Diversity, Host Ranges, and Potential Drivers Of

Home , Acraspis, Atrusca, Bassettia, Belonocnema, Cynipinae, Cynipini

Copyedited by: OUP

Insect Systematics and Diversity, (2020) 4(6): 3; 1–13 doi: 10.1093/isd/ixaa017 Conservation and Biodiversity Research

Diversity, Host Ranges, and Potential Drivers of Speciation Among Downloaded from https://academic.oup.com/isd/article/4/6/3/5997471 by University of Iowa Libraries/Serials Acquisitions user on 08 February 2021 the Inquiline Enemies of Oak Gall Wasps (Hymenoptera: Cynipidae)

Anna K. G. Ward,1,2, Sofia I. Sheikh,1 and Andrew A. Forbes1,

1Department of Biology, University of Iowa, 129 East Jefferson Street, Iowa City, IA 52242 and 2Corresponding author, e-mail: [email protected]

Subject Editor: Heather Hines

Received 12 August, 2020; Editorial decision 14 October, 2020

Abstract Animals that exploit living spaces of other animals (inquilines) may have specialized traits that adapt them to extended phenotypes of their ‘hosts’. These adaptations to host traits may incur fitness trade-offs that restrict the host range of an inquiline such that shifts to new hosts might trigger inquiline diversification. Speciation via host shifting has been studied in many animal parasites, but we know less about the role of host shifts in inquiline speciation. Synergus Hartig (Hymenoptera: Cynipidae: Synergini) is a speciose but taxonomically challenging genus of inquilines that feed inside galls induced by oak gall wasps (Hymenoptera: Cynipidae: Cynipini). Here, we report on a large collection of Synergus reared from galls of 33 oak gall wasp species in the upper Midwestern United States. We integrated DNA barcodes, morphology, ecology, and phenology to delimit putative species of Synergus and describe their host ranges. We find evidence of at least 23Synergus species associated with the 33 gall wasp hosts. At least five previously described Synergus species are each complexes of two to five species, while three species fit no prior description. We find evidence that oak tree phylogeny and host gall morphology define axes of specialization for Synergus. The North American Synergus have experienced several transitions among gall hosts and tree habitats and their host use is correlated with reproductive isolation. It remains too early to tell whether shifts to new hosts initiate speciation events in Synergus inquilines of oak gall wasps, or if host shifts occur after reproductive isolation has already evolved.

Key words: Synergus, Cynipidae, ecological speciation, Quercus, gall-forming insects

Many plant-feeding insects are attacked by diverse and complex and reproductive isolation, another group of insect natural enemies communities of natural enemies (Price 1980, Rodríguez and promises equally interesting insights but is far less well studied in Hawkins 2000, Lewis et al. 2002). In general, these natural enemy this context. Inquilinous insects (inquilines) exploit the homes and/ communities are dominated by one or more trophic levels of para- or use resources produced by other insects (Roskam 1979). Unlike sitic wasps (parasitoids) that lay eggs into or onto their hosts, and parasitoids, which directly parasitize the host insect, inquilines ‘at- whose larvae feed on the still-living host’s body. The particular tack’ the extended phenotype of their ‘host’ insect, and their effect ubiquity of parasitoids (Noyes 2012, Forbes et al. 2018) has led can range from a benign commensalism to a malignant kleptopara- to much research into the mechanisms underlying their evolu- sitism. Though inquilines are common and taxonomically diverse tionary success, with shifts by specialist parasitoids onto new host in the context of some habitats (Sanver and Hawkins 2000), few species frequently invoked as a potential driver of their speciation studies to date have examined life history characters or host ranges (e.g., Stireman et al. 2005, Forbes et al. 2009, Joyce et al. 2010, for individual inquiline species (Stone et al. 1995, 2017), and fewer Hood et al. 2015, Kester et al. 2015, Hamerlinck et al. 2016). still have asked how ecology might influence their evolution and di- A related body of work has employed DNA sequence data to re- versity (though see: Abrahamson et al. 2003, Blair et al. 2005). veal cryptic host specialization among insects—including para- Defined by their strategy of exploiting a habitat created by an- sitoids—initially thought to be oligophagous (Smith et al. 2006, other animal, inquilines are a common associate of insects that in- 2008, 2011; Condon et al. 2008, 2014; Desneux et al. 2009; duce the development of galls—fleshy, highly structured growths of Forbes et al. 2012). tissue—on plants (Sanver and Hawkins 2000). Larvae of gall-inducing While parasitoids continue to be rewarding systems for evolu- insects benefit from the assured source of food that their gall provides tionary biologists interested in the relationship between host use and the protection from predators that concealment inside the gall

2 Insect Systematics and Diversity, 2020, Vol. 4, No. 6

offers (Egan et al. 2018). However, just as the gall ensures food and diversity is hypothesized to positively correlate with the diversity of security for the developing galler, so too can it provide a high-quality potential gall hosts and the Nearctic has a greater diversity of both source of food and protection to a variety of non-galling insects, oaks (~300 species, compared to just ~40 species in the Western including inquilines. Inquilines of gall-inducing insects typically lay Palearctic; Stone et al. 2002, Lobato-Vila and Pujade-Villar 2017, their eggs into the developing gall, after which their larvae consume Hipp et al. 2018) and oak-associated cynipid gall wasps (~700 spe- the gall tissue. This can lead to malnourishment or starvation of the cies, compared with 140 in the western Palearctic; Stone et al. 2002). young galler (Sanver and Hawkins 2000). Inquilines of galls therefore Our primary goal in the current study is to characterize patterns Downloaded from https://academic.oup.com/isd/article/4/6/3/5997471 by University of Iowa Libraries/Serials Acquisitions user on 08 February 2021 straddle the nexus of herbivore and parasite, feeding on plant tissue of diversity, host range, and ecology for a subset of the Nearctic but at the same time exploiting (and sometimes killing) their ‘host’ Synergus, with an eye toward understanding how changes in host insect. Inquilines are important enemies of many diverse gall-forming use might be tied to their diversification. We employ a regionally insects, including cecidomyiid flies (Diptera: Cecidomyiidae; Guay focused collection and Synergus-rearing effort from galls found et al. 2016), gelechid moths (Lepidoptera: Gelechidae; Judd 1967), growing on 15 species of oak trees, infer reproductive barriers using buprestid beetles (Coleoptera: Buprestidae; Medianero et al. 2007), molecular barcodes, ecology, and morphology, and ask the following psyllids (Hemiptera: Psyllidae; Yang et al. 2001), thrips (Thysanoptera: questions: 1) Do putative Synergus species that attack multiple dif- Phlaeothripidae; Crespi 1992), and cynipid wasps (Hymenoptera: ferent gall types harbor additional host- or habitat-associated genetic Cynipidae; Ács et al. 2010). While not as speciose as parasitoids in structure? 2) Along what axes (gall wasp species/gall morphology/ most gall systems, they can often be among the most numerically tree species), if any, do Synergus specialize? We also use our limited dominant of gall associates, and some galls can host several different molecular data to make a first inference regarding how Nearctic and species of inquiline (Roininen and Price 1996, Forbes et al. 2015) to Palearctic Synergus are related to one another. the extent that the inquilines may even be attacked by other species of specialized parasitoids (Wiebes-Rijks and Shorthouse 1992). Synergus Hartig (Hymenoptera: Cynipidae: Synergini) is a genus Methods of inquiline wasps whose larvae feed on galls made on oak trees Collections (Quercus L.; Fagales: Fagaceae) by many of the ~1,000 species of oak We employed a collection approach largely focused on galls in the gall wasp (Hymenoptera: Cynipidae: Cynipini) (Pénzes et al. 2018). Midwestern United States (Fig. 1). We collected galls from August Most Synergus do not create their own primary galls (though see Abe 2015 through October 2017. We recorded geographical location, et al. 2011, Ide et al. 2018). Instead, they induce secondary cham- date of collection, tree host, and the species of gall wasp (based on bers in galls made by other cynipid wasps (Askew 1961, Pénzes et al. gall characteristics, Weld 1959). We stored each collection of galls in 2012). Some Synergus do not mortally injure the developing gall wasp, an individual cup in an incubator that mimicked seasonal variations while others sever the nutrient supply and can be lethal to other gall in temperature, humidity, and light/dark cycle. Each day, we checked inhabitants (Csóka et al. 2005, Ács et al. 2010). Synergus are common all cups in the incubator and placed any emergent insects into 95% across oak gall communities: often multiple species attack the same ethanol, recording the date of emergence. We identified each insect to galler species (e.g., Melika 2006, Nazemi et al. 2008, Bird et al. 2013, family or genus using a variety of taxonomic resources (Goulet and Forbes et al. 2015, Weinersmith et al. 2020), though in many galls only Huber 1993, Gibson et al. 1997, Wahl 2015). In total, we collected one Synergus is known (Burks 1979) and in still others they may be >24,000 galls, representing 103 gall wasp species (inferred using gall replaced by other inquiline genera (e.g., Joseph et al. 2011). morphologies and tree host association based on Weld 1959). Just a few studies have used molecular data to address the evolution and host ranges of Synergus, and all of these have focused on the Palearctic region. A three-gene (COI, cytb, and 28S) phylogeny of inquilines associated with oak gall wasps included 23 of the 30 described Western Palearctic Synergus species and generally supported the hypothesis that they are monophyletic relative to other gall-associated inquiline genera (Ács et al. 2010). Ács et al. (2010) also suggested that some species, including the apparent generalist Synergus umbraculus (Olivier), might be amalgams of several morphologically convergent lineages. This phylogenetic work did not directly address species host ranges at the host plant or gall wasp species level. Two subsequent studies (Bihari et al. 2011, Stone et al. 2017) addressed the population genetics of one of the lineages of S. umbraculus identified byÁcs et al. (2010; lineage 19). Both studies found a strong geographic signal without any strong signal of host- associated genetic differentiation. However, all host gall wasps in these studies were in genus Andricus and all collections save for one were from oaks in the same taxonomic section (Quercus sect. Quercus) (Bihari et al. 2011, Stone et al. 2017). Though much more remains to be addressed relative to the role of host in diversification of Palearctic Synergus, even less is known about Synergus in the Nearctic despite the latter being more species-rich and with a far greater diversity of potential gall hosts (Pénzes et al. 2012,

