Translocator Protein Ligand Protects Against Neurodegeneration in the MPTP Mouse Model of Parkinsonism

This Accepted Manuscript has not been copyedited and formatted. The final version may differ from this version.

Research Articles: Neurobiology of Disease

Translocator protein ligand protects against neurodegeneration in the MPTP mouse model of Parkinsonism

Jing Gong1, Éva M. Szegő1, Andrei Leonov4, Eva Benito5, Stefan Becker4, Andre Fischer5,6, Markus Zweckstetter3,4,5, Tiago Outeiro2,3,7 and Anja Schneider1,8 1German Center for Neurodegenerative Diseases, DZNE, Sigmund-Freud-Str. 27, 53127 Bonn, Germany 2Department of Experimental Neurodegeneration, Center for Biostructural Imaging of Neurodegeneration, University Medical Center Göttingen, University of Göttingen, Waldweg 33, 37075 Göttingen, Germany 3Cluster of Excellence, Nanoscale Microscopy and Molecular Physiology of the Brain (CNMPB), Humboldtallee 23, 30703 Göttingen, Germany 4Max-Planck-Institute for Biophysical Chemistry, Am Faßberg 11, 37077, Göttingen, Germany 5German Center for Neurodegenerative Diseases, DZNE, Von-Siebold-Str. 3a, 37075 Göttingen, Germany 6Department of Psychiatry and Psychotherapy, University Medical Center, Von-Siebold-Str. 3b, 37075 Göttingen, Germany 7Institute of Neuroscience, The Medical School, Newcastle University, Framlington Place, Newcastle Upon Tyne, NE2 4HH, UK 8Department of Neurodegenerative Diseases and Geriatric Psychiatry, University Hospital Bonn, Sigmund- Freud-Str.25, 53127 Bonn, Germany https://doi.org/10.1523/JNEUROSCI.2070-18.2019

Received: 14 August 2018

Revised: 11 January 2019

Accepted: 15 January 2019

Published: 22 February 2019

Author contributions: J.G., E.S., E.B., A.F., M.Z., T.F.O., and A.S. designed research; J.G., E.S., and E.B. performed research; J.G., E.S., E.B., A.F., and A.S. analyzed data; A.L., S.B., and M.Z. contributed unpublished reagents/analytic tools; A.S. wrote the paper.

Conflict of Interest: The authors declare no competing financial interests.

JG was supported by a scholarship from China Scholarship Council. EMSZ was supported by the Dorothea Schlözer fellowship. AF was supported by core funds from the DZNE, the DFG projects FI981/9-1 and SPP1738 (FI981-11-1) and the EU (ERC consolidator grant DEPICODE). MZ was supported by the DFG Collaborative Research Center 803 (project A11). TFO was supported by the DFG Center for Nanoscale Microscopy and Molecular Physiology of the Brain (CNMPB) and by SFB1286 (project B6). AS was supported by the DFG Center for Nanoscale Microscopy and Molecular Physiology of the Brain (CNMPB), DZNE core funds, the DFG project SCHN1265/1-1, and Michael J Fox Foundation (MJFF) grant.

Correspondence should be addressed to To whom correspondence should be addressed. Phone: + +49-228-43302450, Email: [email protected]

Cite as: J. Neurosci 2019; 10.1523/JNEUROSCI.2070-18.2019

Alerts: Sign up at www.jneurosci.org/alerts to receive customized email alerts when the fully formatted version of this article is published. Accepted manuscripts are peer-reviewed but have not been through the copyediting, formatting, or proofreading process.

1 Translocator protein ligand protects against neurodegeneration in the MPTP mouse

2 model of Parkinsonism

3 Jing Gong1#, Éva M. Szegő2,3#, Andrei Leonov4, Eva Benito5, Stefan Becker4, Andre

4 Fischer5,6, Markus Zweckstetter3,4,5, Tiago Outeiro2,3,7, Anja Schneider1,8*

5 1German Center for Neurodegenerative Diseases, DZNE, Sigmund-Freud-Str. 27, 53127

6 Bonn, Germany

7 2Department of Experimental Neurodegeneration, Center for Biostructural Imaging of

8 Neurodegeneration, University Medical Center Göttingen, University of Göttingen, Waldweg

9 33, 37075 Göttingen, Germany

10 3Cluster of Excellence, Nanoscale Microscopy and Molecular Physiology of the Brain

11 (CNMPB), Humboldtallee 23, 30703 Göttingen, Germany

12 4 Max-Planck-Institute for Biophysical Chemistry, Am Faßberg 11, 37077, Göttingen,

13 Germany

14 5 German Center for Neurodegenerative Diseases, DZNE, Von-Siebold-Str. 3a, 37075

15 Göttingen, Germany

16 6 Department of Psychiatry and Psychotherapy, University Medical Center, Von-Siebold-Str.

17 3b, 37075 Göttingen, Germany

18 7 Institute of Neuroscience, The Medical School, Newcastle University, Framlington Place,

19 Newcastle Upon Tyne, NE2 4HH, UK

20 8Department of Neurodegenerative Diseases and Geriatric Psychiatry, University Hospital

21 Bonn, Sigmund-Freud-Str.25, 53127 Bonn, Germany

22 #contributed equally

23 * to whom correspondence should be addressed. Phone: ++49-228-43302450, Email:

24 [email protected]

26 Abbreviated title: TSPO ligand protects against neurodegeneration

28 Number of pages: 45, number of figures: 11, number of tables: 1, number of words for

29 Abstract 165, Introduction 817, Discussion 1379.

31 Conflict of Interest

32 The authors declare no competing financial interests.

34 Acknowledgements

35 JG was supported by a scholarship from China Scholarship Council. EMSZ was supported by

36 the Dorothea Schlözer fellowship. AF was supported by core funds from the DZNE, the DFG

37 projects FI981/9-1 and SPP1738 (FI981-11-1) and the EU (ERC consolidator grant

38 DEPICODE). MZ was supported by the DFG Collaborative Research Center 803 (project

39 A11). TFO was supported by the DFG Center for Nanoscale Microscopy and Molecular

40 Physiology of the Brain (CNMPB) and by SFB1286 (project B6). AS was supported by the

41 DFG Center for Nanoscale Microscopy and Molecular Physiology of the Brain (CNMPB),

42 DZNE core funds, the DFG project SCHN1265/1-1, and Michael J Fox Foundation (MJFF)

43 grant.

46 Abstract

47 Parkinson’s disease (PD) is the second most common neurodegenerative disease, after

48 Alzheimer’s disease. PD is a movement disorder with characteristic motor features that arise

49 due to the loss of dopaminergic neurons from the substantia nigra. Although symptomatic

50 treatment by the dopamine precursor levodopa and dopamine agonists can improve motor

51 symptoms, no disease-modifying therapy exists yet. Here, we show that Emapunil (AC-5216,

52 XBD-173), a synthetic ligand of the translocator protein 18 (TSPO), ameliorates degeneration

53 of dopaminergic neurons, preserves striatal dopamine metabolism and prevents motor

54 dysfunction in female mice treated with the 1-methyl-4-phenyl-1,-2,-3,-6-tetrahydropyridine

55 (MPTP), as a model of parkinsonism. We found that Emapunil modulates the inositol

56 requiring kinase 1 α (IRE α)/-X-box binding protein 1 (XBP1) unfolded protein response

57 pathway and induces a shift from pro- towards anti-inflammatory microglia activation.

58 Previously, Emapunil was shown to cross the blood brain barrier and to be safe and well-

59 tolerated in a phase II clinical trial. Therefore, our data suggest that Emapunil may be a

60 promising approach in the treatment of Parkinson’s disease.

62 Keywords: TSPO, Parkinson’s disease, neurodegeneration, microglia

64 Significance statement

65 Our study reveals a beneficial effect of Emapunil on dopaminergic neuron survival, dopamine

66 metabolism and motor phenotype in the MPTP mouse model of parkinsonism. In addition,

67 our work uncovers molecular networks which mediate neuroprotective effects of Emapunil,

68 including microglial activation state and unfolded protein response pathways. These findings

69 not only contribute to our understanding of biological mechanisms of TSPO function but also

70 indicate that TSPO may be a promising therapeutic target. We thus propose to further validate

71 Emapunil in other Parkinson’s disease mouse models and subsequently in clinical trials to

72 treat Parkinson’s disease.

74 Introduction

75 Parkinson’s disease is a devastating age-associated movement disorder with high prevalence

76 in the elderly population. Motor symptoms arise due to the progressive loss of dopaminergic

77 neurons from the substantia nigra pars compacta (SNpc), but the precise cause is still unclear.

78 Surviving neurons display intracellular inclusions of D-synuclein, known as Lewy bodies

79 (Spillantini et al., 1998). In Parkinson’s disease patients and animal models,

80 neurodegeneration is accompanied by neuroinflammation (McGeer et al., 1988; Imamura et

81 al., 2003; Miklossy et al., 2006; Brochard et al., 2009; Hirsch and Hunot, 2009; Harms et al.,

82 2017), potentially triggered by the release of ATP (Davalos et al., 2005), neuromelanin

83 (Wilms et al., 2003; Zhang et al., 2013) or aggregated D-synuclein (Zhang et al., 2005b;

84 Couch et al., 2011; Acosta et al., 2015) from decaying neurons. These pro-inflammatory

85 stimuli may activate microglia to secrete cytokines and free radicals which further contribute

86 to oxidative stress, neurotoxicity and disease progression (Block et al., 2007) (Hirsch and

87 Hunot, 2009). In Parkinson’s disease patients, higher levels of cytokines were detected in

88 cerebrospinal fluid (Tufekci et al., 2011), serum (Eidson et al., 2017), substantia nigra and

89 striatum (Knott et al., 2000; Teismann et al., 2003; Mogi et al., 2007) as compared to controls.

90 Several genes associated with familial forms of Parkinson’s disease, including SNCA, LRKK2,

91 PARK2, PINK2 and DJ-1, have been linked with immune response (Waak et al., 2009; Gardet

92 et al., 2010; Gu et al., 2010; Akundi et al., 2011; Gillardon et al., 2012; Moehle et al., 2012)

93 and polymorphisms in genes encoding inflammatory cytokines are associated with a higher

94 risk for sporadic Parkinson’s disease (Wahner et al., 2007; Deleidi and Gasser, 2013).

95 Conversely, Minocyclin, an inhibitor of microglial activation, can protect against

96 dopaminergic neuron loss in the 1-methyl-4-phenyl-1,-2,3,-6-tetrahydropyridine (MPTP)

97 parkinsonism mouse model and treatment with microglia-targeted glucocorticoids prevented

98 dopaminergic neuron loss in the 6-hydroxydopamine (6-OHDA) mouse model of Parkinson’s

99 disease (Du et al., 2001; Wu et al., 2002; Tentillier et al., 2016).

100 The translocator protein TSPO is a mitochondrial cholesterol binding protein which is

101 upregulated in microglia during inflammatory activation. TSPO ligands have been widely

102 used to monitor neuroinflammation by PET imaging, both in humans and in mice (Dupont et

103 al., 2017). Several PET imaging studies demonstrated higher retention of TSPO tracers in

104 Parkinson’s disease patients compared to controls (Ouchi et al., 2005; Gerhard et al., 2006;

105 Bartels et al., 2010; Edison et al., 2013; Iannaccone et al., 2013), although a more recent study

106 failed to detect differences between both groups (Koshimori et al., 2015).

107 Anti-inflammatory and neuroprotective effects of TSPO ligands were observed in several

108 clinical studies and in mouse models of neuropsychiatric diseases characterized by

109 neurodegeneration and/or neuroinflammation, such as Alzheimer’s disease (Barron et al.,

110 2013), acute retina degeneration (Scholz et al., 2015), peripheral neuropathies (Giatti et al.,

111 2009), traumatic brain injury (Papadopoulos and Lecanu, 2009), multiple sclerosis (Leva et

112 al., 2017), anxiety (Rupprecht et al., 2009) and depression (Gavioli et al., 2003). There, TSPO

113 ligands inhibit the production of reactive oxygen species (ROS) in activated microglia (Wang

114 et al., 2014), although the precise mechanisms by which TPSO modulate inflammatory

115 processes, are not understood.

116 Currently, there are no therapies that can slow down or halt disease progression in Parkinson’s

117 disease. In this study, we examined the therapeutic potential of a synthetic TSPO ligand,

118 Emapunil, in the MPTP mouse model, which recapitulates important hallmarks of Parkinson’s

119 disease, such as dopaminergic neuron loss, neuroinflammation, and motor deficits. Emapunil

120 (AC-5216, XBD-173) is a selective, high-affinity phenylpurine ligand of TSPO that, in

121 contrast to other ligands such as Ro-4864 and PK1195, does not bind and stimulate GABAA 5

122 receptors. Most importantly, Emapunil was already tested in a phase II clinical trial and found

123 to be safe and well tolerated (Rupprecht et al., 2010). TSPO ligands can exert agonistic,

124 antagonistic or partial agonistic function on TSPO. Differences arise due to ligand binding to

125 distinct subunits of TSPO, target cell type and ligand concentration. Notably, the efficacy of

126 TSPO ligands does not correlate well with TSPO binding affinity which is rather determined

127 by residence time of the ligand at its target (Costa et al., 2016). Emapunil is a TSPO agonist

128 (Rupprecht et al., 2010) that was shown to increase neurosteroid synthesis (Ravikumar et al.,

129 2016) and to decrease inflammation (Karlstetter et al., 2014). TSPO is part of a mitochondrial

130 multiprotein complex together with VDACs, adenine nucleotide translocators, ATPase and

131 steroidogenic acute regulatory protein (StAR) and TSPO effects may at least partially be

132 mediated by TSPO interaction with these proteins (Gatliff and Campanella, 2016).

133 Our results show that Emapunil prevents neuronal loss, restores dopamine metabolism, and

134 attenuates inflammation and motor symptoms in mice exposed to MPTP. In addition, we

135 provide evidence that Emapunil mitigates the unfolded protein response (UPR) and induces a

136 shift from pro- to anti-inflammatory gene expression which may explain its protective effects.

137 Altogether, our data suggest that Emapunil may be a promising candidate for clinical trials to

138 treat Parkinson’s disease.

139

140 Materials and Methods

141 Reagents

142 NǦBenzylǦNǦethyl-2-(7ǦmethylǦ8Ǧoxo-2-phenyl-7,-8-dihydro-9H-purin-9-yl)acetamide

143 (Emapunil, AC-5216, XBD-173, CAS [226954-04-7]) (9) was prepared according to scheme

144 1 below (Zhang et al., 2007).

145 146

147 Scheme 1. Reagents and conditions: (a) NaOEt, EtOH, 0-80°C, 4 h, 81%; (b) POCl3, 90°C,

148 4 h, 99%; (c) glycine, Et3N, EtOH, 78°C, 4 h, 100%; (d) N-ethylbenzylamine, PyBOP, Et3N,

149 DMF, 22°C, 2 h, 100%; (e) NaOH, EtOH, water, 78°C, 2 h, 82%, (f) diphenyl

150 phosphorazidate, Et3N, DMF, 100°C, 6 h, 55%, (g) MeI, NaH, DMF, 22°C, 3 h, 78%.

