Interactions Between Web-Building Immigrant and Agrobiont Spider Species in Wheat and the Effect on Pest Consumption in a Desert Agroecosystem

Interactions between Web-building Immigrant and Agrobiont Spider Species in Wheat and the Effect on Pest Consumption in a Desert Agroecosystem

Thesis submitted in partial fulfillment of the requirements for the degree of “DOCTOR OF PHILOSOPHY”

Itai Opatovsky

Submitted to the Senate of Ben-Gurion University of the Negev

October 2013

Sede-Boqer

Interactions between Web-building Immigrant and Agrobiont Spider Species in Wheat and the Effect on Pest Consumption in a Desert Agroecosystem

Thesis submitted in partial fulfillment of the requirements for the degree of “DOCTOR OF PHILOSOPHY”

Itai Opatovsky

Submitted to the Senate of Ben-Gurion University of the Negev

Approved by the advisors Approved by the Dean of the Kreitman School of Advanced Graduate Studies

October 2013

Sede Boqer

This work was carried out under the supervision of:

Prof. Yael Lubin

In the Mitrani Department of Desert Ecology

Faculty: Albert Katz International School for Desert Studies The Jacob Blaustein Institudes for Desert Research

And Dr. Phyllis G. Weintraub

In the Department of Entomology

Agricultural Research Organization, Gilat Research Center

Research-Student's Affidavit when Submitting the Doctoral Thesis for Judgment

I, Itai Opatovsky, whose signature appears below, hereby declare that (Please mark the appropriate statements):

_X_ I have written this Thesis by myself, except for the help and guidance offered by my Thesis Advisors.

___ The scientific materials included in this Thesis are products of my own research, culled from the period during which I was a research student.

___ This Thesis incorporates research materials produced in cooperation with others, excluding the technical help commonly received during experimental work. Therefore, I am attaching another affidavit stating the contributions made by myself and the other participants in this research, which has been approved by them and submitted with their approval.

Date: __13.8.2014____ Student's name: ___Itai Opatovsky__ Signature:______

Acknowledgments I want to thank many people that helped me, taught me and joined me in this long process of PhD research. First of all I want to thank my supervisors: Prof. Yael Lubin, that raised me well from a young spiderling and Dr. Phyllis Weintraub that showed me the field of applied agricultural research. I want to thank the people that help me conduct this research: Iris Musli, for teaching me everything I know about spider identification, Ishai Hoffman for assisting me for long hours in the field and Prof. James Harwood, Dr. Eric Chapman, Dr. Matt Dougherty, Prof. Shai Morin and Dr. Shirli Bar-David for teaching me the mysterious world of molecular work and for hosting me in their laboratory. I want to thank all my fellow lab members: Dr. Efrat Gavish-Regev, Dr. Daphna Gotlieb, Dr. Reut Berger-Tal, Dr. John Hermann, Dr. Eric Yip, Dr. Valeria Hochman-Adler, Naama and Shlomi Aaron, Huda Beiruti and Eitan Amiel for all the good advice and comments. I would like to thank my parents that taught me the importance of curiosity, how start fastest and always to boost and for letting me to bring all these crawling creatures into my room. Most important, I want to thank my family, Jenia, Ela and Tchoop for supporting me and for knowing how to cheer me in the difficult times.

Table of contents

Abstract ...... 1 Chapter I: General introduction ...... 5 Figure ...... 10 Chapter II: General methods ...... 11 Study site ...... 11 Figure ...... 12 Chapter III: Molecular characterization of the differential role of immigrant and agrobiont generalist predators in pest suppression...... 13 Introduction ...... 13 Materials and methods ...... 14 Results ...... 16 Discussion ...... 18 Tables ...... 21 Figures ...... 22 Chapter IV: Niche separation in an ephemeral environment: prey consumption and competition in coexisting spider species in an agroecosystem ...... 25 Introduction ...... 25 Materials and methods ...... 26 Results ...... 29 Discussion ...... 31 Figures ...... 35 Chapter V: Differences in habitat use and colonization pattern as a mechanism for competition avoidance ...... 43 Introduction ...... 43 Materials and methods ...... 45 Results ...... 46 Discussion ...... 47 Tables ...... 51 Figures ...... 52 Chapter VI: General discussion ...... 55 Figure ...... 58 References ...... 59 Appendixes ...... 65 Abstract in Hebrew ...... 82

List of Tables Table 3.1 ...... 21 Table 5.1 ...... 51

List of Figures Figure 1.1 ...... 10 Figure 2.1 ...... 12 Figure 3.1 ...... 22 Figure 3.2 ...... 23 Figure 3.3 ...... 24 Figure 4.1 ...... 35 Figure 4.2 ...... 36 Figure 4.3 ...... 37 Figure 4.4 ...... 38 Figure 4.5 ...... 39 Figure 4.6 ...... 40 Figure 4.7 ...... 41 Figure 4.8 ...... 42 Figure 5.1 ...... 52 Figure 5.2 ...... 53 Figure 5.3 ...... 54 Figure 6.1 ...... 58

List of Appendices Appendix 1 ...... 65 Appendix 2 ...... 67 Appendix 3 ...... 70 Appendix 4 ...... 72 Appendix 5 ...... 76 Appendix 6 ...... 78 Appendix 7 ...... 79

Abstract

The range of environmental conditions required by an organism is defined as its fundamental niche. Therefore, for species to coexist, each species has to specialize in different conditions or on different resources from the fundamental niche. The reduced dimensions of the fundamental niche, due to species’ specialization, are defined as the realized niche. The separation in the realized niches between species could be in different dimensions, such as food type or food size, spatial location and temporal appearance. For competition to occur between species, they should be present in the same temporal and spatial dimensions and they should share a limiting resource. Competition among predators, for example, is most likely to occur over shared prey type. The common interaction between them is termed exploitation competition, whereby the better competitor monopolizes the preferred prey and reduces the feeding rate and hence the fitness of its competitor. This competition can lead to changes in prey preference of the two competitors and result in their coexistence. Predators can affect each other also by exploitation competition over other limited resources, such as patches that provide refuge or breeding sites. Moreover, interaction between predators can be by interference competition, when the competitors prevent one another from using resources, for example by occupying available territory or by aggressive exclusion. In this situation, predators can decrease the competition intensity by temporal-spatial separation locally in the habitat or at the landscape scale. Therefore, interference competition can also lead to separation of the realized niches of the competitors.

Spiders are a major part of the predatory guild in most ecosystems. They are generalist predators whose dietary requirements overlap. In spite of their broad prey preference, they are food-limited due to: foraging constraints, such as various prey defense mechanisms; the risks associated with attacking and capturing prey that is often larger than themselves; and, for web-building and ambush species, their stationary lifestyle. Therefore, food is considered to be a limiting resource for spiders. Spiders in agricultural fields, in particular, may encounter low prey diversity due to homogenous vegetation structure, and this should increase diet overlap and competition among them. An additional possibility is that spiders in this ecosystem compete spatially, and the limiting resource is optimal location for web building or physical distance for avoiding interference competition. Crop fields are a good model system for studying interactions among competing species of predators, and spiders in particular. Due to the simplicity of the agricultural habitat, the effects of specific factors on the interactions among species can be more easily distinguished. In addition,

1 spiders are known to suppress populations of crop pests, and therefore, understanding the effect of these interactions on prey preference may have implications for the use of spiders as natural enemies.

This research on the interactions between web-building spider species was conducted in wheat fields in the Northern Negev of Israel. More than 50% of the spider species in this habitat are desert species that migrate into the fields during the crop season. The most common web-building spiders are: in the family Theridiidae (especially the genus Enoplognatha), which move in from semi-desert habitats, and in the family Linyphiidae, which disperse between, and complete their life cycle in, crop fields (agrobionts). Both Enoplognatha spp. and linyphiids build their small sheetwebs at the base of wheat stems. The similar placement of the web, overlap in body sizes and the increase in their field-abundance at the beginning of the season, led to the hypothesis that these spider taxa compete over the same resources. Therefore, the main research questions of this study were: 1) Is there overlap in the prey preference of Enoplognatha and linyphiids and do they both consume wheat pests? 2) Do the spiders compete over prey or other resources and how are their niches separated at the micro-habitat level? 3) Do differences in habitat use and dispersal create separation of niches at the habitat level?

To examine the relative prey preference, the gut contents of spiders collected from the wheat fields were analyzed using PCR (Polymerase Chain Reaction). Primers for a common prey type (springtails, Collembola) and two crop pests (aphids, Hemiptera and Hessian fly, Diptera) were used to test for evidence of these prey types (Chapter III). Field surveys of spider populations in wheat fields were conducted. In order to determine if there was competition over prey or web location competition coefficients and correlations between prey abundance and competition strength were calculated (Chapter IV). Microcosm experiments were used to study niche separation at the micro-habitat level, by comparing prey preference and web location of spiders of the two taxa when placed together or separately (Chapter V). Field surveys of spider populations in wheat fields and adjacent non- wheat habitats were conducted to study the habitat use of these spiders and niche separation at the habitat level throughout the year (Chapter VI).

The gut content analyses showed that linyphiids (agrobiont spiders) had greater affinity to the more common prey type, springtails, in this agroecosystem throughout the crop season. In contrast, a higher percentage of Enoplognatha (immigrant spiders) consumed aphids, which are considered pests of wheat. The field survey revealed that agrobiont

2 linyphiids and immigrant Enoplognatha species are competing, especially at the beginning of the wheat season, as indicated by negative competition coefficients. The microcosm experiments showed that both spider species reduced springtail abundance in choice experiments, suggesting that the springtails , are a food resource for both linyphiids and theridiids. These results are consistent with the gut content analyses. However, the consumption rate of springtails in the microcosm experiment suggested that in this system, prey was not a limiting factor: even at the period of lowest prey abundance, more potential prey were available than could be utilized by an individual spider. The microcosm results showed that Enoplognatha gemina (the most common species of Enoplognatha) consumed aphids when springtails were available,, even in the absence of competitors. However, the predation intensity on aphids by E. gemina decreased when competitors (both inter and intra- specific) were present.

The microcosm experiments showed that the amount of prey at the end of the experiment was the same when single or when multiple spider individuals were present, suggesting interference competition. Moreover, E. gemina built their webs higher on the plant when a competitor was present, suggesting competition over web location, hence interference competition. In our field survey, web height changed over the season for both Enoplognatha and linyphiids, but these changes were unrelated to densities of either spider group or of both groups combined. Thus, in low density populations in the field, spatial separation on a horizontal scale may be sufficient to prevent competition for websites.

The results from sampling spider populations in wheat fields and adjacent habitats showed that the first spiders to colonize the wheat fields are juvenile Enoplognatha (Theridiidae) and adult Trichoncoides piscator (Linyphiidae). These spiders disperse into the wheat fields from the natural semi-desert habitats and non-wheat crop fields, respectively, and are predicted to compete over web sites. However, the low abundance of T. piscator affords enough vacant patches for the colonization by the theridiids, allowing nonrandom spatial separation of the two spider taxa in the field. Later in the season, Alioranus pastoralis (Linyphiidae) migrate into wheat fields, presumably from the natural semi-desert environmentat a time when the theridiids are adults and larger in size; therefore, there may be little competition between these two taxa due to smaller overlap in their resource requirements. I suggest that the different dispersal abilities of these spiders, and the composition of source habitats in the environment, are important in reducing competition

3 between them: the first species to colonize the patch influences the population dynamics of the competing spiders in the patch (“priority effect”).

The results of this study increase our understanding of competitive interactions and resource use of co-occurring spider species in wheat fields. Examining the interactions between these spiders shed light on the mechanisms that shape the spider community in wheat fields. It appears that in this ephemeral environment the niche separation of competing species is mostly at a larger scale, by their habitat use and dispersal abilities.

Chapter I: General introduction

The fundamental niche delineates an organism’s required range of environmental conditions, where the species should appear if there are no interspecies interactions, such as predation and competition (Hutchinson 1957). For competition between two species to occur, they must be present in the same temporal and spatial dimensions and they must share a limiting resource. Gause (1936) showed that two species cannot coexist if they have the same resource requirements, i.e. the same fundamental niche. However, in a heterogeneous environment, each species can specialize in different parts of the fundamental niche, which then allows an organism to persist even in the presence of competitors or predators. The reduced dimensions of the fundamental niche constitute its realized niche (Hutchinson 1957). Schoener (1974) suggested that this separation in the realized niches could be in different dimensions, such as food type or food size, spatial location (Davies et al. 1998, Dickie et al. 2002) and temporal appearance.

Generalist predators, which have broad resource requirements may be limited by different specific requirements such as food, foraging area or location for shelter. These predators have mechanisms of niche separation that vary considerably and occur at different scales. For example, exploitation competition over food can cause the better competitor to monopolize the preferred prey thus reducing the feeding rate and hence the fitness of its competitor. This competition can lead to changes in prey preference of the weaker competitor in order to maximize the net rate of its energy intake (Cameron 1971; Abrams 1983; Sih 1993; Bonesi et al. 2004). Additional means of exploitation competition over prey can occur indirectly over the most productive patches (Morris 1996; Amarasekare 2000). In this case, competition avoidance can be achieved by spatial separation in different scales in the foraging area. For example, entomophagous predators such as coccinellid beetles and mite species (Acari) are known to change their distribution on plants, e.g. by foraging at different heights on the plant, or at different locations in the field, in order to reduce competition (Onzo et al. 2003; Snyder 2009).

Regardless of the amount of prey available, competition over location ; for example, patches or micro-habitats that provide shelter from predation (Holbrook and Schmitt 2002; Almany 2004), or breeding and reproduction sites (Mckaye 1977). This interaction for location may be subject to exploitation competition (by aggressive exclusion); however, this type of interaction is usually interference- competition, in which the competitors prevent one another from using resources by occupying available territory (Schoener 1983). Interference

5 competition can also lead to separation of the realized niches of the competitors. For example, two fox species that are mutually aggressive where they overlap, separated spatially at the landscape scale (Vieira and Port 2007), while two species of spiny mouse separated temporally when forced to forage in the same microhabitat (Gutman and Dayan 2005, Neumann and Shields 2006). Separation in prey preference, where the weaker competitor consumed the less preferred or less abundant prey, was noted in foxes, when wild dogs actively prevented them from exploiting human derived food (Vanak and Gompper 2009). An extreme form of interference competition is intra-guild predation, in which the predators prey upon each other. Intra-guild predation reduces prey consumption overall (Rosenheim et al. 1995).

Some interactions, however, can have a facilitation effect; for example, when the behavior or presence of one of the predators changes the behavior of the prey, making the prey more vulnerable or available to the other predator. Such synergistic interactions may increase prey consumption of both predators, e.g. the presence of foliage-foraging predators cause aphids to drop to the ground and increase the probability of the aphids being attacked by ground foraging predators (Losey and Denno 1998a).

Spiders are a major part of the predatory guild in most ecosystems. Spiders are considered generalist predators that overlap in their diet. In spite of their generalist prey preferences, they are food limited due to foraging constraints, such as various prey defense mechanisms, the risks associated with attacking and capturing prey that is often larger than themselves and, for web-building and ambush species, their stationary lifestyle (Wise 1995). Therefore, I hypothesized that the main limiting resource for spiders will be food. Spiders in agricultural habitats in particular encounter low prey diversity due to the homogenous vegetation structure of crop fields (Siemann et al. 1998), and this should increase diet overlap and competition among them. However, agricultural fields can have higher productivity compared to the surrounding environment and may harbor high abundance of prey (Andow 1991), in which case prey may not be a limited resource. Spiders in this ecosystem may also compete over other resources, such as optimal location for web building or physical distance from competitors in order to avoid interference competition. The seasonality in the field conditions and the disturbance of the agricultural management could favor both agricultural species (agrobionts) and immigrant species from the surrounding habitats (Ehler & Miller 1978). Thus, crop fields are a good model system for studying interactions between competing species of predators, and of spiders in particular, because of the potential for

6 competition and simplicity of these habitats make it possible to distinguish among the effects of specific factors on the interactions between the species. Moreover, crop fields are ephemeral environments that change temporally and in composition in predictable ways over the year. The arthropods colonizing the field at the beginning of the crop season and the interactions between them determine the population and community structure throughout the whole season. The repeated colonization of vacant patches (new crop fields) provides an opportunity to investigate the interactions between competing species in a community that is in a dynamic and predictable state of change. These interactions can be tested repeatedly every crop season and consequently this ecosystem provides a good model for studying competition interactions between species.

Spiders in agroecosystems are considered to be effective insect pest control agents because they can colonize the fields when the pests are scarce, and switch their prey preference when the pest populations increase in abundance (Marc et al. 1999, Nyffeler and Sunderland 2003). Therefore, understanding the effects of inter-specific interactions on prey preference and pest consumption will have practical implications in this system.

The research presented here was done in the semi-desert agroecosystem of the Northern Negev, Israel. This agroecosystem is composed of agricultural fields, natural and disturbed semi-desert habitats, and patches of native and non-native planted trees. The agricultural fields receive additional water by irrigation and therefore are densely vegetated during the season; the semi-desert habitat has sparse perennial and annual vegetation cover in spring after the rainy season. The tree habitat has permanent tree cover throughout the year with an understory of annuals in spring. The high-productivity crop fields attract herbivores, which often draw predators from lower productivity habitats and from other crop fields. However, the agricultural fields suffer from disturbance due to crop management, e.g. the use of agricultural machinery and harvesting activities. Non-crop habitats are important as undisturbed habitats, which may provide refuge for spiders, especially during the summer when the agricultural fields are non-productive. Also, the non-crop habitats may serve as breeding sites for spiders that cannot complete their life cycle before fields are harvested. Previous studies in the northern Negev agroecosystem found that the semi-desert habitats have a strong influence on spider assemblages in adjacent wheat fields (Gavish-Regev et al. 2008, Pluess et al. 2008; 2010). More than 50% of the spider species in the northern Negev wheat fields are desert species that migrate into the fields during the crop season (Gavish- Regev et al. 2008, Pluess et al. 2008). The three main spider groups found in the wheat fields

7 are: cursorial spiders (Gnaphosidae and Lycosidae) that migrate into the crop fields early in the season from the surrounding semi-desert environment; web-building spiders in the family Theridiidae (especially the genus Enoplognatha) that also move in from semi-desert habitats; and the web-building family Linyphiidae that disperse within the agricultural environment between fields (Gavish-Regev et al. 2008).

