Accepted Manuscript
Title: Mitochondrial genomes of Australian chicken Eimeria support the presence of ten species with low genetic diversity among strains
Authors: Jess A.T. Morgan, Rosamond M. Godwin
PII: S0304-4017(17)30226-1 DOI: http://dx.doi.org/doi:10.1016/j.vetpar.2017.05.025 Reference: VETPAR 8358
To appear in: Veterinary Parasitology
Received date: 5-10-2016 Revised date: 18-5-2017 Accepted date: 24-5-2017
Please cite this article as: Morgan, Jess A.T., Godwin, Rosamond M., Mitochondrial genomes of Australian chicken Eimeria support the presence of ten species with low genetic diversity among strains.Veterinary Parasitology http://dx.doi.org/10.1016/j.vetpar.2017.05.025
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. Mitochondrial genomes of Australian chicken Eimeria support the presence of ten species with low genetic diversity among strains
Jess A. T. Morgan1,2 and Rosamond M. Godwin1,3
1 Animal Science, Department of Agriculture and Fisheries, Dutton Park, QLD 4102, Australia
2 Queensland Alliance for Agriculture and Food Innovation, The University of Queensland, St Lucia, QLD
4067, Australia
3 Poultry CRC, PO Box U242, University of New England, Armidale, NSW 2351, Australia
Corresponding author: Dr Jess A.T. Morgan, EcoSciences Precinct, 41 Boggo Rd, Dutton Park QLD 4102, Ph
61 7 32554527, email [email protected]
Mitochondrial genomes of Australian chicken Eimeria support the presence of ten species with low genetic diversity among strains
Jess A. T. Morgan and Rosamond M. Godwin
Graphical Abstract Eimeria necatrix
Eimeria tenella
Eimeria praecox
Eimeria acervulina
Eimeria sp. OTU-Z
Eimeria mitis
Eimeria sp. OTU-Y
Eimeria brunetti
Eimeria sp. OTU-X
Eimeria maxima
Mitochondrial genomes of Australian chicken Eimeria support the presence of ten species with low genetic diversity among strains
Jess A. T. Morgan and Rosamond M. Godwin
Highlights
Complete mitochondrial genomes of all known Australian chicken Eimeria align closely to their global counterparts Eimeria species OTU-X, -Y and –Z fall within the clade of species only affiliated with chickens containing E. acervulina, E. maxima, E. mitis, E. brunetti, and E. praecox. Mitochondrial genetic diversity is low among Australian field collected isolates
Abstract
Modern molecular approaches have vastly improved diagnostic capabilities for differentiating among species of chicken infecting Eimeria. Consolidating information from multiple genetic markers, adding additional poultry Eimeria species and increasing the size of available data-sets is improving the resolving power of the DNA, and consequently our understanding of the genus. This study adds information from
25 complete mitochondrial DNA genomes from Australian chicken Eimeria isolates representing all 10 species known to occur in Australia, including OTU-X, -Y and -Z. The resulting phylogeny provides a comprehensive view of species relatedness highlighting where the OTUs align with respect to others members of the genus. All three OTUs fall within the Eimeria clade that contains only chicken-infecting species with close affinities to E. maxima, E. brunetti and E. mitis. Mitochondrial genetic diversity was low among Australian isolates likely reflecting their recent introduction to the country post-European settlement. The lack of observed genetic diversity is a promising outcome as it suggests that the currently used live vaccines should continue to offer widespread protection against Eimeria outbreaks in all states and territories. Flocks were frequently found to host multiple strains of the same species, a factor that should be considered when studying disease epidemiology in the field.
Keywords: Coccidiosis; ; ; ; ; , phylogeny, mito-genome, poultry, operational-taxonomic-units, cryptic species 1. Introduction
Protozoan parasites in the genus Eimeria cause the intestinal disease coccidiosis. This important global livestock disease has a significant economic impact on the poultry industry where high-density housing of large numbers of birds favours parasite transmission. Management of the disease is achieved by strict farm biosecurity as well as in-feed coccidiostats and or vaccination. Despite significant management efforts, coccidiosis outbreaks still occur due to widespread drug resistance and environmental persistence (Blake and Tomley, 2014). The disease has been further promoted by the expansion of floor reared, and free range husbandry techniques that increase flock exposure to infectious oocysts in the environment. Parasite elimination has not proved feasible; instead control is based on parasite suppression allowing birds to develop natural immunity. The annual global cost of coccidiosis, including production losses, prevention and treatment, has been estimated at over USD$3 billion (Dalloul and Lillehoj, 2006).
Seven species of Eimeria are recognized and found globally infecting chickens. In Australia a further three operational taxonomic units (OTU) were characterized by Cantacessi et al., in 2008 (Cantacessi et al.,
2008). Little is known about the prevalence or distribution of these OTU although all three cryptic species have now been identified in flocks from Africa (Clark et al., 2016; Fornace et al., 2013) and a recent global survey of Eimeria suggests they may be widespread in the southern hemisphere, but not the northern
(Clark et al., 2016) . It is unlikely that the OTU, or any of the chicken infecting Eimeria species, originated in Australia as chickens have only been present in the country since European settlement in the late 18th century.
Genetic characterisation of poultry Eimeria has historically been based on a limited number of relatively small (<1000 bp) gene regions (Barta et al., 1997; Cantacessi et al., 2008; Lew et al., 2003; Ogedengbe et al., 2011). With the advent of genome sequencing, paired with a reduction in sequencing costs, it has now become possible to compare much larger regions of DNA. Phylogenetic comparisons of Eimeria based on entire mitochondrial genomes have now been published (Hikosaka et al., 2011; Lin et al., 2011; Liu et al., 2012; Ogedengbe et al., 2014; Ogedengbe et al., 2013) with the interesting discovery that Eimeria necatrix and Eimeria tenella are more closely related to turkey Eimeria than they are to the remaining chicken Eimeria (Miska et al., 2010; Ogedengbe et al., 2014).
As with other apicomplexan parasites, the Eimeria mitochondrial genome has been reduced to roughly 6 kb in length and contains only 3 genes; cytochrome c oxidase subunit I (CO1), cytochrome c oxidase subunit III (COIII) and cytochrome b (Cyt b) plus numerous short fragments of small and large subunit ribosomal DNA (SSU and LSU rDNA) (Lin et al., 2011).
An underlying question for all parasites is to understand how genetic diversity influences epidemiology and pathogenicity and its implication in therapeutic and vaccination strategies as well as disease control.
Experimental outcomes can be profoundly influenced by the choice of Eimeria species and strain, and a lack of standardization among experiments currently hampers meaningful comparisons.
The aim of this study was to characterise the mitochondrial genomes of multiple strains of all Australian species of chicken infecting Eimeria, including OTU-X, -Y and -Z, to assess how they align to global isolates, and to determine if genetic markers capable of distinguishing among strains could be identified.