151

152 Animals

153 8-week-old female C57BL/6JRj female mice were purchased from Janvier Labs, France. Mice

154 were housed in groups of five in an air conditioned room with a 12 hour light-dark cycle and

155 with free access to standard food and water. All procedures complied with the German law on

156 animal protection. All protocols were reviewed and approved by the responsible animal

157 welfare board (Landesamt für Verbraucherschutz, Braunschweig, Lower Saxony, Germany,

158 reference number 12/2210). Mice that lost more than 20% of the body weight during the

159 treatment were excluded from the experiment.

160

161 Subchronic MPTP mouse model

162 Mice received five intraperitoneal injections of 30 mg/kg body weight MPTP (free base,

163 Sigma, Germany) dissolved in 0.9% saline at 24 hours intervals for five consecutive days. A

164 control group was treated with five intraperitoneal injections of saline (Fig. 1).

165

166 Emapunil treatment

167 Mice exposed to MPTP were either treated with intraperitoneal injections of Emapunil or

168 DMSO as vehicle control. Emapunil was dissolved in DMSO and given at a dose of 50 mg/kg

169 body weight every 48 hours for 15 consecutive days, starting at the same day as the MPTP

170 administration (Fig. 1).

171 Mice were sacrificed at two different time points after the first injection: day three for MPP+

172 measurements, transcriptome analysis and qPCR; at day 15 for stereological assay, and

173 quantification of brain dopamine and dopamine metabolites (Fig. 1).

174

175 MPTP metabolism

176 At day 3, five mice of each experimental group were sacrificed and brains were rapidly

177 removed 90 min after the last injection of either saline or MPTP. Striatum from the left

178 hemisphere were dissected on ice and frozen at -80°C. MPP+ concentrations were measured

179 by high pressure liquid chromatography (HPLC) after homogenization of tissue in 0.1 M

180 perchloric acid (50 μl/mg wet tissue) and centrifugation (14000g, 10 min, 4°C). The

181 supernatant was injected onto a reverse-phase column (Nucleosil 100-5 C18; Macherey- 8

182 Nagel) and separated on a mobile phase of 650/1000 ml acetonitrile in phosphate buffer (pH

183 2.5). The MPP+ signal was quantified at an excitation wavelength of 295 nm and an emission

184 wavelength of 375 nm (Fluorescence HPLC Monitor; Shimadzu) (Tonges et al., 2012).

185

186 Real-time polymerase chain reaction (PCR)

187 RNA was isolated from striatum of the right hemisphere of five mice per experimental group.

188 Mice were sacrificed on day 3, 90 min after the last injection of either saline or MPTP. Tissue

189 was dissected on ice. cDNA was reversely transcribed from RNA with RNeasy Mini kit

190 according to the manufacturer’s instructions (Qiagen, Hilden, Germany). Real time

191 polymerase chain reaction (RT-PCR) was performed using Mesa Blue qPCR MasterMix Plus

192 for SYBR Assay low rox (Eurogentec, Belgium). Fold-change expressions were calculated

193 using the 2-ΔΔCT method with E-actin as a reference gene. The primers used are shown in

194 Table 1.

195

196 Neurochemical quantification of dopamine and metabolites

197 Left striatum of 5 mice per experimental group were collected at day 15 and immediately

198 dissected on ice. Tissue samples were homogenized in 0.1 mM perchloric acid (50 μl/mg wet

199 tissue), centrifuged at 5000 g for 1 min, followed by centrifugation at 10000 g for 30 min at

200 4°C. The supernatant was injected onto a C18 reverse-phase HR-80 catecholamine high

201 performance liquid chromatography (HPLC) column (ESA) with a mobile phase (pH 2.9) of

202 90% 75mM sodium phosphate, 275 mg/l octane sulphonic acid and 10% methanol.

203 Dopamine, 3,4-dihydroxyphenylacetic acid and homovanillic acid were quantified after

204 electrochemical detection (ESA Coulochem II with a model 5010 detector) using a

205 Chromeleon computer system (Dionex).

206

207 Behavioral analysis 9

208 Pole and cylinder tests were performed as described (Ogawa et al., 1985) (Tonges et al., 2012)

209 Pole test

210 11 days after the first injection of either saline or MPTP, 13–15 mice per experimental group

211 were trained for 2 days with three test trials per day. Mice were placed head-upward on top of

212 a vertical rough-surfaced pole (diameter 12 mm; height 55 cm), with the base of pole placed

213 in the home cage. Mice oriented themselves downward and descended along the pole to return

214 to their home cage. The time required for orienting downward as well as the time needed to

215 descend along the pole to the bottom of the cage were measured at day 13. Values were

216 averaged from five consecutive trials performed on day 13.

217 Cylinder test

218 The same animals were subjected to the cylinder test at day 14. The cylinder test measures

219 forelimb utilization during normal exploratory activity. Mice were placed in a transparent

220 cylinder (diameter: 11.5 cm; height: 25 cm) and all movements were recorded during the test

221 duration of five minutes. A mirror placed behind the cylinder allowed videotaping of forelimb

222 movements with the mouse turned away from the camera. Forelimb use against the wall after

223 rearing was classified into: (a) ‘both’ forelimbs: simultaneous use of left and right forelimb to

224 contact the cylinder wall during a full rear or alternating use of left and right forelimb during

225 movement along the cylinder wall; (b) ‘free’ rears: full rears of the entire body without

226 touching the wall; (c) ‘left’ forelimb use: first contact of the wall with the left forelimb during

227 a full rear; (d) ‘right’ forelimb use: first contact of the wall with the right forelimb during a

228 full rear. The percentage of ‘both’, ‘right’, left’ or ‘free’ movements of all movements within

229 the entire observation time was calculated.

230

231 Immunohistochemistry

232 At day 15, 8-10 mice per experimental group were anesthetized with 14% chloral hydrate in

233 water and intracardially perfused with cold PBS, followed by 4% paraformaldehyde (PFA) in 10

234 PBS. Brains were removed, post-fixed in 4% PFA overnight and cryopreserved for 48 h at

235 4°C in 30% sucrose in PBS, snap frozen and stored at -80°C until further processing. Free-

236 floating coronal sections (30 Pm) were prepared using a cryostat (CM1900, Leica, Germany)

237 and stored in TBS with 0.1% NaN3 at 4°C. Sections were quenched of endogenous peroxidase

238 activity, blocked with 2% BSA, 0.5% Triton x-100 in Tris buffered saline (TBS) for 1 h at

239 room temperature and incubated with an anti-tyrosine-hydroxylase (TH) antibody (rabbit

240 polyclonal, 1:1000, AB152, Millipore, Germany) in blocking solution for 48 h at 4°C. After

241 washing, sections were incubated with biotinylated donkey anti-rabbit IgG (1:200; RPN-1004,

242 GE Healthcare, Germany) in blocking solution for 2h at room temperature, followed by

243 Extravidin-Peroxidase (1:1000, E2886, Sigma, Germany) in blocking solution for 1h at room

244 temperature. Visualization was performed using 0.03% 3,3-diaminobenzidine (DAB, D5637,

245 Sigma, USA) for 2 min at room temperature. All sections were counterstained in 0.5% Cresyl

246 violet for Nissl staining, dehydrated and mounted in DPX Mountant (06522, Sigma,

247 Germany).

248

249 Immunofluorescence and quantification of microglia activation and astrogliosis

250 After blocking for 1 h at room temperature, every tenth section through the striatum (3

251 slices/brain) was stained with either antibody against anti-ionized calcium-binding adapter

252 molecule 1 (IBA1) (rabbit polyclonal, 1:2000, 019-19741, WAKO, Germany) or antibody

253 against anti-Glial Fibrillary Acidic Protein (GFAP) (Guinea pig polyclonal, 1:1000, 173004,

254 Synaptic Systems, Germany) for 48 h at 4°C in blocking solution (3% BSA, 0.5% Triton X-

255 100 in TBS). After washing, sections were incubated with corresponding secondary

256 antibodies, Alexa Fluor 488-conjugated Donkey-anti-Rabbit IgG antibody (1:1500, ab150129,

257 Abcam, Germany) or Alexa Fluor 647-conjugated Goat anti-Guinea pig IgG antibody

258 (1:1000, thermo fisher scientific, Germany) for 2 h at room temperature, followed by washing

259 and mounting in Mowiol 4-88 (A9011, AppliChem, Germany). For co-immunofluorescence 11

260 stainings of TH and TSPO, we used anti-TSPO antibody (Rabbit polyclonal, 1:500,

261 ab109497, Abcam, Germany) and anti-Tyrosine Hydroxylase antibody (Chicken, 1:1000,

262 ab76442, Abcam, Germany) as primary antibodies and Alexa Fluor 488 Goat anti-Rabbit IgG

263 (1:1000, A11008, Thermo fisher scientific, Germany) and Cy3 Goat Anti-Chicken IgY

264 (1:500, ab97145, Abcam, Germany) as secondary antibodies. Fluorescent images were

265 captured and stitched using either a Nikon Eclipse TI microscope or a Zeiss Axio Observer.Z1

266 microscope connected to Apotome.2 at 10x magnification. Fluorescent images of TH and

267 TSPO staining were captured using a Zeiss LSM 700 laser scanning confocal microscope

268 (LSCM). IBA1 and GFAP positive cells in the striatum were counted using ImageJ software

269 with a cell counter analysis plug-in.

270

271 Sterological quantification of substantia nigra neurons

272 Tyrosine hydroxylase (TH)-positive, as well as Nissl positive neurons in the substantia nigra

273 were quantified by stereology. Every fifth section through the substantia nigra was stained

274 and analyzed at a Zeiss Axioplan microscope equipped with a computer-controlled motorized

275 stage (Ludl Electronics, Hawthorne, USA), using a 100x objective and Stereo Investigator

276 software (Stereo Investigator 9.0, MicroBrightField Inc., USA). A 150x 150 μm grid layout

277 of the substantia nigra and a counting frame of 50 x 50 μm, with 15 μm dissector height and 3

278 μm guard were used for cell counting. All countings were performed by a blinded

279 investigator.

280

281 LUHMES cell culture, differentiation and toxicity assay

282 Lund human mesencephalic (LUHMES) cells (Scholz et al., 2011; Szego et al., 2017) were

283 ﬁrst grown in proliferation medium (advanced DMEM/F12, 1% N2 supplement [Invitrogen,

284 Karlsruhe, Germany], 2 mM L-glutamine (Gibco, Germany), and 40 ng/mL recombinant

285 basic ﬁbroblast growth factor (R&D Systems, USA) in cell culture ﬂasks (Nunc, Denmark) 12

286 coated with 50 ng/mL poly-L-lysine (Sigma, Germany). For differentiation, proliferation

287 medium was replaced by differentiation medium (advanced DMEM/F12, 1% N2 supplement,

288 2 mM L-glutamine, 1 mM dibutyryl 3’,5’-cyclic AMP [Sigma], 1 μg/μl tetracycline, and 2

289 ng/mL recombinant human glial derived neurotrophic factor [R&D Systems], USA).

290 For siRNA mediated down-regulation of TSPO, cells were transfected with esiRNA

291 EHU080541 (Sigma, Germany) and Lipofectamine RNAiMAX transfection reagent

292 (13778030, Thermo Fisher scientific, Germany) according to the manufacturers’ instructions

293 4 days after differentiation. Control cells were transfected with control siRNA (1027310,

294 Qiagen, Germany). For toxicity assay, on the 7th day of differentiation, LUHMES cells were

295 treated with either Emapunil (5 μM) or DMSO as solvent control. After 12 hours, cells were

296 either treated with DMSO, MPP+ (10 PM in DMSO) or rotenone (10 PM in DMSO). Cell

297 culture supernatants were harvested after 24 hours for toxicity measurements using ToxiLight

298 assay (ToxiLight Kit, Lonza, Germany), following the manufacturer’s instruction. In brief, 50

299 μl of reagent was added to 50 μl of culture supernatant, and incubated at room temperature for

300 5 min. Luminescence was measured in a luminescence counter (Wallac, Germany).

301 For mRNA isolation and qPCR, LUHMES cells were randomly divided into 8 groups and

302 treated for 12 hours with either DMSO, toyocamycin (Sigma, 1 μM in DMSO), Emapunil (5

303 μM) or toyocamycin plus Emapunil. Cells were subsequently incubated for 12 hours with

304 DMSO or 10 PM rotenone, and harvested for mRNA isolation (RNeasy Mini Kit, Qiagen,

305 Germany).

306

307 RNA sequencing

308 RNA-Seq was carried out in an Illumina HiSeq2000. Reads were aligned to mm10 using

309 STAR (Anders et al., 2015) with the following parameters: --outFilterMismatchNmax 2 --

310 outSAMstrandField intronMotif --sjdbOverhang 49. Counts were generated using htseq

311 (Anders et al., 2015). Differential gene expression analysis was carried out using DESeq2 13

312 (Love et al., 2014). Genes with an adjusted p-value < 0.05 were considered significant. Gene

313 list overlaps were calculated using Venny (JC, (2007-2015) ). Functional enrichment analysis

314 was performed using Webgestalt 2.0 (Zhang et al., 2005a; Wang et al., 2013; Kirov et al.,

315 2014) and gene network visualization was carried out using Cytoscape 3.0’s plugin ClueGO

316 (Bindea et al., 2009). Pathways with a p-value < 0.1 were considered significant.

317 Transcription factor binding site enrichment analysis was done with PSCAN (Zambelli et al.,

318 2009) using TRANSFAC database. Heatmaps and individual gene traces were plotted in R

319 (Team, 2008).

320

321 Experimental Design and Statistical Analysis

322 A graphical overview on the experimental design is given in Fig. 1. Data were analyzed either

323 with 2-tailed unpaired t-test (Welch’s t-test), one- or two-way analysis of variance followed

324 by Tukey’s honestly significant difference test (one-way ANOVA) or Holm Sidak test (one-

325 or two-way ANOVA) (GraphPad Prism 6.07 (GraphPad Software, Inc., La Jolla, CA, USA).

326 Data was assessed for normality using the Shapiro–Wilk test, with F test for variances. The

327 null hypothesis was rejected at the 0.05 p-value level. Data are presented as mean ± SEM.

328

329 Results

330 Emapunil prevents neuronal loss in the MPTP model of parkinsonism

331 Firstly, we tested the potential of Emapunil as a therapeutic strategy by evaluating its effect

332 on dopaminergic neuronal loss in the subchronic MPTP mouse model of parkinsonism, which

333 recapitulates important motor features of sporadic Parkinson’s disease. To this end, 8-week-

334 old female mice were intraperitoneally injected with 30 mg/kg body weight MPTP on five

335 consecutive days. At the same time of MPTP treatment, mice received intraperitoneal

336 injections of either Emapunil (MPTP + Emapunil group) or DMSO (MPTP + DMSO group),

337 as a vehicle control. Wild type mice treated with saline instead of MPTP served as an 14

338 additional control (NaCl group) (Fig. 1). TSPO ligands mediate gonadal upregulation of

339 testosterone production. Alterations in testosterone levels have been discussed as a potential

340 risk factor for Parkinson’s disease and gonadectomy in mice was associated with loss of

341 dopaminergic neurons and Parkinson-like symptoms (Khasnavis et al., 2013). Therefore, we

342 decided to use female mice for our experiments. 15 days after the first exposure to MPTP

343 treatment, mice were sacrificed and sterologically analysed for surviving dopaminergic

344 neurons in the substantia nigra (Fig. 2A, B). While the number of TH-positive neurons was

345 significantly lower in MPTP + DMSO-treated mice when compared to NaCl control animals,

346 neuron loss was completely prevented in the MPTP + Emapunil group. Similar results were

347 found for Nissl-positive neurons in the substantia nigra (Fig. 2C) (NaCl group: TH-positive

348 neurons = 21572 ± 417, Nissl-positive neurons = 27125 ± 352, n = 10; MPTP + DMSO

349 group: TH-positive neurons = 12047 ± 246, Nissl-possitive neurons = 20258 ± 401, n = 10;

350 MPTP + Emapunil group: TH-positive neurons = 17547 ± 391, Nissl-positive neurons =

351 25662 ± 423, n = 8; *p < 0.05, ***p < 0.001; TH-positive neurons: F (2, 25) = 192.5, p <

352 0.0001; Nissl-possitive neurons: F (2, 25) = 90.46, p < 0.0001, One-way ANOVA, Tukey’s

353 post hoc test, data are given as means ± SEM).

