Sequential Divergence and the Multiplicative Origin Of

SEQUENTIAL DIVERGENCE AND THE MULTIPLICATIVE

ORIGIN OF COMMUNITY DIVERSITY

A Dissertation

Submitted to the Graduate School

of the University of Notre Dame

in Partial Fulfillment of the Requirements

for the Degree of

Doctor of Philosophy

Glen Ray Hood

Jeffrey L. Feder, Director

Graduate Program in Biological Sciences

Notre Dame, Indiana

May 2016

Glen Ray Hood

2016

SEQUENTIAL DIVERGENCE AND THE MULTIPLICATIVE ORIGIN OF

COMMUNITY DIVERSITY

Abstract

Glen Ray Hood

The field of evolutionary ecology has focused on understanding two important aspects regarding the origin of species: (1) the ecological adaption of organisms to different environments, and (2) the co-evolutionary interplay between organisms themselves. In this regard, a long standing, but understudied hypothesis that unifies these considerations is “biodiversity begets biodiversity” in a process referred to as “sequential divergence”. Specifically, sequential divergence contends that as species diverge, they create new niches for other organisms to adapt to. As a result, the divergence of one species could lead to the genesis of many new taxa. Here, to understand how common sequential divergence may be in nature, I test for a multiplicative effect of the process within a single system consisting of three parasitoid wasps, Diachasma alloeum, Utetes canaliculatus and Diachasmimorpha mellea (Hymenoptera: Braconidae), that attack

Rhagoletis pomonella fruit flies (Diptera: Tephritidae).

Using genetic tools, behavioral studies, and life history analyses, I show that the same host-related ecological selection pressures that differentially adapt and Glen Ray Hood reproductively isolate Rhagoletis to their respective host plants (the timing of adult eclosion and host fruit odor preference) cascaded across trophic levels and induce host- associated genetic divergence for each of the three members of the parasitoid community.

In addition interspecific competition between wasp species for limited resource during larval development inside fly hosts is mitigated by their temporal subdivision of the shared host fly resource. As a result, the seasonal subdivision of fly resources is accentuating allochronic isolation among conspecific wasps attacking different host flies, generating increased reproductive isolation and contributing to their ongoing divergence.

Furthermore, the role of temporal resource partitioning does not appear to be isolated to Rhagoletis-attacking parasitoids. Results from a meta-analysis of 64 studies suggests that species differences in the timing of a key life cycle event, oviposition, into shared insect hosts may be an important life history strategy mediating competition between parasitoid species in general and allowing for multiple taxa to co-exist on shared hosts. In turn, his process could play a critical role in structuring insect communities and contributing to the incredible diversity of parasitoid species observed in nature.

Overall, my findings support the claim that “biodiversity begets biodiversity” and suggest that the process may be more common in nature that previously thought.

Divergent selection at lower trophic levels has the potential to not only linearly, but multiplicatively amplify biodiversity at higher levels. In addition, sequential divergence may be accentuated by other types of species interactions (i.e., interspecific competition) to help facilitate the process and promote species coexistence. For smaller organisms like parasitoids that can partition and experience resources on a fine scale cascade, sequential divergence could be a major force contributing to the formation of new biodiversity.

Dedicated to John and Ollie Stevens.

CONTENTS

Figures...... vi

Tables ...... xii

Acknowledgments...... xiv

Chapter 1: Introduction ...... 1 1.1 The Biodiversity Question and Sequential Speciation...... 1 1.2 General Implications of Sequential Speciation ...... 3 1.3 Plant-feeding Insect and their Parasitoids: “The Greatest Biodiversity Show on Earth” ...... 5 1.4 Rhagoletis pomonella Fruit Flies and Their Community of Host Specific Parasitoid Wasps: A Model for Testing the Multiplicative Sequential Divergence Hypothesis ...... 7 1.5 Overview of Chapters ...... 10 1.6 Literature Cited ...... 13

Chapter 2: Geographic Ranges and Host Breadths of Parasitoid Wasps Associated with the Rhagoletis pomonella (Diptera: Tephritidae) Species Complex ...... 17 2.1 Abstract ...... 17 2.2 Introduction ...... 18 2.3 Methods...... 20 2.3.1 Biology of Host Flies and Parasitoid Wasps...... 20 2.3.2 Sample Collection and Identification...... 22 2.3.3 Literature Review...... 23 2.4 Results ...... 23 2.4.1 Egg-stage Parasitoids ...... 23 2.4.2 Larval-stage Parasitoids ...... 25 2.4.3 Pupal-stage Parasitoid ...... 29 2.4.4 Miscellaneous Parasitoids ...... 30 2.5 Discussion ...... 31 2.6 Acknowledgments...... 36 2.7 Literature Cited ...... 36

Chapter 3: Sequential Divergence and the Multiplicative Origin of Community Diversity ...... 41 3.1 Abstract ...... 41 3.2 Introduction ...... 42 iii

3.3 Materials and Methods ...... 51 3.3.1 Specimen Collection ...... 51 3.3.2 Genetic Methods ...... 53 3.3.3 Analysis of Genetic Data ...... 54 3.3.4 Field Observations of Mating Behavior ...... 58 3.3.5 Host Odor Discrimination Testing ...... 59 3.3.6 Cross-reared Diachasma ...... 62 3.3.7 Eclosion Study ...... 63 3.4 Results and Discussion ...... 64 3.4.1 mtDNA Divergence ...... 64 3.4.2 Microsatellite Differentiation ...... 67 3.4.3 Site of Mating Assembly ...... 72 3.4.4 Host Plant Odor Discrimination...... 73 3.4.5 Eclosion Timing ...... 78 3.4.6 Genetic Correlations with Eclosion Time...... 79 3.5 Conclusions ...... 82 3.6 Acknowledgments...... 88 3.7 Literature Cited ...... 88

Chapter 4: Interspecific Competition and Temporal Resource Partitioning Facilitates Speciation and the Formation of Community Biodiversity ...... 95 4.1 Abstract ...... 95 4.2 Introduction ...... 96 4.3 Materials and Methods ...... 103 4.3.1 Study System ...... 103 4.3.2 Rates of Parasitism and Community Composition ...... 105 4.3.3 Assessing Resource Limitation ...... 106 4.3.4 Tests of Multiple Parasitism and a Competitive Hierarchy of Interspecific Competition...... 107 4.3.5 Temporal and Spatial Resource Partitioning ...... 110 4.3.6 Morphometrics ...... 112 4.3.7 Intraspecific Temporal Isolation ...... 112 4.4 Results ...... 113 4.4.1 Rates of Parasitism and Community Composition ...... 113 4.4.2 Resource Limitation ...... 114 4.4.3 Multiple Parasitism ...... 116 4.4.4 Evidence of Interspecific Competition and a Competitive Hierarchy...... 118 4.4.5 Temporal and Spatial Resource Partitioning ...... 120 4.4.6 Morphometrics ...... 127 4.4.7 Interspecific Competition and Allochronic Isolation ...... 129 4.5 Discussion ...... 131 4.6 Conclusion ...... 138 4.7 Acknowledgments...... 140 4.8 Literature Cited ...... 141

Chapter 5: Temporal Resource Partitioning Promotes Parasitoid Biodiversity...... 150 5.1 Abstract ...... 150 5.2 Introduction ...... 151 5.3 Materials and Methods ...... 156 5.3.1 Identifying and Selecting Studies for Inclusion in the Meta- Analysis...... 156 5.3.2 Compiling and Calculating Effect Sizes and Statistical Analyses ..157 5.3.3 Timing of Oviposition and Patterns of Species Abundance in Nature ...... 163 5.4 Results ...... 164 5.4.1 Evidence for Competition ...... 164 5.4.2 Competition and the Order and Timing of Oviposition ...... 165 5.4.3 Competition and Oviposition Timing in Nature ...... 168 5.4.4 Competition, Oviposition Timing, and Parasitoid Abundance ...... 169 5.4.5 Effects of Life History and Phylogenetic Relationships ...... 171 5.5 Discussion ...... 171 5.5.1 Oviposition Timing and Biological Control ...... 178 5.5.2 Conclusion and Future Directions ...... 179 5.6 Acknowledgments...... 182 5.7 Literature Cited ...... 182

Chapter 6: Conclusion...... 190 6.1 Introduction ...... 190 6.2 Summary of Research Chapters ...... 191 6.3 Further Avenues of Research ...... 196 6.4 Final Thoughts ...... 201 6.5 Literature Cited ...... 202

Appendix A: Supplemental Material for Chapter 2 ...... 206 A.1 Description of Appendix for Chapter 2...... 206 A.2 Literature Cited ...... 219

Appendix B: Supplamental Text and Tables for Chapter 3 ...... 221 B.1 Description of Appendix for Chapter 3 ...... 221 B.2 Parasitoid Biology ...... 221 B.3 Host Ranges, Geographic Distributions, and Parasitism Rates ...... 222 B.4 Literature Cited ...... 224

Appendix C: Supplamental Tables for Chapter 4 ...... 236 C.1 Description of Appendix for Chapter 4 ...... 236 C.2 Literature Cited ...... 249

Appendix D: Supplementary Tables for Chapter 5 ...... 250 D.1 Description of Appendix for Chapter 5...... 250 D.2 Literature Cited ...... 273

FIGURES

Figure 1.1: Patterns of biodiversity potentially explained by sequential divergence taken from Hood and Feder (2016). (A) Adaptive radiations following the last five major mass extinction events (indicated by asterisks). Adaptive from Purves et al. (1994). (B) Significant relationship between species richness and diversification rates of taxa in tropical climates. Adapted from Emerson and Kolm (2005). (C) Clades of phytophagous insects are more species than sister clades of non-plant feeders. Diversity (as indicated by number of species) for five different pairs of sister taxa (scientific and common names given) and their inferred ancestral feedings habitats. Modified from Mitter et al. (1988)...... 4

Figure 1.2: (A) The apple maggot fly (R. pomonella) on a hawthorn fruit, (B) the parasitoid wasp Diachasma alloeum searching for an oviposition site on a blueberry fruit. Genetic, behavioral and diapause data suggest D. alloeum has formed a new host race/incipient species via a host shift from attacking blueberry flies to now attacking apple flies (Forbes et al. 2009). (C) Diachasmimorpha mellea on apple and (D) Utetes canaliculatus on the leaf of a snowberry plant. ....9

Figure 2.1: Collection sites and host ranges of parasitoids of Rhagoletis eggs: Utetes canaliculatus (black circles), U. richmondi (asterisks) and U. lectoides (gray circles). The location where U. canaliculatus and U. lectoides overlap (1 site: Rednersville, Ontario, Canada), is denoted by a gray circle inside of a black circle. Refer to Tables A.1 in the appendix for complete list of sites and identities of host plants and flies for each collection...... 26

Figure 2.2: Collection sites and host ranges of parasitoids of larval Rhagoletis flies: Diachasma alloeum (black circles), Diachasmimoprha mellea (gray circles), and Opius downesi (asterisks). Sites where D. alloeum and D. mellea have been reared from the same hosts are denoted by a gray circle inside of a black circle. Sites where D. mellea and O. downesi have been reared from the same hosts are denoted by an asterisk inside of a gray circle. Refer to Tables A.1 in the appendix for complete list of sites and identities of host plants and flies for each collection...... 28

Figure 3.1: Three scenarios of co-divergence in a host-parasitoid system. (A) A single sequential divergence event, (B) sequential divergence with multiplicative amplification of biodiversity, and (C) co-speciation in allopatry. In scenario A, co-divergence is driven by the cascade of divergent ecological selection pressures across trophic levels in sympatry. Here, a degree of divergent ecological vi

adaptation must accompany the host shift such that parasitoids are not merely moving between geographically separated hosts. In scenario B, the multiplicative effects of sequential divergence can be seen as several members of the parasitoid community diverge in parallel with their host. In scenario C, co-divergence (co- speciation) occurs after host plant, fly, and parasitoid populations become jointly geographically isolated (black bar), resulting in parallel allopatric speciation. Here, little differentiation need accompany the initial host shift of fly or parasitoid. Co-speciation is not necessarily driven by the creation and adaptation to new niches but by the concordant geographic and reproductive separation of hosts and parasitoids...... 44

Figure 3.2: The community of host-specific parasitoids that attack members of the (A) Rhagoletis pomonella sibling species complex: (B) Diachasma alloeum, (C) Diachasmimorpha mellea, and (D) Utetes canaliculatus that (E) emerge from the fly pupal case as adults following overwintering. Scale bar = 1 mm...... 45

Figure 3.3: Collection sites for U. canaliculatus and D. mellea in the Midwestern and Northeastern U.S. Numbers correspond to the locations described in Table B.1 in the appendix...... 52

Figure 3.4: Linkage disequilibrium (LD) estimates between pairs of microsatellite loci genotyped for (A) U. canaliculatus, and (B) D. mellea. Test crosses are not currently possible to develop recombination distance maps or assign loci to linkage groups for these species. We therefore present LD estimates in the form of a network depicting significant pairwise Burrow’s composite disequilibrium values (small numbers along branches) between specific pairs of microsatellites (large numbers at the end nodes of branches). Loci UC50, UC61 and UC65 did not display significant LD with any other microsatellite in U. canaliculatus and are therefore designated as unlinked. See Materials and Methods for discussion of calculation of Burrow’s composite disequilibrium values. *P = 0.05; **P < 0.01; ***P < 0.001...... 56

Figure 3.5 Maximum parsimony mtDNA COI gene trees for (A) U. canaliculatus, and (B) D. mellea attacking hawthorn (red), apple (green), blueberry (blue), flowering dogwood (yellow), snowberry (white), and black cherry (black) flies. The three major haplotypes identified for U. canaliculatus are designated A, B and C. Each tree is rooted with the outgroup taxon, D. alloeum. Non-parenthetic numbers next to each circle indicate collecting site (see Table B.1 and Fig. 3.3 for site designations). Numbers in parentheses indicate the number of identical haplotypes sequenced at each collecting site. The number of nucleotide substitutions (evolutionary steps) and bootstrap support based on 10,000 replicates (in parentheses) are given above longer branches...... 66

Figure 3.6: Neighbor-joining genetic distance network based on Nei’s D for 20 microsatellite loci genotyped for Utetes belonging to mtDNA haplotype classes A, B and C attacking hawthorn (red), apple (green), flowering dogwood (yellow)

vii

or snowberry (white) flies. Each node represents pooled microsatellite data across sites for host-associated populations of wasps belonging to each of the three mtDNA haplotype classes depicted in Fig. 3.5A. Numbers on branches represent bootstrap support values based on 10,000 replicates across loci...... 68

Figure 3.7: Neighbor-joining genetic distance networks of Nei’s D based on all microsatellite loci for (A) U. canaliculatus, and (B) D. mellea attacking hawthorn (red), apple (green), blueberry (blue), flowering dogwood (yellow), snowberry (white) and black cherry (black) flies. Bootstrap support values ≥ 50% based on 10,000 replicates across loci are given along branches. Numbers next to or inside circles indicate collecting sites (see Table B.1 and Fig. 3.3 for site designations). The node of U. canaliculatus labeled “N” refers to a northern population of wasps attacking flowering dogwood that was pooled across multiple collecting sites. ...70

Figure 3.8: Host fruit odor discrimination of (A) D. alloeum, (B) U. canaliculatus, and (C) D. mellea. Values represent the percent increase (preference) or decrease (avoidance) in the orientation of wasps to the arm of the Y-tube containing different host fruit volatiles relative to the blank (odorless) control arm. Each host associated population of wasps displayed avoidance behavior to all non-natal fruit odors. We therefore averaged avoidance values  SE (gray bars) across all non- natal fruit assays (see Table B.5 for individual values and statistical significance). Data for D. alloeum taken from Forbes et al. (2009). *P = 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001...... 74

Figure 3.9: Host odor discrimination of hawthorn and blueberry fly-origin D. alloeum reared for a single generation on apple-infesting R. pomonella in apple fruits. Values represent the percent increase (preference) or decrease (avoidance) in the orientation of hawthorn-origin or blueberry-origin D. alloeum to the arm of the Y- tube olfactometer containing the indicated host fruit odor relative to blank odorless control treatment. **P < 0.01; ***P < 0.001...... 77

Figure 3.10: Mean eclosion times averaged across collecting sites for Rhagoletis (circles) infesting blueberry (blue), apple (green), snowberry (white), black cherry (black), hawthorn (red), and flowering dogwood (yellow) host plants, and D. alloeum (squares), U. canaliculatus (triangles), and D. mellea (diamonds) attacking each fly host. Data for D. alloeum are from Forbes et al. (2009). See Table B.6 for individual site values  SE...... 80

Figure 3.11: Cumulative eclosion curves for (A-F) U. canaliculatus, and (G-J) D. mellea attacking hawthorn (red), apple (green), blueberry (blue) snowberry (white) and black cherry (black) flies. Significance was assessed by Kolmogorov-Smirnov tests. See Table B.6 for means ± SE of eclosion times...... 81

viii

Table C.1 for details of the collecting site locations and a breakdown of parasitism rates for each wasp species for each fly host at each site in each year of the survey...... 114

Figure 4.2: (A) Empty Rhagoletis pomonella pupal cases from which a parasitoid wasp emerged and (B) an empty, dissected pupal case that is devoid of host fly resources. Photo credit: Hannes Schuler...... 115

Figure 4.3: Linear regressions of percent parasitism versus time for staged samples of hawthorn (panels A, B), apple (C, D), and blueberry flies (E) from 0 to 20 days post pupariation. Given for each relationship is the coefficients of determination (r2) and significance value (P-value) of the slope of each regression line. Parasitism rates for U. canaliculatus (Uc = black triangles), D. mellea (Dm = grey squares) and D. alloeum (Da = open circles) were determined by mtDNA PCR genetic analysis (see Material and Methods). Panels A, C, and E include all wasp species in estimates of parasitism rates, panels B and D exclude D. alloeum, and panel F considers single parasitism rates for D. mellea alone attacking hawthorn- (red), apple- (green), and blueberry- (blue) origin flies. See Table C.3 for parasitism rates used in the regressions...... 119

Figure 4.5: Temporal and spatial distributions of U. canaliculatus, D. mellea, and D. alloeum wasps captured in the field by sweep netting adults off of fruit in the canopy (grey circles) and on the ground (black circles) beneath plants at six different times throughout the field season. The number of parasitoids caught at each location at each site and sampling times are given in Table C.4...... 126

Figure 5.1: Hypothetical examples of the (A) no relationship (r/s), (B) a positive relationship, and (C) a negative relationship between survivorship of inferior species and the interval between oviposition times...... 158

lack of publication bias. Values falling along the solid black line indicate an effect size of zero. The best-fit dashed line is displayed to visualize the non-significant relationship. (B) Normal quantile plot between effect size (Spearman’s rhoz) and the ranked based Z-score (drawn from a normal distribution with a mean of 0 and a standard deviation of 1). A coefficient of determination close to 1 (r2 = 0.98) is indicative of normality...... 162

Figure 5.3: The distributions of survivorship values at t0 of the superior species when there is no difference in the interval between oviposition events for 44 studies (50% = competitive equivalence between species 1 and species 2; 100% = complete competitive dominance of one species). All data are displayed in rank order of effect size and UL and LL 99% CI. The dashed line represents the mean and the grey area about the dashed line represents 99% CIs about the mean. See Table D.5 for effect sizes and statistical analyses...... 165

Figure 5.4: The distribution of the difference in survivorship (average survivorship of the species ovipositing first across all treaments – survivorship of the species ovipositing second across all treaments) for 55 studies. Negative values indicate the species ovipositing second experienced increased survivorship and positive values indicate the species ovipositing first experienced increased survivorship. All data are displayed in rank order of effect size and UL and LL 99% CI. The dashed line represents the mean and the grey area about the dashed line represents 99% CIs about the mean. See Table D.6 for effect sizes and statistical analyses...... 166

Figure 5.5: The distribution of effect sizes (rhoz) for 64 studies that quantified the relationship between survivorship and the interval between oviposition times during competition between immature parasitoids. All data are displayed in rank order of effect size and UL and LL 99% CI. The dashed line represents the mean and the grey area about the dashed line represents 99% CIs about the mean. See Table D.3 for effect sizes and statistical analyses...... 168

Figure 5.6: (A) The relationship between survivorship of the competitively inferior species ovipositing at the same time (t0) and the difference between timing of oviposition in nature of competing species. (B) The relationship between the difference between timing of oviposition in nature of competing species and the abundance of the competitively inferior species in nature. Also give are the correlation coefficients (r), significance values (P) and the sample size (n) for each correlation. See Tables D.4 for data used to form each regression...... 170

Figure 5.7: The weighted mean effect size (rhoz ) and UL and LL 99% CI of the relationship between survivorship and the timing of oviposition between competing parasitoids in four different life history categories: (A) level of specialization (generalist vs. specialist), (B) egg laying strategies (solitary vs. gregarious), (C) larval feeding habitat/placement of eggs, (ectoparasitoid vs.

endoparasitoid), and (D) native vs. introduced species. Numbers above bars represent observations per group...... 173

Figure 5.8: The weighted mean effect size (rhoz ) and UL and LL 99% CI of the relationship between survivorship and the timing of oviposition during intrinsic, interspecific competition between immature parasitoids (A) across varying levels of phylogentic similarity (order, family and genus), and (B) ovipositing into host taxa at varying phylogenetic levels (order and family). For panel A, order, family and genus represent the lowest shared classification for competing parasitoids. For panel B, order and family represent the lowest taxonomic level for which replication was large enough to analyze. Numbers above bars represent observations per group...... 174

TABLES

Table 2.1: Egg and larval stage attacking parasitoids of Rhagoletis pomonella and other shared hosts ...... 24

Table 3.1: Summary of conditions (criteria) conducive to and supporting hypotheses of sympatric host race formation and sequential divergence ...... 46

Table 3.2: Pairwise estimates of habitat isolation (1 - % behavioral overlap) due to differences in fruit odor discrimination behavior calculated between wasps attacking different host populations of Rhagoletis...... 76

Table 3.3: Pairwise estimates of temporal isolation calculated between wasps attacking host-associated populations of Rhagoletis at sympatric sites ...... 83

Table 4.1: Number of days to eclosion and statistical differences in cumulative eclosion curves between different wasp attacking the same and different fly hosts ...... 123

Table 4.2: Temporal isolation between wasp species attacking the same and different fly hosts based on adult eclosion time, sweep net studies and wasps reared from field collected fruit...... 124

Table A.1: Records of parasotoid wasps attacking fruit flies in the Rhagoletis pomonella species complex...... 207

Table B.1: Collecting sites ecoogically and genetically analyzed in Chapter 3 ...... 225

Table B.2: List of microsatellites genotyped in Chapter 3 ...... 226

Table B.3: Monte carlo non-parametic tests for significant microsatellite allele frequency differences ...... 228

Table B.4: Generalized linear modelS for host and latitude-related microsatellite differentiation ...... 230

Table B.5: Percentage increase or decrease of wasps of different host fly-origins to fruit odor sources ...... 231

xii

Table B.6: Fruiting times of host plants and mean eclosion times for host-associated populations of Rhagoletis and wasps at sympatric study sites ...... 233

Table B.7: Genetic associations of microsatellites with the timing of adult wasp eclosion ...... 235

Table C.1: Collection sites and host plant and host fly associations monitored for parasitism in Chapter 4 ...... 237

Table C.2: Forward and reverse primers used to detect wasp and fly DNA...... 241

Table C.3: Number of wasps genetically detected at each of EIGHT fly host life stages ...... 242

Table C.4: The number of wasps caught in sweet nets and reared from fruit collected directly from the plant and on the ground beneath plants across the Field Season ...... 243

Table D.1: Studies and species included in the meta-analysis ...... 251

Table D.2: Life history characteristics of competing parasitoid species included in sub- analyses ...... 254

Table D.3: Summary statistics of correlations between survivorship and the timing of oviposition...... 257

Table D.4: Data used to calculate the timing of oviposition and abundance in nature ....260

Table D.5: Chi-square test results comparing survivorship of species 1 to a null of 50% survivorship (i.e., competitive equivalence) when both species oviposit at the same time ...... 264

Table D.6: Fisher exact test assessing the effect of the order of oviposition on survivorship...... 267

Table D.7: Heterogeneity statistics ...... 270

xiii

ACKNOWLEDGMENTS

I have been in college for 30 consecutive semester without a break. That is a long time. This has been made possible by the friendship, mentorship, love, help, and support of several groups of people. First, I would like to thank my advisor, Jeffrey Feder, for his patience, sense of humor, enthusiasm and great taste in music. Jeff has been a great mentor and an even better friend and has had a tremendous positive influence on my development as a scientist. Jeff’s attitude towards science and the creative way in which he approaches scientific problems is infectious and it makes coming to lab something I truly look forward to every day. None of this would have been possible without Jeff’s guidance and support. While words alone could never be enough to show the gratitude and appreciation I have for Jeff, I will say that he is one of the “last great American whales”. I look forward to many more years of collaboration, beers, Mexican food and epic Rhagoletis-collecting road trips with Jeff.

