US 2015O167065A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2015/0167065 A1 Nelson et al. (43) Pub. Date: Jun. 18, 2015

(54) ISOTHERMAL AMPLIFICATION OF (22) Filed: Dec. 13, 2013 NUCLECACDS WITHNA POROUS MATRIX Publication Classification (71) Applicant: General Electric Company, (51) Int. Cl. Schenectady, NY (US) CI2O I/68 (2006.01) (52) U.S. Cl. (72) Inventors: John Richard Nelson, Clifton Park, NY CPC ...... CI2O I/6844 (2013.01) (US); David Roger Moore, Rexford, NY (US); Bing Li, Clifton Park, NY (US); (57) ABSTRACT Robert Scott Duthie, Schenectady, NY Provided herein are methods for amplification a target (US); Patrick McCoy Spooner, dsDNA that is impregnated within a porous matrix using Slingerlands, NY (US) endonuclease-assisted DNA amplification. The amplicons may be subsequent detected within the porous matrix or may (73) Assignee: General Electric Company, be eluted out of the porous matrix. Methods for extracting a Schenectady, NY (US) genetic material from a biological sample using endonu clease-assisted DNA amplification within a porous matrix are (21) Appl. No.: 14/106,264 also provided. Patent Application Publication Jun. 18, 2015 Sheet 1 of 6 US 201S/O167065 A1

Inosine Inosine-containing f primer I

Target DNA DNA Polymerase O Y Endonuclease& I

I y Endonuclease nicking -uiem y y

FIG. 1 Patent Application Publication Jun. 18, 2015 Sheet 2 of 6 US 201S/O167065 A1

Exonuclease-resistant, inosine-containing primer

Exonuclease treatment

Exonuclease inactivation Inosine

I f Target DNA DNA Polymerase O Y Endonuclease&

T y Endonuclease nicking

FIG. 2 Patent Application Publication Jun. 18, 2015 Sheet 3 of 6 US 201S/O167065 A1

No Template 50 ng TB DNA — — —

Thioation - --

5% FiCOI - H |

FIG. 3 Patent Application Publication Jun. 18, 2015 Sheet 4 of 6 US 201S/O167065 A1

SOUtion NC PEGNC 903 PEG 903 FUSiOn 5

CD o H d g 2 g 2 g 2 g Z Z Z Z

FIG. 4 Patent Application Publication Jun. 18, 2015 Sheet 5 of 6 US 201S/O167065 A1

Seidoo Seldoo O. Seldoo OOL Seidoo O'OOL Seldoo 00'00 seidoo OOOOOL OLN Jexe/N

JeyueW Seldoo seidoo Ol seidoo 00 seldoo O'OO seidoo OO'OOL Seidoo OOOOOL OLN Patent Application Publication Jun. 18, 2015 Sheet 6 of 6 US 201S/O167065 A1

OO-OfM. GuoSn

GUOISn

OO-OfM ON pe)009

ON pe)0OI9

OO-OfM ON

ON

OO-IO/W GuoSn

GUOISn

OO-OfM ON pe)009

ON pe)3O9

OO-O FM ON

ON OO - O UAA IOIUOO em|ISO US 2015/O167065 A1 Jun. 18, 2015

ISOTHERMAL AMPLIFICATION OF 0005) DNA detection techniques employing simplified NUCLECACDS WITHNA POROUS DNA amplification methods that do not require target dsDNA MATRIX denaturation prior to its amplification would offer several potential advantages for processing and screening of a broad FEDERALLY SPONSORED RESEARCH & range of sample types. Further, along with simpler and robust DEVELOPMENT sample preparation and processing methods for trace and/or 0001. This invention was made with Government support dilute target nucleic acids, such techniques would greatly under contract number HR0011-11-2-0007, held by the Uni facilitate DNA-based assays in POC and field-deployed versity of Washington awarded by the Defense Advanced assayS. Research Projects Agency (DARPA). The Government has certain rights in the invention. BRIEF DESCRIPTION 0006. In some embodiments, a method for producing at FIELD OF INVENTION least one amplicon based on a target dsDNA within a porous matrix is provided. The method comprises the steps of pro 0002 The invention generally relates to isothermal ampli viding the porous matrix, impregnating the target dsDNA fication of a double stranded DNA (dsDNA) within a porous within the porous matrix and amplifying at least one portion matrix. It further relates to amplification of a dsDNA (e.g., a of the impregnated target dsDNA within the porous matrix to genomic DNA) that is impregnated within a porous matrix produce at least one amplicon within the porous matrix. The using an endonuclease-assisted nucleic acid amplification amplification is performed under isothermal conditions by and Subsequent detection of amplicons within the porous contacting the impregnated, target dsDNA with a DNA matrix. amplification reaction mixture comprising at least one BACKGROUND inosine-containing primer, at least one 5'-->3' exonuclease deficient DNA polymerase having strand displacement activ 0003. With the development of a variety of techniques for ity, at least one nuclease that is capable of nicking a DNA at isolation, amplification and detection of nucleic acids, a residue 3' to an inosine residue, and dNTP mixture. The nucleic acid-based assays have emerged over the years as DNA amplification may be performed under isothermal con powerful tools for various applications such as diagnostic and ditions without any prior denaturation of the dsDNA to single forensic analysis. However, even today, immunoassays have stranded DNA (ssDNA). more widespread acceptance then nucleic acid-based assays 0007. In some embodiments, a method for extracting a due to their easy formats and lower operational costs Immu genetic material from a biological sample using a nuclease noassays are less complex than nucleic acid-based assays assisted DNA amplification assay is provided. The biological since they are simple detection assays and do not involve any sample is first contacted with a porous matrix comprising target amplification step. In contrast, amplification of a chemicals that lyse the biological sample and preserve the nucleic acid target (e.g., DNA amplification) is a critical step genomic DNA within the porous matrix. At least one portion in many of the nucleic acid-based assays. DNA amplification of the preserved genomic DNA is then amplified within the is a process of replicating a target DNA to generate multiple porous matrix to produce the at least one amplicon within the copies of it. Since individual strands of a dsDNA are antipar porous matrix. The at least one amplicon is interrogated or allel and complementary, each Strand may serve as a template eluted out of the porous matrix for interrogation. The ampli strand for the production of its complementary strand. The fication of the preserved genomic DNA is performed within template strand is preserved as a whole or as a truncated the porous matrix by contacting the preserved genomic DNA portion and the complementary Strand is assembled from within the porous matrix with a DNA amplification reaction deoxynucleoside triphosphates (dNTPs) by a DNA poly mixture comprising at least one inosine-containing primer, at merase. The complementary strand synthesis proceeds in least one 5'-->3' exonuclease-deficient DNA polymerase hav 5'-->3' direction starting from the 3' terminal end of a primer ing strand displacement activity, at least one nuclease that is sequence that is hybridized to the template strand. capable of nicking a DNA at a residue 3' to an inosine residue, 0004 For most of the currently known DNA amplification and dNTP mixture. The DNA amplification may be per techniques, expensive and/or complex equipment and higher formed under isothermal conditions without any prior dena levels of skilled labor are required. For nucleic acid-based turation of the dsDNA to single stranded DNA (ssDNA). analysis to become widely used for clinical or industrial applications, complexity of assays/instrumentation and their DRAWINGS cost need to be reduced. Specifically, if nucleic-acid based tests were to be performed at the point of care (POC) level 0008. These and other features, aspects and advantages of (e.g., near patient or near process), simple, easy to use, cost the present invention will become better understood when the competitive systems are essential. DNA-based assays involv following detailed description is read with reference to the ing thermal cycling amplification have been performed in a accompanying figures. lateral flow stick employing an associated thermally-regulat 0009 FIG. 1 illustrates a schematic representation of able apparatus. However, such thermal cycling amplification endonuclease-assisted DNA amplification usinginosine-con methods are less than ideal, for example, for POC applica taining primers. tions. Even though isothermal nucleic acid amplification 0010 FIG. 2 illustrates a schematic representation of (e.g., SMART reaction) of a target DNA putatively immobi endonuclease-assisted DNA amplification using exonu lized in a porous matrix (e.g., FTA paper) has been attempted, clease-resistant, inosine-containing primers. such methods involved prior heating of the immobilized, 0011 FIG. 3 illustrates enhanced efficiency of endonu target dsDNA to thermally denature the target dsDNA to its clease-assisted DNA amplification using exonuclease-resis single stranded counterparts. tant, inosine-containing primers. US 2015/O167065 A1 Jun. 18, 2015

0012 FIG. 4 illustrates endonuclease assisted isothermal agents like albumin (e.g., BSA) or pyrolidine) that may be amplification of a target dsDNA in different porous matrices required for a DNA amplification reaction. and in Solution. 0020. As used herein, the term “primer' refers to a short 0013 FIG. 5A illustrates detection limits when endonu linear oligonucleotide that hybridizes to a target DNA to clease assisted amplification is performed in Solution. prime a DNA synthesis reaction. The primer may be an RNA 0014 FIG. 5B illustrates detection limits when endonu oligonucleotide, a DNA oligonucleotide, or a chimeric clease assisted amplification is performed in a PEG-modified sequence. The primer may contain natural, synthetic, or nitrocellulose porous matrix. modified nucleotides. For example, the primer may comprise 0015 FIG. 6A illustrates the effects blocking agents and/ naturally occurring nucleotides (G, A, C or T nucleotides) or or other additives on endonuclease assisted isothermal ampli their analogues. Both the upper and lower limits of the length fication of a target dsDNA in solution. of the primer sequence may be empirically determined. The 0016 FIG. 6B illustrates the effects blocking agents and/ lower limit on primer length is the minimum length that is or other additives on endonuclease assisted isothermal ampli required to form a stable duplex upon hybridization with the fication of a target dsDNA in different porous matrices. target DNA under DNA amplification reaction conditions. Very short primers (usually less than 3 nucleotides long) do DETAILED DESCRIPTION not form thermodynamically stable duplexes with target 0017. To more clearly and concisely describe and point out DNA under such hybridization conditions. The upper limit is the subject matter of the claimed invention, the following often determined by the possibility of having a duplex forma definitions are provided for specific terms, which are used in tion in a region other than the pre-determined DNA sequence the following description and the appended claims. in the target DNA. Generally, suitable primer lengths are in 0018. As used herein, the term “target DNA” refers to a the range of about 4 nucleotides long to about 40 nucleotides DNA sequence of either natural or synthetic origin that is long. In some embodiments the primer ranges in length from desired to be amplified in a DNA amplification reaction. The 5 nucleotides to 30 nucleotides. The term “forward primer' target DNA acts as a template in the nucleic acid amplification refers to a primer that anneals to a first strand of the target reaction. In a DNA amplification reaction, either a portion of DNA and the term “reverse primer' refers to a primer that a target DNA or the entire region of a target DNA may get anneals to a complimentary, second strand of the target DNA. amplified by a DNA polymerase to produce one or more Together, a forward primer and a reverse primer are generally amplification products (amplicons). The target DNA may be oriented on the target DNA sequence in a manner analogous obtained from a variety of sources, for example, from a bio to PCR primers, such that a DNA polymerase can initiate the logical sample (i.e., a sample obtained from a biological DNA synthesis resulting in replication of both strands. Subject) in Vivo or in vitro, a food, an agricultural sample, or 0021. As used herein, the term “inosine-containing an environmental sample. The target DNA may be obtained primer' refers to a primer comprising at least one inosine from, but are not limited to, bodily fluid or an exudate (e.g., residue in its sequence. The inosine residue is a 2'-deoxyri blood, blood plasma, serum, milk, cerebrospinal fluid, pleural bonucleoside or 2'-ribonucleoside residue, wherein the fluid, lymph, tears, sputum, saliva, stool, lung aspirates, nucleobase is a hypoxanthine. Inosine residue may also be an throat or genital Swabs, or urine), organs, tissues, fractions inosine analogue, for example, Xanthine structures that result and sections (e.g., sectional portions of an organ or tissue), from deamination of guanine. The inosine residue is capable cells isolated from a biological Subject or from a particular of base pairing with a thymine, an adenine, a cytidine or a region (e.g., a region containing diseased cells, or circulating uridine residue. Inosine analogues may be a 2'-deoxyribo tumor cells) of a biological Subject, cell fractions, or cultures. nucleoside or 2'-ribonucleoside wherein the nucleobase The biological sample that contains or Suspected to contain includes a modified base Such as Xanthine, uridine, oxanine the target DNA may be of eukaryotic origin, prokaryotic (oxanosine), other O-1 purine analogs, N-6-hydroxylami origin, viral origin, or bacteriophage origin. For example, the nopurine, nebularine, 7-deaza hypoxanthine, other 7-dea target DNA may be obtained from an insect, a protozoa, a Zapurines, and 2-methyl purines. The inosine or inosine ana bird, a fish, a reptile, a mammal (e.g., rat, mouse, cow, dog, logue residue may be positioned near the 3' terminal end of a guinea pig, or rabbit), or a primate (e.g., chimpanzee or primer sequence, often as a penultimate nucleotide at the 3' human). The DNA product generated by another reaction, end of the primer sequence. Such as a ligation reaction, a PCR reaction, or a synthetic 0022. As used herein, the term “exonuclease resistant, DNA may also serve as the target DNA. The target DNA may inosine-containing primer refers to an inosine-containing be a circular DNA, a linear DNA or a nicked DNA. The target primer sequence that is resistant to the action of an exonu DNA may be a genomic DNA or a plasmid DNA. clease enzyme (i.e., not degraded by the exonuclease). In 0019. As used herein, the term “DNA amplification reac Some embodiments, the exonuclease resistant primer may be tion mixture' refers to a mixture of reagents that is essential resistant to both 3'->5' exonuclease activity and 5'-->3' exo for performing a DNA amplification reaction of a target DNA. nuclease activity. In some embodiments, the exonuclease The DNA amplification reaction mixture disclosed herein resistant prime is resistant to 3'->5' exonuclease activity. The includes, at the minimum, at least one inosine-containing inosine-containing primer may be engineered to make it exo primer, dNTPs, at least one nuclease that is capable of nicking nuclease-resistant by chemical modification, for example, by an inosine-containing strand of a dsDNA at a reside 3' to the introduction of at least one phosphorothioate linkage at an inosine residue and at least one DNA polymerase having appropriate position. For example, an inosine-containing strand displacement activity. The DNA polymerase may be a primer that contains a phosphorothioate linkage between the 5'-->3' exonuclease-deficient DNA polymerase. It may further 3' terminal nucleotide and the penultimate residue is resistant include reagents such as buffer(s), salt(s) and other compo to the action of exonuclease in a 3'->5' direction. Since the nents (e.g., accessory proteins such as single Stranded DNA 3'->5' exonuclease digests the nucleic acid in a 3' to 5' direc binding protein, denaturant like urea, glycerol, blocking tion, the phosphorothioate linkage at this position prevents US 2015/O167065 A1 Jun. 18, 2015