2018). Seventy-eight species of Synergus have been described in the Fig. 1. Map of gall collections that yielded Synergus samples used in this Nearctic (Lobato-Vila et al. 2019), though the total number is pre- study. For a list of samples, locations, and tree and gall associations, see dicted to be far higher (Lobato-Vila and Pujade-Villar 2017). Synergus Supp Table 2 (online only). Copyedited by: OUP

Insect Systematics and Diversity, 2020, Vol. 4, No. 6 3

Identification of Putative Species Bayesian support values to each node describing the likelihood that We first separated Synergus by gall association and then sorted indi- descendants of that node belong to the same species. We used the viduals into morphotypes based on characters used by previous au- online server (http://species.h-its.org/) and used our Bayesian tree thors to distinguish species (e.g., color, mesopleural striation, antennal of Synergus samples (Supp Fig. 47 [online only]) as the input tree. segmentation, patterns of syntergal punctures, etc.). Representatives We ran 100,000 MCMC generations with a 10% burn-in. We con- from each morphotype were also identified to species—where pos- firmed convergence by visualizing the likelihood trace plots of the sible—using keys by Gillette (1896), Lobato-Vila and Pujade-Villar iterations. Downloaded from https://academic.oup.com/isd/article/4/6/3/5997471 by University of Iowa Libraries/Serials Acquisitions user on 08 February 2021 (2017), and Lobato-Vila et al. (2019), or matched to described species based on morphological descriptions and records of host associ- Results ations found in Fullaway (1911), McCracken and Egbert (1922), or Muesebeck et al. (1951). From each morphologically defined species, Summary of Collections and Species Hypotheses we chose individuals (usually females) to interrogate genetically. To We reared 12,272 individual natural enemies from 88 different gall allow for detection of possible cryptic diversity, we chose individuals types. Of these natural enemies, 1,645 were Synergus wasps reared that represented a diverse set of collection sites and from across each from galls of 33 gall wasp species (Supp Tables 3 and 4 [online only]). morphotype’s spectrum of eclosion dates. In cases where a Synergus Among these, we identified 14 Synergus morphospecies, 11 of which morphotype emerged from the same gall wasp species but from dif- corresponded closely to previously described taxa (see Synthesis ferent oak tree species, we also chose representatives from each tree below for details). Although relative support values differed for habit. We photographed a single forewing and a profile of the body Bayesian and maximum likelihood mtCOI trees, topologies were the of each wasp used in genetic work (Supp Figs. S1–S46 [online only]). same. The Bayesian tree of 148 individual Synergus (Fig. 2; Supp We also pinned and deposited representatives of most morphotypes Fig. 47 [online only]) demonstrates extensive phylogenetic struc- into the collection of the University of Iowa Museum of Natural ture corresponding to host gall wasp and oak section association. History (Supp Table 1 [online only]). The synthesis of our data with the Palearctic Synergus sequences For 96 samples extracted before 2017, we used a DNeasy previously published by Ács et al. (2010) produced Bayesian and Blood and Tissue kit (Qiagen, Germantown, MD) to destructively maximum likelihood trees with the same topology: the Palearctic extract DNA from specimens. For another 55 Synergus extracted Synergus formed a clade within the Nearctic Synergus (Fig. 3; Supp after 2017, we used a CTAB/PCI approach following the methods Figs. 48 and 49 [online only]). from Chen et al. (2010). The mtCOI region was amplified using For ABGD, there was no clear barcode gap and thus we investi- the primers LepR1 5′ TAAACTTCTGGATGTCCAAAAAATCA gated two different partitions—one more liberal (more splitting) and 3′ and LepF1 5′ ATTCAACCAATACATAAAGATATTGG 3′ one more conservative (more clumping). The liberal partition sug- (Smith et al. 2008). We cleaned DNA using EXOI and SAP be- gested 36 groups, whereas the conservative partition suggested 21 fore Sanger sequencing both the forward and reverse sequence groups (Fig. 2; Supp Fig. 50 [online only]). The highest support solu- on an ABI 3730 in the University of Iowa’s Carver Center for tion for bPTP suggested 31 groups (Fig. 2; Supp Fig. 51 [online only]). Genomics. We edited and aligned sequences in Geneious v.8.1.9 (Biomatters, Inc., San Diego, CA) and determined the model with Synthesis the best fit to our sequences using AIC in jModelTest2 (Darriba While any one of morphological differences, mtCOI sequence di- et al. 2012), which chose a GTR+I+Γ model. We constructed vergence, and patterns of differing host association in sympatry phylogenetic trees using a Bayesian approach (MrBayes v3.2, would not alone be sufficiently strong evidence of species bound- Ronquist et al. 2012), performing two independent searches with aries, agreement between them builds a much stronger argument. four chains run for 3,000,000 generations, sampling every 1,000 We use concordance between these three factors to define a final generations. Log-likelihood plots of the MCMC iterations were count of putative species in our collections (Fig. 2). Among the ori- visualized to confirm convergence and select a standard 25% ginal 14 morphologically defined species, we find a revised total burn-in. We also constructed a phylogenetic tree using a max- of 23–27 species. In particular, at least five previously described imum likelihood approach with RAxML v8.2, using a GTR+Γ Synergus species in our collections are each composed of at least model with 1,000 bootstrap pseudoreplicates (Stamatakis two or more taxa, each with a more limited range of host galls than 2014). Sequences are available on GenBank: accession numbers morphological species definitions initially implied. What follows is MT124785:MT124935 (see Supp Table 2 [online only]). We also an account of each morphological ‘species’ alongside a summary of combined our mtCOI sequences with a previously published data its revised status in light of these new results. Species are named set of Palearctic Synergus mtCOI sequences from Ács et al. (2010) below in the order in which they appear in our mtCOI tree, from top and generated Bayesian and maximum likelihood trees following to bottom (Fig. 2). When a species was reared from >1 different gall the same methods as above. types, we discuss apparent morphological or location-based similar- We generated molecular species hypotheses using two different ities among these gall hosts. We also plot collection and emergence but complementary approaches: Automatic Barcode Gap Discovery dates of all Synergus specimens to offer a sense of their phenology as (ABGD; Puillandre et al. 2012) and PTP (Poisson Tree Processes it relates to host use (Fig. 4). model; Zhang et al. 2013). ABGD uses a sequence alignment to infer Synergus laeviventris (Osten-Sacken) (clades 1–3) (wing and lat- a confidence interval for genetic divergence within species. Ideally, a eral habitus images: Supp Figs. S1–S6 [online only]) is a complex clear difference emerges between interspecific and intraspecific com- of at least three species, differing from one another in their host parisons, defining a ‘barcode gap’ for the sample set. ABGD was run gall use. One species (clade 1) attacks the bud galls of Andricus with the default prior range (0.001, 0.1), a Jukes–Cantor model of pisciformis Beutenmüller and Andricus quercusfrondosus (Bassett) distance, and minimum slope increase of 1. PTP (Zhang et al. 2013) on white oak (Quercus alba L.) and swamp white oak (Quercus bi- is a coalescence-based approach that requires a rooted phylogen- color Willd.)—both in oak section Quercus. A second species (clade etic tree as its input. We used the updated version bPTP, which uses 2) uses Disholcaspis quercusglobulus (Fitch) bullet galls on white branch lengths as proxies for substitutions and provides posterior oak (section Quercus), and a third (clade 3) attacks several different Copyedited by: OUP