354 MPTP crosses the blood brain barrier, where it is mainly converted by astrocytic monoamine-

355 oxidase B (MAO B) to its toxic metabolite, 1-methyl-4-phenylpyridinium (MPP+). To exclude

356 any interference of Emapunil itself on MPP+ production, we quantified MPP+ levels in the

357 MPTP + DMSO and the MPTP + Emapunil groups. No significant differences were detected

358 between the two groups (data not shown). Together, these data suggest that Emapunil protects

359 against MPTP-induced degeneration of dopaminergic neurons.

360

361 Emapunil protects against MPTP-induced motor impairments

362 Next, to determine whether the protective effect of Emapunil on dopaminergic cell survival

363 also correlated with preserved motor function in MPTP-treated animals, mice were subjected 15

364 to a cylinder test (see Fig. 1). We recorded limb-use asymmetry of rearing movements in mice

365 placed into a glass cylinder, including total number of rears, percentage of free rears, rears

366 with either the right or left forelimb, and rears utilizing both forelimbs. MPTP + DMSO-

367 treated mice showed less free rears compared to saline-injected control mice while rears

368 supported by both forehands were increased (Fig. 3A). In contrast, MPTP + Emapunil-treated

369 mice scored similar to the saline-control group, with a significantly higher rate of the more

370 difficult free rears compared to the control group (NaCl group: ratio of free rears = 22.9 ±

371 2.37%, ratio of left forelimb rears = 4.71 ± 1.27%, ratio of right forelimb rears = 3.48 ±

372 0.845%, ratio of rears with both forelimbs = 68.9 ± 3.49%, n = 15; MPTP + DMSO group:

373 ratio of free rears = 13.5 ± 2.82%, ratio of left forelimb rears = 4.07 ± 0.947%, ratio of right

374 forelimb rears = 5.98 ± 1.37%, ratio of rears with both forelimbs = 68.9 ± 3.49%, n = 14;

375 MPTP + Emapunil group: ratio of free rears = 32 ± 2.36%, ratio of left forelimb rears = 6.79 ±

376 0.01.4%, ratio of right forelimb rears = 2.92 ± 0.99%, ratio of rears with both forelimbs = 58.3

377 ± 3.66%, n = 13; *p < 0.05, **p < 0.01, ***p < 0.001; free rears: F (2, 39) = 12.91, p =

378 0.0001; both forelimbs: F (2, 39) = 6.494, p = 0.00368; One-way ANOVA, Tukey’s post hoc

379 test, data are given as means ± SEM) (Fig. 3A). These data indicate that Emapunil treatment

380 protected MPTP-treated mice against deteriorating motor function. Encouraged by these

381 findings, we employed an additional well-established motor function assay, the pole test, to

382 assess the effects of Emapunil on coordination deficits and bradykinesia. As expected, mice

383 treated with MPTP + DMSO turned slower downward after head-upward placement near the

384 top of the pole as compared to saline controls (Fig. 3B). However, MPTP + Emapunil mice

385 were faster in orienting themselves downward, and scored comparable to saline controls

386 (NaCl group: time = 1.36 ± 0.1311 s, n = 15; MPTP + DMSO group: time = 1.545 ± 0.1008

387 s, n = 15; MPTP + Emapunil group: time = 1.152 ± 0.0658 s, n = 13; *p < 0.05, **p < 0.01,

388 ***p < 0.001; F (2, 40) = 3.366, p = 0.04; One-way ANOVA, Tukey’s post hoc test, data are

389 given as means ± SEM). Taken together, these results further confirm that Emapunil mediates 16

390 neuroprotective effects in the MPTP mouse model, preserving motor coordination as well as

391 postural control.

392

393 Emapunil attenuates loss of dopamine and of dopamine metabolites in the MPTP model

394 Next, we asked, whether Emapunil would also preserve functional activity of nigrostriatal

395 innervation as assessed by striatal concentrations of dopamine and its metabolites, quantified

396 by high pressure liquid chromatography at day 3. In MPTP treated animals, both, dopamine

397 and its metabolites dihydroxyphenylacetic acid (DOPAC) and homovanillic acid (HVA) were

398 reduced compared to saline treated controls, reflecting MPTP induced toxicity towards

399 dopaminergic neurons. Consistently with a protective effect of Emapunil, reduction of

400 dopamine and DOPAC levels were less pronounced in the Emapunil treated MPTP group

401 compared to the MPTP (+DMSO) group (Fig. 4A). No significant difference was observed for

402 HVA levels between MPTP mice treated with Emapunil or not. Dopamine turnover rates, as

403 defined by the ratio of ([DOPAC] + [HVA])/[dopamine] were higher in MPTP-treated mice

404 compared to saline controls, indicating increased cellular stress. In contrast, dopamine

405 turnover rates in MPTP-treated animals exposed to Emapunil were lower and reached a level

406 which was comparable to saline treated control animals. These data suggest that Emapunil

407 decreases cellular stress and preserves nigrostriatal innervation by preventing axonal injury.

408 (NaCl group: dopamine = 8.444 ± 0.691 ng/mg, DOPAC = 7.144 ± 0.2925 ng/mg, metabolic

409 ratio = 1.934 ± 0.1684, n = 5; MPTP + DMSO group: dopamine = 3.293 ± 0.3095 ng/mg,

410 DOPAC = 5.534 ± 0.3939 ng/mg, metabolic ratio = 3.743 ± 0.3718, n = 5; MPTP + Emapunil

411 group: dopamine = 5.581 ± 0.4028 ng/mg, DOPAC = 6.691 ± 0.4018 ng/mg, metabolic ratio

412 = 2.304 ± 0.1942, n = 5; *p < 0.05, **p < 0.01, ***p < 0.001, n.s. = not significant;

413 dopamine: F (2, 12) = 27.17, p < 0.0001; DOPAC: F (2, 12) = 5.147, p = 0.0243; metabolic

414 ratio: F (2, 12) = 13.41, p = 0.0008; One-way ANOVA, Tukey’s post hoc test, data are given

415 as means ± SEM). 17

416

417 Emapunil mitigates ER stress

418 To further investigate the effects of Emapunil on cellular stress responses, we assessed the

419 activation of X-box binding protein 1 (XBP1), a transcription factor which positively

420 regulates the unfolded protein response (UPR). UPR serves as an adaptive cellular stress

421 response induced by the accumulation of misfolded proteins in the endoplasmic reticulum

422 (ER). Its downstream cascade leads to inhibition of translation, clearance of misfolded

423 proteins through autophagy and the ER-associated degradation (ERAD) pathway, and to the

424 induction of chaperones, thereby restoring ER homeostasis. However, chronic activation of

425 UPR can ultimately induce apoptosis (Urra et al., 2013). ER stress has been implicated in

426 Parkinson’s disease pathogenesis, with a protective function during initial disease stages and a

427 deleterious, proapoptotic effect under chronically sustained stress levels (Mercado et al.,

428 2015). The active form of XBP1 transcription factor mRNA, Xbp1s, is generated by

429 unconventional splicing through inositol requiring kinase 1 α (IRE1 α) (Ron and Walter,

430 2007). Thus, the activity of XBP1 as a marker for ER stress can be assessed through

431 quantitative real-time RT-PCR for the detection of spliced Xbp1s mRNA (van Schadewijk et

432 al., 2012). We found that, consistently with a protective effect of Emapunil, the mRNA levels

433 of Xbp1s, as well as the ratio of Xbp1s/Xbp1 mRNA were restored to saline control levels in

434 mice treated with Emapunil (MPTP + Emapunil) (Fig. 5A-C). In contrast, MPTP treatment

435 alone (MPTP + DMSO) resulted in significantly higher levels of active Xbp1s mRNA and

436 Xbp1s/Xbp1 ratio compared to saline control and MPTP + Emapunil groups (Fig. 5A-C).

437 (NaCl group: Xbp1 = 1 ± 0.02093, spliced Xbp1s = 1 ± 0.045, ratio = 1 ± 0.0473, n = 5;

438 MPTP + DMSO group: Xbp1 = 0.88 ± 0.067, spliced Xbp1s = 1.35 ± 0.0527, ratio = 1.57 ±

439 0.155, n = 5; MPTP + Emapunil group: Xbp1 = 0.904 ± 0.05349, spliced Xbp1s = 0.896 ±

440 0.036, ratio = 1.01 ± 0.0834, n = 5; **p < 0.01, ***p < 0.001; Xbp1: F (2, 12) = 1.543, p =

441 0.25329; spliced Xbp1s: F (2, 12) = 27.3, p < 0.0001; ratio: F (2, 12) = 9.67, p = 0.003151; 18

442 One-way ANOVA, Tukey’s post hoc test, data are given as means ± SEM). To further

443 investigate the neuroprotective effects of Emapunil, we utilized an immortalized human

444 dopaminergic cell line (Lund human mesencephalic cells, LUHMES) (Lotharius et al., 2002).

445 Treatment of postmitotically differentiated LUHMES cells with the either the active

446 metabolite of MPTP, MPP+ (1-methyl-4-phenylpyridinium) or rotenone, have been

447 established as cellular models of human parkinsonism (Giordano et al., 2012; Krug et al.,

448 2014). Both, MPP+ and rotenone exposure, resulted in reduced dopaminergic cell survival as

449 measured by the release of adenylate kinase relative to DMSO solvent control (ToxiLight

450 assay). Consistent with our in vivo findings, Emapunil treatment ameliorated toxic MPP+ and

451 rotenone effects (Fig. 5D) (DMSO group: fold change = 1 ± 0.06748, n = 31; DMSO + 5 PM

452 Emapunil group: fold change = 1.216 ± 0.08, n = 31; 10 PM MPP+ + DMSO group: fold

453 change = 4.877 ± 0.4397, n = 17; 10 PM MPP+ + 5 PM Emapunil group: fold change = 4.024

454 ± 0.3168, n = 17; 10 PM rotenone + DMSO group: fold change = 5.624 ± 0.2506, n = 14; 10

455 PM rotenone + Emapunil group: fold change = 4.042 ± 0.0871, n = 14; *p < 0.05, ***p <

456 0.001; F (2, 118) = 9.856, p < 0,0001; Two-way ANOVA, Holm Sidak post hoc test, data are

457 given as means ± SEM). We next assessed XBP1s/XBP1 ratios under oxidative stress induced

458 by rotenone. Similar to our in vivo treatment with MPTP, we found a significant increase of

459 XBP1s/XBP1 with rotenone compared to saline controls (Fig. 5E). Increased XBP1s/XBP1

460 ratios were restored to normal levels by additional treatment with either Emapunil or the

461 IRE1α-XBP1 inhibitor toyocamycin (2-hydroxy-1-naphthaldehyde) (Tanabe et al., 2018) (Fig

462 5E). Simultanous treatment of rotenone challenged cells with Emapunil and Toyocamycin

463 together did not result in additive effects, further indicating that Emapunil acts on the IRE1α-

464 XBP1 pathway (Fig. 5E). Of note, no XBP1s/XBP1 differences were detected in LUHMES

465 cells treated with either Emapunil nor toyocamycin alone (Fig. 5E) (Vehicle group: XBP1 = 1

466 ± 0.106, spliced XBP1s = 1 ± 0.132, ratio = 1 ± 0.041, n = 9; rotenone group: XBP1 = 9.23 ±

467 3.41, spliced XBP1s = 67.7 ± 22.6, ratio = 8.47 ± 1, n = 9; Toyocamycin group: XBP1 = 0.681

468 ± 0.181, spliced XBP1s = 0.607 ± 0.171, ratio =0.896 ± 0.102, n = 9; Emapunil group: XBP1

469 = 0.679 ± 0.197, spliced XBP1s = 0.68 ± 0.197, ratio = 1.02 ± 0.0424, n = 9; Toyocamycin +

470 Emapunil group: XBP1 = 0.879 ± 0.212, spliced XBP1s = 0.823 ± 0.199, ratio = 0.93 ±

471 0.0884, n = 9; rotenone + toyocamycin group: XBP1 = 0.969 ± 0.175, spliced XBP1s = 1.23 ±

472 0.188, ratio = 1.46 ± 0.264, n = 9; rotenone + Emapunil group: XBP1 = 0.599 ± 0.167, spliced

473 XBP1s = 0.756 ± 0.173, ratio = 1.58 ± 0.252, n = 9; rotenone + toyocamycin + Emapunil

474 group: XBP1 = 1.41 ± 0.404, spliced XBP1s = 2.2 ± 0.724, ratio = 1.48 ± 0.14, n = 9; **p <

475 0.01, ***p < 0.001; XBP1: F (7, 64) = 5.835, p < 0.0001; XBP1s: F (7, 64) = 8.645, p <

476 0.0001; ratio: F (7, 64) = 45.43, p < 0.0001; One-way ANOVA, Tukey’s post hoc test, data

477 are given as means ± SEM). We performed co-immunofluorescence stainings with antibodies

478 against TSPO and TH in mouse brain sections and antibodies against TSPO and beta-III-

479 tubulin in LUHMES cells to test for neuronal TSPO expression. Indeed, TSPO

480 immunofluorescence was present in TH positive dopaminergic neurons in mouse brains (Fig.