the digestive action of the exonuclease. If the inosine residue include degenerate sequences. For example, the codons is present on the 5' side of the phosphorothioate, it will be GCA, GCC, GCG, and GCU all encode alanine. Thus, at maintained in the primer. Similarly, an inosine-containing every amino acid position where an alanine is specified, any primer that contains a phosphorothioate linkage between the of these codons may be used interchangeably in constructing 5' terminal nucleotide and the penultimate residue is resistant a corresponding nucleotide sequence. Such nucleic acid vari to the action of exonuclease in a 5'-->3' direction. When an ants are conservative variants, since they encode the same exonuclease-resistant, inosine containing primer hybridizes protein (assuming that is the only alternation in the sequence). with a target DNA and forms double stranded nucleic acid One skilled in the art recognizes that each codon in a nucleic structure, the double stranded structure may be recognized by acid, except for AUG (sole codon for methionine) and UGG specific endonucleases resulting in a single stranded nick in (tryptophan) may be modified conservatively to yield a func the inosine-containing Strand. For example, endonuclease V tionally identical peptide or protein molecule. As to amino is capable of nicking the inosine-containing strand of a acid sequences, one skilled in the art will recognize that double stranded DNA at a position 3' to the inosine residue alteration of a polypeptide or protein sequence via Substitu when the exonuclease-resistant inosine-containing primer is tions, deletions, or additions of a single amino acid or a small hybridized to a target DNA. number (typically less than about ten) of amino acids may be 0023. As used herein, the term “dNTPs’ refers to a mix a “conservative variant' if the physico-chemical properties of ture of deoxynucleotide triphosphates that act as precursors the altered polypeptide or protein sequence is similar to the required by a DNA polymerase for DNA synthesis. Each of original. In some cases, the alteration may be a Substitution of the deoxynucleotide triphosphates in a dNTP mixture com one amino acid with a chemically similar amino acid. prises a deoxyribose Sugar, an organic base, and a phosphate Examples of conservative variants include, but not limited to, in a triphosphate form. A dNTP mixture may include each of the Substitution of one hydrophobic residue (e.g., isoleucine, the naturally occurring deoxynucleotide triphosphate (e.g., valine, leucine or methionine) for one another; or the substi dATP, dTTP, dGTP, dCTP or dUTP). In some embodiments, tution of one polar residue for another (e.g., the Substitution of each of the naturally occurring deoxynucleotide triphos arginine for lysine, glutamic for aspartic acid, or glutamine phates may be replaced or Supplemented with a synthetic for asparagine) and the like. Genetically encoded amino acids analog, provided however that inosine base may not replace generally may be divided into four families: (1) acidic: aspar or supplement guanosine base (G) in a dNTP mixture. Each of tate, glutamate; (2) basic: lysine, arginine, histidine; (3) non the deoxynucleotide triphosphates in dNTP may be present in polar: alanine, Valine, leucine, isoleucine, proline, phenyla the reaction mixture at a final concentration of 10 uM to lanine, methionine, tryptophan; and (4) uncharged polar: 20,000 uM, 100 uM to 1000 uM, or 200 uM to 300 uM. glycine, asparagine, glutamine, cysteine, serine, threonine, 0024. As used herein, the term “amplicon' refers to tyrosine. nucleic acid amplification products that result from the ampli 0027. The examples of the methods relate to endonu fication of a target nucleic acid. Amplicons may comprise a clease-assisted DNA amplification (referred to as “Ping mixture of amplification products (e.g. a mixed amplicon Pong' amplification) of a target dsDNA on a porous matrix. population), several dominant species of amplification prod The endonuclease-assisted DNA amplification is generally ucts (e.g. multiple, discrete amplicons), or a single dominant aninosine-mediated amplification, wherein the endonuclease species of amplification product. A single species of amplicon is capable of nicking an inosine-containing strand of a may be isolated from a mixed population of amplicons using dsDNA. The target dsDNA is amplified as such without any art-recognized techniques, such as affinity purification or prior denaturation to ssDNA molecules. The target dsDNA, electrophoresis. An amplicon may comprise single-stranded which is impregnated on the porous matrix, is amplified or double-stranded DNA depending on the reaction scheme within the porous matrix to produce at least one amplicon used. An amplicon may be largely single-stranded or partially based on the target dsDNA. The target dsDNA is not eluted double-stranded or completely double-stranded DNA. out of the porous matrix prior to or after the amplification 0025. The term “mutant endonuclease' or “engineered reaction. The amplification reaction happens inside the endonuclease' as used herein refers to an endonuclease porous matrix and not in Solution and the amplicons are enzyme that is generated by genetic engineering or protein generated within the porous matrix. The amplicons may be a engineering, wherein one or more amino acid residues are single stranded or a double-stranded DNA, often extending to altered from the wild type endonuclease. The alteration may the end of the template Strand. Ping Pong amplification may include a Substitution, a deletion or an insertion of one or use about 2 to 20 or more total numbers of nested primers to more amino acid residues. Throughout the specification and amplify a target dsDNA template. The generated amplicons claims, the Substitution of an amino acid at one particular may be Subsequently detected within the porous matrix using location in the protein sequence is referred using a notation a variety oftechniques or they may be eluted out of the porous “(amino acid residue in wild type enzyme) (location of the matrix using appropriate eluents. amino acid in wild type enzyme) (amino acid residue in 0028 FIG. 1 depicts a schematic representation of an engineered enzyme). For example, a notationY75A refers to embodiment of endonuclease-assisted target DNA amplifica a substitution of a Tyrosine (Y) residue at the 75" position of tion. The target DNA is amplified using an inosine-containing the wild type enzyme by an Alanine (A) residue (in mutant/ primer, a DNA polymerase (e.g., a strand displacement poly engineered enzyme). merase) and dNTPs in presence of an endonuclease (e.g., 0026. The term “conservative variants', as used herein, endonuclease V) that is capable of nicking an inosine-con applies to both amino acid and nucleic acid sequences. With taining strand of a dsDNA at a location 3' to the inosine respect to particular nucleic acid sequences, the term “con residue. Inosine residue in the primer may base pair with a servative variants’ refers to those nucleic acids that encode cytidine residue or a thymidine residue in the target DNA, identical or similar amino acid sequences (ie, amino acid wherein hypoxanthene Substitutes for a guanine to comple sequences that have similar physico-chemical properties) and ment a cytosine, or Substitutes for an adenine to complement US 2015/O167065 A1 Jun. 18, 2015 a thymine. Upon binding of the inosine-containing primer to phosphodiester bonds 3' to the inosine (i.e., specifically nicks the target DNA, the DNA polymerase (e.g., a 5'-->3 exonu a DNA at a position two nucleotides 3' to an inosine nucle clease-deficient Bst DNA polymerase) extends the inosine otide, about 95% the second phosphodiester bond and about containing primer thereby generating a dsDNA (primer 5% the third phosphodiester bond) leaving a nick with 3'-hy extension product). Generation of the dsDNA in turn gener droxyl and 5'-phosphate. When the target DNA is double ates a nicking site for the endonuclease, which is capable of Stranded, the Endonuclease V nick occurs in the Strand com creating a single stranded nick at the inosine-containing prising the inosine residue. strand of a dsDNA at a position 3' to the inosine residue. The endonuclease nicks the inosine-containing Strand of this 0032 Endonuclease-assisted DNA amplification as illus double-stranded DNA. Nicking creates a new DNA synthesis trated in FIG. 1 may be varied, for example, by employing initiation site for the DNA polymerase. The DNA polymerase additional primers, additional enzymes, additional nucle binds to this initiation site and further elongates the nicked otides, stains, dyes, or other labeled components. For primer. DNA polymerases use dNTP mixture to add nucle example, each of the naturally occurring deoxynucleotides in otides to the 3' hydroxyl end of the nick creating a new DNA a dNTP mixture may be replaced or supplemented with a Strand (amplicon) complementary to the target DNA’s tem synthetic analogue, provided however that deoxyinosine plate strand. This elongation step once again creates a nicking triphosphate (dITP) may not replace or supplement dGTP in site for the endonuclease. Since the DNA polymerase has the dNTP mixture. With a single, forward primer, the rate of Strand displacement activity, it displaces a ssDNA product synthesis of complimentary copies of target DNA is relatively while it re-creates the double-stranded primer extension constant, resulting in a steady, linear increase in the number of product. Thus the elongation by the DNA polymerase fol complimentary copies with time. Multiple primers may be lowed by nicking by the endonuclease Such as endonuclease included in the reaction mixture to accelerate the amplifica V gets repeated multiple times until any one of the essential tion process. Paired primers comprising a forward primer and DNA amplification reagents in the DNA amplification reac a reverse primer may be included in the reaction mixture for tion mixture is exhausted. In each cycle, the strand displace generating both the plus and minus Strands. For example, ment DNA polymerase employed in these reactions displaces when a reverse primer (a primer that anneals to the generated the complementary strand that was generated in the previous complementary strand ((+) strand) to further generate a (-) cycle. The steps of hybridization, elongation, nicking and Strand in the reverse direction) that anneals to the comple further elongation may occur Substantially simultaneously. mentary strand of target DNA at a defined distance from the This cycle repeats, synthesizing multiple single strands of forward primer is added, the amplification process is accel erated. Since the targets for each of these primers would be DNA complementary to the downstream portion of the target present in the original template, both Strands would be ampli DNA template. fied in the two primer scheme (“Ping product” being the 0029. The inosine-containing primer may be a forward amplicon of the forward primer and the “Pong product' being primer or a reverse primer or a mixture of both. Amplicons may be generated using a single inosine-containing primer, the amplicon of the reverse primer). The inclusion of multiple paired inosine-containing primers, or nested-paired inosine paired primers may improve the relative percentage of a dis containing primers. The inosine-containing primer may dem crete product in the reaction mixture. onstrate a melting temperature of 25°C. to 80°C., 30° C. to 0033. In some embodiments, a method of producing at 65° C., or 40° C. to 55° C. in the reaction mixture. In some least one amplicon based on a target double stranded DNA embodiments, the inosine-containing primer demonstrates a within a porous matrix using an endonuclease-assisted DNA melting temperature of 50° C. in the reaction mixture having amplification is provided. The method comprises the steps of a salt concentration of about 6 mM. The inosine-containing (a) providing the porous matrix, (b) impregnating the target primer(s) are engineered to have a nucleotide sequence that is double stranded DNA within the porous matrix, (c) contact complementary, in the Watson-Crick sense, to a pre-deter ing the impregnated, target double stranded DNA with a DNA mined sequence, which is present in the target DNA template. amplification reaction mixture comprising at least one 0030. In general, the inosine analogue residue of the inosine-containing primer, at least one 5'-->3' exonuclease inosine-containing primer is positioned away from the 5' end deficient DNA polymerase having strand displacement activ of the prime Such that the primer remains annealed to the ity, at least one nuclease that is capable of nicking a DNA at target DNA after nicking by the endonuclease (e.g., the length a residue 3' to an inosine residue, and dNTP mixture, and (d) of the nicked primer is sufficient to enable binding to the amplifying at least one portion of the impregnated target target DNA under the nucleic acid amplification reaction double stranded DNA within the porous matrix using the conditions). In some embodiments, the inosine nucleotide in DNA amplification reaction mixture of step (c) to produce the the inosine-containing primer may be positioned at least 4 at least one amplicon within the porous matrix. The nuclease nucleotides, at least 5 nucleotides, or at least 10 nucleotides may be an endonuclease that is capable of nicking the inosine downstream of the 5' end of the inosine-containing primer. In containing strand of a double stranded DNA at a residue 3' to Some embodiment, the inosine-containing primer may com an inosine residue. In some embodiments, an endonuclease V prise more than one inosine residue or inosine analogues. For may be used in the DNA amplification reaction. The endonu example, inosine may be present at both the penultimate 3' clease V may be a wild type endonuclease or a mutant endo residue and ultimate 3' residue (e.g., NNNNNIIN). In some nuclease. embodiments, an inosine analogue may be substituted for the 0034. The DNA amplification reaction on the porous inosine of the inosine-containing primer. matrix is performed under isothermal conditions. The reac 0031. An endonuclease such as endonuclease V may be tion temperature during an isothermal amplification reaction used as for the DNA amplification reaction. Endonuclease V condition may range 1° C. 5°C., or 10° C. from a set tem is a repair enzyme that recognizes DNA containing inosines perature. In some embodiments, the target dsDNA is ampli (or inosine analogues) and hydrolyzes the second or third fied within the porous matrix at 45° C. (+1° C.). Thermally US 2015/O167065 A1 Jun. 18, 2015