Enoplognatha spp. (Theridiidae) and the linyphiids share the same microhabitat in the Negev wheat fields and build their webs at the base of the stems. The linyphiids are found mostly in the crop fields; they complete their whole life cycle within the fields and they may survive between the crop seasons as egg sacs that are placed under soil clumps (Gavish- Regev et al. 2008). They have a high reproductive rate and may complete more than one life cycle during the crop season; therefore, their population growth rate is high. The theridiids migrate into the wheat fields early in the season as juveniles with a body size similar to adult linyphiids. However, the longer life cycle of theridiids allows them to grow in size, and adults are ultimately larger than adult linyphiids (Figure 1.1). Due to their migration pattern, the theridiids need an alternative habitat to serve as a source for immigration at the beginning of the crop season. The similar placement of the web, overlap in body sizes and the increase in abundance in the fields at the beginning of the crop season, led to the hypothesis that these two spider taxa compete over the same limiting resources (e.g. prey type and web location). I predicted that the niche separation of these spiders will be caused by competition-induced changes in the prey preference or web location. Moreover, the different habitats that provide a source for dispersal, and the timing of dispersal, may provide an additional temporal-spatial dimension for competition avoidance for these co-occurring species. Therefore, the main research questions that I address in these studies were: 1) Is there overlap in the prey preference of Enoplognatha and linyphiids and do they both consume wheat pests? 2) Do the spiders compete over prey or other resources and how are their niches separated at the micro- habitat level? 3) Do differences in habitat use and dispersal create separation of niches at the habitat level?

The second chapter provides a general description of the northern Negev wheat agroecosystem. In the third chapter, I examined whether the two spider taxa (Enoplognatha and linyphiids) overlap in their prey preference and whether they consume crop pests. I used PCR to analyze the DNA remains of gut contents of spiders collected in the field: primers were used for springtails, which are generally preferred prey for spiders, and for two agricultural pests, aphids and Hessian fly. In the fourth chapter, I tested for competition

8 between the spider groups in the field by calculating the competition coefficients from a field survey during the wheat season . I correlated the competition coefficients with prey abundance in order to detect whether the prey is the resource over which the spiders compete. I also studied the type of competition (exploitation or interference) and mechanism for niche separation using microcosm experiments in the laboratory. This method tested whether niche separation at the micro-habitat level was caused by changes in web location or by changing prey preferences. In the fifth chapter, a field survey of spider populations in wheat fields and adjacent non-wheat habitats was used to study niche separation at the habitat level throughout the year.

Interspecific competition is considered to influence community composition of many organisms, including spiders (Wise 1995). This study increases our understanding of competitive interaction and resource use of co-occurring spider species in wheat fields.

Figures

Figure 1.1: A) Adult female of Enoplognatha Gemina with egg sac. Spider size 4.3 mm; B) Adult female of Alioranus pastoralis. Spider size 2 mm. (Photos by Pau-Shen Huang)

Chapter II: General methods

Study site

The study area was located in agricultural fields around Kibbutz Be’eri (31° 25’ 37” N, 34° 29’ 34” W), situated in the north-western part of the Negev desert of Israel. The sampling sites were scattered over an area of 6 X 6 km around the Kibbutz. This area is a semi-desert region that is dominated by large, annual crop fields (average of 10.8 hectares). During the winter, the main crop is wheat (Triticum aestivum L.), which is sown just before first rains (November) and harvested for green fodder (March) or for grain when dry (May-June). Management of the wheat fields varies, but most are maintained as a dryland crops that are not irrigated and rely on natural precipitation (271 mm average rainfall from the previous ten years, the Israeli Meteorological Service). No insecticide was applied during the entire sampling season. Summer crops typically consist of cotton (Gossypium spp.), sunflowers (Helianthus annuus) and peanuts (Arachis hypogaea).

The common non-crop habitats in this agroecosystem are semi-desert and planted tree habitats (Figure 2.1). The natural semi-desert habitats of the loessial plateau are dry most of the year except for brief rain-fall, and the land is barren except for sparse perennial vegetation (Asphodelus aestivus, Lycium shawii). In spring, after the winter rainy season, this habitat is covered with annual plants. Eucalyptus plantations (mainly Eucalyptus camaldulensis) were planted during the last 60 years along the dry streambanks to prevent soil erosion (180-330 trees per hectare). The soil cover in the tree plantations is mostly dry Eucalyptus leaf litter and a few perennial shrubs (species mentioned above).

Figure

Figure 2.1: The common non-crop habitats in the semi-desert agroecosystem of the north- western part of the Negev desert of Israel: A) Natural semi-desert habitat; B) planted Eucalyptus trees. (Photos by Itai Opatovsky)

Chapter III: Molecular characterization of the differential role of immigrant and agrobiont generalist predators in pest suppression* *based on: Opatovsky I, Chapman E.G., Weintraub P.G., Lubin Y. and Harwood J.D. 2012. Biological Control. 63:25-30.

Introduction

The vegetative homogeneity of the crop fields and the short duration of the crops can result in decreased herbivore diversity, thereby reducing the number of prey types available to potential natural enemies (predators and parasitoids) (Siemann et al. 1998). However, the same conditions can favor rapid population growth of certain herbivores that are adapted to crop conditions and increase the abundance of common agricultural herbivores. Therefore, agrobiont natural enemies that are adapted to crop conditions, namely that are found mainly in crop fields and that complete their life cycle within these fields, should prefer the common herbivore species. Conversely, natural enemies that move between crop and non-crop habitats during their life cycle may lack adaptations for particular prey, thereby allowing them to utilize prey resources in both habitats. The main hypothesis of this chapter is that agrobiont spiders will exhibit prey preference for species available throughout the crop season, while migrant species will have a more generalist predatory behavior and therefore include in their diet more ephemeral arthropods when these herbivore populations increase. In such a scenario, pest suppression is likely to be driven primarily by migration of predators from outside the crop.

In this chapter, I examine the consumption of naturally occurring pest and non-pest prey populations. I compared the presence of prey DNA in the gut contents of two spider taxa, Linyphiidae (sheetweb spiders) and Theridiidae (cobweb spiders, genus Enoplognatha), under open-field conditions. This method is useful for assessing predation intensity on specific prey types (Hoogendoorn and Heimpel 2001). The similar web characteristics and location would suggest that these spiders consume similar prey types, but little information is available on their foraging activities and very closely related species sometimes exhibit very different feeding patterns (Harwood et al. 2001, 2003, Romero and Harwood 2010).

Given the lack of available information, and likely importance of these predators in biological control, I examined the frequency of consumption of two major wheat pests in Israel: aphids (Hemiptera: Aphididae) and the Hessian fly (Diptera: Cecidomyidae, Maytiola destructor (Say)) by linyphiids and Enoplognatha spp.. Aphids cause minor levels of direct damage to wheat but mainly serve as vectors for wheat pathogens, such as the barley yellow

13 dwarf virus (Avidov and Harpaz 1969). Despite known predation on aphids by spiders and other predators (Sunderland et al. 1987, Harwood et al. 2004), some aphid species (e.g. Rhopalosiphum padi, Sitobiom avenae and Metopolophium dirhodum) are of low nutritional quality for spiders (Toft 1995, Toft 2005). The Hessian fly is the major pest of wheat in Israel, although it varies in abundance from year to year; eggs are oviposited at the base of stems and larvae feed in the nodes of the lower leaf blades, directly damaging the plant. It is a bivoltine species, appearing as an adult outside the plant only for 3-4 days (Stokes 1957, Avidov and Harpaz 1969). Additionally, wheat fields have high densities of other arthropods that may serve as important alternative prey. For example, springtails (Collembola) are very abundant in agricultural environments, especially in and on the soil, and are a preferred and nutritious prey group for many spiders (Bilde et al. 2000).

In this chapter, I examined the prey available to agrobiont linyphiids and immigrant Enoplognatha spiders. I used a DNA-based molecular method to determine the frequencies with which these predator groups prey on important wheat pests (aphids and Hessian flies) and on the most abundant alternative prey (springtails). I predicted that the agrobiont linyphiids will prefer the common prey in this agroecosystem (i.e. springtails), while migrating Enoplognatha, will exhibit a more generalist predatory behavior and therefore will feed more frequently on pest species. Because primers for Hessian fly were not available, I designed species specific primers for this prey type.

Material and methods

Maytiola destructor primer design

DNA was extracted from whole specimens of adult M. destructor using QIAGEN DNeasy Tissue Kits (QIAGEN Inc., Chatsworth, California, USA) following the manufacturer’s animal tissue protocol. Primers specific for M. destructor were designed for the mitochondrial cytochrome c oxidase subunit I (COI) region. This section was amplified using polymerase chain reaction (PCR) with general COI primers (LCO-1490 and HCO-2198; (Folmer et al. 1994). PCR reactions (50 μL) consisted of 1X Takara buffer (Takara Bio Inc., Shiga, Japan), 0.2 mM of each dNTP, 4 μL of template DNA, 0.2 mM of each primer and 1.25 U Takara Ex Taq™. PCR reactions were carried out in Bio-Rad PTC-200 and C1000 thermal cyclers (Bio-Rad Laboratories, Hercules, California, USA). The PCR cycling protocols were 94 °C for 1 min followed by 50 cycles of 94 °C for 50 s, 40 °C for 45 s, 72 °C for 45 s and a final extension of 72 °C for 5 min. Reaction success was determined by

14 electrophoresis of 10 μL of PCR product in 3% SeaKem agarose (Lonza, Rockland, Maine, USA) stained with ethidium bromide (0.1 mg/L). PCR reactions that yielded significant product were purified with QIAGEN MinElute PCR purification kit according to the manufacturer’s guidelines. Cycle sequencing reactions were carried out in both the forward and reverse directions in an ABI 9700 thermal cycler using the ABI Big-Dye Terminator mix (v. 3.0; Applied Biosystems, Foster City, California, USA).

Forward and reverse M. destructor COI sequences were aligned using AlignIR (v. 2.0, LI-COR Biosciences Inc., Lincoln, Nebraska, USA). These sequences were added to a multiple alignment of COI sequences of genetically related Diptera species obtained via BLAST searches of GenBank (Karlin and Altschul 1990, 1993) (Appendix 1). The multiple alignment was used to design a pair of M. destructor-specific primers (MDF: 5'- ATCAATTGCCCATACTGGTTC-3'; MDR: 5'- CTTCATGCGTCATTAATTTTGTCTAGTA-3') that amplify 180 bp of COI. To confirm primer specificity, they were tested with DNA extractions of starved linyphiids and Enoplognatha, and tested for cross-reactivity against 96 non-target arthropod, mollusc and nematode species (15 orders, 57 families; Appendix 2) collected in Kentucky alfalfa fields, and arthropod species collected in the wheat fields of Israel (12 orders; 51 morphospecies; Appendix 2). The morphospecies specimens are preserved in the Lubin laboratory (Ben- Gurion University) for further identification, if required.

PCR cycling parameters for the M. destructor primers were optimized and the optimal PCR cycling protocol for Takara reagents was found to be 94 °C for 1 min followed by 50 cycles of 94 °C for 45 s, 58 °C for 45 s, 72 °C for 30 s and a final extension of 72 °C for 5 min.

Analysis of prey consumption by spiders

To test for pest and alternative prey consumption, both immigrant (Enoplognatha spp.) and agrobiont (Linyphiidae) spiders were screened via prey taxon-specific primers. These predators were located visually in the wheat fields and collected from webs using a hand-held aspirator every two weeks between January 1, 2010 and April 15, 2010, and stored in 95% ethanol at -20 °C until DNA extraction. We tested for consumption of the following wheat pests: (1) M. destructor, with the primers described above, (2) aphid species, with general aphid primers (Aphid-413-F & Aphid-565-R which amplify 153 bp of COI DNA; Chapman et al. 2010), and (3) springtails using general springtail primers (Col4F & Col5R which

15 amplify 177 bp of 18S rDNA; Kuusk and Agusti 2008). DNA was extracted from spider abdomens using QIAGEN DNeasy Tissue Kits as described above. PCR reactions were carried out with Takara reagents as described above. The cycling protocols for the springtails primers were modified from protocols described by Kuusk & Agustí (2008) as follows: 94 °C for 1 min followed by 50 cycles of 94 °C for 45 s, 50 °C for 45 s, 72 °C for 45 s and a final extension of 72 °C for 5 min. Reaction success was determined as above.

This method yields the proportion of individuals that consumed each type of prey, which is an estimate of the strength of predation.

Evaluating potential prey

In order to evaluate the availability of potential prey to linyphiids and Enoplognatha in wheat fields, 60 sticky-traps were placed in situ for 24 h every two weeks during the growing season (December 2010 – May 2011, total 10 sampling sessions in two seasons of 16 and 8 hectares). The sticky-traps were constructed with transparent plastic sheets (7 cm2) covered with Rimifoot© polybutene trapping adhesive coated on both sides, and were placed horizontally two centimeters above ground to simulate spider webs. The traps approximated the size of the webs of linyphiids and Enoplognatha and were placed in positions typical of their websites, and thus were expected to capture prey available to these spider groups (after Harwood et al. 2001, 2003). The traps were separated by 10 meters from each other and from the field margins in order to reduce the influence of the field edge.

Statistical analysis

Pearson's Chi-square (χ2) (Statistica software v.10; StatSoft, Inc. 2011) was used to test for significant differences in the proportion of PCR positive results for aphid, springtails and Hessian fly feeding between spider groups, sexes and different life stages.

Results

Maytiola destructor primer validation

The primers designed to amplify M. destructor DNA did not cross-react with extractions of predators (linyphiids and Enoplognatha) or a suite of non-target arthropods, including species common in Israeli wheat fields (Appendix 2).

Field collected spiders

During the crop season, 150 Enoplognatha spp. (91 juveniles and sub-adults, 17 adult males and 42 adult females) and 159 linyphiids (56 juveniles and sub-adults, 34 adult males and 69 adult females) were collected (Table 3.1).

Prey consumption in the field

Significantly more Enoplognatha tested positive for aphid DNA compared to those screening positive for springtails (39% and 25% respectively; χ2 = 13.25, p < 0.0001, Figure 3.1) and a significantly higher percentage of linyphiids were positive for springtail DNA compared to those screening positive for aphids (75% and 16% respectively; χ2 = 38.25, p < 0.0001). Twenty individuals of Enoplognatha spp. (13%) and 17 linyphiids (11%) consumed both the aphids and the springtails. However, a high percentage of Enoplognatha spp. (49%) did not test positive for either prey type; this was not significantly different from the percent testing positive for aphid DNA (χ2 = 1.14, p = 0.29). Only one individual of the linyphiids showed consumption of the M. destructor.

Effect of age on prey consumption

The prey consumption patterns were similar in juvenile and adult stages of each species (Figure 3.2). However, Enoplognatha showed no significant difference between the proportions of individuals testing positive for springtails and aphids and not testing positive for both prey types (adults: springtails vs. aphid: χ2 = 2.77, p = 0.10; aphid vs. negative for both: χ2 = 1.19, p = 0.27; juveniles: springtails vs. aphid: χ2 = 0.80, p = 0.37, aphid vs. negative for both: χ2 = 2.71, p = 0.10). A significantly higher proportion of linyphiids consumed springtails than aphids, both as juveniles and as adults (adults: χ2 = 49.10, p < 0.0001; juveniles: χ2 = 21.28, p < 0.0001). Nine juvenile and five adult Enoplognatha spp. (10% and 15% respectively) and ten juvenile and seven adult linyphiids (10% and 13% respectively) consumed both aphids and springtails. Furthermore, a significantly higher proportion of juvenile linyphiids did not test positive for any prey as compared to adults (χ2 = 3.77, p = 0.05), but no such significant differences were found with aphid consumption alone (χ2 = 0.04, p = 0.85).

Effect of gender on prey consumption

A higher proportion of female Enoplognatha spp. consumed springtails and aphids than did males (χ2 = 7.05, p = 0.01; χ2 = 11.57, p = 0.001, for springtails and aphids respectively, 17

Figure 3.3), while more males contained no detectable prey DNA compared to females (χ2 = 11.45, p = 0.001). Within each gender group of Enoplognatha spp., there was no significant difference between the proportion screening positive for springtails vs. aphids (males: χ2 = 1.20, p = 0.27; females: χ2 = 3.46, p = 0.06). Within linyphiids, springtails were consumed more often than aphids by both sexes (males; χ2 = 76.41, p < 0.0001; females; χ2 = 39.29, p < 0.0001) and the proportion of individuals that consumed springtails did not differ significantly between sexes (χ2 = 0.05, p = 0.82). However, significantly more females than males consumed aphids (χ2 = 11.64, p = 0.001), but no significant difference was found in the proportion of individuals not testing positive for either prey type (χ2 = 0.0, p = 1.0) (Figure 3.3). Four female (19%) and no male Enoplognatha spp., and one male and 11 female linyphiids (3% and 16% respectively) consumed both aphids and springtails.