4 Insect Systematics and Diversity, 2020, Vol. 4, No. 6 Downloaded from https://academic.oup.com/isd/article/4/6/3/5997471 by University of Iowa Libraries/Serials Acquisitions user on 08 February 2021

Fig. 2. Overview of all data used in inferring Synergus species hypotheses for this study. Left: simplified mtCOI phylogeny ofSynergus included in this study (see Supp Fig. 47 [online only] for full tree). Bold branches indicate support ≥0.9. ‘Clade’ describes putative species assignments based on the sum of information to the right of this column. Gray bars in ABGD (conservative [‘C’] and liberal [‘L’] partitions) and bPTP columns indicate assignments of individuals into groups by these respective algorithms. ‘Morphological ID’ refers to each collection’s similarity (or lack of similarity) to previously described species. ‘Gall host’, ‘oak section’, ‘plant tissue(s)’, and ‘Host gall morphology’ refer to ecological characters for Synergus in each clade, and example photos of galls are shown in Fig. 6.

oak apple galls (Andricus Hartig and Amphibolips Reinhard) found Synergus unk. #1 (clade 4) (Supp Figs. S7 and S8 [online only]) on red oak (Quercus rubra L.) and pin oak (Quercus palustris was reared from an unknown twig gall on a bur oak (Quercus Münchh.)—both section Lobatae. Previous rearing records (Gillette macrocarpa Michx.; section Quercus). This Synergus ran closest to 1896) associate S. laeviventris with the oak apple gall Amphibolips Synergus batatoides Ashmead in the Gillette (1896) key, but its color quercusspongifica Osten-Sacken, as well as from three bullet galls: and sculpturing did not match that description. Synergus batatoides D. quercusglobulus, Disholcaspis rubens (Gillette), and Atrusca are associated with Callirhytis quercusbatatoides (Ashmead) quercuscentricola (Osten-Sacken). Clades 1 and 3 are unusual stem galls in southern live oaks (Quercus virginiana Mill.; section among our collections in that we found evidence of two or three Virentes). Since we do not have specimens of S. batatoides for com- temporally distinct generations, each attacking different gall species parison, it is not clear whether this is just a morphological variant (Fig. 5). of a species previous described only from the southern United States Copyedited by: OUP

Insect Systematics and Diversity, 2020, Vol. 4, No. 6 5

a few months of gall collection or after more than a year (Fig. 4). One species (clades 8a and 8b) was reared from Acraspis Mayr galls and other leaf galls on various white oaks (section Quercus). This species was split into two additional groups by the ‘liberal’ ABGD partition but since both groups contained Synergus from the same Acraspis pezomachoides Osten-Sacken collection in Peducah, KY, this split does not appear to be supported by ecology or geog- Downloaded from https://academic.oup.com/isd/article/4/6/3/5997471 by University of Iowa Libraries/Serials Acquisitions user on 08 February 2021 raphy. A second species (clade 9) was reared from Andricus biconius Weld and Andricus robustus Weld in post oaks (Quercus stellata Wangenh.; section Quercus), and a third species (clade 10) was reared from Andricus quercusstrobilanus (Osten-Sacken) in bur, white, and swamp white oaks (section Quercus). A fourth species (clade 11) was reared from a variety of stem and leaf galls on oaks in section Quercus. Previous taxonomic work has already suggested that S. oneratus species contains two geographic varieties differing in the amount of black on the mesonotum: S. oneratus oneratus (some yellow) in the Midwest and S. oneratus coloradensis (entirely black) Fig. 3. Summary phylogenetic tree of Nearctic Synergus mtCOI sequences in the west (Gillette 1896). The discovery of S. oneratus oneratus in from this study (shown here collapsed into two clades) combined with California (Fullaway 1911, McCracken and Egbert 1922) indicated Palearctic mtCOI sequences from Synergus and other inquilinous cynipids a more complex distribution. Here, clades 10 and 11 (Supp Figs. previously published in Ács et al. (2010). Values above the branches represent S19 and S21 [online only]) appear to better match the description of Bayesian posterior probabilities and the values below the branch are maximum likelihood bootstrap values. See Supp Figs. 48 and 49 (online only) S. oneratus oneratus, while clade 8 (Supp Figs. S15 and S17 [online for full trees. only]) is closer to S. oneratus coloradensis. No females of clade 9 were available for this comparison. or a different species. This species was also notable as one of the Synergus unk. #2 (clade 12) (Supp Fig. S23 [online only]) was earliest-emerging Synergus in our collections (Fig. 4). represented by a single male reared from a Philonix nigra (Gillette) Synergus coniferae Ashmead (clade 5) (Supp Figs. S9 and S10 gall on leaves of bur oak in Konza, KS (clade 12). Because many keys [online only]) was reared from Callirhytis quercusventricosa and do not address males, the failure to attach a name to this species does previously from the same host by Ashmead (1885). We found no not mean that it is undescribed. additional host or genetic structure within this species. Our samples Synergus villosus Gillette (clades 13 and 14) (Supp Figs. S24 and were taken from shingle oaks (Quercus imbricaria; section Lobatae) S25 [online only]) includes two distinct species. One species (clade in both Iowa City, IA, and St. Louis, MO. 13) was reared from Callirhytis lanata (Gillette) and Dryocosmus Synergus lignicola (Osten-Sacken) (clade 6) (Supp Figs. S11 and imbricariae Ashmead, a fuzzy leaf gall and a stem bullet gall, re- S12 [online only]) was reared from Callirhytis quercusgemmaria spectively, both on red oak (section Lobatae) in Tiffin, IA. A second (Ashmead) on red oaks (section Lobatae) from Traverse City, species (clade 14) was reared from Acraspis villosa Gillette, a fuzzy MI. These wasps closely match the description of Synergus davisi leaf gall, on bur oak (section Quercus) in Urbana, IL. Some caution (Beutenmüller 1907) and were reared from the same host gall from should be used in definitively separating clades 13 and 14, as col- which S. davisi was previously described, but a recent revision of lections were from different states and differences could be due to some Nearctic Synergus (Lobato-Vila et al. 2019) synonymized geography. The original description of S. villosus (Gillette 1896) was S. davisi with S. lignicola. Our female S. lignicola specimens have an from A. villosa galls collected in Iowa and the morphology of these incomplete division in their final antennal segments, such that they wasps exactly matches our Illinois wasp, while the samples from red can appear to have either 13 or 14 segments. oak showed them to have entirely yellow mesonota, which differs Synergus nr. lignicola (clade 7) (Supp Figs. S11 and S12 [on- from the bur oak collection and the original S. villosus description line only]) were reared from Callirhytis quercuspunctata (Bassett) (thorax entirely black). Wasps from both clades emerged 9–11 mo collected on pin oaks in St. Louis, MO. This twig gall is the same after gall collection (Fig. 4). host from which S. lignicola was previously reared (another Synergus magnus Gillette (clade 15) (Supp Fig. S26 [online only]) known host is the morphologically similar Callirhytis cornigera was reared from Amphibolips quercusjugulans (Osten-Sacken) leaf (Osten-Sacken)) (Gillette 1896), but it differs in having 14 (in- galls and from unidentified acorn galls on black oaks (Quercus stead of 13) female antennal segments, and a slight incision in the velutina Lam.) and red oaks, respectively (both section Lobatae). posterior-dorsal edge of its syntergite. At the more conservative This species was previously reared from an Amphibolips cookii partition, ABGD did not separate this species from S. lignicola Gillette gall (Gillette 1896). All S. magnus emerged within 1–2 mo (clade 6), though they were distinguished by both the bPTP of the gall collection data (Fig. 4). method and the more liberal ABGD partition. The difference in Synergus erinacei Gillette (clades 16 and 17) (Supp Figs. S27– morphology and host galls suggests that they are two different S29 [online only]) contains either one or two different species. species, though a lack of a sympatric collection here allows for One putative species (clade 16) was reared from Acraspis erinacei the possibility that differences are due to geographic isolation ra- (Beutenmüller) and A. pezomachoides leaf galls on white oaks ther than reproductive isolating barriers. (section Quercus). The second (clade 17) was reared from Acraspis Synergus oneratus (Harris) (clades 8–11; Supp Figs. S15–S22 [on- macrocarpae Bassett on bur oaks (section Quercus). The two line only]) may contain as many as five species among the samples S. erinacei clades are also separated by geography, so a definitive in our collection, each defined by COI sequence similarity, host asso- conclusion regarding species status requires additional work. ciation, and morphological variation. These Synergus showed some Synergus walshii Gillette (clades 18 and 19) (Supp Figs. S30–S33 variation in phenology, but generally emergence was either within [online only]) contains two putative species. One (clade 18) was Copyedited by: OUP