stable endonucleases and DNA polymerases may be used the porous matrix. In some embodiments, the porous matrix depending upon the reaction temperature of DNA amplifica may be a cellulose membrane or a nitrocellulose membrane. tion reaction. In some other embodiments, the porous matrix is a polyeth 0035. The impregnated dsDNA in the porous matrix is yleneglycol-modified cellulose membrane or polyethyleneg amplified within the porous matrix without any prior dena lycol-modified nitrocellulose membrane with reduced pro turation step (e.g., thermal denaturation). Further, the dsDNA tein binding capabilities. is not eluted out of the porous matrix prior to amplification, 0037. In some embodiments, the porous matrix may be and thus amplification happens in the porous matrix and not in FF60 nitrocellulose (GE Healthcare), PEGMA 300 grafted the solution in a tube or well. The primers, either alone or in nitrocellulose (NC-PEG), 903 cellulose (GE Healthcare), combination may increase the chances to strand invade to PEGMA 300 grafted 903 cellulose (903-PEG), 31-ETF cel create a “D-loop” that initiates the endonuclease-assisted lulose (GE Healthcare), Fusion 5 (GE Healthcare), Glass DNA amplification. Once the target DNA amplification is Fiber (Standard 17, GF/F, both from GE Healthcare), or over, the amplicons may be detected within the porous matrix Quartz (QMA, from GE Healthcare). Coating and grafting of to determine the presence, absence or quantity of a particular porous cellulose substrates (e.g., 903, 31ETF) or nitrocellu amplicon and/or to detect the reaction kinetics of DNA ampli lose (FF60, FF80HP) may be performed in an aqueous solu fication. Further, the amplicon may subsequently be eluted tion containing 10% PEGMA 300 (polyethylene glycol out of the porous matrix postamplification. The impregnation methyl ether methacrylate, Number average molecular of the target dsDNA within the porous matrix may be per weight (M): 300, from Sigma Aldrich) and 30% Tween 20, formed by any of the known methods. The impregnation may followed by electronbeam irradiation of the coated substrate. be done via chemisorption or physiosorption. For example, a Electron beam (e-beam) irradiation creates free radicals on porous matrix (e.g., FTATM paper, GE Healthcare) that con the membrane surface which initiates polymerization of the tains impregnated lysing agents (e.g., detergents, urea) may methacrylate monomers, and as a result, the PEG moieties are be used to lyse a biological sample in the porous matrix. The permanently introduced to the membranes. After the e-beam detergent may be an ionic detergent Such as sodium dodecyl treatment, the treated membranes may be washed with water sulfate (SDS). The porous matrix may further contain chemi to remove co-solvent Tween 20 and ungrafted PEG species cals that stabilize a genomic DNA (e.g., an anti-oxidant, and then dried. For example, the polyethyleneglycol-modi chaotrope). Thus the genomic DNA in a biological sample fied cellulose membrane is fabricated through e-beam irra may be impregnated in the porous matrix by contacting a diation of the cellulose membrane in presence of an active biological sample with a porous matrix, which lyses the bio compound containing a polyethyleneglycol group (e.g., poly logical sample and preserve the genomic DNA. When the ethyleneglycol methyl ether methacrylate). Polyethylenegly porous matrix contains a detergent, an amplification mixture col-modified nitrocellulose membrane is fabricated through comprising a detergent sequestering agent may be used for e-beam irradiation of the nitrocellulose membrane in pres DNA amplification. The detergent sequestering agent seques ence of an active compound containing a polyethyleneglycol ters the ionic Surfactant that is present in the porous matrix, group (e.g., polyethyleneglycol methyl ether methacrylate). which may otherwise inhibit the DNA amplification reaction. 0038. The DNA amplification reaction mixture may fur Suitable detergent sequestering agent includes, but are not ther comprise one or more of reagents that enhance or assist limited to, alpha-cyclodextrins and polyamines. In some DNA amplification reaction such as buffers, single strand embodiments, the genomic DNA may not leach out of the DNA binding protein (e.g., E. coli SSB, T4 gene 32 protein porous matrix due to its high molecular weight. However, (T4 g32p), T7 gene 2.5 protein, Ncp7, recA, or combinations after amplification of at least one portion of the impregnated thereof), topoisomerase, formamide, ethylene glycol, reduc genomic DNA, the amplicon, due to its Smaller sizes, may be ing agents, alpha-cyclodextrin, or Ficoll. Any buffers (e.g., eluted to a different area of the porous matrix or may be eluted Tris buffer, HEPES buffer) that result in a reaction pH out of the porous matrix by using appropriate eluents (e.g., TE between 6 and 9 may be used for the DNA amplification buffer). reaction. In some embodiments, the pH of the DNA amplifi 0036. The porous matrix may be selected so that they are cation reaction mixture is about 8.0. In some embodiments, capable of holding the target dsDNA within its porous struc buffers that enhance DNA stability (e.g., HEPES) may be tures. The efficient impregnation of target dsDNA may used. Thermo-labile buffers such as Tris-Borate, HEPES, and depend on a variety of factors including the pore size, bio MOPS buffers may be disfavored in some specific DNA compatibility and the molecular weight of the dsDNA. Suit amplification reactions. In some specific embodiments, the able porous matrixes that may be used include, but are not DNA amplification reaction buffer may comprise 25 mM limited to, a cellulose membrane, a nitrocellulose membrane, Tris-Borate; 5 mM MgCl; 0.01% Tween; and 20% ethylene a cellulose acetate membrane, a nitrocellulose mixed ester glycol. The DNA amplification reaction mixture may further membrane, a glass fiber, a polyetherSulfone membrane, a include one or more of blocking agents (e.g., bovine serum nylon membrane, a polyolefin membrane, a polyester mem albumin (BSA), human serum albumin, bactopeptone, brane, a polycarbonate membrane, a polypropylene mem casein) and/or surfactants (e.g., non-ionic detergents, for brane, a polyvinylidene difluoride membrane, a polyethylene example 0.01% of Tween 20). The non-specific binding of membrane, a polystyrene membrane, a polyurethane mem proteins in the DNA amplification reaction mixture (e.g., brane, a polyphenylene oxide membrane or a poly(tetrafluo DNA polymerase) on to the porous matrix may render it roethylene-co-hexafluoropropylene) membrane. The porous unavailable for DNA amplification reaction. Inclusion of matrix may be modified (e.g., coated) with Suitable materials blocking agents and/or detergents in the DNA amplification to alter the characteristics of the porous matrix. For example, reaction mixtures reduces or eliminates the non-specific bind the porous matrix may be coated with an alkyl (oligooxyalky ing of proteins or other reagents to the porous matrix. In some lene) group (e.g., an R-(O—CH2—CH2—), group) to embodiments, the Surfactant may be a non-ionic detergent reduce the active binding (e.g., specific binding) of proteins to selected from Tween-20, NP-40, Triton-X-100, or combina US 2015/O167065 A1 Jun. 18, 2015

tions thereof. In some embodiments, 0.05% NP-40 and may range depending on the length of the primer used, for 0.005% Triton X-100 is used for the reaction. The DNA example, the value of n may range from 0 to 13). However, in amplification reaction mixture may further include at least some embodiments, the primer could have the modified one topoisomerase (e.g., a type 1 topoisomerase). The topoi nucleotide as the inosine residue (e.g., NNNNNN*IN). In Somerase may be present in the reaction mixture at a final some embodiments, the modified nucleotide may be located concentration of at least 0.1 ng/uL. The single stranded DNA at a position other than the 3'-terminal position provided that binding protein may be present in the reaction mixture at a the primer sequence contains at least one inosine residue final concentration of at least 0.1 ng/uL. The DNA amplifi located next to the modified residue (e.g., NNNNI*NNNN or cation reaction mixture may also include one or more reduc NNNN*INNNN). When the modified nucleotide is located at ing agents such as dithiothreitol (DTT), 2-mercaptoethanol positions other than the 3'-terminal end of a primer sequence, (BME), Tris(carboxyethyl) phosphine (TCEP), or 2-mercap the 3'-terminal nucleotide of said primer may be removed by toethylamine (MEA) that reduces the oxidation of enzymes in the 3'->5' exonuclease activity. Other nucleotide modifica the reaction mix and improves the quality and yield of the tions known in the art that make a nucleotide sequence resis amplicons produced. In some embodiments, the DNA ampli tant to an exonuclease may be used as well. fication mixture further includes one or more of blocking 0041 Any of the DNA polymerases known in the art may agents such as albumin (e.g., BSA), powdered milk, gelatin, be employed for DNA amplification. DNA polymerases suit casein, or bactopeptone. The DNA amplification reaction able for use in the inventive methods may demonstrate one or may be performed in an unmodified porous Substrate in pres more of the following characteristics: strand displacement ence of a blocking agent. The DNA amplification reaction activity, the ability to initiate strand displacement from a nick, may be performed in an modified porous substrate either in and/or low degradation activity for single stranded DNA. In presence or in absence of a blocking agent. some embodiments, the DNA polymerase employed may be 0039. The primer employed for the DNA amplification devoid of one or more exonuclease activities. For example, reaction in the porous matrix may be exonuclease-resistant. the DNA polymerase may be a 3'->5' exonuclease-deficient FIG. 2 depicts a schematic representation of an embodiment DNA polymerase or the DNA polymerase may lack 5'-->3' of the endonuclease-assisted DNA amplification reaction exonuclease activity. In some embodiments, the DNA poly using exonuclease-resistant, inosine-containing primer. Prior merase may lack both 3'->5' and 5'-->3' exonuclease activities to the generation of the DNA amplification mixture, the (i.e., an exo (-) DNA polymerase). Exemplary DNA poly primer Solution containing the exonuclease-resistant, merases useful for the methods include, without limitation, inosine-containing primer, may be decontaminated by treat 5'-->3' exonuclease-deficient Klenow, 5'-->3'exonuclease-de ing with an appropriate exonuclease to remove any contami ficient Bst DNA polymerase (the large fragment of Bst DNA nating nucleic acid. The decontamination of the primer Solu polymerase), 5'-->3' exonuclease-deficient delta Tts DNA tion is often achieved by incubating the primer solution with polymerase, 5'-->3' exonuclease-deficient T7 polymerase exo an exonuclease and a divalent cation to allow the exonuclease (-) Klenow, or exo(-)T7 DNA polymerase (SequenaseTM). In to render the contaminating nucleic acid inert. A single exo Some embodiments, a combination of DNA polymerases may nuclease or a combination of exonucleases may be used to be used. decontaminate the primer Solution. Suitable exonucleases 0042 DNA polymerase enzymes typically require diva include, but are not limited, exonuclease I, exonuclease III, lent cations (e.g., Mg", Mn", or combinations thereof) for exonuclease VII. T7 gene-6 exonuclease, spleen exonuclease, DNA synthesis. Accordingly, one or more divalent cations T5 D15 exonuclease or lambda exonuclease. In one embodi may be added to the DNA amplification reaction mixture. For ment, a combination of exonuclease I and exonuclease III is example, MgCl, may be included in the reaction mixture at a used for decontaminating the primer Solution. After the concentration range of 2 mM to 6 mM. Higher concentrations decontamination reaction, the added exonuclease in the of MgCl2 may be preferred when high concentrations (e.g., primer Solution may be inactivated. If inactivation is not greater than 10 pmoles, greater than 20 pmoles, or greater performed after the decontamination reaction, the quantity of than 30 pmoles) of inosine-containing primer are included in exonuclease may be selected such that it does not interfere the reaction mixture. with the subsequent DNA amplification reaction in the porous 0043. In some embodiments, a mutant endonuclease V is matrix. In some embodiments, extender templates, which are included in the DNA amplification reaction mixture to nick specific primer sequences (e.g., primers that contain addi the inosine-containing double stranded DNA. The mutant E. tional 5' sequences that allow for additional sequence (e.g., a coli endonuclease may be a Y75A mutant E. coli endonu promoter sequence or a restriction endonuclease site specific clease V corresponding to SEQ ID NO: 2. This mutant is sequence or a novel primer binding site sequence) to be added generated by replacing the Tyrosine (Y) residue at the 75' to the end of hybridized amplicon DNA) may be annealed at position of a wild type E. coli endonuclease V (SEQID NO: the 3' end of the amplicon. 1) with an Alanine (A) residue. In some embodiments, a 0040. The exonuclease-resistant inosine-containing mutant Afu endonuclease Y74A (SEQ ID NO: 4) and/or its primer may comprise at least one nucleotide that makes the conservative variants is employed. The mutant Y74A Afu primer resistant to degradation by an exonuclease, particu endonuclease is generated by Substituting a Tyrosine (Y) larly by a 3'->5' exonuclease. For example, an exonuclease residue at the 75" position of a wildtype Afu endonuclease V resistant primer may possess one or more phosphorothioate (SEQID NO:3) with analanine (A) residue. In some embodi linkages between nucleotides in the sequence (e.g., ments, a Y80A mutant of Termotoga maritima (Tma) endo NNNNN*N*N*I*N or N*NNNN*N*N*I*N). The modified nuclease V (SEQID NO: 6) and/or its conservative variants is nucleotide is commonly a 3'-terminal nucleotide of the primer included the DNA amplification reaction mixture. sequence having a penultimate inosine residue (e.g., (NNN) 0044. In some embodiments, a rationally designed, NI*N or (NNN), NI*I where * represents a phosphorothio mutant endonuclease V enzyme is employed that has ate bond between the nucleotides and the integer value of n increased substrate binding, increased nicking efficiency, US 2015/O167065 A1 Jun. 18, 2015