I also appreciate the guidance and support I received from my committee members: Elizabeth Archie, Jason McLaughlan and Michael Pfrender. Thank you all for stimulating discussion and taking my committee meetings seriously. They felt more like scientific discussions and less like “beat downs”. Beth—thank you for assigning the

Tamara Mendelson papers about reproductive isolation in Darters as reading for my written exams. They have helped shape my thinking about the evolution of reproductive isolation during speciation. Mike and Jason—thank you both for urging me to submit an xiv

appeal to PNAS. I am now firmly convinced that all manuscripts rejections should be appealed and re-appealed until editors cave in and have no choice but to accept!

To my family: my dad, Billy Hood, my mom, Theresa Dirker, my step-father,

Gary Dirker, my brothers, Aaron Hood and Eric Dirker, and my sister, Lindsay Donohoo and my Grandparents, John and Ollie Stevens. I told everyone I would make it and I think you are the only group of people that truly believed me. Thank you all for always supporting me, believing in me, and allowing me to pursue my dreams. I am looking forward to moving back to Texas and catching up on time lost these last seven years. I would also like to thank my extended family, the Morton’s/Fisk’s, Chuck Sr., Veronica,

Joey, Louis, Rosemary, Luke, T.J., Victoria, Philip and especially baby Audrey for all the free food, vacations, and a place to spend the holidays.

Day-to-day sanity was kept intact by the interactions with members of the

Rhagoletis-mafia and the Feder lab. Thomas Powell, Andrew Forbes, Scott Egan, Greg

Ragland, Dan Hahn, Monte Mattsson, Jim Smith, Stewart Berlocher, Wee Yee, and

Robert Goughnour deserve credit for helping me get started and seeing me through to the end. Peter Myers, Cheyenne Tait, Mary Glover, Hannes Schuler, Cong Xu, and especially

Meredith Doellman—thank you for making my time in the Feder lab a unique and incredible experience and eating dollar tacos with me on Wednesdays.

To Joe Sarro, Lindsey Sargent, Nathan Evans and especially Mike Brueseke: thank you for making South Bend an almost bearable place to spend seven years. Thanks to my friends back home (Bricio Vasquez, Thomas Brown, Drew Brown, Kate Gomez,

Daniel Sanford, John Spain, Jason Krueger, Steven Elliott, Abby Elliott, Kristen

Hennessey and Rich Porter). I now have a Ph.D. in counting, weighting and measuring

bugs. I hope you are all proud. Thanks to my long-time science friends, Jeff Troy,

Michelle Downey and Vincent Farallo. Beers on you at Showdown!

All my success here at Notre Dame is directly linked to the training I received from my good friend and collaborator, James Ott, at Texas State University. I would have initially been lost as a Ph.D. student had it not been for his mentorship as a M.Sc. advisor.

You always treated me as a colleague, even when I did not really deserve it. Thank you for letting me stay at your house the summer I was homeless and thank you for saving my relationship with Patricia. I will forever be grateful that you introduced me to the field of cecidology. Thank you for the investment you made in me. Hopefully it has paid and will continue to pay dividends.

Lastly, none of this makes any sense without Patricia Morton and her “fistful of love”! Thanks for letting me grow out my beard for 3 years at a time. You are the second best life-partner I have ever had. At this rate, if you keeping working hard, you are bound to reach the top spot. The last 8 years have been decent but I fear the next 8 will likely be worse. Oh well, I guess it is a good thing we love other? Thanks for everything Pat! “You

… you know … you just do”!

xvi

CHAPTER 1:

INTRODUCTION

1.1 The Biodiversity Question and Sequential Speciation

In 2005, in celebration of their 125th anniversary, Science published a list of the

25 most important questions facing the field over the next quarter century. One of the questions was “What determines species diversity?” In the opening paragraph of the

Origin of Species, Darwin referred to in this problem as a “mystery of mysteries”

(Darwin, 1859; pp. 1). Yet, here we (the field of evolutionary ecology) stand, some ~ 150 years later, and while biologist have made great strides in piecing together evidence to help solve Darwin’s mystery, the final verdict still remains largely elusive. The overarching goal of my Ph.D. dissertation is to aid the ongoing investigation into the unsolved mystery of the origin of species by researching a relatively unexplored but potentially critical component of the biodiversity question: “does diversity begets diversity” (Mitter et al. 1988, Mayer and Pimm 1997, Palmer and Maurer 1997,

Butterfield 2001, Emerson and Kolm 2005, Erwin 2005, 2008, Janz et al. 2006, Stireman et al. 2006, Abrahamson and Blair 2008, Forbes et al. 2009, Feder and Forbes 2010, Bush et al. 2011, Stevens and Tello 2011, Hood et al. 2015, Hood and Feder 2016).

In the last 30 years, there has been increasing interest in the role that ecology plays in population divergence and speciation (Schluter 2000, Coyne and Orr 2004,

Rundle and Nosil 2005, Funk et al. 2006, Nosil 2012). In this regard, two important 1

considerations involve the ecological adaptation of organisms to different environments and the co-evolutionary interactions between organisms themselves. Indeed, as Science noted in their 125th anniversary perspectus, “… the interplay between the environment and … between the organisms themselves play key roles in encouraging diversity … but exactly how is largely a mystery” (Pennisi 2005). One important factor to consider may be biodiversity itself. Specifically, as new species form they create new niches that associated organisms can exploit and potentially adapt to, which may catalyzing a chain reaction of divergence and/or speciation events across trophic levels. This, process, referred to as “sequential” or “cascading” divergence/speciation (Stireman et al. 2006,

Abrahamson and Blair 2008, Forbes et al. 2009, Feder and Forbes 2010, Hood et al.

2015, Hood and Feder 2016) has been a central principle underlying many aspects of evolutionary ecology (Mitter et al. 1988, Mayer and Pimm 1997, Palmer and Maurer

1997, Butterfield 2001, Emerson and Kolm 2005, Erwin 2005, 2008, Janz et al. 2006,

Stireman et al. 2006, Abrahamson and Blair 2008, Forbes et al. 2009, Feder and Forbes

2010, Bush et al. 2011, Stevens and Tello 2011, Hood et al. 2015, Hood and Feder 2016) but has gone largely empirically untested. For my Ph.D. dissertation research, I take a broad, multi-faceted experimental (ecological and genetic) and meta-analytical approach to understanding if and how new biodiversity may be rapidly and multiplicatively created through the process of sequential divergence and once generated, how this diversity is maintained in nature.

1.2 General Implications of Sequential Speciation

The conceptual basis for the sequential divergence hypothesis is that, except for primary producers, the niches of organisms are other organisms. Organismal niches can have abiotic environmental dimensions associated with them requiring ecological adaptation, but essentially the organismal resource is the niche. From this perspective, most organisms are ecto- or endo-parasitic predators. Moreover, when thinking about adaptive radiations, niches are not static, pre-existing entities being filled through time.

Rather, they are dynamic entities being created as new taxa form and differentiate.

Biodiversity may therefore literally feed on biodiversity to create even more biodiversity, the major limitation eventually being how many new and different taxa can take advantage of the same resource.

The idea that “biodiversity begets biodiversity” has been applied to many areas of biology and may help explain several macroevolutionary patterns of species diversity

(Fig. 1.1; Hood et al. 2016). In paleobiology, niche construction may help trigger diversification following mass extinction, possibly facilitating speciation and adaptive radiation events such as the Cambrian Explosion (Erwin 2005, 2008). In community ecology, sequential speciation may help explain the positive relationship between species richness and diversification rates of several different taxa in tropical climates (Mayer and

Pimm 1997, Emerson and Kolm 2005). In systematics, the process may help explain why clades of plant-feeding insects are more speciose than sister clades of non-plant feeders

(Mitter et al. 2008). In each of these cases, diversification of organisms into new habitats and life histories may increase the rate of speciation among other species with whom they interact, thereby increasing total species richess within communities. However, these

examples of sequential divergence are based on either verbal arguments or correlation analysis. They do not constitute direct proof of sequential divergence. This requires demonstrating radiations in action within an ecological timeframe.

1.3 Plant-feeding Insect and their Parasitoids: “The Greatest Biodiversity Show on Earth”

Sequential speciation may be most relevant for understanding the great diversity of plant-eating insect specialists and their associated parasitoid communities

(Abrahamson & Blair 2008; Stireman et al. 2006; Feder and Forbes 2010). When phytophagous insects diversify by shifting to novel host plants, new opportunities become available for their parasitoids to follow suit and speciate in kind. Given that (1) over half of all animals may be parasites in a broad-sense, (2) plant feeding insects are the most speciose group of animals (Price 1980), (3) most insect species are attacked by ≥

1 insect parasite (Hawkins and Lawton 1987), and (4) 20% of all insects may be parasitic wasps (La Salle & Gauld 1991), there is a world of opportunity for sequential speciation/divergence to be an important process in nature and generate a wealth of new endless forms. For smaller organisms like phytophagous insects and their parasitoids that can partition and experience resources on a fine scale, the effects of new niche construction and engineering could cascade through ecosystems and be a major driver of biodiversity (Bush 1993). Indeed while several studies have documented phylogenetic concordance between hosts and their parasites (or symbionts) that attest to co- cladogenesis (reviewed in Feder and Forbes 2010), more often than not, host and parasite phylogenies are incongruent (reviewed in de Vienne et al. 2013). This result implies that

host shifting is common and passive co-cladogenesis is not the only or dominant means of co-diversification in nature.

However, several issues complicate the study of sequential divergence in insect communities. First, in most systems, there is a lack of detailed information about the natural history and geographic context of host shifting, and the absence of a free-living parasite life stage often complicates analysis. In these cases, co-cladogenesis due to parallel allopatry or the separate vertical transmission of parasites in hosts rather than the cascading effects of shifting host ecology could trigger for co-diversification (Ehrlich and

Raven 1964; Schluter 2000; Coyne and Orr 2004). What is needed to resolve this issue is a well-defined systems with known and well-resolved natural histories to directly test whether ecological adaptation can sequentially amplify diversity. Second, only a few studies have examined patterns of host and parasite diversity testing for tritrophic effects

(reviewed in Abrahamson and Blair 2008), and these examples are lacking in several areas: (1) most cases are linear tests of sequential divergence where speciation of a single species of herbivore induces speciation of a single parasitoid species; (2) most studies lack a simultaneous treatment of genetic signatures documenting and ecological mechanisms promoting sequential speciation. In this respect, fruit flies in the genus

Rhagoletis and their associated parasitoid community offers a well-defined system with a known natural and biogeographical history (see below). This allows me to directly genetically and ecologically test for a linear versus multiplicative effect of sequential divergence across trophic levels.

1.4 Rhagoletis pomonella Fruit Flies and Their Community of Host Specific Parasitoid

Wasps: A Model for Testing the Multiplicative Sequential Divergence Hypothesis

The Rhagoletis-parasitoid system possesses several attributes making it well- suited for studying sequential speciation (Hood et al. 2012). First, R. pomonella flies (Fig.

1.2) are a textbook example of sympatric speciation via host plant shifting for phytophagous insects (Bush 1969, Berlocher and Feder 2002, Coyne and Orr 2004).

Specifically, the recent introduction of apple into the new world ~ 400 yrs. ago and the subsequent shift of R. pomonella from apple to hawthorn is a classic example of host race formation in action (Berlocher and Feder 2002). The known natural history of the

Rhagoletis system provides the background necessary to investigate sequential speciation. Second, flies in the R. pomonella complex are attacked by three genera of host-specific parasitoids, Diachasma, Utetes, and Diachasmimorpha. Furthermore, previously published work and preliminary studies suggest that the larval life stages of these three species may intensely compete for limited fly resources and this process may have important ramifications during sequential divergence (Lathrop and Newton 1933,

Forbes et al. 2010, Hood et al. 2012). Third, the members of all three wasp genera have a free-living, sexual adult stage. This allows us to rule out the possibility of strict co- speciation of wasps with Rhagoletis due to vertical transmission. Forth, it has been documented that one member of the parasitoid community, Diachasma alloeum, is sequentially speciating in parallel with its fly host (Forbes et al. 2009; see below).

However, Rhagoletis is attacked by a community of specialist parasitoid wasps.

Therefore, the Rhagoletis-wasp system provides an opportunity to test whether ecological

adaptation can sequentially and multiplicatively amplify diversity across the entire parasitoid community.

The central premise for the entire R. pomonella species complex is that differential adaptation to new host plants, in particular, traits related to host specific mating and diapause timing, generate ecological barriers to gene flow that initiate speciation (see below). The R. pomonella complex contains a number of host races (e.g., the apple and hawthorn-infesting forms of the species R. pomonella) and sibling species

(R. mendax [blueberry fly], R. zephyria [snowberry fly], R. cornivora [silky dogwood fly], and the undescribed flowering dogwood fly) that (1) are specific to different host plants, and (2) are at varying stages of divergence along the speciation continuum (Bush

1969). The close morphological similarity, distinct host affiliations, and broadly overlapping ranges led Bush (1966) to propose that these flies all speciated sympatrically via host plant shifting in North America.

Two ecological adaptations appear to be particularly important for generating reproductive isolation and initiating sympatric speciation in R. pomonella group flies.

The first trait is related to the timing of the overwintering diapause. Each Rhagoletis taxon infests the fruit of a different host plant that ripen at different times during the year.

Given that Rhagoletis is univoltine and adults are short-lived (~ 1 month), differences in the length of the overwinter diapause have evolved that synchronize the flies to eclose at differing times in the season matching the fruiting phenology of their respective host plants. The differences in eclosion time results in allochronic mating isolation between the host races and sibling species (Feder et al. 1993; 1994).

7KHVHFRQGWUDLWLVWKDW5KDJROHWLVUHSURGXFHLQDKRVWVSHFLILFPDQQHUXVLQJWKH

KRVWIUXLWDVDUHQGH]YRXVVLWHIRUFRXUWVKLSDQGPDWLQJ 3URNRS\ $VD

UHVXOWGLIIHUHQWLDOKRVWFKRLFHWUDQVODWHVGLUHFWO\LQWRPDWHFKRLFHDQGSUH]\JRWLF

UHSURGXFWLYHLVRODWLRQ2QHNH\FXHWKDWIOLHVXVHWRGLVFULPLQDWHEHWZHHQDOWHUQDWLYH

KRVWVLVWKHYRODWLOHFRPSRXQGVHPLWWHGE\ULSHQLQJIUXLW /LQQHWDO ,QERWKIOLJKW

WXQQHODVVD\VDQGILHOGWUDSSLQJWULDOVIOLHVKDYHEHHQVKRZQWRSUHIHUHQWLDOO\RULHQWWR

WKHLUUHVSHFWLYHQDWDOEOHQGVDQGDYRLGQRQQDWDOEOHQGV /LQQHWDO)RUEHVHW

DO 7KXVGLIIHUHQFHVLQKRVWFKRLFHUHODWHGWRIUXLWRGRUGLVFULPLQDWLRQLVDQ

LPSRUWDQWFRPSRQHQWRIV\PSDWULFVSHFLDWLRQIRU5KDJROHWLVIOLHV

)LJXUH $ 7KHDSSOHPDJJRWIO\ 5SRPRQHOOD RQDKDZWKRUQIUXLW % WKHSDUDVLWRLG ZDVS'LDFKDVPDDOORHXPVHDUFKLQJIRUDQRYLSRVLWLRQVLWHRQDEOXHEHUU\IUXLW*HQHWLF EHKDYLRUDODQGGLDSDXVHGDWDVXJJHVW'DOORHXPKDVIRUPHGDQHZKRVWUDFHLQFLSLHQW VSHFLHVYLDDKRVWVKLIWIURPDWWDFNLQJEOXHEHUU\IOLHVWRQRZDWWDFNLQJDSSOHIOLHV )RUEHV HWDO & 'LDFKDVPLPRUSKDPHOOHDRQDSSOHDQG ' 8WHWHVFDQDOLFXODWXVRQWKH OHDIRIDVQRZEHUU\SODQW

2QHGRFXPHQWHGFDVHRIVHTXHQWLDOVSHFLDWLRQLQYROYHVWKH5KDJROHWLVDWWDFNLQJ

SDUDVLWRLG'LDFKDVPDDOORHXP )RUEHVHWDO $SSOHKDZWKRUQEOXHEHUU\DQG

VQRZEHUU\DVVRFLDWHGSRSXODWLRQVRI'DOORHXPGLVSOD\HGVLJQLILFDQWDOOHOHIUHTXHQF\

GLIIHUHQFHVIRUQLQHRIPLFURVDWHOOLWHORFLVFRUHG$ODFNRIIL[HGGLIIHUHQFHVLQ

PW'1$VXJJHVWHGWKDWKRVWDVVRFLDWHGSRSXODWLRQVRI'DOORHXPDUHRIUHFHQWRULJLQDQG

there is ongoing gene flow. Forbes et al. (2009) also found that the same host-related ecological adaptations that reproductively isolate R. pomonella flies are operating in D. alloeum. Adult D. alloeum use the host fruit as a rendezvous site for mating and display similar preference/avoidance behaviors for fruit odor volatiles. Diachasma alloeum also parallels its fly host is diapause related life history differences. Across several sympatric blueberry, apple and hawthorn sites, D. alloeum shows significant differences in eclosion times when reared in the standard laboratory conditions. Thus, the work of Forbes et al.

(2009) provided us with one of the first and best known cases of the genetic signatures of and ecological mechanisms promoting sequential speciation in the Rhagoletis-parasitoid community. To understand how common sequential divergence may be in creating

(insect) biodiversity among systems in nature, the next obvious step is to determine how common the process may be within a single system. Thus, as a natural extension of

Forbes et al. (2009), the specific goal of my dissertation is to examine if divergence of

Rhagoletis flies at one tropic level has a reverberating effects by amplifying biodiversity at the adjacent trophic level for not just one wasp species but the entire community of wasps attacking the fly.

1.5 Overview of Chapters

I have organized my dissertation into four empirical chapters (Chapters 2-5) and a synthesis chapter (Chapter 6) specifically addressing four major issues regarding sequential divergence and the multiplicative origin of community diversity in the

Rhagoletis-parasitoid system (Chapters 2-4) and in parasitoid’s in general (Chapter 5).

Below, I offer an overview of each chapter.

In Chapter 2 of my dissertation, I synthesize the existing data from the literature and incorporate my own data to document the broader geographic ranges and extended host associations of the parasitoid wasps that attack Rhagoletis pomonella species complex flies in North America. Here my goal was to determine if: (1) wasps that co- occur attack different life-stages of the fly, (2) co-occurring wasps share some fly species in common but are unique to other fly hosts, and (3) wasps vary on a regional scale in their geographic distributions. This work is necessary as it sets the stage to test for the multiplicative properties of sequential divergence (Chapter 3) and the role that interspecific competition and temporal resource partitioning among parasitoid species sharing fly hosts plays in facilitating the sequential divergence process in the Rhagoletis- parasitoid system (Chapter 4).

In Chapter 3, I take a multi-faceted experimental and genetic approach to testing the multiplicative hypothesis of sequential divergence. I first develop a list of conditions

(criteria) conducive to and supporting hypotheses of sympatric host race formation and sequential divergence in general in insect host-parasitoid systems. This list serves as my road map into testing for the genetic signatures of and ecological mechanisms that promote sequential divergence in the Rhagoletis-parasitoid system. I then use population genetics tools, field-based behavioral observations, host fruit odor discrimination assays, and analyses of life history timing, to determine if the same host-related ecological selection pressures that differentially adapt and reproductively isolate Rhagoletis to their respective host plants (host-associated differences in the timing of adult eclosion, host fruit odor preference and avoidance behaviors, and mating site fidelity) cascaded through the ecosystem and induce host-associated genetic divergence for each of the three

members of the parasitoid community. By incorporating these results with those previously published by Forbes et al. (2009), I can determine if sequential speciation cannot simply linearly, but multiplicatively amplify biodiversity across trophic levels.

In Chapter 4, I employ a six-prong strategy using a series of rearing experiments, field and laboratory based observations and diagnostic genetic analyses and measurements of reproductive isolation to (1) examine whether interspecific larval competition between wasp species ovipositing (i.e., laying eggs) into and cohabitating the same Rhagoletis hosts results in the temporal subdivision of host fly resources and (2) test if resource partitioning allows the wasp community to coexist on shared fly hosts and contributes to evolution of reproductive isolation and population divergence among wasp species. Specifically, my results show that interspecific competition and temporal resource partitioning between wasps species attacking a single fly host appears to be promoting (increasing) allochronic reproductive isolation between the same species of wasp on different hosts thereby facilitating host race formation and speciation across the wasp community.