Having this information could assist with improved vaccine monitoring and quality control and provide the tools for molecular epidemiology to characterise different strains of Eimeria.
2. Methods
Samples and DNA extraction
Animal Science Queensland, within the Queensland Department of Agriculture and Fisheries housed oocysts from pure Australian strains of each of the seven characterized Eimeria species and three OTU
(Table 1). Prior to DNA extraction oocysts were washed with distilled water, then suspended in 80 µL of phosphate-buffered saline (PBS, pH 7.2) and mechanically homogenized using 0.1 g of 1 mm glass beads for 5 min in a MiniBeadbeater-96 (Biospec Products, Bartlesville, OK, USA). DNA was extracted from the cracked oocysts using a DNeasy Tissue Kit (Qiagen, Chadstone, VIC, Australia) following the manufacturer’s guidelines into a final elution volume of 50 µl. DNA from two mammal infecting Eimeria species, E. zuernii and E. falciformis (Table 2), were sequenced as part of this study to help resolve basal lineages in the phylogeny.
All available online Eimeria spp. mitochondrial DNA genome sequences were included in preliminary phylogenetic analyses (Tables 1 and 2) including turkey-specific species which Ogedengbe et al. (2014) demonstrated were closely related to chicken Eimeria. In addition Caryospora bigenetica, Cyclospora cayetanensis and an avian Isospora sp. were included as these species have been reported paraphyletic with some representatives nested within the Eimeria clade (Barta et al., 2012; Chapman et al., 2013;
Megía‐Palma et al., 2015) . A representative of the genus Choleoeimeria was used to root the phylogeny.
DNA amplification and sequencing
Complete mitochondrial genome sequence was obtained from three strains of each of the seven recognised species of Eimeria infecting chickens in Australia. Complete coverage of the genome was obtained with the use of seven primer pairs (Table 3). Amplification reactions were carried out in 10 µl volumes containing 0.5 µM of each primer pair, combined with 10-100 ng of extracted DNA, 10x
HotMaster Taq buffer (Eppendorf, Macquarie Park NSW, Australia, containing 25 mM magnesium), 0.8 mM dNTP, and 0.05 units/µl of HotMaster Taq DNA polymerase (Eppendorf, Macquarie Park NSW,
Australia). Thermal cycling conditions consisted of an initial denaturation (95°C for 4 minutes) followed by
30 cycles of 95°C for 30 seconds, 47-55°C (refer to Ta column in primer tables) for 30 seconds and 72°C for
1 minute 30 seconds, with a final extension step of 72°C for 7 minutes. Cycling was performed in a Biorad thermal cycler PTC-200 (DNA Engine Peltier). PCR products were viewed on 1.5% agarose and TBE gels stained with GelRed (Biotium, USA, distributed by Gene Target Solutions, Dural, New South Wales,
Australia). PCR products were concentrated and desalted prior to sequencing using Exosap-it® (USB
Corporation distributed by GE Healthcare Bio-Sciences, Rydalmere NSW, Australia). Approximately 20 ng of DNA was used in standard ABI Dye Terminator sequencing reactions using Big Dye Vers 3.1 technology
(Applied Biosystems, Thermo-Fisher Scientific, Scoresby, Victoria, Australia) and were run on an Applied Biosystems 3130XL Genetic Analyser. Raw sequence chromatograms were aligned and edited with
Sequencher (Vers 4.8 Gene Codes Corporation, Ann Arbor, MI, USA).
DNA sequence and amino acid alignment
Sequences were linearized to the same starting point as used by Lin et al., (2011). Complete sequences were aligned using ClustalW (Thompson et al., 1997). The ClustalW output was then eyeball edited prior to phylogenetic analysis to ensure codon reading frames were maintained across the alignment and gaps minimised. Coding sequence was determined by aligning files to annotated accessions on Genbank.
Coding sequences were translated into amino acids using NCBI genetic code 4 for mold, protozoa and coelenterate mitochondrial DNA. Two data sets were prepared for phylogenetic analyses. The first data set was for a broad scale analysis using an amino acid alignment that included a single representative of each Eimeria species from Table 1 and all related taxa from Table 2. This analysis was restricted to amino acid alignments as the distance among taxa was such that DNA sequences in the noncoding regions were too variable to align with confidence and third codon positions were likely to be saturated. Prior to phylogenetic analysis, amino acid alignments were truncated to avoid suspicious putative coding sequence at the start and end of genes that caused frame shifts. Positions described below relate to a
6,628bp alignment of the 54 ingroup taxa (excludes Choleoeimeria) which has been uploaded to the
DRYAD digital data repository as a Fasta file that is publically available for download (accession XXXX). The complete cytochrome b coding sequence was used between positions 128 and 1,207 (360 amino acids); the COI coding sequence was restricted to between positions 1,228 to 2,686 in the alignment (486 amino acids); and COIII was restricted to positions 4,423 and 5,184 (260 amino acids). Following the removal of noncoding regions it became possible to include Choleoeimeria in the alignment. The three coding regions were then translated and concatenated for phylogenetic analysis. The final amino acid data set analysed consisting of a single representatives of each species, including Choleoeimeria and 27 ingroup taxa, has been uploaded to DRYAD as a Fasta file that is publically available for download (accession XXXX). The second data set was a complete mitochondrial DNA sequence alignment focused on the chicken infecting Eimeria species, and their nearest relatives, determined from the amino acid phylogeny (Fasta file is publically available for download from DRYAD, accession XXXX).
Phylogenetic analyses
Outgroup selection for the mtDNA amino acid phylogenetic analyses proved difficult. Initial trees were rooted with an avian Isospora sp., however, a genetic distance matrix suggested this species might also be nested within the Eimeria genus so a more distant taxa, Choleoeimeria sp., was selected to root the amino acid phylogeny. The DNA sequence of this genus was clearly divergent (amino acid sequences were alignable but large tracts of non-coding DNA could not be aligned) to all other species in the analysis and a ribosomal DNA phylogeny placed Choleoeimeria basal to the greater Eimeria clade (Megía‐Palma et al.,
2015). Single representatives of each ingroup species were analysed to avoid bias. Prior to analysis an amino acid substitution model was determined using likelihood ratios in Mega v6 (Tamura et al., 2013).
Based on Akaike information criterion (AIC), the model selected for the 1,100 amino acid alignment of 28 samples, was a Le and Gascuel (LG) general amino acid replacement matrix with estimates of invariant sites (I) and among site heterogeneity (G) (summarized as LG+I+G).