Abundance of potential prey

In total, 5,835 potential prey were collected from sticky traps. The most common orders of prey, in each collecting date, were springtails (non-pest arthropods, 68% of potential prey captured) and Diptera (20%). Of the Diptera, 50% were Nematocera, which included the Hessian fly. Seven other orders contributed <5% of the total prey: Thysanoptera, Hemiptera (with aphids as 1% of the total potential prey), Hymenoptera, Araneae, Coleoptera, Psocoptera, and Orthoptera, in order of decreasing abundance.

Discussion

The results showed that a higher percentage of Enoplognatha (immigrant spiders) consumed aphids compared to springtails. In contrast, linyphiids (agrobiont spiders) showed greater affinity to non-pest springtails, the more common prey type in this agroecosystem throughout the crop season. These results support our hypothesis that because agrobiont spiders complete their life cycle exclusively in crop fields, they are better adapted to consume prey types common in agricultural environments (e.g., springtails) than are immigrant web-builders. However, an explanation is required for the higher proportion of immigrant spiders that consumed aphids, a relatively scarce prey, when springtails were so abundant. A possible explanation is that Enoplognatha has a more generalized diet, typical of species inhabiting non-crop systems, and therefore they consumed aphids as their densities increased. Some aphid species are less preferred by some spider species and of lower quality than similar-size nutritious prey (e.g., D. melanogaster) (Toft 2005). However, aphids may provide some nutritional benefits to Enoplognatha, and therefore were selected by the spiders. An

18 alternative possibility is that springtails are the relatively preferred prey type for both groups of spiders, and that they compete for this resource. Springtails are abundant throughout the wheat growing season and have been found in high densities in all fields (personal observation). While this resource appears sufficiently plentiful to reduce competition between predators, springtail distribution is typically patchy in crop fields. This distribution pattern may induce competition for web location as opposed to direct competition for the prey (Harwood et al. 2001, Harwood et al. 2003), thus explaining the differences in prey consumption. Additionally, aphids might have been more abundant when spiders were collected for gut analysis than when sticky trap samples were collected, although this explanation is less likely as aphid densities in Negev wheat are generally low (Avidov and Harpaz 1969). Finally, the high proportion of spider individuals that did not show any positive results for markers could indicate that there are other prey types, which are not tested, over which the spiders compete.

Differences in prey consumption between these spider groups may be induced not only by competition, but also by web construction characteristics of the spiders. For example, web architecture may reflect differences in prey capture capabilities and thus in the type of prey caught in the web (e.g. flying or jumping insects). Nyffeler (1999) indicated that the theridiid diet contains a high proportion of flying insects (Diptera and Hymenoptera), that are frequently caught in the tangled structure of the web. In contrast, linyphiids were recorded to prey upon springtails and Aphididae (Nyffeler and Benz 1988) and this prey selection strategy may be due to their web structure, behavior and foraging strategy. Although linyphiids are web-builders, members of the subfamily Erigoninae (including the most abundant species in the wheat fields – Alioranus pastoralis (Cambridge)), actively forage on the ground and capture prey around the web, thereby increasing the likelihood of encountering springtails (Alderweireldt 1994). This foraging behavior, coupled with a relative prey preference for springtails, may explain the higher proportion of linyphiids that consumed springtails. The predation behavior of Enoplognatha spp. is unknown. The disproportionately large number of individuals that consumed aphids when their availability was low suggests that these spiders actively forage on the wheat stems where they would encounter more aphids.

Examining prey consumption by different life stages revealed interesting patterns and indicated that juvenile linyphiids were less reliant on aphids or springtails as compared to adults. These results suggest shifts in prey preference during the life stages of the linyphiids

19 with a lower predation rate on both of these prey types at the juvenile life stage, a behavior known in other species of spiders (Marc et al. 1999). However, this pattern was not evident in juvenile Enoplognatha, which showed a similar pattern of prey consumption as adults. Enoplognatha could be important in aphid suppression owing to their tendency to consume pest species both as juveniles and adults and to their apparent preference for aphids even when populations are low.

Particularly interesting were variations in prey consumption between male and female spiders. It is thought that male spiders spend limited time searching for food and consume less prey while they are actively seeking females (Alderweireldt 1994). In contrast, female spiders require more prey to maximize egg production. In Enoplognatha, the majority of males (~70%) did not screen positive for any of the three prey detected by PCR, which represented the majority of food items available to spiders. Surprisingly, linyphiids showed a similar pattern of prey consumption in males and females, as most of the individuals consumed springtails irrespective of gender. It may be that male Enoplognatha changed their pattern of prey consumption and consumed other types of prey or that they stopped feeding, but the results indicate that male linyphiids continued foraging and intercepting prey (springtails) on the ground when searching for females.

A number of factors could explain the low number of individuals that screened positive for Hessian fly DNA. Most significantly, the early appearance of adults of this pest in the fields occurred before spiders were sampled, and the late occurrence of theridiids in the crop (Gavish-Regev et al. 2008, Pluess et al. 2008) may significantly limit their capacity to provide any valuable biological control service for this prey. However, in years when Hessian flies are more abundant, it may be that these spiders are effective in reducing the Hessian fly populations especially during the second outbreak period. This clearly warrants further investigation.

In summary, theridiids (mainly Enoplognatha) migrating into the crop fields from the surrounding environment consume aphids more frequently than do agrobiont linyphiids. These results suggest the potential importance of the spiders migrating from outside the crop as a viable biological control agent in this wheat agroecosystem. In the following chapter, I examine whether this pattern of prey consumption is driven by competitive interactions among the spider species.

Table

Table 3.1: The total numbers of spiders captured by hand-collecting during the wheat season, by species, stage and sex.

Male ♂ Female ♀ Unknown

Linyphiidae

Alioranus pastoralis (O. P.-Cambridge) 9 28 - Bathyphantes extricatus (O. P.-Cambridge) 3 2 - Mermessus denticulatis (Banks) - 3 - Diplocephalus protuberans (O. P.- - 1 - Cambridge) Meioneta pseudorurestris (Wunderlich) 15 15 - Adult unknown spp. 7 20 - Sub-adults 10 11 - Juveniles - - 35

Theridiidae

Enoplognatha gemina Bosmans & Van 6 34 - Keer Enoplognatha macrochelis Levy & Amitai 11 8 - Enoplognatha sub-adults 25 10 - Theridiid juveniles - - 56

Figures

Figure 3.1: Comparison of the percentage of linyphiids and Enoplognatha from wheat (males, females and all age classes combined) screening positive for aphid (light grey column) and springtails (black column) DNA. The dark grey column represents the individuals that were not positive for any of the prey screened by PCR. Prey consumption was compared for different prey within and between spider taxa (Enoplognatha spp. and the linyphiids). The letters above the bars present significant differences between and within the spider groups; N= number of individuals.

Enoplognatha Linyphiidae

Figure 3.2: Effect of age class on the percentage of spiders from wheat screening positive for aphid (light grey column) and springtails (black column) DNA. The dark grey column represents the individuals that did not screen positive for any of the prey screened by PCR. Prey consumption was compared for different prey and age class within and between spider groups. The letters above the bars present significant differences among spider groups and age classes. N = the number of individuals in each bar.

Enoplognatha Linyphiidae

Figure 3.3: Differences between the frequency of male and female spiders from wheat screening positive for aphid (light grey column) and springtails (black column) DNA. The dark grey column represents the individuals that did not screen positive for any of the prey screened by PCR. Prey consumption for different prey was compared between genders within each spider group. The letters above the bars present significant differences. N = the number of individuals in each bar.

Enoplognatha Linyphiidae

Chapter IV: Niche separation in an ephemeral environment: prey consumption and competition in coexisting spider species in an agroecosystem

Introduction

Coexisting species of natural enemies in crop fields may interact in ways that influence their prey preference and pest suppression abilities. The interactions between them can be exploitation competition, in which the better competitor exploits the favored prey and reduces the feeding rate and fecundity of its competitor. For generalist predators, such as spiders, this type of competition can cause switching of prey preference by the weaker competitor to the less preferable prey in order to maximize its net rate of energy intake (Abrams 1983, Sih 1993). However, exploitation competition can occur over other limited resources, such as productive patches or sites for web construction. This interaction can lead to a change in web location within the micro-habitat or at larger scales (Wise 1995). Another type of interaction relevant for spiders is interference competition in which individuals directly influence each other’s resource utilization. This interaction also can lead to a change in web location within the micro-habitat or to dispersal from the habitat in order to reduce competition (Spiller 1984, 1986, Sabelis 1992, Wise 1995). Interference competition may result in intra-guild predation, in which the spider consumes other predators in the same guild thereby receiving nutrients from the other predator and reducing potential competition for food (Polis et al. 1989). Intra- guild predation is determined mainly by body size differences of the competitors; however, this phenomenon is considered less common in web-building spiders than in active hunters (Wise 1995).

The common web-building spiders found in the Negev wheat agroecosystem are the families Linyphiidae (primarily the species Aliornaus pastoralis (O. P. Cambridge 1872) and Trichoncoides piscator Simon 1884) and Theridiidae, mainly species of the genus Enoplognatha (E. gemina Bosmans & Van Keer 1999 and E. macrochelis Levy & Amitai 1981) (Gavish-Regev et al. 2008, Pluess et al. 2008). These spider groups use similar micro- habitats in wheat fields, where they build small, horizontal sheet-webs at the base of wheat stems, suggesting the potential for competition over resources such as prey or web-sites. In a previous study (chapter III), I used DNA gut-content analysis to test predation on springtails (Collembola) and aphids (Aphididae, Hemiptera). I showed that a higher proportion of linyphiids consumed springtails compared to the Enoplognatha, while more Enoplognatha

25 consumed aphids. Many aphid species are considered poor quality prey for spiders owing to the presence of feeding deterrent compounds (Toft 1995). This raises the question whether linyphiids and Enoplognatha in this system have different prey preferences, or if the observed differences are the result of niche separation due to competition over shared resources.

Linyphiids are agrobionts that complete their life cycle within crop fields, either remaining in the soil between seasons, moving among the different seasonal crops or moving into the field edge (ecotone) during harvest (Gavish-Regev et al. 2008, Pluess et al. 2008, Opatovsky and Lubin 2012). Species of Enoplognatha are immigrant spiders that enter crops each season from the surrounding desert environment. When Enoplognatha migrates into the crop, space for web construction could be a limiting factor, causing exploitation competition over web location or direct interference competition. Exploitation competition over prey is predicted at the beginning of the season when field productivity is low, and hence prey is likely to be limiting.

I investigated the interactions between the immigrant Enoplognatha and the agrobiont linyphiids. I hypothesized that the two spider taxa compete over prey or web location. In order to examine whether there is competition between the spiders, I calculated the competition coefficients based on a field survey. I estimated field densities of the two spider groups, their colonization pattern, and densities of their potential prey over the crop season to test whether the competition is over prey. I predicted that there would be a negative correlation between densities of the two spider taxa, indicating competition between them. In order to understand the type of competition and the resource they compete over, I conducted microcosm experiments, in which the prey consumption of A. pastoralis and E. gemina and their web location alone and with a potential competitor was recorded. I predicted that there would be changes in resource utilization when a competitor is present.

Materials and methods

Field survey: Estimating abundances of spiders and potential prey

Spiders and potential arthropod prey were collected on nine sampling dates in an 8.7 hectare irrigated field during the wheat season (December 2010-May 2011). .Sixty quadrates of 0.5m2,. separated 10 m from one another and from the field edge, Quadrates were searched visually and spiders were collected from their webs using a hand-held aspirator, and placed in vials. The height and area of each web was measured for each individual spider. In the

26 laboratory specimens were identified to the lowest taxonomic rank, spider life stage, body length and sex were recorded. and

Potential prey abundance was evaluated using small, web-sized, sticky traps (Harwood et al. 2001, 2003). In each quadrate, a single sticky trap consisting of a 7.5 cm2 transparent plastic sheet coated on both sides with polybutene trapping adhesive (Rimifoot©, Rimi Inc., Petach-Tikva, Israel) was placed horizontally, two centimeters above ground, to simulate a spider web. The traps were removed after 24 hr and the insects were counted and identified to order.

Microcosm experiments

I tested consumption rates of aphids and springtails with two species of spiders; immigrant theridiids and agrobiont linyphiids. The spiders were two common species collected in the wheat fields: the theridiid, Enoplognatha gemina and the linyphiid, Alioranus pastoralis. The spiders were brought to the laboratory, starved for few days (as indicated below) and used in the experiments. The aphid species, Schizaphis graminum (Rondani, 1852) (Hemiptera, Aphididae), was collected in the field and reared in the laboratory on wheat seedlings to create a colony. Springtail colonies Sinella curviseta Brook, 1882 (Collembola, Entomobryidae) were established from a laboratory stock (Department of Biological Sciences, Aarhus University, Denmark), due to lack of success in creating a colony of the native springtail species collected in the fields. The springtail colonies were maintained in plastic containers with plaster of Paris, and fed with baker’s yeast. All prey colonies were kept in a growth chamber (26±1oC, 12:12 L:D and about 45% RH).

Two microcosm experiments were conducted. In the first experiment, the microcosms were made of flowerpots (height 9 cm, radius 11 cm) topped with transparent plastic cylinders (height 20 cm). Wheat seedlings were grown in the microcosm three weeks prior to the experiment and reached a height of 20 cm by the time the experiment started. Spiders that were starved for one week before the experiment were added to the microcosms through a hole in the plastic container according to the following treatments: 1) no spiders (control), 2) one A. pastoralis individual, 3) one E. gemina individual , 4) two A. pastoralis 5) two E. gemina, 6) one individual each of A. pastoralis and E. gemina. The spiders were left in the microcosms for one week in a growth chamber (26oC, 12:12 L:D) to allow web building. On the day of the experiment, 20 springtails and 20 aphids from laboratory colonies were added to each microcosm. After three days, the microcosms were opened and the number of aphids

27 and springtails were counted by visually searching the wheat plants and by separating them from the soil using a fine sieve.

In the second experiment, the microcosms were larger (height 15 cm, radius 15 cm; topped with plastic cylinders of height 35 cm) and the seedlings were grown for four weeks before the experiment started. The spiders were starved for three days before they were added to the microcosms according to the following treatments: 1) no spiders (control), 2) one A. pastoralis individual, 3) one E. gemina individual, 4) two E. gemina individuals, 5) one individual each of A. pastoralis and E. gemina. After four days, ten aphids and ten springtails were added to each microcosm. Ten days after the prey was added, the numbers of aphids and springtails were counted visually and with a fine sieve and web height and size were measured. In this experiment, fewer prey were added and the experiment duration was longer in order to increase potential competitive interactions over prey.

Data analysis

Field survey: The colonization pattern of the spiders was identified by measuring the proportion of spiders of each taxon that: 1. colonized plots alone, 2. with other individuals of the same taxon and 3. with at least one individual from the other taxon. In order to test the effect of total prey density on patch occupancy of the two spiders groups, regression models of spider abundance on total prey abundance were constructed to obtain the slope of the interaction for each sampling date. Separately, the effect of the most abundant prey group, springtails, on spider density was also tested. Competition coefficients between the two spider taxa, Enoplognatha spp. and the linyphiids, were calculated for each sampling date by regressing the abundance per plot of one spider taxon against the abundance of the other (Hallett and Pimm 1979). Thus, the density of each of the spider taxa was tested once as a dependent variable and once as a predictor variable and the slope of the regression was taken as the competition coefficient. Early in the season, spider abundance was very low, and absence of individuals could not be taken as evidence of competition. Thus, plots that did not contain any individual of either taxa were not included in the regressions. Negative competition coefficient values indicate competition in the plots, and the more negative the value, the larger the effect of the competitor on the taxon representing the dependent variable.

In a second analysis, we removed the influence of potential prey abundance on the competition coefficients by using the residuals of a regression of spider abundance on the abundance of insects in the sticky traps in each plot as predictors to calculate the competition

28 coefficients (based on Rosenzweig et al. 1984). Linear regression was used to test spider characteristics that might affect the competition coefficients for each spider taxon: total web area, web height of each spider taxon, spider abundance, prey/spider abundance ratio, ratio between the average web sizes of the taxa, and the ratio between the average body sizes of the spiders of the two taxa. The effect of these factors on the competition coefficients was tested separately for the first part of the crop season (five sampling dates: December 29- March 16) and the second part of the crop season (four sampling dates: March 30- May 22). In order to determine if competitor presence influenced the web characteristics, the abundances of each spider taxon in each plot was regressed against web size and height in each sampling date. Also, the influence of the competitor on the spider’s web height, was determined for each spider taxon using ANOVA on plots with and without competitors on each sampling date.

Microcosm experiments: The effect of the treatment on the number of remaining aphids and springtails at the end of the experiment was tested using ANOVA and a-priori least squares comparisons of means. We used the following contrasts: 1) In order to evaluate prey preference, the reduction in number of prey was compared between treatments with presence of one spider individual and the control; 2) intra-specific competition was tested by comparing the reduction in prey numbers in treatments with one individual and two individuals of the same species; and 3) inter-specific competition was tested by comparing the reduction in prey numbers in treatments with two individuals of the same species and two individuals of different species. Survival of the spiders in the different treatments was compared using χ2 goodness of fit test. Finally, web size and height were compared between the two spider species in the different treatments using ANOVA.

All analyses were performed using Statistica software v.10 (StatSoft, Inc. 2011).