increased nicking specificity and/or increased nicking sensi than a double stranded DNA comprising an inosine residue. tivity. A mutant endonuclease V may also be designed Such Some mutant endonucleases may nick structures other than that the substrate binding is reversible. The mutant endonu DNA sequences containing inosine residue while Some oth clease V enzyme may then Support repeated nicking by each ers may be very specific to inosine-containing DNA enzyme, whereas the corresponding wild type enzyme may sequences. For example, Tma and Afu endonucleases (SEQ be capable of only a single round (or a few limited rounds) of ID NO:3 and SEQID NO: 5) do not nick structures such as nicking (for example, the wild type E. coli endonuclease V flaps and pseudo Y structures. In some embodiments, when there are multiple inosine residues in a double stranded DNA, (SEQ ID NO: 1) remains bound to the DNA after nicking). the employed endonuclease V mutant may preferentially nick Such mutant endonuclease V may be used in a reaction mix (often 1 or 2 nucleotides 3' to the inosine residue) the inosine ture in less than Stoichiometric quantities to effect a nicking residue that is paired with a cytosine residue than the inosine reaction. In some embodiments, a conservative variant of the residue that is paired with a thymine residue. In some aspects, mutant endonuclease V may be used for the DNA amplifica the endonuclease V mutant may nicka double stranded DNA tion reaction. For example, further alteration of a mutant containing base pair mismatches. The nicking may happen at endonuclease V via substitution, deletion, and/or addition of the location of the base pair mismatch or at a location 3' to the a single amino acid or a small number (typically less than base pair mismatch that is separated by one or more bases. about ten) of amino acids may be a “conservative variant” if 0046. In some embodiments, a heat stable endonuclease V the physico-chemical properties of the altered mutant endo is used for the DNA amplification reaction. For example, nuclease V is similar to the original mutant endonuclease V. In Y75A E. coli endonuclease V mutant is inactivated by incu Some cases, the alteration may be a Substitution of one amino bation at temperatures above 50° C., whereas it retains its acid with a chemically similar amino acid. enzymatic activity at 37-49°C. Archaeoglobus fulgidus (Afu) 0045. The mutant endonuclease V may have a higher effi endonuclease V (both wild type (SEQID NO:3) and Y75A ciency than the wild type endonuclease V to nick the inosine mutant (SEQID NO: 4)) or Tma endonuclease V (both wild containing strand of the double stranded DNA when the type (SEQID NO: 5) and Y80A mutant (SEQID NO: 6)) are inosine is paired with cytosine or thymine. Further, a mutant generally more thermo stable than the E. coli endonuclease V endonuclease V may preferentially nick an inosine-contain (both wild type (SEQID NO: 1) and Y75A mutant (SEQID ing strand of a double stranded DNA than an inosine-contain NO: 2)). In some embodiments where strand displacement ing single stranded DNA. For example, Y75A E. colimutant DNA synthesis by DNA polymerase may be increased by endonuclease V (SEQ ID NO: 2) nicks a double stranded incubation at an elevated temperature, an endonuclease V DNA comprising an inosine residue better than a single which functions at high temperature (e.g., 45-80°C.) may be Stranded DNA comprising an inosine residue. In contrast, used. Y80ATma mutant endonuclease V (SEQ ID NO: 6) nicks a 0047 Table 1 provides the sequences of wild type endo single Stranded DNA comprising an inosine residue better nucleases and mutant endonuclease V enzymes. TABL E 1. Sequences of Wild type endonucleases, mutant endonucleases, template DNAs, and various primers

Ref. No. Sequence (N-term - C-term; 5'-->3') Length

Wide Type E. SEQ ID MIM DLASLRAQQIELASSWIREDRLDKD 225 coli : 1 PPD LIAGADWGFEOGGEWTRAAMWLLK endonuclease W YPSLELVEYKWARIATTMPYIPGFLSFRE YPALLAAWEMLSQKPDLVFWDGHGISH PRRLGWASHFGLLWDWPTIGWAKKRLCG PLSSEPGALAPLMDKGEOLAWWWR RCNPLFIATGHRVSVDSALAWWOR CMKGYRLPEPTRWADAWASERPAFWRY

Y75A multant E. SEQ ID MIM D ASLRAQQIELASSWIREDRLDKD 225 coli NO : 2 IAGADWGFEOGGEWTRAAMWLLK endonuclease W ELVEYKWARIATTMPAIPGFLSFRE LLAAWEMLSOKPDLVFWDGHGISH GWASHFGLLWDWPTIGWAKKRLCG E d LSSEPGALAPLMDKGEOLAWWWR R CNPLFIATGHRVSVDSALAWVOR TCMS GY R L P E PTRWADAWASERPAFWRY

Wild Type Aful SEQ ID OMNLEELRRIOEEMSRSWWLEDLIPL 221 endonuclease W NO : 3 E LEYVVGVDQAFISDEVVSCAVKLTFP LEWWDKAWRWEKWTFPYIPTFLMFREG PAVNAWKGLWDDRAAIMWDGSGIAHP RCGLATYIALKLRKPTWGITKKRLFGE WEWEDGLWRLLDGSETIGYALKSCRR KPIFISPGSYISPDSALELTRKCLKGYKL PEPIRIADKLTKEWKRELTPTSKLK US 2015/O167065 A1 Jun. 18, 2015

TABLE 1 - continued Sequences of Wild type endonucleases, mutant endonucleases, template DNAs, and various primers Ref. No. Sequence (N-term - C-term; 5'-->3') Length

Y74A multant SEO ID OMNLEELRRIOEEMSRSWWLED IPL 221 Aful NO: 4 ELEYVVGVDOAFISDEVVSCAVK TP endonuclease W EWWDKAWRWEKWTFPAIPTELM FREG PAVNAWKGLWDDRAAIMWDGSGIAHP RCGLATYIALK FGE EWEDGLWRLL DGSETIGYALKSCRR KPIFISPGSYISPDSALELTRKC E.EPIRIADKLTKEWKRELTPTSKL Wild Type Tma SEO ID DYROLHRWDLPPEEAIKVONELR 225 endonuclease W NO: 5 LTPYEGEPEYWAGWDLSFPGKEEGLAW EYPS FKILEWWSERGEITFPYIPGLL FREGPLFLKAWEKLRTKPDWWWF DGQ AHPRKLGIASHMGLFIEIPTIGWAKSR YGTFKMPEDKRCSWSYLYDGEEI IGCV RTKEGSAPIFWSPGHLMDWESSK RLIKA. T L PGRRIPEPTRLAHIYTORLKKGLF

Y8OA multant SEO ID DYROLHRWDLPPEEAIKVONELR 225 Tma NO: 6 LTPYEGEPEYWAGWDLSFPGKEEGLAW endonuclease W WWLEYPS FKILEWWSERGEITFPAIPGLL FREGPLFLKAWEKLRTKPDWWWF DGQ GLAHPRKLGIASHMGLFIEIPTIGWAKSR YGTFKMPEDKRCSWSYLYDGEEI IGCV I RTKEGSAPIFWSPGHLMDWESSK RLIKA. FTLPGRRIPEPTRLAHIYTORLKKGLF