Amino acid trees were constructed using maximum likelihood (L), maximum parsimony (P), and distance matrix analyses (D) in Mega v6 (Tamura et al., 2013). In Mega v6 (Tamura et al., 2013), unweighted trees were found using heuristic searches using nearest neighbour interchange (NNI). The amino acid alignment contained no gaps and for the parsimony analysis sequences were added randomly and tree-bisection- reconnection (TBR) branch swapping was used. The LG+I+G model was not available for constructing the neighbour joining distance tree in Mega v6 (Tamura et al., 2013), so a Jones Taylor and Thornton
(JTT)+I+G model was used instead. Branch support was determined for all trees by bootstrapping using
1000 replicates.
Phylogenetic trees based on DNA sequence alignments were constructed using maximum parsimony (P), maximum likelihood (L) and distance matrix analyses (D) in PAUP*, Vers 4.0b10 (Swofford, 2002). Before generating the trees a series of likelihood ratio tests were completed using MrModeltest (Nylander, 2004) to determine the best nucleotide substitution model to use for L and D analyses. Based on akaike information criterion (AIC), the model selected for the 6,488 base alignment of the 42 sequences, was a general time reversible model (GTR) with estimates of invariant sites (I) and among site heterogeneity (G)
(summarized as GTR+I+G). The PAUP*(Swofford, 2002) command block used was
Lset Base=(0.3039 0.1717 0.1669) Nst=6 Rmat=(1.708280444 2.608000278 1.668951631 0.358015329
5.944323063) Rates=gamma Shape=0.6757 Pinvar=0.4947;
In PAUP* (Swofford, 2002), unweighted trees were found using heuristic searches with random sequence addition and tree-bisection-reconnection (TBR) branch swapping. For the parsimony analysis gaps were treated as missing data. Other settings used were Mulpars in effect, Maxtrees set to 1000 (P) or 200 (D and L) and heuristic search repetitions were set to 1000 (P) or one (D and L). Branch support was determined for P and D trees by bootstrapping using 1000 replicates. Bayesian support was determined for the L tree using a general time reversible model GTR+I+G model in MrBayes (Huelsenbeck and
Ronquist, 2001) with a 1,000,000 generations and a burnin of 250,000. Maximum likelihood trees are presented with all bifurcating branches having ≥ 70% Bayesian support, otherwise they were collapsed.
Species-specific mtDNA SNP assays
Based on species-level sequence alignments of the mitochondrial genomes of the pure Eimeria stains
(Table 1) plus mitochondrial fragments from GenBank (Benson et al., 2013), pairs of species-specific primers were developed flanking variable single nucleotide polymorphisms (SNPs). Two assays per species were developed targeting from 1 to 9 SNPs (Table 4) based on the alignments of all available international strains. The assays were designed to detect strain differences within single species so that DNA extracted from field collected mixed-species infections could be screened without having to undergo the time consuming process of species isolation. Assays could not be developed for OTU-X or OTU-Y because DNA sequence from only one pure strain was available for these species (i.e. variable SNPs were unknown). Flock screening for different Eimeria strains
Flock screening was conducted using Australian Eimeria samples collected from 181 geographically widespread flocks that had tested genetically positive to Eimeria. Samples from every Australian state and territory (8 in total) were represented for E. acervulina, E. necatrix, E. mitis and OTU-Z, while 7 regions were represented for E. maxima, 6 for E. tenella and 4 for E. brunetti and E. praecox. Detailed collection and species-level screening methods are published in Godwin and Morgan (2015). The samples were obtained from mixed stool or caecal contents thus represented a flock, not an individual bird. DNA was
PCR amplified using the species-specific mtDNA SNP assays described above (primers and annealing temperatures detailed in Table 4). The PCR amplification products were directly sequenced using standard
ABI Dye Terminator sequencing reactions using Big Dye Vers 3.1 technology (Applied Biosystems, Thermo-
Fisher Scientific, Scoresby, Victoria, Australia).
3. Results
Complete mitochondrial genomes were sequenced from 25 Eimeria isolates representing all 10 species known to occur in chickens throughout Australia, including OTU-X, -Y and -Z. Additional genome sequences were obtained for strains of E. zuernii and E. falciformis. The chicken Eimeria genomes vary in size from 6,166 to 6,419 nucleotides with the final alignment consisting of 6,488 bases with an average GC content of 34.7%. Species-level comparisons among the chicken infecting Eimeria ranged from 2.2 to
14.5% divergence while population differences within species were under 0.65% (Table 5).
The deeper phylogenetic comparison to other Eimeria species and related taxa based on an amino acid alignment (Figure 1) identified two poultry infecting clades. Two turkey infecting species E. innocua and E. dispersa did not group with the other poultry infecting species; instead they separated in a clade with
Cyclospora cayetanensis (human). Eimeria zuernii (cattle) was nested between the two poultry clusters although bootstrap support was not strong (Figure 1). The remaining poultry infecting clade divided into two clusters. One cluster contained only chicken infecting species while the second cluster contained chicken infecting species and turkey infecting species. The overall phylogeny generally grouped species by host. Both the canary infecting Isospora sp and human infecting Cyclospora cayetanensis (human) were nested within the Eimeria genus while Caryospora bigenetica (snake) fell in a basal position on the tree.
The phylogenetic tree constructed from the complete mtDNA genome alignment, focused on the chicken infecting Eimeria species. The tree highlights the lack of strain variability within all of the species as demonstrated by short branch lengths (Figure 2). The three OTUs are unique with OTU-X falling sister to
E. maxima (4.5% divergence), OTU-Y sister to E. brunetti (5.6% divergence) and OTU-Z either falling in a unique clade of its’ own (as in Figure 2) or else sister to E. mitis (as in Figure 1, 10.7% divergence). The species separate with high bootstrap support on the tree and both the amino acid and DNA based trees support the close relationships detailed above as well as between E. tenella and E. necatrix. Deeper nodes relating these sister species to one another lacked strong bootstrap support at both the DNA and amino acid level. Sequence similarity was high among comparisons of Australian strains to publically available international strains (China, Japan, UK and USA).
Sixteen species-specific mtDNA SNP assays were developed, two assays for each species (excluding OTU-X and -Y)(Figure 3 and Table 4). The assays were tested against DNA extracted from pure species of all known Australian species to confirm their specificity. Any assays that mis-primed on non-target species were redesigned with the primers given mismatched penultimate bases (underlined bases in Table 4) then specificity testing was repeated to ensure that the assays only amplified their target species.
Screening of geographically widespread Australian flocks with the species-specific mtDNA SNP assays identified common international SNP genotypes for E. acervulina, E. maxima and E. tenella (Figure 4).
Greatest diversity was observed among Australian strains of E. mitis. A proportion of all of the flocks proved difficult to genotype for the SNPs due to the presence of more than one strain of the target species resulting in mixed SNP signals. Common genotypes were widespread for all of the species and, for
Australian Eimeria, no correlation was found between genetic diversity and geographic origin using the mtDNA SNP based assays.
