Deletion of the Oligopeptide Transporter Lmo2193 Decreases the Virulence of Listeria Monocytogenes

J Vet Sci. 2020 Nov;21(6):e88 https://doi.org/10.4142/jvs.2020.21.e88 pISSN 1229-845X·eISSN 1976-555X Original Article Deletion of the oligopeptide Microbiology transporter Lmo2193 decreases the virulence of Listeria monocytogenes Honghuan Li 1, Yanjie Qiao 1, Dongdong Du 2, Jing Wang 1,3,*, Xun Ma 1,* 1College of Animal Science and Technology, Shihezi University, Shihezi 832003, Xinjiang, China 2Analysis and Testing Center, Xinjiang Academy of Agricultural and Reclamation Science, Shihezi 832003, Xinjiang, China 3Key Laboratory of Control and Prevention of Animal Disease, Xinjiang Production & Construction Corps, Shihezi 832003, Xinjiang, China Received: May 13, 2020 Revised: Sep 15, 2020 ABSTRACT Accepted: Oct 5, 2020 Background: Listeria monocytogenes is a gram-positive bacterium that causes listeriosis mainly *Corresponding authors: in immunocompromised hosts. It can also cause foodborne outbreaks and has the ability Jing Wang to adapt to various environments. Peptide uptake in gram-positive bacteria is enabled by Key Laboratory of Control and Prevention of Animal Disease, Xinjiang Production oligopeptide permeases (Opp) in a process that depends on ATP hydrolysis by OppD and F. & Construction Corps; College of Animal Previously a putative protein Lmo2193 was predicted to be OppD, but little is known about Science, Shihezi University, North 4th Road, the role of OppD in major processes of L. monocytogenes, such as growth, virulence, and Shihezi 832003, Xinjiang, China. biofilm formation. E-mail: [email protected] Objectives: To determine whether the virulence traits of L. monocytogenes are related to OppD. Methods: In this study, Lmo2193 gene deletion and complementation strains of L. monocytogenes Xun Ma College of Animal Science, Shihezi University, were generated and compared with a wild-type strain for the following: adhesiveness, invasion North 4th Road, Shihezi 832003, Xinjiang, ability, intracellular survival, proliferation, 50% lethal dose (LD50) to mice, and the amount China. bacteria in the mouse liver, spleen, and brain. E-mail: [email protected] Results: The results showed that virulence of the deletion strain was 1.34 and 0.5 orders © 2020 The Korean Society of Veterinary of magnitude higher than that of the wild-type and complementation strains, respectively. Science The function of Lmo2193 was predicted and verified as OppD from the ATPase superfamily. This is an Open Access article distributed Deletion of lmo2193 affected the normal growth ofL. monocytogenes, reduced its virulence in under the terms of the Creative Commons cells and mice, and affected its ability to form biofilms. Attribution Non-Commercial License (https:// Conclusions: Deletion of the oligopeptide transporter Lmo2193 decreases the virulence of creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial L. monocytogenes. These effects may be related to OppD's function, which provides a new use, distribution, and reproduction in any perspective on the regulation of oligopeptide transporters in L. monocytogenes. medium, provided the original work is properly cited. Keywords: Listeria monocytogenes; oligopeptide permeases; gene deletion; biofilm; virulence ORCID iDs Honghuan Li https://orcid.org/0000-0002-1983-3470 INTRODUCTION Yanjie Qiao https://orcid.org/0000-0003-1614-8707 Listeria has over 15 internationally recognized species, among which only Listeria ivanovii and Dongdong Du Listeria monocytogenes are considered to be pathogenic [1-3]. L. monocytogenes is a Gram-positive https://orcid.org/0000-0002-1619-8635 Jing Wang intracellular pathogen originally thought to infect only rabbits and guinea pigs. However, https://orcid.org/0000-0002-6653-4860 infections in humans were later confirmed, and L. monocytogenes was identified as a foodborne Xun Ma pathogen and causative agent of human and livestock listeriosis. L. monocytogenes can grow at https://orcid.org/0000-0002-0847-1865 low temperatures and has strong resistance to environmental stress factors, such as low pH https://vetsci.org 1/13 Toxicity of oligopeptide transporter to Listeria monocygenes Funding and high salt concentration. Therefore, L. monocytogenes is of high importance in the food and This work supported by National Natural animal husbandry industries [4-6]. Science Foundation of China (No. China, 31860712 and 31360614); the Open Project Program of Xinjiang Provincial Bacterial species can acquire peptides in different ways. Genes for Opp are widely present State Key Laboratory of Sheep Genetic in Gram-negative and positive bacteria, and it is a multi-subunit protein complex belonging Improvement and Healthy Production to the ABC transporter family [7]. Opp is usually located in the plasma membrane and