0048. The amplicons produced by various embodiments 0050. The preserved genomic DNA may be amplified of the present DNA amplification methods may be deter within the porous matrix under isothermal conditions by mined qualitatively or quantitatively by any of the existing using the above-disclosed endonuclease-assisted DNA techniques. The amplicons may be detected either within the amplification methods. For example, in one embodiment, this porous matrix or outside of the porous matrix. For example, may be achieved by contacting the preserved genomic DNA for a qualitative or quantitative assay, terminal-phosphate with a DNA amplification reaction mixture comprising at labeled ribonucleotides may be used in combination with a least one inosine-containing primer, at least one 5'-->3' exo phosphatase during/after DNA amplification reaction for nuclease-deficient DNA polymerase having strand displace color generation. In Such embodiments, the terminal phos ment activity, at least one nuclease that is capable of nicking phate may be protected from dephosphorylation by using a DNA at a residue 3' to an inosine residue, and dNTP mix terminal-phosphate methyl esters of dNTPs or deoxynucleo ture. The nuclease may be an endonuclease Such as endonu side tetraphosphates. clease V or a mutant endonuclease V. At least one portion of 0049. In some embodiments, a method for extracting a the preserved genomic DNA may be amplified under isother genetic material from a biological sample via amplification of mal conditions within the porous matrix using the DNA the genetic material is provided. The genetic material may be amplification reaction mixture to produce the at least one an amplicon derived from a portion of the genomic DNA, for amplicon within the porous matrix. example, via whole genome amplification. In some embodi ments, the method comprises the steps of lysing the biological 0051. The porous matrix may be selected such that high sample in a porous matrix by contacting the biological sample molecular weight DNA (e.g., genomic DNA) does not elute with a porous matrix comprising chemicals that can lyse the out of the porous matrix. For example, after lysing the bio biological sample and preserve the genomic DNA within the logical sample within the porous matrix, the porous matrix porous matrix. The porous matrix may be a Solid matrix and may be washed with appropriate eluents (e.g., a TE buffer) to lysing chemicals may be impregnated in the porous matrix in remove one or more chemicals that are used for lysing the dried formats (e.g., a paper strip impregnated with lysing biological sample and/or preserving the genetic material. The chemicals). The lysing chemicals may include, for example, washing of the porous matrix may be useful especially if the salts, detergents, chaotropes, reducing agents, anti-oxidants, lysis chemicals include any components that may interfere chelating agents or buffers. For example, the porous Substrate with the endonuclease-assisted DNA amplification reaction. may be impregnated with one or more of sodium dodecyl After the amplification, the produced amplicon has compara Sulfate (SDS), urea, guanidinium chloride, or arginine. Upon tively low molecular weight DNA. These amplicons may then contacting the biological sample with the porous matrix, the be eluted out of the porous matrix by using appropriate elu impregnated chemicals lyse the biological sample (e.g., cell entS. lysis) within the porous matrix and preserve/stabilize the 0.052 Unlike other isothermal DNA amplification reac genomic DNA within the porous matrix. The preserved tions, wherein a bumper primer that extends and knock of the genomic DNA may be stored for longer periods in the porous first primer to make that first extension product single matrix, if needed. Stranded, endonuclease-assisted DNA amplification repeat US 2015/O167065 A1 Jun. 18, 2015 edly copies the target dsDNA. The target dsDNA does not separate the template Strands and allow primerannealing. No move or elute out from the porous matrix due to its size. heating is required to denature the template. Once the Dena However, the generated, Smaller amplicons may be eluted out turation has been formulated, an Enzyme Mix containing all of the porous matrix. the necessary proteins is prepared in a buffered glycerol solu 0053 Practice of the invention will be still more fully tion. For example, the Enzyme mix may include a mutant understood from the following examples, which are pre Endo V, a Bst DNA Polymerase and a single stranded DNA sented herein for illustration only and should not be construed binding protein (SSB). The Enzyme Mix is then combined as limiting the scope of the present invention as defined by the with dNTPs and requisite divalent cations to prepare the appended claims. Reaction Mix. Finally, the Denaturation and Reaction Mix are mixed and immediately placed at 45° C. to start amplifi EXAMPLES cation. 0059. The Denaturation is prepared by mixing 1.0 uL of 0054 Some abbreviations used in the examples section are 10x Denaturation Buffer, 1.0 uL of template at the appropri expanded as follows: “mg: milligrams; “ng’: nanograms; ate concentration, 1.0 uL of an inosine-containing primer “pg': picograms; “fg: femtograms; “mL': milliliters; “mg/ mixture, 2.0 uL of ethylene glycol, 0.5 LL of 25% (v/v) mL’: milligrams per milliliter; “mM’: millimolar; “mmol': formamide and 1.5 L of water for a total volume of 7.0 uL. millimoles; “pM': picomolar; “pmol”: picomoles; "Lull': This is allowed to sitat room temperature while the remaining microliters; “min' minutes and "h.': hours. reaction components are assembled. 0055 All melting temperature values provided herein are 0060. The Enzyme Mix is prepared by mixing 0.378 uL of determined according to the formula, 100.5+(41*(yG+ZC Enzyme Dilution Buffer, 0.381 uL of Bst DNA polymerase 16.4)/(wA+xT+yG+ZC))-(820/(wA+xT+yG+ZC))+16. (120 units/uIL), 0.2 ul, SSB (5ug/uIL) and 0.041 uL of mutant 6*LOG 10(Na++K+)-0.56(% EG)-0.32(% G)-0.62(% Endonuclease V for a total volume of 1.0 uL. F) where w, x, y and Z refer to the number of adenosine, 0061. A Reaction Mix is prepared by mixing 1.0LL of 10x cytosine, guanosine and thymidine residues, respectively, Reaction Buffer, 1.0 uL of Enzyme Mix and 1.0 uL of 50% contained in the primer, Na+ refers to the Sodium concentra (v/v) glycerol. tion (mM), K+ refers to the potassium concentration (mM), 0062. A complete Ping Pong reaction is prepared by mix EG refers to the ethylene glycol concentration (%), G refers to ing 7 ul of Denaturation Reaction with 3.0 uL of Reaction the glycerol concentration (%), and Frefers to the formamide Mix and incubating at 45° for one hour. Note that other concentration (%). reaction components (e.g., Ficoll) may be substituted for 0056. TRIS-HC1 and Tween 20 were obtained from Sigma water in the Denaturation Mix. Aldrich; dNTPs were obtained from GE Healthcare; and 0063. Following incubation the amplification is generally NaCl was obtained from Ambion. Volumes shown in micro analyzed by gel electrophoresis using a 15% Acrylamide liters unless otherwise indicated. Amplicons may be visual TBE-Urea gel (Invitrogen) Immediately prior to gel loading, ized and/or quantified using any of art-recognized techniques 3 uL of a completed PingPong reaction is combined with 6LL (e.g., electrophoresis to separate species in a sample and Gel Loading Buffer II (Invitrogen) and heat denatured at 95° observe using an intercalating dye such as ethidium bromide, C. for two minutes followed by immediate quenching on ice. acridine orange, or proflavine). Amplicon production may 5uL of this heat-denatured PingPong reaction is then loaded also be tracked using optical methods (e.g., ABI Series 7500 in one well of the gel. Electrophoresis is accomplished Real-Time PCR machine) and an intercalating dye (e.g., according to the manufacturers (Invitrogen) instructions. SYBR Green I). The amplicons produced in the following Once electrophoresis is complete, the gel is stained with a 20x examples were visualized using electrophoresis or optical solution of SYBR Gold (Invitrogen) for 15 minutes and then techniques. scanned for fluorescein with a TyphoonTM 9410 Variable 0057 HET Buffer is 10 mM HEPES Buffer, pH 8, 0.1 mM Mode Imager (GE Healthcare). EDTA and 0.1% (v/v) Tween 20. 10x denaturation buffer is 100 mM HEPES Buffer, pH 8.0, 1 mM EDTA, 0.1% (v/v) Example 2 Tween 20 and 10 mg/ml BSA. 10x Reaction Buffer is 150 mMHEPES Buffer, pH 8,30mM magnesium chloride, 1 mM Endonuclease-Assisted Isothermal Amplification of a manganese sulphate, 2.5 mM dATP, 2.5 mM dCTP 2.5 mM Template DNA Using Exonuclease-Resistant, dGTP, 2.5 mM dTTP, 50 mM ammonium sulfate, 10 mM Inosine-Containing Primers TCEP and 0.1% (v/v) Tween 20. Enzyme Dilution Buffer is 0064. The primers used in endonuclease-assisted isother 10 mM HEPES, pH 8, 1 mM TCEP, 0.5 mM EDTA, 0.01% mal amplification contain an inosine as the penultimate 3' (v/v) Tween 20 and 50% (v/v) glycerol. 5% (w/v) Ficoll 400 base. Endonuclease V recognizes inosine as a non-natural is equivalent to 5 g/100 ml of water. base and nicks the DNA strand containing the inosine residue Example 1 at one base 3' to the lesion. An enhanced amplification kinet ics may be obtained using a nuclease-resistant primer, Endonuclease-Assisted Isothermal Amplification of a wherein the phosphate bond between the inosine reside and Template DNA the terminal 3' base has been phosphorothioated. 0065. Sequences for six forward and five reverse primers 0058. A completed Ping Pong amplification reaction is were identified in the 5' region of the Mycobacterium tuber composed of three separate parts termed either 1) Denatur culosis rpoB gene. Two sets of these 11 primers were synthe ation 2) Enzyme Mix or 3) Reaction Mix. The different parts sized, one set without phosphorothioation and the other set are prepared in the order indicated and eventually combined with phosphorothioation between the inosine and the termi to start the reaction. Denaturation involves mixing the DNA nal 3' base of each primer. TABLE 1 and TABLE 2 provide the template and primers in a buffered chemical denaturant to sequences of the various primers used in the examples. US 2015/O167065 A1 Jun. 18, 2015 10

TABLE 1. Non-phosphorothioated primers without phosphorothioation between the inosine and the terminal 3' base of each primer Primer Name Ref. No. Sequence (5'-->3') Length

A TBropB F1 SEO ID NO: 7 ACAGCCGCTAGTCCTAIT 8

A TBropB F2 SEO ID NO: 8 CCCGCAAAGTTCCTCIA 7

A TBrpoB F3n SEO ID NO: 9 ACCGGGTCTCCT. TCIC 6 A TBrpoB F4 SEO ID NO: 10 GCTGCGCGAACCACTTIA

A TBrpoB F5 SEO ID NO: 11 CCGTACCCGGAGCIC A TBrpoB F6 SEO ID NO: 12 CAGATTCCCGCCAGAIC

A TBropB R2 SEO ID NO: 13 GGCGAACCGATCAIC A TBropB R3 SEO ID NO: 14 CGGCGGATTCGCIC

A TBrpoB R4 SEO ID NO: 15 GGTTGACATCACCCCIC

A TBrpoB R5 SEO ID NO: 16 GAGCAC CTCTTCCAGIC

A TBrpoB R6 SEO ID NO: 17 CGATCGGAGACAGCTCIT

TABLE 2 Phosphorothioated primers with phosphorothioation (* represents phosphorothioate linkage) between the inosine and the terminal 3' base of each primer. Primer Name Ref. No. Sequence (5'-->3') Length A TBropB F1* SEQ ID NO: 18 ACAGCCGCTAGTCCTAI* T 8 A TBropB F2* SEQ ID NO: 19 CCCGCAAAGTTCCTCI* A 7 A TBrpoB F3nk SEQ ID NO: 2O ACCGGGTCTCCT TCI* C 6 A TBrpoB F4* SEQ ID NO: 21 GCTGCGCGAACCACTTI* A A TBrpoB F5* SEQ ID NO: 22 CCGTACCCGGAGCI* C A TBrpoB F6* SEQ ID NO. 23 CAGATTCCCGCCAGAIC* A TBropB R2* SEQ ID NO: 24 GGCGAACCGATCAI* C A TBropB R3* SEQ ID NO: 25 CGGCGGATTCGCI* C A TBrpoB R4* SEQ ID NO: 26 GGTTGACATCACCCCI* C A TBrpoB R5* SEQ ID NO: 27 GAGCACCTCTTCCAGI* C A TBrpoB R6* SEQ ID NO: 28 CGATCGGAGACAGCTCI* T

0066. To generate the non-phosphorothioated primer set, uL IATBrpoB F4* (534 pmol/uL), 1.72 uL IATBrpoB F5* 4.00 uLIATBrpoBF1 (629 pmol/uL), 3.16 uLIATBrpoB F2 (1451 pmol/uL), 1.76 uL IATBrpoB F6* (1417 pmol/uL), (793 pmol/uL), 3.64 uL IATBrpoB F3n (686 pmol/uL), 3.50 2.72 uL IATBrpoB R2* (920 pmol/uL), 1.80 uL IATBrpoB uLIATBrpoB R2 (715 pmol/uL), 3.28ul IATBrpoB R3 (762 R3* (1392 pmol/uL), 1.51 uL IATBrpoB R4* (1652 pmol/ pmol/LL), 5.74 uL IATBrpoB F4 (436 pmol/L), 2.84 LLIA uL), 1.79 uL IATBrpoB R5* (1398 pmol/ul), and 7.00 uLIA TBrpoB F5 (880 pmol/uL), 4.17 uL IATBrpoB F6 (599 TBrpoB R6* (358 pmol/uL) was mixed with 218.15uL HE(0. pmol/LL), 4.94 uLIATBrpoB R4 (506 pmol/LL), 4.15uLIA 1)T buffer (Total Volume=250 uL) TBrpoB R5 (602 pmol/uL) and 5.63 uL IATBrpoB R6 (444 0068. Each primer set was then used in an endonuclease pmol/uL) was mixed with 204.95 uL HE(0.1)T buffer (Total assisted isothermal amplification reaction prepared and ana Volume=250 uL) lyzed as in Example 1. The final concentration of each oligo 0067. To generate the phosphorothioated primer set, 3.32 nucleotide primer in the PingPong reaction was 10 pmol. As uL IATBrpoB F1*(754 pmol/uL), 2.72 uL IATBrpoB F2* depicted in FIG. 3., use of nuclease-resistant primers (i.e., (920 pmol/uL), 2.83 uL IATBrpoB F3*(883 pmol/uL), 4.68 primer set containing phosphorothioation) increase the yield US 2015/O167065 A1 Jun. 18, 2015