4. Discussion A comparison of the mtDNA amino acid Eimeria phylogeny to those constructed using ribosomal DNA 18S sequences (Chapman et al., 2013; Megía‐Palma et al., 2015) shows general systematic congruence between the genomes. The genus Caryospora has a basal position in the phylogeny, the rabbit infecting species group together and the avian infecting Isospora sp. and primate infecting Cyclospora are nested within the genus Eimeria. A major difference between the nuclear DNA and mtDNA genome trees is that the 18S tree has a single monophyletic poultry clade with Cyclospora as sister (Chapman et al., 2013;
Megía‐Palma et al., 2015). The mtDNA tree currently splits the poultry clade nesting E. zuernii and
Cyclospora amongst the turkey infecting species. This is probably an artefact of single species representation of the bovine and primate infecting clades in the phylogeny. As more mtDNA genomes become available for Cyclospora and the cattle and sheep infecting Eimeria species, the long branches currently leading to these individuals will be broken and the poultry Eimeria will likely re-group into a monophyletic assemblage.
The complete mitochondrial sequences of described chicken infecting Eimeria species from Australia align closely to those sequenced from China, Japan, the UK and the USA. Diversity within the species was below
0.65%. Species level diversity among the chicken infecting species ranged from 2.2 to 14.5% with E. tenella and E. necatrix the closest relatives. Improved species diagnostics, largely the result of molecular technologies, and wider species coverage has resolved many of the confused species identities that confounded phylogenies earlier this century (Lew et al., 2003).
The resolving power of mitochondrial DNA is excellent at Eimeria species level and the division of the chicken infecting species into two clades; one with species that only infect chickens and the second with species that infect chickens and species that infect turkeys, is strongly supported (Ogedengbe et al.,
2014). This division of chicken infecting Eimeria into two major lineages is also supported by a phylogeny constructed from conserved nuclear ribosomal DNA 18S sequences (Schwarz et al., 2009). The placement of OTU-X, -Y and -Z within the chicken-only infecting clade has strong bootstrap support on the mitochondrial genome tree and is consistent on the amino acid tree, but lacks bootstrap support. OTU-X, -Y and -Z were clearly different from each other and from all other characterised species in the genus including E. mivati for which only COI sequence is available for comparison (Wang, 2006). The closest relative of OTU-X is E. maxima and OTU-Y is sister to E. brunetti. Both of these relationships are well supported in the phylogeny and appear to be more recent divergence events. The affinity of OTU-Z to other members of the genus is less clear; this species appears to have diverged around the same time as the radiation event that led to the major chicken Eimeria lineages in this clade. An alignment of COI sequences alone including E. mivati, which falls sister to E. mitis, suggests OTU-Z may have a closer affinity to the clade containing E. brunetti and OTU-Y, although again this relationship lacks bootstrap support.
Phylogenetic trees based on ribosomal ITS2 sequences have suggested OTU-Z might be sister to E. necatrix and E. tenella (Fornace et al., 2013), however Schwarz et al.,(2009) and Clark et al., (2016) published a different topology using the same marker which highlights the importance of outgroup selection and sequence alignments. Chicken Eimeria display high within individual variability in the ribosomal internal transcribed spacers and length differences make sequence alignments for phylogenetic comparisons difficult for this marker (Lew et al., 2003). The relationship presented here, based on the complete mitochondrial genome, provides a more robust overview of relationships within the genus.
Independent of tree building algorithm, OTU-Z falls within the chicken-specific Eimeria clade with maximum bootstrap and Bayesian support.
As a population level marker the mitochondrial DNA did provide a small number of variable SNPs. Within
Australia, E. mitis proved the most variable species with an order of magnitude more variable sites than most of the other species. When compared to sequences from a small number of international strains, E. mitis remained one of the most variable species but by a substantially smaller margin. The large increase in population level SNPs for E. tenella (2 SNPs found differentiating Australian, Chinese and Japanese E. tenella strains but 42 SNPs identified when UK E. tenella Houghton strain was included in the comparison) may reflect a unique E. tenella lineage but more likely is the result of sequencing artefacts resulting from poorer sequence quality (higher misincorporation error rates) obtained using early next generation sequencing technologies. Two species-specific mtDNA SNP targeting assays were developed per species to screen field collected
Eimeria samples from a nationwide sampling effort to investigate Eimeria species and strain distributions around Australia. Common international SNP genotypes were found for E. acervulina, E. maxima and E. tenella. Without screening more global isolates it is difficult to determine if these common genotypes represent a lack of global diversity, or if they might represent the source of Australian Eimeria. Greatest
SNP genotypic diversity was again observed for E. mitis. Genotype distribution did not correlate with geographic origin, however, the sample sizes were too small, and the SNPs too few, for a comprehensive population genetic assessment. This study forms a base-line of sequences so that in the future, if new immunologically distinct or highly pathogenic strains are detected, they can be sequenced and rapidly compared to known genotypes in the hope that strain-diagnostic mtDNA markers might be identified.
Mixed SNP signals in many of the samples highlighted the presence of multiple strains infecting flocks.
Mixed species infections are common in Australia with flocks typically infected with at least two Eimeria species (Godwin and Morgan, 2015). The success of live Eimeria vaccines demonstrates that protective immunity develops in birds once they have been exposed to a species of Eimeria, so, with the exception of some strains which have been shown to not cross-protect (e.g. E. maxima, Smith et al., 2002), it is unlikely that more than one strain fully develops in a single bird (Williams, 1998). This is the first evidence to suggest that Australian flocks are harbouring multiple strains of the same species. A recent paper by
Blake et al., (2015) has identified mixed strain infections of E. tenella in flocks from India and Africa. The finding in Australia for multiple strains of the same species within a flock was not a rare occurrence; flocks with mixed SNP genotypes were found for E. acervulina, E. maxima, E. mitis and OTU-Z. The use of live multi-species vaccines may be adding to the number of circulating strains within flocks, however, the sampled flocks screened in this study were all unvaccinated. With the advent of strain level genetic markers, future studies of Eimeria will be able to track disease epidemiology and hopefully gain a better understanding of virulence markers.
Conclusions Australian species of chicken Eimeria align closely to their international counterparts. A phylogeny constructed from complete mitochondrial genome sequences places all three OTUs within the clade containing Eimeria species that only infect chickens. Within species mitochondrial genetic diversity was present but low among Australian isolates. Genetically different strains of the same species were frequently found in flocks. The advent of strain-specific markers will assist in future studies investigating the epidemiology of coccidiosis.
Acknowledgements
We would like to thank Bioproperties Pty Ltd for access to pure strains of the three Eimeria OTUs and also pure Eimeriavax vaccine strains. Thanks also to Professor Robin B. Gasser for providing DNA of outgroup species E. zuernii and E. falciformis. We appreciate the anonymous reviewer feedback received as it helped to resolve the conundrum of outgroup choice. Funding for this project was provided by the
Chicken Meat RIRDC (project PRJ-002473), the Poultry CRC (project Morgan 1-2-3) and the Queensland
Government. Mitochondrial DNA sequences were extracted from online genome sequencing efforts by the Malaysian Genome Institute (E. maxima – Houghton) and Sanger (E. acervulina – UK and E. tenella -
Houghton).