6 Insect Systematics and Diversity, 2020, Vol. 4, No. 6 Downloaded from https://academic.oup.com/isd/article/4/6/3/5997471 by University of Iowa Libraries/Serials Acquisitions user on 08 February 2021

Fig. 4. Collection and emergence dates for each of the 27 clades (putative species) of Synergus in this study. Dots indicate individual Synergus emergences; left-most margins of boxes demarcate the earliest gall collection that produced Synergus in each clade. In three cases, boxes with different border styles are used to indicate collection events from galls that occur at different times during the year, and which may indicate the use of temporally distributed gall hosts. Though galls were sometimes collected in different years, each collection was standardized to the year in which the gall first formed. Dates span >1 yr because some insects did not emerge from galls until more than a year after galls were collected.

reared from galls of two Phylloteras Ashmead species on bur oak Synergus unk. #3 (clade 21) (Supp Fig. S36 [online only]) was and swamp white oak (section Quercus), the other (clade 19) from reared from Disholcaspis Dalla Torre & Kieffer bullet galls on various Andricus leaf galls on bur, white, and post oaks (section branches of white, swamp white, and post oaks (section Quercus) Quercus). Previous collections of S. walshii (Gillette 1896) were and differed from S. punctatus by having females with mostly from Andricus quercusflocci (Walsh) galls, one of the clade 19 hosts. chestnut-brown heads, and <1/3 of the posterior edge of their Synergus punctatus Gillette (clades 20, 22–25) (Supp Figs. S34, S35, syntergite covered with punctures. and S37–S41 [online only]) may contain up to five distinct species. The Synergus campanula Osten-Sacken (clades 25–27) (Supp Figs. first species (clade 20) was reared from leaf galls of Andricus nigricens S42–S46 [online only]) contains between two and three species. Gillette on swamp white oak (section Quercus). A second species (clade One species (clade 25) was collected from clustered midrib leaf galls 22) was reared from Acraspis and Philonix Fitch leaf galls on white, of Andricus dimorphus (Beutenmüller) on dwarf chinquapin oak bur, and chinquapin oaks (Quercus muehlenbergii Engelm.) (section (Quercus prinoides Willd.; section Quercus). The other species (or Quercus) and females had some color variation, with thorax and ab- two) (clades 26 and 27) were reared from a mix of leaf and stem domen color ranging from black to a chestnut-brown. Two additional galls from white, swamp white, and post oaks (section Quercus). putative species—both with a mix of black- and brown-bodied individ- One potential difference between wasps in clades 26 and 27 is their uals—were reared from galls of A. robustus (clade 23) and A. erinacei emergence timing, with clade 26 wasps all emerging 10–12 mo after (clade 24) galls on post and white oaks, respectively. We are more ten- gall collection, while clade 27 wasps had two emergence peaks: one tative about definitively splitting clades 23 and 24 due to conflation of within the first few months after galls were collected and the other genetic and host differences with geographic distance. the following year (Fig. 4). Copyedited by: OUP

Insect Systematics and Diversity, 2020, Vol. 4, No. 6 7 Downloaded from https://academic.oup.com/isd/article/4/6/3/5997471 by University of Iowa Libraries/Serials Acquisitions user on 08 February 2021

Fig. 5. Collection dates, emergence dates, and gall morphologies of three species previously collected under the name Synergus laeviventris. The relationships (as implied by mtCOI) among the three species are shown in the tree at left. Red triangles denote collection dates for galls from which at least one S. laeviventris (black dots) later emerged, such that this figure allows for assessment of whenS. laeviventris emerged relative to when their host galls were collected. Boxes are used to isolate distinct collection/eclosion relationships from one another, which we interpret as evidence for discrete generations. Gall wasp species are labeled above the photos of their respective galls (* indicates the photo is a cross-section). Dates are organized to reflect emergence ofSynergus relative to when focal galls were formed by gall wasps, such that some Synergus emerge up to 1 yr after gall formation. Dates of eclosion are combined across the 3 yr of collection.

Discussion evolutionary histories. The Palearctic Synergus were initially div- ided into two major morphological groups (Mayr 1872): Section Nearctic Synergus Diversity and Taxonomy I, which are univoltine and usually not lethal to their associated One immediate lesson from this study is that the Nearctic Synergus galler, and Section II, which tend to be both bivoltine and lethal harbor both cryptic and undiscovered species. For 5 of 11 previously (Wiebes-Rijks 1979). The two sections also differed in patterns of named species in our collections, we find evidence of additional gen- microscopic punctures on their metasomal tergites. These sections etic, morphological, phenological (Fig. 4), and/or ecological struc- were more recently revealed to be paraphyletic (Ács et al. 2010). ture indicative of >1 species. Three other putative species apparently One of the potential reasons for the disconnect between morpho- fit no previous description. Because this was a geographically limited logical and molecular data is that Synergus can be morphologically survey, it thus seems very likely that many more undiscovered spe- cryptic as well as exhibit variance in morphology within species cies exist in North America, both as members of morphologically (Wiebes-Rijks 1979). cryptic assemblages, and as undescribed species. Indeed, when recent One morphological character previously suggested as useful authors have focused on the Nearctic, they have consistently added for organizing the Nearctic fauna seems immediately relevant new species (e.g., Lobato-Vila and Pujade-Villar 2017; Lobato-Villa given these new results. Gillette (1896) split the genus into three et al. 2018, 2019). The incompleteness of the record is perhaps un- ‘natural’ groups based on whether females of each species have surprising as most taxonomic and phylogenetic work has empha- 13, 14, or 15 segments in their flagella. Among our collections, sized the Synergus of the western Palearctic (Penzes et al. 2012) we found only 14- and 15-segmented females (with S. lignicola while the most comprehensive list of Nearctic Synergus species is being indeterminately 14-segmented), but all 15-segmented fe- now >40 yr old (Burks 1979). males (clades 12–15) grouped together on the mtCOI tree (Fig. 2; A taxonomic revision of the Nearctic Synergus that incorporates Supp Figs. 47 and 52 [online only]), suggesting a common an- molecular, morphological, and ecological data appears warranted, cestry among these samples. While we acknowledge caveats about and, though such a revision is beyond the scope of this paper, it inferring too much from a single short mitochondrial sequence might be informed by some of our findings. Morphological charac- (Funk and Omland 2003; and more on this below), this may be an ters historically used to sort Synergus into taxonomically relevant early indication that antennal segment number is an informative groups do not necessarily reflect characters shared due to common Copyedited by: OUP

8 Insect Systematics and Diversity, 2020, Vol. 4, No. 6 Downloaded from https://academic.oup.com/isd/article/4/6/3/5997471 by University of Iowa Libraries/Serials Acquisitions user on 08 February 2021

Fig. 6. Photos of galls collected in this study from which Synergus emerged. Gall photos are grouped based on similar morphology and location found on tree. Numbers following the species name of the gall indicate the Synergus clades (see Fig. 2) that were reared from that host.

character. To assist future efforts in this regard, we include sup- hosts of these Synergus, also show fidelity to oaks with similar chem- plemental profile and forewing pictures of wasps from each clade istry (which generally means more closely related oaks; Abrahamson (Supp Figs. S1–S46 [online only]) and have deposited examples of et al. 1998, 2003). most clades into the collection of the University of Iowa Museum Less specialization was evident at finer levels of plant taxonomic of Natural History. organization. For example, Synergus species reared from galls on white oak (Q. alba) were also often reared from galls on swamp Host Ranges and Axes of Specialization white oak (Q. bicolor), bur oak (Q. macrocarpa), or post oak Our primary motivation for this study was to evaluate the extent to (Q. stellata)—all North American members of section Quercus, the which inquilines specialize on aspects of their host environments, white oaks. Specialization on oak section rather than oak species which then would stand as an initial, indirect assessment of how may explain why prior assessments of host plant specialization in the changes in host use might result in lineage divergence. Evidence Palearctic Synergus—where most samples have been from the same from our study suggests that Nearctic Synergus specialize on aspects oak section—have not resolved strong genetic structure associated of host plant identity, gall morphology, and/or gall phenology. with host plant (e.g., Bihari et al. 2011, Stone et al. 2017). Given that One obvious axis of specialization was host tree section. Though Synergus in this study specialize on either red and white oaks, it will we made large collections of galls from several oak species in both be interesting in the future to include Synergus associated from oaks section Quercus (white oaks) and section Lobatae (red oaks), we in section Virentes (the live oaks), another North American group found no evidence of a Synergus species that was reared from both which overlaps geographically with the southern ranges of some of sections. This pattern conforms to previous studies, which have sug- the oaks in this study. gested Synergus may often be specific to closely related oaks species While Synergus did not appear to specialize at the oak species (Pujade-Villar et al. 2003). Other Cynipidae, including the gall wasp level (below the section level), they did specialize on galls of different Copyedited by: OUP

