N Ronce, F Faravelli, S Lenzner, C E Schwartz, J Lespinasse, H Van Esch, D Lacombe, C Goizet, F Phan-Dinh Tuy, H van Bokhoven, J-P Fryns, J Chelly, H-H Ropers, C Moraine, B C J Hamel, S Briault ............................................................................................................................... J Med Genet 2005;42:780–786. doi: 10.1136/jmg.2004.029439 lymphoblastoid cell lines (family N42) that were established Truncating mutations were found in the PHF8 gene (encoding from peripheral lymphocytes using standard protocols. the PHD finger protein 8) in two unrelated families with X linked mental retardation (XLMR) associated with cleft lip/ palate (MIM 300263). Expression studies showed that this Fluorescence in situ hybridisation (FISH) BACs on chromosome Xp11.21 were selected from Ensembl gene is ubiquitously transcribed, with strong expression of database (http://www.ensembl.org) and the UCSC genome the mouse orthologue Phf8 in embryonic and adult brain browser (http://genome.ucsc.edu) and obtained from the structures. The coded PHF8 protein harbours two functional CHORI Institute (http://bacpac.chori.org). Hybridisation domains, a PHD finger and a JmjC (Jumonji-like C terminus) experiments were carried out as previously described.12 domain, implicating it in transcriptional regulation and chromatin remodelling. The association of XLMR and cleft lip/palate in these patients with mutations in PHF8 suggests Mutation analysis of PHF8 Polymerase chain reaction (PCR) was carried out in 50 ml an important function of PHF8 in midline formation and in the reaction volumes containing 100 ng of genomic DNA from development of cognitive abilities, and links this gene to the patients, 10 pM of each primer, 1.25 mM of dNTPs, 0.5 U XLMR associated with cleft lip/palate.
    [Show full text]
  • Olig1 and Sox10 Interact Synergistically to Drivemyelin Basic
    The Journal of Neuroscience, December 26, 2007 • 27(52):14375–14382 • 14375 Cellular/Molecular Olig1 and Sox10 Interact Synergistically to Drive Myelin Basic Protein Transcription in Oligodendrocytes Huiliang Li,1 Yan Lu,2 Hazel K. Smith,1 and William D. Richardson1 1Wolfson Institute for Biomedical Research and Department of Biology, University College London, London WC1E 6BT, United Kingdom, and 2Medical Research Council, Clinical Sciences Centre, Imperial College London, London W12 0NN, United Kingdom The oligodendrocyte lineage genes (Olig1/2), encoding basic helix-loop-helix transcription factors, were first identified in screens for master regulators of oligodendrocyte development. OLIG1 is important for differentiation of oligodendrocyte precursors into myelin- forming oligodendrocytes during development and is thought to play a crucial role in remyelination during multiple sclerosis. However, itisstillunclearhowOLIG1interactswithitstranscriptionalcofactorsandDNAtargets.OLIG1wasreportedlyrestrictedtomammals,but we demonstrate here that zebrafish and other teleosts also possess an OLIG1 homolog. In zebrafish, as in mammals, Olig1 is expressed in the oligodendrocyte lineage. Olig1 associates physically with another myelin-associated transcription factor, Sox10, and the Olig1/Sox10 complex activates mbp (myelin basic protein) transcription via conserved DNA sequence motifs in the mbp promoter region. In contrast, Olig2 does not bind to Sox10 in zebrafish, although both OLIG1 and OLIG2 bind SOX10 in mouse. Key words: Olig1; Olig2; Sox10; Mbp; oligodendrocyte; myelin; zebrafish; mouse; evolution; development Introduction directly regulates Mbp transcription (Stolt et al., 2002), and over- Myelin, the multilayered glial sheath around axons, is one of the expression of SOX10 alone is sufficient to induce myelin gene defining features of jawed vertebrates (gnathostomes). It is expression in embryonic chick spinal cord (Liu et al., 2007).
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]