References
Barta, J.R., Martin, D.S., Liberator, P.A., Dashkevicz, M., Anderson, J.W., Feighner, S.D.,
Elbrecht, A., Perkins-Barrow, A., Jenkins, M.C., Danforth, H.D., Ruff, M.D., Profous-
Juchelka, H., 1997. Phylogenetic relationships among eight Eimeria species infecting
domestic fowl inferred using complete small subunit ribosomal DNA sequences. Journal of
Parasitology 83, 262-271.
Barta, J.R., Ogedengbe, J.D., Martin, D.S., Smith, T.G., 2012. Phylogenetic position of the
adeleorinid coccidia (Myzozoa, Apicomplexa, Coccidia, Eucoccidiorida, Adeleorina)
inferred using 18S rDNA sequences. Journal of Eukaryotic Microbiology 59, 171-180. Benson, D.A., Cavanaugh, M., Clark, K., Karsch-Mizrachi, I., Lipman, D.J., Ostell, J., Sayers,
E.W., 2013. GenBank. Nucleic Acids Research 41, D36-D42.
Blake, D.P., Clark, E.L., Macdonald, S.E., Thenmozhi, V., Kundu, K., Garg, R., Jatau, I.D.,
Ayoade, S., Kawahara, F., Moftah, A., Reid, A.J., Adebambo, A.O., Álvarez Zapata, R.,
Srinivasa Rao, A.S.R., Thangaraj, K., Banerjee, P.S., Dhinakar-Raj, G., Raman, M.,
Tomley, F.M., 2015. Population, genetic, and antigenic diversity of the apicomplexan
Eimeria tenella and their relevance to vaccine development. Proceedings of the National
Academy of Sciences 112, E5343-E5350.
Blake, D.P., Tomley, F.M., 2014. Securing poultry production from the ever-present Eimeria
challenge. Trends in Parasitology 30, 12-19.
Cantacessi, C., Riddell, S., Morris, G.M., Doran, T., Woods, W.G., Otranto, D., Gasser, R.B.,
2008. Genetic characterization of three unique operational taxonomic units of Eimeria
from chickens in Australia based on nuclear spacer ribosomal DNA. Veterinary
Parasitology 152, 226-234.
Chapman, H.D., Barta, J.R., Blake, D., Gruber, A., Jenkins, M., Smith, N.C., Suo, X., Tomley,
F.M., 2013. A selective review of advances in coccidiosis research. Adv Parasitol 83, 93-
171.
Cinar, H.N., Gopinath, G., Jarvis, K., Murphy, H.R., 2015. The Complete Mitochondrial Genome
of the Foodborne Parasitic Pathogen Cyclospora cayetanensis. PLoS One 10, e0128645.
Clark, E.L., Macdonald, S.E., Thenmozhi, V., Kundu, K., Garg, R., Kumar, S., Ayoade, S.,
Fornace, K.M., Jatau, I.D., Moftah, A., Nolan, M.J., Sudhakar, N.R., Adebambo, A.O.,
Lawal, I.A., Álvarez Zapata, R., Awuni, J.A., Chapman, H.D., Karimuribo, E., Mugasa,
C.M., Namangala, B., Rushton, J., Suo, X., Thangaraj, K., Srinivasa Rao, A.S.R., Tewari,
A.K., Banerjee, P.S., Dhinakar Raj, G., Raman, M., Tomley, F.M., Blake, D.P., 2016. Cryptic Eimeria genotypes are common across the southern but not northern hemisphere.
International Journal for Parasitology 46, 537-544.
Dalloul, R.A., Lillehoj, H.S., 2006. Poultry coccidiosis: recent advancements in control measures
and vaccine development. Expert Review of Vaccines 5, 143-163.
Fornace, K.M., Clark, E.L., Macdonald, S.E., Namangala, B., Karimuribo, E., Awuni, J.A.,
Thieme, O., Blake, D.P., Rushton, J., 2013. Occurrence of Eimeria species parasites on
small-scale commercial chicken farms in Africa and indication of economic profitability.
PLoS One 8, e84254.
Godwin, R.M., Morgan, J.A.T., 2015. A molecular survey of Eimeria in chickens across Australia.
Veterinary Parasitology 214, 16-21.
Hafeez, M.A., McAllister,C.T., Seville,S. and Barta,J.R. 2015. The complete mitochondrial
genome sequence of an unnamed Choleoeimeria species (Eimeriidae, Eucoccidiorida,
Coccidiasina, Apicomplexa) causing coccidiosis in the gall bladder of the prairie
kingsnake (Lampropeltis calligaster calligaster: Colubridae, Reptilia) (Genbank direct
submission accession KT203395).
Hafeez, M.A., Vrba, V., Barta, J.R., 2016. The complete mitochondrial genome sequence of
Eimeria innocua (Eimeriidae, Coccidia, Apicomplexa). Mitochondrial DNA. Part A, DNA
mapping, sequencing, and analysis 27, 2805-2806.
Hikosaka, K., Nakai, Y., Watanabe, Y.-i., Tachibana, S.-I., Arisue, N., Palacpac, N.M.Q.,
Toyama, T., Honma, H., Horii, T., Kita, K., Tanabe, K., 2011. Concatenated mitochondrial
DNA of the coccidian parasite Eimeria tenella. Mitochondrion 11, 273-278.
Huelsenbeck, J.P., Ronquist, F., 2001. MRBAYES: Bayesian inference of phylogenetic trees.
Bioinformatics 17, 754-755. Lew, A.E., Anderson, G.R., Minchin, C.M., Jeston, P.J., Jorgensen, W.K., 2003. Inter- and intra-
strain variation and PCR detection of the internal transcribed spacer 1 (ITS-1) sequences of
Australian isolates of Eimeria species from chickens. Veterinary Parasitology 112, 33-50.
Lin, R.-Q., Qiu, L.-L., Liu, G.-H., Wu, X.-Y., Weng, Y.-B., Xie, W.-Q., Hou, J., Pan, H., Yuan,
Z.-G., Zou, F.-C., Hu, M., Zhu, X.-Q., 2011. Characterization of the complete
mitochondrial genomes of five Eimeria species from domestic chickens. Gene 480, 28-33.
Liu, G.H., Hou, J., Weng, Y.B., Song, H.Q., Li, S., Yuan, Z.G., Lin, R.Q., Zhu, X.Q., 2012. The
complete mitochondrial genome sequence of Eimeria mitis (Apicomplexa: Coccidia).