Insect Systematics and Diversity, 2020, Vol. 4, No. 6 9 Downloaded from https://academic.oup.com/isd/article/4/6/3/5997471 by University of Iowa Libraries/Serials Acquisitions user on 08 February 2021

Fig. 7. Emergence dates of adult Synergus punctatus (clade 24) from 20 separate collections of Acraspis erinacei galls, organized by their calendar date of collection. ‘n’ indicates the number of galls in each collection. Vertical dashed lines indicate the earliest date when we observed young A. erinacei galls on trees during this study. Red triangles denote the date of each collection, with the three collections in year 2 representing the previous year’s leaves collected from the ground beneath trees. The vertical grey bar indicates truncation of the months December–February when no Synergus were emerging.

morphology. Though our haphazard collections give us an incom- enemies and therefore similar galls will tend to be attacked by the plete picture of all hosts attacked by each species, most species tended same or similar species (Ward et al. 2019). Brookfield (1972) simi- to favor galls that shared similar characteristics (Figs. 2 and 6). larly suggested that inquilines and parasitoids of galls depend more Most strikingly, even when we reared Synergus from different gall on gall morphology than other factors such as gall wasp species or hosts across the course of the year, each generation nevertheless tree host (note, however, that this last is belied by our data). Because conserved elements of gall morphology. The clade 1 S. laeviventris the evolutionary relationships among the Nearctic gall wasps them- wasps, for example, emerged in late May from small bud galls of selves are not yet known, it is not possible to distinguish gall morph- Andricus pisiformis collected in early April, and then adults emerged ology from gall wasp phylogeny. A phylogeny of North American again in the fall from a second small bud gall (A. quercusfrondosus) gall wasps will be helpful in this respect. collected in August and September (Fig. 5). Adults of this species may Phenology has also been previously considered as an important then oviposit into pre-winter bud galls of A. pisiformis or perhaps axis of adaptation and specialization for Synergus because some attack a third overwintering host that we did not collect in this study. developing galls may offer only a limited ‘window of opportunity’ Similarly, we captured three discrete generations of S. laeviventris during which an inquiline might successfully oviposit (Penzes et al. clade 3 wasps, each attacking oak apple galls containing a central 2012). The S. laeviventris clades 1 and 3 wasps described above ap- cell surrounded by radiating fibers, but each made by different galler pear to fit this pattern, with each of their respective two or three gen- species (Fig. 5). erations attacking different galls, presumably during some window Conservation of host gall morphology suggests that Synergus of early gall development (Fig. 5). In contrast to this pattern, the long specialization conforms to the ‘Enemy Hypothesis’ (Bailey et al. (July–October) emergence schedule of S. punctatus clade 24 wasps 2009). That is: galls with similar qualities will exclude certain natural from A. erinacei galls (Fig. 7) suggests that these Synergus may Copyedited by: OUP

10 Insect Systematics and Diversity, 2020, Vol. 4, No. 6

undergo multiple generations per year and are capable of attacking An alternative to the above hypothesis is that ecological diver- A. erinacei galls for much of the time that these galls occur on leaves gence among Synergus occurs after reproductive isolation evolves (though an alternative interpretation here is that S. punctatus is between lineages. For instance, perhaps Synergus speciate in the univoltine and that harvesting galls from leaves somehow induces absence of divergent ecological selection (e.g., Nosil and Flaxman Synergus emergence). Some individual S. punctatus also undergo 2011), and then later shift into new hosts or habitats upon sec- a period of winter diapause that ends shortly before the next gen- ondary contact because partitioning of environments facilitates eration of A. erinacei appears on leaves again, further highlighting coexistence of ecologically similar sympatric species (Dufour et al. Downloaded from https://academic.oup.com/isd/article/4/6/3/5997471 by University of Iowa Libraries/Serials Acquisitions user on 08 February 2021 their phenological tracking of this host (Fig. 7). 2017). One advantage of our renewed exploration of the Nearctic Characterizing Synergus host ranges and their relative level of Synergus is that it suggests taxa for further study that may allow specialization has important connotations for conservation and the disentanglement of these competing hypotheses. For instance, pest control. Oak gall wasps have been transported into non-native clades where individuals with little or no mtCOI differentiation ranges (Walker et al. 2002, Prior and Hellmann 2010), with some have been reared from galls of different morphologies (e.g., clades classified as invasive due to their impact on trees (Buffington et al. 3, 9, 27) could be interrogated further. If experimental tests re- 2016, Davis 2017). Synergus, because they are often the most abun- vealed significant host-associated reproductive isolation and/or dant enemy of some gall species, may be particularly important population genetic analyses suggested evidence of host-associated in the control of alien gallers (Schönrogge et al. 1996, 2000), and genetic differentiation, these might support a hypothesis that their host breadth could inform likelihood of colonization. For in- difference in host use is contributing to divergence. Similarly, as stance, knowledge about host gall characters might allow for bio- new samples of Synergus from across a wider geographic area are control efforts that employ native Synergus rather than introducing added to this data set, an increasing role for geographic isolation non-native parasites or inquilines (though the latter can also be suc- might emerge between sister species. cessful: Moriya et al. 1989). Notes on the Relationship Between Nearctic and Implications for Synergus evolution Palearctic Synergus One leading explanation for why parasitoid wasps are so diverse is This first genetic analysis of a large number of Nearctic Synergus that adaptations to new insect hosts may lead to host-associated dif- allows for a preliminary assessment of their relationships to the ferentiation and speciation (Stireman et al. 2005; Feder and Forbes Palearctic Synergus. Our summary tree that includes the Ács et al. 2010, Kaiser et al. 2015, König et al. 2015). When a parasitoid (2010) Palearctic Synergus (Fig. 3) suggests at the very least that adopts a new host, trade-offs associated with adaptation to the new these are two different sets of fauna, with no species apparently host can result in reproductive isolation from individuals attacking spanning both North American and Eurasia. Further, this combined the ancestral host (Hood et al. 2015). We know surprisingly little mtCOI tree suggests that the Nearctic Synergus are not a monophy- about whether the same ecological differences can drive lineage di- letic group. Because this is based on a single gene, we are hesitant vergence in insect inquilines: one exception is the tumbling flower to make strong conclusions about the geographic origins, but if the beetle Mordellistena convicta (Coleoptera: Mordellidae), which Nearctic Synergus are not monophyletic (as others have previously suggested; Bozsó et al. 2014), it suggests that the history of move- feeds on the galls of two lineages of Eurosta solidaginis gall flies ment of these inquilines between continents bears close attention. (Diptera: Tephritidae) on goldenrods (Solidaginis; Compositae). Life Similarly, as additional data are collected, it will be interesting to history and molecular work has shown that both E. solidaginis and study in greater detail the uncertain phylogenetic relationship be- M. convicta have formed host-associated lineages on two different tween Synergus and its putative sister genus, Saphonecrus Dalla species of goldenrod, suggesting that speciation has ‘cascaded’ across Torre and Kieffer (Bozsó et al. 2014). Future multilocus analyses trophic levels (gall former to inquiline) (Abrahamson et al. 2003, promise to reveal additional insights into these histories. Eubanks et al. 2003, Rhodes et al. 2012). This beetle system offers a compelling hint that ecological changes might lead to lineage divergence in inquilines, but missing is a broader study of ecological and Supplementary Data host use patterns within an entire inquiline clade. Supplementary data are available at Insect Systematics and What do we learn about the role of host shifts in Synergus Diversity online. evolution? Though not a comprehensive phylogenetic history of these species, our mtCOI tree of Nearctic Synergus (Fig. 2; Supp Figs 47 and 50 [online only]) nevertheless suggests many histor- ical shifts between host tree sections (Quercus to Lobatae), be- Acknowledgments tween gall wasp species, and between gall morphologies. This Robin Bagley, Will Carr, Sarah Duhon, Alaine Hippee, Kyle McElroy, Dan- is not a definitive signature that host shifts drive speciation in iel McGarry, Kevin Neely, Monzer Shakally, Eric Tvedte, Joseph Verry, and Synergus, but the broad correlation between ecological changes Caleb Wilson helped collect galls. Irene Lobato-Vila provided helpful context and the evolution of reproductive isolation suggests this as a regarding possible morphological variation within Synergus lignicola and its synonymy with Synergus davisi. Three anonymous reviewers dramatically in- leading hypothesis. Transitions among host wasps, galls, and tree creased the quality of the final manuscript. Funding for collections was pro- sections all represent changes that—to differing extents—require vided to A.K.G.W. and S.I.S. from the Center for Global and Regional En- the evolution of novel behaviors, life histories, and strategies for vironmental Research at the University of Iowa, and by a James Van Allen circumventing host defenses. The accumulation of such divergent Natural Sciences Fellowship to A.A.F. characters in the context of different habitats has been shown to directly (Craig et al. 1993, Forbes et al. 2005, Fujiyama et al. 2013, Doellman et al. 2019, Hood et al. 2019) and indirectly Author Contributions (Nosil and Hohenlohe 2012) lead to the evolution of reproductive A.K.G.W. and A.A.F. conceived of the study. All authors collected and ana- isolation in many different insect systems. lyzed data and wrote the manuscript. Copyedited by: OUP