Results

Spider densities in the field

In total, 160 theridiids (Enoplognatha spp.) and 229 linyphiids were collected in the field during the crop season. Juvenile theridiids entered the fields at the beginning of the season and were present throughout the crop season. Sub-adults peaked in January-February and adults in February-March (Figure 4.1A), thus the juveniles present in the second half of the season could be either migrants or the result of local reproduction. Linyphiids first appeared as adults at the beginning of the season and completed one full life cycle within the field

(Figure 4.1B). The first adult peak occurred in January and a second, larger one in March. The theridiids had larger body sizes and web area compared to the linyphiids until the middle of the wheat season (March), while in the second half of the season, when juvenile theridiids predominated in the field, they were smaller, they had smaller webs and their webs were lower than those of the linyphiids (Figure 4.2A, B, C). Prey abundance increased until March and then decreased until the end of the crop season. The lowest prey abundance was two insects per sticky trap per day, while the highest was over 20 per trap. Springtails constituted 11 to 83% (average 58%) of the total prey over the season.

During the first half of the wheat season the spider density was low: 0.7 spiders per square meter with a maximum of five spider individuals per plot. The theridiids were found mostly as one individual in a plot and the linyphiids were found in similar frequencies in plots with or without other individuals (Figure 4.3 A and B). At the second part of the wheat season, the spider density was higher, 1.2 spiders per square meter, with a maximum of seven spider individuals per plot. During this part of the crop season, both the theridiids and the linyphiids were found in similar frequencies in plots with or without other individuals.

Measuring competition: field survey

There was no significant correlation between the total prey abundance or of springtail abundance alone and the spider abundances on all sampling dates (Figure 4.4A, B; p>0.05 for all regressions). The competition coefficients, however, were negative for almost all sampling sessions, showing that there was competition between theridiids and linyphiids, and each group had a negative effect on the abundance of its competitor (Figure 4.5A). After removing the effect of prey abundance by using the residuals of the regression of spider abundance on the total potential prey abundance, the competition coefficients were essentially unchanged (Figure 4.5).

Competition coefficients were not influenced by the characteristics measured (total web area, spider abundance, web height of each spider group, prey/spider abundance, web size ratios and body size ratio, p>0.05 for all regressions), with the exception of the prey/spider abundance ratio, which lowered the competition coefficient of the linyphiids in the second period of the wheat season (Appendix 3). Thus, in plots with more prey per spider the theridiids had a negative effect on linyphiid density. There was no significant effect of spider abundance on web characteristics of either spider group (Appendix 4) and no significant effect of competitor presence on spider web height (Appendix 5).

Testing competition: microcosm experiments

In both microcosm experiments aphids, being parthenogenetic and viviparous, reproduced in the microcosms, but springtails did not reproduce during the experiments. In the first microcosm experiment, the overall effect of treatment was significant for the springtails but not for the aphids (springtails: F(df=5)=3.93, p=0.007; aphids: F(df=5)=1.47, p=0.22; Figure 4.6). A single E. gemina or A. pastoralis reduced the number of springtails relative to the control (Figure 4.6; t=2.69, p = 0.01; t=3.82, p<0.01, respectively), but there was no additive effect of an additional predator: when two spiders were present, springtail abundance at the end of the experiment did not differ from the treatments with one spider. The single E. gemina reduced the number of aphids compared to the control (Figure 4.6; t=2.12, p = 0.04) and again, there was no additive effect of an additional predator.

In the second microcosm experiment, similar to the first experiment, the effect of treatment was significant for the springtails but not for the aphids (springtails: F(df=4)=6.02, p=0.001; aphids: F(df=4)=2.43, p=0.07; Figure 4.7). At the end of the experiment, a single E. gemina reduced the numbers of both springtails and aphids relative to the control (Figure 4.7; t=3.53, p < 0.01; t=2.21, p=0.03, respectively) and there was no additive effect of additional predators on prey reduction for either prey type. Alioranus pastoralis survival did not differ 2 when E. gemina was present and when they were alone (χ (df=1)=0.15, p=0.7), and E. gemina survival was also not influenced by the presence of competitors of either species (with A. 2 2 pastoralis: χ (df=1)=0.03, p=0.9; with E. gemina: χ (df=1)=1.36, p=0.25) (Appendix 6).

The ANOVA analysis of differences in the web area between the treatments showed that the web area of the A. pastoralis was smaller than that of the E. gemina and that neither spider species changed their web size when a competitor was present (F(df=4)=8.28, p=0.003, post-hoc comparison between A. pastoralis and E. gemina were p<0.05, Figure 4.8). The analysis of web height showed that A. pastoralis webs were lower than those of E. gemina and the web height of A. pastoralis did not change in the presence of competitors. The height of the E. gemina webs, however, increased in the presence of another competitor of either species (F(df=4)=20.69, p<0.0001, post-hoc comparisons between A. pastoralis and E. gemina and between E. gemina in all treatments were <0.05, Figure 4.8) (Appendix 6).

Discussion

The field survey revealed that agrobiont linyphiids and immigrant Enoplognatha species (Theridiidae) are competing, especially at the beginning of the wheat season, as indicated by

31 the negative competition coefficients. The microcosm experiments showed that both species reduced springtail abundance, suggesting that springtails, which are the most abundant prey in the wheat fields, are a food resource for both linyphiids and theridiids. These results are consistent with the gut content analyses of these spiders, in which springtail DNA was found in both linyphiids and theridiids collected from the wheat fields (Opatovsky et al. 2012). Nevertheless, the field survey also showed that the spiders did not occur in higher densities in plots with greater abundance of springtails or of total prey. This contrasts with other studies in which linyphiid densities were shown to increase with springtail abundance in wheat at the plot level (Harwood et al. 2001, 2003).

In our system, prey was not a limiting factor: even at the period of the lowest prey abundance, more potential prey were available than could be utilized by an individual spider. Nyffeler and Benz (1988) evaluated the prey capture of linyphiids in temperate-zone wheat fields (by observation) as 0.8 prey per spider per day (mostly springtails and aphids). We found that the lowest abundance of potential prey/spider in the wheat fields was two prey per spider per day. This conclusion receives further support from the observation that the competition coefficients did not change after removing the effect of prey density. In the microcosm experiments as well, springtails were not depleted: two springtails on average remained even after 10 days of the second experiment, where we provided initially only 10 springtails per microcosm. These results are consistent with the prey consumption measurements of Nyffeler and Benz (1988). We concluded that springtails, which are very abundant throughout the wheat season, are a sufficient food resource for the population of spiders in this environment and that competition for prey does not explain the negative competition coefficients observed in the field.

Negative competition coefficients could be explained by competition over a different limiting resource, namely sites for web building; direct interference competition. The significant negative competition coefficient values were calculated at the beginning to middle of the wheat season: during this period, adult linyphiids are already found in the fields while juvenile theridiids are migrating into the fields from the surrounding environment and the density of both groups of spiders is increasing. We suggest that as the spider populations grow during this time, competition over sites for web construction increases. We did not test for competition over websites explicitly, and it may be that the spiders reduce competition for websites by avoiding patches that are colonized by other spiders or that there is competition at the time of site selection. This avoidance behavior is seen mostly by the theridiids at the

32 first half of the wheat season and could explain the negative competition coefficients early in the season.

The microcosm experiments provided evidence for interference interactions between the spiders. First, there was no additive effect of the presence of another spider individual on the reduction in prey abundance at the end of the experiment. Several authors have used the lack of such an additive effect to indicate the occurrence of interference interactions (Ferguson and Stiling 1996, Lang 2003, Snyder and Ives 2003). Often such interference competition in generalist predators is due to intra-guild predation, but in our experiments we did not see any evidence of intra-guild predation. Second, E. gemina built their webs higher on the plant when a competitor was present. Herberstein (1998) found that a vertical change in web location reduced competition between spiders and changed the prey composition available to the competing spiders. In our field survey, web height changed over the season for both theridiids and linyphiids, but these changes were unrelated to densities of either spider group or both groups combined. Also, the presence of a competitor did not affect the web height of the spiders at the field scale. Thus, in the low density field populations, spatial separation on a horizontal scale may be sufficient to prevent competition for websites.

The microcosm results showed that E. gemina consumed aphids even when springtails were available as well, and when there was no competitor. Thus, aphids are an acceptable prey for E. gemina and these different prey preferences could result in differentiation in the realized niches of the two spiders, allowing them to co-exist in this environment. Contrary to accepted views that agrobiont predators are phenologically adapted to the agricultural environment and therefore will be better suppressors of pest herbivores (Samu and Szinetar 2002, Welch et al. 2011), we found that the spider species that fed on aphids was the immigrant species, E. gemina. We suggest that the immigrant theridiids are generalists and consume both springtails and aphids, while the agrobiont linyphiids are specialists on the most common prey in this environment, namely springtails. As a prey generalist, E. gemina can change its web location on the plant in the presence of a competitor and by doing so take advantage of other prey types (Herberstein 1998). Alioranus pastoralis, which specializes in epigeal prey such as springtails, built sheet webs at ground level and therefore did not change the web location when a competitor was present. Some erigonine linyphiids (subfamily Erigoninae) leave their sheet-webs to search for prey (Alderweireldt 1994). Alioranus pastoralis belongs to this subfamily and its response to the presence of competitors may be to change its foraging behavior, i.e. actively forage on the ground, rather than the web height.

The reduction in aphid numbers in the microcosm experiments could also be explained by a change in aphid behavior as well as by direct predation by E. gemina. Aphids have several predator avoidance mechanisms, e.g. behavioral (dropping behavior), morphological, social and chemical (Losey and Denno 1998b). These induced prey defenses are costly and may reduce survival or reproduction rate (Nelson 2007), and indeed, behavioral responses alone were shown to lower aphid survival (Nelson et al. 2004). In our experiment, E. gemina whose webs were placed higher on the plant may have induced a behavioral response in the aphids and reduced their ability to reproduce compared to the control. In summary, our study shows that the mechanisms underlying pest reduction by natural enemies in a simple agricultural system may be highly complex due to competition between predators that share similar niches.

Figures

Figure 4.1: Densities of the two spider taxa (A) immigrant Theridiidae, Enoplognatha spp. and (B) agrobiont Linyphiidae, and abundance of potential prey in quadrates in a wheat field over the crop season in the Northern Negev, Israel. The vertical dotted line separates early and late periods in the cropping season, corresponding to the increasing and decreasing periods of prey abundance, respectively. The solid black line represents the adult spiders, the broken black line represents the sub-adults, the dotted black line represents the juvenile and the solid grey line represents the prey.

Figure 4.2: (A) Average spider body length (mm), (B) web area (cm2) and (C) web height above ground (cm) of the immigrant Enoplognatha (grey line) and agrobiont linyphiids (black line). The error bars represent the standard errors. The vertical dotted line separates the early and late periods in the crop season (see Figure 4.1).

Figure 4.3: Proportion of Enoplognatha (A) and linyphiids (B) that colonize the plot alone (solid black line), together with other individuals from the same taxon (dotted black line) or together with individuals from the other taxon (solid grey line). The vertical dotted line separates the early and late periods in the crop season (see Figure 4.1).

Figure 4.4: Slope of regressions of total spider abundance on total prey abundance (A) and total spider abundance on springtails (Collembola, Entomobryidae) abundance (B) at each sampling date. Circles indicate the regression slopes for linyphiids and squares indicate the slopes for Enoplognatha spp. None of the regressions were significant (p>0.05). The vertical dotted line separates the early and late periods in the crop season (see Figure 4.1).

Figure 4.5: Competition coefficients for the two spider taxa (Linyphiidae – squares, Enoplognatha spp. – circles) at each of the sampling dates (A), and competition coefficients after removing the effect of prey abundance on the spider abundance by regression (B). Negative coefficients indicate competition and positive ones indicate preference for the same patches. Filled squares and circles represent statistically significant competition coefficients (p<0.05). The vertical dotted line separates the early and late periods in the crop season (see Figure 4.1).

Figure 4.6: Experiment 1: The number of prey individuals remaining at the end of the experiment. Black bars represent the number of aphids and white bars the number of springtails. The treatments are: 1) no spiders (control), 2) one individual of Alioranus pastoralis (Linyphiidae) (Ap), 3) one individual of Enoplognatha gemina (Theridiidae) (Eg), 4) two individuals of A. pastoralis (Ap+Ap), 5) two individuals of E. gemina (Eg+Eg), 6) one individual of A. pastoralis and one individual of E. gemina (Ap+Eg). The error bars represent standard errors. The asterisks indicate significant a-priori comparisons.

Figure 4.7: Experiment 2: The number of prey individuals remaining at the end of the experiment. Black bars represent the number of aphids and white bars represent the number of springtails. The treatments are: 1) no spiders (control), 2) one individual of Alioranus pastoralis (Linyphiidae) (Ap), 3) one individual of Enoplognatha gemina (Theridiidae) (Eg), 4) two individuals of E. gemina (Eg+Eg), 5) one individual of A. pastoralis and one individual of E. gemina (Ap+Eg). The error bars represent standard errors. The asterisks indicate significant a-priori comparisons.

Figure 4.8: Web area (cm2, white bars) and web height above ground (cm, black bars) of Alioranus pastoralis (Linyphiidae) (Ap) when alone or with Enoplognatha gemina (Theridiidae) (+Eg); and of E. gemina (Eg) when alone, with A. pastoralis (+Ap) and with another E. gemina individual (+Eg). The error bars represent standard errors. The letters above the bars show significant differences (p<0.05): capital letters are comparisons of web area and lower case letters indicate web height comparisons.

Chapter V: Differences in habitat use and colonization pattern as a mechanism for competition avoidance

Introduction

Agroecosystems are composed of various habitat types that differ in their biotic and abiotic conditions at various scales. Agricultural fields are ephemeral, usually with a period devoid of crop or vegetation cover, and a seasonally or annually changing crop type. These changes affect the field habitat structure and the landscape composition both temporally and spatially. The non-crop habitats, on the other hand, are stable with higher diversity available for the herbivore and predator populations in this ecosystem. These habitats provide refuges in times of disturbance, alternative sources of food and breeding sites, therefore allowing maintenance of more permanent population of arthropods (Wissinger 1997, Landis et al. 2000).

Natural enemies and their prey differ in the temporal and spatial use of habitats in the agroecosystem. Some species are adapted to a specific habitat type and must complete their life cycle in this habitat. Species that are adapted to crop fields (agrobiont species), which are disturbed habitats in this environment, usually have to disperse between fields in order to complete their life cycle or they have a short life cycle that is correlated with the crop season (Southwood et al. 1974). Other species in the agroecosystem are more generalist in their habitat preference and therefore disperse among the different habitats during the year. Most of natural enemies and herbivores are attracted to the high productivity of the crop fields and migrate in at the beginning of the season from the surrounding environment (Tscharntke et al. 2005). Some of these species do not maintain year-round resident populations in the fields and their populations are dependent on immigration of individuals from the surroundings. For example, bridled skinks (Trachylepis vittata, Scincidae) are attracted to wheat fields in the semi-desert agroecosystem due to the high density of prey, but they do not survive the harvest of the crop, causing these fields to be an ecological trap for them (Rotem et al. 2013). Other generalist species emigrate back into the surrounding environment when the field productivity decreases due to harvest (Wissinger 1997, Rand et al. 2006). For example, Lygus bugs disperse during the annual harvest into nearby cotton fields together with their natural enemies (damsel bugs Nabis spp., big-eyed bugs Geocoris spp. and lacewings Chrysoperla spp.). At the beginning of the next crop cycle, they migrate back into the alfalfa fields (Sivakoff et al. 2012).

The habitat use and the dispersal abilities of different species can affect colonization dynamics, species interactions and species composition at larger scales (Leibolt et al. 2004). The composition of source habitats in the environment influence the species will be the first colonizer of the crop field, and the first species to colonize a patch can determine the success of subsequent colonizing species through competitive interactions (Sutherland 1974). These interactions will ultimately affect the distribution and abundance of the species in the different habitats of the agroecosystem.

Spiders are a major component of the guild of natural enemies in agroecosystems. Spiders are known to differ in their habitat preference and can be divided into habitat generalists or crop specialists (agrobionts) (Samu and Szinetar 2002). In the semi-desert agroecosystem of the northern Negev of Israel, the spider assemblage in wheat fields is dominated by three families (Gavish-Regev et al. 2008, Pluess et al. 2008). Species in two of the families (Gnaphosidae and Theridiidae – mainly Enoplognatha species) are generalists in their habitat preference and are attracted to the agricultural habitats, which have high productivity compared to the natural semi-desert environment. Individuals in these groups migrate into the crop fields from the surrounding environment (Gavish-Regev et al. 2008). Most species in the third dominant family, the Linyphiidae, are habitat specialists and are found almost only in crop fields. They do not disperse into the semi-desert natural environment and are unable to survive in that habitat, which is a hostile environment for them (Gavish-Regev et al. 2008, Pluess et al. 2008, Opatovsky and Lubin 2012). Both the immigrant Enoplognatha and agrobiont linyphiids are web building spiders that share the same micro-habitats in wheat fields and therefore are presumed to compete over the same resources.

In the previous chapters, I investigated competition interactions between these spiders. I found that linyphiids and Enoplognatha compete at the beginning of the crop season. In spite of differences in prey consumption, prey is not the limiting resource for these spiders. It may be that the spiders compete over locations for web construction, as seen at a small scale in laboratory experiments. Another hypothesis is that the Enoplognatha avoid occupied patches and therefore reduce competition at the field scale. Here, I suggest that the different habitat use by the linyphiids and Enoplognatha provides a mechanism for competition avoidance between these spiders at a larger scale.

The hypothesis of this part of my work is that the differences in temporal-spatial habitat use by these spider taxa affect their colonization of fields at the beginning of the crop

44 season and later also spatial overlap between them. I predicted that the agrobiont linyphiids will be the first to colonize the wheat fields from other agricultural fields, and therefore they will force the Enoplognatha to find vacant patches. In order to test this prediction, I sampled the two spider taxa in wheat fields and in adjacent non-crop habitats and recorded the changes in abundance of the linyphiids and Enoplognatha spp. during and between the wheat seasons in these habitats.