Mitochondrial DNA 23, 341-343.
Liu, G.H., Tian, S.Q., Cui, P., Fang, S.F., Wang, C.R., Zhu, X.Q., 2015. The complete
mitochondrial genomes of five Eimeria species infecting domestic rabbits. Exp Parasitol
159, 67-71.
Logan-Klumpler, F.J., De Silva, N., Boehme, U., Rogers, M.B., Velarde, G., McQuillan, J.A.,
Carver, T., Aslett, M., Olsen, C., Subramanian, S., Phan, I., Farris, C., Mitra, S.,
Ramasamy, G., Wang, H., Tivey, A., Jackson, A., Houston, R., Parkhill, J., Holden, M.,
Harb, O.S., Brunk, B.P., Myler, P.J., Roos, D., Carrington, M., Smith, D.F., Hertz-Fowler,
C., Berriman, M., 2012. GeneDB--an annotation database for pathogens. Nucleic Acids
Res 40, D98-108.
Megía‐Palma, R., Martínez, J., Acevedo, I., Martín, J., García‐Roa, R., Ortega, J., Peso‐Fernández,
M., Albaladejo, G., Cooper, R.D., Paranjpe, D.A., 2015. Phylogeny of the reptilian
Eimeria: are Choleoeimeria and Acroeimeria valid generic names? Zoologica Scripta 44,
684-692.
Miska, K.B., Schwarz, R.S., Jenkins, M.C., Rathinam, T., Chapman, H.D., 2010. Molecular
Characterization and Phylogenetic Analysis of Eimeria From Turkeys and Gamebirds: Implications for Evolutionary Relationships in Galliform Birds. Journal of Parasitology 96,
982-986.
Nylander, J.A.A. 2004. MrModeltest 2.3 (Evolutionary Biology Centre, Uppsala University,
Program distributed by the author ).
Ogedengbe, J.D., Hanner, R.H., Barta, J.R., 2011. DNA barcoding identifies Eimeria species and
contributes to the phylogenetics of coccidian parasites (Eimeriorina, Apicomplexa,
Alveolata). International Journal for Parasitology 41, 843-850.
Ogedengbe, M.E., Barta, J.R., 2016. The complete mitochondrial genome of Caryospora
bigenetica (Eimeriidae, Eucoccidiorida, Coccidiasina, Apicomplexa). Mitochondrial DNA.
Part A, DNA mapping, sequencing, and analysis 27, 3289-3290.
Ogedengbe, M.E., Brash, M., Barta, J.R., 2016. The complete mitochondrial genome sequence of
an Isospora sp. (Eimeriidae, Eucoccidiorida, Coccidiasina, Apicomplexa) causing systemic
coccidiosis in domestic Canaries (Serinus canaria Linn.). Mitochondrial DNA. Part A,
DNA mapping, sequencing, and analysis 27, 3315-3317.
Ogedengbe, M.E., El-Sherry, S., Whale, J., Barta, J.R., 2014. Complete mitochondrial genome
sequences from five Eimeria species (Apicomplexa; Coccidia; Eimeriidae) infecting
domestic turkeys. Parasites & Vectors 7, 335-335.
Ogedengbe, M.E., Hafeez, M.A., Barta, J.R., 2013. Sequencing the complete mitochondrial
genome of Eimeria mitis strain USDA 50 (Apicomplexa: Eimeriidae) suggests conserved
start positions for mtCOI- and mtCOIII-coding regions. Parasitology Research 112, 4129-
4136.
Schwarz, R.S., Jenkins, M.C., Klopp, S., Miska, K.B., 2009. Genomic analysis of Eimeria spp.
populations in relation to performance levels of broiler chicken farms in Arkansas and
North Carolina. The Journal of Parasitology 95, 871-880. Smith, A.L., Hesketh, P., Archer, A., Shirley, M.W., 2002. Antigenic diversity in Eimeria maxima
and the influence of host genetics and immunization schedule on cross-protective
immunity. Infection and Immunity 70, 2472-2479.
Swofford, D.L. 2002. PAUP* Phylogenetic Analysis Using Parsimony (*and Other Methods)
(Sunderland, Massachusetts, Sinauer Associates).
Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular
evolutionary genetics analysis version 6.0. Molecular biology and evolution 30, 2725-
2729.
Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The
CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided
by quality analysis tools. Nucleic Acids Research 25, 4876-4882.
Tian, S.Q., Cui, P., Fang, S.F., Liu, G.H., Wang, C.R., Zhu, X.Q., 2015. The complete
mitochondrial genome sequence of Eimeria magna (Apicomplexa: Coccidia).
Mitochondrial DNA 26, 714-715.
Wang, X., Huang, B., Zhao, Q., Han, H., Dong, H., Jiang, L. and Han, J 2006. Eimeria mivati
strain Shanghai cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial
(Direct Genbank Submission accession EF174185).
Williams, R.B., 1998. Epidemiological aspects of the use of live anticoccidial vaccines for
chickens. International Journal for Parasitology 28, 1089-1098.
Legends to Figures
Figure 1. Maximum likelihood phylogenetic tree built from an amino acid alignment of Eimeria species and their relatives. Bootstrap branch support (based on parsimony, distance and likelihood analyses) is shown if present in all trees and >80%. New Genbank accessions are underlined.
Figure 2. Maximum likelihood phylogenetic tree of poultry infecting Eimeria species and strains based on complete mitochondrial genome sequences (two partial genomes marked with *). Branch support (bootstrap and Bayesian) is shown if >80% using all tree building algorithms (likelihood, distance and parsimony). New Genbank accessions are underlined.
Figure 3. Linearized mitochondrial genome alignment of eight Eimeria species displaying the gene coding regions (Cytb, COI and COIII), alignment gaps (breaks in solid black lines) and the location of species- specific assays designed to target variable SNPs for strain diagnostics.
Figure 4. Genetic diversity of Australian Eimeria compared to international isolates. Shading and patterns within bars correspond to unique genotypes; white bars indicate a mixed SNP signal indicating the presence of multiple strains in the sample.
Figr-1Figure 1.