481 6A) and in differentiated LUHMES cells (Fig. 6B). TSPO expression was additionally

482 detected by Western blot analysis of LUHMES cell lysates (Fig. 6C). The selectivity of

483 Emapunil binding to TSPO has previously been determined by measuring binding affinities of

484 Emapunil to a series of receptor, transporter and ion channel proteins in vitro up to

485 concentrations of 1 PM (Kita et al., 2004). To further validate that the effects of Emapunil are

486 indeed mediated by TSPO, we tested Emapunil on toxicity and XBP1s/XBP1 ratio in rotenone

487 exposed LUHMES cells treated with either TSPO or control siRNA. TSPO siRNA treatment

488 resulted in ~55% reduction of TSPO protein levels as determined by Western blot analysis

489 (TSPO siRNA group: TSPO = 0.445 ± 0.067, n = 3; control siRNA group, TSPO = 1 ± 0.071,

490 n = 3; **p < 0.01; t = 5.693, df = 4, p = 0.0048; 2-tailed unpaired t-test (Welch’s t-test), data

491 are given as means ± SEM) (Fig. 7A, B) without affecting TH expression (TSPO siRNA

492 group: TH = 0.897 ± 0.096, n = 3; control siRNA group, TH = 1 ± 0.048, n = 3; n.s. = not 20

493 significant; t = 2.92, df = 2.92, p = 0.4121; 2-tailed unpaired t-test (Welch’s t-test), data are

494 given as means ± SEM) (Fig. 7C). Consistent with our earlier findings, rotenone induced

495 toxicity in LUHMES cells was ameliorated by Emapunil in control siRNA treated cells

496 (DMSO group: fold change = 1 ± 0.026, n = 8; DMSO + 10 PM rotenone group: fold change

497 = 3.682 ± 0.345, n = 8; 5 PM Emapunil + DMSO group: fold change = 1.37 ± 0.114, n = 8; 5

498 PM Emapunil + 10 PM rotenone group: fold change = 1.61 ± 0.152, n = 8; **p < 0.005, ***p

499 < 0.001; Two-way ANOVA, Tukey post hoc test, data are given as means ± SEM) (Fig. 8A).

500 However, downregulation of TSPO by siRNA significantly impaired this Emapunil mediated

501 rescue (DMSO group: fold change = 1.165 ± 0.0768, n = 8; DMSO + 10 PM rotenone group:

502 fold change = 4.293 ± 0.357, n = 8; 5 μM Emapunil + DMSO group: fold change = 1.385 ±

503 0.135, n = 8; 5 PM Emapunil + 10 PM rotenone group: fold change = 2.908 ± 0.324, n = 8;

504 **p < 0.005, ***p < 0.001 F (3, 55) = 3.365, p = 0.0251; Two-way ANOVA, Tukey’s post

505 hoc test, data are given as means ± SEM) (Fig. 8A). Notably, rotenone toxicity was not further

506 increased in TSPO siRNA treated cells compared to control siRNA exposed cells (Fig. 8A).

507 This is most likely due to the fact that rotenone toxicity reached already a maximum toxicity

508 at 10 PM and did not further increase with higher concentrations (DMSO group: fold change

509 = 1 ± 0.00554, n = 6; 0.5 PM rotenone group: fold change = 4.18 ± 0.195, n = 6; 1 PM

510 rotenone group: fold change = 4.55 ± 0.189, n = 6; 2.5 PM rotenone group: fold change =

511 6.028 ± 0.229, n = 8; 5 PM rotenone group: fold change = 7.246 ± 0.104, n = 8; 10 PM

512 rotenone group: fold change = 8.559 ± 0.259, n = 8; 20 PM rotenone group: fold change =

513 8.518 ± 0.317, n = 8; **p < 0.005, ***p < 0.001, n.s. = not significant; F (6, 42) = 95.5, p <

514 0.0001; One-way ANOVA, Tukey’s post hoc test, data are given as means ± SEM) (Fig. 8B).

515 Supporting the notion that Emapunil effects require TSPO, XBP1s/XBP1 ratios did not

516 decrease in response to Emapunil treatment in TSPO siRNA and rotenone exposed cells,

517 compared to rotenone and control siRNA treated cells (DMSO with control siRNA group:

518 fold change = 1 ± 0.029, n = 12; DMSO with TSPO siRNA group: fold change = 1.022 ±

519 0.069, n = 12; DMSO + 10 PM rotenone with control siRNA group: fold change = 3.66 ±

520 0.245, n = 12; DMSO + 10 PM rotenone with TSPO siRNA group: fold change = 3.178 ±

521 0.204, n = 12; 5 PM Emapunil + DMSO with control siRNA group: fold change = 0.955 ±

522 0.03, n = 12; 5 PM Emapunil + DMSO with TSPO group: fold change = 1.141 ± 0.153, n =

523 12; 5 PM Emapunil + 10 PM rotenone with control siRNA group: fold change = 1.573 ±

524 0.14, n = 12; 5 PM Emapunil + 10 PM rotenone with TSPO group: fold change = 2.515 ±

525 0.246, n = 12; **p < 0.005, ***p < 0.001, n.s. = not significant; F (3, 88) = 6.931, p = 0.0003;

526 Two-way ANOVA, Tukey’s post hoc test, data are given as means ± SEM) (Fig. 8C).

527

528 Emapunil inhibits microgliosis

529 Since TSPO ligands have been linked to mitigated neuroinflammatory responses, we tested

530 the effects of Emapunil on microgliosis and astrocytosis in vivo. At day 15, mice were

531 sacrificed and sections stained for microglia (IBA1) and astrocytes (GFAP) (Fig. 9 A, B).

532 Quantification of striatal cell counts confirmed microgliosis as well as astrocytosis in the

533 MPTP + DMSO group compared to saline controls. Treatment with Emapunil markedly

534 ameliorated microgliosis in MPTP-treated mice, but induced only a modest, albeit significant

535 reduction of astrogliosis (Fig. 9 C, D). (NaCl group: IBA1 positive cells = 180.4 ±

536 4.125/mm2, n = 9; GFAP positive cells = 1.152 ± 0.1288/mm2, n = 6; MPTP + DMSO group:

537 IBA1 positive cells = 234.7 ± 4.813/mm2, n = 10; GFAP positive cells = 133.7 ± 4.283/mm2,

538 n = 7; MPTP + Emapunil group: IBA1 positive cells = 190.8 ± 6.627/mm2, n = 8; GFAP

539 positive cells = 109.4 ± 3.438/mm2, n = 6; ***p < 0.001, n.s. = not significant; IBA1 positive

540 cells: F (2, 158) = 33.19, p < 0.0001; GFAP positive cells: F (2, 111) = 446.5, p < 0.0001;

541 One-way ANOVA, Tukey’s post hoc test, data are given as means ± SEM).

542 22

543 Emapunil induces a shift from pro- to anti-inflammatory microglial activation state

544 In contrast to the effect observed on microglia cell counts at day 15, quantitative RT-PCR

545 analysis of striatal tissue at day 3 revealed higher Iba1 mRNA levels in both, MPTP + DMSO

546 and MPTP + Emapunil treated groups, compared to saline control (Fig. 10). Iba1 mRNA

547 expression levels were comparable between MPTP + DMSO and MPTP + Emapunil groups

548 at day 3 (NaCl group normalized to 1: 1 ± 0.1763; MPTP + DMSO group: 5.633 ± 0.6228;

549 MPTP + Emapunil group: 6.842 ± 1.015, n = 5; **p < 0.01, ***p < 0.001, n.s. = not

550 significant; F (2, 12) = 19.68, p = 0.000163; One-way ANOVA, Tukey’s post hoc test, data

551 are given as means ± SEM). We next investigated mRNA expression levels of Tspo (TSPO)

552 as a microglia activation marker (Fig. 10 B), of the classical M1 pro-inflammatory markers:

553 Tnfa, encoding tumor necrosis factor alpha (TNF-D , Cxcl10, encoding C-X-C motif

554 chemokine 10 (CXCL10), Il1b, encoding interleukin 1-E IL-1E , Mpa2l, encoding

555 macrophage activating 2 like protein (Mpa2l), Il6, encoding interleukin 6 (IL6), Nos2,

556 encoding inducible nitric oxide synthase 2 (iNOS2), Cox2, encoding cyclooxygenase 2

557 (COX2) as well as of the anti-inflammatory M2 marker genes Arg1, encoding arginase 1

558 (Arg1), Il10, encoding interleukin 10 (IL10), Il4, encoding interleukin 4 (IL4), Mrc1,

559 encoding macrophage mannose receptor (MMR), Ym1, encoding for chitinase-3-like protein

560 3/YM1, Fizz2, encoding found in inflammatory zone (FIZZ2) (Fig. 10 C). Tspo and Cox2

561 mRNA levels were exclusively increased in the MPTP + DMSO group as compared to saline

562 controls and MPTP + Emapunil treated animals (Fig. 10 B, C). Another M1 pro-inflammatory

563 marker, Cxcl10, was increased in MPTP + DMSO and to a lower extent in MPTP + Emapunil

564 treated mice (Fig. 10 C). Altogether, these data indicate a mitigating effect of Emapunil on

565 pro-inflammatory microglia activation (NaCl group normalized to 1: Tspo = 1 ± 0.07894,

566 Tnfa = 1 ± 0.3178, Cxcl10 = 1 ± 0.1652, Il1b = 1 ± 0.1329, Mpa2l = 1 ± 0.07732, Il6 = 1 ±

567 0.1694, Nos2 = 1 ± 0.1704, Cox2 = 1 ± 0.1734, n = 5; Fold change in MPTP + DMSO group:

568 Tspo = 2.342 ± 0.379, Tnfa = 5.885 ± 0.6208, Cxcl10 = 11.6 ± 0.5612, Il1b = 1.581 ±

569 0.3056, Mpa2l = 1.111 ± 0.07614, Il6 = 2.227 ± 0.3152, Nos2 = 2 ± 0.1327, Cox2 = 2.746 ±

570 0.2961, n = 5; Fold change in MPTP + Emapunil group: Tspo = 0.7979 ± 0.1375, Tnfa=

571 4.979 ± 0.6865, Cxcl10 = 5.365 ± 1.449, Il1b = 1.385 ± 0.1907, Mpa2l = 1.158 ± 0.279, Il6

572 = 3.189 ± 0.5172, Nos2 = 1.66 ± 0.305, Cox2 = 1.539 ± 0.171, n = 5; **p < 0.01, ***p <

573 0.001, n.s. = not significant; Tspo: F (2, 12) = 12.52 , p = 0.001157; Tnfa: F (2, 12) =

574 21.75, p = 0.000151; Cxcl10: F (2, 12) = 34.86, p < 0.0001; Il1b: F (2, 12) = 1.777, p = 0.004;

575 Mpa2l: F (2, 11) = 0.2046, p = 0.8180; Il6: F (2, 12) = 9.131, p = 0.0039; Nos2: F (2, 12) =

576 5.55, p = 0.0197; Cox2: F (2, 12) = 16.32, p = 0.00038; One-way ANOVA, Tukey’s post hoc

577 test, data are given as means ± SEM). In contrast, the anti-inflammatory M2 state markers

578 Arg1, Il10, YM1 and FIZZ2 were exclusively increased in the MPTP + Emapunil group,

579 suggesting an additional anti-inflammatory effect (NaCl group normalized to 1: Arg1 = 1 ±

580 0.06473, Il10 = 1 ± 0.04799, Il4 = 1 ± 0.08438, Mrc1 = 1 ± 0.0555, Ym1 = 1 ± 0.1139, Fizz2

581 = 1 ± 0.2787, n = 5; Fold change in MPTP + DMSO group: Arg1 = 0.8055 ± 0.001321, Il10 =

582 0.9218 ± 0.02449, Il4 = 1.905 ± 0.4561, Mrc1 = 1.517 ± 0.06856, Ym1 = 1.357 ± 0.225, Fizz2

583 = 1.282 ± 0.2985, n = 5; Fold change in MPTP + Emapunil group: Arg1 = 1.259 ± 0.1289,

584 Il10 = 2.478 ± 0.557, IL4 = 3.082 ± 0.9407, Mrc1 = 1.955 ± 0.1961, Ym1 = 2.21 ± 0.0745,

585 Fizz2 = 4.248 ± 0.5753, n = 5; *p < 0.05, **p < 0.01, ***p < 0.001, n.s. = not significant;

586 Arg1: F (2, 12) = 6.171, p = 0.015957; Il10: F (2, 12) = 7.365, p = 0.008185; Il4: F (2, 12) =

587 2.971, p = 0.0895; Mrc1: F (2, 12) = 14.84, p = 0.00057; Ym1: F (2, 12) = 16.75, p =

588 0.000336; Fizz2: F (2, 12) = 19.51, p = 0.000169; One-way ANOVA, Tukey’s post hoc test,

589 data are given as means ± SEM). Together, these data indicate a shift from pro- to anti-

590 inflammatory microglial activation induced by Emapunil treatment.

591

592 Effects of Emapunil on transcription

593 There is increasing evidence for significant changes in gene expression during Parkinson’s

594 disease pathogenesis (Pinho et al., 2016). Moreover, altered transcriptome plasticity is an

595 early sign of disrupted cellular homeostasis (Fischer, 2014; Martinez Hernandez et al., 2018).

596 When we compared striatal gene-expression levels at day 3 between the three groups (NaCl

597 control, MPTP + DMSO, MPTP + Emapunil) by RNA sequencing, we found MPTP-

598 associated changes in 1017 genes compared to saline controls (Fig. 11 A). Administration of

599 Emapunil to MPTP-treated animals resulted in 2464 differentially expressed genes compared

600 to saline controls, 834 of which were also changed in MPTP + DMSO only treated animals

601 (Fig. 11 A). These data suggest Emapunil treatment attenuated the de-regulation of 183

602 MPTP-induced genes and elicited an Emapunil-specific gene-expression program linked to

603 1630 genes (Fig. 11 A). This indicates that Emapunil not only partially reinstates

604 transcriptional changes induced by MPTP but also exerts additional effects. Functional

605 enrichment analysis revealed that genes upregulated by MPTP and normalized by additional

606 Emapunil treatment, are linked to pathways of innate immune response and cytokine

607 production, vesicle-mediated transport, endocytosis, neurogenesis, neuron differentiation and

608 kinase signaling (Fig. 11 B). In contrast, MPTP-specific down-regulated genes which were

609 fully restored to normal expression levels by Emapunil are linked to cell projection

610 organization and assembly pathways, to lipid metabolism, cell migration and motility (Fig. 11

611 B). Apart from restoring approximately 82% of MPTP induced gene expression changes,

612 Emapunil treatment resulted in of the 1630 differentially expressed genes that were unique to

613 the Emapunil treated MPTP-exposed animals (Fig. 11 A). Functional network analysis of

614 these 1630 Emapunil related genes revealed pathways linked to immune response, e.g.

615 regulation of inflammatory response, cytokine production, leukocyte mediated immunitiy and

616 response to molecules of bacterial origin (Fig. 11 C). These data are in line with the reported

617 effect of Emapunil on microglia-mediated immune function.

618 25

619 Discussion

620 Here, we investigated the effect of the TSPO ligand Emapunil in a well-established mouse

621 model of parkinsonism, an important component of Parkinson’s disease. We show that

622 systemic administration of Emapunil ameliorates microgliosis, neuroinflammation and ER

623 stress in the MPTP-induced subchronic parkinsonism mouse model. Most importantly, we

624 find that Emapunil treatment protects against neuron loss in the substantia nigra, striatal

625 dopamine depletion and motor deficits. In addition to an almost complete restoration of

626 MPTP-associated gene expression changes, Emapunil alters the expression of genes

627 unaffected by MPTP. We identified two potential pathways which may explain the

628 neuroprotective effects of Emapunil: (i) inhibition of the IRED/XBP1s related unfolded

629 protein response (UPR) and (ii) shift from pro- to anti-inflammatory microglia polarization.