of endonuclease-assisted isothermal amplification reaction methyl ether methacrylate 300 (PEGMA 300; Sigma-Ald products by about a factor of two. rich) and 30% (v/v) Tween 20 (Sigma-Aldrich). Excess solu tion was removed and the treated matrices were subjected to Example 3 e-beam irradiation (Advanced Electron Beam (AEB) Appli cation Development unit, EBLAB-150), with an operating Grafting of PEG Directly to Cellulosic Membrane voltage of 125 kV, and electron dosage delivery of 10 kGy. Through Electron Beam Irradiation Following irradiation, the modified matrices were washed in distilled water by orbital rotating for 30 minutes, and repeat 0069 Coating of and grafting to porous cellulose sub for three times. The membranes were then allowed to air dry strates (e.g., 903, 31ETF) or nitrocellulose (FF60, FF80HP) at room temperature for overnight. The template DNA was may be performed in an aqueous solution containing 10% 500 pg of TB genomic DNA. An amplification reaction was PEGMA 300 (polyethylene glycol methyl ether methacry prepared and was added to each contained disc through a port. late. Number average molecular weight (M) 300) and 30% No denaturation of the double stranded DNA template was Tween 20 followed by electronbeam irradiation of the coated performed prior to amplification. The ports were sealed and substrate. E-beam irradiation creates free radicals on the the slide was incubated at 45° C. for one hour. Following membrane surface which initiates polymerization of the incubation, the porous matrices were removed and placed in methacrylate monomers, and as a result, the PEG moieties are separate Costar R. Spin-X(R) centrifuge tubes (Corning Life permanently introduced to the membranes. After the e-beam treatment, the treated membranes are washed with water to Sciences). The Spin-X tubes were centrifuged at 16xg for five remove co-solvent Tween 20 and ungrafted PEG species and minutes to collect the completed amplification reactions. then dried. Three microliters of each of the collected reaction were mixed with six microliters of Gel Loading Buffer II (Life Technolo gies) and denatured by heating at 95°C. for two minutes. The Example 4 denaturations were quenched on ice and immediately loaded into separate wells of 15% acrylamide 7 Murea gels (Life Reduction of Non-Specific Binding of Proteins to the Technologies). The gels were subjected to electrophoresis Pegylated Nitrocellulose Membranes according to the manufacturers instructions and then stained 0070 A running buffer was prepared by coating 40 mm with SYBR Gold (Life Technologies). Stained gels were gold nanoparticles with a final concentration of 0.2 mg/ml imaged using a TyphoonTM Variable Mode Imager (GE BSA and 0.8 OD (optical density) Au. Nitrocellulose (NC) Healthcare). membranes were dipped into the running buffer, and the gold label was used to serve as the indicator of BSA presence on Example 6 the membranes. Cellulose absorbent pads were laminated on top of NC to ensure constant flow of running buffer on the NC 0073) Isothermal amplification reactions were prepared membranes. and processed according to Example 2 using an exonuclease 0071. It was observed that for non-modified nitrocellu resistant primer set designed to generate an amplicon of 81 lose, gold nanoparticles aggregated in the origin of the flow base pairs in length from a 5' region of the Mycobacterium on the membrane, indicating non-specific binding of BSA to tuberculosis rpoB gene. Porous matrices of FF60 nitrocellu the membrane. Alternatively, it was observed that for PEG lose (GE Healthcare), PEGMA 300 grafted nitrocellulose, modified nitrocellulose membranes, gold nanoparticle Solu 903 cellulose (GE Healthcare), PEGMA 300 grafted 903 tions were able to flow smoothly through the membrane into cellulose and Fusion 5 (GE Healthcare) were tested for their cellulose absorbent pad, indicating the intrinsic ability of the ability to support amplification as outlined in Example 5. Five modified membrane to block non-specific interactions nanograms of purified M. tuberculosis double stranded DNA (American Type Culture Collection) were used as the tem between the protein and the membrane. plate in each reaction. FIG. 4 demonstrates that every porous matrix tested Supported amplification to some degree as com Example 5 pared to the reaction completed in Solution. Endonuclease-Assisted Isothermal Amplification of a Example 7 Template DNA on a Porous Matrix 0074. A titration of input template amount of M. tubercu 0072 Nine millimeter diameter discs of modified or losis was accomplished to compare in solution amplification unmodified porous matrices were sealed in hybridization to in paper amplification. One genome equivalent of M. tuber chambers (e.g., Grace Bio-Labs SA8R-2.0-SecureSeal 8-9 culosis DNA was estimated to be 4,403,765 base pairs in mm Dia.x 1.8 mm Depth, 26 mmx51 mm OD, 1.5 mm Dia. length or 4.78 fg. The primer set used is provided in Table 3. Ports) attached to new glass microscope slides. The porous In FIG. 5A, in solution amplification detected down to 10 matrix may be a FF60 nitrocellulose (GE Healthcare), copies of input template, with nonspecific amplification prod PEGMA 300 grafted nitrocellulose (NC-PEG), 903 cellulose paper (GE Healthcare), PEGMA 300 grafted 903 cellulose ucts appearing only in the one copy reaction. In FIG. 5B, in paper (903-PEG), or a Fusion 5 paper (GE Healthcare). paper amplification produced the expected amplification PEGMA 300 grafted nitrocellulose and PEGMA300 grafted products in all reactions, demonstrating effective amplifica 903 cellulose paper were fabricated by soaking the appropri tion of double stranded target DNA in a porous matrix. ate base substrate (FF60 nitrocellulose or 903 cellulose) in an 0075 Primer Set DNA Sequences (I designates an inosine aqueous Solution containing 10% (w/v) polyethylene glycol moiety: * designates phosphorothioation) US 2015/O167065 A1 Jun. 18, 2015 12

TABLE 3 instructions and then stained with SYBR Gold (Life Tech nologies). Stained gels were imaged using a TyphoonTMVari Phosphorothioated primers with phosphorothidation able Mode Imager (GE Healthcare). (* represents phosphorothioate linkage) between the inosine and the terminal 3' base of each primer. 0077 FIG. 6A illustrates the effects blocking agents and/ or other additives on endonuclease-assisted isothermal Amount amplification of a target dsDNA in solution and FIG. 6B in one illustrates the effects blocking agents and/or other additives reaction on endonuclease-assisted isothermal amplification of a target Name Sequence Length (pmol dsDNA in different porous matrices. In absence of blocking agent, the non-modified matrixes showed minimal or medio SEO ID NO : 29 CATGAAGTGCTGGAAGGATI'k C 21 4. cre DNA amplification on different porous matrices. How SEQ ID NO. 3OTCCTCTAAGGGCTCTCGTTI k G 21 4. ever, the modified porous matrices (e.g., PEGylated Nitrocel lulose (NC-PEG)) shows enhanced DNA amplification SEO ID NO : 31 AAATTATCGCGGCGAACGGI* C 21 6 efficiencies. Alpha-cyclodextrin enhanced the DNA amplifi cation in many porous matrices. SEO ID NO: 32 GGCAGATTCCCGCCAGAI* C 19 6 0078. The above detailed description is exemplary and not SEO ID NO : 33 AAAACAGCCGCTAGTCCTAI* T 21 8 intended to limit the invention of the application and uses of the invention. Throughout the specification, exemplification SEO ID NO. 34 TCGCCCGCAAAGTTCCTCI* A 2O 8 of specific terms should be considered as non-limiting examples. The singular forms “a”, “an and “the include SEQ ID NO: 35 CCAAACCGGGTCTCCTTCI k C 2O 10 plural referents unless the context clearly dictates otherwise. Approximating language, as used herein throughout the SEO ID NO: 36 TAAGCTGCGCGAACCACTTI* A 21 10 specification and claims, may be applied to modify any quan titative representation that could permissibly vary without SEQ ID No. 37 CTGGGTTGACATCACCCCI* C 2O 10 resulting in a change in the basic function to which it is SEO ID NO: 38AAGTCCTCGATCGGAGACAI'k C 21 10 related. Accordingly, a value modified by a term Such as “about is not to be limited to the precise value specified. SEO ID NO: 39 GACAACGACATCGACCCGI* A 2O 8 Unless otherwise indicated, all numbers expressing quanti ties of ingredients, properties Such as molecular weight, reac SEO ID NO: 4 OCGTCGAAACGAGGGTCAGAIA 21 8 tion conditions, so forth used in the specification and claims are to be understood as being modified in all instances by the SEO ID NO: 41 CTCGTCGACGGGTGCCTTI* A 2O 8 term “about.” Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specifica SEQ ID NO: 42 GTACGTCATGTCCTTGTCTTTI k C 23 6 tion and attached claims are approximations that may vary SEO ID NO : 43 TCACCGGTGTTGTTGTTGATI* A 22 4. depending upon the desired properties sought to be obtained by the invention. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be Example 8 construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Where neces Effect of Blocking Agents and/or Other Additives on sary, ranges have been Supplied, and those ranges are inclu Endonuclease-Assisted Isothermal Amplification of sive of all sub-ranges there between. Target dsDNA in Solution and in Different Porous 007.9 The invention may be embodied in other specific Matrices forms without departing from the spirit or essential charac teristics thereof. The foregoing embodiments are selected 0076 Ping pong reactions were carried out using the embodiments or examples from a manifold of all possible modified primers. Reactions took place within the porous embodiments or examples. The foregoing embodiments are matrix. Following incubation, the porous matrices were therefore to be considered in all respects as illustrative rather removed and placed in separate Costar R. Spin-X(R) centrifuge than limiting on the invention. While only certain features of tubes (Corning Life Sciences). The Spin-X tubes were cen the invention have been illustrated and described herein, it is to be understood that one skilled in the art, given the benefit of trifuged at 16xg for five minutes to collect the completed this disclosure, will be able to identify, select, optimize or amplification reactions. Three microliters of each reaction modify Suitable conditions/parameters for using the methods (FIG. 6A) of the collected reaction were mixed with six in accordance with the principles of the invention, suitable for microliters of Gel Loading Buffer II (Life Technologies) and these and other types of applications. The precise use, choice denatured by heating at 95°C. for two minutes. The denatur of reagents, choice of variables such as concentration, Vol ations were quenched on ice and immediately loaded into ume, incubation time, incubation temperature, and the like separate wells of 15% acrylamide 7 Murea gels (Life Tech may depend in large part on the particular application for nologies). A second gel was made by inserting the porous which it is intended. It is, therefore, to be understood that the matrix directly in to the gel (FIG. 6B), and adding Gel Load appended claims are intended to cover all modifications and ing Buffer II (Like Technologies). The label “pos.control” in changes that fall within the spirit of the invention. Further, all FIGS. 6A and 6B refers to positive control. The gels were changes that come within the meaning and range of equiva Subjected to electrophoresis according to the manufacturers lency of the claims are intended to be embraced therein. US 2015/O167065 A1 Jun. 18, 2015 13

SEQUENCE LISTING

<16O is NUMBER OF SEO ID NOS: 43

<210s, SEQ ID NO 1 &211s LENGTH: 225 212. TYPE: PRT <213> ORGANISM: Escherichia coli

<4 OOs, SEQUENCE: 1 Met Ile Met Asp Lieu Ala Ser Lieu. Arg Ala Glin Glin Ile Glu Lieu Ala 1. 5 1O 15 Ser Ser Val Ile Arg Glu Asp Arg Lieu. Asp Lys Asp Pro Pro Asp Lieu. 2O 25 3O Ile Ala Gly Ala Asp Val Gly Phe Glu Glin Gly Gly Glu Val Thr Arg 35 4 O 45 Ala Ala Met Val Lieu Lleu Lys Tyr Pro Ser Lieu. Glu Lieu Val Glu Tyr SO 55 6 O Llys Val Ala Arg Ile Ala Thr Thr Met Pro Tyr Ile Pro Gly Phe Leu 65 70 7s 8O Ser Phe Arg Glu Tyr Pro Ala Lieu. Lieu Ala Ala Trp Glu Met Lieu. Ser 85 90 95 Gln Llys Pro Asp Leu Val Phe Val Asp Gly His Gly Ile Ser His Pro 1OO 105 11 O Arg Arg Lieu. Gly Val Ala Ser His Phe Gly Lieu. Lieu Val Asp Val Pro 115 12 O 125 Thir Ile Gly Val Ala Lys Lys Arg Lieu. Cys Gly Llys Phe Glu Pro Lieu. 13 O 135 14 O Ser Ser Glu Pro Gly Ala Lieu Ala Pro Lieu Met Asp Llys Gly Glu Glin 145 150 155 160 Lieu Ala Trp Val Trp Arg Ser Lys Ala Arg Cys Asn Pro Lieu. Phe Ile 1.65 17O 17s Ala Thr Gly His Arg Val Ser Val Asp Ser Ala Lieu Ala Trp Val Glin 18O 185 19 O Arg Cys Met Lys Gly Tyr Arg Lieu Pro Glu Pro Thr Arg Trp Ala Asp 195 2OO 2O5 Ala Val Ala Ser Glu Arg Pro Ala Phe Val Arg Tyr Thr Ala Asn Glin 21 O 215 22O

Pro 225

<210s, SEQ ID NO 2 &211s LENGTH: 225 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Mutant E. coli Endonuclease W