KT203395 Choleoeimeria sp. unknown - snake KP658102 Caryospora bigenetica Brazil - snake KP658103 Isospora sp. Canada - canary 95-98 KP025693 Eimeria flavescens China - rabbit
100 KP025690 Eimeria irresidua China - rabbit KP009592 Eimeria intestinalis China - rabbit
99-100 KF419217 Eimeria magna China - rabbit KP025691 Eimeria media China - rabbit 98-99 KP025692 Eimeria vejdovskyi China - rabbit KX495129 Eimeria falciformis Nth America - mice KP796149 Cyclospora cayetanensis unknown - human KR108296 Eimeria innocua Czech Republic - turkey KJ608416 Eimeria dispersa UK - turkey 85-100 KX495130 Eimeria zuernii Nth America - cattle KJ608414 Eimeria meleagrimitis USA - turkey 92-99 89-96 KJ608418 Eimeria meleagridis USA - turkey KJ608415 Eimeria adenoeides Canada - turkey KJ608413 Eimeria gallopavonis UK - turkey KX094952 Eimeria necatrix Gronec Aus - chicken 86-98 KX094949 Eimeria tenella Darten Aus - chicken 97-99 KX094944 Eimeria praecox Jorpra Aus - chicken KX094946 Eimeria acervulina Newace Aus - chicken KX094955 Eimeria sp. OTU-Z1 Aus - chicken KX094962 Eimeria mitis Redmit Aus - chicken
100 KX094960 Eimeria sp. OTU-Y1 Aus - chicken KX094958 Eimeria brunetti Monbru Aus - chicken
100 KX094967 Eimeria sp. OTU-X1 Aus - chicken KX094965 Eimeria maxima Medmax Aus - chicken
0.05
Figure 2.
KX495130 Eimeria zuernii North America - cattle KJ608414 Eimeria meleagrimitis - turkey KJ608413 Eimeria gallopavonis - turkey 100 KJ608415 Eimeria adenoeides - turkey 100 KJ608418 Eimeria meleagridis - turkey 81-100 HQ702482 Eimeria necatrix China - chicken 100 KX094953 Eimeria necatrix Mednec Aus - chicken KX094954 Eimeria necatrix Gatnec Aus - chicken 100 KX094952 Eimeria necatrix Gronec Aus - chicken KX094949 Eimeria tenella Darten Aus - chicken GeneDB Sanger Eimeria tenella Houghton UK - chicken KX094951 Eimeria tenella Ingten Aus - chicken 89-100 AB564272 Eimeria tenella NIAH Japan - chicken HQ702484 Eimeria tenella China - chicken KX094950 Eimeria tenella Redten Aus - chicken KX094943 Eimeria praecox Andpra Aus - chicken 100 KX094945 Eimeria praecox Ingpra Aus - chicken KX094944 Eimeria praecox Jorpra Aus - chicken HQ702483 Eimeria praecox China - chicken GeneDB Sanger Eimeria acervulina UK* - chicken HQ702479 Eimeria acervulina China - chicken 100 KX094948 Eimeria acervulina Ponace Aus - chicken KX094947 Eimeria acervulina Royace Aus - chicken KX094946 Eimeria acervulina Newace Aus - chicken 96-100 100 KX094955 Eimeria sp. OTU-Z1 Aus - chicken KX094956 Eimeria sp. OTU-Z2 Aus - chicken KX094963 Eimeria mitis Jormit Aus - chicken 100 KF501573 Eimeria mitis USDA50 USA - chicken JN864949 Eimeria mitis China - chicken KX094962 Eimeria mitis Redmit Aus - chicken KX094961 Eimeria mitis Kelmit Aus - chicken KX094960 Eimeria sp. OTU-Y1 Aus - chicken 100 100 HQ702480 Eimeria brunetti China - chicken KX094958 Eimeria brunetti Monbru Aus - chicken KX094959 Eimeria brunetti Roybru Aus - chicken KX094957 Eimeria brunetti Bowbru Aus - chicken KX094967 Eimeria sp. OTU-X1 Aus - chicken 100 MGI Eimeria maxima Houghton UK* - chicken 100 HQ702481 Eimeria maxima China - chicken KX094965 Eimeria maxima Medmax Aus - chicken KX094966 Eimeria maxima Ingmax Aus - chicken 0.1 KX094964 Eimeria maxima ARI-M3 Aus - chicken
Figure 3.
1 500 1,000 1,500 2,000 2,500 3,000 3,500 4,000 4,500 5,000 5,500 6,000 6,470 E. acervulina Cytb COI COIII 1. E. acervulina ace ... ace Assay 2
2. E. necatrix E. necatrix nec Assay 1 nec Assay 2
3. E. brunetti bru Assay 1 bru Assay 2 E. brunetti 4. E. mitis mit Assay 1 mit Assay 2
5. E. praecox E. mitis pra Assay 1 pra Assay 2
6. E. sp OTU Z Z Assay 1 Z Assay 2 E. praecox 7. E. maxima max Assay 1 max Assay 2
E. sp.8. OTUE. tenella Z ten Assay 1 ten A... ten Assay 2
Figure 4.
Table 1 Chicken infecting Eimeria included in study with new accessions underlined
Species Strain Geographical Origin Genbank Accession
E. acervulina Newace Queensland, Aus KX094946
Ponace Queensland, Aus KX094948
Royace Queensland, Aus KX094947
China China HQ702479*
Emw- UK GeneDB, Sangerε scaff1766ε
E. brunetti Monbru South Australia, Aus KX094958
Roybru Queensland, Aus KX094959
Bowbru New South Wales, Aus KX094957
China China HQ702480*
E. maxima Ingmax Victoria, Aus KX094966
ARI-M3 Victoria, Aus KX094964
Medmax Victoria, Aus KX094965
China China HQ702481*
Houghton UK MGIθ
E. mitis Kelmit Queensland, Aus KX094961
Redmit Queensland, Aus KX094962
Jormit Queensland, Aus KX094963
China China JN864949∞
USDA 50 USA KF501573π
E. necatrix Gatnec Queensland, Aus KX094954
Gronec Queensland, Aus KX094952
Mednec Victoria, Aus KX094953
China China HQ702482*
E. praecox Jorpra Queensland, Aus KX094944
Ingpra New South Wales, Aus KX094945
Andpra Queensland, Aus KX094943
China China HQ702483*
E. tenella Darten Queensland, Aus KX094949
Ingten New South Wales, Aus KX094951 Redten Queensland, Aus KX094950
China China HQ702484*
NIAH Japan AB564272¥
Houghton UK GeneDB, Sangerδ
E. sp. OTU X1 X1 Victoria, Aus KX094967