Insect Systematics and Diversity, 2020, Vol. 4, No. 6 11

References Cited and T. M. Withers (eds.), Biology, ecology and evolution of gall-inducing arthropods. Science Publishers, Inc., Enfield, NH. Abe, Y., T. Ide, and N. Wachi. 2011. Discovery of a new gall-inducing species Darriba, D., G. L. Taboada, R. Doallo, and D. Posada. 2012. jModelTest 2: in the inquiline tribe Synergini (Hymenoptera: Cynipidae): inconsistent more models, new heuristics and parallel computing. Nat. Methods. 9: implications from biology and morphology. Ann. Entomol. Soc. Am. 104: 772. 115–120. Davis, M. 2017. Biology, molecular systematics, population dynamics and Abrahamson, W., G. Melika, R. Scrafford, and G. Csoka. 1998. Gall-inducing control of a stem gall wasp, Zapatella davisae (Hymenoptera: Cynipidae). insects provide insights into plant systematic relationships. Am. J. Bot. 85:

Ph.D. dissertation, University of Massachusetts, Amherst, MA. Downloaded from https://academic.oup.com/isd/article/4/6/3/5997471 by University of Iowa Libraries/Serials Acquisitions user on 08 February 2021 1159. Desneux, N., P. Starý, C. J. Delebecque, T. D. Gariepy, R. J. Barta, Abrahamson, W. G., C. P. Blair, M. D. Eubanks, and S. A. Morehead. K. A. Hoelmer, and G. E. Heimpel. 2009. Cryptic species of parasitoids 2003. Sequential radiation of unrelated organisms: the gall fly Eurosta attacking the soybean aphid (Hemiptera: Aphididae) in Asia: Binodoxys solidaginis and the tumbling flower beetle Mordellistena convicta. J. Evol. communis and Binodoxys koreanus (Hymenoptera: Braconidae: Biol. 16: 781–789. Aphidiinae). Ann. Entomol. Soc. Am. 102: 925–936. Ács, Z., R. J. Challis, P. Bihari, M. Blaxter, A. Hayward, G. Melika, G. Csóka, Doellman, M. M., S. P. Egan, G. J. Ragland, P. J. Meyers, G. R. Hood, Z. Pénzes, J. Pujade-Villar, J. L. Nieves-Aldrey, et al. 2010. Phylogeny and T. H. Q. Powell, P. Lazorchak, D. A. Hahn, S. H. Berlocher, P. Nosil, et al. DNA barcoding of inquiline oak gall wasps (Hymenoptera: Cynipidae) of 2019. Standing geographic variation in eclosion time and the genomics the Western Palaearctic. Mol. Phylogenet. Evol. 55: 210–225. of host race formation in Rhagoletis pomonella fruit flies. Ecol. Evol. 9: Ashmead, W. H. 1885. A bibliographical and synonymical catalogue of the 393–409. North American Cynipidae, with description of new species. Trans. Am. Dufour, C. M., A. Herrel, and J. B. Losos. 2017. Ecological character displace- Entomol. Soc. 12: 291–304. ment between a native and an introduced species: the invasion of Anolis Askew, R. R. 1961. On the biology of the inhabitants of oak galls of Cynipidae cristatellus in Dominica. Biol. J. Linn. Soc. 123: 43–54. (Hymenoptera) in Britain. Trans. Soc. Br. Entomol., 14: 237–268. Egan, S. P., G. R. Hood, E. O. Martinson, and J. R. Ott. 2018. Cynipid gall Bailey, R., K. Schönrogge, J. M. Cook, G. Melika, G. Csóka, C. Thuróczy, and wasps. Curr. Biol. 28: R1370–R1374. G. N. Stone. 2009. Host niches and defensive extended phenotypes struc- Eubanks, M. D., C. P. Blair, and W. G. Abrahamson. 2003. One host shift leads ture parasitoid wasp communities. PLoS Biol. 7: e1000179. to another? Evidence of host-race formation in a predaceous gall-boring Beutenmüller, W. 1907. Notes on a few North American Cynipidae, with de- beetle. Evolution. 57: 168–172. scriptions of new species. Bull. Am. Mus. Nat. Hist. 23: 463–466. Feder J. L., and A. A. Forbes. 2010. Sequential speciation and the diversity of Bihari, P., B. Sipos, G. Melika, B. Fehér, K. Somogyi, G. N. Stone, and parasitic insects. Ecol. Entomol. 35: 67–76. Z. Pénzes. 2011. Western Palaearctic phylogeography of an inquiline oak Forbes, A. A., J. Fisher, and J. L. Feder. 2005. Habitat avoidance: overlooking gall wasp, Synergus umbraculus. Biol. J. Linn. Soc. 102: 750–764. an important aspect of host-specific mating and sympatric speciation? Bird, J. P., G. Melika, J. A. Nicholls, G. N. Stone, and E. A. Buss. 2013. Life Evolution. 59: 1552–1559. history, natural enemies, and management of Disholcaspis quercusvirens Forbes, A. A., T. H. Powell, L. L. Stelinski, J. J. Smith, and J. L. Feder. 2009. (Hymenoptera: Cynipidae) on live oak trees. J. Econ. Entomol. 106: Sequential sympatric speciation across trophic levels. Science. 323: 1747–1756. 776–779. Blair, C. P., W. G. Abrahamson, J. A. Jackman, and L. Tyrrell. 2005. Cryptic Forbes, A. A., S. Satar, G. Hamerlinck, A. E. Nelson, and J. J. Smith. 2012. speciation and host-race formation in a purportedly generalist tumbling DNA barcodes and targeted sampling methods identify a new species and flower beetle. Evolution. 59: 304–316. cryptic patterns of host specialization among North American Coptera Bozsó, M., Z. Pénzes, P. Bihari, S. Schwéger, C. T. Tang, M. M. Yang, J. Pujade- (Hymenoptera: Diapriidae). Ann. Entomol. Soc. Am. 105: 608–612. Villar, and G. Melika. 2014. Molecular phylogeny of the inquiline cynipid Forbes A. A., G. R. Hood, M. C. Hall, J. Lund, R. Izen, S. P. Egan, and wasp genus Saphonecrus Dalla Torre and Kieffer, 1910 (Hymenoptera: J. R. Ott. 2015. Parasitoids, hyperparasitoids, and inquilines associated Cynipidae: Synergini). Plant Prot. Q. 29: 26–31. with the sexual and asexual generations of the gall former, Belonocnema Brookfield, J. F. 1972. The inhabitants (Hymenoptera: Cynipidae, treatae (Hymenoptera: Cynipidae). Ann. Entomol. Soc. Am. 109: 49–63. Chalcidoidea) of the cynipidous galls of Quercus borealis in Nova Scotia. Forbes, A. A., R. K. Bagley, M. A. Beer, A. C. Hippee, and H. A. Widmayer. Can. Entomol. 104: 1123–1133. 2018. Quantifying the unquantifiable: why Hymenoptera, not Coleoptera, Buffington, M. L., G. Melika, M. Davis, and J. S. Elkinton. 2016. The descrip- is the most speciose animal order. BMC Ecol. 18: 21. tion of Zapatella davisae, new species, (Hymenoptera: Cynipidae) a pest Fujiyama, N., H. Ueno, S. Kahono, S. Hartini, K. W. Matsubayashi, gall wasp of black oak (Quercus velutina) in New England, USA. Proc. N. Kobayashi, and H. Katakura. 2013. Distribution and differentiation of Entomol. Soc. Wash. 118: 14–27. Henosepilachna diekei (Coleoptera: Coccinellidae) on two host-plant spe- Burks, B. D. 1979. Superfamily Cynipoidea, pp. 1045–1107. In K. V. Krombein, cies across Java, Indonesia. Ann. Entomol. Soc. Am. 106: 741–752. P. D. Hurd, and D. R. Smith (eds.), Catalog of Hymenoptera in America Fullaway, D. T. 1911. Monograph of the gall making Cynipidae (Cynipinae) north of Mexico, volume 1: Symphyta and Apocrita (Parasitica). of California. Ann. Entomol. Soc. Am. 4: 331–381. Smithsonian Institution Press, Washington, DC. Funk, D. J., and K. E. Omland. 2003. Species-level paraphyly and polyphyly: Chen, H., M. Rangasamy, S. Y. Tan, H. Wang, and B. D. Siegfried. 2010. frequency, causes, and consequences, with insights from animal mitochon- Evaluation of five methods for total DNA extraction from western corn drial DNA. Ann. Rev. Ecol. Evol. Syst. 34: 397–423. rootworm beetles. PLoS One. 5: e11963. Gibson, A. P., J. T. Huber, and J. B. Woolley. 1997. Annotated keys to the Condon, M. A., S. J. Scheffer, M. L. Lewis, and S. M. Swensen. 2008. Hidden genera of Nearctic Chalcidoidea. National Research Council of Canada, neotropical diversity: greater than the sum of its parts. Science. 320: Ottawa, ON, Canada. 928–931. Gillette, C. P. 1896. A monograph of the genus Synergus. Trans. Am. Entomol. Condon, M. A., S. J. Scheffer, M. L. Lewis, R. Wharton, D. C. Adams, and Soc. 23: 85–100. A. A. Forbes. 2014. Lethal interactions between parasites and prey in- Goulet H., and J. T. Huber. 1993. Hymenoptera of the world: an identification crease niche diversity in a tropical community. Science. 343: 1240–1244. guide to families. Agriculture Canada, Ottawa, ON, Canada. Craig, T. P., J. K. Itami, W. G. Abrahamson, and J. D. Horner. 1993. Behavioral Guay, J. F., D. Bulot, J. M. Béland, and C. Cloutier. 2016. Gall-maker evidence for host-race formation in Eurosta solidaginis. Evolution. 47: Paradiplosis tumifex (Diptera: Cecidomyiidae) and its inquiline Dasineura 1696–1710. balsamicola (Diptera: Cecidomyiidae): an update on epidemic episodes Crespi, B. J. 1992. Behavioural ecology of Australian gall thrips (Insecta, and seasonal ecology in Québec, Canada. Can. Entomol. 148: 452. Thysanoptera). J. Nat. Hist. 26: 769–809. Hamerlinck, G., D. Hulbert, G. R. Hood, J. J. Smith, and A. A. Forbes. 2016. Csóka, G., G. N. Stone, and G. Melika. 2005. Biology, ecology and evolution Histories of host shifts and cospeciation among free-living parasitoids of of gall-inducing Cynipidae, pp. 569–636. In A. Raman, C. W. Schaefer, Rhagoletis flies. J. Evol. Biol. 29: 1766–1779. Copyedited by: OUP