Materials and methods

Study sites

Spiders were sampled in 14 sites that were composed of wheat fields adjacent to different alternative habitats. Six sites were adjacent to tree plantations (“planted trees”), four sites were adjacent to natural semi-desert habitat (“semi-desert”) and four sites were adjacent to a summer crop (“sunflower”) (Figure 5.1). The tree plantations were composed of Eucalyptus trees (mainly Eucalyptus camaldulensis) that were planted along the dry river-banks to prevent soil erosion (180-330 trees per hectare, I.O. unpublished). The soil cover in this habitat is mostly Eucalyptus leaf litter and sparse perennial vegetation (Asphodelus aestivus, Lycium shawii). The semi-desert habitat is a loess soil plain with annual vegetation, mainly after the rainy season, and perennial vegetation (as above).

Spider sampling

Four samples were taken during the wheat season (January, February, April and November - 2011) and three samples between the wheat seasons (June, August and September - 2011). The spiders were sampled using pitfall traps and a suction device. At each site, 8 pitfall traps were located 50 m from the field edge into the field and 50 m into the adjacent habitat (total of 16 traps for each site). The 8 traps were aligned in a line parallel to the field’s edge in both adjacent habitats. The traps were separated by 3 m from each other. The traps were 10 cm deep with an opening diameter of 9 cm, buried in the ground so the rim was level with the ground. Each trap contained 100 ml of 50% ethylene glycol with a drop of detergent to break the water surface. The traps were open for a week each sampling date.

The suction samples were taken with a converted leaf blower (STIHL SH 55) that had the intake and exhaust ports reversed. The intake port was fitted with a 10 cm diameter hose into which fine mesh nylon bags were inserted to collect the samples. The sampling was done along five transects in each habitat, 50 m from the habitat edge. Each transect was 20 m long

45 and the nozzle of the suction device was lowered for 10 s at each 1 m along the transect (total of 20 suctions per sample and 10 sample per site). After each transect the content of the sleeve was emptied into a bag that was cooled until the spiders were separated using a hand aspirator. The spiders were stored in 70% ethanol until they were identified. Adult spiders were identified to species level and immature individuals were identified to genus (Enoplognatha) or family level (Linyphiidae).

Data analysis

In order to understand the overall patterns of abundance of the two taxa in each habitat throughout the year, the abundance of the adults and juveniles in the wheat fields and non- wheat habitats were plotted for each sampling date. To evaluate the use of non-crop habitats for these two taxa, I tested the effect of the habitat type (planted trees, semi-desert, summer crop and adjacent wheat fields) on spider abundance. The abundance of spiders was compared between habitats using Kruksal-Wallis non-parametric ANOVA in all seasons combined and in each season (wheat season and between the wheat seasons), using the average number of spider individuals per trap or suction sample. For each comparison, I chose the sampling method that collected the highest number of spiders (see Appendix 7). Samples from the two methods were not combined because on some dates samples from only one method were available. Significant effects of the habitat type on spider abundance were further examined with post-hoc tests for differences between pairs of habitats using pairwise Wilcoxon rank sum test with Bonferroni corrections. A similar procedure was used to analyze habitat use of the juvenile stages alone. The analysis was done at genus or species level for these two spider groups (Linyphiidae and Enoplognatha) using R software (Team R, 2010).

Results

Overall, 108 Enoplognatha and 200 linyphiid individuals were collected using the two sampling methods. With the following results: 54 Enoplognatha and 122 linyphiid individuals were collected in wheat fields (3% and 8% of the total individuals collected in wheat fields, respectively); 17 Enoplognatha and 15 linyphiid individuals were collected in Eucalyptus plantations (1% each of the total individuals collected in Eucalyptus, respectively); 36 Enoplognatha and 18 linyphiid individuals were collected in natural semi- desert habitats (3% and 1% of the total individuals collected in semi-desert, respectively); and one Enoplognatha and 45 linyphiid individuals were collected in sunflower fields (0.1% and 8% of the total individuals collected in sunflower fields, respectively).

Linyphiidae – The linyphiids were collected mainly using pitfall traps. No juveniles were found in either the pitfall traps or the suction samples. The main species found in this family were Alioranus pastoralis (O. P. – Cambridge 1872) (28% of the adult linyphiid individuals in the wheat fields) and Trichoncoides piscator Simon 1884 (22%). In general, the linyphiids were found in higher abundance in wheat fields adjacent to trees than in the tree habitat (Table 5.1). Both linyphiid species were abundant in the wheat fields during the growing season and their populations decreased at the end of the season (Figure 5.2A,B). At the end of the wheat season, and especially following harvest, T. piscator populations increased in the non-wheat habitats (Figure 5.2B).

Alioranus pastoralis was found both in wheat fields and in the open habitat only during the wheat season. This species was not recovered from any of the sampled habitats outside the wheat season (Table 5.1, Figure 5.3A). Trichoncoides piscator occurred in both planted trees and the wheat fields adjacent to them during the wheat season, and between seasons, it was found in fallow wheat fields adjacent to planted trees and in sunflower fields (Table 5.1, Figure 5.3B).

Theridiidae – Adult Enoplognatha were collected in pitfall traps and juveniles mainly in suction samples (Appendix 6). Juvenile Enoplognatha were abundant at the beginning of the wheat season in the wheat and non-wheat habitats, followed by an increase in adult numbers in both wheat and non-wheat habitats (Figure 5.2C). Adult numbers dropped at the end of the wheat season and neither juveniles nor adults were collected between the crop seasons.

The main species of this genus were E. macrochelis and E. gemina, but there were not enough individuals of each species of Enoplognatha alone to test for habitat preference (33 individuals of E. gemina and 29 individuals of E. macrochelis). Adult Enoplognatha were found in the semi-desert habitat and in wheat fields adjacent to semi-desert during the wheat season, and in lower abundance in the planted trees and the adjacent wheat fields (Table 5.2, Figure 5.3C). Juveniles were collected in all of the above habitats in similar numbers (Table5.2, Figure 5.3D).

Discussion

Overall, spider abundance was low in our samples, as is typical of these desert agroecosystems (Pluess et al., 2008; Opatovsky et al., 2010; Opatovsky & Lubin 2012). By comparison, cereal fields and adjacent grasslands in temperate regions of Europe have

47 abundances several times greater (e.g., Schmidt and Tscharntke, 2005; Schmidt-Entling and Döbeli, 2009). This low abundance in desert agroecosystems makes it difficult to detect significant patterns in the spider’s distribution. Moreover, the low abundance of juveniles of the two taxa makes the location of reproduction of these spiders elusive. I observed that linyphiids lay eggs in the wheat fields and Gavish-Regev et al. (2008) suggested that linyphiid eggs might survive in the soil until the next wheat season. Gavish-Regev et al. (2008) found that theridiid juveniles, primarily Enoplognatha species, immigrated into Negev wheat fields at the beginning of the crop season, most likely by ballooning, as they appeared simultaneously throughout the field. They found no adult females in the fields and concluded that the species did not reproduce in the wheat fields by the time the crop was harvested in early March. However, in this study the wheat season extended to May, and both adults and juveniles were present in the fields at this time.

Many linyphiids species are considered crop specialist (agrobionts). In the semi-desert agroecosystem of Israel most of the species were found exclusively, or in higher abundance in the wheat fields as compared to the natural semi-desert environment (Pluess et al. 2008). Agrobiont spiders need the constant cover of annual crops in order to complete their life cycle or to colonize the wheat fields at the beginning of the season. Nevertheless, Pluess et al. (2010) did not find a positive correlation between the percentage of area covered with crop fields and linyphiid abundance in the fields. My data suggest that Trichoncoides piscator moves into the sunflower fields at the end of the wheat season and these fields provide a refuge for this species for part of the inter-wheat season. Most of the linyphiids do not disperse to the semi-desert habitat after the wheat harvest and do not survive in the harvested wheat fields (Opatovsky and Lubin 2012). Therefore, the summer crops provide important refuge for T. piscator between wheat crop seasons and likely a source for dispersal.

Although T. piscator appears to be strict agrobiont, the most common linyphiids species, Alioranus pastoralis, showed a different pattern of habitat use. Alioranus pastoralis, was found in the wheat fields but also, in lower abundance, in the semi-desert habitat. This species appears as adults in the wheat fields at the beginning of the crop season (see also chapter IV) but their source habitat is not clear. On one hand, the A. pastoralis population in the wheat fields may be derived from eggs that were laid in the soil, survived the summer in and hatched in the bare fields before the next wheat season, as suggested by Gavish-Regev et al. (2008). On the other hand, adults may migrate from small populations present in the semi- desert habitat and then proliferate in the wheat fields during the wheat season. If A.

48 pastoralis, does not survive the harvest and becomes extinct locally, the wheat fields could be ecological traps for this species.

Enoplognatha species are generalists in their habitat preference and use non-crop habitats during part of their life cycle (Pluess et al. 2008). The abundance of juvenile Enoplognatha increased at the beginning of the crop season both in the wheat fields and the non-wheat habitats and this was followed by an increase in the sub-adults and adults in both habitats (see also chapter IV). The high abundance of Enoplognatha in natural semi-desert habitats during the crop season suggests that these habitats serve as a source for dispersal into the wheat fields during the crop season (as suggested also by Gavish-Regev et al. 2008). However, the lack of any Enoplognatha sampled in any of the habitats during the fallow season is puzzling. It may be that they aestivate in concealed locations as juveniles or sub- adults or they remain in the ecotonal vegetation (which was not sampled here) until the next crop.

The differences in habitat use of these common species shed light on the mechanisms of competition avoidance at a larger scale. Although Gavish-Regev (2008) found that the linyphiids appear in the wheat fields before the theridiids, in my study I found that the juvenile Enoplognatha and adult T. piscator colonized the wheat fields simultaneously. It may be that these spiders have better dispersal abilities that allow them to colonize vacant patches in the wheat fields and therefore to dominate the web-building spider guild at the beginning of the season. This process is known as a “priority effect” in which the presence of one species decreases the colonization ability of another species and thus may determine the local species distribution (Sutherland. 1974). In chapter IV I found that the strongest competition between the Enoplognatha spp. and the linyphiids is at the beginning of the crop season and apparently this competition is mainly between Enoplognatha spp. and T. piscator. However, T. piscator occurred in lower abundance than the Enoplognatha and therefore may not significantly reduce the abundance of available patches for colonization by the theridiids. Later in the season A. pastoralis entered the wheat fields, suggesting a different pattern of dispersal and colonization by this spider. At this time during the crop season the Enoplognatha are adults and much larger than the adult linyphiids that enter the fields, therefore the competition between these spider species is reduced (as seen also in the lower competition coefficients, chapter IV). The differences in habitat use together with differences in dispersal abilities (which should be further investigated) suggest a mechanism for niche separation at the field scale. This mechanism is presumably very important for competition

49 avoidance in ephemeral environments, where recolonization of vacant patches occurs every crop season.

Tables

Table 5.1: Habitat preference of the main spider groups (families, genera and main species) between the wheat fields and adjacent alternative habitats (semi-desert habitat, planted trees, summer crop) during and between the wheat seasons. Significant effects are marked in bold.

Group Factor H(df) p Significant differences

Linyphiidae Season 9.22(1) 0.002 Wheat season

Habitat 17.93(5) 0.003 Wheat adjacent trees>trees (0.04)

Habitat (wheat season) 11.16(3) 0.01 Wheat adjacent trees>trees (0.03)

Habitat (between seasons) 13.68(5) 0.02 -

Alioranus pastoralis Habitat (wheat season) 7.5(3) 0.06

Trichoncoides Season 5.77(1) 0.02 Between seasons>wheat season piscator

Habitat 23.13(5) <0.001 Sunflower>open (0.01) Sunflower>trees (0.01)

Habitat (wheat season) 7.61(3) 0.05

Habitat (between seasons) 3.45(5) 0.63

Theridiidae

Enoplognatha Season 14.67(1) <0.001 Wheat season>between seasons

Habitat 13.15(5) 0.02 Wheat adjacent to semi- desert>trees (0.03)

Habitat (wheat season) 7.88(3) 0.04 Wheat adjacent to semi- desert>trees (0.03)

Semi-desert>trees (0.03)

Habitat (between seasons)

Enoplognatha Habitat (wheat season) 1.0(3) 0.80 juvenile

Figures

Figure 5.1: Distribution of the 14 sampling sites in the northern Negev, Israel. Black circles represent fallow wheat fields adjacent to sunflowers fields, gray circles represent wheat fields adjacent to desert habitats, and white circles represent wheat fields adjacent to Eucalyptus trees. Two wheat fields adjacent to Eucalyptus trees (dotted circles) were irrigated during the crop season. Agricultural settlements are marked with stars.

Figure 5.2: Average number of individuals per pitfall trap or suction sample for A) Alioranus pastoralis, B) Trichoncoides piscator, and C) Enoplognatha. The black line represents wheat fields and the grey line, non-wheat habitats. The solid line represents adult and sub-adult Enoplognatha spp., the dashed line represents juveniles. The vertical dotted lines separate the wheat growing season (November-May, represented also by the horizontal black bar) and the fallow season (June-October).

Figure 5.3: Average number of individuals per pitfall trap for A) Alioranus pastoralis, B) Trichoncoides piscator, C) Enoplognatha, and suction sample for juvenile Enoplognatha (D), according to the different habitat types (WT – Wheat adjacent to tree plantations, WN – Wheat adjacent to Natural semi-desert, WS – Wheat adjacent to Sunflower, T – Tree plantations, N – Natural semi-desert and S – Sunflowers). The black bars represents the wheat season and the grey bar represent the period between the wheat seasons. The error bars represent standard error and the letters above the bars represent statistical significant between the habitats for each season (capital letters – differences at the wheat season, lower-case letters – differences between the crop seasons).

Chapter VI: General discussion

Knowledge of the interactions between potentially competing species is essential for understanding how communities are structured. Based on this work I can suggest a conceptual model for a complex mechanism of niche separation in ephemeral environments (Figure 6.1). According to the field survey, agrobiont linyphiids and immigrant Enoplognatha species are competing for a resource, especially at the beginning of the wheat season, as indicated by the negative competition coefficients. However it was not clear whether the resource that the spiders compete over is prey or web location. The gut content analysis showed that both spider taxa consumed springtails, a common prey in wheat fields and likely to be a preferred prey type for spiders. The microcosms experiment did not show any niche separation at the dimension of prey type consumed by the spiders. In the field, however, it is possible that spiders switch to consumption of other prey types that were not tested in the microcosm experiments. The observed change of web location may shift to different prey types, e.g. higher webs can be better for capturing flying insects. However, as indicated by the amount of prey consumed and the prey availability in the field, it seems that prey is not the limiting factor and therefore it is not the resource that the spiders compete over.

Microcosm experiments showed a separation of the web location at the small scale (the vertical location on the plant), while field samples suggested separation in the larger horizontal field scale. These results suggest that sites for web construction are the limited resource. Differences in the productivity of the patches within the field could also explain separation at the field scale. However, this is less likely, as there was no correlation between the density of spiders and prey in the field. However, the location of spider web is usually indicative of prey availability. The changes in web location in the microcosom experiments suggest the occurrence of interference competition between the spiders. By changing web location, spiders avoid direct contact and possibly intra-guild predation. Although there was no direct evidence for intra-guild predation at the small scale it could be that at higher spider abundances, vertical separation in the web location would prevent mutual predation.

In the semi-arid wheat fields studies, spider abundance is typically low; therefore,, the mechanism for niche separation may be primarily horizontal within the field. This mechanism is influenced by the colonization pattern of the linyphiids and Enoplognatha spiders in the wheat fields; Enoplognatha were found in vacant patches without competitors at the beginning of the wheat season, while the linyphiids were found in similar proportion in

55 patches with and without competitors. Studying the habitat use by these spider taxa showed that the juvenile Enoplognatha and adult T. piscator were the first to colonize the wheat fields. These spiders may have dispersal abilities that allow them to colonize vacant patches in the wheat fields and therefore to determine the initial spider composition of the patch. This process, known as a “priority effect”, in which the presence of one species decreases the colonization of another species, may determine the local species distribution (Sutherland 1974). I found that the strongest competition between Enoplognatha and linyphiids is at the beginning of the crop season and apparently most of the competition is between Enoplognatha and T. piscator. However, T. piscator are less abundant than Enoplognatha and therefore may not significantly reduce the abundance of patches available for colonization by the theridiids. Later in the season A. pastoralis enter the wheat fields, suggesting a different pattern of dispersal and colonization of this spider. At this time in the crop season the Enoplognatha are adults and much larger than the adult linyphiids that enter the fields, therefore competition between these spiders may be reduced. These differences in habitat use, together with possible differences in dispersal abilities suggest that horizontal separation of web location at the field scale is the main mechanism of competition avoidance in this semi-desert ephemeral environment. However, the species-specific dispersal patterns that affect his mechanism remain to be studied in this system.

Recently it has been understood that the fundamental niche of organisms is determined not only by suitable environmental space and conditions, but also by the dispersal abilities of the organism and the composition of dispersal sources in the environment (Pulliam 2000, Holt 2009). Large dispersal pulses from multiple sources can create a condition in which the species will be present within the patch but outside of its fundamental niche (Holt 2009), creating an unsustainable population. In contrast, dispersal limitations can create conditions in which species will not be present in the fundamental niche within the range of their population (Holt 2009). The influence of dispersal and source habitats is particularly important in ephemeral environments that change rapidly, creating vacant habitats for colonization of competing species. Changes in the dispersal abilities or dispersal pattern can provide another mechanism for niche separation different from those suggested by Schoener's theory (1983), which suggests that the separation in the realized niches could be in food resources, spatial location or temporal appearance. It may be that the different dispersal abilities of these spiders and the composition of source habitats in the environment are important as a mechanism of competition avoidance in these spiders; the first species to colonize the patch influences the community structure. Thus, perhaps the mechanism that is

56 most important for niche separation in this ephemeral environment is acting at the field scale and not at the plant scale.