630

631 A common feature in many neurodegenerative diseases is the misfolding and accumulation of

632 proteins. Under acute conditions, the UPR counteracts the accumulation of misfolded proteins

633 by activation of ER associated degradation pathways, attenuation of protein expression, and

634 increased chaperone production. However, sustained activation of the UPR induces apoptosis,

635 as observed in many neurodegenerative diseases, including prion (Moreno et al., 2013),

636 Alzheimer’s, Huntington’s and Parkinson’s disease. Thus, inhibition of the UPR was

637 suggested as a potential therapeutic approach in various neurodegenerative disorders. The

638 UPR can be induced by three distinct pathways: PRKR-like ER kinase (PERK), inositol-

639 requiring enzyme 1 (IRE1), or activating transcription factor 6 (ATF6) (Schroder and

640 Kaufman, 2005). In response to ER stress, activated IRE1D splices Xbp1 mRNA to the more

641 active and stable form Xbp1s. The XBP1s protein acts as a transcription factor for UPR

642 related genes which can result in protective as well as in toxic effects, depending, amongst

643 others, on the pathway induced and the duration of UPR activation. Thus, overexpression of

644 active XBP1s was previously shown to suppress neurotoxicity in MPP+ treated dopaminergic 26

645 neuron cultures (Sado et al., 2009), whereas down-regulation of XBP1 in dopaminergic

646 neurons resulted in higher ER stress levels and neuronal loss (Valdes et al., 2014). Recent

647 evidence, however, supported a protective effect of pharmacological inhibition of the

648 IRE1/XBP1 pathway by β-asarone in the 6-OHDA rat model of parkinsonism (Ning et al.,

649 2016). Inhibition of IRE1/XBP1 was also protective in various mouse models of other

650 neurodegenerative disease (Vidal et al., 2012) and activated IRE1/XBP1 signaling promoted

651 pathology in a mouse model of Alzheimer’s disease (Duran-Aniotz et al., 2017). Our findings

652 indicate that MPTP and rotenone activate IRE1/XBP1 signalling. Emapunil restores increased

653 XBP1s/XBP1 ratios and protects against neurotoxicity in MPP+ and rotenone treated

654 dopaminergic neuron cultures as well as in the MPTP mouse model. Our data suggest that

655 Emapunil may act as an upstream inhibitor of the IRE1/XBP1 pathway, thereby attenuating

656 cellular stress and apoptosis.

657

658 Until recently, it was assumed that TSPO is required for the transport of cholesterol from the

659 outer to the inner mitochondrial membrane, as the rate limiting step in steroid synthesis

660 (Mukhin et al., 1989) (Krueger and Papadopoulos, 1990) (Rupprecht et al., 2010). This was

661 challenged by findings in TSPO knockout mice which failed to show impaired

662 steroidogenesis (Tu et al., 2014) (Banati et al., 2014) (Batoko et al., 2015), although

663 conflicting results were obtained by other groups (Fan et al., 2015; Owen et al., 2017; Barron

664 et al., 2018). Emapunil effects may thus at least partially be caused by alterations in

665 neurosteroid levels. This notion is also supported by our transcriptome network analysis

666 which indicates Emapunil-mediated changes in steroid hormone response networks (Fig. 8C).

667 Neurosteroids allosterically bind gamma-aminobutyric acid (GABA) receptors and may

668 enhance GABA signaling, in line with the anxiolytic effects of Emapunil (Rupprecht et al.,

669 2009). Neurosteroids can additionally regulate gene expression, thus potentially ameliorating

670 inflammatory activation. Consistently, a TSPO ligand of the N,N-dialkyl-2-phenylindol-3- 27

671 ylglyoxylamide class (PIGAs) was shown to attenuate LPS/Interferon-Jinduced upregulation

672 of iNOS and COX2 in an astroglioma cell line (Santoro et al., 2016). Our functional network

673 analysis of gene expression changes induced by MPTP and reinstated by Emapunil, revealed

674 that Emapunil counteracts the activation of innate immune response and cytokine production

675 pathways upregulated by MPTP. Unexpectedly, the majority of Emapunil-associated

676 transcriptome alterations do not involve genes affected by MPTP. Network analysis of these

677 Emapunil-specific genes again included networks linked to the regulation of cytokine

678 production and other, immune-related pathways. This is in line with previous reports of anti-

679 inflammatory effects observed with different synthetic TPSO ligands (Choi et al., 2011), e.g.,

680 in experimental autoimmune encephalomyelitis (Daugherty et al., 2013), Alzheimer’s disease

681 (Barron et al., 2013) or retina degeneration (Scholz et al., 2015) (Barichello et al., 2017).

682 Similar to macrophages, microglia can adopt different activation states, formerly

683 distinguished into a pro-inflammatory M1, and an alternative, anti-inflammatory activation

684 state M2. Recently, instead of this oversimplicistic model, a concept of multiple or mixed

685 microglia activation states was proposed. We found several of the M1 associated pro-

686 inflammatory marker transcripts upregulated under MPTP treatment, including Tnfa, Cxcl10,

687 Nos2 and Cox2. Enhanced mRNA levels of Cxcl10 and Cox2 were reversed under Emapunil

688 administration, whereas a trend towards a reduction of Nos2 and Tnfa was observed, but did

689 not reach significance. In parallel, we found upregulation of various M2 linked phenotypic

690 marker genes in MPTP + Emapunil treated animals, i.e. Arg1, Il10, Il4 (trend), Mrc1, Ym1

691 and Fizz2. M2 activation states can further be divided into M2a, M2b and M2c polarization

692 states which are associated with different functions, e.g. the M2a state with tissue repair.

693 M2a-like activation is induced by Il4 and is characterized by increased Arg1, Ym1 and Fizz2

694 expression as well as Il10 secretion. Il10 in turn can stimulate M2c polarization which

695 suppresses M1-associated pro-inflammatory activity. Thus, Emapunil treatment appears to

696 activate a microglial M2a and M2c anti-inflammatory response. Microglia can shift from M1 28

697 to M2 activation state which may lead to mixed M1/M2 profiles as we observed. Thus,

698 manipulating microglial activation to enhance anti-inflammatory phenotypes has been

699 suggested as a possible therapeutic strategy in Pakinson’s disease (Subramaniam and

700 Federoff, 2017). Our findings suggest that Emapunil could constitute a promising molecule

701 for therapeutic intervention in Parkinson’s disease, especially given that Emapunil is orally

702 available and readily crosses the blood brain barrier (Owen et al., 2014). Emapunil was

703 previously tested in 70 healthy volunteers in a panic disorder paradigm and in a clinical phase

704 II trial in patients with generalized anxiety disorder (Rupprecht et al., 2009) (Owen et al.,

705 2012). Importantly, the side effects of Emapunil were comparable to those of placebo. Thus,

706 the safety profile and blood brain barrier permeability make Emapunil ideally suited for

707 clinical applications in CNS disorders. We have tested Emapunil effects only in female mice

708 as upregulation of gonadal testosterone production by TSPO ligands had been reported

709 previously (Chung et al., 2013). Therefore, it is possible that the effects of Emapunil differ

710 between sexes. In addition, TSPO expression levels may differ between male and female

711 mice. For example, significantly higher myocardial TSPO levels were reported in male

712 compared to female mice during myocarditis (Fairweather et al., 2014). In brain, TSPO

713 mRNA levels were significantly higher in male drosophila compared to females (Lin et al.,

714 2015), further supporting the notion that treatment response to TSPO ligands may differ in a

715 sex-dependent manner. One Another limitation of our study is the comparatively high dose of

716 50 mg Emapunil/kg body weight. It cannot be excluded that this may lead to off target effects,

717 although the effects of Emapunil on the UPR IRE1D-XBP1 pathway depended on the

718 presence of TSPO. This supports the notion that the effects of Emapunil are mediated by

719 TSPO rather than by off target effects. TSPO bears a single nucleotide polymorphism rs6971,

720 which results in the substitution of alanine 147 to threonine (A147T). Homozygous A147T

721 carriers are characterized by a 15 fold lower binding affinity of TSPO to most of its synthetic

722 ligands, including Emapunil (Owen et al., 2011b; Owen et al., 2011a). The A147T 29

723 polymorphism is frequent in the Caucasian population with approximately 9% homozygous

724 carriers and below 1% in the Asian population (Kurumaji et al., 2000; Owen et al., 2011b). In

725 future clinical studies, this limitation could be overcome by increasing the dose of Emapunil

726 in low affinity binders. In conclusion, we propose that Emapunil should be further validated

727 in clinical trials to treat Parkinson’s disease.

728

729 List of Abbreviations

730 6-OHDA = 6-hydroxydopamine; ATF6 = activating transcription factor 6; Arg1 = arginase 1;

731 COX2 = cyclooxygenase 2; Cxcl10 = C-X-C motif chemokine 10; DOPAC =

732 dihydroxyphenylacetic acid; ERAD = ER-associated degradation; FIZZ2 = found in

733 inflammatory zone; HVA = homovanillic acid; Il1E = interleukin 1-E; Il6 = interleukin 6; IRE

734 D = inositol requiring kinase 1 α; LUHMES = Lund human mesencephalic; MAO B =

735 monoamine-oxidase B; MPP+ = 1-methyl-4-phenylpyridinium; MPTP = 1-methyl-4-phenyl-

736 1,-2,-3,-6-tetrahydropyridine; Mpa2l = macrophage activating 2 like protein; iNos2 =

737 inducible nitric oxide synthase 2; Il10 = interleukin 10; Il4 = interleukin 4; MMR =

738 macrophage mannose receptor; mPTP = mitochondrial permeability transition pore; PERK =

739 PRKR-like ER kinase; PFA = paraformaldehyde; PIGAs= N,N-dialkyl-2-phenylindol-3-

740 ylglyoxylamide class; ROS = reactive oxygen species; SNpc = substantia nigra pars

741 compacta; TNF = tumor necrosis factor; UPR = unfolded protein response; TH = tyroxine

742 hydroxylase; TSPO = translocator protein 18; XBP1 = X-box binding protein 1; YM1 =

743 chitinase-3-like protein 3.

744

745

746

747

748

749

750

751

752

753

754

755

756

757

758

759

760

761

762

763

764

765

766

767

768

769

770 References

771 Acosta SA, Tajiri N, de la Pena I, Bastawrous M, Sanberg PR, Kaneko Y, Borlongan CV (2015) Alpha- 772 synuclein as a pathological link between chronic traumatic brain injury and Parkinson's 773 disease. Journal of cellular physiology 230:1024-1032.

774 Akundi RS, Huang Z, Eason J, Pandya JD, Zhi L, Cass WA, Sullivan PG, Bueler H (2011) Increased 775 mitochondrial calcium sensitivity and abnormal expression of innate immunity genes 776 precede dopaminergic defects in Pink1-deficient mice. PloS one 6:e16038. 777 Anders S, Pyl PT, Huber W (2015) HTSeq--a Python framework to work with high-throughput 778 sequencing data. Bioinformatics 31:166-169. 779 Banati RB, Middleton RJ, Chan R, Hatty CR, Kam WW, Quin C, Graeber MB, Parmar A, Zahra D, 780 Callaghan P, Fok S, Howell NR, Gregoire M, Szabo A, Pham T, Davis E, Liu GJ (2014) Positron 781 emission tomography and functional characterization of a complete PBR/TSPO knockout. 782 Nature communications 5:5452. 783 Barichello T, Simoes LR, Collodel A, Giridharan VV, Dal-Pizzol F, Macedo D, Quevedo J (2017) The 784 translocator protein (18kDa) and its role in neuropsychiatric disorders. Neurosci Biobehav 785 Rev 83:183-199. 786 Barron AM, Ji B, Kito S, Suhara T, Higuchi M (2018) Steroidogenic abnormalities in translocator 787 protein knockout mice and significance in the aging male. Biochem J 475:75-85. 788 Barron AM, Garcia-Segura LM, Caruso D, Jayaraman A, Lee JW, Melcangi RC, Pike CJ (2013) Ligand for 789 translocator protein reverses pathology in a mouse model of Alzheimer's disease. J Neurosci 790 33:8891-8897. 791 Bartels AL, Willemsen AT, Doorduin J, de Vries EF, Dierckx RA, Leenders KL (2010) [11C]-PK11195 PET: 792 quantification of neuroinflammation and a monitor of anti-inflammatory treatment in 793 Parkinson's disease? Parkinsonism & related disorders 16:57-59. 794 Batoko H, Veljanovski V, Jurkiewicz P (2015) Enigmatic Translocator protein (TSPO) and cellular stress 795 regulation. Trends in biochemical sciences 40:497-503. 796 Bindea G, Mlecnik B, Hackl H, Charoentong P, Tosolini M, Kirilovsky A, Fridman WH, Pages F, 797 Trajanoski Z, Galon J (2009) ClueGO: a Cytoscape plug-in to decipher functionally grouped 798 gene ontology and pathway annotation networks. Bioinformatics 25:1091-1093. 799 Block ML, Zecca L, Hong JS (2007) Microglia-mediated neurotoxicity: uncovering the molecular 800 mechanisms. Nature reviews Neuroscience 8:57-69. 801 Brochard V, Combadiere B, Prigent A, Laouar Y, Perrin A, Beray-Berthat V, Bonduelle O, Alvarez- 802 Fischer D, Callebert J, Launay JM, Duyckaerts C, Flavell RA, Hirsch EC, Hunot S (2009) 803 Infiltration of CD4+ lymphocytes into the brain contributes to neurodegeneration in a mouse 804 model of Parkinson disease. The Journal of clinical investigation 119:182-192. 805 Choi J, Ifuku M, Noda M, Guilarte TR (2011) Translocator protein (18 kDa)/peripheral benzodiazepine 806 receptor specific ligands induce microglia functions consistent with an activated state. Glia 807 59:219-230. 808 Chung JY, Chen H, Midzak A, Burnett AL, Papadopoulos V, Zirkin BR (2013) Drug ligand-induced 809 activation of translocator protein (TSPO) stimulates steroid production by aged brown 810 Norway rat Leydig cells. Endocrinology 154:2156-2165. 811 Costa B, Da Pozzo E, Giacomelli C, Barresi E, Taliani S, Da Settimo F, Martini C (2016) TSPO ligand 812 residence time: a new parameter to predict compound neurosteroidogenic efficacy. Scientific 813 reports 6:18164. 814 Couch Y, Alvarez-Erviti L, Sibson NR, Wood MJ, Anthony DC (2011) The acute inflammatory response 815 to intranigral alpha-synuclein differs significantly from intranigral lipopolysaccharide and is 816 exacerbated by peripheral inflammation. Journal of neuroinflammation 8:166. 817 Daugherty DJ, Selvaraj V, Chechneva OV, Liu XB, Pleasure DE, Deng W (2013) A TSPO ligand is 818 protective in a mouse model of multiple sclerosis. EMBO molecular medicine 5:891-903. 819 Davalos D, Grutzendler J, Yang G, Kim JV, Zuo Y, Jung S, Littman DR, Dustin ML, Gan WB (2005) ATP 820 mediates rapid microglial response to local brain injury in vivo. Nature neuroscience 8:752- 821 758. 822 Deleidi M, Gasser T (2013) The role of inflammation in sporadic and familial Parkinson's disease. 823 Cellular and molecular life sciences : CMLS 70:4259-4273. 824 Du Y, Ma Z, Lin S, Dodel RC, Gao F, Bales KR, Triarhou LC, Chernet E, Perry KW, Nelson DL, Luecke S, 825 Phebus LA, Bymaster FP, Paul SM (2001) Minocycline prevents nigrostriatal dopaminergic