12 Insect Systematics and Diversity, 2020, Vol. 4, No. 6

Hipp, A. L., P. S. Manos, A. González-Rodríguez, M. Hahn, M. Kaproth, Muesebeck, C. F. W., K. V. Krombein, and H. K. Townes 1951. Hymenoptera J. D. McVay, S. V. Avalos, and J. Cavender-Bares. 2018. Sympatric par- of America north of Mexico. US Government Printing Office, Washington, allel diversification of major oak clades in the Americas and the origins of DC. Mexican species diversity. New Phytol. 217: 439–452. Nazemi, J., A. A. Talebi, S. E. Sadeghi, G. Melika, and A. Lozan. 2008. Species Hood, G. R., A. A. Forbes, T. H. Powell, S. P. Egan, G. Hamerlinck, J. J. Smith, richness of oak gall wasps (Hymenoptera: Cynipidae) and identification of and J. L. Feder. 2015. Sequential divergence and the multiplicative origin associated inquilines and parasitoids on two oak species in western Iran. of community diversity. Proc. Natl. Acad. Sci. USA. 112: E5980–E5989. Northwest. J. Zool. 4: 189–202.

Hood, G. R., L. Zhang, E. G. Hu, J. R. Ott, and S. P. Egan. 2019. Cascading Nosil, P., and S. M. Flaxman. 2011. Conditions for mutation-order speciation. Downloaded from https://academic.oup.com/isd/article/4/6/3/5997471 by University of Iowa Libraries/Serials Acquisitions user on 08 February 2021 reproductive isolation: plant phenology drives temporal isolation among Proc. R. Soc. B: Biol. Sci. 278: 399–407. populations of a host-specific herbivore. Evolution. 73: 554–568. Nosil, P., and P. A. Hohenlohe. 2012. Dimensionality of sexual isolation Ide, T., J. Kusumi, K. Miura, and Y. Abe. 2018. Gall inducers arose from in- during reinforcement and ecological speciation in Timema cristinae stick quilines: phylogenetic position of a gall-inducing species and its relatives insects. Evol. Ecol. Res. 14: 467–485. in the inquiline tribe Synergini (Hymenoptera: Cynipidae). Ann. Entomol. Noyes, J. 2012. An inordinate fondness of beetles, but seemingly even more Soc. Am. 111: 6–12. fond of microhymenoptera! Hamuli. 3: 5–8. Joseph, M. B., M. Gentles, and I. S. Pearse. 2011. The parasitoid community of Pénzes, Z., C. T. Tang, P. Bihari, M. Bozsó, S. Schwéger, and G. Melika. 2012. Andricus quercuscalifornicus and its association with gall size, phenology, Oak associated inquilines (Hymenoptera, Cynipidae, Synergini). TISCIA and location. Biodivers. Conserv. 20: 203–216. Monogr. Ser. 11: 1–76. Joyce, A. L., J. S. Bernal, S. B. Vinson, R. E. Hunt, F. Schulthess, and Pénzes, Z., C. T. Tang, G. N. Stone, J. A. Nicholls, S. Schwéger, M. Bozsó, R. F. Medina. 2010. Geographic variation in male courtship acoustics and and G. Melika. 2018. Current status of the oak gall wasp (Hymenoptera: genetic divergence of populations of the Cotesia flavipes species complex. Cynipidae: Cynipini) fauna of the Eastern Palaearctic and Oriental Entomol. Exp. Appl. 137: 153–164. Regions. Zootaxa. 4433: 245–289. Judd, W. W. 1967. Insects and other arthropods from year-old galls caused Price, P. W. 1980. Evolutionary biology of parasites. Princeton University by Gnorimoschema gallaesolidaginis Riley (Lepidoptera: Gelechiidae) on Press, Princeton, NJ. goldenrod. Can. J. Zool. 45: 49–56. Prior, K. M., and J. J. Hellmann. 2010. Impact of an invasive oak gall wasp Kaiser, L., B. P. Le Ru, F. Kaoula, C. Paillusson, C. Capdevielle-Dulac, on a native butterfly: a test of plant-mediated competition. Ecology. 91: J. O. Obonyo, E. A. Herniou, S. Jancek, A. Branca, P. A. Calatayud, et al. 3284–3293. 2015. Ongoing ecological speciation in Cotesia sesamiae, a biological con- Puillandre, N., A. Lambert, S. Brouillet, and G. Achaz. 2012. ABGD, trol agent of cereal stem borers. Evol. Appl. 8: 807–820. Automatic Barcode Gap Discovery for primary species delimitation. Mol. Kester, K. M., G. M. Eldei, and B. L. Brown. 2015. Genetic differentiation of Ecol. 21: 1864–1877. two host–foodplant complex sources of Cotesia congregata (Hymenoptera: Pujade-Villar, J., G. Melika, P. Ros-Farré, Z. Acs, and G. Csóka. 2003. Braconidae). Ann. Entomol. Soc. Am. 108: 1014–2015. Cynipid inquiline wasps of Hungary, with taxonomic notes on the western König, K., E. Krimmer, S. Brose, C. Gantert, I. Buschlüter, C. König, Palaearctic fauna (Hymenoptera: Cynipidae, Cynipinae, Synergini). Folia S. Klopfstein, I. Wendt, H. Baur, L. Krogmann, et al. 2015. Does early Entomol. Hung. 64: 121–170. learning drive ecological divergence during speciation processes in para- Rhodes, B. C., C. P. Blair, M. K. Takahashi, and W. G. Abrahamson. 2012. sitoid wasps? Proc. R. Soc. B: Biol. Sci. 282: 20141850. The role of olfactory cues in the sequential radiation of a gall-boring Lewis, O. T., J. Memmott, J. Lasalle, C. H. Lyal, C. Whitefoord, and beetle, Mordellistena convicta. Ecol. Entomol. 37: 500–507. H. C. J. Godfray. 2002. Structure of a diverse tropical forest insect–para- Rodríguez, M. Á., and B. A. Hawkins. 2000. Diversity, function and stability sitoid community. J. Anim. Ecol. 71: 855–873. in parasitoid communities. Ecol. Lett. 3: 35–40. Lobato-Vila, I., and J. Pujade-Villar. 2017. Description of five new species Roininen, H., P. W. Price, and J. Tahvanainen. 1996. Bottom-up and top-down of inquiline oak gall wasps of the genus Synergus Hartig (Hymenoptera, influences in the trophic system of a willow, a galling sawfly, parasitoids Cynipidae: Synergini) with partially smooth mesopleurae from Mexico. and inquilines. Oikos. 77: 44–50. Zool. Stud. 56: 1–28. Ronquist, F., M. Teslenko, P. van der Mark, D. L. Ayres, A. Darling, S. Höhna, Lobato-Vila, I., D. Cibrián-Tovar, U. M. BarreraRuíz, and J. Pujade-Villar. B. Larget, L. Liu, M. A. Suchard, and J. P. Huelsenbeck. 2012. MrBayes 2018. Study of the inquiline oak gall wasp fauna emerged from agamic 3.2: efficient Bayesian phylogenetic inference and model choice across a galls of Andricus quercuslaurinus Melika and Pujade-Villar, 2009 from large model space. Syst. Biol. 61: 539–542. Mexico. Southwest. Entomol. 