Colonization patterns, dispersal abilities and habitat composition in the semi-desert agroecosystem may be important in determining the pest control abilities of spiders in the wheat fields. Enoplognatha is an early immigrant into the wheat fields. Our results showed that a higher percentage of Enoplognatha consumed aphids compared to springtails. Aphids are considered a crop pest, but during the time of this research, they were scarce in the fields. Two possible explanations for aphid consumption by Enoplognatha were suggested: first, Enoplognatha is a generalist (typical of species in natural habitats) and feeds on a wide variety of prey, and second, aphids provide some nutritional benefits to Enoplognatha, and therefore were selected by the spiders despite their low abundance in the field. Either way, Enoplognatha are a potential natural enemy of aphids. The ability of Enoplognatha to provide bio-control services may be compromised by a low predation rate on aphids and by a further reduction in predation rate in the presence of the competitor, A. pastoralis. Enoplognatha could be an effective natural enemy of aphids, based on the microcosm experiments, gut-contents analysis of field-caught spiders and their ability to colonize the field at the beginning of the season. However, in this study field densities of both aphids and spiders were too low to test this. Therefore, a field-based test would have to be done either in locations where the pest and spider abundances are higher, or experimentally by manipulating their densities in field plots.

Figure

Figure 6.1: Conceptual model showing mechanisms of niche separation of Enoplognatha (Theridiidae) and linyphiid spiders in the Negev semi-desert agroecosystem.

References

Abrams, P. 1983. The theory of limiting similarity. Annual Review of Ecology and Systematics 14:359-376.

Alderweireldt M. 1994. Prey selection and prey capture strategies of linyphiid spiders in high-input agricultural fields. Bulletin of the British Arachnological Society 9:300-308.

Almany, G. R. 2004. Does increased habitat complexity reduce predation and competition in coral reef fish assemblages?. Oikos 106:275-284.‏

Amarasekare, P. 2000. Coexistence of competing parasitoids on a patchily distributed host: local vs. spatial mechanisms. Ecology 81:1286-1296.‏

Andow, D. A. 1991. Vegetational diversity and arthropod population response. Annual review of entomology 36:561-586.‏

Avidov, Z. and Harpaz, I. 1969. Plant pests of Israel. Israel Universities Press Jerusalem.

Bilde, T., Axelsen, J.A. and Toft, S. 2000. The value of Collembola from agricultural soils as food for a generalist predator. Journal of Applied Ecology 37:672-683.

Bonesi, L., Chanin, P. and Macdonald, D.W. 2004. Competition between Eurasian otter Lutra lutra and American mink Mustela vison probed by niche shift. Oikos 106:19-26.

Cameron, G.N. 1971. Niche overlap and competition in woodrats. Journal of Mammalogy 52:288-296.

Chapman, E.G., Romero, S. and Harwood, J.D., 2010. Maximizing collection and minimizing risk: does vacuum suction sampling increase the likelihood for misinterpretation of food web connections? Molecular Ecology Resources 10:1023-1033.

Davies, S.J., Palmiotto, P.A., Ashton, P.S., Lee, H.S. and Lafrankie, J.V. 1998. Comparative ecology of 11 sympatric species of Macaranga in Borneo: tree distribution in relation to horizontal and vertical resource heterogeneity. Journal of Ecology 86:662-673.

Dickie, I.A., Xu, B. and Koide, R.T. 2002. Vertical niche differentiation of ectomycorrhizal hyphae in soil as shown by TRFLP analysis. New Phytologist 156:527-535.

Ehler, L. and Miller, J. 1978. Biological control in temporary agroecosystems. Biocontrol 23:207-212.

Ferguson, K.I. and Stiling, A. 1996. Non-additive effects of multiple natural enemies on aphid populations. Oecologia 108:375-379.

Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R.. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3:294-299.

Gause, G.F. 1936. The struggle for existence. Dover Publications.

Gavish-Regev, E., Lubin, Y. and Coll, M. 2008. Migration patterns and functional groups of spiders in a desert agroecosystem. Ecological Entomology 33:202-212.

Gutman, R. and Dayan, T. 2005. Temporal partitioning: an experiment with two species of spiny mice. Ecology 86:164-173.

Hallett, J.G. and Pimm, S.L. 1979. Direct estimation of competition. American Naturalist 113:593-600.

Harwood, J.D., Sunderland, K.D. and Symondson, W.O.C. 2001. Living where the food is: web location by linyphiid spiders in relation to prey availability in winter wheat. Journal of Applied Ecology 38:88-99.

Harwood, J.D., Sunderland, K.D. and Symondson, W.O.C. 2003. Web-location by linyphiid spiders: prey-specific aggregation and foraging strategies. Journal of Animal Ecology 72:745-756.

Harwood, J.D., Sunderland, K.D. and Symondson, W.O.C. 2004. Prey selection by linyphiid spiders: molecular tracking of the effects of alternative prey on rates of aphid consumption in the field. Molecular Ecology 13:3549-3560.

Herberstein, M.E. 1998. Web placement in sympatric linyphiid spiders (Arachnida, Araneae): Individual foraging decisions reveal inter-specific competition. Acta Oecologica 19:67- 71.

Holbrook, S. J., & Schmitt, R. J. 2002. Competition for shelter space causes density- dependent predation mortality in damselfishes. Ecology 83:2855-2868.‏

Holt, R.D. 2009. Bringing the Hutchinsonian niche into the 21st century: ecological and evolutionary perspectives. Proceedings of the National Academy of Sciences 106:19659- 19665.‏

Hoogendoorn, M. and Heimpel, G.E. 2001. PCR-based gut content analysis of insect predators: using ribosomal ITS-1 fragments from prey to estimate predation frequency. Molecular Ecology, 10:2059-2067.

Hutchinson, G.E. 1957 Concluding remarks: Cold Springs Harbor Symposium in Quantitative Biology.

Karlin, S. and Altschul, S.F.. 1990. Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes. Proceedings of the National Academy of Sciences 87:2264-2268.

Karlin, S. and Altschul, S.F.. 1993. Applications and statistics for multiple high-scoring segments in molecular sequences. Proceedings of the National Academy of Sciences 90:5873-5877.

Kuusk, A. and Agusti, N. 2008. Group-specific primers for DNA-based detection of springtails (Hexapoda: Collembola) within predator gut contents. Molecular Ecology Resources 8:678-681.

Landis, D.A., Wratten, S.D. and Gurr, G.M. 2000. Habitat management to conserve natural enemies of arthropod pests in agriculture. Annual Review of Entomology 45:175-201.

Lang, A. 2003. Intraguild interference and biocontrol effects of generalist predators in a winter wheat field. Oecologia 134:144-153.

Leibold, M.A., Holyoak, M., Mouquet, N., Amarasekare, P., Chase, J.M., Hoopes, M.F., Holt, R.D., Shurin, J.B., Law, R., Tilman, D., Loreau, M. and Gonzalez, A. 2004. The metacommunity concept: a framework for multi‐scale community ecology. Ecology Letters 7:601-613.

Losey, J.E. and Denno, R.F. 1998a. Positive predator-predator interactions: enhanced predation rates and synergistic suppression of aphid populations. Ecology 79:2143-2152.

Losey J. E., R. F. Denno. 1998b. The escape response of pea aphids to foliar-foraging predators: factors affecting dropping behaviour. Ecological Entomology 23:53-61.

Marc, P., Canard, A. and Ysnel, F. 1999. Spiders (Araneae) useful for pest limitation and bioindication. Agriculture, Ecosystems & Environment 74:229-273.

McKaye, K. R. 1977. Competition for breeding sites between the cichlid fishes of Lake Jiloa, Nicaragua. Ecology 58:291-302.‏

Morris, D. W. 1996. Coexistence of specialist and generalist rodents via habitat selection. Ecology 77:2352-2364.‏

Nelson, E. H., Matthews, C.E. and Rosenheim, J.A. 2004. Predators reduce prey population growth by inducing changes in prey behavior. Ecology 85:1853-1858.

Nelson, E.H. 2007. Predator avoidance behavior in the pea aphid: costs, frequency, and population consequences. Oecologia 151:22-32.

Neumann, G. and Shields, E.J. 2006. Interspecific interactions among three entomopathogenic nematodes, Steinernema carpocapsae Weiser, S. feltiae Filipjev, and Heterorhabditis bacteriophora Poinar, with different foraging strategies for hosts in multipiece sand columns. Environmental Entomology 35:1578-1583.

Nyffeler, M. 1999. Prey selection of spiders in the field. Journal of Arachnology 27:317-324.

Nyffeler, M. and Benz, M. 1988. Prey and predatory importance of micryphantid spiders in winter wheat fields and hay meadows. Journal of Applied Entomology 105:190-197.

Nyffeler, M. and Sunderland, K.D. 2003. Composition, abundance and pest control potential of spider communities in agroecosystems: a comparison of European and US studies. Agriculture, Ecosystems & Environment 95:579-612.

Onzo, A., Hanna, R. and Sabelis, M.W. 2003. Interactions in an acarine predator guild: impact on Typhlodromalus aripo abundance and biological control of cassava green mite in Benin, West Africa. Experimental and Applied Acarology 31:225-241.

Opatovsky, I. and Lubin, Y. 2012. Coping with abrupt decline in habitat quality: Effects of harvest on spider abundance and movement. Acta Oecologica 41:14-19.

Opatovsky, I., Chapman, E.G., Weintraub, P.G., Lubin,Y. and Harwood, J.D. 2012. Molecular characterization of the differential role of immigrant and agrobiont generalist predators in pest suppression. Biological Control 63:25-30.

Pluess, T., Opatovsky, I., Gavish-Regev, E., Lubin, Y. and Schmidt, M.H. 2008. Spiders in wheat fields and semi-desert in the Negev (Israel). Journal of Arachnology 36:368-373.

Pluess, T., Opatovsky, I., Gavish-Regev, E., Lubin, Y. and Schmidt-Entling, M.H. 2010. Non-crop habitats in the landscape enhance spider diversity in wheat fields of a desert agroecosystem. Agriculture, Ecosystems & Environment 137:68-74.

Polis, G.A., Myers, C.A. and Holt, R.D. 1989. The ecology and evolution of intraguild predation: potential competitors that eat each other. Annual Review of Ecology and Systematics 20:297-330.

Pulliam, H.R. 2000. On the relationship between niche and distribution. Ecology Letters 3:349-361.

Rand, T.A., Tylianakis, J.M. and Tscharntke, T. 2006. Spillover edge effects: the dispersal of agriculturally subsidized insect natural enemies into adjacent natural habitats. Ecology Letters 9:603-614.

Romero, S.A. and Harwood, J.D. 2010. Diel and seasonal patterns of prey available to epigeal predators: Evidence for food limitation in a linyphiid spider community. Biological Control 52:84-90.

Rosenheim, J.A., Kaya, H., Ehler, L., Marois, J.J. and Jaffee, B. 1995. Intraguild predation among biological-control agents: theory and evidence. Biological Control 5:303-335.

Rosenzweig, M.L., Abramsky, Z. and Brand, S.. 1984. Estimating species interactions in heterogeneous environments. Oikos 43:329-340.

Rotem, G., Ziv, Y., Giladi, I. and Bouskila, A. 2013. Wheat fields as an ecological trap for reptiles in a semiarid agroecosystem. Biological Conservation 167:349-353.

Sabelis, M.W. 1992. Predatory arthropods. Pages 225-264 In Crawley, M.J. (Ed.) Natural Enemies: The Population Biology of Predators, Parasites and Diseases, Oxford University Press.

Samu, F. and Szinetar, C. 2002. On the nature of agrobiont spiders. The Journal of Arachnology 30:389-402.

Schmidt, M. H. & Tscharntke, T. 2005. The role of perennial habitats for central european farmland spiders. Agriculture, Ecosystems & Environment 105:235-242.

Schmidt-Entling, M. H. & Döbeli, M. H. 2009. Sown wildflowers to enhance spiders in arable fields. Agriculture, Ecosystems & Environment 133:19-22

Schoener, T.W. 1974. Resource partitioning in ecological communities. Science 185:27-39.

Schoener, T.W. 1983. Field experiments on interspecific competition. The American Naturalist 122:240-285.

Siemann, E., Tilman, D., Haarstad, J. and Ritchie, M. 1998. Experimental tests of the dependence of arthropod diversity on plant diversity. The American Naturalist 152:738- 750.

Sih, A. 1993. Effects of ecological interactions on forager diets: competition, predation risk, parasitism and prey behaviour. Pages 182-211 In Hughes, R. (Ed.) Diet selection: an interdisciplinary approach to foraging behaviour, Wiley-Blackwell Press, pp. 182-212.

Sivakoff, F.S., Rosenheim, J.A. and Hagler, J.R. 2012. Relative dispersal ability of a key agricultural pest and its predators in an annual agroecosystem. Biological Control 63:296- 303.

Snyder, W.E. 2009. Coccinellids in diverse communities: Which niche fits? Biological Control 51:323-335.

Snyder, W.E. and Ives, A.R. 2003. Interactions between specialist and generalist natural enemies: parasitoids, predators, and pea aphid biocontrol. Ecology 84:91-107.

Southwood, T., May, R., Hassell, M. and Conway, G. 1974. Ecological strategies and population parameters. American Naturalist 108:791-804

Spiller, D.A. 1984. Seasonal reversal of competitive advantage between two spider species. Oecologia 64:322-331.

Spiller, D.A. 1986. Interspecific competition between spiders and its relevance to biological control by general predators. Environmental Entomology 15:177-181.

StatSoft, Inc. 2011. STATISTICA (Data analysis software system), version 10. www.statsoft.com

Stokes, B.M. 1957. Observations and experiments on the Hessian fly (Mayetiola destructor Say). Annals of Applied Biology 45:122-132.

Sunderland, K., Crook, N., Stacey, D. and Fuller, B. 1987. A study of feeding by polyphagous predators on cereal aphids using ELISA and gut dissection. Journal of Applied Ecology 24:907-933.

Sutherland, J.P. 1974. Multiple stable points in natural communities. The American Naturalist 108:859-873.

Team R. 2010. R: A language and environment for statistical computing. R Foundation for Statistical Computing. Vienna, Austria.

Tscharntke, T., Rand, T.A. and Bianchi, F. 2005. The landscape context of trophic interactions: Insect spillover across the crop-noncrop interface. Ecology Letters 8:857- 874.

Toft, S. 1995. Value of the aphid Rhopalosiphum padi as food for cereal spiders. Journal of Applied Ecology 32:552-560.

Toft, S. 2005. The quality of aphids as food for generalist predators: implications for natural control of aphids. European Journal of Entomology 102:371-383.

Vanak, A.T. and Gompper, M.E. 2009. Dietary niche separation between sympatric free- ranging domestic dogs and Indian foxes in central India. Journal of Mammalogy 90:1058- 1065.

Vieira, E. and Port, D. 2007. Niche overlap and resource partitioning between two sympatric fox species in southern Brazil. Journal of zoology 272:57-63.

Welch, K.D., Crain, P.R. and Harwood, J.D. 2011. Phenological dynamics of web-building spider in alfalfa: implications for biological control. The Journal of Arachnology 39:244- 249

Wise, D.H. 1995. Spiders in ecological webs. Cambridge University Press .

Wissinger, S.A. 1997. Cyclic colonization in predictably ephemeral habitats: A template for biological control in annual crop systems. Biological Control 10:4-15.

Appendices

Appendix 1: Primer sequences aligned with 23 species of Cecidomylidae, 3 species of Sciaridae, 21 species of Mycetophilidae and 2 species of Agromyzidae. Three dashes between the primers represent the 131 base pairs that occur between the priming sites.

MDF (5'→3') (3'←5') MDR

Number Taxon ATCAATTGCCCATACTGGTTC ---TACTAGACAAAATTAATGACGCATGAAG

Diptera,Cecidomylidae family

EF189968 Asphondylia rosetta .ATT.....A.....AA.AAG ---...... TT...... TT.ACAA..T

EU439919 Asteromyia carbonifera TATT.....A.....A..C.. ---A.....T..TT...... C..ATAA..T

EU439916 Asteromyia euthamiae .ATT.....A.....A..A.. ---A.....T..T...... T..ATAA..T

AB334238 Bruggmanniella_actinodaphnes .ATT.....T...... A.A.. ---A.....TT....A.....TT.ATA.G.T

FJ803277 Calamomyia phragmites TATTT.ACATG....ATA..A ---ATC..A.T..CC.C.T.T.TATGGA..A

AB105494 Contarinia maculipennis TATT.....T.....A..AA. ---A.....TT...... TT..TAAG.A

AB105485 Contarinia okadai TATT..CA.T..C..A..AA. ---A.....TT...... TT.TTAAG.A

AB280766 Contarinia viburnorum TATT.....A.....A..A.. ---A.....TT...... T.ATAA..T

AB334218 Daphnephila machilicola .ATT..A..T....A...A.. ---A.....TTG...A.....TT.TTAA..T

DQ480722 Dasineura banksiae ...... A.....A..G.. ---...... TT...... TTAT..T

EU375702 Dasineura folliculi ...T..CT.....T.G..G.. ---A...... T...... TTAAG.T

AB162847 Hartigiola faggalli TGT...... A.....A..A.. ---...... TT...... T..GCAT..T

AB162848 Mikiola fagi TATT.....A....A.A.AAG ---G...... T..G.A...... T.ACAA..T

AB106528 Obolodiplosis robiniae TATT.....A....A.A.AAG ---G...... T..G.A...... T.ACAA..T

AB213402 Oxycephalomyia styraci TATC.....A...T.AA..AT ---A.....TT..T...... TT.TTAA..T

AB213409 Placochela nigripes .ATT.....A.....A..AG. ---A.....TT...... TT.TTAAG.A

AB334237 Pseudasphondylia neolitseae .ATT..A..T.....AA.AG. ---A.....TT....A...... T.ATAAG.A

AB244579 Rabdophaga salicivora C..T..C...... A.. ---A...... T...... TTAAG.A

AB244581 Rabdophaga strobilina T.TT.....T...... A.. ---A.....T..C...... ACAAG.A

AB244583 Rabdophaga terminalis ...T...... A.. ---A.....T..T...... TTAAG.A

DQ267670 Rhopalomyia solidaginis TAG...... T.A..AA. ---A.....TT...... T..ATAA..T

AB213410 Schizomyia galiorum .ATT.....T.....A..A.. ---A.....TT...... T.ATAA..T AB105484 Thecodiplosis japonensis .ATT.....T...... A.AA. ---A...... T..T...... TT.TTAAG.T

Diptera,Sciaridae family

DQ060500S Bradysia difformis .A...... T...T.A..GG. ---A....A...... T..TCAA..T

AB284397 Ctenosciara japonica .A.TT.AT.....T....AG. ---A....A...... T..TTAAG.T

AF319838 Lycoriella mali TA.TG.AT....CT.A..GG. ---A....A.T.TCC.C.T.T...ATGA..T

Diptera, Mycetophilidae family

DQ787887 Allodia sp. TGTTC..CATG.C...TAC.A ---ATA..A...TCC.C.T.T.AATTGA...