826 neurodegeneration in the MPTP model of Parkinson's disease. Proceedings of the National 827 Academy of Sciences of the United States of America 98:14669-14674. 828 Dupont AC, Largeau B, Santiago Ribeiro MJ, Guilloteau D, Tronel C, Arlicot N (2017) Translocator 829 Protein-18 kDa (TSPO) Positron Emission Tomography (PET) Imaging and Its Clinical Impact in 830 Neurodegenerative Diseases. International journal of molecular sciences 18. 831 Duran-Aniotz C, Cornejo VH, Espinoza S, Ardiles AO, Medinas DB, Salazar C, Foley A, Gajardo I, 832 Thielen P, Iwawaki T, Scheper W, Soto C, Palacios AG, Hoozemans JJM, Hetz C (2017) IRE1 833 signaling exacerbates Alzheimer's disease pathogenesis. Acta neuropathologica 134:489-506. 834 Edison P, Ahmed I, Fan Z, Hinz R, Gelosa G, Ray Chaudhuri K, Walker Z, Turkheimer FE, Brooks DJ 835 (2013) Microglia, amyloid, and glucose metabolism in Parkinson's disease with and without 836 dementia. Neuropsychopharmacology : official publication of the American College of 837 Neuropsychopharmacology 38:938-949. 838 Eidson LN, Kannarkat GT, Barnum CJ, Chang J, Chung J, Caspell-Garcia C, Taylor P, Mollenhauer B, 839 Schlossmacher MG, Ereshefsky L, Yen M, Kopil C, Frasier M, Marek K, Hertzberg VS, Tansey 840 MG (2017) Candidate inflammatory biomarkers display unique relationships with alpha- 841 synuclein and correlate with measures of disease severity in subjects with Parkinson's 842 disease. Journal of neuroinflammation 14:164. 843 Fairweather D, Coronado MJ, Garton AE, Dziedzic JL, Bucek A, Cooper LT, Jr., Brandt JE, Alikhan FS, 844 Wang H, Endres CJ, Choi J, Pomper MG, Guilarte TR (2014) Sex differences in translocator 845 protein 18 kDa (TSPO) in the heart: implications for imaging myocardial inflammation. J 846 Cardiovasc Transl Res 7:192-202. 847 Fan J, Campioli E, Midzak A, Culty M, Papadopoulos V (2015) Conditional steroidogenic cell-targeted 848 deletion of TSPO unveils a crucial role in viability and hormone-dependent steroid formation. 849 Proceedings of the National Academy of Sciences of the United States of America 112:7261- 850 7266. 851 Fischer A (2014) Epigenetic memory: the Lamarckian brain. The EMBO journal 33:945-967. 852 Gardet A, Benita Y, Li C, Sands BE, Ballester I, Stevens C, Korzenik JR, Rioux JD, Daly MJ, Xavier RJ, 853 Podolsky DK (2010) LRRK2 is involved in the IFN-gamma response and host response to 854 pathogens. Journal of immunology 185:5577-5585. 855 Gatliff J, Campanella M (2016) TSPO: kaleidoscopic 18-kDa amid biochemical pharmacology, control 856 and targeting of mitochondria. Biochem J 473:107-121. 857 Gavioli EC, Duarte FS, Bressan E, Ferrara P, Farges RC, De Lima TC (2003) Antidepressant-like effect of 858 Ro5-4864, a peripheral-type benzodiazepine receptor ligand, in forced swimming test. 859 European journal of pharmacology 471:21-26. 860 Gerhard A, Pavese N, Hotton G, Turkheimer F, Es M, Hammers A, Eggert K, Oertel W, Banati RB, 861 Brooks DJ (2006) In vivo imaging of microglial activation with [11C](R)-PK11195 PET in 862 idiopathic Parkinson's disease. Neurobiology of disease 21:404-412. 863 Giatti S, Pesaresi M, Cavaletti G, Bianchi R, Carozzi V, Lombardi R, Maschi O, Lauria G, Garcia-Segura 864 LM, Caruso D, Melcangi RC (2009) Neuroprotective effects of a ligand of translocator protein- 865 18 kDa (Ro5-4864) in experimental diabetic neuropathy. Neuroscience 164:520-529. 866 Gillardon F, Schmid R, Draheim H (2012) Parkinson's disease-linked leucine-rich repeat kinase 867 2(R1441G) mutation increases proinflammatory cytokine release from activated primary 868 microglial cells and resultant neurotoxicity. Neuroscience 208:41-48. 869 Giordano S, Lee J, Darley-Usmar VM, Zhang J (2012) Distinct effects of rotenone, 1-methyl-4- 870 phenylpyridinium and 6-hydroxydopamine on cellular bioenergetics and cell death. PloS one 871 7:e44610. 872 Gu XL, Long CX, Sun L, Xie C, Lin X, Cai H (2010) Astrocytic expression of Parkinson's disease-related 873 A53T alpha-synuclein causes neurodegeneration in mice. Molecular brain 3:12. 874 Harms AS, Delic V, Thome AD, Bryant N, Liu Z, Chandra S, Jurkuvenaite A, West AB (2017) alpha- 875 Synuclein fibrils recruit peripheral immune cells in the rat brain prior to neurodegeneration. 876 Acta neuropathologica communications 5:85.

877 Hirsch EC, Hunot S (2009) Neuroinflammation in Parkinson's disease: a target for neuroprotection? 878 The Lancet Neurology 8:382-397. 879 Iannaccone S, Cerami C, Alessio M, Garibotto V, Panzacchi A, Olivieri S, Gelsomino G, Moresco RM, 880 Perani D (2013) In vivo microglia activation in very early dementia with Lewy bodies, 881 comparison with Parkinson's disease. Parkinsonism & related disorders 19:47-52. 882 Imamura K, Hishikawa N, Sawada M, Nagatsu T, Yoshida M, Hashizume Y (2003) Distribution of major 883 histocompatibility complex class II-positive microglia and cytokine profile of Parkinson's 884 disease brains. Acta neuropathologica 106:518-526. 885 JC O ((2007-2015) ) Venny. An interactive tool for comparing lists with Venn's diagrams. 886 http://bioinfogpcnbcsices/tools/venny/index.html. 887 Karlstetter M, Nothdurfter C, Aslanidis A, Moeller K, Horn F, Scholz R, Neumann H, Weber BH, 888 Rupprecht R, Langmann T (2014) Translocator protein (18 kDa) (TSPO) is expressed in 889 reactive retinal microglia and modulates microglial inflammation and phagocytosis. J 890 Neuroinflammation 11:3. 891 Khasnavis S, Ghosh A, Roy A, Pahan K (2013) Castration induces Parkinson disease pathologies in 892 young male mice via inducible nitric-oxide synthase. The Journal of biological chemistry 893 288:20843-20855. 894 Kirov S, Ji R, Wang J, Zhang B (2014) Functional annotation of differentially regulated gene set using 895 WebGestalt: a gene set predictive of response to ipilimumab in tumor biopsies. Methods in 896 molecular biology 1101:31-42. 897 Kita A, Kohayakawa H, Kinoshita T, Ochi Y, Nakamichi K, Kurumiya S, Furukawa K, Oka M (2004) 898 Antianxiety and antidepressant-like effects of AC-5216, a novel mitochondrial 899 benzodiazepine receptor ligand. Br J Pharmacol 142:1059-1072. 900 Knott C, Stern G, Wilkin GP (2000) Inflammatory regulators in Parkinson's disease: iNOS, lipocortin-1, 901 and cyclooxygenases-1 and -2. Molecular and cellular neurosciences 16:724-739. 902 Koshimori Y, Ko JH, Mizrahi R, Rusjan P, Mabrouk R, Jacobs MF, Christopher L, Hamani C, Lang AE, 903 Wilson AA, Houle S, Strafella AP (2015) Imaging Striatal Microglial Activation in Patients with 904 Parkinson's Disease. PloS one 10:e0138721. 905 Krueger KE, Papadopoulos V (1990) Peripheral-type benzodiazepine receptors mediate translocation 906 of cholesterol from outer to inner mitochondrial membranes in adrenocortical cells. The 907 Journal of biological chemistry 265:15015-15022. 908 Krug AK, Gutbier S, Zhao L, Poltl D, Kullmann C, Ivanova V, Forster S, Jagtap S, Meiser J, Leparc G, 909 Schildknecht S, Adam M, Hiller K, Farhan H, Brunner T, Hartung T, Sachinidis A, Leist M (2014) 910 Transcriptional and metabolic adaptation of human neurons to the mitochondrial toxicant 911 MPP(+). Cell death & disease 5:e1222. 912 Kurumaji A, Nomoto H, Yoshikawa T, Okubo Y, Toru M (2000) An association study between two 913 missense variations of the benzodiazepine receptor (peripheral) gene and schizophrenia in a 914 Japanese sample. Journal of neural transmission 107:491-500. 915 Leva G, Klein C, Benyounes J, Halle F, Bihel F, Collongues N, De Seze J, Mensah-Nyagan AG, Patte- 916 Mensah C (2017) The translocator protein ligand XBD173 improves clinical symptoms and 917 neuropathological markers in the SJL/J mouse model of multiple sclerosis. Biochimica et 918 biophysica acta 1863:3016-3027. 919 Lin R, Rittenhouse D, Sweeney K, Potluri P, Wallace DC (2015) TSPO, a Mitochondrial Outer 920 Membrane Protein, Controls Ethanol-Related Behaviors in Drosophila. PLoS Genet 921 11:e1005366. 922 Lotharius J, Barg S, Wiekop P, Lundberg C, Raymon HK, Brundin P (2002) Effect of mutant alpha- 923 synuclein on dopamine homeostasis in a new human mesencephalic cell line. The Journal of 924 biological chemistry 277:38884-38894. 925 Love MI, Huber W, Anders S (2014) Moderated estimation of fold change and dispersion for RNA-seq 926 data with DESeq2. Genome biology 15:550.

927 Martinez Hernandez A et al. (2018) The diphenylpyrazole compound anle138b blocks Abeta channels 928 and rescues disease phenotypes in a mouse model for amyloid pathology. EMBO molecular 929 medicine 10:32-47. 930 McGeer PL, Itagaki S, Boyes BE, McGeer EG (1988) Reactive microglia are positive for HLA-DR in the 931 substantia nigra of Parkinson's and Alzheimer's disease brains. Neurology 38:1285-1291. 932 Mercado G, Castillo V, Vidal R, Hetz C (2015) ER proteostasis disturbances in Parkinson's disease: 933 novel insights. Frontiers in aging neuroscience 7:39. 934 Miklossy J, Doudet DD, Schwab C, Yu S, McGeer EG, McGeer PL (2006) Role of ICAM-1 in persisting 935 inflammation in Parkinson disease and MPTP monkeys. Experimental neurology 197:275-283. 936 Moehle MS, Webber PJ, Tse T, Sukar N, Standaert DG, DeSilva TM, Cowell RM, West AB (2012) LRRK2 937 inhibition attenuates microglial inflammatory responses. The Journal of neuroscience : the 938 official journal of the Society for Neuroscience 32:1602-1611. 939 Mogi M, Kondo T, Mizuno Y, Nagatsu T (2007) p53 protein, interferon-gamma, and NF-kappaB levels 940 are elevated in the parkinsonian brain. Neuroscience letters 414:94-97. 941 Moreno JA, Halliday M, Molloy C, Radford H, Verity N, Axten JM, Ortori CA, Willis AE, Fischer PM, 942 Barrett DA, Mallucci GR (2013) Oral treatment targeting the unfolded protein response 943 prevents neurodegeneration and clinical disease in prion-infected mice. Science translational 944 medicine 5:206ra138. 945 Mukhin AG, Papadopoulos V, Costa E, Krueger KE (1989) Mitochondrial benzodiazepine receptors 946 regulate steroid biosynthesis. Proceedings of the National Academy of Sciences of the United 947 States of America 86:9813-9816. 948 Ning B, Deng M, Zhang Q, Wang N, Fang Y (2016) beta-Asarone Inhibits IRE1/XBP1 Endoplasmic 949 Reticulum Stress Pathway in 6-OHDA-Induced Parkinsonian Rats. Neurochemical research 950 41:2097-2101. 951 Ogawa N, Hirose Y, Ohara S, Ono T, Watanabe Y (1985) A simple quantitative bradykinesia test in 952 MPTP-treated mice. Research communications in chemical pathology and pharmacology 953 50:435-441. 954 Ouchi Y, Yoshikawa E, Sekine Y, Futatsubashi M, Kanno T, Ogusu T, Torizuka T (2005) Microglial 955 activation and dopamine terminal loss in early Parkinson's disease. Annals of neurology 956 57:168-175. 957 Owen DR, Lewis AJ, Reynolds R, Rupprecht R, Eser D, Wilkins MR, Bennacef I, Nutt DJ, Parker CA 958 (2011a) Variation in binding affinity of the novel anxiolytic XBD173 for the 18 kDa 959 translocator protein in human brain. Synapse 65:257-259. 960 Owen DR, Gunn RN, Rabiner EA, Bennacef I, Fujita M, Kreisl WC, Innis RB, Pike VW, Reynolds R, 961 Matthews PM, Parker CA (2011b) Mixed-affinity binding in humans with 18-kDa translocator 962 protein ligands. Journal of nuclear medicine : official publication, Society of Nuclear Medicine 963 52:24-32. 964 Owen DR, Yeo AJ, Gunn RN, Song K, Wadsworth G, Lewis A, Rhodes C, Pulford DJ, Bennacef I, Parker 965 CA, StJean PL, Cardon LR, Mooser VE, Matthews PM, Rabiner EA, Rubio JP (2012) An 18-kDa 966 translocator protein (TSPO) polymorphism explains differences in binding affinity of the PET 967 radioligand PBR28. Journal of cerebral blood flow and metabolism : official journal of the 968 International Society of Cerebral Blood Flow and Metabolism 32:1-5. 969 Owen DR, Guo Q, Kalk NJ, Colasanti A, Kalogiannopoulou D, Dimber R, Lewis YL, Libri V, Barletta J, 970 Ramada-Magalhaes J, Kamalakaran A, Nutt DJ, Passchier J, Matthews PM, Gunn RN, Rabiner 971 EA (2014) Determination of [(11)C]PBR28 binding potential in vivo: a first human TSPO 972 blocking study. Journal of cerebral blood flow and metabolism : official journal of the 973 International Society of Cerebral Blood Flow and Metabolism 34:989-994. 974 Owen DR, Fan J, Campioli E, Venugopal S, Midzak A, Daly E, Harlay A, Issop L, Libri V, 975 Kalogiannopoulou D, Oliver E, Gallego-Colon E, Colasanti A, Huson L, Rabiner EA, Suppiah P, 976 Essagian C, Matthews PM, Papadopoulos V (2017) TSPO mutations in rats and a human 977 polymorphism impair the rate of steroid synthesis. The Biochemical journal 474:3985-3999.