<4 OOs, SEQUENCE: 2 Met Ile Met Asp Lieu Ala Ser Lieu. Arg Ala Glin Glin Ile Glu Lieu Ala 1. 5 1O 15 Ser Ser Val Ile Arg Glu Asp Arg Lieu. Asp Lys Asp Pro Pro Asp Lieu. 2O 25 3O Ile Ala Gly Ala Asp Val Gly Phe Glu Glin Gly Gly Glu Val Thr Arg 35 4 O 45

Ala Ala Met Val Lieu Lleu Lys Tyr Pro Ser Lieu. Glu Lieu Val Glu Tyr SO 55 6 O US 2015/O167065 A1 Jun. 18, 2015 14

- Continued

Llys Val Ala Arg Ile Ala Thr Thr Met Pro Ala Ile Pro Gly Phe Leu 65 70 7s 8O Ser Phe Arg Glu Tyr Pro Ala Lieu. Lieu Ala Ala Trp Glu Met Lieu. Ser 85 90 95 Gln Llys Pro Asp Leu Val Phe Val Asp Gly His Gly Ile Ser His Pro 1OO 105 11 O Arg Arg Lieu. Gly Val Ala Ser His Phe Gly Lieu. Lieu Val Asp Val Pro 115 12 O 125 Thir Ile Gly Val Ala Lys Lys Arg Lieu. Cys Gly Llys Phe Glu Pro Lieu. 13 O 135 14 O Ser Ser Glu Pro Gly Ala Lieu Ala Pro Lieu Met Asp Llys Gly Glu Glin 145 150 155 160 Lieu Ala Trp Val Trp Arg Ser Lys Ala Arg Cys Asn Pro Lieu. Phe Ile 1.65 17O 17s Ala Thr Gly His Arg Val Ser Val Asp Ser Ala Lieu Ala Trp Val Glin 18O 185 19 O Arg Cys Met Lys Gly Tyr Arg Lieu Pro Glu Pro Thr Arg Trp Ala Asp 195 2OO 2O5 Ala Val Ala Ser Glu Arg Pro Ala Phe Val Arg Tyr Thr Ala Asn Glin 21 O 215 22O

Pro 225

<210s, SEQ ID NO 3 &211s LENGTH: 221 212. TYPE: PRT <213> ORGANISM: Archaeoglobus fulgidus

<4 OOs, SEQUENCE: 3 Met Lieu Gln Met Asn Lieu. Glu Glu Lieu. Arg Arg Ile Glin Glu Glu Met 1. 5 1O 15 Ser Arg Ser Val Val Lieu. Glu Asp Lieu. Ile Pro Lieu. Glu Glu Lieu. Glu 2O 25 3O Tyr Val Val Gly Val Asp Glin Ala Phe Ile Ser Asp Glu Val Val Ser 35 4 O 45 Cys Ala Wall Lys Lieu. Thir Phe Pro Glu Lieu. Glu Val Val Asp Lys Ala SO 55 6 O Val Arg Val Glu Lys Val Thr Phe Pro Tyr Ile Pro Thr Phe Leu Met 65 70 7s 8O Phe Arg Glu Gly Glu Pro Ala Val Asn Ala Wall Lys Gly Lieu Val Asp 85 90 95 Asp Arg Ala Ala Ile Met Val Asp Gly Ser Gly Ile Ala His Pro Arg 1OO 105 11 O

Arg Cys Gly Lieu Ala Thr Tyr Ile Ala Lieu Lys Lieu. Arg Llys Pro Thr 115 12 O 125

Val Gly Ile Thir Lys Lys Arg Lieu. Phe Gly Glu Met Val Glu Val Glu 13 O 135 14 O

Asp Gly Lieu. Trp Arg Lieu. Lieu. Asp Gly Ser Glu Thir Ile Gly Tyr Ala 145 150 155 160

Lieu Lys Ser Cys Arg Arg Cys Llys Pro Ile Phe Ile Ser Pro Gly Ser 1.65 17O 17s

Tyr Ile Ser Pro Asp Ser Ala Lieu. Glu Lieu. Thir Arg Llys Cys Lieu Lys US 2015/O167065 A1 Jun. 18, 2015 15

- Continued

18O 185 19 O Gly Tyr Lys Lieu Pro Glu Pro Ile Arg Ile Ala Asp Llys Lieu. Thir Lys 195 2OO 2O5 Glu Val Lys Arg Glu Lieu. Thr Pro Thir Ser Lys Lieu Lys 21 O 215 22O

<210s, SEQ ID NO 4 &211s LENGTH: 221 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223 is OTHER INFORMATION: Mutant Afu Endonuclease W

<4 OOs, SEQUENCE: 4 Met Lieu Gln Met Asn Lieu. Glu Glu Lieu. Arg Arg Ile Glin Glu Glu Met 1. 5 1O 15 Ser Arg Ser Val Val Lieu. Glu Asp Lieu. Ile Pro Lieu. Glu Glu Lieu. Glu 2O 25 3O Tyr Val Val Gly Val Asp Glin Ala Phe Ile Ser Asp Glu Val Val Ser 35 4 O 45 Cys Ala Wall Lys Lieu. Thir Phe Pro Glu Lieu. Glu Val Val Asp Lys Ala SO 55 6 O Val Arg Val Glu Lys Val Thr Phe Pro Ala Ile Pro Thr Phe Leu Met 65 70 7s 8O Phe Arg Glu Gly Glu Pro Ala Val Asn Ala Wall Lys Gly Lieu Val Asp 85 90 95 Asp Arg Ala Ala Ile Met Val Asp Gly Ser Gly Ile Ala His Pro Arg 1OO 105 11 O Arg Cys Gly Lieu Ala Thr Tyr Ile Ala Lieu Lys Lieu. Arg Llys Pro Thr 115 12 O 125 Val Gly Ile Thir Lys Lys Arg Lieu. Phe Gly Glu Met Val Glu Val Glu 13 O 135 14 O Asp Gly Lieu. Trp Arg Lieu. Lieu. Asp Gly Ser Glu Thir Ile Gly Tyr Ala 145 150 155 160 Lieu Lys Ser Cys Arg Arg Cys Llys Pro Ile Phe Ile Ser Pro Gly Ser 1.65 17O 17s Tyr Ile Ser Pro Asp Ser Ala Lieu. Glu Lieu. Thir Arg Llys Cys Lieu Lys 18O 185 19 O Gly Tyr Lys Lieu Pro Glu Pro Ile Arg Ile Ala Asp Llys Lieu. Thir Lys 195 2OO 2O5 Glu Val Lys Arg Glu Lieu. Thr Pro Thir Ser Lys Lieu Lys 21 O 215 22O

<210s, SEQ ID NO 5 &211s LENGTH: 225 212. TYPE: PRT <213> ORGANISM: Termotoga maritima

<4 OOs, SEQUENCE: 5 Met Asp Tyr Arg Glin Lieu. His Arg Trp Asp Lieu Pro Pro Glu Glu Ala 1. 5 1O 15

Ile Llys Val Glin Asn. Glu Lieu. Arg Llys Lys Ile Llys Lieu. Thr Pro Tyr 2O 25 3O

Glu Gly Glu Pro Glu Tyr Val Ala Gly Val Asp Leu Ser Phe Pro Gly 35 4 O 45 US 2015/O167065 A1 Jun. 18, 2015 16

- Continued

Lys Glu Glu Gly Lieu Ala Val Ile Val Val Lieu. Glu Tyr Pro Ser Phe SO 55 6 O Lys Ile Leu Glu Val Val Ser Glu Arg Gly Glu Ile Thr Phe Pro Tyr 65 70 7s 8O Ile Pro Gly Lieu. Lieu Ala Phe Arg Glu Gly Pro Lieu. Phe Lieu Lys Ala 85 90 95 Trp Glu Lys Lieu. Arg Thr Llys Pro Asp Val Val Val Phe Asp Gly Glin 1OO 105 11 O Gly Lieu Ala His Pro Arg Llys Lieu. Gly Ile Ala Ser His Met Gly Lieu. 115 12 O 125 Phe Ile Glu Ile Pro Thir Ile Gly Val Ala Lys Ser Arg Lieu. Tyr Gly 13 O 135 14 O Thr Phe Llys Met Pro Glu Asp Lys Arg Cys Ser Trp Ser Tyr Lieu. Tyr 145 150 155 160 Asp Gly Glu Glu Ile Ile Gly Cys Val Ile Arg Thr Lys Glu Gly Ser 1.65 17O 17s Ala Pro Ile Phe Val Ser Pro Gly His Leu Met Asp Val Glu Ser Ser 18O 185 19 O Lys Arg Lieu. Ile Lys Ala Phe Thr Lieu Pro Gly Arg Arg Ile Pro Glu 195 2OO 2O5 Pro Thr Arg Lieu Ala His Ile Tyr Thr Glin Arg Lieu Lys Lys Gly Lieu. 21 O 215 22O

Phe 225

<210s, SEQ ID NO 6 &211s LENGTH: 225 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223 is OTHER INFORMATION: Mutant Tma Endonuclease W

<4 OOs, SEQUENCE: 6 Met Asp Tyr Arg Glin Lieu. His Arg Trp Asp Lieu Pro Pro Glu Glu Ala 1. 5 1O 15 Ile Llys Val Glin Asn. Glu Lieu. Arg Llys Lys Ile Llys Lieu. Thr Pro Tyr 2O 25 3O Glu Gly Glu Pro Glu Tyr Val Ala Gly Val Asp Leu Ser Phe Pro Gly 35 4 O 45 Lys Glu Glu Gly Lieu Ala Val Ile Val Val Lieu. Glu Tyr Pro Ser Phe SO 55 6 O Lys Ile Lieu. Glu Val Val Ser Glu Arg Gly Glu Ile Thr Phe Pro Ala 65 70 7s 8O

Ile Pro Gly Lieu. Lieu Ala Phe Arg Glu Gly Pro Lieu. Phe Lieu Lys Ala 85 90 95

Trp Glu Lys Lieu. Arg Thr Llys Pro Asp Val Val Val Phe Asp Gly Glin 1OO 105 11 O Gly Lieu Ala His Pro Arg Llys Lieu. Gly Ile Ala Ser His Met Gly Lieu. 115 12 O 125

Phe Ile Glu Ile Pro Thir Ile Gly Val Ala Lys Ser Arg Lieu. Tyr Gly 13 O 135 14 O

Thr Phe Llys Met Pro Glu Asp Lys Arg Cys Ser Trp Ser Tyr Lieu. Tyr 145 150 155 160 US 2015/O167065 A1 Jun. 18, 2015 17

- Continued

Asp Gly Glu Glu Ile Ile Gly Cys Val Ile Arg Thr Lys Glu Gly Ser 1.65 17O 17s Ala Pro Ile Phe Val Ser Pro Gly His Leu Met Asp Val Glu Ser Ser 18O 185 19 O Lys Arg Lieu. Ile Lys Ala Phe Thr Lieu Pro Gly Arg Arg Ile Pro Glu 195 2OO 2O5 Pro Thr Arg Lieu Ala His Ile Tyr Thr Glin Arg Lieu Lys Lys Gly Lieu. 21 O 215 22O

Phe 225

<210s, SEQ ID NO 7 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (17) . . (17) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (17) . . (17) <223> OTHER INFORMATION: n is a, c, g, or t <4 OO > SEQUENCE: 7 acagcc.gcta gtc.ctant 18

<210s, SEQ ID NO 8 &211s LENGTH: 17 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (16) ... (16) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (16) ... (16) <223> OTHER INFORMATION: n is a, c, g, or t <4 OOs, SEQUENCE: 8 ccc.gcaaagt to citcna 17

<210s, SEQ ID NO 9 &211s LENGTH: 16 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (15) . . (15) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (15) . . (15) <223> OTHER INFORMATION: n is a, c, g, or t

<4 OOs, SEQUENCE: 9 accoggtotc ctitcnc 16 US 2015/O167065 A1 Jun. 18, 2015 18

- Continued

<210s, SEQ ID NO 10 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (17) . . (17) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (17) . . (17) <223> OTHER INFORMATION: n is a, c, g, or t <4 OOs, SEQUENCE: 10 gctg.cgcgaa c cacttina 18

<210s, SEQ ID NO 11 &211s LENGTH: 15 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (14) . . (14) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222 LOCATION: (14) . . (14) <223> OTHER INFORMATION: n is a, c, g, or t <4 OOs, SEQUENCE: 11 cc.gt accc.gg agcnic 15