E. sp. OTU Y1 Y1 Victoria, Aus KX094960
E. sp. OTU Z1 Z1 Victoria, Aus KX094955
E. sp. OTU Z2 Z2 New South Wales, Aus KX094956
* (Lin et al. 2011), ε Contaminated E. maxima (Weybridge), θ Malaysia Genome Institute, ∞ (Liu et al., 2012), π (Ogedengbe et al., 2013), ¥ (Hikosaka et al., 2011), δ (Logan-Klumpler et al., 2012)
Table 2 Non-chicken infecting Eimeria included in initial analyses with new accessions underlined
Host Species Strain Geographical Origin Genbank Accession
turkey E. gallopavonis Weybridge UK KJ608413ɑ
E. adenoeides Guelph Ontario, Canada KJ608415ɑ
E. meleagridis USAR97-01 Arkansas, USA KJ608418ɑ
E. meleagrimitis USMN08-01 Minnesota, USA KJ608414ɑ
E. dispersa Briston UK KJ608416ɑ
E. innocua Czech Republic KR108296µ
rabbit E. magna China KF419217ɣ
E. intestinalis China KP009592λ
E. flavescens China KP025693λ
E. media China KP025691λ
E. vejdovskyi China KP025692λ
E. irresidua China KP025690λ
cattle E. zuernii North America KX495130
mouse E. falciformis North America KX495129
snake Caryospora bigenetica MTZ_07-12108 Brazil KP658102ε
Choleoeimeria sp. JRB-2016 unknown KT203395π
human Cyclospora cayetanensis Not listed KP231180£
canary Isospora sp. JRB-2015 Canada KP658103β
ɑ (Ogedengbe et al., 2014), µ (Hafeez et al., 2016), ɣ (Tian et al., 2015), λ (Liu et al., 2015), ε (Ogedengbe & Barta, 2016), £ (Cinar et al., 2015), β (Ogedengbe et al., 2016), π (Hafeez et al., 2015)
Table 3. Generic primers for mtDNA amplification of Eimeria species with associated annealing temperatures (Ta)
5’ position in E. tenella
Primer Sequence starting 5 prime end accession HQ702484 Ta
E-mt-F1.1 TTAACACCTCCATGTCGGCTC 2814 59
E-mt-R1 CTTTCCGGTTGTTTCCATCTC 4006 57
E-mt-F2 TGGGGATCCAATCCAGTGC 3880 55
E-mt-R2.1 CADATAGCTTCYACRAAATGCCA 4972 60
E-mt-F2.5 CTWTGGATTACAGGWYTACACTT 4782 58
E-mt-R2.5 TCGGGTAAATTCCGTCCTGC 5787 57
E-mt-F3 AGGGAAGTAAAGGTGCTCAG 5649 55
E-mt-R3 CCCCAGAAACTCATTTGACC 525 55
E-mt-F4.1 GTTTATTATGTCTCAAGTGAGATC 121 59
E-mt-R4.1 ATACCTAATTCYTTATGGTTTGC 1286 55
E-mt-F4.5 CAAGAAATTGYGCAACATCTTGG 1050 60
E-mt-R4.5 ACDGKCATCATATGRTGTGCC 2126 57
E-mt-F5 TGGTGATCCAGTATTATATCAAC 1920 57
E-mt-R5 GATAGGGAACAAACTGCCTCA 2940 57
Table 4. Primer information for Eimeria species-specific assays targeting variable SNPs in the mitochondrial DNA for strain differentiation
Product size
Primer Target species and Sequence 5' to 3' 5’ position in Ta Location* SNP
E. acervulina HQ702479 bases
Assay 1 F AAATGAGGCTTGATGGTTAAG 6144 50 658 2
R AGAATCTTTTTAATGTAGGACCG 326 Cytb
Assay 2 F TTTAAAAAATTAATTGGTTGTAT 2951 47 439 1
R TCAGGGGTGTATGTAATG 3389 NC1
E. necatrix HQ702482
Assay 1 F GATGCCGCTTTTAATGGTGCC 1907 57 668 2
R ACATTAAATCCTAGTAAGTGCACA 2574 COI
Assay 2 F AAGAAATTTTGGTTTCCCTCC 3138 53 1261 4
R CAGCTTCTCTGAATGTGATA 4397 NC1
E. brunetti HQ702480
Assay 1 F CAATTATTGGTTTAATATGTGGC 2403 50 726 4
R TTCAGGAGCAAACCGTTGAT 3128 COI&NC1
Assay 2 F CCATATTTATACTAGAACGGTA 3495 50 932 9
R AGTACTAATAACACCTAAACAG 4426 NC1&COIII
E. mitis KF501573
Assay 1 F CAGGTCCGGTCCGATTG 4217 53 1026 3
R ACAGTTATTTTTTAAATGACCGA 5241 NC1
Assay 2 F TGTCAAGTTCCTTTAATGTAGTTC 5366 57 962 5
R GGTGTACTTTTGTTTTAAATTTATACA 6326 NC2
E. praecox HQ702483
Assay 1 F GCAACATCTTGGAGTATTGC 1061 53 1309 4
R TTACATAATAAGTATCGTGTAAT 2369 COI
Assay 2 F TAAAGCACGAAATATCATGTGT 2977 53 892 2
R GCTTCCATTAATAAGAAAGTAT 3868 NC1
E. maxima HQ702481
Assay 1 F GCAGTAGCGGTAATACTATA 13 47 579 2
R AAACCTCCTAATAACCATGAA 590 Cytb
Assay 2 F GTTTCTATGTGGATAATCCTAAG 590 55 980 4
R ATCGGTACTAATAACAGTGATATG 1277 Cytb&COI E. tenella HQ702484
Assay 1 F CGCTCTACCAATATTCGTTAT 5912 50 958 1
R GAGCTACAAATGGAAGTACG 656 Cytb
Assay 2 F CTTTGTATTACATTTCGTACTT 622 47 769 9
R CTAATGCAACAACACGTAAC 1390 Cytb
E. sp. OTU Z KX094955
Assay 1 F ATATAACTGATACAACTCTAATA 4500 53 423 1
R ATGATTCTAATTGAGGTAATACTA 4922 COIII
Assay 2 F GTAGTTATCTCACAGCTTAG 5296 53 724 2
R GTATAACCATAGGTTATTGTC 6019 NC2
* NC1 noncoding region between COI and COIII, NC2 noncoding region between COIII and Cytb Table 5. Maximum number of base differences (SNPs), including gaps, below the diagonal, and percent similarity above the diagonal, for pairwise species comparisons of complete mitochondrial DNA genome sequences (based on a 6,526 nucleotide alignment). Within species SNP differences, including a comparison among just Australian isolates (in brackets), lies along the diagonal.
ten nec bru mit ace pra max X Y Z
E. tenella 42(2) 97.8 88.7 87 90.8 90.4 86.6 86.5 88.9 89.6
E. necatrix 139 15(1) 89.1 87.3 91.3 91 86.9 86.8 89.5 89.9
E. brunetti 707 682 20(2) 88.6 92.2 91.9 87.6 87.6 94.4 91.6
E. mitis 841 817 728 31(14) 90.2 89.8 85.5 85.5 88.9 89.3
E. acervulina 572 542 480 627 10(1) 94.6 89.2 88.8 92.3 93.2
E. praecox 597 565 504 653 328 10(3) 88.9 88.5 92 92.7
E. maxima 837 807 769 930 670 688 14(3) 95.5 88 88.1
OTU-X 840 814 773 934 697 711 279 (0) 87.6 88
OYU-Y 694 647 346 701 480 498 749 773 (0) 91.4
OTU-Z 652 624 519 682 422 452 735 743 535 (3)