978 Papadopoulos V, Lecanu L (2009) Translocator protein (18 kDa) TSPO: an emerging therapeutic target 979 in neurotrauma. Experimental neurology 219:53-57. 980 Pinho R, Guedes LC, Soreq L, Lobo PP, Mestre T, Coelho M, Rosa MM, Goncalves N, Wales P, Mendes 981 T, Gerhardt E, Fahlbusch C, Bonifati V, Bonin M, Miltenberger-Miltenyi G, Borovecki F, Soreq 982 H, Ferreira JJ, T FO (2016) Gene Expression Differences in Peripheral Blood of Parkinson's 983 Disease Patients with Distinct Progression Profiles. PloS one 11:e0157852. 984 Ravikumar B, Crawford D, Dellovade T, Savinainen A, Graham D, Liere P, Oudinet JP, Webb M, Hering 985 H (2016) Differential efficacy of the TSPO ligands etifoxine and XBD-173 in two rodent 986 models of Multiple Sclerosis. Neuropharmacology 108:229-237. 987 Ron D, Walter P (2007) Signal integration in the endoplasmic reticulum unfolded protein response. 988 Nature reviews Molecular cell biology 8:519-529. 989 Rupprecht R, Papadopoulos V, Rammes G, Baghai TC, Fan J, Akula N, Groyer G, Adams D, Schumacher 990 M (2010) Translocator protein (18 kDa) (TSPO) as a therapeutic target for neurological and 991 psychiatric disorders. Nat Rev Drug Discov 9:971-988. 992 Rupprecht R et al. (2009) Translocator protein (18 kD) as target for anxiolytics without 993 benzodiazepine-like side effects. Science 325:490-493. 994 Sado M, Yamasaki Y, Iwanaga T, Onaka Y, Ibuki T, Nishihara S, Mizuguchi H, Momota H, Kishibuchi R, 995 Hashimoto T, Wada D, Kitagawa H, Watanabe TK (2009) Protective effect against Parkinson's 996 disease-related insults through the activation of XBP1. Brain research 1257:16-24. 997 Santoro A, Mattace Raso G, Taliani S, Da Pozzo E, Simorini F, Costa B, Martini C, Laneri S, Sacchi A, 998 Cosimelli B, Calignano A, Da Settimo F, Meli R (2016) TSPO-ligands prevent oxidative damage 999 and inflammatory response in C6 glioma cells by neurosteroid synthesis. Eur J Pharm Sci 1000 88:124-131. 1001 Scholz D, Poltl D, Genewsky A, Weng M, Waldmann T, Schildknecht S, Leist M (2011) Rapid, complete 1002 and large-scale generation of post-mitotic neurons from the human LUHMES cell line. Journal 1003 of neurochemistry 119:957-971. 1004 Scholz R, Caramoy A, Bhuckory MB, Rashid K, Chen M, Xu H, Grimm C, Langmann T (2015) Targeting 1005 translocator protein (18 kDa) (TSPO) dampens pro-inflammatory microglia reactivity in the 1006 retina and protects from degeneration. J Neuroinflammation 12:201. 1007 Schroder M, Kaufman RJ (2005) ER stress and the unfolded protein response. Mutation research 1008 569:29-63. 1009 Spillantini MG, Crowther RA, Jakes R, Hasegawa M, Goedert M (1998) alpha-Synuclein in filamentous 1010 inclusions of Lewy bodies from Parkinson's disease and dementia with lewy bodies. 1011 Proceedings of the National Academy of Sciences of the United States of America 95:6469- 1012 6473. 1013 Subramaniam SR, Federoff HJ (2017) Targeting Microglial Activation States as a Therapeutic Avenue 1014 in Parkinson's Disease. Frontiers in aging neuroscience 9:176. 1015 Szego EM, Gerhardt E, Outeiro TF (2017) Sirtuin 2 enhances dopaminergic differentiation via the 1016 AKT/GSK-3beta/beta-catenin pathway. Neurobiology of aging 56:7-16. 1017 Tanabe Y, Suehara Y, Kohsaka S, Hayashi T, Akaike K, Mukaihara K, Kurihara T, Kim Y, Okubo T, Ishii 1018 M, Kazuno S, Kaneko K, Saito T (2018) IRE1alpha-XBP1 inhibitors exerted anti-tumor activities 1019 in Ewing's sarcoma. Oncotarget 9:14428-14443. 1020 Team R (2008) R: A language and environment for statistical computing. R Foundation for Statistical 1021 Computing, Vienna, Austria 1022 Teismann P, Tieu K, Choi DK, Wu DC, Naini A, Hunot S, Vila M, Jackson-Lewis V, Przedborski S (2003) 1023 Cyclooxygenase-2 is instrumental in Parkinson's disease neurodegeneration. Proceedings of 1024 the National Academy of Sciences of the United States of America 100:5473-5478. 1025 Tentillier N, Etzerodt A, Olesen MN, Rizalar FS, Jacobsen J, Bender D, Moestrup SK, Romero-Ramos M 1026 (2016) Anti-Inflammatory Modulation of Microglia via CD163-Targeted Glucocorticoids 1027 Protects Dopaminergic Neurons in the 6-OHDA Parkinson's Disease Model. The Journal of 1028 neuroscience : the official journal of the Society for Neuroscience 36:9375-9390.

1029 Tonges L, Frank T, Tatenhorst L, Saal KA, Koch JC, Szego EM, Bahr M, Weishaupt JH, Lingor P (2012) 1030 Inhibition of rho kinase enhances survival of dopaminergic neurons and attenuates axonal 1031 loss in a mouse model of Parkinson's disease. Brain 135:3355-3370. 1032 Tu LN, Morohaku K, Manna PR, Pelton SH, Butler WR, Stocco DM, Selvaraj V (2014) Peripheral 1033 benzodiazepine receptor/translocator protein global knock-out mice are viable with no 1034 effects on steroid hormone biosynthesis. The Journal of biological chemistry 289:27444- 1035 27454. 1036 Tufekci KU, Genc S, Genc K (2011) The endotoxin-induced neuroinflammation model of Parkinson's 1037 disease. Parkinson's disease 2011:487450. 1038 Urra H, Dufey E, Lisbona F, Rojas-Rivera D, Hetz C (2013) When ER stress reaches a dead end. 1039 Biochimica et biophysica acta 1833:3507-3517. 1040 Valdes P, Mercado G, Vidal RL, Molina C, Parsons G, Court FA, Martinez A, Galleguillos D, Armentano 1041 D, Schneider BL, Hetz C (2014) Control of dopaminergic neuron survival by the unfolded 1042 protein response transcription factor XBP1. Proceedings of the National Academy of Sciences 1043 of the United States of America 111:6804-6809. 1044 van Schadewijk A, van't Wout EF, Stolk J, Hiemstra PS (2012) A quantitative method for detection of 1045 spliced X-box binding protein-1 (XBP1) mRNA as a measure of endoplasmic reticulum (ER) 1046 stress. Cell stress & chaperones 17:275-279. 1047 Vidal RL, Figueroa A, Court FA, Thielen P, Molina C, Wirth C, Caballero B, Kiffin R, Segura-Aguilar J, 1048 Cuervo AM, Glimcher LH, Hetz C (2012) Targeting the UPR transcription factor XBP1 protects 1049 against Huntington's disease through the regulation of FoxO1 and autophagy. Human 1050 molecular genetics 21:2245-2262. 1051 Waak J, Weber SS, Waldenmaier A, Gorner K, Alunni-Fabbroni M, Schell H, Vogt-Weisenhorn D, Pham 1052 TT, Reumers V, Baekelandt V, Wurst W, Kahle PJ (2009) Regulation of astrocyte inflammatory 1053 responses by the Parkinson's disease-associated gene DJ-1. FASEB journal : official 1054 publication of the Federation of American Societies for Experimental Biology 23:2478-2489. 1055 Wahner AD, Sinsheimer JS, Bronstein JM, Ritz B (2007) Inflammatory cytokine gene polymorphisms 1056 and increased risk of Parkinson disease. Archives of neurology 64:836-840. 1057 Wang J, Duncan D, Shi Z, Zhang B (2013) WEB-based GEne SeT AnaLysis Toolkit (WebGestalt): update 1058 2013. Nucleic acids research 41:W77-83. 1059 Wang M, Wang X, Zhao L, Ma W, Rodriguez IR, Fariss RN, Wong WT (2014) Macroglia-microglia 1060 interactions via TSPO signaling regulates microglial activation in the mouse retina. The 1061 Journal of neuroscience : the official journal of the Society for Neuroscience 34:3793-3806. 1062 Wilms H, Rosenstiel P, Sievers J, Deuschl G, Zecca L, Lucius R (2003) Activation of microglia by human 1063 neuromelanin is NF-kappaB dependent and involves p38 mitogen-activated protein kinase: 1064 implications for Parkinson's disease. FASEB journal : official publication of the Federation of 1065 American Societies for Experimental Biology 17:500-502. 1066 Wu DC, Jackson-Lewis V, Vila M, Tieu K, Teismann P, Vadseth C, Choi DK, Ischiropoulos H, Przedborski 1067 S (2002) Blockade of microglial activation is neuroprotective in the 1-methyl-4-phenyl- 1068 1,2,3,6-tetrahydropyridine mouse model of Parkinson disease. The Journal of neuroscience : 1069 the official journal of the Society for Neuroscience 22:1763-1771. 1070 Zambelli F, Pesole G, Pavesi G (2009) Pscan: finding over-represented transcription factor binding site 1071 motifs in sequences from co-regulated or co-expressed genes. Nucleic acids research 1072 37:W247-252. 1073 Zhang B, Kirov S, Snoddy J (2005a) WebGestalt: an integrated system for exploring gene sets in 1074 various biological contexts. Nucleic acids research 33:W741-748. 1075 Zhang MR, Kumata K, Maeda J, Yanamoto K, Hatori A, Okada M, Higuchi M, Obayashi S, Suhara T, 1076 Suzuki K (2007) 11C-AC-5216: a novel PET ligand for peripheral benzodiazepine receptors in 1077 the primate brain. Journal of nuclear medicine : official publication, Society of Nuclear 1078 Medicine 48:1853-1861.

1079 Zhang W, Zecca L, Wilson B, Ren HW, Wang YJ, Wang XM, Hong JS, Shahsavar S (2013) Human 1080 neuromelanin: an endogenous microglial activator for dopaminergic neuron death. Frontiers 1081 in bioscience 5:1-11. 1082 Zhang W, Wang T, Pei Z, Miller DS, Wu X, Block ML, Wilson B, Zhang W, Zhou Y, Hong JS, Zhang J 1083 (2005b) Aggregated alpha-synuclein activates microglia: a process leading to disease 1084 progression in Parkinson's disease. FASEB journal : official publication of the Federation of 1085 American Societies for Experimental Biology 19:533-542.

1086

1087

1088

1089 Figure legends

1090 Fig. 1 Experimental design

1091 8 weeks old female C57BL/6JRj mice were assigned to three different experimental treatment

1092 groups (top: NaCl group, middle: MPTP + DMSO group and bottom: MPTP + Emapunil

1093 group). Animals either received NaCl or 30 mg/kg body weight of MPTP by intraperetoneal

1094 injection once daily on 5 subsequent days (days 1-5). Animals in the MPTP + Emapunil group

1095 were additionally treated with intraperitoneal injections of 50 mg/kg body weight of Emapunil

1096 every second day, starting from day 1, until day 15. 5 animals of each group were sacrificed

1097 on day 3, striatum as well as substantia nigra were prepared and shock-frozen for further

1098 analysis by qPCR, HPLC, and transcriptome. The remaining animals underwent motor

1099 function tests on days 11-13 (pole test) and on day 14 (cylinder test). Animals were perfused

1100 on day 15 and brains were cryo-frozen for further stereological analysis.

1101

1102 Fig. 2 Emapunil ameliorates MPTP induced dopaminergic neuron loss

1103 A Representative images of the substantia nigra of mice treated with NaCl (top), MPTP

1104 (middle) or MPTP and Emapunil (bottom) (Anti-TH antibody staining, scale bar 200 Pm).

1105 B Dopaminergic neurons were quantified as the total number of TH-immunoreactive neurons.

1106 C The number of Nissl-stained neurons was quantified in the NaCl, MPTP or MPTP and

1107 Emapunil treatment groups.

1108 All data are shown as means + SEM. One-way ANOVA, in between group difference p <

1109 0.0001 (both in TH and Nissl stained neurons), *p < 0.05, ***p < 0.001. Tukey’s post hoc

1110 test.

1111

1112 Fig. 3 Emapunil treatment restores motor function

1113 A Cylinder test of mice treated with either NaCl (black bars), MPTP (red bars) or MPTP +

1114 Emapunil (green bars) 14 days after first MPTP application. The histograph shows the

1115 percentage of rears against the cylinder wall, either as free rears without paw support or rears

1116 supported with only the left, only the right or with both paws. No significant between group

1117 difference was observed for right or left paw only assisted rears. Data are shown as means +

1118 SEM. One-way ANOVA, in between group difference p = 0.000108 (free rears) and p =

1119 0.003677 (support with both paws). *p < 0.05, **p < 0.01, ***p < 0.001. Tukey’s post hoc

1120 test.

1121 B Pole test performance 11-13 days after the initial MPTP dose. The histograph shows the

1122 time taken to orient downward at the top of the pole.

1123 Data are shown as means + SEM. One-way ANOVA, in between group difference p = 0.04.

1124 *p < 0.05. Tukey’s post hoc test.

1125

1126 Fig. 4 HPLC analysis of dopamine and its metabolites in the striatum

1127 A Dopamine

1128 B Dihydroxyphenylacetic acid (DOPAC)

1129 C Metabolic ratio [homovallinic acid (HVA) + DOPAC]/dopamine.

1130 Data are shown as means + SEM. One-way ANOVA, in between group difference p < 0.0001

1131 (dopamine), p = 0.02 (DOPAC), and p = 0.0008 (metabolic ratio). *p < 0.05, **p < 0.01,

1132 ***p < 0.001; n.s. = not significant. Tukey’s post hoc test.

1133 39

1134 Fig. 5 Emapunil mitigates ER stress

1135 A qPCR analysis of relative mRNA expression levels of unspliced Xbp1

1136 B qPCR analysis of relative mRNA expression levels of spliced Xbp1s

1137 C Ratio of spliced Xbp1s/unspliced Xbp1 normalized to NaCl control.

1138 Data are shown as means + SEM, One-way ANOVA, in between group difference p =

1139 0.25329 (Xbp1), p < 0.0001 (spliced Xbp1s) and p = 0.003151 (ratio Xbp1s/Xbp1). **p < 0.01,

1140 ***p < 0.001. Tukey’s post hoc test.

1141 D Cell toxicity was measured by adenylate kinase release (relative ToxiLight luminescence)

1142 in differentiated LUHMES cells treated with either DMSO, MPP+ or rotenone and with or

1143 without addition of Emapunil. Data are shown as means + SEM, Two-way ANOVA, in all

1144 interaction comparisons p < 0.0001, *p < 0.05, ***p < 0.001. Holm Sidak post hoc test.

1145 E XBP1s/XBP1 ratios in Luhmes cells. Data are shown as means + SEM, One-way ANOVA,

1146 in between group difference p < 0.0001. **p < 0.01, ***p < 0.001. Tukey’s post hoc test.

1147

1148 Fig. 6 TSPO expression in dopaminergic neurons

1149 A Immunofluorescence staining of 8 week old wild-type control mice (substantia nigra).

1150 Sections were stained with antibodies against TSPO (left, green color) and TH (middle, red

1151 color). Merged image (right), scale bar 20 Pm.