In Chapter 5, I take a meta-analytical approach by analyzing 64 observations from

41 published studies of interspecific competition to help understand how temporal resource partitioning, and in particular the timing of oviposition, plays in allowing multiple parasitoid species to co-exist on shared insect hosts. Specifically, I analyzed studies of oviposition manipulation to determine if and how the order and timing of oviposition between two competing species utilizing the same insect hosts affects

(mediates) the outcome (offspring survivorship) of competition between immature parasitoid species. I then couple these results with estimates of abundance and the timing

of oviposition from naturally co-occurring populations of parasitoid species to find that the timing of oviposition may be an important life history strategy mediating competitive interactions between immature parasitoids that allows multiple species to co-exist on shared hosts and may play an important role structuring insect communities. I conclude

Chapter 5 by detailing the ramifications of these findings for sequential divergence in the the Rhagoletis-parasitoid system and how the timing of oviposition and temporal resource partitioning may feedback to effect (increase) biodiversity in parasitoid communities.

In Chapter 6, I conclude my dissertation with a summary of the results of my findings and what they mean for the sequential divergence and the multiplicative origin of community level biodiversity in the Rhagoletis parasitoid system and (insect and parasitoid) biodiversity in general. I then provide an outline for future research in the

Rhagoletis-parasitoid system and abroad regarding sequential divergence and the role of interspecific competition in ecological speciation in general and more specifically in phytophagous insects and endoparasitoids.

1.6 Literature Cited

Abrahamson, W.G. and Blair, C.P. 2008. Sequential radiation through host-race formation: herbivore diversity leads to diversity in natural enemies. Specialization, Speciation, and Radiation: The Evolutionary Biology of Herbivorous Insects. University of California Press, Berkley, CA, USA.

Berlocher, S.H., and Feder, J.L. 2002. Sympatric speciation in phytophagous insects: moving beyond controversy? Annual Review of Entomology 47:773-815.

Bush, G.L. 1966. The taxonomy, cytology, and evolution of the genus Rhagoletis in North America (Diptera, Tephritidae). Bulletin of the Museum of Comparative Zoology. 134, 431-562.

Bush, G.L. 1969. Sympatric host race formation and speciation in frugivorous flies of the genus Rhagoletis (Diptera: Tephritidae). Evolution 23:237-251.

Bush, G.L. 1993. A reaffirmation of Santa Rosalia, or why are there so many kinds of small animals? pp 229-249. In D. Edwards and D. R. Lees (eds.) Evolutionary Patterns and Process, Academic Press, New York.

Bush, A.M., Bambach, R.K. and Erwin, D.H. 2011. Ecospace Utilization During the Ediacaran Radiation and the Cambrain Eco-explosion. Pp 111-133 in Quantifying the Evolution of Early Life: Numerical Approaches to the Evaluation of Fossils and Ancient Ecosystems. eds: Laflamme, Marc, Schiffbauer, James, Dornbos and Stephen. Springer Netherlands.

Butterfield, N.J. 2001. The Ecology of the Cambrian Region. Columbia University Press, New York, NY.

Coyne, J.A., and Orr, H.A. 2004. Speciation. Sinauer, Sunderland, MA, USA.

Darwin, C. 1859. On the Origin of Species by Means of Natural Selection or the Preservation of Favored Races in the Struggle for Life. J. Marray, London.

Ehrlich, P.R. and Raven, P.H. 1964. Butterflies and plants: a study in coevolution. Evolution 18:586-608.

Emerson, B.C. and Kolm, N. 2005. Species diversity can drive speciation. Nature 434:1015–1017.

Erwin, D.H. 2005. Seeds of diversity. Science 57:168-172.

Erwin, D.H. 2008. Macroevolution of ecosystem engineering, niche construction and diversity. Trends in Ecology and Evolution 23:304-310.

Feder, J.L., Hunt, T.A. and Bush, G.L. 1993. The effects of climate, host plant phenology and host fidelity on the genetics of apple and hawthorn infesting races of Rhagoletis pomonella. Entomologia Experimentalis et Applicata 69:117-135.

Feder, J.L., Opp, S., Wlazlo B., Reynolds, K., Go, W. and Spisak, S. 1994. Host fidelity is an effective pre-mating barrier between sympatric races of the Apple Maggot Fly. Proceedings of the National Academy of Science 91:7990-7994.

Feder, J.L. and Forbes, A.A. 2010. Sequential speciation and the diversity of parasitic insects. Ecological Entomology 35:67-76.

Funk, D.J., Filchak, K.E. and Feder, J.L. 2002. Herbivorous insects: model systems for the comparative study of speciation ecology. Genetica 116:251-267.

Funk, D.J., Nosil, P. and Etges, W.J. 2006. Ecological divergence exhibits consistently positive associations with reproductive isolation across disparate taxa. Proceedings of the National Academy of Sciences 103:3209-3213.

Forbes, A.A., Fisher, J. and Feder, J.L. 2005. Habitat avoidance: overlooking an important aspect of host-specific mating and sympatric speciation? Evolution 59:1552–1559

Forbes, A.A., Powell, T.H.Q., Stelinski, L.L, Smith, J.J. and Feder, J.L. 2009. Sequential sympatric speciation across trophic levels. Science 323:776-779.

Forbes, A.A., Hood, G.R. and Feder, J.L. 2010. Geographic ranges and host breadths of parasitoid wasps associated with the Rhagoletis pomonella (Diptera: Tephritidae) species complex. Annals of the Entomological Society of America 103:908-915.

Hawkins, B.A, and Lawton, J.H. 1987. Species richness for parasitoids of British phytophagous insects. Nature 326:788-790.

Hood, G.R., Egan, S.P. and Feder, J.L. 2012. Interspecific competition and speciation in endoparasitoids. Evolutionary Biology 39:219-230.

Hood, G.R., Forbes, A.A., Powell, T.H.Q., Egan, S.P., Hamerlinck, G., Smith, J.J. and Feder, J.L. 2015. Sequential divergence and the multiplicative origin of community diversity. Proceedings of the National Academy of Sciences 112:E5980-5989.

Hood, G.R. and Feder, J.L. 2016. Sequential Speciation in Encyclopedia of Evolutionary Biology. In press.

Janz, N., Nylin, S. and Wahlberg, N. 2006. Diversity begets diversity: host expansion and the diversification of plant-feeding insects. BMC Evolutionary Biology 6:4.

La Salle, J., and Gauld, I.D. 1991. Parasitic Hymenoptera and the biodiversity crisis. Redia 74:315-334.

Lathrop, F.H. and Newton, R.C. 1933. The biology of Opuis melleus Gahan, a parasite of the blueberry maggot. Journal of Agricultural Research 46:143-160.

Linn, C., Feder, J.L., Nojima, S., Dambroski, H.R., Berlocher, S.H. & Roelofs, W. 2003. Fruit odor discrimination and sympatric host race formation in Rhagoletis. Proceedings of the National Academy of Sciences of the United States of America 100:11490–11493.

Linn, C.E., Dambroski, H.R., Feder, J.L., Berlocher, S.H., Nojima, S. and Roelofs, W.L. 2004. Postzygotic isolating factor in sympatric speciation in Rhagoletis flies: reduced response of hybrids to parental host-fruit odors. Proceedings of the National Academy of Science 101:17753-17758. 15

Mayer, A.L. and Pimm, S.L. 1997. Tropical rainforests: diversity begets diversity. Current Biology 7:R430-432.

Mitter, C., Farrell, B. and Wiegmann, B. 1988. The phylogenetic study of adaptive zones- has phytophagy promoted insect diversification? American Naturalist 132:107- 128.

Nosil, P. 2012. Ecological Speciation. Oxford University Press, New York, NY, USA.

Palmer, M.W. and Maurer, T.A. 1997. Does diversity beget diversity? A case study of crops and weeds. Journal of Vegetation Science 8:235-240.

Pennisi, E. 2005. What determines species diversity? Science 309:5731.

Price, P.W. 1980. Evolutionary Biology of Parasites. Princeton University Press, Princeton, NJ. Prokopy, R.J., Bennett, E.W. and Bush, G.L. 1971. Mating behavior in Rhagoletis pomonella (Diptera: Tephritidae). I. Site of assembly. Canadian Entomologist 103:1405-1409.

Prokopy, R.J., Bennett, E.W. and Bush, G.L. 1971. Mating behavior in Rhagoletis pomonella (Diptera: Tephritidae). I. Site of assembly. Canadian Entomologist 103:1405-1409.

Prokopy, R.J., Bennett, E.W. and Bush, G.L. 1972. Mating behavior in Rhagoletis pomonella (Diptera: Tephritidae). II. Temporal organization. Canadian Entomologist 104:97-104.

Purves, W.K., Gordon, H. and Raig, H.H. 1994. Life: The Sciences of Biology (4th ed.). Sinauer Press, Sunderland, MD, USA.

Rundle, H.D. and Nosil, P. 2005. Ecological Speciation. Ecology Letters 8:336-352.

Schluter, D. 2000. The Ecology of Adaptive Radiation. Oxford University Press, New York, NY, USA.

Stevens, R.D. and Tello, J.S. 2011. Diversity begets diversity: relative roles of structural and resource heterogeneity in determining roden community structure.

Stireman, J.O., Nason, J.D., Heard, S.B., and Seehawer, J.M. 2006. Cascading host- associated genetic differentiation in parasitoids of phytophagous insects. Proceedings of the Royal Society of London, Series B-Biological Sciences 273:523-530. de Vienne, D.M., Refregier, G., Lopez-Villavicencio, M., Tellier, A., Hood, M.E. and Guraud, T. 2013. Cospeciation vs host-shift speciation: methods for testing evidence from natural associations and relation to coevolution. New Phytologist 198:347-385.

CHAPTER 2:

GEOGRAPHIC RANGES AND HOST BREADTHS OF PARASITOID WASPS

ASSOCIATED WITH THE RHAGOLETIS POMONELLA (DIPTERA: TEPHRITIDAE)

SPECIES COMPLEX1

2.1 Abstract

A major goal of evolutionary ecology is to understand how new biodiversity is created and structured into communities. The apple maggot fly, Rhagoletis pomonella, a model for rapid ecological speciation via host plant shifting in phytophagous insects, and its parasitoid community can offer valuable insight into addressing this issue. Speciation of Rhagoletis flies appears to be driving the “sequential divergence” of at least one host specific parasitoid wasp, Diachasma alloeum, that attacks the fly. However, biological and geographic information regarding D. alloeum and other parasitoids that attack flies in the genus Rhagoletis is sorely lacking, a problem that complicates the study of their evolution. Here, we present a synthesis of the geographic ranges and extended host associations of Rhagoletis-attacking parasitoids. Using personal collections and published records we ask if: (1) wasps that co-occur in sympatry attack different life-stages of the

1Chapter published as: *Forbes, A.A., *Hood, G.R. and Feder, J.L. 2010. Geographic ranges and host breadths of parasitoid wasps associated with the Rhagoletis pomonella (Diptera: Tephritidae) species complex. Annals of the Entomological Society of America 103:908-915. *Denotes equal contribution. 17

fly, (2) locally co-occurring wasps share some fly species in common but are unique to other fly hosts, and (3) wasps vary on a regional scale in their geographic distributions. A better understanding the distributions and host ranges of Rhagoletis-attacking parasitoid will facilitate future studies of sequential divergence in this system.

2.2 Introduction

Two of the most important questions in ecology and evolutionary biology are

“how do new species form” and once formed, “how is biodiversity structured into communities” (May 1999, Gavrilets and Losos 2009). These questions are interrelated, as factors affecting community structure may often feedback to generate new biodiversity

(Emerson and Kolm 2005, Erwin 2005). In particular, as new species form, they may create new opportunities (niches) for associated organisms to exploit and adapt to, potentially leading to the genesis of many new taxa. Such “cascading” or “sequential” speciation has been proposed to be particularly important for phytophagous insects and their associated parasitoids (Stireman et al. 2006, Abrahamson and Blair 2008, Feder and

Forbes 2010). When an insect shifts to a new plant it may have rippling effects across the ecosystem and trigger diversification in the higher trophic level of its associated parasitoid community. Parasitoids of phytophagous insects may be particularly prone to sequential radiation because many are relative specialists on their hosts (Price 1980,

Abrahamson and Blair 2008). Thus, changes in the ecology of phytophagous insects related to host plant shifting can place strong divergent selective pressures on parasitoids attempting to track their insect hosts. A potential result of this divergent selection may be ecologically-based reproductive isolation which may lead to speciation.

Previously, it was discovered that the parasitoid wasp Diachasma alloeum

(Hymenoptera: Braconidae) has formed new incipient species (i.e., host races) by specializing on a number of diversifying host flies in the Rhagoletis pomonella species complex (Diptera: Tephritidae) (Forbes et al. 2009). Rhagoletis pomonella is a model for sympatric speciation via host plant shifting (Bush 1966, 1994). The recent shift of R. pomonella from its native host hawthorn (Crataegus spp.) to introduced, domesticated apple (Malus domestica) in the mid-1800s is an example of incipient ecological speciation in action (Bush 1994). Forbes et al. (2009) found genetic, behavioral, and life history differences between D. alloeum attacking different Rhagoletis hosts, including the apple and hawthorn infesting host race of flies. Because D. alloeum is free-living as a sexual adult, the observed differences for the wasp cannot simply be due to passive co- cladogenesis resulting from obligate vertical transmission of parasites. Rather, these findings imply that speciation can induce speciation and biodiversity beget biodiversity, as the effects of new niche construction cascade upwards across trophic levels.

Rhagoletis pomonella flies are also attacked by several other species of braconid wasps in addition to D. alloeum in the genera Diachasmimorpha, Utetes and Opius

(Wharton & Marsh 1978). Here, we begin to address the question of how widespread sequential radiation may be by characterizing the geographic distributions and ecologies of these parasitoid guilds associated with R. pomonella and other flies in the R. pomonella species complex. In this regard, we are particularly interested in determining whether and how species interactions may affect the potential for wasp radiation.

Competitive exclusion theory predicts that two or more species cannot stably coexist if they utilize the same resources (Gause 1932; MacArthur and Wilson 1967, Mayfield and

Levine 2010). Yet several different taxa of parasitoid wasps appear to overlap in their use of Rhagoletis flies. We hypothesize that parasitoids can potentially overlap in their host fly use due to four factors acting alone or in combination: (1) wasps that co-occur in sympatry attack different life-stages of the fly, (2) locally co-occurring wasps share some fly species in common but not others and (3) wasps vary on a regional scale in their geographic distributions. We examine these hypotheses by synthesizing information of host breadth and geographic distributions of Rhagoletis-attacking parasitoids from our own collections and previously published literature. Our results suggest that all three factors may contribute to structuring the braconid parasitoid community attacking

Rhagoletis fruit flies and we discuss the implications of these findings for the potential for sequential divergence to amplify biodiversity at the parasitoid trophic level.

2.3 Methods

2.3.1 Biology of Host Flies and Parasitoid Wasps

The taxonomic status of Rhagoletis host fly populations collected in the study ranged from host races, to sibling species, to morphologically and genetically distinct species. Twenty-four species of Rhagoletis flies have been described from North America

(Bush 1966, Foote et al. 1993). Many of these species are well studied because they are important agricultural pests (e.g., R. pomonella, R. mendax, R. cingulata, R. fausta, R. completa), while others are known only from single specimen collections (e.g., R. ebbestti). The richest literature exists for the R. pomonella species complex of flies, which consists of R. pomonella, R. mendax (blueberry maggot), R. zephyria (snowberry maggot), and R. cornivora (shrubby dogwood maggot). In the current study, we also 20

distinguished R. sp. nr. pomonella, an undescribed fly attacking flowering dogwood

(Cornus florida) (Berlocher 1984), and R. sp. nr. mendax, an undescribed fly attacking sparkleberry (Vaccinium arboreum), as independent taxa within the complex (Berlocher

1999, 2000). In addition, hawthorn-infesting R. pomonella populations from the Ejo

Volcaino Trans Mexico central highlands (EVTM) should be considered a separate taxon

(Xie et al. 2007), while the status of hawthorn flies from the Sierra Madre Oriental mountains of Mexico (SMO) is less certain (Xie et al. 2007). Host plant affiliations for each fly taxon are given in Table A.1.

Rhagoletis in North America are primarily univoltine, having 1 generation per year. Female flies oviposit into ripening, unabscised fruits on host plants. Fly eggs hatch after 2-3 days, and larvae feed and develop for 2-5 weeks within the host fruit (Feder

1998). Following fruit abscission, larvae emerge from the host fruit and burrow ~ 4 cm into the topsoil. Here, they pupate and enter a facultative overwintering diapause (Dean and Chapman 1973). Adult flies generally eclose the following spring/summer, although a small proportion of the population can eclose later in successive years (up to 4 years) after repeated cycles of overwintering and heating (Lathrop and Nickels 1931, Dean and

Chapman 1973). The timing of fly eclosion varies by species and coincides with host plant fruiting phenology (Feder and Filchak 1999). Upon eclosion, the short-lived adults

(~ 28 days in the field) use a combination of visual and olfactory cues to locate host fruits, which are used as rendezvous sites for mating and oviposition (Prokopy et al.

1971, 1972, Prokopy and Roitberg 1984, Forbes et al. 2005, Forbes and Feder 2006).

Adult parasitoid wasps of Rhagoletis also use visual and chemical cues to search for fly-infested fruit. Wasp, like the flies, mate near host fruit. Female wasps oviposit

directly into either fly eggs or second/third instar fly larvae, depending on the parasitoid species (Lathrop and Newton 1933, Prokopy and Webster 1978, Stelinski et al. 2004).

Wasp eggs hatch and the developing wasp larva completely consumes its Rhagoletis host once a fly larvae leaves the host fruit and burrows into the soil (Lathrop and Newton

1933; Wharton and Marsh 1978). Overwintering and pupation take place inside the intact fly puparium (Lathrop and Newton 1933). Adult wasp emergence generally coincides with the temporal availability of host flies (Dean and Chapman 1973, Feder 1995, Forbes et al. 2009). More than one egg may be laid in a host by different conspecific and/or heterospecific female wasps; however, no more than one parasitoid has been documented to emerge from each fly puparium (Lathrop and Newton 1933, Dean and Chapman

1973). Therefore, the opportunity for intense competition exists among parasitoids.

2.3.2 Sample Collection and Identification

Rhagoletis flies and their parasitoids were collected from 91 different sites from

1989-2009 (Table A.1). Standard fly and wasp husbandry as discussed in Feder et al.

(1997) and Forbes et al. (2009) was used to rear specimens to adulthood in the laboratory.

For the number of adult parasitoids reared from each site see Table A1. Each reared adult parasitoid was identified to the species level using the taxonomic keys of Gahan

(1919, 1930), Wharton (1997) and Wharton and Marsh (1978).

Flies from all species in the R. pomonella species complex were collected.

Several sympatrically occurring Rhagoletis species more distantly related to R. pomonella were also collected (R. basiola, R. chionanthi, R. cingulata, R. completa, R. electromorpha, R. indifferens, R. suavis, R. tabellaria). With two exceptions, we found that parasitoids reared from non-R. pomonella group flies were distinctly different taxa 22

from those reared from the R. pomonella group. These wasps will therefore not be discussed further, except within the context of demonstrating non-overlap of host fly use by geographically sympatric parasitoids. The two exceptions were a parasitoid of R. cingulata (the black cherry fly), that appears to be close to or the same as a larval parasitoid of R. pomonella, and a parasitoid of R. tabellaria (host: Cornus stolonifera) that resembles a different larval parasitoid of R. pomonella.

2.3.3 Literature Review

Historical records of parasitoid collections were obtained by searching the primary literature for current scientific names and archaic synonyms of parasitoids and host flies

(see species descriptions below). A review of literature pertaining to the life history and biology of R. pomonella species complex flies was also conducted. Thirty published papers were obtained that had non-overlapping information on geographical distributions and host associations of wasps (Table A.1).

2.4 Results

2.4.1 Egg-stage Parasitoids

Three different species of wasps (Hymenoptera: Braconidae) were identified that parasitize the egg-stage of Rhagoletis flies: Utetes canaliculatus and U. richmondi Gahan

(= O. richmondi), and U. lectoides Gahan (= O. lectoides) (Table 2.1). The first egg parasitoid, Utetes canaliculatus Gahan (= Opius lectus, O. canaliculatus), was reared

TABLE 2.1:

EGG AND LARVAL STAGE ATTACKING PARASITOIDS OF RHAGOLETIS

POMONELLA AND OTHER SHARED HOSTS

Egg Larval Species Group Fly Species Host Plant Parasitoid Parasitoid R. pomonella Apple ●(E)○(W) ■□◊ R. pomonella Hawthorn ●(E)○(W) ■□◊ R. sp. nr. Flowering pomonella Dogwood ● ■ (rare)□ R. mendax Blueberry pomonella * ■□ R. sp. nr. Sparkleberry mendax ■ R. zephyria Snowberry ●(E)○(W) ■□◊ R. mendax x R. Honeysuckle zephyria ● ■ Silky R. cornivora Dogwood * cingulata R. cingulata Black Cherry □ Red Ozier taballeria R. tabellaria Dogwood ◊ Note: Egg parasitoids: ● = Utetes canaliculatus, ○ = U. lectoides, * = U. richmondi. Larval parasitoids: ■ = Diachasma alloeum, □ = Diachasmimorpha mellea, ◊ = Opius downesi. E = eastern U.S. only. W = western U.S. only. See Table A.1 in the appendix for full records of host affiliations. See Figs. 1.1 and 1.2 for estimated geographic ranges. from four species of Rhagoletis infesting a total of nine different fruit hosts (Table A.1):

R. pomonella in apples (M. domestica) and four species of hawthorn (C. mollis, C. rosei,

C. gracilor, and C. mexicana), R. zephyria in snowberry (Symphoricarpos albus) and R. nr. sp. pomonella in flowering dogwood (Cornus florida). Utetes canaliculatus was not reared from any collections of R. mendax infesting blueberries or from R. nr. sp. mendax infesting sparkleberries. The realized geographic distribution of U. canaliculatus 24

encompassed most of the eastern United States and southeastern Canada, west to

Minnesota in the north and Texas in the south (Fig. 1.1). Individuals were also reared from geographically isolated populations of R. pomonella in Mexico, although Mexican populations of U. canaliculatus may be a different species or race (see Rull et al. (2009) for a description of Mexican Utetes as Utetes sp. nr. canaliculatus).

The second egg parasitoid, U. richmondi, was reared from R. mendax infesting blueberries (Vaccinium corymbosum), R. nr. sp. mendax infesting sparkleberries (V. arboreum), and R. cornivora infesting shrubby dogwood (C. amomum) (Table A.1).