its (No. MYSKLKF201905). High-level Talents primary function is to capture peptides from the extracellular environment as a source Research Project of Shihezi University (No. of carbon and nitrogen in plasma. At the genetic level, the five Opp genes encoding the RCZX201504); XPCC international science subunits of the transporter are contained in a single operon, OppABCDF [8]. The resulting and technology cooperation project (No. 2017BC003); the Open Project Program of Opp complex (OppABCDF) is the main transporter of incoming peptides, and acts as an Key Laboratory of Control and Prevention ATP-binding cassette (ABC) transporter. OppABCDF contains five proteins in the assembled of Animal Disease, Xinjiang Production & complex: OppA, OppB, OppC, OppD and OppF, where each subunit plays different roles in Construction Corps (No. 2020BTDJ05). the bacterial transport process. OppB and OppC are homologous membrane integration Conflict of Interest proteins, which together form a translocation pore. OppD and OppF are two homologous The authors declare no conflicts of interest. nucleotide binding domains that can facilitate transport by ATP binding and hydrolysis. Finally, OppA is a receptor or substrate binding protein that determines the specificity Author Contributions towards the system's substrate. It has been hypothesized that the L. monocytogenes Opp operon Conceptualization: Honghuan L; Data curation: Honghuan L, Yanjie Q; Formal also consists of five subunits 9[ ]. In addition to their important role in cell nutrition, peptide analysis: Honghuan L; Funding acquisition: transporters may be involved in processes that regulate cell-to-cell signaling, including the Jing W, Xun M; Investigation: Honghuan L; regulation of pathogenic bacterial virulence gene expression. Methodology: Honghuan L, Dongdong D; Project administration: Xun M; Resources: In 2016, Maury used pan-genome technology to analyze genome-wide sequences of 104 L. Xun M; Writing - original draft: Honghuan L; monocytogenes strains, and predicted 15 new putative virulence factors, including Opp that is Writing - review & editing: Jing W, Xun M. potentially coded in 2 putative genes: lmo2192 and lmo2193. The RAST annotation of Lmo2192 is OppF, however the function of lmo2193 is unknown, as no RAST annotation exists [10]. Studies indicate that Opp in L. monocytogenes is associated with survival at low temperatures, oligopeptide transport, and virulence. In this study, lm2193 was assigned as OppD, which belongs to the ATPase superfamily. A deletion mutant in lmo2193 impaired virulence of the LM90SB2 strain both in vitro and in vivo. MATERIALS AND METHODS Bacterial strains, plasmids and cells Wild-type L. monocytogenes strain LM90SB2 of serotype 4b was isolated from sheep with sciatic encephalitis in Xinjiang. The strain was isolated, identified and preserved by the Institute of Animal Science and Technology at Shihezi University. The temperature sensitive shuttle vector pKSV7 was gifted by Zhejiang University, China; and the integration plasmid pIMK2 was gifted by Professor Yin Yuelan of Yangzhou University, China. Primary human brain microvascular endothelial cells (HBMEC) were purchased from Scien Cell Research Laboratories, USA. Mouse brain microvascular endothelial cells (MBMEC) were purchased from Guangzhou Ginio Biotech Co., Ltd. Swine intestinal epithelial cells (SIEC) and the mouse macrophage line RAW264.7 were stored by our laboratory. 6- to 8-week-old BALB/c mice were purchased from the Shihezi University Animal Experimental Center. Primers Primers were designed using the gene sequence of the L. monocytogenes reference strain EGD-e genome in GenBank (accession number: AL591982), lmo2193 gene sequence (accession https://vetsci.org https://doi.org/10.4142/jvs.2020.21.e88 2/13 Toxicity of oligopeptide transporter to Listeria monocygenes Table 1. Polymerase chain reaction primers used in this experiment Name/number Sequence (5′–3′) Product length (bp) Target gene F1 AACTGCAGTGTGGGTAACGACCAGCAT 3′ (PstI) 454 Upstream sequence of the lmo2193 gene R1 TAAAAGAGAGGTGAGGAAAACTGAACAAAGAGAAAAATT F2 AATTTTTCTCTTTGTTCAGTTTTCCTCACCTCTCTTTTA 342 Downstream sequence of the lmo2193 gene R2 CGGGATCC-TATGGCTTCCATGACTTTAG (BamH I) DF CATTCACACTCCTTATCGGGT 2,563 (1,486) Detecting primers DR CTTTATTGGGCTTGGTCTTCC CF CGCGGATCCATGGAAAAGCTATTAGAAG (BamH I) 1,077 lmo2193 gene CR CCCTCGAGTCATTCTACCTCTACCCCT (XhoI) Underlined values, restriction enzyme cutting site. number: CAD00271) using Primer 5.0 software. Primers F1 and F2 were used to construct the lmo2193 deletion strain. The detection primers DF and DR were used to amplify a 1486-bp DNA fragment from the genomic DNA of the mutant strain ΔOppD. Recombinant primers CF and CR were used to amplify a 1077-bp target gene fragment. Table 1 shows information for

Load more