1152 B Immunofluorescence staining of LUHMES cells. Left DAPI (blue color), antibody against

1153 TSPO (green), antibody against beta-III-tubulin (red) and merged image (right image). Scale

1154 bar 50 Pm.

1155

1156 Fig. 7 TSPO siRNA treatment decreases TSPO expression levels

1157 A Western blot analysis of TSPO, beta-Actin and TH levels in LUHMES cells, with and

1158 without siRNA directed against TSPO.

1159 B Quantification of TSPO levels (Western blot analysis from Fig. 7A) normalized to beta-

1160 Actin (loading control). Data are shown as means + SEM, 2-tailed unpaired t-test (Welch’s t-

1161 test), p = 0.0048; **p < 0.005.

1162 C Quantification of TH levels (Western blot analysis from Fig. 7A) normalized to beta-Actin

1163 (loading control). Data are shown as means + SEM, 2-tailed unpaired t-test (Welch’s t-test), p

1164 = 0.412; n.s. = not significant.

1165

1166 Fig. 8 The effects of Emapunil depend on TSPO expression

1167 A Cytotoxicity measured by adenylate kinase release (ToxiLight luminescence) in

1168 differentiated LUHMES cells treated with either TSPO or control siRNA. Experimental

1169 groups: DMSO, 10 PM rotenone, 5 PM Emapunil, 10 PM rotenone and 5 PM Emapunil. Data

1170 are shown as means + SEM, Two-way ANOVA, F(3, 54)=3.365, p = 0.0251; **p < 0.005;

1171 ***p < 0.001; n.s. = not significant; Tukey post hoc test.

1172 B Cytotoxicity (ToxiLight luminescence assay) in differentiated LUHMES cells with

1173 increasing rotenone concentrations. Data are shown as means + SEM, One-way ANOVA, in

1174 between group difference p < 0.0001; ***p < 0.001; n.s. = not significant; Tukey post hoc

1175 test.

1176 C qPCR analysis of spliced XBP1s/unspliced XBP1 in differentiated LUHMES cells treated

1177 with TSPO or control siRNA. Experimental groups as in A.

1178 Data are shown as means + SEM, Two-way ANOVA, F(3, 82)=6.458, p = 0.0006; **p <

1179 0.005; ***p < 0.001, n.s. = not significant; Tukey post hoc test.

1180

1181 Fig. 9 Emapunil prevents microgliosis and astrogliosis in MPTP animals

1182 A IBA1 (green) immunohistochemistry of striatal sections from either NaCl, MPTP + DMSO

1183 or MPTP + Emapunil treated mice, sacrificed at day 15.

1184 B GFAP (red) immunohistochemistry of striatal sections from either NaCl, MPTP + DMSO

1185 or MPTP + Emapunil treated mice, sacrificed at day 15.

1186 C Quantification of IBA1 positive cells (striatum).

1187 D GFAP positive cells (striatum).

1188 Data are shown as total numbers/mm2 (means + SEM), 3 sections from each animal were

1189 analyzed with n = 6-7 animals per group. Data are shown as means + SEM, One-way

1190 ANOVA, in between group differences p < 0.0001 (both in IBA1 and GFAP quantification).

1191 ***p < 0.001; n.s. = not significant. Tukey’s post hoc test. Scale bars indicate 50 μm (A) and

1192 100 μm (C).

1193

1194 Fig. 10 Emapunil mediates a shift from pro- to anti-inflammatory gene expression

1195 Striatal RNA was isolated on day 3 from mice either treated with NaCl (black bars), MPTP +

1196 DMSO (red bars) or MPTP + Emapunil (green bars) (n = 5 per experimental group). qPCR

1197 analysis of mRNA expression of A Iba1, B Tspo, C pro-and D anti-inflammatory cytokines

1198 and chemokines. Histographs show relative mRNA levels normalized to NaCl control

1199 condition. Data are shown as means + SEM. One-way ANOVA, in between group difference

1200 p = 0.000163 (Iba1), p = 0.001157 (Tspo), p = 0.000151 (Tnfa), p < 0.0001 (Il10), p =

1201 0.004103 (Il1b), p = 0.81803 (Mpa2l), p = 0.0039 (Il6), p = 0.019653 (Nos2), p = 0.000377

1202 (Cox2), p = 0.015957 (Arg1), p = 0.008185 (Il10), p = 0.0895 (Il4), p = 0.00057 (Mrc1), p =

1203 0.000336 (Ym1), p = 0.000169 (Fizz2). *p < 0.05, **p < 0.01, ***p < 0.001; n.s. = not

1204 significant. Tukey’s post hoc test.

1205

1206 Fig. 11 Effects of MPTP and Emapunil on the transcriptome

1207 A Venn diagram showing the overlap between the transcriptional response to MPTP and

1208 Emapunil as well as genes which are only affected by MPTP treatment or only affected by

1209 additional Emapunil treatment (MPTP + Emapunil). 42

1210 B Individual traces for the 183 genes that are significant in the MPTP group alone (i.e.

1211 attenuated by Emapunil treatment). On the right, the most salient gene ontology (GO)

1212 categories for up- and down-regulated genes within those 183 are represented.

1213 C Network of GO terms associated with Emapunil-specific genes (i.e. those 1630 in the Venn

1214 diagram from (B) that are only changed in the MPTP + Emapunil treatment group but not in

1215 the MPTP group). LFC = log fold change.

1216

1217

1218 Table 1

1219 List of primers for qPCR Gene Forward Primer Reverse Primer (protein) Mrc1 AGTGGCAGGTGGCTTATG GGTTCAGGAGTTGTTGTGG (MMR) Ym1 (YM1) CATTCAGTCAGTTATCAGATTC AGTGAGTAGCAGCCTTGG C Fizz2 TGGAGAATAAGGTCAAGGAAC GTCAACGAGTAAGCACAGG (FIZZ2) Il10 (IL10) TGGCCCAGAAATCAAGGAGC CAGCAGACTCAATACACACT Il4 (IL4) AGATGGATGTGCCAAACGTCCT AATATGCGAAGCACCTTGGAAGC CA C Arg1 GGAAGACAGCAGAGGAGGTG TATGGTTACCCTCCCGTTGA (Arg1) Iba1 GTCCTTGAAGCGAATGCTGG CATTCTCAAGATGGCAGATC (IBA1) Tspo GGGAGCCTACTTTGTGCGTGG CAGGTAAGGATACAGCAAGCGG (TSPO) G Tnfa (TNF- TTCCGAATTCACTGGAGCCTCG TGCACCTCAGGGAAGAATCTGGA D) AA A IP10 (IP10) TGAGCAGAGATGTCTGAATCCG TGTCCATCCATCGCAGCA

IL1b (IL1E) AAGGGCTGCTTCCAAACCTTTG ATACTGCCTGCCTGAAGCTCTTG AC T Mpa2l CAAGAGGGAGAAGATTGAACA CACTTGCCTTCACCCCTTTC (MPA2l) TGA Nos2 CTGCTGGTGGTGACAAGCACAT ATGTCATGAGCAAAGGCGCAGA (iNOS2) TT AC Cox2 TTGCTGTACAAGCAGTGGCAAA TGCAGCCATTTCCTTCTCTCCTGT (COX2) GG Il6 (IL6) TGGCTAAGGACCAAGACCATCC AACGCACTAGGTTTGCCGAGTAG AA A Xbp1 CAGCACTCAGACTATGTGCA GTCCATGGGAAGATGTTCTGG (XBP1) mouse Xbp1s CTGAGTCCGAATCAGGTGCAG GTCCATGGGAAGATGTTCTGG (XBP1s) mouse XBP1 CAGCACTCAGACTACGTGCA ATCCATGGGGAGATGTTCTGG (XBP1) human XBP1s AACCAGGAGTTAAGACAGCGC CTGCACCTGCTGCGGACT (XBP1s) TT human Actb (E- TGTGATGGTGGGAATGGGTCAG TGTGGTGCCAGATCTTCTCCATG Actin) AA T mouse GAPDH GAAGGTGAAGGTCGGAGT CATGGGTGGAATCATAATGGAA

(GAPDH) human

1220

1221

Figure 1

+ ), transcriptome

female C57BL/6JRj mice, 8 weeks striatum: qPCR, HPLC (MPP motor function:motor pole function:testHPLC (dopamine cylinder test and metabolites)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 perfusion NaCl immunohistochemistry n=25 stereology perfusion MPTP immunohistochemistry n=25 stereology perfusion MPTP+ immunohistochemistry Emapunil n=23 stereology Figure 2

A IHC: anti-TH, Substantia nigra B Substantia nigra

*** 25000 *** ***

20000

15000

NaCl 10000 200 Pm 5000 TH-immunoreactive neuronsTH-immunoreactive 0

ap. NaCl MPTP Em

MPTP+

* *** *** MPTP 30000 200 Pm

20000

10000 Nissl posstive neurons posstive Nissl MPTP+ Emapunil 0 . 200 Pm P p Cl a Na MPT Em P+ PT M Figure 3

A Cylinder test

100 NaCl 90 ** *** MPTP 80 MPTP+Emap. 70 60 50 * * *** 40 30 20 relative number of rears [%] rears of number relative 10 0 free rears left right both

B Pole test

2.0 1.8 * 1.6 1.4 1.2 1.0 0.8 0.6

time to turn body (s) body turn to time 0.4 0.2 0.0

p. aCl TP a N MP Em TP+ MP Figure 4

ABCStriatum, Dopamine Striatum, DOPAC Striatum, metabolic ratio

** n.s. 10 *** * 8 * 5 ** 9 7 *** 8 4 6 7 6 5 3 5 4 4 3 2 3 ng/mg wet tissue ng/mg wet tissue wet ng/mg 2 2 1

1 1 (HVA+DOPAC)/dopamine 0 0 0 . l . Cl TP ap ap aCl TP ap. Na NaC m N MP Em MPTP E MP Em + + PTP+ MPTP MPTP M B

Figure 5

A Unspliced Xbp1 B Spliced Xbp1s C Xbp1s/Xbp1

1.5 1.5 *** *** 2.1 ** ** 1.8 1.2 1.5 1.0 0.9

Xbp1 1.2 /

0.6 0.9

0.5 Xbp1s 0.6 0.3 0.3 relative mRNA expression mRNA relative relative mRNA expression mRNA relative 0.0 0.0 0.0 l Cl p. ap. ap. TP a NaC NaCl Na MPTP Em MPTP Em MP Em + TP P MPTP+ MPTP+ M

DECytotoxicity assay XBP1s/XBP1

5 uM DMSO ** ** ** 5 uM Emapunil *** n.s. *** *** 6 0.0906 10 *** *** *

5 8 4 6 3 4

2 XBP1s/XBP1 n.s. 1 2

0 0 fold change of released adenylate released of change fold kinase relative to DMSO treatment + e il il il le n n nil P ic o cin cin u u P h n y pun y p DMSO M tenone e a a V ote cam mapun cam map m M E E u Ro R o Em yo E 0 + + + 1 Toy n e uM i To n in 0 c + o c 1 y e n n te my cam o ca o n o te Ro o oy Toy R T + e n o n

Rote

Figure 8

A Cytotoxicity assay

*** n.s. n.s. n.s. *** n.s. ** 5.0 *** *** *** 4.5 4.0 3.5 ** 3.0 2.5 n.s. 2.0 n.s. n.s. 1.5 1.0 0.5 fold change of released adenylate kinase

relative to DMSO and TSPO siRNA control 0.0 TSPO siRNA - + - + - + - + DMSORotenone Emapunil Rotenone Emapunil

B Cytotoxicity assay 10 *** n.s. 8 *** *** 6 *** *** n.s.

kinase relativeto DMSO control 0 fold change of released adenylate released of change fold

μM μM μM μM μM μM μM

0 .5 1 .5 5 0 0 0 2 1 2 Rotenone concentration

C XBP1s/XBP1 *** n.s. n.s. n.s. *** n.s. n.s. *** *** *** 4.0

3.5

3.0 **

2.5 XBP1 / 2.0 n.s.

n.s. XBP1s 1.5 n.s.

1.0 relative mRNA expression mRNA relative 0.5

0.0 TSPO siRNA - + - + - + - + DMSORotenone Emapunil Rotenone Emapunil Figure 9

A NaCl MPTP MPTP+Emap. IBA1

B NaCl MPTP MPTP+Emap. GFAP

C D *** n.s. 300 150 *** *** *** *** 250 120 ) 200 ) 2 2 90 150 60

(per 1 mm(per 1 100 (per mm 1 (per

50 30 Iba1 positivecells in CPu GFAP positive cells in CPu GFAP cells positive 0 0 il l il n n u TP u NaCl NaC p MPTP MP Emap Ema + P+ T MPTP MP Figure 10

A Iba1 B Tspo

n.s. 10 3.0 *** ** ** ** n.s. 2.5 8

2.0 6 1.5 4 1.0

2 relative mRNA expression mRNA relative relative mRNA expression relative 0.5

0 0.0 . Cl Cl p a ap. TP a N Na MPTP Em MP Em + P T P MPTP+ M C * *** ** 13 *** 10 *** n.s. 7 ** n.s. n.s. 4 n.s. *** ** 3 n.s. n.s. * n.s. n.s. n.s. n.s. 2 n.s. n.s.

relative mRNA expression mRNA relative 1

0 Tnfa Cxcl10 Il1b Mpa2l Il6 Nos2 Cox2

*** n.s. *** 5 D n.s. n.s. n.s. 4 * n.s. * 3 *** n.s.*** * n.s. **

2 n.s. n.s. * 1 relative mRNA expression mRNA relative

0 Arg1 Il10 Il4 Mrc1 Ym1 Fizz2 Figure 11

AB MPTP innate immune response 1.5 regulation of ERK1 and ERK2 cascade regulation of vesicle-mediated transport endocytosis regulation of cytokine production positive regulation of neuron differentiation positive regulation of neurogenesis

183 834 1630 1.0 positive regulation of MAPK cascade Fold Change Fold

0.0 0.5 1.0 1.5 2.0 2.5

1.0 regulation of cell projection organization actin cytoskeleton organization cell projection assembly Emapunil regulation of ion transport cellular lipid metabolic process positive regulation of cell migration positive regulation of cell motility Fold Change Fold

0.7 phospholipid metabolic process

0.0 0.5 1.0 1.5 2.0 2.5 -log10(adjusted p-value) C Emapunil-specific network (LFC > |0.3|)

positive microtubule regulation of cytoskeleton positive response to organization regulation of external stimulus involved in endocytosis mitosis

regulation of response to innflammatory steroid hormone reesponse meiotic nucleear division

defense response response to nucleaear division hormone reesponse to oxygen-containing inflammatory cell cycle process coompound response regulation of cell division cellular response regulat gulation of to clear division oxygen-containing cytokin negative compound product regulation of cytokine production respop nse to myeloid leukocyte moleculeu of regulation of bacterial origin activation extrinsic apoptotic leukocyte signaling pathway mediated via death domain immunity receptors vasculature reproductive positive response to development structure regulation of oxidative stress development proteolysis

response to oxygen levels ionizing regulation of radiation proteolysis regulation of involved in response to cellular protein vitamin smooth muscle catabolic process cellular response cell proliferation to inorganic substance