Utetes richmondi was absent from all other host collections, including sympatric R. pomonella, and R. nr. sp. pomonella, and R. zephyria. The geographic distribution of U. richmondi corresponded to that of R. mendax and R. nr. sp. mendax (Fig. 2.1).

The third egg parasitoid, U. lectoides, was reared from the snowberry fly R. zephyria (host: S. albus) and introduced R. pomonella infesting native and introduced hawthorns (C. douglassi and C. monogyna, respectively) in the Pacific Northwest (Table

A.1). Collections of U. lectoides extended from Washington and Oregon east into

Minnesota, overlapping with the ancestral range of the snowberry fly, R. zephyria (Bush

1966, Gavrilovic et al. 2007), although a single record of U. lectoides reared from R. pomonella infesting apples in Ontario suggests caution in this interpretation (Fig. 1.1).

2.4.2 Larval-stage Parasitoids

Three different species of wasps (Hymenoptera: Braconidae) were identified that parasitize the larval-stage of Rhagoletis flies (Table 2.1): Diachasma alloeum Gahan (=

O. alloeus, D. ferrugineus, D. ferrugineum, O. ferrugineus), Diachasmimorpha mellea

Gahan (= O. melleus, Biosteres melleus, B. rhagoletis), and Opius downesi Gahan. 25

The first larval parasitoid, D. alloeum, was reared from six different Rhagoletis species infesting a total of 16 different fruit hosts (Table A.1): R. pomonella (in apple [M. domestica] and 5 species of hawthorn [C. mollis, C. opaca, C. flabatella, C. viridis and C. brachycantha], as well as populations attacking plums [Prunus domestica] and Asian crab apple [M. floribunda]), R. mendax (in highbush blueberries [V. corymbosum], deerberries [V. stamineum], and dwarf huckleberries [Galylussacia dumosa]), R. nr. sp. mendax (in sparkleberries [V. arboreum]), and R. zephyria (in two species of snowberry

[Symphoricarpos albus and S. occidentalis]). The wasp was also found infesting hybrid

R. zephyria × R. mendax flies (Schwarz et al. 2005) attacking recently introduced populations of Asian honeysuckles (Lonicera spp.). Despite extensive collections, D. alloeum was reared just twice from the flowering dogwood fly, R. nr. sp. pomonella, both times from sites in southern Illinois. The more distantly related R. cornivora, and the many additional North American Rhagoletis species outside of the R. pomonella species complex were not identified as hosts of D. alloeum. The geographic distribution of D. alloeum was confined primarily to the eastern half of North America (Fig. 2.2), but the wasp was also found as far west as Wyoming and as far south as Texas. Southern populations of D. alloeum were associated only with sparkleberries (V. arboreum), deerberry (V. stamineum), eastern mayhaws (C. opaca) and blueberry hawthorns (C. brachycantha), while northern wasps were more cosmopolitan (nine hosts).

The second larval parasitoid, D. mellea, was reared from six Rhagoletis species in a total of 11 fruit hosts: R. pomonella in apple (M. domestica) and hawthorn (C. mollis,

C. mexicana, C. rosei, and C. douglasii), R. mendax (V. corymbosum) and the flowering dogwood fly, R. sp. nr. pomonella. The wasp was also reared twice from R. zephyria

Figure 2.2: Collection sites and host ranges of parasitoids of larval Rhagoletis flies: Diachasma alloeum (black circles), Diachasmimorpha mellea (gray circles), and Opius downesi (asterisks). Sites where D. alloeum and D. mellea have been reared from the same hosts are denoted by a gray circle inside of a black circle. Sites where D. mellea and O. downesi have been reared from the same hosts are denoted by an asterisk inside of a gray circle. Refer to Tables A.1 in the appendix for complete list of sites and identities of host plants and flies for each collection.

infesting S. albus and once each from R. pomonella infesting plums (Prunus domestica), and the hybrid Lonicera fly infesting honeysuckle. One record of D. mellea reared from a non-Rhagoletis host, Myoleja limata in Florida, was dismissed by Wharton and Marsh

(1978) as likely contamination of the collection. A collection of R. cingulata infesting black cherries (Prunus serotina) from Granger, Indiana, yielded parasitoids that closely resemble D. mellea, although the exact taxonomic determination of these should be viewed with caution until further genetic analysis can be performed. The geographic distribution of D. mellea was similar to that of D. alloeum, but extended into the central highlands (EVTM) of Mexico (Rull et al. 2009). The wasp may also have been recently introduced along with populations of R. pomonella into apples and hawthorns in

Washington State (Gut and Brunner 1994).

A third parasitoid, Opius downesi, was reared from R. zephyria in snowberries, R. pomonella in hawthorns (C. monogyna and C. douglassi) and apples (M. domestica), and from R. tabellaria in Cornus stolonifera in Door County, Wisconsin. Little is known about the biology of O. downesi. However, the longer length of the female ovipositor compared to known egg-stage attacking species suggests that O. downesi is a larval-stage attacking species (Gahan 1919; Wharton and Marsh 1978). While collections of O. downesi suggest that it is much less common than D. alloeum and D. mellea, the species may be more widespread in the Northwestern U.S (Fig 2.2).

2.4.3 Pupal-stage Parasitoid

One additional parasitoid may be an important source of mortality for R. pomonella in North America: Coptera pomonellae Muesebeck (= Psilus spp.)

(Hymenoptera: Diapriidae). This species is a pupal parasitoid of R. pomonella

(Muesebeck 1980) that attacks flies after they have left the fruit and burrowed into the soil to overwinter. While the abundance and distribution of Coptera pomonellae is relatively unknown, the species is likely underrepresented due to traditional sampling methods that rely on collecting parasitized flies directly from fruit. However, Cameron and Morrison (1974, 1977) reported C. pomonellae parasitism rates as high as 10.0% and

5.8% respectively from R. pomonella pupae sifted from soil under apple trees in Quebec.

In addition, Maier (1981) found C. pomonellae attacking R. pomonella from both apples and hawthorns in Connecticut at rates as high as 15.2% and 14.5% respectively.

Moreover, Muesebeck (1980) lists R. suavis (the walnut husk fly) as a host for C. pomonellae in Kansas, and notes additional field collections of adult wasps from New

York and South Carolina without reporting host fly-associations.

2.4.4 Miscellaneous Parasitoids

Additional parasitoid reports for Rhagoletis flies from the primary literature include Pattason conotracheli (Hymenoptera: Mymaridae) parasitizing apple maggots in

Connecticut (Porter and Alden 1921), a finding Dean and Chapman (1973) attribute to spillover from plum curculio (Coleoptera: Curculionidae). Aphaereta auripes and

(Hymenoptera: Braconidae) and an unidentified Eulophid (Hymenoptera: Chalcidoidae) were reported to emerge from beneath apple trees in Ithaca, New York (Middlekauff

1941). However, we suspect A. auripes, usually a parasitoid of Sarcophagid flies parasitizing snails (Muesebeck et al. 1951) is an anomaly. With respect to the Eulophid, we have observed occasional Chalcidoidae in emergence cages, but are uncertain of their host associations and taxonomic status as they are common parasitoids of 30

Ichneumonidae. Finally, several references to Diachasma ferrugineum Muesebeck (=

Opius ferrugineus) attacking R. pomonella in hawthorns and apples (Middlekauff 1941;

Maier 1981) are almost certainly a reference to D. alloeum, as these two species were synonymous for many years and differ only in ovipositor length and number of antennal segments (Wharton and Marsh 1978). Extensive morphological and genetic work on D. alloeum in Michigan, Illinois, New Jersey and Indiana did not identify any D. ferruginium associated with R. pomonella (Forbes et al. 2008; Forbes et al. 2009), despite broad geographic overlap of R. pomonella and R. cingulata populations in the eastern

U.S., the latter fly being a known, primary host for D. ferrugineum.

2.5 Discussion

Flies in the R. pomonella sibling species complex are attacked by a wide variety of parasitoid wasps. The main objectives in the current work were to characterize the dimensions of this parasitoid biodiversity (i.e, what is out there in nature) and determine how parasitoid biodiversity is structured, both spatially (geographic distribution) and ecologically (host fly associations). The ultimate goal is to discern how these dimensions of biodiversity translate into the potential for sequential divergence and, thus, new wasp biodiversity. Understanding how the parasitoid guild is constructed (packed) with respect to their host flies yields insight into which host niche dimensions must likely be open to facilitate cascading parasitoid speciation across trophic levels. Such an understanding can then be tested empirically to see if it is realized in nature in terms of new host races and incipient species of wasps forming in response to newly-available fly resources. Our working hypothesis is that host niche dimensions where wasp species exclusion is

observed must be open for sequential radiation to occur, and those dimensions that do not affect wasp species packing will not impinge on sequential radiation.

Three general results emerged from the current study. First, host life-stage attacked is a principal axis organizing wasp biodiversity. Egg and larval parasitoids overlap broadly in their geographic and hosts distributions, co-occurring in sympatry on every R. pomonella fly host. The same may also be true for the pupal parasitoid Coptera pomonellae, at least with respect to apple- and hawthorn-infesting flies, but further sampling is needed to confirm this result. Thus, differences in life-stages attacked appear to be sufficient to allow co-existence between Rhagoletis parasitoids. Therefore, it appears that the presence of multiple species of parasitoids attacking different life stages of the fly host is itself unlikely to restrict successful host shifting and potential race formation in this system.

Second, the structure of the egg-parasitoid community implies that competition is sufficient to preclude multiple egg-stage attacking wasps from utilizing the same

Rhagoletis fly host in an area. None of the three eggs parasitoids of R. pomonella, U. canaliculatus, U. richmondi, and U. lectoides, were reared from the same host fly species in the same geographic region. Utetes canaliculatus and U. richmondi are sympatric across most of their respective ranges (Fig. 2.1). However, they share no fly host species in common (Tables A.1). Moreover, U. lectoides is geographically separated from U. canaliculatus and U. richmondi, with the possible exception of a single record of U. lectoides from apple-infesting R. pomonella in Ontario, Canada (Monteith 1977). We cannot substantiate the veracity of this report, but current sampling is inconsistent with U. lectoides being present as far east as Ontario. It is conceivable, however, that Ontario

represents the eastern-most limit for the wasp. Nevertheless, co-occurrence appears highly restricted among Rhagoletis egg parasitoids, implying that the egg resource may be too limited to support multiple wasp taxa utilizing the same fly host. As a consequence, the absence of other egg-stage parasitoids may be a prerequisite for successful host shifting and race formation for U. lectoides, U. canaliculatus, and U. richmondi.

Third, in contrast to egg-stage parasitoids, the larval-stage attacking wasps D. mellea and D. alloeum were routinely reared from the same host fly populations and sites

(Fig. 2.1, Tables A.1). The same also appears to be true for D. mellea and O. downesi in the western U.S., provided that the latter species is confirmed to be a larval-stage attacking parasitoid. These results imply that the presence of a larval-stage parasitoid does not restrict potential host shifting and race formation by other larval-stage attacking wasps. Indeed, it is even possible that the presence of an interspecific competitor could facilitate sequential radiation by imposing additional divergent selection pressures on wasps to reduce competition by augmenting ecological adaptations related to the host fruit and/or host fly resource.

Several interacting factors may lessen the intensity of interspecific competition among larval-stage parasitoids and permit co-existence. For example, D. alloeum and D. mellea do not completely overlap in the host fly use. Diachasmimorpha mellea was reared from numerous collections of the flowering dogwood fly, R. sp. nr. pomonella, a host from which D. alloeum was reared only rarely. In contrast, in the Southeast, D. alloeum was found primarily in R. sp. nr. mendax infesting sparkleberries (V. arboreum), while D. mellea was not. These “private” hosts may serve as source populations for a

wasp in an area and permit co-existence of the parasitoid on alternate sink hosts (e.g., hawthorn, apple, and blueberry flies) where other larval-stage parasitoids are present.

Another factor potentially facilitating co-existence is that D. alloeum and D. mellea do not completely overlap in their geographic distributions; D. mellea extends far south into Mexico, while D. alloeum does not. In contrast, D. alloeum occurs in parts of the southeastern U.S., including Florida where D. mellea is not found. These areas of non-overlap may also promote co-existence by serving as source populations for wasps, mitigating against regional extinction of a taxon.

Finally, the larval resource may be sufficiently broad temporally and spatially to allow D. alloeum and D. mellea to finely divide that resource in a manner permitting co- existence. This could occur, for example, by D. mellea and D. alloeum utilizing different stages of larval development (e.g., 2nd vs. 3rd instar) or by differentially attacking fly larvae feeding within abscised vs. unabscised fruit. Moreover, population densities of the wasps could vary in a mosaic pattern across the landscape with one species (possibly a better colonizer) predominating at some sites and the other wasp (possibly a superior competitor) dominating at others. These aspects of the biology of D. mellea and D. alloeum warrant further study and could have important repercussions for sequential radiation.

An interesting and unexpected finding revealed by the current study is the co- existence of O. downesi and D. mellea in the Pacific Northwest. Rhagoletis pomonella is believed to have been introduced into Oregon in the 1960s via human transport of larval- infested apples from the east. Along with domesticated apple, R. pomonella in the West also attacks the introduced hawthorn C. monogyna, as well as the native black hawthorn,

C. douglasii. It appears that D. mellea was also introduced along with R. pomonella in the Northwest. The wasps now parasitizes apple and introduced and native hawthorn fly populations in these regions (Gut and Brunner 1994). In addition to D. mellea, R. pomonella is also attacked by the wasps U. lectoides and O. downesi, both native parasitoids of endemic R. zephyria (snowberry fly) populations (AliNiazee 1985). Thus, the potential exists for two recently derived (< 50 years) host races of wasps to have formed on R. pomonella in the Pacific Northwest. Similarly, the Lonicera fly that infests introduced honeysuckle in the eastern U.S. may provide another potential example of rapid parasitoid race formation.

In conclusion, characterization of the geographic distributions and host associations of hymenopteran parasitoids of R. pomonella group flies produced several significant patterns bearing on wasp host race formation and sequential divergence.

Wasps attacking different life-history stages do not appear to impinge on parasitoid host shifting. However, only one species of egg-stage parasitoid may be able to utilize a given fly host in a region. In contrast, the presence of a larval-stage attacking parasitoid does not exclude other larval-stage attacking wasps from co-occurring on the same host fly.

Future studies will test the consequences of these general relationships for sequential radiation by determining if genetically differentiated hosts races or species exist on different host flies. Our prediction is that sequential speciation can, at best, only linearly amplify egg-parasitoid diversity (1 fly host = 1 wasp parasitoid), but has the potential to multiplicatively enhance (1 fly to many parasitoid species) larval-stage parasitoids.

2.6 Acknowledgments

We thank Stewart Berlocher, Guy Bush, Tom Powell, Jim Smith, and Dietmar

Schwarz for access to their parasitoid collections and/or records of parasitism. We also acknowledge Bob Wharton's valuable web-resource for persons interested in parasitoids of the fruit-infesting Tephritidae: http://hymenoptera.tamu.edu/paroffit/. This work was supported by a NSF DDIG awarded to JLF and AAF and an AMNH Theodore Roosevelt

Fund award to AAF.

2.7 Literature Cited

Abrahamson, W.G. and Blair, C.P. 2008. Sequential radiation through host-race formation: herbivore diversity leads to diversity in natural enemies. Pp. 188-202 in K. J. Tilmon, ed. Specialization, Speciation, and Radiation: The Evolutionary Biology of Herbivorous Insects. University of California Press, Berkeley, CA.

AliNiazee, M.T. 1985. Opiine parasitoids (Hymenoptera: Braconidae) of Rhagoletis pomonella and R. zephyria (Diptera: Tephritidae) in the Willamette Valley, Oregon. The Canadian Entomologist 117:163-166.

Berlocher, S.H. 1984. A New North-American Species of Rhagoletis (Diptera, Tephritidae), with Records of Host Plants of Cornus-Infesting Rhagoletis. Journal of the Kansas Entomological Society 57:237-242.

Berlocher, S.H. 1999. Host race or species? Allozyme characterization of the 'flowering dogwood fly', a member of the Rhagoletis pomonella complex. Heredity 83:652- 662.

Berlocher, S.H. 2000. Radiation and divergence in the Rhagoletis pomonella species group: Inferences from allozymes. Evolution 54:543-557.

Bush, G.L. 1966. The taxonomy, cytology, and evolution of the genus Rhagoletis in North America (Diptera, Tephriditae). Bulletin of the Museum of Comparative Zoology 134:431-562.

Bush, G.L. 1994. Sympatric speciation in animals: New wine in old bottles. Trends In Ecology and Evolution 9:285-288.

Cameron, P.J. and Morrison, F.O. 1974. Psilus sp. (Hymenoptera: Diapriidae), a parasite of the pupal stage of the apple maggot, Rhagoletis pomonella (Diptera: Tephritidae) in south-western Quebec. Phytoprotection 55:13-16.

Cameron, P.J. and Morrison, F.O. 1977. Analysis of mortality in the apple maggot, Rhagoletis pomonella (Diptera: Tephritidae), in Quebec. The Canadian Entomologist 109:769-787.

Dean, R.W. and Chapman, P.J. 1973. Bionomics of the apple maggot in Eastern New York. Search Agriculture 3:10.

Emerson, B. C. and Kolm, N. 2005. Species diversity can drive speciation. Nature 434:1015-1017.

Erwin, D.H. 2005. Seeds of diversity. Science 308:1752-1753.

Feder, J.L. 1995. The effects of parasitoids on sympatric host races of Rhagoletis pomonella (Diptera, Tephritidae). Ecology 76:801-813.

Feder, J.L. 1998. The apple maggot fly, Rhagoletis pomonella: flies in the face of conventional wisdom about speciation? in D. J. Howard, and S. H. Berlocher, eds. Endless Forms: Species and Speciation. Oxford University Press, New York.

Feder, J.L. and Filchak, K.E. 1999. It's about time: the evidence for host plant-mediated selection in the apple maggot fly, Rhagoletis pomonella, and its implications for fitness trade-offs in phytophagous insects. Entomologia Experimentalis et Applicata 91:211-225.

Feder, J.L. and Forbes, A.A. 2010. Sequential Speciation and the Diversity of Parasitic Insects. Ecological Entomology 35:67-76.

Feder, J.L., Roethele, J.B., Wlazlo, B. and Berlocher, S.H. 1997. Selective maintenance of allozyme differences among sympatric host races of the apple maggot fly. Proceedings of the National Academy of Science 94:11417-11421.

Foote, R.H., Blanc, F.L. and Norrbom, A.L. 1993. Handbook of the fruit flies (Diptera: Tephritidae) of America north of Mexico. Cornell University Press, Ithaca, NY.

Forbes, A.A., and Feder, J.L. 2006. Divergent preferences of Rhagoletis pomonella host races for olfactory and visual fruit cues. Entomologia Experimentalis et Applicata 119:121-127.

Forbes, A.A., Fisher, J. and Feder, J.L. 2005. Habitat avoidance: Overlooking an important aspect of host-specific mating and sympatric speciation? Evolution 59:1552-1559.

Forbes, A.A., Powell, T.H.Q., Noor, M.A.F., Lobo, N.F. and Feder, J.L. 2008. Development of novel microsatellite loci for Diachasma alloeum (Hymenoptera: Braconidae), a parasitoid of Rhagoletis pomonella. Molecular Ecology Resources 8:373-376.

Forbes, A.A., Powell, T.H.Q., Stelinski, L.L., Smith, J.J. and Feder, J.L. 2009. Sequential sympatric speciation across trophic levels. Science 323:776-779.

Gahan, A.B. 1919. Descriptions of seven new species of Opius (Hymenoptera: Braconidae). Proceedings of the Entomological Society of Washington 21:161- 170.

Gahan, A.B. 1930. Synonymical and descriptive notes on parasitic Hymenoptera. Proceedings of the United States National Museum 77:1-12.

Gause, G.F. 1932. Experimental studies on the struggle for existence. Journal of Experimental Biology 9:389-402.

Gavrilets, S. and Losos, J.B. 2009. Adaptive radiation: contrasting theory with data. Science 323:732-737.

Gavrilovic, V., Bush, G.L., Schwarz, D., Crossno, J.E. and Smith, J.J. 2007. Rhagoletis zephyria (Diptera: Tephritidae) in the Great Lakes basin: a native insect on native hosts? Ann Entomol Soc Am 100:475-482.

Gut, L.J. and Brunner, J.F. 1994. Parasitism of the apple maggot, Rhagoletis pomonella, infesting hawthorns in Washington. Entomophaga 39:41-49.

Lathrop, F.H. and Newton, R.C. 1933. The biology of Opuis melleus Gahan, a parasite of the blueberry maggot. Journal of Agricultural Research 46:143-160.

Lathrop, F.H. and Nickels, C.B. 1931. The blueberry maggot from an ecological viewpoint. Annals of the Entomological Society of America 24:260-281.

MacArthur, R.H. and Wilson, E.O. 1967. The theory of Island biogeography. Princeton University Press, Princeton, NJ.

Maier, C.T. 1981. Parasitoids emerging from puparia of Rhagoletis pomonella (Diptera: Tephritidae) infesting hawthorn and apple in Connecticut. The Canadian Entomologist 113:867-870.

May, R. 1999. Unanswered questions in ecology. Philosophical Transactions of the Royal Society Of London Series B-Biological Sciences 354:1951-1959.

Mayfield, M.M. and Levin, J.M. 2010. Opposing effects of competitive exclusion on the phylogenetic structure of communities. Ecology Letters 13:1085-1093.

Middlekauff, W.W. 1941. Some biological observations of the adults of the apple maggot and the cherry fruit flies. Journal of Economic Entomology 34:621-624.

Monteith, L.G. 1977. Additional records and the role of the parasites of the apple maggot Rhagoletis pomonella (Diptera: Tephritidae) in Ontario. Proceedings of the Entomological Society of Ontario 108:3-6.

Muesebeck, C.F.W. 1980. The Nearctic parasitic wasps of the genera Psilus Panzer and Coptera Say (Hymenoptera, Proctotrupoidea, Diapriidae). United States Department of Agriculture Techinical Bulletin 1617:1-71.

Muesebeck, C.F.W., Krombein, K.V. and Townes, H.K. 1951. Hymenoptera of America North of Mexico: Synoptic Catalog. U.S. Government Printing Office, Washington, D.C., USA.

Porter, B.A. and Alden, C.H. 1921. Anaphoidea conotracheli Girault, (Hym.), and egg parasite of the apple maggot. Proceedings of the Entomological Society of Washington 23:62-63.

Price, P.W. 1980. Evolutionary biology of parasites. Princeton University Press, Princeton, NJ.