43: 591–610. Roskam, J. C. 1979. Biosystematics of insects living in female birch catkins. II. Lobato-Vila, I., D. Cibrián-Tovar, U. M. Barrera-Ruíz, A. Equihua-Martínez, Inquiline and predaceous gall midges belonging to various genera. Neth. E. G. Estrada-Venegas, M. L. Buffington, and J. Pujade-Villar. 2019. J. Zool. 29: 283–351. Review of the Synergus Hartig species (Hymenoptera: Cynipidae: Sanver, D., and B. A. Hawkins. 2000. Galls as habitats: the inquiline commu- Synergini) associated with tuberous and other tumor-like galls on oaks nities of insect galls. Basic Appl. Ecol. 1: 3–11. from the New World with the description of three new species from Schönrogge, K., G. N. Stone, and M. J. Crawley. 1996. Alien herbivores and Mexico. Proc. Entomol. Soc. Wash. 121: 193. native parasitoids: rapid developments and structure of the parasitoid Mayr, G. 1872. Die Einmiethler der mitteleuropäischen Eichengallen. Verh. and inquiline complex in an invading gall wasp Andricus quercuscalicis Zool. Bot. Ges. Wien 22: 669–726. (Hymenoptera: Cynipidae). Ecol. Entomol. 21: 71–80. McCracken, M. I., and D. B. Egbert. 1922. California gall-making Cynipidae: Schönrogge, K., P. Walker, and M. J. Crawley. 2000. Parasitoid and inquiline with descriptions of new species (Vol. 3, No. 1–4). Stanford University attack in the galls of four alien, cynipid gall wasps: host switches and the Press, Stanford, CA. effect on parasitoid sex ratios. Ecol. Entomol. 25: 208–219. Medianero, E., M. C. Paniagua, and H. Barrios. 2007. Galls produced by Hylaeogena Smith, M. A., N. E. Woodley, D. H. Janzen, W. Hallwachs, and P. D. Hebert. thoracica (Coleoptera: Buprestidae) and the effect of the inquiline Philides 2006. DNA barcodes reveal cryptic host-specificity within the presumed anthonomoides (Coleoptera: Curculionidae). Coleopt. Bull. 61: 568–572. polyphagous members of a genus of parasitoid flies (Diptera: Tachinidae). Melika, G. 2006. Gall wasps of Ukraine. Cynipidae. Vestn. Zool. 21: 1–300. Proc. Natl. Acad. Sci. USA. 103: 3657–3662. Moriya, S., K. Inoue, A. Otake, M. Shiga, and M. Mabuchi. 1989. Smith, M. A., J. J. Rodriguez, J. B. Whitfield, A. R. Deans, D. H. Janzen, Decline of the chestnut gall wasp population, Dryocosmus kuriphilus W. Hallwachs, and P. D. Hebert. 2008. Extreme diversity of tropical para- Yasumatsu (Hymenoptera : Cynipidae) after the establishment of sitoid wasps exposed by iterative integration of natural history, DNA Torymus sinensis Kamijo (Hymenoptera : Torymidae). Appl. Entomol. barcoding, morphology, and collections. Proc. Natl. Acad. Sci. USA. 105: Zool. 24: 231–233. 12359–12364. Copyedited by: OUP

Insect Systematics and Diversity, 2020, Vol. 4, No. 6 13

Smith, M. A., E. S. Eveleigh, K. S. McCann, M. T. Merilo, P. C. McCarthy, Ward, A. K. G., O. S. Khodor, S. P. Egan, K. L. Weinersmith, and A. A. Forbes. and K. I. Van Rooyen. 2011. Barcoding a quantified food web: crypsis, 2019. A keeper of many crypts: a behaviour-manipulating parasite attacks concepts, ecology and hypotheses. PLoS One. 6: e14424. a taxonomically diverse array of oak gall wasp species. Biol. Lett. 15: Stamatakis, A. 2014. RAxML version 8: a tool for phylogenetic analysis and 20190428. post-analysis of large phylogenies. Bioinformatics. 30: 1312–1313. Weinersmith, K. L., A. A. Forbes, A. K. G. Ward, P. F. P. Brandão-Dias, Stireman, J. O., J. D. Nason, S. B. Heard, and J. M. Seehawer. 2005. Cascading Y. M. Zhang, and S. P. Egan. 2020. Arthropod community associated host-associated genetic differentiation in parasitoids of phytophagous in- with the asexual generation of Bassettia pallida Ashmead (Hymenoptera:

sects. Proc. R. Soc. B: Biol. Sci. 273: 523–530. Cynipidae). Ann. Entomol. Soc. Am. 113: 373–388. Downloaded from https://academic.oup.com/isd/article/4/6/3/5997471 by University of Iowa Libraries/Serials Acquisitions user on 08 February 2021 Stone, G. N., K. Schönrogge, M. J. Crawley, and S. Fraser. 1995. Geographic Weld L. H. 1959. Cynipid galls of the Eastern United States. Privately printed, and between-generation variation in the parasitoid communities associ- Ann Arbor, MI. ated with an invading gall wasp, Andricus quercuscalicis (Hymenoptera: Wiebes-Rijks, A. A. 1979. A character analysis of the species Synergus Hartig, Cynipidae). Oecologia. 104: 207–217. section II (Mayr, 1872) (Hymenoptera, Cynipidae). Zool. Med. Leiden. Stone, G. N., K. Schonrogge, R. J. Atkinson, D. Bellido, and J. Pujade- 53: 297–321 Villar. 2002. The population biology of oak gall wasps (Hymenoptera: Wiebes-Rijks, A. A., and J. D. Shorthouse. 1992. Ecological relationships of Cynipidae). Annu. Rev. Entomol. 47: 633–668. insects inhabiting cynipid galls, pp. 238–257. In J. D. Shorthouse and Stone, G. N., S. C. White, G. Csóka, G. Melika, S. Mutun, Z. Pénzes, O. Rohfritsch (eds.), Biology of insect-induced galls. Oxford University S. E. Sadeghi, K. Schönrogge, M. Tavakoli, and J. A. Nicholls. 2017. Press, Oxford, United Kingdom. Tournament ABC analysis of the western Palaearctic population history Yang, M. M., C. Mitter, and D. R. Miller. 2001. First incidence of inquilinism of an oak gall wasp, Synergus umbraculus. Mol. Ecol. 26: 6685–6703. in gall-forming psyllids, with a description of the new inquiline species Wahl, D. B. 2015 (and updates). Genera Ichneumonorum Nearcticae. Version: (Insecta, Hemiptera, Psylloidea, Psyllidae, Spondyliaspidinae). Zool. 2015.08.17. http://www.amentinst.org/GIN/. Scripta. 30: 97–113. Walker, P., Leather, S. R., and Crawley, M. J. 2002. Differential rates of in- Zhang, J., P. Kapli, P. Pavlidis, and A. Stamatakis. 2013. A general species vasion in three related alien oak gall wasps (Cynipidae: Hymenoptera). delimitation method with applications to phylogenetic placements. Divers. Distrib. 8: 335–349. Bioinformatics. 29: 2869–2876.