<210s, SEQ ID NO 12 &211s LENGTH: 17 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (16) ... (16) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (16) ... (16) <223> OTHER INFORMATION: n is a, c, g, or t <4 OOs, SEQUENCE: 12 cagatt cocq ccaganc 17

<210s, SEQ ID NO 13 &211s LENGTH: 15 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (14) . . (14) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (14) . . (14) <223> OTHER INFORMATION: n is a, c, g, or t US 2015/O167065 A1 Jun. 18, 2015 19

- Continued

<4 OOs, SEQUENCE: 13 ggcgalaccga t canc 15

<210s, SEQ ID NO 14 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (13) . . (13) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (13) . . (13) <223> OTHER INFORMATION: n is a, c, g, or t <4 OOs, SEQUENCE: 14 cggcggattic gcnic 14

<210s, SEQ ID NO 15 &211s LENGTH: 17 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222 LOCATION: (16) . . (16) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (16) ... (16) <223> OTHER INFORMATION: n is a, c, g, or t <4 OOs, SEQUENCE: 15 ggttga catc accc.cnc 17

<210s, SEQ ID NO 16 &211s LENGTH: 17 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (16) ... (16) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (16) ... (16) <223> OTHER INFORMATION: n is a, c, g, or t <4 OOs, SEQUENCE: 16 gagcacct ct tccagnc 17

<210s, SEQ ID NO 17 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (17) . . (17) 223 OTHER INFORMATION: I 22 Os. FEATURE: US 2015/O167065 A1 Jun. 18, 2015 20

- Continued <221 > NAMEAKEY: misc feature <222s. LOCATION: (17) . . (17) <223> OTHER INFORMATION: n is a, c, g, or t <4 OOs, SEQUENCE: 17 cgat.cggaga cagct cnt 18

<210s, SEQ ID NO 18 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (17) . . (18) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (17) . . (17) 223 OTHER INFORMATION: I

<4 OOs, SEQUENCE: 18 acagcc.gcta gtc.ctant 18

<210s, SEQ ID NO 19 &211s LENGTH: 17 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (16) ... (16) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (16) ... (17) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage

<4 OOs, SEQUENCE: 19 ccc.gcaaagt to citcna 17

<210s, SEQ ID NO 2 O &211s LENGTH: 16 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (15) . . (16) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (15) . . (15) 223 OTHER INFORMATION: I

<4 OOs, SEQUENCE: 2O accoggtotc ctitcnc 16

<210s, SEQ ID NO 21 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence US 2015/O167065 A1 Jun. 18, 2015 21

- Continued

22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (17) . . (17) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (17) . . (18) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage

<4 OOs, SEQUENCE: 21 gctg.cgcgaa c cacttina 18

<210s, SEQ ID NO 22 &211s LENGTH: 15 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (14) . . (14) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (14) . . (15) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage

< 4 OO SEQUENCE: 22 cc.gt accc.gg agcnic 15

<210s, SEQ ID NO 23 &211s LENGTH: 17 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (16) ... (16) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (16) ... (17) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage

<4 OOs, SEQUENCE: 23 cagatt cocq ccaganc 17

<210s, SEQ ID NO 24 &211s LENGTH: 15 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (14) . . (14) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (14) . . (15) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage

<4 OOs, SEQUENCE: 24 US 2015/O167065 A1 Jun. 18, 2015 22

- Continued ggcgalaccga t canc 15

<210s, SEQ ID NO 25 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (13) . . (13) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (13) . . (14) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage

<4 OOs, SEQUENCE: 25 cggcggattic gcnic 14

<210s, SEQ ID NO 26 &211s LENGTH: 17 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222 LOCATION: (16) . . (16) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (16) ... (17) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage

<4 OOs, SEQUENCE: 26 ggttga catc accc.cnc 17

<210s, SEQ ID NO 27 &211s LENGTH: 17 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (16) ... (16) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (16) ... (17) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage

<4 OOs, SEQUENCE: 27 gagcacct ct tccagnc 17

<210s, SEQ ID NO 28 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (17) . . (17) US 2015/O167065 A1 Jun. 18, 2015 23

- Continued

223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (17) . . (18) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage

<4 OOs, SEQUENCE: 28 cgat.cggaga cagct cnt 18

<210s, SEQ ID NO 29 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (2O) . . (2O) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (2O) . . (21) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage

<4 OOs, SEQUENCE: 29 Catgaagtgc tiggaaggatin C 21

<210 SEQ ID NO 3 O &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (2O) . . (2O) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (2O) . . (21) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage

<4 OOs, SEQUENCE: 30 t cct ctaagg gct citcgttn g 21

<210s, SEQ ID NO 31 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (2O) . . (2O) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (2O) . . (21) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage

<4 OOs, SEQUENCE: 31 aaattatcgc ggcgaacggn c 21

<210s, SEQ ID NO 32 US 2015/O167065 A1 Jun. 18, 2015 24

- Continued

&211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (18) ... (18) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (18) ... (19) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage

<4 OOs, SEQUENCE: 32 ggcagatt Co. c9ccaganc 19

<210s, SEQ ID NO 33 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (2O) . . (2O) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (2O) . . (21) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage

<4 OOs, SEQUENCE: 33 aaaa.ca.gc.cg c tagt cctan t 21

<210s, SEQ ID NO 34 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (19) . . (19) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (19) . . (2O) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage

<4 OOs, SEQUENCE: 34 tcqc cogcaa agttcc ticna 2O

<210s, SEQ ID NO 35 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (19) . . (19) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (19) . . (2O) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate US 2015/O167065 A1 Jun. 18, 2015 25

- Continued linkage

<4 OOs, SEQUENCE: 35 c caaac cqgg tot cott.cnc 2O

<210s, SEQ ID NO 36 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (2O) . . (2O) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (2O) . . (21) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage

<4 OOs, SEQUENCE: 36 taagctg.cgc gaaccacttin a 21

<210s, SEQ ID NO 37 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (19) . . (19) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (19) . . (2O) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage

<4 OO > SEQUENCE: 37 ctgggttgac at caccc.cnc 2O

<210s, SEQ ID NO 38 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (2O) . . (2O) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (2O) . . (21) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage

<4 OOs, SEQUENCE: 38 aagt cct catcggagacan C 21

<210s, SEQ ID NO 39 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence US 2015/O167065 A1 Jun. 18, 2015 26

- Continued

22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (19) . . (19) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (19) . . (2O) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage

<4 OOs, SEQUENCE: 39 gacaacgaca t cacccgna 2O

<210s, SEQ ID NO 4 O &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (2O) . . (2O) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (2O) . . (21) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage

<4 OOs, SEQUENCE: 4 O Cgtcgaaacg agggit cagan a 21

<210s, SEQ ID NO 41 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (19) . . (19) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (19) . . (2O) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage

<4 OOs, SEQUENCE: 41 Ctcgt.cgacg ggtgccttna 2O

<210s, SEQ ID NO 42 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (22) ... (22) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (22) ... (23) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage

<4 OOs, SEQUENCE: 42 gtacgt catgtcc ttgtc.tt tric 23 US 2015/O167065 A1 Jun. 18, 2015 27

- Continued

<210s, SEQ ID NO 43 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Primer Sequence 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (21) ... (21) 223 OTHER INFORMATION: I 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (21) ... (22) <223> OTHER INFORMATION: Residues are linked via a phosphorothioate linkage

<4 OOs, SEQUENCE: 43 t caccggtgt tttgttgat na 22

1. A method of producing at least one amplicon based on a 6. The method of claim 4, wherein the porous matrix fur target double stranded DNA within a porous matrix compris ther comprises an alkyl oligo(oxyalkylene) group. ing: 7. The method of claim 6, wherein the porous matrix is a (a) providing the porous matrix: polyethyleneglycol-modified cellulose membrane, polyeth yleneglycol-modified nitrocellulose membrane, or a combi (b) impregnating the target double stranded DNA within nation thereof. the porous matrix: 8. The method claim 1, wherein the porous matrix com (c) contacting the impregnated, target double stranded prises a detergent. DNA with a DNA amplification reaction mixture com 9. The method of claim 8, wherein the amplification mix prising at least one inosine-containing primer, at least ture comprises a detergent sequestering agent. one 5'-->3' exonuclease-deficient DNA polymerase hav 10. The method of claim 9, wherein the detergent seques ing Strand displacement activity, at least one nuclease tering agent is an alpha-cyclodextrin. that is capable of nicking a DNA at a residue 3' to an 11. The method of claim 1, wherein the nuclease is an inosine residue, and a dNTP mixture; endonuclease that is capable of nicking an inosine-containing (d) amplifying at least one portion of the impregnated strand of a double stranded DNA at a residue 3' to an inosine target double stranded DNA within the porous matrix residue. using the DNA amplification reaction mixture of step (c) 12. The method of claim 11, wherein the endonuclease is to produce the at least one amplicon within the porous endonuclease V or a mutant endonuclease V. matrix; and 13. The method of claim 12, wherein the mutant endonu (e) determining a rate of production of the at least one clease V is chosen from a mutant Escherichia coli endonu amplicon within the porous matrix. clease V comprising amino acid sequence of SEQID NO: 2, 2. The method of claim 1, further comprising determining a mutant Archaeoglobus fulgidus endonuclease V comprising a presence, an absence, or a quantity of the amplicon within amino acid sequence of SEQID NO: 4, or a mutant Termo toga maritima endonuclease V comprising amino acid the porous matrix. sequence of SEQID NO: 6. 3. The method of claim 1, wherein the at least one portion 14. The method of claim 1, wherein the at least one 5'-->3' of the impregnated target double stranded DNA is amplified exonuclease-deficient DNA polymerase is selected from within the porous matrix under isothermal conditions without 5'-->3' exonuclease-deficient T7 DNA polymerase, 5'-->3' denaturing the target double stranded DNA. exonuclease-deficient Bst DNA polymerase, 5'-->3' exonu 4. The method claim 1, wherein the porous matrix com clease-deficient Klenow, 5'-->3' exonuclease-deficient delta prises a cellulose membrane, a nitrocellulose membrane, a Tts DNA polymerase, or combinations thereof. cellulose acetate membrane, a nitrocellulose mixed ester 15. The method of claim 1, wherein the target double membrane, a glass fiber, a polyetherSulfone membrane, a stranded DNA is a genomic DNA. nylon membrane, a polyolefin membrane, a polyester mem 16. The method of claim 1, wherein the DNA amplification brane, a polycarbonate membrane, a polypropylene mem reaction mixture further comprises a detergent, a blocking brane, a polyvinylidene difluoride membrane, a polyethylene agent, or both. membrane, a polystyrene membrane, a polyurethane mem 17. The method of claim 1 or claim 6, wherein the DNA brane, a polyphenylene oxide membrane, a poly(tetrafluoro amplification mixture further comprises gelatin, powdered ethylene-co-hexafluoropropylene) membrane, or a combina milk, albumin, casein, bactopeptone or combinations thereof. tion thereof. 18. The method of claim 1, further comprising eluting out 5. The method of claim 4, wherein the porous matrix is a the amplicon from the porous matrix. cellulose membrane, a nitrocellulose membrane, or a combi 19. The method of claim 1, wherein the inosine-containing nation thereof. primer is an exonuclease-resistant primer. US 2015/O167065 A1 Jun. 18, 2015 28

20. A method for extracting a genetic material from a (d) determining a quantity of amplicons produced within biological sample comprising: the porous matrix; and (a) contacting the biological sample with a porous matrix (e) eluting the at least one amplicon out of the porous comprising chemicals that lyse the biological sample matrix. and preserve the genomic DNA within the porous 21. The method of claim 20, wherein the porous matrix is matrix; impregnated with chemicals chosen from a salt, a detergent, a (b) contacting the preserved genomic DNA within the chaotrope, a reducing agent, an anti-oxidant, a chelating porous matrix with a DNA amplification reaction mix agent, a buffer, or combinations thereof. ture comprising at least one inosine-containing primer, 22. The method of claim 21, wherein the porous matrix is at least one 5'-->3' exonuclease-deficient DNA poly impregnated with guanidinium hydrochloride, arginine, merase having Strand displacement activity, at least one sodium dodecyl sulfate (SDS), urea, or combinations thereof. nuclease that is capable of nicking a DNA at a residue 3 23. The method of claim 22, wherein the endonuclease is to an inosine residue, and dNTP mixture; endonuclease V or a mutant endonuclease V. (c) amplifying at least one portion of the preserved 24. The method of claim 23, wherein the DNA amplifica genomic DNA within the porous matrix using the DNA tion mixture further comprises gelatin, powdered milk, albu amplification reaction mixture of step (b) to produce tat min, casein, bactopeptone or combinations thereof. least one amplicon within the porous matrix: k k k k k