Prokopy, R.J., Bennett, E.W. and Bush, G.L. 1971. Mating Behavior in Rhagoletis pomonella (Diptera: Tephritidae). I. Site of Assembly. Canadian Entomologist 103:1405-1409.

Prokopy, R.J., Bennett, E.W. and Bush, G.L. 1972. Mating Behavior in Rhagoletis pomonella (Diptera: Tephritidae). II. Temporal Organization. Canadian Entomologist 104:97-104.

Prokopy, R.J. and Roitberg, B.D. 1984. Foraging behavior of true fruit flies. American Scientist 72:41-49.

Prokopy, R.J. and Webster, R.P. 1978. Oviposition-deterring Pheromone of Rhagoletis pomonella: A kairomone for its parasitoid Opius lectus. Journal of Chemical Ecology 4:481-494.

Rull, J., Wharton, R., Feder, J.L., Gullien, L, Sivinski, J., Forbes, A.A. and Aluja, M. 2009. Latitudinal variation in parasitoid guild composition and parasitism rates of North American hawthorn infesting Rhagoletis. Environmental Entomology 38:588-599.

Schwarz, D., Matta, B.M., Shakir-Botteri, N.L. and McPheron, B.A. 2005. Host shift to an invasive plant triggers rapid animal hybrid speciation. Nature 436:546-549.

Stelinski, L L., Pelz, K.S. and Liburd, O.E. 2004. Field observations quantifying attraction of the parasitic wasp, Diachasma alloeum (Hymenoptera: Braconidae)

to blueberry fruit infested by the blueberry maggot fly, Rhagoletis mendax (Diptera: Tephritidae). Florida Entomologist 87:124-129.

Stireman, J.O., Nason, J.D., Heard, S.B. and Seehawer, J.M. 2006. Cascading host- associated genetic differentiation in parasitoids of phytophagous insects. Proceedings of the Royal Society of London, Series B., Biological Sciences 273:523-530.

Wharton, R.A. 1997. Generic relationships of Opiine Braconidae (Hymenoptera) parasitic on fruit-infesting Tephritidae (Diptera). Contributions of the American Entomological Institute 30:1-53.

Wharton, R A. and Marsh, P.M. 1978. New world Opiinae (Hymenoptera: Braconidae) parasitic on Tephritidae (Diptera). Journal of the Washington Academy of Science 68:147-167.

Xie, X., Rull, J., Michel, A., Velez, S., Forbes, A.A., Lobo, N., Aluja, M. and Feder, J.L. 2007. Hawthorn-infesting populations of Rhagoletis pomonella in Mexico and speciation mode plurality. Evolution 61:1091-1105.

CHAPTER 3:

SEQUENTIAL DIVERGENCE AND THE MULTIPLICATIVE ORIGIN OF

COMMUNITY DIVERSITY2

3.1 Abstract

Phenotypic and genetic variation in one species can influence the composition of interacting organisms within communities and across ecosystems. As a result, the divergence of one species may not be an isolated process, as the origin of one taxon could create new niche opportunities for other species to exploit, leading to the genesis of many new taxa in a process termed “sequential divergence.” Here, we test for such a multiplicative effect of sequential divergence in a community of host-specific parasitoid wasps, Diachasma alloeum, Utetes canaliculatus and Diachasmimorpha mellea

(Hymenoptera: Braconidae), that attack Rhagoletis pomonella fruit flies (Diptera:

Tephritidae). Flies in the R. pomonella species complex radiated by sympatrically shifting and ecologically adapting to new host plants, the most recent example being the apple-infesting host race of R. pomonella formed via a host plant shift from hawthorn- infesting flies within the last 160 years. Using population genetics, field-based behavioral observations, host fruit odor discrimination assays, and analyses of life history timing, we

2Chapter published as: Hood, G.R., Forbes, A.A., Powel, T.H.Q., Egan, S.P., Hamerlinck, G., Smith, J.J. and Feder, J.L. 2015. Sequential divergence and the multiplicative origin of community diversity. Proceedings of the National Academy of Sciences U.S.A. 112:E5980-5989. 41

show that the same host-related ecological selection pressures that differentially adapt and reproductively isolate Rhagoletis to their respective host plants (host-associated differences in the timing of adult eclosion, host fruit odor preference and avoidance behaviors, and mating site fidelity) cascaded through the ecosystem and induce host- associated genetic divergence for each of the three members of the parasitoid community.

Thus, divergent selection at lower trophic levels can potentially multiplicatively and rapidly amplify biodiversity at higher levels on an ecological time scale, which may sequentially contribute to the rich diversity of life.

3.2 Introduction

Population divergence is a fundamental evolutionary process contributing to the diversity of life (Coyne and Orr 2004). Studies of how new life forms originate typically focus on how barriers to gene flow evolve in specific lineages, resulting in their divergence into descendent daughter taxa. As a result, evolutionary biologists now have a good understanding of how variation within a population is transformed by selection into differences between taxa (Coyne and Orr 2004, Pinho and Hey 2010, Feder et al. 2013).

What is less well understood is whether the divergence of one population has consequences that ripple through the trophic levels of an ecosystem and effect entire communities of interacting organisms. Studies in paleontology (Butterfield 2001, Erwin

2008, Bush et al. 2011), community ecology (Emerson and Kolm 2005), systematics

(Strong et al. 1984, Mitter et al. 1988), and ecosystem genetics (Whitham et al. 2006,

2008) suggest that evolutionary change in one lineage can influence entire communities of organisms. For example, when the genotype/phenotype of a “foundation” species

influences the relative fitness of other species, evolutionary change(s) in this genotype/phenotype may affect organisms in adjacent trophic levels (Whitham et al.

2006, 2008). If these evolutionary changes are linked to ecological adaptation and reproductive isolation (RI), associated organisms may diverge in parallel, potentially creating entire co-evolved communities distinct from one another (Stireman et al. 2006,

Abrahamson and Blair 2008, Forbes et al. 2009, Feder and Forbes 2010). Therefore, population divergence may not always be an isolated process, as the differentiation of one taxon could beget the divergence of many others.

Such “sequential” or “cascading” divergence events may be particularly relevant to understanding why some groups of organisms, like plants, the insects that feed on them, and the parasitoids that attack the insects, are more diverse and species-rich than other groups (Mitter et al. 1988, Strong et al. 1984, Stireman et al. 2006, Abrahamson and Blair 2008, Forbes et al. 2009, Feder and Forbes 2010). Specifically, when phytophagous insects diversify by adapting to new host plants, they create a new habitat for their parasitoids to exploit (Fig. 3.1). If a parasitoid shifts to the new habitat it can encounter the same divergent ecological selection pressures as its insect host, which could result in the parallel divergence of insect host and parasitoid (Stireman et al. 2006,

Abrahamson and Blair 2008, Forbes et al. 2009, Feder and Forbes 2010) (Fig. 3.1A).

Moreover, sequential divergence may have multiplicative effects in generating biodiversity, as the shift of an insect to a new plant may open a new niche opportunity for not just for one, but the entire community of parasitoids attacking the insect host

(Abrahamson et al. 2008, Feder and Forbes 2010) (Fig. 3.1B). However, few convincing

)LJXUH7KUHHVFHQDULRVRIFRGLYHUJHQFHLQDKRVWSDUDVLWRLGV\VWHP $ $VLQJOH VHTXHQWLDOGLYHUJHQFHHYHQW % VHTXHQWLDOGLYHUJHQFHZLWKPXOWLSOLFDWLYHDPSOLILFDWLRQ RIELRGLYHUVLW\DQG & FRVSHFLDWLRQLQDOORSDWU\,QVFHQDULR$FRGLYHUJHQFHLVGULYHQ E\ WKH FDVFDGH RI GLYHUJHQW HFRORJLFDO VHOHFWLRQ SUHVVXUHV DFURVV WURSKLF OHYHOV LQ V\PSDWU\+HUHDGHJUHHRIGLYHUJHQWHFRORJLFDODGDSWDWLRQPXVWDFFRPSDQ\WKHKRVWVKLIW VXFKWKDWSDUDVLWRLGVDUHQRWPHUHO\PRYLQJEHWZHHQJHRJUDSKLFDOO\VHSDUDWHGKRVWV,Q VFHQDULR % WKH PXOWLSOLFDWLYH HIIHFWV RI VHTXHQWLDO GLYHUJHQFH FDQ EH VHHQ DV VHYHUDO PHPEHUVRIWKHSDUDVLWRLGFRPPXQLW\GLYHUJHLQSDUDOOHOZLWKWKHLUKRVW,QVFHQDULR& FRGLYHUJHQFH FRVSHFLDWLRQ RFFXUV DIWHU KRVW SODQW IO\ DQG SDUDVLWRLG SRSXODWLRQV EHFRPH MRLQWO\ JHRJUDSKLFDOO\ LVRODWHG EODFN EDU UHVXOWLQJ LQ SDUDOOHO DOORSDWULF VSHFLDWLRQ +HUH OLWWOH GLIIHUHQWLDWLRQ QHHG DFFRPSDQ\ WKH LQLWLDO KRVW VKLIW RI IO\ RU SDUDVLWRLG&RVSHFLDWLRQLVQRWQHFHVVDULO\GULYHQE\WKHFUHDWLRQDQGDGDSWDWLRQWRQHZ QLFKHV EXW E\ WKH FRQFRUGDQW JHRJUDSKLF DQG UHSURGXFWLYH VHSDUDWLRQ RI KRVWV DQG SDUDVLWRLGV

H[DPSOHVRIVHTXHQWLDOGLYHUJHQFHH[LVW 6WLUHPDQHWDO$EUDKDPVRQDQG%ODLU

)RUEHVHWDO)HGHUDQG)RUEHV DQGLQQRVWXG\LVWKHUHERWKJHQHWLF

DQGHFRORJLFDOHYLGHQFHIRUVHTXHQWLDOGLYHUJHQFHPXOWLSOLFDWLYHO\DPSOLI\LQJ

ELRGLYHUVLW\

+HUHZHWHVWIRUWKHPXOWLSOLFDWLYHHIIHFWVRIVHTXHQWLDOGLYHUJHQFHLQWKH

FRPPXQLW\RISDUDVLWRLGZDVSV +\PHQRSWHUD%UDFRQLGDH WKDWDWWDFNIUXLWIOLHVLQWKH

5KDJROHWLVSRPRQHOODVLEOLQJVSHFLHVFRPSOH[ 'LSWHUD7HSKULWLGDH )LJ 6HYHUDO

)LJXUH7KHFRPPXQLW\RIKRVWVSHFLILFSDUDVLWRLGVWKDWDWWDFNPHPEHUVRIWKH $ 5KDJROHWLV SRPRQHOOD VLEOLQJ VSHFLHV FRPSOH[ % 'LDFKDVPD DOORHXP & 'LDFKDVPLPRUSKDPHOOHDDQG ' 8WHWHVFDQDOLFXODWXVWKDW ( HPHUJHIURPWKHIO\ SXSDOFDVHDVDGXOWVIROORZLQJRYHUZLQWHULQJ6FDOHEDU PP

IHDWXUHVRIWKHELRORJ\DQGELRJHRJUDSK\RIWKH5KDJROHWLVSDUDVLWRLGV\VWHPPDNHLWDQ

LGHDOV\VWHPIRULQYHVWLJDWLQJWKHPXOWLSOLFDWLYHGLYHUJHQFHK\SRWKHVLVDQGDOORZXVWR

GLUHFWO\WHVWVHYHUDOFULWHULDVXSSRUWLQJV\PSDWULFKRVWUDFHIRUPDWLRQ 'UHVDQG0DOOHW

DQGVHTXHQWLDOGLYHUJHQFH $EUDKDPVRQDQG%ODLU VXPPDUL]HGLQ7DEOH

)LUVWFRQFHUQLQJWKHVSDWLDOFRQWH[WRIGLYHUJHQFH FULWHULRQ 5SRPRQHOODFRPSOH[

IOLHVKDYHIRUPHGLQWKHDEVHQFHRIJHRJUDSKLFLVRODWLRQ,QSDUWLFXODUWKHUHFHQW

V\PSDWULFVKLIWRI5SRPRQHOODIURPLWVDQFHVWUDOKRVWSODQWKDZWKRUQ &UDWDHJXVVSS

WRLQWURGXFHGGRPHVWLFDWHGDSSOH 0DOXVGRPHVWLFD LQWKHODVW\HDUVLVDQH[DPSOH

RIKRVWUDFHIRUPDWLRQLQDFWLRQ %HUORFKHUDQG)HGHU&R\QHDQG2UU0LFKHO

HWDO3LQKRDQG+H\)HGHUHWDO(JDQHWDO WKHK\SRWKHVL]HG

TABLE 3.1:

SUMMARY OF CONDITIONS (CRITERIA) CONDUCIVE TO AND SUPPORTING

HYPOTHESES OF SYMPATRIC HOST RACE FORMATION AND SEQUENTIAL

DIVERGENCE

Criteria supporting hypotheses of sympatric host Rp Da Dm Uc race formation and sequential divergence Criterion 1. Shift to new host resource and multiple host-associations occur in sympatry or close Yes Yes Yes Yes geographic proximity Criterion 2. Host-associated populations form distinct genetic clusters (spatially replicable), but experience Yes Yes Yes Yes gene flow at appreciable rates

Criterion 3. Females, but also potentially males, display host preferences and discriminate among Yes Yes Yes Yes alternate hosts

Criterion 4. Host choice is linked to mate choice facilitating assortative mating and resulting in Yes Yes Yes Yes prezygotic habitat isolation

Criterion 5. Host selection and fidelity are under some Yes; tested in Not Not degree of genetic control and not due solely to Yes one direction tested tested maternal, learning, or environmental effects

Criterion 6. Differences in insect phenologies tracks differences in the host phenologies resulting in Yes Yes Yes Yes temporal (allochronic) isolation

Criterion 7. Insect phenology under some degree of genetic control and not due solely to maternal or Yes Yes Yes Yes environmental effects

Criterion 8. Fitness tradeoffs exist between host- Yes some Not Not associated populations resulting in migrants and Not tested times tested tested hybrids having reduced fitness Note: Criteria conducive to sympatric host race formation modified from Dres and Mallet (2002) and sequential divergence modified from Abrahamson and Blair (2008) and Feder and Forbes (2010). Also shown is whether these criteria have been empirically tested and confirmed in Rhagoletis pomonella (Rp) species complex flies and three members of the parasitoid wasp community attacking the flies: Diachasma alloeum (Da), Diachasmimorpha mellea (Dm), and Utetes canaliculatus (Uc). Data for Da are from Forbes et al. (2009) and the current study (criterion 5).

initial stage of ecological speciation (Dres and Mallet 2002, Berlocher and Feder 2002).

The short time frame and sympatric spatial context of R. pomonella’s shift to apple exclude passive co-divergence or speciation (Fig. 3.1C) as an explanation for differentiation. Specifically, fly and wasp populations could not have diverged in concert because they became jointly geographically separated in the past (Fig. 3.1C). Rather, if flies and wasps display concordant adaptations, it is likely due to the direct effects of divergent ecological selection resulting from host shifts cascading from host plants to flies to parasitoids (Figs. 3.1A-B).

Second, the apple and hawthorn host races of R. pomonella belong to a closely related group of sibling species, including R. mendax (host: blueberry, Vaccinium spp.),

R. zephyria (host: snowberry, Symphoricarpos spp.) and the undescribed flowering dogwood fly (host: Cornus florida). All of these taxa purportedly radiated via sympatric host shifts (Bush 1969, Berlocher 2000, Berlocher and Feder 2002, Xie et al. 2008,

Michel et al. 2010, Powell et al. 2013, Egan et al. 2015). In addition, other species in the genus such as the eastern cherry fly, R. cingulata (host: black cherry, Prunus serotina) are sympatric with R. pomonella group flies (Bush 1969). Thus, the potential for sequential divergence in the Rhagoletis parasitoid community extends beyond the host races, with multiple co-occurring fly resources existing for wasps to attack, satisfying criterion 1.

Third, Rhagoletis in the eastern U.S. are attacked by a community of host specific endoparasitoid wasps that include the species Diachasma alloeum, Utetes canaliculatus and Diachasmimorpha mellea (Forbes et al. 2010, Hood et al. 2012) (Fig. 3.2). All three species have a free-living, sexually reproducing adult life stage. This life cycle eliminates

vertical transmission as a factor facilitating co-divergence. Utetes canaliculatus oviposits into Rhagoletis eggs laid beneath the skin of ripe fruit, while D. alloeum and D. mellea oviposit into late instar larvae feeding within fruit (Fobes et al. 2010). A degree of niche partitioning for oviposition sites therefore exists among species (Hood et al. 2012), potentially facilitating co-existence on the same fly host. As a result, multiple host associations of wasps exist in close geographic proximity, fulfilling the requirements of criterion 1 for sympatric race formation and sequential divergence for the wasp community as well.

In addition, a previous study documented that one parasitoid attacking Rhagoletis,

D. alloeum, is undergoing sequential divergence (Forbes et al. 2009). Population genetic surveys, field observations, behavioral assays of host choice, and studies of life history timing supported the existence of an ecologically derived population of D. alloeum attacking the recently formed apple-infesting host race of R. pomonella, meeting criteria

2, 3, 4, 6 and 7. We hypothesize that if U. canaliculatus and D. mellea are undergoing sequential divergence, they will show similar patterns of host-associated ecological and genetic divergence.

Two dimensions of divergent ecological selection generate reproductive isolation among host-associated populations of Rhagoletis and D. alloeum: host-specific mating

(habitat isolation) and differences in eclosion phenology (temporal isolation). With respect to habitat isolation, Rhagoletis (Prokopy et al. 1971, 1972) and D. alloeum

(Forbes et al. 2009) court and mate on or near the fruit of their respective host plants. The most important long-to-intermediate range cue that flies use to find and discriminate among plants are the volatile compounds emitted from the surface of ripening fruit (Feder

et al. 1994, Linn et al. 2003, Forbes et al. 2005). Flies display genetically-based behavioral preference for natal fruit surface volatiles and avoid the volatiles of alternative fruit (Feder et al. 1994). Similarly, D. alloeum prefer natal and avoid non-natal host fruit volatiles in behavioral assays (Forbes et al. 2009), supporting criterion 3. Consequently, differences in host choice translate directly to mate choice, generating prezygotic habitat- related RI for both flies and wasps, fulfilling criterion 4. Additionally, host odor discrimination may also act as a postzygotic barrier to gene flow in R. pomonella as they suffer behavioral host choice sterility mediated by a reduced chemosensory ability to find suitable host fruit for mating and oviposition (Linn et al. 2004). Whether or not hybrid D. alloeum display a similar behavior is unknown. Lastly, criteria 5 is partially met for

Rhagoletis as the host fruit environment has no effect on host odor discrimination behaviors for hawthorn-origin R. pomonella reared in apple fruit, indicating that host selection and fidelity are under (partial) genetic control (Linn et al. 2003, 2004). Similar experiments have not yet been conducted in D. alloeum (but see below).

With respect to temporal isolation (criterion 6), the timing of overwinter diapause is an important host-related ecological adaptation for Rhagoletis. The host plants of

Rhagoletis fruit at different times of the year (Filchak et al. 2000, Dambroski and Feder

2007, Egan et al. 2015). For example, apple varieties favored by R. pomonella ripen 3-4 weeks before native hawthorns in sympatry. Thus, flies must eclose to coincide with the availability of ripe fruit to find mates and oviposition sites. Rhagoletis are univoltine and their lifespan short (one month). Differences in eclosion timing between races therefore results in partial allochronic mating isolation (Feder et al. 1994, Filchak et al. 2000, Linn et al. 2004, Dambroski and Feder 2007, Egan et al. 2015). The differences in eclosion

timing also confer a degree of postzygotic isolation because hybrids will possess eclosion patterns asynchronous with fruit ripening (Feder et al. 1994, Filchak 2000, Dambroski and Feder 2007). Rhagoletis attacking blueberries and flowering dogwoods display similar differences in eclosion time related to variation in host fruiting phenology

(Dambroski and Feder 2007).

The life cycle of D. alloeum mirrors that of Rhagoletis, generating the same divergent ecological selection pressures. As a result, populations of D. alloeum attacking different Rhagoletis eclose to match the phenology of fly larvae feeding within host fruit

(Forbes et al. 2009). In addition, longevity of D. alloeum (~ 2 weeks) is half that of

Rhagoletis, generating even more pronounced allochronic mating isolation compared to the fly (Forbes et al. 2009), supporting criterion 6. Significant allele frequency differences between sympatric populations of D. alloeum attacking different fly hosts

(criterion 2) were associated with differences in eclosion time (Forbes et al. 2009), confirming criterion 7. The same has also been found for Rhagoletis (Filchak et al. 2000,

Dambroski and Feder 2007, Egan et al. 2015), connecting host-related life history adaptation and RI to patterns of genetic differentiation among flies and wasps.

Here, we test for the multiplicative hypothesis of sequential divergence in the

Rhagoletis-parasitoid system using the criteria in Table 3.1 to frame the experimental approach. For populations of U. canaliculatus and D. mellea attacking different

Rhagoletis we first assessed mtDNA sequence variation and conducted population genetics surveys using nuclear-encoded microsatellites to test for host-related genetic differentiation (criterion 2). Second, to test for host-plant related assortative mating caused by habitat isolation, we coupled field observations of mating behavior of U.

canaliculatus and D. mellea with tests of host odor discrimination, including preference for and avoidance of fruit surface volatile compounds (criteria 3 and 4). To determine if genetic effects contributed to host odor discrimination (criterion 5), we compared the behavioral responses of D. alloeum reared thorough non-natal fly and host plant environments to parental and non-natal host fruit volatiles. Third, to assess the degree of allochronic isolation due to variation in host phenology, we compared the timing of adult eclosion for U. canaliculatus and D. mellea attacking different fly populations in sympatry (criterion 6). Lastly, to link host-associated genetic differentiation to divergence in life history timing (criterion 7), we tested for associations between microsatellite genotypes and the timing of eclosion for U. canaliculatus and D. mellea. While host- associated fitness tradeoffs (criterion 8) have been inferred for several species of

Rhagoletis feeding in natal versus non-natal fruit (Bierbaum and Bush 1990, Ragland et al. 2015), difficulty in reciprocally transplanting wasps precludes these experiments at this time, but remain an area for future study.