DQ787888 Allodiopsis rustica TGTAC..CATG.....TA..A ---ATA..A.T..CC.C.T.T.AATTGT..A

DQ787886 Anatella sp. TATCT.ACA.G.....TAC.A ---ATA..AGA.CCC.C...T.AATTGT...

DQ787894 Brazypeza bisignata TGTAC.ACATG.....TA..A ---ATA..A.T..CC.C.T.T.GAATGA...

DQ787890 Brevicornu sp. TGTCC.CCATG.....TA..A ---ATA..A.A.TCC.C.T.T.AATTGA..A

DQ787879 Cordyla sp. TGT.T..CA.G.....TA..A ---ATA..A.A.TCC.C.T.T.AATTGT...

DQ787875 Docosia sp. TGT.T.ACATG.....TA..A ---ATA..A.T..CC.C.T.T.AATTG...A

DQ787878 Dynatosoma reciprocum TGT.T.ACATG.....TA..A ---ATA..A.A.TCCAC.T.T.AATTGT..A

DQ787881 Exechia sp. TGT.T.GCATG.....TAC.A ---ATA..A.A.TCCCC.T.T.AATTGT..A

DQ787884 Exechiopsis subulata CGT.T.ACA.G....ATA..A ---ATA..A.A.TCC.C.T.T.AATTGT..A

DQ787874 Leia sp. TGT.C.ACATG.....TA..A ---ATA..A.A.TCC.C.A.T.AATTGA...

DQ787877 Mycetophila sp. T...... T....G...AG. ---A...... TCAAG.A

EU126517 Mycetophila sp. TGTTC..CA.G.C..CTAC.A ---ATA..A...CCC.C.T.T.GATTG...A

DQ787893 Notolopha cristata TGTTC..CATG.C..ATA..A ---ATA..A.T.GCC.C.T.T.AATTGT..A

DQ787895 Pseudobrazypeza sp. TATTC..CATG.....TA..A ---ATAC.A.A.TCC.C.T.T.GATTGT..A

DQ787885 Pseudorymosia fovea TGTTT.ACATG.....TAC.A ---ATA..A...TCC.C.T.T.AATTGA...

DQ787880 Rymosia sp. TGT.T.ACA.G.C..ATAC.A ---ATA..A.A.TCCCC.T.T.AATTGA..A

DQ787892 Synplasta excogitate TGT.T.ACATG.....TA..A ---ATA..A.A.TCC.C.T.T.AATTGT..A

DQ787898 Tarnania dziedzickii TGTTC..CATG....ATATTA ---ATA..A...TCC.C.T.T.GAATGT...

DQ787897 Tarnania fenestralis TGT.T.ACATG.....TA..A ---ATAC.A...TCC.C.T.T.AATTGT..A

DQ787891S Tigmatomeria crassicornis TGTGT.ACATG.....TA..A ---ATA..A.A.TCC.C.T.T.AATTGA...

Diptera,Agromyzidae family

EF104693 Chromatomyia lactuca .GTT...... GGA..AG. ---...... ACATG.T

EU367560 Phytomyza jonaitisi .ATT.....T...GGA..AG. ---...... TCAT...

Appendix 2: Maytiola destructor primers tests in amplification of invertebrate samples taken from alfalfa fields of University of Kentucky (10 orders, 28 families) and arthropods common in the wheat fields of Israel (12 orders; 51 morphospecies). The morphospecies are common arthropods that were separated according to morphological differences.

Phylum Order Family Species

Samples from Kentucky

Arthropoda Coleoptera Coccinellidae Sasajiscymnus tsugae (Sasaji and McClure)

Chrysomelidae Leptinotarsa decemlineata (Say)

Curculionidae Hypothenemus hampei (Ferrari)

Ptilodactylidae Anchycteis velutina (Horn)

Diptera Sciomyzidae Sepedomerus macropus (Walker)

Sepedonea isthmi (Steyskal)

Hemiptera Adelgidae Adelges tsugae (Annand)

Pineus strobi (Hartig)

Aleyrodidae Bemisia tabaci (Gennadius) biotype B

Bemisia tabaci (Gennadius) biotype Q

Undetermined sp.

Anthocoridae Orius albidipennis (Reuter)

Orius laevigatus (Fieber)

Aphididae Myzus persicae (Sulzer)

Cicadellidae Circulifer tenellus (Baker)

Graphocephala coccinea (Forster)

Coccidae Coccus hesperidium (Linnaeus)

Eulecanium cerasorum (Cockerell)

Neolecanium cornuparvum (Thro)

Parthenolecanium quercifex (Fitch)

Pulvinaria innumerabilis (Rathvon)

Geocoridae Geocoris bullatus (Say)

Nabidae Nabis alternatus (Parshley)

Pseudococcidae Pseudococcus maritimus (Ehrhorn)

Psyllidae Cacopsylla pyricola (Forster)

Bactericerca cockerelli (Sulc)

Hymenoptera Apidae Aphis mellifera (Linnaeus)

Bombus sp.

Bethylidae Prorops nasuta (Waterston)

Ceraphronidae Aphanogmus sp.

Eulophidae Phymastichus coffea (LaSalle)

Formicidae Tapinoma sp.

Mutillidae Pseudomethoca simillima (Smith)

Lepidoptera Nymphalidae Danaus plexippus (Linnaeus)

Neuroptera Chrysopidae Chrysopa oculata (Say)

Thysanoptera Phlaeothripidae Karnyothrips flavipes (Jones)

Thripidae Frankliniella occidentalis (Pergande)

Mollusca Stylomatophora Endodontidae Aniguispira alternata (Say)

Nematoda Rhabditida Steinernematidae Steinernema carpocapsae (Weiser)

Tylenchida Allantonematidae Thripinema sp.

Samples from Israel

Arthropoda Acri Morphospecies 1405

Araneae Araneidae Morphospecies 829

Gnaphosidae Morphospecies 614

Linyphiidae Morphospecies 627

Lycosidae Morphospecies 638

Philodromidae Thanatus sp. 605

Salticidae Morphospecies 516

Thomisidae Morphospecies 596

Coleoptera Carabidae Morphospecies 456

Coccinellidae Morphospecies 498

Curculionidae Morphospeceis 400

Scydmaeidae Morphospecies 417

Staphylinidae Morphospecies 404

Tenebrionidae Morphospecies 694

Diptera Morphospecies 471

Morphospecies 461

Morphospecies 467

Morphospecies 482

Morphospecies 595

Morphospecies 731

Morphospecies 794

Morphospecies 951

Morphospecies 981

Morphospecies 991

Morphospecies 995

Morphospecies 996

Morphospecies 1024

Morphospecies 1043

Morphospecies 1049

Morphospecies 1098

Morphospecies 1137

Morphospecies 1171

Morphospecies 1218

Morphospecies 1259

Cecidomyiidae Morphospecies 983

Morphospecies 1329

Morphospecies 1375

Morphospecies 1424

Sciaridae Morphospecies 446

Morphospecies 1159

Hemiptera Cicadellidae Megophthalmus sp. 662

Tingidae Morphospecies 714

Hymenoptera Braconidae Morphospecies 1081

Morphospecies 1082

Formicidae Morphospecies 513

Isopoda Morphospecies 409

Isoptera Morphospecies 676

Neuroptera Chrysopidae Morphospecies 952

Psocoptera Morphospecies 1232

Thysanoptera Morphospecies 1358

Thysanura Morphospecies 484

Appendix 3: The effect of different spider characteristics (total web area, spider density, spider/prey ratio, ratio between the average web sizes of spider of the two taxa, and the ratio between the average sizes of spiders in the two taxa) on the competition coefficients. Separate regressions were done on samples taken during the first half of the crop season (five sampling sessions: December 29-March 16) and during the second half of the season (four sampling sessions: March 30- May 22). Significant effects are marked in bold.

Spider family R2 F p value Slope

First half of the wheat season

Total web area Linyphiidae 0.06 0.13 0.75 0.01 Theridiidae 0.62 3.40 0.2 0.07 Spider density Linyphiidae 0.025 0.05 0.84 -0.01 Theridiidae 0.80 8.04 0.1 0.98 Prey/spider ratio Linyphiidae 0.05 0.1 0.78 -0.01 Theridiidae 0.02 0.04 0.86 -0.01 Linyphiidae web height Linyphiidae 0.001 0.004 0.95 -0.03 Theridiidae 0.45 2.45 0.21 0.67 Theridiidae web height Linyphiidae 0.33 1.53 0.30 -0.58 Theridiidae 0.27 1.15 0.36 0.52 Web size ratio Linyphiidae 0.34 1.04 0.41 0.24 (Theridiidae/Linyphiidae) Theridiidae 0.06 0.13 0.75 -0.16 Size ratio Linyphiidae 0.08 0.01 0.91 -0.04 (Theridiidae/Linyphiidae) Theridiidae 0.003 0.006 0.94 0.05

Second half of the wheat season Total web area Linyphiidae 0.03 0.1 0.78 0.01 Theridiidae 0.58 4.19 0.13 -0.02 Spider density Linyphiidae 0.53 3.34 0.16 0.52 Theridiidae 0.69 6.80 0.08 0.30

Prey/spider ratio Linyphiidae 0.98 104.1 0.01 -0.03 Theridiidae 0.07 0.14 0.74 -0.003 Linyphiidae web height Linyphiidae 0.04 0.30 0.6 0.20

Theridiidae 0.13 1.12 0.32 0.37 Theridiidae web height Linyphiidae 0.40 4.67 0.63 0.06 Theridiidae 0.13 1.06 0.33 0.36 Web size ratio Linyphiidae 0.10 0.35 0.59 0.49 (Theridiidae/Linyphiidae) Theridiidae 0.05 0.16 0.71 -0.17 Size ratio Linyphiidae 0.003 0.008 0.93 -0.05 (Theridiidae/Linyphiidae) Theridiidae 0.19 0.72 0.45 -0.24

Appendix 4: The effect of the abundance of each spider group (separately and combined) on web characteristics (web area and height above ground) of each taxon. Significant effects are marked in bold.

Date of Web characteristics Density of R2 F p value Slope sampling spider session family

December Linyphiidae web area Linyphiidae N/A N/A N/A N/A 29 Theridiidae N/A N/A N/A N/A Both N/A N/A N/A N/A Linyphiidae web height Linyphiidae N/A N/A N/A N/A Theridiidae N/A N/A N/A N/A Both N/A N/A N/A N/A Theridiidae web area Linyphiidae N/A N/A N/A N/A Theridiidae 0.17 1.23 0.31 -0.41 Both 0.17 1.23 0.31 -0.41 Theridiidae web height Linyphiidae N/A N/A N/A N/A Theridiidae <0.001 0.002 0.95 0.021 Both <0.001 0.002 0.95 0.021 January Linyphiidae web area Linyphiidae 0.04 0.55 0.47 -0.21 11 Theridiidae 0.03 0.35 0.56 -0.17 Both 0.5 0.59 0.45 -0.21 Linyphiidae web height Linyphiidae 0.01 0.17 0.68 0.12 Theridiidae 0.18 2.66 0.13 0.43 Both 0.1 1.32 0.27 0.31 Theridiidae web area Linyphiidae 0.003 0.04 0.84 -0.05 Theridiidae 0.07 1.10 0.31 0.27 Both 0.02 0.27 0.6 0.14 Theridiidae web height Linyphiidae 0.04 0.61 0.44 0.20 Theridiidae <0.001 0.003 0.95 -0.02 Both 0.02 0.27 0.6 0.14

February Linyphiidae web area Linyphiidae 0.003 0.04 0.84 -0.05 7 Theridiidae 0.07 1.11 0.31 -0.27 Both 0.01 0.16 0.69 -0.11 Linyphiidae web height Linyphiidae 0.02 0.36 0.56 0.15 Theridiidae 0.33 6.82 0.02 0.57 Both 0.22 4.1 0.06 0.47 Theridiidae web area Linyphiidae 0.02 0.43 0.51 0.15 Theridiidae 0.28 7.24 0.01 0.52 Both 0.18 4.25 0.05 0.42 Theridiidae web height Linyphiidae 0.05 1.04 0.32 -0.23 Theridiidae 0.006 0.12 0.73 -0.08 Both 0.06 1.2 0.28 -0.24 February Linyphiidae web area Linyphiidae 0.06 0.63 0.44 -0.26 22 Theridiidae 0.13 1.39 0.26 0.36 Both 0.02 0.15 0.71 0.13 Linyphiidae web height Linyphiidae 0.001 0.16 0.9 0.04 Theridiidae 0.02 0.20 0.66 -0.15 Both 0.01 0.09 0.77 -0.1 Theridiidae web area Linyphiidae 0.03 0.65 0.43 -0.17 Theridiidae 0.03 0.65 0.43 -0.17 Both 0.08 1.8 0.19 -0.28 Theridiidae web height Linyphiidae <0.001 <0.001 1 0 Theridiidae <0.001 <0.001 1 0 Both <0.001 <0.001 1 0 March 16 Linyphiidae web area Linyphiidae 0.03 0.71 0.40 -0.18 Theridiidae <0.001 0.01 0.92 -0.02 Both 0.02 0.43 0.51 -0.14 Linyphiidae web height Linyphiidae 0.005 0.12 0.73 -0.07 Theridiidae 0.01 0.28 0.60 -0.11

Both 0.02 0.37 0.55 -0.13 Theridiidae web area Linyphiidae 0.03 0.33 0.58 0.16 Theridiidae <0.001 <0.001 0.98 -0.01 Both 0.02 0.21 0.65 0.13 Theridiidae web height Linyphiidae 0.06 0.77 0.39 0.24 Theridiidae 0.03 0.40 0.54 -0.18 Both 0.01 0.13 0.72 0.1 March 30 Linyphiidae web area Linyphiidae 0.01 0.30 0.58 0.11 Theridiidae 0.11 3.35 0.07 0.34 Both 0.04 1.16 0.29 0.21 Linyphiidae web height Linyphiidae 0.16 4.98 0.03 0.40 Theridiidae 0.07 2.0 0.17 0.27 Both 0.2 6.73 0.01 0.45 Theridiidae web area Linyphiidae 0.04 0.19 0.67 -0.19 Theridiidae 0.005 0.02 0.88 0.07 Both 0.04 0.22 0.66 -0.2 Theridiidae web height Linyphiidae 0.07 0.36 0.57 -0.26 Theridiidae 0.21 1.36 0.29 0.46 Both 0.03 0.14 0.72 -0.16 April 11 Linyphiidae web area Linyphiidae 0.52 4.47 0.1 0.72 Theridiidae N/A N/A N/A N/A Both 0.52 4.47 0.1 0.72 Linyphiidae web height Linyphiidae 0.08 0.36 0.57 0.28 Theridiidae N/A N/A N/A N/A Both 0.08 0.36 0.57 0.28 Theridiidae web area Linyphiidae N/A N/A N/A N/A Theridiidae N/A N/A N/A N/A Both N/A N/A N/A N/A Theridiidae web height Linyphiidae N/A N/A N/A N/A

Theridiidae N/A N/A N/A N/A Both N/A N/A N/A N/A May 4 Linyphiidae web area Linyphiidae 0.001 0.007 0.93 0.03 Theridiidae 0.001 0.01 0.91 0.04 Both 0.002 0.01 0.91 0.04 Linyphiidae web height Linyphiidae 0.001 0.008 0.93 0.03 Theridiidae 0.02 0.15 0.70 -0.15 Both 0.01 0.06 0.81 -0.1 Theridiidae web area Linyphiidae 0.01 0.13 0.72 0.13 Theridiidae 0.01 0.08 0.78 0.10 Both 0.01 0.12 0.73 0.12 Theridiidae web height Linyphiidae 0.001 0.008 0.93 -0.03 Theridiidae <0.001 0.004 0.95 0.02 Both <0.001 <.001 0.99 0.004 May 22 Linyphiidae web area Linyphiidae 0.14 0.96 0.36 -0.37 Theridiidae 0.14 0.96 0.36 -0.37 Both 0.14 0.96 0.36 -0.37 Linyphiidae web height Linyphiidae 0.002 0.01 0.91 0.05 Theridiidae 0.002 0.01 0.91 0.05 Both 0.002 0.01 0.91 0.05 Theridiidae web area Linyphiidae 0.38 1.26 0.37 -0.62 Theridiidae 0.04 0.10 0.78 -0.22 Both 0.27 0.77 0.47 -0.52 Theridiidae web height Linyphiidae 0.09 0.20 0.80 -0.30 Theridiidae 0.01 0.02 0.89 0.10 Both 0.03 0.06 0.83 -0.17