3.3 Materials and Methods

3.3.1 Specimen Collection

Host fruit infested with parasitized flies were collected from nine sites in the eastern U.S. from 2006–2012 (Fig. 3.3; Table B.1). Six of these sites for U. canaliculatus and four for D. mellea represent locations where two or more Rhagoletis taxa were sympatric (< 1.5 km apart) or in close proximity (< 10 km apart). Infested fruit were sampled from host plants and the ground beneath plants during the summer and fall from

2006-2012. Fruit were transported to a greenhouse at the University of Notre Dame 51

)LJXUH &ROOHFWLRQ VLWHV IRU 8 FDQDOLFXODWXV DQG ' PHOOHD LQ WKH 0LGZHVWHUQ DQG 1RUWKHDVWHUQ 86 1XPEHUV FRUUHVSRQG WR WKH ORFDWLRQV GHVFULEHGLQ7DEOH%LQWKHDSSHQGL[

where they were placed on wire mesh racks in plastic collecting trays. The trays were monitored once daily for newly emerging larvae that left fruit and pupariated. Fly pupae were placed in Petri dishes filled with moist vermiculite and exposed to a pre-winter period of eight days at 21°C and a 14:10 L:D cycle in a constant temperature room. The

Petri dishes were then transferred to a refrigerator and overwintered at 4°C for 4 months.

After four months, the Petri dishes were removed from the cold and held in individual 15 cm × 15 cm × 25 cm plexiglass cages supplied with water and food (a mixture of honey and brewer’s yeast) inside a 24°C, 14:10 L:D cycle rearing chamber. Cages were monitored daily for fly and wasp eclosion. Upon eclosion, adult flies and wasps were sexed, wasps morphologically identified to species using the taxonomic keys of Wharton and Marsh 1978, Wharton (1979) and Wharton and Yoder (2015), and cold stored at -

80°C for genetic analysis. A portion of eclosing wasps were placed in separate cages and used to measure adult longevity and test for host odor discrimination (see below).

3.3.2 Genetic Methods

Genomic DNA was isolated from whole body tissue of individual adult wasps using Puregene extraction kits (Gentra Systems, Minneapolis, MN). Purified samples of

DNA were transferred to 96-well plates for PCR amplification, mtDNA sequencing, and microsatellite genotyping. Twenty and 21 pairs of unique microsatellite primers were developed for U. canaliculatus and D. mellea, respectively, from 454 whole-genomic sequencing of wasps reared from apple and hawthorn-infesting flies collected at Grant and Fennville, MI. Microsatellite loci were designated with the prefix “UC” for U. canaliculatus and “DM” for D. mellea, followed by a number indicating their original order of characterization (see Table B.2 for details of the microsatellites). We used 53

microsatellites because, compared to other types of markers, they have high mutation rates and levels of polymorphism, characteristics useful for revealing subtleties in population genetic structure associated with rapid and recent divergence.

We also PCR-amplified and sequenced a 540 bp region of the mtDNA

Cytochrome Oxidase subunit I (COI). Alleles at each locus were PCR amplified using a pair of locus-specific primers, one of which was fluorescently labeled. After an initial denaturation period of 5 min. at 94°C, DNA was amplified for 35 cycles, followed by a final extension for 10 min. at 72°C. The PCR products were then pooled into one of four groups, each of which was genotyped separately using Fragment Analysis v.3.4

(Beckman Coulter CEQ8000, Fullerton, CA, USA). We also PCR-amplified a 540 bp region of the mtDNA Cytochrome Oxidase subunit I (COI) for 130 U. canaliculatus

(GenBank accession numbers KT761291-KT761420) and 76 D. mellea (GenBank accession numbers KT761422 – KT761497) attacking various fly hosts at several sites as well as a single Diachasma alloeum (GenBank accession number KT761421) infesting hawthorn flies at Grant, MI to serve as an outgroup using universal primers developed by

Simon et al. (1994) and used for D. alloeum by Forbes et al. (2009). Purified PCR products were DNA sequenced on an ABI 3700 sequencer with the ABI Prism® BigDYE

Terminator v3.0 system (Applied Biosystems, Inc., Foster City, CA, USA).

3.3.3 Analysis of Genetic Data

Microsatellite loci were tested for conformity to Hardy-Weinberg equilibrium

(HWE) in females (diploid) using Markov chain randomization methods with default parameters in Micro-Checker (Van Oosterhout et al. 2004). Of the 41 microsatellites scored, no locus displayed significant deficiencies of heterozygosity in more than two 54

populations, implying markers represented single-copy sequences that did not possess high frequencies of null alleles. Furthermore, every haploid male possessed only a single allele for each microsatellite and we observed no obvious null allele at each locus. We estimated linkage disequilibrium (LD) between pairs of microsatellites separately for each host-associated population using Burrow’s composite ∆ (Weir 1979), which does not assume HWE or require phased data, but instead provides a joint metric of intra- and inter-locus disequilibria based solely on genotype frequencies. Thus, ∆ is equivalent to the LD parameter D under HWE (Weir 1979). We combined multi-locus haplotypes of individual males together at random based on their frequencies in a population to construct diploid genotypes in HWE to combine with females genotypes to estimate a single ∆ value for each population. These values were then transformed to a standardized correlation coefficient and combined across populations using the method of Fisher

(Sokal and Rohlf 2010) to derive overall measures that were tested for significance by chi-square tests, as described by Weir (1979). In general, LD was low between loci of both species, an indication that most markers were evolving independently. However, certain microsatellites did display significant LD, and these loci were: (1) arranged stepwise with one another to form arrays interconnecting the majority of markers genotyped for each species (Fig. 3.4), and (2) used in association with eclosion time relationships to pool alleles at loci for GLM analysis (see below).

We tested for a relationship between eclosion timing and microsatellite genotypes separately for males and females by a two-way ANOVA with genotype and host as main effects. The analyses were performed on the subset of individuals genotyped that were

)LJXUH/LQNDJHGLVHTXLOLEULXP /' HVWLPDWHVEHWZHHQSDLUVRIPLFURVDWHOOLWH ORFLJHQRW\SHGIRU $ 8FDQDOLFXODWXVDQG % 'PHOOHD7HVWFURVVHVDUHQRW FXUUHQWO\SRVVLEOHWRGHYHORSUHFRPELQDWLRQGLVWDQFHPDSVRUDVVLJQORFLWROLQNDJH JURXSV IRU WKHVH VSHFLHV :H WKHUHIRUH SUHVHQW /' HVWLPDWHV LQ WKH IRUP RI D QHWZRUNGHSLFWLQJVLJQLILFDQWSDLUZLVH%XUURZ¶VFRPSRVLWHGLVHTXLOLEULXPYDOXHV VPDOO QXPEHUV DORQJ EUDQFKHV EHWZHHQ VSHFLILF SDLUV RI PLFURVDWHOOLWHV ODUJH QXPEHUVDWWKHHQGQRGHVRIEUDQFKHV /RFL8&8&DQG8&GLGQRWGLVSOD\ VLJQLILFDQW/'ZLWKDQ\RWKHUPLFURVDWHOOLWHLQ8FDQDOLFXODWXVDQGDUHWKHUHIRUH GHVLJQDWHGDVXQOLQNHG6HH0DWHULDOVDQG0HWKRGVIRUGLVFXVVLRQRIFDOFXODWLRQRI %XUURZ¶VFRPSRVLWHGLVHTXLOLEULXPYDOXHV 3 3 3

also phenotyped for eclosion timing3. We concentrated on the sympatric pairs of wasps attacking hawthorn and apple flies, transforming the eclosion time for each individual by its standard deviation from the mean eclosion time for each sex at the site from which it was collected. Normalizing eclosion times allowed us to combine data across hosts and sites to test for genetic associations. We report the results for the main genotype effect and the genotype × host interaction because the host effect was significant in the

ANOVA for all loci. We also performed stepwise multiple regressions for all microsatellites against normalized eclosion times separately for females and males.

We tested for significant allele frequency differences between host-associated populations at sympatric sites using a non-parametric, Monte Carlo approach.

Microsatellite genotypes were randomly resampled with replacement from the combined data set for a locus at a site to determine the probability from 100,000 replicates of generating a Nei’s genetic distance D (Nei 1972) greater than the observed value between populations by chance. We also performed generalized linear model (GLM) analyses at sympatric sites to test for significant host and latitude effects on microsatellite allele frequencies for each species. For the GLM analyses, allele frequency was modeled as a quasi-binomial variable with host as a discrete factor and latitude as a continuous factor.

The GLM analysis required that we collapse the microsatellites to a diallelic dataset. To accomplish this, we pooled different combinations of alleles at each locus into two variant classes, using the diallelic combination that: (1) generated the highest level of LD

3See DRYAD Repository (http://datadryad.org/resource/doi:10.5061/dryad.5n72m) for all raw data presented herein including eclosion times, adult longevity and allele frequency tables. 57

with other loci (Fig. 3.4), and (2) explained the largest amount of variation in adult eclosion time (Table B.2), similar to Michel et al. (2010) and Powell et al. (2013).

We assessed the genetic relationships among populations for COI mtDNA by constructing maximum parsimony gene trees for U. canaliculatus and D. mellea using

PHYLIP 3.69 (Felsenstein 2005). Additionally, we examined relationships for the nuclear-encoded microsatellites by constructing unrooted neighbor-joining networks for

U. canaliculatus and D. mellea based on Nei’s pairwise genetic distances calculated between populations using PHYLIP 3.69 (Felsenstein 2005), with bootstrap support determined by 10,000 replicates across loci.

3.3.4 Field Observations of Mating Behavior

To determine the site of mating assembly for wasps, we conducted a total of 45 hours of field observations from early August to mid-September in 2011 and 2012 at two sites near Grant, MI and Fennville, MI where stands of apple and hawthorn trees co-occur following the methods described by Forbes et al. (2009). From two to four observers walked through a site during an observation period in search of adult U. canaliculatus and D. mellea. Many species of host-specific parasitoids that attack tephritids do not disperse great distances from their natal hosts, foraging and resting primarily on or near the fruit of their host flies (Jones et al. 1996). Therefore, to ensure an objective and unbiased survey of the distribution of wasps at the sites, we spent only 15 of the total 45 hours of observation focused on host trees themselves. For the remaining 30 hours, observers concentrated efforts searching on fruits and vegetation of non-Rhagoletis host plants within a ~ 30 meter radius from apple or hawthorn trees at these sites. 58

During the 15 hours that apple and hawthorn trees were surveyed, when an adult wasp was spotted its position on the plant and sex were noted and a stopwatch was started. The individual was then continuously monitored for a minimum of 5 minutes or until mating was initiated. If mating was initiated during the 5 minute period, the time and distance of the mating pair to the nearest host fruit were recorded, the pair collected, and morphologically identified to species level in the laboratory. Only observed individuals that initiated mating were included in subsequent analyses. A total of 23 mating pairs of U. canaliculatus were observed on apple (n = 9) and hawthorn (n = 14) trees, while 19 mating pairs of D. mellea were observed on apple (n = 11) and hawthorn

(n = 8) trees.

3.3.5 Host Odor Discrimination Testing

Synthetic fruit blends previously developed by coupling gas chromatography/mass spectrometry and electroantennographic detection (GC/MS-EAD), were used for odor testing flies infesting apple, hawthorn, and flowering dogwood that induce the same level of response as whole fruit extracts (Linn et al. 2003, Nojima et al.

2003a, 2003b, Forbes et al. 2005). Each blend consists of a suite of the behaviorally active chemical compounds emitted from the surface of the ripening host fruit (Nojima et al. 2003a, 2003b). In the current study we used apple, hawthorn, and flowering dogwood blends and whole fruit for blueberries (store bought Vaccinium corymbosum from

Michigan) and snowberries (field collected uninfested Symphoricarpos albus collected from Notre Dame, IN, USA). Whole fruit was not used for all behavioral assays because not all fruits keep well in the laboratory. 59

The behavioral response of each species to host fruit odors was assayed using a

Y-tube olfactometer following the methods of Forbes et al. (2009). The Y-tube, unlike the flight tunnel used in odor discrimination tests for R. pomonella (Linn et al. 2003,

2004), allows for the simultaneous assessment of preference and avoidance behaviors.

The olfactometer is a Y-shaped glass tube with a 250 mm long neck that measures 19 mm in internal diameter. The two 200 mm arms of the Y-tube are each attached to a 2000 ml

Erlenmeyer flask that houses fruit odor sources. Flasks were placed below a 0.8 cm × 1.5 cm piece of plywood to eliminate potential visual cues. Carbon filtered air carrying host fruit volatiles was split into each arm of the tube at a rate of 100 mL/min. The entire apparatus was attached to a plywood sheet held at 22 ± 2°C and positioned below a light source (34W Cool White light bulb) to induce parasitoid movement up the tube. To investigate geotaxis bias (i.e., preference for a particular arm of the Y-tube with no odor present) and establish a baseline value of orientation in the Y-tube for statistical analyses, we first conducted control treatments where both flasks were left odorless. To accomplish this, we placed a single three to six-day-old odor naïve individual 1 cm into the neck of the Y-tube. After five minutes, its position in the Y-tube was recorded (left arm, right arm or neck). We then repeated the process with one flask housing an odor source to determine if the individual oriented to either the arm containing no odor (avoidance), odor source (preference) or remained in the neck of the Y-tube. The process was then repeated with each individual tested once to each odor source on different days with the order and position of the fruit odors in the Y-tube (right or left arm) randomized. The odorless trials provided expected control frequencies for each wasp population to orient to the right arm, left arm, and neck of the Y-tube. These expected, control frequencies

were then compared to the observed (odor treatment) frequencies using a chi-square test to determine statistical significance (Forbes et al. 2009). Due to insufficient sample sizes, we pooled wasps having the same host fly association across sites and sexes for statistical analysis.

We calculated the degree of habitat isolation (HI) between pairs of wasp populations based on their fruit volatile responses in the Y-tube olfactometer using the formula from Powell et al. (2012, 2014). The formula measures behavioral overlap between two host-associated wasp populations x and y to each other’s fruit volatile compounds according to the formula:

p  p HI = 1 - x y 2 where px is the proportion of the wasp population from host fly x responding to the non-  natal fruit odor of host plant y, and py is the proportion of wasps from host fly y responding to the non-natal fruit odor of host plant x.

We also estimated total prezygotic reproductive isolation (PZtotal) between pairs of wasp populations attacking different hosts due to the combined effects of allochronic isolation (AI) and habitat isolation (HI) using methods similar to those described by

Ramsey et al. (2003). Estimates of total reproductive isolation take into account the absolute contribution of each barrier considering the reduction in gene flow already imposed by the barriers acting previously in the life cycle. The contribution of each barrier at two stages of the life cycle is calculated as:

PZ1 = AI, and (1)

PZ2 = HI(1-PZ1), and (2)

PZtotal = PZ1 + PZ2 (3) 61

where PZ1 is the reduction of inter-host migration for wasps attacking two different flies at a sympatric site, and PZ2 is the proportion of the remaining population that will avoid the alternate host given the opportunity during the period of seasonal overlap. Total prezygotic reproductive isolation (PZtotal) can then be calculated by summing across the absolute contributions of each barrier.

3.3.6 Cross-reared Diachasma

To test for environmental effects on host fruit odor discrimination, we reared D. alloeum collected from parasitized hawthorn and blueberry flies from Grant, MI and

Fennville, MI respectively for a single generation on apple flies infesting apple fruit in the laboratory and assayed the resulting adult offspring in the Y-tube olfactometer to parental versus apple fruit volatiles. In the summer of 2012, approximately 400 sexually mature apple-origin R. pomonella adults originally collected from Grant, MI in 2011 and overwintered in the laboratory were placed into a 60 cm × 30 cm × 30 cm plexiglass cage under a tented sheet in a greenhouse at the University of Iowa. Cages were stocked with artificial leaves and fly food. A variety of fresh, store bought apples including honey crisp, gala, and pink lady varieties were scrubbed with warm water to remove surface wax, pierced with insect pins to facilitate oviposition, and placed on raised platforms near the ceiling of the cages. After 5-6 days following signs of infestation, the apples were divided and moved to two new cages, where they were placed on top of raised platforms over trays of moist vermiculite. Following overwinter, approximately 150 adult D. alloeum emerging from hawthorn-infesting flies collected from Grant, MI, and 50 D. alloeum emerging from blueberry-infesting flies collected from Fennville, MI were 62

placed into separate cages containing maggot infested apples. The apples in the cages were washed daily with water to remove a known oviposition deterring pheromone deposited by D. alloeum on the surface of fruit (Stelinski et al. 2007). Rhagoletis larvae emerging from the apples fell into the vermiculite and pupated. The vermiculite in the cages was sifted weekly to collect pupae. The pupae were then overwintered for four months. A total of 22 hawthorn fly-origin and five blueberry fly-origin D. alloeum adults subsequently eclosed from the overwintered pupae and were tested for their responses to their parental (natal) versus non-natal apple fruit odors, as described above.

3.3.7 Eclosion Study

The timing of adult eclosion was determined by monitoring fly pupae once daily following overwinter for emerging flies and wasps. Eclosion curves for wasps were analyzed with Kolmogorov–Smirnov (KS) tests. Due to insufficient sample sizes, we pooled individuals from sympatric sites across years and sexes (there was minimal variation between sexes, populations, and years sampled). Also, due to insufficient sample size and quantity of DNA, U. canaliculatus attacking apples flies at site five were used in the eclosion analysis but pooled with site six (the nearest site < 30 km away) for microsatellite genotyping. Additionally, U. canaliculatus attacking flowering dogwood flies at sites 4 and 6 were pooled to represent a single “northern” population for microsatellite genotyping.

We also coupled estimates of adult longevity with eclosion timing to calculate the potential degree of temporal isolation (i.e., 1-percent overlap) of adults from pairs of sympatric populations. Adult longevity was calculated for individuals by measuring the 63

interval, in days, between adult emergence and death by monitoring individuals placed in wire mesh cages supplied with food and water (~ 10 wasps per cage) twice daily. We estimated the degree of allochronic isolation (AI) between pairs of wasp populations according to the formula:

xiyi AI = 1 - 2 2 xi  yi

where xi and yi are the proportions of wasps from populations x and y alive on day i based  on their eclosion curves and probabilities of survival to day i derived from the longevity estimates. We found no difference in adult longevity between sexes, populations, or host fly origin of U. canaliculatus and D. mellea.

3.4 Results and Discussion

3.4.1 mtDNA Divergence

To make a case for the sequential divergence of U. canaliculatus and D. mellea, it must be shown that populations attacking the derived apple fly do not represent unrecognized sibling species associated with different Rhagoletis. In this case, differences could be erroneously attributed to ecological adaptation following a recent sympatric host shift when, in fact, they represent older speciation events that potentially occurred in allopatry. To test for the existence of cryptic sibling species, we sequenced a

540 bp region of the mtDNA COI gene for specimens morphologically classified as U. canaliculatus and D. mellea attacking apple, hawthorn, blueberry, flowering dogwood, snowberry, and black cherry flies. The presence of sibling species would be indicated by diverged mtDNA haplotypes that, upon analysis using nuclear encoded microsatellites, 64

would identify as genetically distinct populations, implying an absence of gene flow.

A maximum parsimony gene tree of Utetes populations attacking apple, hawthorn, snowberry, and flowering dogwood flies indicated three distinct mtDNA haplotype groups distinguished by ≥ 19 nucleotide substitutions (Fig. 3.5A). Haplotype A was restricted to wasps attacking the flowering dogwood fly, while haplotype B was found only in wasps attacking flowering dogwood and a single population of snowberry flies from State College, PA (site 9). Haplotype C was most common, found in U. canaliculatus attacking flowering dogwood, apple, hawthorn and a single population of snowberry flies from East Lansing, MI (site 2). Thus, the possibility exists for three different cryptic Utetes sibling species, with haplotype C being the most informative for testing the sequential divergence hypothesis, attacking populations of all four Rhagoletis hosts parasitized by U. canaliculatus.

In contrast to U. canaliculatus, there was no evidence for a distinct mtDNA matrilineage among D. mellea attacking apple, hawthorn, blueberry or black cherry flies

(Fig. 3.5B). Similar to previous results from D. alloeum (Forbes et al. 2009), several haplotypes were found in D. mellea displaying low levels of sequence divergence (≤ 1%).

Haplotypes did not differentiate wasps in a host-specific manner and were generally shared among all populations. The pattern implies that host-associated populations of D. mellea are relatively recently derived, including those attacking apple flies, and rules out the presence of long established cryptic species.

)LJXUH0D[LPXPSDUVLPRQ\PW'1$&2,JHQHWUHHVIRU $ 8FDQDOLFXODWXV DQG % ' PHOOHD DWWDFNLQJ KDZWKRUQ UHG DSSOH JUHHQ EOXHEHUU\ EOXH IORZHULQJGRJZRRG \HOORZ VQRZEHUU\ ZKLWH DQGEODFN FKHUU\ EODFN IOLHV 7KHWKUHHPDMRUKDSORW\SHVLGHQWLILHGIRU8FDQDOLFXODWXVDUHGHVLJQDWHG$%DQG & (DFK WUHH LV URRWHG ZLWK WKH RXWJURXS WD[RQ ' DOORHXP 1RQSDUHQWKHWLF QXPEHUVQH[WWRHDFKFLUFOHLQGLFDWHFROOHFWLQJVLWH VHH7DEOH%DQG)LJIRU VLWH GHVLJQDWLRQV 1XPEHUV LQ SDUHQWKHVHV LQGLFDWH WKH QXPEHU RI LGHQWLFDO KDSORW\SHV VHTXHQFHG DW HDFK FROOHFWLQJ VLWH 7KH QXPEHU RI QXFOHRWLGH VXEVWLWXWLRQV HYROXWLRQDU\VWHSV DQGERRWVWUDSVXSSRUWEDVHGRQUHSOLFDWHV LQSDUHQWKHVHV DUHJLYHQDERYHORQJHUEUDQFKHV

3.4.2 Microsatellite Differentiation

The pattern of microsatellite differentiation for 20 loci suggested the existence of three cryptic species of Utetes likely having diverged prior to the introduction of apples to North America ~ 400 ya and the shift of R. pomonella to apples within the last 160 years. The three genetic clusters observed in the microsatellite genetic distance network

(Fig. 3.6) corresponded exactly to the three major mtDNA haplotypes (Fig. 3.5A).

Populations defined by mtDNA haplotypes A, B, and C each possessed alleles displaying high frequency differences or private variants at many loci. For example, allele 173 at locus UC57 ranged in frequency from 0.45-0.76 among haplotype C wasp populations, was absent in haplotype B, and present at low frequency (~ 0.06) in haplotype A. Thus, all subsequent analyses of U. canaliculatus focused on the widespread mtDNA haplotype

C populations to test for recent sequential divergence.

Within haplotype C, significant microsatellite differentiation was observed among populations of U. canaliculatus attacking snowberry, flowering dogwood, hawthorn, and apple flies. No fixed or high frequency private allele was found for any of the 20 microsatellite loci that distinguished wasps attacking different fly hosts. Instead, populations shared major alleles in common that differed in frequency, implying that differentiation among populations is likely of relatively recent origin with on-going (or recently ceased) gene flow. Significant allele frequency differences were observed in each of the six sympatric pairwise comparisons between wasps attacking different fly hosts (Table B.3). Seven loci (UC8, 10, 12, 16, 22, 47, 54) displayed pronounced and consistent differences (of similar magnitude and in the same direction) across at least three pairwise sympatric comparisons (Table B.3). Similarly, GLM analyses identified

)LJXUH 1HLJKERUMRLQLQJ JHQHWLF GLVWDQFH QHWZRUN EDVHG RQ 1HL¶V ' IRU PLFURVDWHOOLWHORFLJHQRW\SHGIRU8WHWHVEHORQJLQJWRPW'1$KDSORW\SHFODVVHV$% DQG & DWWDFNLQJ KDZWKRUQ UHG DSSOH JUHHQ IORZHULQJ GRJZRRG \HOORZ RU VQRZEHUU\ ZKLWH IOLHV(DFKQRGHUHSUHVHQWVSRROHGPLFURVDWHOOLWHGDWDDFURVVVLWHV IRU KRVWDVVRFLDWHG SRSXODWLRQV RI ZDVSV EHORQJLQJ WR HDFK RI WKH WKUHH PW'1$ KDSORW\SHFODVVHVGHSLFWHGLQ)LJ$1XPEHUVRQEUDQFKHVUHSUHVHQWERRWVWUDS VXSSRUWYDOXHVEDVHGRQUHSOLFDWHVDFURVVORFL

seven loci (UC8, 12, 14, 32, 47, 52, 53) showing a significant host effect across the five sympatric paired sites of wasps attacking apple and hawthorn flies (Table B.4). There was little evidence for a major effect of geography in the GLM analysis, as only two loci

(UC14, 61) had a significant latitude and/or host × latitude effect (Table B.4). This result contrasts with previous findings for R. pomonella (Filchak et al. 2000, Michel et al. 2010) and D. alloeum (Forbes et al. 2009) where latitudinal variation was pronounced. Thus, the direction and magnitude of host-related allele frequency differences were more consistent across sites for U. canaliculatus than for R. pomonella or D. alloeum. As a result, a neighbor joining (NJ) genetic distance network based on all 20 microsatellites distinguished populations attacking apple, hawthorn, flowering dogwood, and snowberry flies (Fig. 3.7). Apple and hawthorn fly attacking wasps were positioned adjacently in the network, consistent with the apple fly-attacking populations having originated via a recent shift from hawthorn flies. While a shift of U. canaliculatus from the snowberry to apple fly cannot be completely discounted, this scenario appears unlikely because: (1) the genetic distance of apple to snowberry fly attacking wasps is greater than that to hawthorn fly-attacking wasps, and (2) populations of the snowberry fly are relatively rare and present at low densities in the eastern U.S. compared to R. pomonella (Gavrilovic et al. 2007).

The pattern of microsatellite differentiation for 21 microsatellite loci for D. mellea also supported the existence of a recently derived population attacking apple flies.

Similar to U. canaliculatus, D. alloeum (Forbes et al. 2009), and R. pomonella (Filchak et al. 2000, Michel et al. 2010, Powell et al. 2013), no fixed or high frequency private alleles were found that distinguish D. mellea populations attacking different fly hosts.

)LJXUH 1HLJKERUMRLQLQJ JHQHWLF GLVWDQFH QHWZRUNV RI 1HL¶V ' EDVHG RQ DOO PLFURVDWHOOLWHORFLIRU $ 8FDQDOLFXODWXVDQG % 'PHOOHDDWWDFNLQJKDZWKRUQ UHG DSSOH JUHHQ EOXHEHUU\ EOXH IORZHULQJGRJZRRG \HOORZ VQRZEHUU\ ZKLWH DQG EODFNFKHUU\ EODFN IOLHV%RRWVWUDSVXSSRUWYDOXHVEDVHGRQUHSOLFDWHV DFURVV ORFL DUH JLYHQ DORQJ EUDQFKHV 1XPEHUV QH[W WR RU LQVLGH FLUFOHV LQGLFDWH FROOHFWLQJ VLWHV VHH 7DEOH % DQG )LJ IRU VLWH GHVLJQDWLRQV 7KH QRGH RI 8 FDQDOLFXODWXVODEHOHG³1´UHIHUVWRDQRUWKHUQSRSXODWLRQRIZDVSVDWWDFNLQJIORZHULQJ GRJZRRGWKDWZDVSRROHGDFURVVPXOWLSOHFROOHFWLQJVLWHV

However, significant and consistent allele frequency differences were observed for eight loci (DM19, 32, 42, 48, 51, 61, 62, 65) in at least three sympatric pairwise comparisons between D. mellea attacking different fly hosts (Table B.3). GLM analyses revealed four loci (DM14, 15, 25, 61) displaying a significant host effect across the four sympatric pairs of apple and hawthorn fly attacking wasp populations (Table B.4). Unlike U. canaliculatus but similar to Rhagoletis (Filchak et al. 2000, Michel et al. 2010, Powell et al. 2013) and D. alloeum (Forbes et al. 2009), a high proportion (28.6%) of loci (DM1, 6,

14, 15, 19, 28) showed a significant host × latitude effect for D. mellea (Table B.4). A NJ network based on all 21 loci clustered all apple fly-attacking D. mellea separately from populations parasitizing hawthorn, blueberry, and black cherry flies (Fig. 3.7B). Similar to previous findings for D. alloeum (Forbes et al. 2009), the network suggested that D. mellea attacking blueberry flies could be the source of the population parasitizing apple flies. However, this conclusion is preliminary because: (1) only a single population of D. mellea attacking blueberry flies was genotyped in the study, (2) at the sympatric site in

Fennville, MI, more loci displayed significant differences between wasps attacking blueberry and apple flies (7 loci) than between blueberry and hawthorn flies (2 loci), and

(3) D. mellea is a relatively rare parasitoid of blueberry flies (Forbes et al. 2010, Hood et al. 2012). Thus, a hawthorn or black cherry fly ancestry cannot be discounted.

The origins of recently formed apple fly-attacking parasitoids still need to be established. Genetic results imply that apple-infesting populations of D. alloeum are genetically more closely related to wasps parasitizing the blueberry fly, R. mendax, than the hawthorn-infesting race of R. pomonella (Forbes et al. 2009). While inferences can be made regarding the origin of the apple infesting populations of U. canaliculatus and D.

mellea, the genetic results are more ambiguous than for D. alloeum. Regardless,

Rhagoletis and its parasitoids may not always co-speciate in a strict 1:1 follow the leader fashion. Wasps attacking different flies in the community may take advantage of the new niche opportunity provided by Rhagoletis host shift not necessarily just the parasitoid infesting ancestral fly hosts. Thus, adaptive starbursts of sequential divergence may be the result of biodiversity radiating from several different origins within the community.

Regardless, the genetic results support criterion 2 and multiplicative sequential divergence by establishing the existence of host-associated genetic differentiation among both U. canaliculatus and D. mellea.

3.4.3 Site of Mating Assembly

Field observations of mtDNA haplotype C U. canaliculatus in stands of apple and hawthorn trees confirmed the use of host fruit as the site of mating assembly. A total of

23 mating pairs were detected over 45 hours. Eleven of the 23 mating pairs (48%) were detected directly on apple or hawthorn fruit, while the remaining 12 pairs (52%) were observed on branches or leaves an average of 8.52 ± 2.11 cm from the nearest host fruit

(range = 5-30 cm). The mean time from the first observation of a male and female to the initiation of mating was 143 ± 19 s (range = 4-411 s). No mating pair or individual U. canaliculatus was observed on any non-Rhagoletis plant, underscoring the host-specific nature of mating.

Field observations of D. mellea in stands of apple and hawthorn trees also confirmed the use of host fruit as the site of mating assembly similar to U. canaliculatus,

D. alloeum (Forbes et al. 2009), and R. pomonella (Prokopy et al. 1971). A total of 19 mating pairs were observed over 45 hours. Five of the 19 mating pairs (26%) were 72

detected directly on apple or hawthorn fruit, while the remaining 14 pairs (74%) were seen on branches or leaves an average of 12.37 ± 3.25 cm from the nearest host fruit

(range = 3-45 cm). The mean time from first observation to initiation of mating was 209

± 35.1 s (range = 12-516 s). No mating pair or individual D. mellea was observed on any non-Rhagoletis plant.

We did not detect a single wasp in the field survey outside the immediate vicinity of apple or hawthorn trees on a non-host plant in the 30 hours of observation. Failure to find wasps on non-host vegetation and fruit was not due to the parasitoids being inconspicuous. A Rhagoletis fly is about 10 times the mass of a Drosophila and as wasps do not consume their fly hosts until they have reached their full size as pupae, the wasps can be nearly as large in size (but not weight) (Fig. 3.2). Additionally, D. mellea and U. canaliculatus are brightly colored (red and dark red/black respectively) and contrast against foliage and fruit of plants (Fig. 3.2). The wasps are also highly active in flight.

Consequently, the wasps are easily spotted flying near or resting on vegetation at a distance of several meters. In addition, flies are highly parasitized at these sites, therefore we would have observed wasps on non-host plants if they were present. We also note that because many species of Rhagoletis are agricultural pests, the biology and natural history of their parasitoids is well-studied. We are not aware of a documented observation of wasps on a non-Rhagoletis host. Nevertheless, we cannot completely rule out the possibility that occasionally wasps do occur and initiate mating on non-host plants.

3.4.4 Host Plant Odor Discrimination

Results from Y-tube behavioral assays supported the existence of divergent host choice based on fruit odor discrimination in U. canaliculatus similar to Rhagoletis (Linn 73

et al. 2003, 2004) and D. alloeum (Forbes et al. 2009). Wasps displayed no tendency to orient to the right or left arm of the Y-tube when no fruit odor was present (2 =1.2; P =

0.27). However, odor-naïve, mtDNA haplotype C U. canaliculatus reared from snowberry, flowering dogwood, apple, and hawthorn flies all preferentially oriented to the arm of the Y-tube containing their respective natal fruit volatiles compared to the odorless control arm (Fig. 3.8; Table B.5). Wasps also avoided the odors of alternative fly hosts, orienting less often to non-natal fruit volatiles compared to the odorless control

(Fig. 3.8; Table B.5).

Figure 3.8: Host fruit odor discrimination of (A) D. alloeum, (B) U. canaliculatus, and (C) D. mellea. Values represent the percent increase (preference) or decrease (avoidance) in the orientation of wasps to the arm of the Y-tube containing different host fruit volatiles relative to the blank (odorless) control arm. Each host associated population of wasps displayed avoidance behavior to all non-natal fruit odors. We therefore averaged avoidance values  SE (gray bars) across all non-natal fruit assays (see Table B.5 for individual values and statistical significance). Data for D. alloeum taken from Forbes et al. (2009). *P = 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001. 74

Results from behavioral assays also supported the existence of divergent host choice in D. mellea as well. Wasps showed no tendency to orient to either arm of the Y- tube when no fruit odor was present (2 =0.10; P = 0.76). However, odor-naïve D. mellea attacking apple, hawthorn, blueberry, and black cherry flies all preferred their respective natal host fruit volatiles and avoided non-natal fruit odors compared to the odorless control arm (Fig. 3.8; Table B.5).

In many models of ecological speciation (Berlocher and Feder 2002, Dres and

Mallet 2002, Coyne and Orr 2004, Abrahamson and Blair 2008, Feder and Forbes 2010) including R. pomonella (Bush 1969, Feder et al. 1994, Berlocher 2000), host choice and mate choice (the site where courtship and mating occurs) are linked, generating habitat- related prezygotic RI among diverging populations. When coupling the results from host fruit odor discrimination assays and field observations, the same is true for the community of wasps attacking different Rhagoletis hosts, supporting criteria 3 and 4 and multiplicative sequential divergence. We estimate that fruit odor discrimination potentially translates into ≥ 84% prezygotic RI among U. canaliculatus attacking different Rhagoletis hosts at sympatric sites (Table 3.2). Similarly, estimates for D. mellea ranged from 68-88% across populations (Table 3.2).

We caution, however, that observations of site of mating may be skewed unintentionally by observers bias by focusing on locations in the field where insects are more likely to be present (on host fruit) than not (on other non-host plant tissue). Thus, it is possible that we missed mating pairs behaving in a non-host specific manner, thereby overestimating the importance of host choice and RI. However, more time was spent surveying non-host plants (30 hours) than host trees (15 hours) for parasitoids. Moreover,

TABLE 3.2:

PAIRWISE ESTIMATES OF HABITAT ISOLATION (1 - % BEHAVIORAL

OVERLAP) DUE TO DIFFERENCES IN FRUIT ODOR DISCRIMINATION

BEHAVIOR CALCULATED BETWEEN WASPS ATTACKING DIFFERENT HOST

POPULATIONS OF RHAGOLETIS.

Host Habitat isolation comparison Da Uc Dm A vs. H 69% 85% 77% A vs. B 68% 68%

A vs. S 79% 84% A vs. C 85% A vs. D 89% H vs. B 74% 77% H vs. S 56% 85% H vs. C 88% H vs. D 85% B vs. S 66% B vs. C 79%

S vs. D 85%

Note: Species abbreviations: Da = D. alloeum; Uc = U. canaliculatus; Dm = D. mellea; A = apple flies; H = hawthorn flies; S = snowberry flies; B = blueberry flies; C = black cherry flies. Estimates for Da are calculated from host odor discrimination estimates from Forbes et al. (2009). all the wasps are conspicuous in color and large compared to other parasitoids (Fig. 3.2B-

E). Consequently, wasps or mating pairs residing on a non-host plant would have likely been observed if present.

In the current study, we reared 22 hawthorn fly-origin and five blueberry fly- origin D. alloeum through a single generation in R. pomonella infesting apples. Both hawthorn and blueberry-origin D. alloeum retained their preferences for their respective natal host fruit odors, while avoiding apple volatiles (Fig. 3.9; Table B.5). Thus, rearing

VWXGLHVVXSSRUWDJHQHWLFEDVLVIRUEHKDYLRUDOGLIIHUHQFHVLQKRVWIUXLWRGRUGLVFULPLQDWLRQ

IRU5KDJROHWLV /LQQHWDO DQG'DOORHXP )RUEHVHWDO VXSSRUWLQJ

SDUWLDOO\FULWHULD

)LJXUH+RVWRGRUGLVFULPLQDWLRQRIKDZWKRUQDQGEOXHEHUU\IO\RULJLQ'DOORHXP UHDUHG IRU D VLQJOH JHQHUDWLRQ RQ DSSOHLQIHVWLQJ 5 SRPRQHOOD LQ DSSOH IUXLWV 9DOXHV UHSUHVHQWWKHSHUFHQWLQFUHDVH SUHIHUHQFH RUGHFUHDVH DYRLGDQFH LQWKHRULHQWDWLRQRI KDZWKRUQRULJLQRUEOXHEHUU\RULJLQ'DOORHXP WRWKHDUPRIWKH<WXEHROIDFWRPHWHU FRQWDLQLQJWKHLQGLFDWHGKRVWIUXLWRGRUUHODWLYHWREODQNRGRUOHVVFRQWUROWUHDWPHQW 3 3

$WSUHVHQWZHFDQQRWUHDU8FDQDOLFXODWXVRU'PHOOHDLQDOWHUQDWHIO\KRVWVWR

WHVWIRUHQYLURQPHQWDORUPDWHUQDOHIIHFWVRQIUXLWRGRUGLVFULPLQDWLRQDVKRUWFRPLQJRI

RXUUHVXOWVDQGLPSRUWDQWDYHQXHIRUIXWXUHUHVHDUFK+RZHYHUH[DPSOHVRIODUYDO

FRQGLWLRQLQJDIIHFWLQJDGXOWSUHIHUHQFHDUHUDUHIRUKRORPHWDERORXVLQVHFWV %DUURQ

DQGZKHQIRXQGXVXDOO\LQYROYHFDVHVZKHUHMXYHQLOHOLIHVWDJHVFRPHLQGLUHFWFRQWDFW

ZLWKSODQWWLVVXHVGXULQJGHYHORSPHQW 7XUOLQJVHWDO 1HYHUWKHOHVVLQVWDQFHVGR

H[LVWLQZKLFKSDUDVLWRLGVOHDUQFXHVIURPWKHLULQVHFWKRVW 6WRUHFNHWDO )RU

H[DPSOHWKHEUDFRQLGZDVS$SKLGLXVFROHPDQLOHDUQVQDWDOKRVWSUHIHUHQFHE\

antennating the mummy of its aphid host following adult emergence. If A. colemani are dissected from their hosts prior to adult emergence and allowed to complete development, natal host preference is reduced. While we cannot completely discount such effects for D. mellea and U. canaliculatus, they are unlikely to be major contributors to host choice for these wasps. In this regard, U. canaliculatus and D. mellea are endoparasitoids that oviposit into fly eggs and larvae, respectively, in fruit. Wasp larvae do not feed on their Rhagoletis hosts until larvae have left fruit and pupariated in the soil.

Thus, wasps do not come in direct contact with the surface volatiles of ripening host fruit prior to returning to their respective host fruit to mate and oviposit as adults the following year. In addition, wasps eclose as adults from fly pupal cases buried in the soil for > 300 days. Following eclosion, flies must move quickly to the soil surface or be trapped underground, therefore making it difficult for wasps to antennate fly pupal cases for host cues. Moreover, any volatile compound from the surface of ripe fruit, even if originally present (which is unlikely as fly larvae do not consume the skin of fruit, but the flesh which is chemically different), would have long since dissipated from the pupal case and surrounding soil. Furthermore, it is unlikely wasps would also learn to avoid odors emitted from non-natal fruits from exposure to the natal host fly pupal case or a similar host-related stimuli only. Thus, the biologies of U. canaliculatus and D. mellea suggest that fruit odor discrimination may be (partially) genetically based, as is the case for

Rhagoletis (Linn et al. 2003, 2004) and D. alloeum (Forbes et al. 2009).

3.4.5 Eclosion Timing

Eclosion curves differed significantly among mtDNA haplotype C U. canaliculatus attacking different fly hosts at sympatric sites, tracking the eclosion times 78

of their Rhagoletis hosts and the fruiting times of their respective host plants (Figs. 3.10,

3.11; Table B.6). The one exception was at Dowagiac, MI where eclosion times of U. canaliculatus infesting apple (102.83 ± 1.05 days; n = 35) and hawthorn (102.71 ± 1.18 days; n = 38) flies did not differ (Fig. 3.11; Table B.6). Interestingly, similar results were previously found for both R. pomonella and D. alloeum at this site (Table B.6) (Forbes et al. 2009). Mean adult longevity for U. canaliculatus was 9.54 ± 0.18 days (n = 167) in the laboratory. Assuming Utetes have the same life span in nature (likely an overestimate), we estimate that the observed differences in eclosion time translate into allochronic prezygotic RI between host-associated populations of U. canaliculatus at all sites (excluding Dowagiac, MI) (11-96%) (Table 3.3).

Eclosion curves for D. mellea also differed significantly among populations attacking different fly hosts at sympatric sites (Figs. 3.10, 3.11; Table B.6). Mean adult longevity for D. mellea was 12.21 ± 0.30 days (n = 67) in the laboratory. We estimate that the differences in eclosion times translate into prezygotic RI between host-associated populations of D. mellea at all sites (12-55%) (Table 3.3). Given that wasps may not reach sexual maturity till several days after adult eclosion, temporal isolation among host-associated populations of all three species of parasitoids may been greater in nature that what these estimates given here suggest.

3.4.6 Genetic Correlations with Eclosion Time.

Eight loci in females (UC10, 12, 14, 18, 47, 52, 59, 60) and eight in males (UC14,

32, 48, 52, 53, 54, 59, 60) displayed significant genotype or genotype × host effects with eclosion time (Table B.7). Of these loci, six showed a significant host effect between wasps attacking apple and hawthorn flies in GLM analyses (Table S3), linking the pattern 79

)LJXUH0HDQHFORVLRQWLPHVDYHUDJHGDFURVVFROOHFWLQJVLWHVIRU5KDJROHWLV FLUFOHV LQIHVWLQJ EOXHEHUU\ EOXH DSSOH JUHHQ VQRZEHUU\ ZKLWH EODFN FKHUU\ EODFN KDZWKRUQ UHG DQGIORZHULQJGRJZRRG \HOORZ KRVWSODQWVDQG'DOORHXP VTXDUHV 8FDQDOLFXODWXV WULDQJOHV DQG'PHOOHD GLDPRQGV DWWDFNLQJHDFKIO\KRVW'DWDIRU 'DOORHXPDUHIURP)RUEHVHWDO 6HH7DEOH%IRULQGLYLGXDOVLWHYDOXHVr6(

Figure 3.11: Cumulative eclosion curves for (A-F) U. canaliculatus, and (G-J) D. mellea attacking hawthorn (red), apple (green), blueberry (blue) snowberry (white) and black cherry (black) flies. Significance was assessed by Kolmogorov- Smirnov tests. See Table B.6 for means ± SE of eclosion times.

81 Pattern of genetic differentiation with an important host-related adaptation causing prezygotic RI. Overall, a significant stepwise multiple regression was found between seven loci for females (r = 0.49; P < 0.0001) and six for males (r = 0.40; P = 0.03) with eclosion time. Similar relationships between multiple microsatellites and eclosion time were found for Rhagoletis (Michel et al. 2010, Powell et al. 2013) and D. alloeum

(Forbes et al. 2009).

Three microsatellite loci for females (DM18, 25, 61) and five loci for males

(DM18, 19, 28, 33, 36) displayed significant genotype or genotype × host effects with eclosion time (Table B.7). Of these loci, two displayed a significant host effect between apple and hawthorn fly attacking wasps in GLM analyses (Table B.4). Consequently, evidence supporting criteria 6 and 7 was found for both D. mellea and U. canaliculatus.

However, unlike U. canaliculatus, D. alloeum (Forbes et al. 2009), and R. pomonella

(Michel et al. 2010, Powell et al. 2013), stepwise multiple regressions revealed no significant relationship between microsatellites and eclosion time for female or male D. mellea.

3.5 Conclusions

The concept that “biodiversity begets biodiversity” is deeply engrained in biology

(Butterfield 2001, Emerson 2005, Stireman et al. 2006, Abrahamson and Blair 2008,

Erwin 2008, Forbes et al. 2009, Feder and Forbes 2010, Bush et al. 2011). Sequential divergence has been proposed to help explain a number of diverse patterns including radiations following mass extinctions (Butterfield 2001, Erwin 2008, Bush et al. 2011), species diversity in the tropics (Emerson 2005), and macro-evolutionary patterns of

Dm 4% vs. 12% 21% 67% 21% 13% 22% 17%

9% 8% vs. 74% 18% 37% 19% 51%

Between species comparisons species Between vs.