Appendix 5: The differences in web height of the two taxa in the presence of competitors (from the same or other taxa) at each sampling date. No significant effects were found

Date of Spider taxon Presence of other Average s.d. F p sampling spiders web value session height (cm) December Linyphiidae None 0.75 0.26 29 Other linyphiids - - - - Theridiids - - Theridiidae None 1.21 0.63 Other theridiids - - 0.005 0.94 Linyphiids 1.25 0.35 January Linyphiidae None 1.06 0.56 11 Other linyphiids 10.8 0.58 0.71 0.5 Theridiids 1.5 0.5 Theridiidae None 0.93 0.44 Other theridiids 1.21 0.50 2.53 0.1 Linyphiids 1.7 0.91 February Linyphiidae None 1.3 0.57 7 Other linyphiids 1.68 1.15 0.61 0.55 Theridiids 2.05 1.7 Theridiidae None 2.16 1.41 Other theridiids 1.85 0.62 0.73 0.49 Linyphiids 1.58 0.49 February Linyphiidae None 1.78 0.63 22 Other linyphiids 1.5 0.7 0.16 0.84 Theridiids 1.5 1.3 Theridiidae None 1.59 0.77 Other theridiids 1.25 0.35 1.8 0.18 Linyphiids 1 0 March 16 Linyphiidae None 1.76 0.69 Other linyphiids 1.88 1.02 0.84 0.43 Theridiids 1.3 0.75

Theridiidae None 1.1 0.65 Other theridiids 1.75 0.163 0.85 0.44 Linyphiids 1.2 0.34 March 30 Linyphiidae None 1.46 0.92 Other linyphiids 2.75 1.85 2.97 0.06 Theridiids 2.57 1.9 Theridiidae None 3.75 4.59 Other theridiids 1 0 1.63 0.24 Linyphiids 1.9 1.24 April 11 Linyphiidae None 1.6 0.41 Other linyphiids 1.75 0.5 0.24 0.63 Theridiids - - Theridiidae None - - Other theridiids - - - Linyphiids - - May 4 Linyphiidae None 1.4 0.74 Other linyphiids 1.4 0.54 0.19 0.82 Theridiids 1.2 0.44 Theridiidae None 1.33 0.6 Other theridiids 2.14 1.28 1.35 0.28 Linyphiids 2.06 0.86 May 22 Linyphiidae None 2.35 1.1 Other linyphiids - - 0.01 0.9 Theridiids 2.5 - Theridiidae None 2.25 1.06 Other theridiids 2.37 1.18 0.08 0.92 Linyphiids 2 0.7

Appendix 6: Results of a-priori least squares comparisons of means to test differences in the number of remaining aphids and springtails at the end of the laboratory experiments. Significant differences are marked in bold.

Prey Comparisons between treatments t value p value First experiment Aphids Control – one linyphiid 0.78 0.44 One linyphiids – two linyphiids 0.55 0.58 One linyphiids – one linyphiid and one theridiid 0.11 0.91 Control – one theridiid 2.12 0.04 One theridiids – two theridiids 0.01 0.99 One theridiids – one linyphiid and one theridiid 1.5 0.13 Springtails Control – one linyphiid 3.8 <0.001 One linyphiids – two linyphiids 0.17 0.86 One linyphiids – one linyphiid and one theridiid 0.62 0.53 Control – one theridiid 2.69 0.01 One theridiids – two theridiids 1.11 0.27 One theridiids – one linyphiid and one theridiid 0.57 0.57 Second experiment Aphids Control – one linyphiid 1.24 0.22 One linyphiids – one linyphiid and one theridiid 1.18 0.24 Control – one theridiid 2.21 0.03 One theridiids – two theridiids 0.25 0.79 One theridiids – one linyphiid and one theridiid 0.25 0.8 Springtails Control – one linyphiid 1.1 0.28 One linyphiids – one linyphiid and one theridiid 1.98 0.06 Control – one theridiid 3.53 0.001 One theridiids – two theridiids 0.45 0.65 One theridiids – one linyphiid and one theridiid 0.28 0.77

Appendix 7: The number of individuals from each spider group that were collected in each sampling methods and the average number of individuals per trap/suction sampling. The t- test measure significant differences between the number of individuals collected in each method. Significant differences are marked in bold.

No. of ind. Average of ind. Collecting Group caught in each per trap/suction t p method method sample

Linyphiidae Alioranus pastoralis Pitfall 36 0.07 0.72 0.47 Suction device 10 0.04 Trichoncoides piscator Pitfall 34 0.03 1.82 0.07 Suction device 0 0 Theridiidae Enoplognatha Pitfall 46 0.14 2.53 0.01 Suction device 9 0.04 Juveniles of Pitfall 16 0.02 Enoplognatha 3.1 0.002 Suction device 33 0.1

והעכבישים הראשונים לאכלס את הכתמים הפנויים בשדות החיטה משפיעים על מבנה החברה של כתם זה.

מחקר זה מגדיל את הבנתנו לגבי יחסי התחרות וניצול המשאבים של מיני עכבישים הקיימים בצוותא בשדות חיטה. בחינת יחסי הגומלין בין מינים מתחרים חשובה בכדי להבהיר את התהליכים שמעצבים את חברת העכבישים, והטורפים בכלל, בשדות החיטה. נראה כי, בסביבה החקלאית המשתנה הפרדת הגומחות בין מינים מתחרים נעשית בעיקר בקנה מידה גדול, ומתאפשרת על ידי שימוש שונה של המינים המתחרים בבתי הגידול ויכולות הפצה שונות.

לבחינת החפיפה בהעדפת המזון של העכבישים וטריפת המזיקים, תכולת הקיבה של עכבישים שנאספו בשדה נבחנה באמצאות PCR. תחיליים לטרף נפוץ )קפצזנבים( ולשני מזיקים )כנימות ויתוץ הקמה( שימשו לבחינת המצאות שאריות ד.נ.א של סוגי טרף אלו בקיבת העכבישים. דיגום בשדה של אוכלוסיות העכבישים שימש לבחינת המצאות תחרות בין קבוצות העכבישים והאם התחרות מושפעת מצפיפות הטרף או ממשאב אחר. בכדי לענות של שאלה זו מקדמי התחרות ומידת ההתאמה בין מקדם התחרות לצפיפות הטרף חושבו. ניסויי מיקרוקוסמוס במעבדה שימשו לבחינת הפרדת הגומחות בקנה המידה קטן של הצמח הבודד, לדוגמא על ידי שינוי העדפת הטרף או מיקום הרשתות. דיגום אוכלוסיות העכבישים בשדות חיטה ובבתי גידול שאינם חיטה, במהלך ובין עונות גידול החיטה, שימשו לבדיקת השימוש בבתי הגידול השונים על ידי עכבישים אילו וחלוקת הגומחאות בקנה מידה גדול יותר .

ניתוח תכולת הקיבה הראתה כי אחוז גדול של הערסלנים )עכבישים חקלאיים( טרפו את סוג הטרף הנפוץ יותר בסביבה החקלאית במהלך עונת הגידול, הקפצזנבים. לעומתם, אחוז גדול יותר של Enoplognatha טרפו כנימות הנחשבות מזיק חקלאי. דיגום העכבישים בשדה חשף כי ה- Enoplognatha המהגרים והערסלנים החקלאיים מתחרים בינהם בעיקר בתחילת עונת הגידול, כפי שהראו מקדמי התחרות השליליים בין העכבישים. ניסוי המעבדה הראו כי המצאות של כול אחד מהמינים )משתי קבוצות העכבישים( צמצמה את צפיפות הקפצזנבים בסיום הניסוי. מידע זה תומך בהשערה כי הקפצזנבים, הנפוצים בסביבה החקלאית, הינם טרף מועדף על העכבישים. תוצאות אילו נתמכות גם על ידי ניתוח תכולת הקיבה של העכבישים שנאספו בשדה שהראה המצאות של שיירי קפצזנבים בקיבת הערסלנים וה-Enoplognatha . עם זאת, קצב הטריפה של הקפצזנבים בניסויי המעבדה הראה כי במערכת זו טרף אינו גורם מגביל. גם בתקופות במהלך עונת גידול החיטה שבהן צפיפות הטרך היתה נמוכה, היצע הטרף היה גדול יותר מהנדרש על ידי אוכלוסיות העכבישים. תוצאות ניסוי המעבדה הראו כי Enoplognatha gemina )המין הנפוץ ביותר מסוג זה( ניזון מכנימות גם כאשר קפצזנבים היו נוכחים וללא המצאות מתחרים. אבל, עוצמת הטריפה פחתה כאשר נכחו מתחרים )מאותו המין וממין שונה(, מה שיכול להצביע על תחרת הפרעה. בנוסף E. gemina בנו את רשתותיהם גבוה יותר על צמחי החיטה כשמתחרה היה נוכח, מה שיכול להצביע על תחרות על מיקום הרשת או תחרות הפרעה. בדיגום העכבישים בשדה, גובה הרשת השתנה במהלך עונת החיטה עבור שתי קבוצות העכבישים, אולם שינויים אילו לא היו תלויים בצפיפויות העכבישים )ביחד או לחוד(. לפיכך, בצפיפויות עכבישים נמוכות בשדה, הפרדה מרחבית יכולה להיות מספקת בכדי למנוע תחרות על מיקום בניית רשת.

דיגום העכבישים בבתי הגידול השונים הראה כי העכבישים הראשונים לאכלס את שדות החיטה היו Enoplognatha צעירים ו- Trichoncoides piscator בוגרים )ערסלנים(. עכבישים אילו מהגרים אל שדות החיטה מבתי הגידול הטבעיים או משדות חקלאיים אחרים )בהתאמה( ומתחרים בינהם על מיקום להתישבות. אך הצפיפות הנמוכה של T. piscator מותירה מספיק כתמים פנויים לאכלוס על ידי הכדורנים, מה שמאפשר פיזור מרחבי של עכבישים אליו בשדה. מאוחר יותר בעונת החיטה, Alioranus pastoralis )ערסלנים( מהגר אל השדות, ככול הנראה מבתי הגידול הטבעיים. מין זה מהגר אל שדות החיטה כאשר הכדורנים הינם בוגרים ובעלי גודל גוף גדול יותר מהערלסנים ולכן עוצמת התחרות בין קבוצות העכבישים פחותה. יתכן כי הבדלים ביכולות ההפצה של עכבישים אילו והפיזור המרחבי של בתי הגידול שמשמשים אותם כמקור להפצה, חשובים להפרדת הגומחות של קבוצות עכבישים אילו

תקציר

תחרות מתרחשת כששני מינים מתקיימים באותו הזמן ואותו המקום וצורכים את אותו משאב מגביל . הגומחה הבסיסית על מנת ששני המינים יתקיימו בצוותא, על כול מין להתמחות בחלק אחר של אותה גומחה בסיסית, אשר מסכמת את דרישות האורגניזם. המימדים המצומצמים של הגומחה הבסיסית , בעקבות התמחות המינים, נקראים גומחה ממומשת. ההפרדה בין הגומחות הממומשות של המינים יכולה להיות בכמה מימדים: סוג מזון או גודלו, מיקום במרחב או מיקום בזמן. תחרות בין טורפים בדרך כלל תתקיים על משאב מזון משותף ויחסי הגומלים בינהם יהיו בעיקר תחרות ניצול. בתחרות זו, המתחרה המוצלח יותר מנצל את סוג המזון המועדף ומוריד את קצב הטריפה ולפיכך את החיוניות של המתחרה . תחרות הניצול יכולה להיות על משאבים אחרים מלבד טרף, לדוגמה, מחסות למסתור או אתרי רביה. תחרות הניצול יכולה להוביל לשינויים בניצול המשאבים של שני המינים המתחרים ובכך לאפשר לשני המינים להתקיים בצוותא. בנוסף, יחסי גומלין בין טורפים יכולים להיות ישירים – כתחרות הפרעה . בהם אחד המתחרים אינו מאפשר למתחרה השני לנצל את המשאבים, לדוגמא על ידי אכלוס של טריטוריה פנויה או התנהגות אגרסיבית. במצב זה, הטורפים יכולים לצמצם את השפעת התחרות על ידי הפרדה בזמן או במרחב, מקומית בבית הגידול או בקנה מידה מרחבי גדול יותר. לפיכך, גם תחרות הפרעה יכולה להוביל לשינוי בגומחה הממומשת של שני המינים המתחרים.

עכבישים הינם חלק עיקרי מגילדת הטורפים ברוב המערכות האקולוגיות. עכבישים הינם טורפים כוללניים בעלי חפיפה בתפריט המזון שלהם. עכבישים בבתי גידול חקלאיים נתקלים במגוון טרף נמוך יותר בעקבות מבנה הצמחיה האחיד של בתי גידול אילו, מה שיכול להביל לעליה בחפיפה בתפריט המזון ועוצמת התחרות. לכן השערת העבודה היא כי עכבישים בסביבה החקלאית יתחרו תחרות ניצול על משאב המזון אשר הינו המשאב המגביל. השערה נוספת היא, כי עכבישים מתחרים על משאב מרחבי וכי המשאב המגביל הוא מיקום מיטבי לבניית רשת או ריחוק פיזי למניעת הפרעה. לפיכך, שדות חקלאיים הם מערכת מודל טובה לבחינת יחסי הגומלין בין מינים מתחרים של טורפים ועכבישים בפרט. עוצמת התחרות המוגברת והפשטות של בתי גידול אילו, מאפשרים הבחנה בגורמים העיקריים המשפיעים על יחסי הגומלין של מינים מתחרים. בנוסף, עכבישים ידועים ביכולם לצמצם אוכלוסיות של מזיקי חקלאות ולכן, הבנת השפעת יחסי גומלין אילו על העדפת המזון וקצב הטריפה יכולות להיות בעלות השלכות ישומיות לגבי שימוש עכבישים להדברת מזיקים.

מחקר זה נערך בשדות חיטה של צפון הנגב. בסביבה אקולוגית-חקלאית זו יותר מחמישים אחוז ממיני העכבישים בשדות החיטה הם מינים מדבריים אשר מהגרים אל השדות במהלך עונת הגידול. העכבישים בוני הרשתות הנפוצים ביותר בשדות החיטה שייכים למשפחת הכדורניים )בעיקר הסוג Enoplognatha( אשר מהגרים מבתי גידול מדבריים ומשפחת הערסלנים, אשר נודדים ומשלימים את מחזור חייהם בשדות חקלאיים. ה-Enoplognatha והערסלנים בונים את רשתותיהם האופקיות בסמוך לבסיס צמחי החיטה. מיקום הרשת הדומה, דימיון בגודל גופם ואיכלוס השדות בתחילת עונת הגידול על ידי שתי קבוצות אילו, הובילו להשערה כי שני טקסונים אילו של עכבישים מתחרים על אותם משאבים. השערה זו הובילה לשאלות המחקר העיקריות של מחקר זה: 1( האם קיימת חפיפה בהעדפת המזון של ה- Enoplognatha והערסלנים? 2( האם קיימת תחרות בין העכבישים על טרף או משאבים אחרים וכיצד הגומחות הממומשות מופרדות בקנה המידה של מיקרו בית הגידול? 3( האם ההבדלים בשימושי בתי הגידול של עכבישים אילו מובילים לחלוקת גומחות בקנה מידה גדול )בית הגידול(?

הצהרת תלמיד המחקר עם הגשת עבודת הדוקטור לשיפוט

אני החתום מטה מצהיר/ה בזאת: )אנא סמן(:

_X_ חיברתי את חיבורי בעצמי, להוציא עזרת ההדרכה שקיבלתי מאת מנחה/ים.

___ החומר המדעי הנכלל בעבודה זו הינו פרי מחקרי מתקופת היותי תלמיד/ת מחקר.

___ בעבודה נכלל חומר מחקרי שהוא פרי שיתוף עם אחרים, למעט עזרה טכנית הנהוגה בעבודה ניסיונית. לפי כך מצורפת בזאת הצהרה על תרומתי ותרומת שותפי למחקר, שאושרה על ידם ומוגשת בהסכמתם.

תאריך _13.8.2014_ שם התלמיד/ה __איתי אופטובסקי____ חתימה ______

העבודה נעשתה בהדרכת

פרופ' יעל לובין

במחלקה לאקולוגיה מדברית ע"ש מיטרני

בבית הספר ללימודי מדבר ע"ש אלברט כץ במכון לחקר המדבר ע"ש בלאונשטיין

ודר' פיליס ויינטראוב

במחלקה לאנטומולוגיה

במנהל המחקר החקלאי, מכון וולקני

יחסי גומלין בין מיני עכבישים חקלאיים ומהגרים הבונים רשתות וההשלכות על טריפת מזיקי חיטה בסביבה החקלאית מדברית

מחקר לשם מילוי חלקי של הדרישות לקבלת תואר "דוקטור לפילוסופיה"

מאת

איתי אופטובסקי

הוגש לסינאט אוניברסיטת בן גוריון בנגב

אישור המנחה

אישור דיקן בית הספר ללימודי מחקר מתקדמים ע"ש קרייטמן ______

חשון תשע"ד אוקטובר 2013

שדה בוקר

מחקר לשם מילוי חלקי של הדרישות לקבלת תואר "דוקטור לפילוסופיה"

מאת

איתי אופטובסקי

הוגש לסינאט אוניברסיטת בן גוריון בנגב

חשון תשע"ד אוקטובר 2013

שדה בוקר