74% 85% 21% 40% 53% 31% 85% 11% 30% 31% Da

S AT SYMPATRIC SITES SYMPATRIC AT B H H A H A H A H A H A Host

Dm 21% 16% 55% 12% 54% 33% 38% 17% RHAGOLETIS TABLE 3.3: TABLE

Uc 3% 11% 30% 52% 47% 15% 28% 96%

5% Da 5% 53% 17% 34% 30% 29% 75%

Within comparisons species

ATED POPULATIONSATED OF s. B A vs. H A vs. H A vs. H A vs. C H vs. C A vs. H Host comparison A vs. H A vs. H A vs. S H vs. S A vs. H A vs. B H v ASSOCI

RWISE ESTIMATESRWISE OF HOST- WASPS CALCULATED TEMPORAL BETWEEN ISOLATION ATTACKING Dowagiac, MIDowagiac, Oaks, MIThree S.IN Bend, Urbana, IL Location MIGrant, MIE. Lansing, MIFennville,

PAI 5 6 7 3 4 1 2 Site Site No.

83 diversification in herbivorous insects (Strong et al. 1984, Mitter et al. 1988). However, the process has rarely been explicitly studied. Here, we document, for the first time, to our knowledge, the genetic signatures of and ecological mechanisms promoting rapid, sequential divergence for three phylogenetically distinct species as the same host-related ecological adaptations associated with host choice and life history timing in Rhagoletis appear to have evolved concordantly in the wasps.

We caution, however, that our results represent a single datum. Additional studies are needed to assess how common and taxonomically widespread sequential divergence is and evaluate its importance for generating patterns of biodiversity and understand how novel guilds or communities may be assembled de novo. Conditions promoting sequential divergence (Table 3.1; Fig. 3.1) may not be common for many species and difficult to empirically test. Regardless, even if sequential divergence is rare, it could still, through a multiplicative effect, make a non-trivial contribution to the origin of new taxa. Thus, for organisms such as insects and their parasites that experience and partition resources on a fine scale (Bush 1993), the effects of new niche construction may cascade through ecosystems and have an important effect on biodiversity. Given the existence of an estimated 10-30 million plant-feeding insect species, (Price 1980), that each phytophagous insect is likely attacked by ≥ 1 parasitoid (Hawkins and Lawton 1987), and that host-specific parasitoids account for an estimated 25% of insects, sequential divergence may be an underappreciated process (Stireman et al. 2006, Abrahamson and

Blair 2008, Forbes et al. 2009, Feder and Forbes 2010).

Additional concerns regarding sequential divergence require clarification. In a previous study, Forbes et al. (2009) associated sequential divergence with sympatric

84 divergence-with-gene-flow (criterion 1). This need not always be the case. The critical element is that divergent ecological selection pressures transcend trophic levels to generate new biodiversity. Thus, sequential divergence may occur in any geographic context. For example, sequential divergence is also possible in allopatry if the evolution of RI is driven by adaptation to a new host following migration of a parasite into a different geographic area (Fig. 3.1C). However, verifying that the cause for population divergence was due to the cascading effects of selection from plant, to insect, to parasitoid, as opposed to genomic conflict and RI arising as an inadvertent by-product of mutation order processes (Schluter 2009, Nosil 2011), is difficult in the absence of gene flow. Consequently, we focused on an example of sequential divergence involving sympatric host shifts, allowing us to directly document the multiplicative potential of the process in action. Thus, we excluded mtDNA haplotypes A and B in Utetes from further analysis here, but these taxa may represent cases of sequential divergence when considered from a broader geographic perspective.

We also defined the process with respect to “population divergence” rather than using the previously defined term “sequential speciation” (Forbes et al. 2009) to convey a focus on recent sympatric host shifts for empirical testing and to remove any presumption of the evolutionary outcome of the study. While the results support the sequential divergence hypothesis, it is not possible to discern the long-term evolutionary fate of species we studied. We are unable to determine, with certainty, if these taxa will diverge further along the “speciation continuum” (Feder et al. 2012), represent “frozen” multi- state polymorphisms in evolutionary equilibrium between selection and gene flow, or have already attained species status. Thus, case studies of speciation must rely on

85 inferences drawn from comparisons involving a series of related population pairs at varying stages along the “speciation continuum” (Feder et al. 2013). We therefore contend that host-specific populations of D. alloeum, D. mellea and U. canaliculatus provide an opportunity to make inferences concerning the critical ecological attributes and adaptations initiating sequential divergence which may result in speciation. Recent theory suggests that during ecological divergence, populations may diverge incrementally through time before a threshold level of differentiation is reached and the genomes of taxa rapidly “congeal” into new species (Flaxman et al. 2014). Thus, populations that appear to be in evolutionary limbo may be slowly accumulating new mutations of small effect and progressively inching their way towards species status. In this regard, the two cryptic Utetes taxa we discovered (Figs. 3.5, 3.6) imply that the wasps have the potential to diverge further. However, it remains to be determined whether sequential divergence alone (cascading ecological selection pressures) or other mechanisms contribute to the transition from races or biotypes to species.

With respect to the current taxonomic status of wasp populations, we cast the experimental design in terms of eight criteria supporting sympatric host race formation and sequential divergence (Table 3.1). The results support, partially or in whole, criteria

1-7 for Rhagoletis and its parasitoid community. Due to difficulties in wasp husbandry, we could not test for host fly-related fitness tradeoffs among populations (criterion 8).

Reciprocal fruit transplant studies of apple and hawthorn-infesting R. pomonella have failed to detect host-related differences in larval feeding performance with respect to survivorship to pupariation (Reissig and Smith 1978). However, tradeoffs in larval performance have been documented between R. pomonella sibling species (Bierbaum and

Bush 1990, Ragland et al. 2015) that may distinguish Rhagoletis sibling species from host races. If the same is true for wasps, experiments investigating performance tradeoffs may help establish the taxonomic status of D. alloeum, D. mellea, and U. canaliculatus.

Nevertheless, estimates of habitat isolation via host odor discrimination and temporal isolation via differences in eclosion timing substantially reproductively isolate host- associated populations of D. alloeum, D. mellea and U. canaliculatus (Tables 3.2, 3.3).

Taking into account the relative contribution of each measure of reproductive isolation, temporal isolation and habitat isolation can act in concert to produce prezygotic RI among pairs of D. alloeum (70-94%), U. canaliculatus (85-99%), and D. mellea (79-

90%). Moreover, other cues in addition to fruit surface volatiles also likely increase host plant fidelity and habitat isolation for the wasps (e.g., differences in fruit color, size, and taste), as in Rhagoletis (Prokopy and Roitberg 1984). Host fruit odor discrimination could also contribute to postzygotic RI for the wasps due hybrid behavioral sterility, as it may for Rhagoletis (Linn et al. 2004).

Finally, competition may limit the potential for multiplicative sequential divergence (Hood et al. 2012), placing limits on the overall number of parasitoids that can simultaneously share the same host. However, we discovered two cryptic, highly diverged haplotypes of egg-attacking Utetes sharing snowberry and flowering dogwood hosts suggesting that wasps can subdivide the fly resource and avoid extinction.

However, competition does occurs among Rhagoletis parasitoids, as only one adult wasp ecloses when a single fly is attacked by multiple parasitoids (Hood et al. 2012).

Furthermore, larval-attacking D. mellea and D. alloeum overlap in host use. Thus, several species co-occur and it is possible that interspecific interactions may foster diversity by

selecting for newly shifting wasps to differentiate to avoid competition on novel hosts reducing temporal overlap and increasing their RI from ancestral population (Linn et al.

2003). Indeed eclosion time differences exists not only within each species attacking different fly hosts, but also between parasitoid species sharing the same host (Tables 3.2;

B.6; Fig. 3.10). Therefore, a degree of temporal niche partitioning for oviposition sites exists among species, a common phenomenon among parasitoids sharing the same host

(Weis and Abrahamson 1985, Hackett-Jones et al. 2009). While speculative, this may permit co-existence of multiple species on shared fly hosts. Moreover, escape from parasitism itself may also favor host shifting in Rhagoletis (Feder 1995). Thus, host plant, fly, and wasp may play a tritrophic co-evolutionary game of hide and seek that spins off several new life forms.

3.6 Acknowledgments

We thank E. Archie, S. Berlocher, M. Brueseke, T. Brown, M. Doellman, C. Finn,

M. Glover, K. Gomez, T. Kubler, J. McLaughlin, P. Meyers, M. Pfrender, G. Ragland, D.

Sanford, H. Schuler, and C. Tait for helpful comments and support. Funding was provided to JLF, AAF and SPE by the National Science Foundation (DEB-1145573) and to GRH by the Indiana Academy of Science, the Entomological Society of America,

Sigma Xi, and the National Science Foundation (DEB-1310850).

3.7 Literature Cited

Abrahamson W.G. and Blair C.P. 2008. Sequential radiation through host-race formation: herbivore diversity leads to diversity in natural enemies. Specialization, Speciation, and Radiation: The Evolutionary Biology of Herbivorous Insects, eds Tilmon KJ (University of California Press) pp 188-202. 88

Barron, A.B. 2001. The life and death of Hopkins’ host-selection principle. Journal of Insect Behavior 14:725-737.

Berlocher, S.H. 2000. Radiation and divergence in the Rhagoletis pomonella species group: inferences from allozymes. Evolution 54:543-557.

Berlocher, S.H. and Feder, J.L. 2002. Sympatric speciation in phytophagous insects: moving beyond controversy? Annual Review of Entomology 47:773-815.

Bierbaum, T.J. and Bush, G.L. 1990. Genetic differentiation in the viability of sibling species of Rhagoletis fruit-flies on host plants, and the influence of reduced hybrid viability on reproductive isolation. Entomologia Experimentalis et Applicata 55:105-118.

Bush, G.L. 1969. Sympatric host race formation and speciation in frugivorous flies of the genus Rhagoletis (Diptera: Tephritidae). Evolution 23:237-251.

Bush, G.L. 1993. A reaffirmation of Santa Rosalia, or why there are so many kinds of small animals? Evolutionary Patterns and Processes, eds Edwards D, Lees DR (Academic Press, New York) pp 229-249.

Bush, A.M., Bambach, R.K. and Erwin D.H. 2011. Ecosphere utilization during the Ediacaran Radiation and the Cambrian Eco-explosion. Quantifying the Evolution of Early Life: Numerical Approaches to the Evalucation of Fossils and Ancient Ecosystems, eds Laflamme M, Schiffbauer J, Dornbos S (Springer, Netherlands) pp 111-133.

Butterfield, N.J. 2001. The Ecology of the Cambrian Region. Columbia University Press, New York, NY, USA.

Coyne J.A., Orr, H.A. 2004. Speciation. Sinauer, Sunderland, MA, USA.

Dambroski, H. and Feder, J.L. 2007. Host plant and latitude-related diapause variation in Rhagoletis pomonella: a test for multifaceted life history adaptation on different stages of diapause development. Journal of Evolutionary Biology 20:2101-2112.

Dres, M. and Mallet, J. 2002. Host races in plant-feeding insects and their importance in sympatric speciation. Philosophical Transactions of the Royal Society of London B: Biological Sciences 357:471-492.

Egan, S.P., Ragland, G.J., Assour, L., Powell, T.H.Q., Hood, G.R., Emrich, S., Nosil, P. and Feder, J.L. 2015. Experimental evidence of genome-wide impact of ecological selection during early stages of speciation-with-gene-flow. Ecology Letters 18:817-825.

Emerson, B.C. and Kolm, N. 2005. Species diversity can drive speciation. Nature 434:1015–1017.

Erwin, D.H. 2008. Macroevolution of ecosystem engineering, niche construction and diversity. Trends in Ecology and Evolution 23:168-172.

Feder, J.L., Opp, S.B., Wlaxlo, B., Reynolds, K. Go, W. and Spisak, S. 1994. Host fidelity is an effective premating barrier between sympatric races of the apple maggot fly. Proceedings of the National Academy Science 91:7990-7994.

Feder, J.L. 1995. The effects of parasitoids on sympatric host races of the apple maggot fly, Rhagoletis pomonella (Diptera: Tephritidae). Ecology 76:801-813.

Feder, J.L. and Forbes, A.A. 2010. Sequential divergence and the diversity of parasitic insects. Ecological Entomology 35:67-76.

Feder, J.L., Egan, S.P. and Nosil, P. 2012. The Genomics of Speciation-With-Gene-Flow. Trends in Genetics 28:342-50.

Feder, J.L., Flaxman S.M., Egan S.P., Comeault A.A. and Nosil P. 2013. Geographic mode of speciation and genomic divergence. Annual Review of Ecology and Systematics 44:73-97.

Felsenstein, J. 2005. PHYLIP (Phylogeny Inference Package) Version 3.6. Distributed by the author. Department of Genome Sciences, University of Washington, Seattle, Washington.

Filchak, K.E., Roethele, J.B. and Feder, J.L. 2000. Natural selection and sympatric divergence in the apple maggot Rhagoletis pomonella. Nature 407:739-742.

Flaxman, S.M., Wacholder, A.C., Feder, J.L. and Nosil, P 2014. Theoretical models of the influence of genomic architecture of the hynamics of speciation. Molecular Ecology 23:4074-4088.

Forbes, A.A., Fisher, J. and Feder, J.L. 2005. Habitat avoidance: overlooking an important aspect of host-specific mating and sympatric speciation? Evolution 59:1552-1559.

Forbes, A.A., Powell, T.H.Q., Stelinski, L., Smith, J.L. and Feder J.L. 2009. Sequential sympatric speciation across trophic levels. Science 323:776-779.

Gavrilovic, V., Bush, G.L., Schwarz, D., Crossno, J.E. and Smith, J.J. 2007. Rhagoletis zephyria (Diptera: Tephritidae) in the Great Lakes Basin: a native insect on native hosts? Annals of the Entomological Society of America 100:474-482.

Hackett-Jones, E., Cobbold, C. and White, A. 2009. Coexistence of multiple parasitoids on a single host due to differences in parasitoid phenology. Theoretical Ecology 2:19-31.

Hawkins, B.A. and Lawton, J.H. 1987. Species richness for parasitoids of British phytophagous insects. Nature 326:788-790.

Hood, G.R., Egan, S.P. and Feder, J.L. 2012. Interspecific competition and speciation in endoparasitoids. Evolutionary Biology 39:219-230.

Jones, T.H., Godfray, H.C.J and Hassell, M.P. 1996. Relative movement of a tephritid fly and its parasitoid wasps. Oecologia 106:317-324.

Linn, C.E., Feder, J.L., Nojima, S., Dambroski, H.R., Berlocher, S.H. and Roelofs, W. 2003. Fruit odor discrimination and sympatric host race formation in Rhagoletis. Proceedings of the National Academy of Science 100:11490-11493.

Michel, A.P., Sim, S., Powell, T.H.Q., Taylor, M.S., Nosil, P. and Feder, J.L. 2010. Widespread genomic divergence during sympatric speciation. Proceedings of the National Academy of Sciences 107:9724-9729.

Mitter, C., Farrell, B. and Wiegmann, B. 1988. The phylogenetic study of adaptive zones has: has phytophagy promoted insect diversification? American Naturalist 132:107-128.

Nei, M. 1972. Genetic distance between populations. American Naturalist 106:283-292.

Nojima, S., Linn, C., Morris, B., Zhang, A. and Roelofs, W. 2003a. Identification of host fruit volatiles from hawthorn (Crataegus spp) attractive to hawthorn-origin Rhagoletis pomonella flies. Journal of Chemical Ecology 29:319-334.

Nojima, S., Linn, C. and Roelofs, W. 2003b. Identification of host fruit volatiles from flowering dogwood (Cornus florida) attractive to the dogwood-origin Rhagoletis pomonella flies. Journal of Chemical Ecology 29:2347-2357.

Nosil, P. and Flaxman, S. 2011. Conditions for mutation-order speciation. Proceedings of the Royal Society of London B: Biological Sciences 278:399–407.

Pinho, C. and Hey, J. 2010. Divergence with gene flow: models and data. Annual Review of Ecology and Systematics 41:215-230.

Powell. T.H.Q., Hood, G.R., Murphy, M.O., Heilveil, J.S. Berlocher, S.H., Nosil, P. and Feder, J.L. 2013. Genetic divergence along the speciation continuum: the transition from host race to species in Rhagoletis (Diptera: Tephritidae). Evolution 67:2561-2576.

Powell, T.H.Q., Forbes, A., Hood, G.R. and Feder, J.L. 2014. Ecological adaptation and reproductive isolation in sympatry: genetic and phenotypic evidence for native host races of Rhagoletis pomonella. Molecular Ecology 23:688-704.

Price, P.W. 1980. Evolutionary Biology of Parasites. Princeton University Press, Princeton, NJ, USA.

Prokopy, R.J., Bennett, E.W. and Bush, G.L. 1971. Mating behavior in Rhagoletis pomonella (Diptera: Tephritidae). I. Site of assembly. Canadian Entomologist 103:1405-1409.

Prokopy, R.J., Bennett, E.W. and Bush, G.L. 1972. Mating behavior in Rhagoletis pomonella (Diptera: Tephritidae). II. Temporal organization. Canadian Entomologist 104:97-104.

Prokopy, R.J. and Roitberg, B.D. 1984. Foraging behavior of true fruit flies. American Scientists 72:41-49.

Ragland, G.J., Almskaar, K., Duong, K.L., Gough, H.M., Huddleston, J., Feder, J.L., Hahn, D.A. and Schwarz, D. 2015. Differences in fitness and transcriptome-wide gene expression associated with Rhagoletis (Diptera: Tephritidae) larvae feeding in alternate host fruit environments. Molecular Ecology 24:2759-2776.

Ramsey, J., Bradshaw, H.D. and Schemske, D.W. 2003. Components of reproductive isolation between the monkeyflowers Mimulus lewisii and M. cardinalis (Phrymaceae). Evolution 57:1520-1534.

Reissig, W.H. and Smith, D.C. 1978. Bionomics of Rhagoletis pomonella in Crataegus. Annals of the Entomological Society of America 71:155-159.

Schluter, D. 2009. Evidence for ecological speciation and its alternative. Science 323:737–741.

Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H. and Flook, P. 1994. Evolution, weighting and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87:651-701.

Sokal, R.R. and Rohlf, F.J. 2012. Biometry: The Principles and Practice of Statistics in Biological Research. Freeman and Co, New York, NY, USA.

Stelinski, L.L., Oakleaf, R. and Rodriguez-Saona, C. 2007. Oviposition-deterring pheromone deposited on blueberry fruit by the parasitic wasp, Diachasma alloeum. Behaviour 144:429-445.

Stireman, J.O., Nason, J.D., Heard, S. and Seehawer, J.M. 2006. Cascading host- associated genetic differentiation in parasitoids of phytophagous insects. P Roy Soc Lond B Bio 273:523-530.

Storeck, K., Poppy, G.M., van Emden, H.F. and Powell, W. 2000. The role of plant chemical cues in determining host preference in the generalist aphid parasitoid Aphidius colemani. Entomologia Experimentalis et Applicata 97:41-46.

Strong, D.R., Lawton, J.A. and Southwood, T.R.E. 1984. Insects on Plants: Community Patterns and Mechanisms. Blackwell Scientific, Oxford, UK.

Turlings, T.C.J., Wackers, F.L., Vet, L.E.M., Lewis, J. and Tumlinson, J.H. 1993. Learning of host-finding cues by Hymenopterous parasitoids. Insect Learning: Ecological and Evolutionary Perspectives, eds. Papaj DR, Lewis A (Chapman & Hall, New York) pp 51-78.

Van Oosterhout, C., Hutchinson, W.F., Wills, D.P.M. and Shirley, P. 2004. Micro- Checker: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 6:90-92.

Wharton, W.A. and Marsh, P.M. 1978. New Word Opiinae (Hymenoptera: Braconidae) parasitic on Tephritidae (Diptera). Journal of the Washington Academy of Sciences 68:147-167.

Wharton, R.A. 1997. Generic relationships of opine Braconidae (Hymenoptera) parasitic on fruit infesting Tephritidae (Diptera). Contributions of the American Entomological Institute 30:1-53.

Wharton, R.A. and Yoder, M.J. Parasitoids of Fruit-Infesting Tephritidae. Available at: paroffit.org/ [Accessed July 2, 2015].

Weir, B.S. 1979. Inferences about linkage disequilibrium. Biometrics 35:235-254.

Weis, A.R. and Abrahamson, W.G. 1985. Potential selective pressures by parasitoids on a plant-herbivore interaction. Ecology 66:1261-1269.

Whitham, T.G., Bailey, J.K., Schweitzer, J.A., Schuster, S.M., Bangert, R.K., LeRoy, C.J., Lonsdorf, E.V., Allan, G.J., DiFazio, S.P., Potts, B.M., Fischer, D.G., Gehring, C.A., Lindroth, R.L., Marks, J.C., Hart, S.C., Wimp, G.M. and Wooley, S.C. 2006. A framework for community and ecosystem genetics: from genes to ecosystems. Nature Reviews Genetics 7:510-523.

Whitham, T.G., DiFazio, S.P., Schweitzer, J.A., Shuster, S.M., Allan, G.J., Bailey, J.K. and Woolbright, S.A. 2008. Extending genomics to natural communities and ecosystems. Science 320:492-495.

Xie, X., Michel, A.P., Schwarz, D., Rull, J., Velez, S., Forbes, A.A., Aluja, M. and Feder, J.L. 2008. Radiation and divergence in the Rhagoletis pomonella species complex: inference from DNA sequence data. Journal of Evolutionary Biology 21:900-913.

CHAPTER 4:

INTERSPECIFIC COMPETITION AND TEMPORAL RESOURCE PARTITIONING

FACILITATES SPECIATION AND THE FORMATION OF COMMUNITY

BIODIVERSITY

4.1 Abstract

An important question linking ecology and evolutionary biology is whether competitive interactions between species sharing a limited resource can lead to niche partitioning to allow multiple species to co-exist, and as a by-product of these interactions, facilitate population divergence and promote speciation. To answer this question, we examine the role of temporal resource partitioning in contributing to the coexistence of and ongoing population divergence between three host-specific parasitoid wasps. Specifically, we test (1) whether interspecific larval competition between wasp species (Utetes canaliculatus, Diachasmimorpha mellea and Diachasma alloeum) attacking Rhagoletis pomonella fruit flies results in the temporal subdivision of host fly resources and (2) if resource partitioning allows the wasp community to coexist on shared fly hosts and contributes to evolution of reproductive isolation and population divergence among wasp species. Through a series of rearing experiments, field observations, and genetic analyses, we show that while wasp species co-exist across space and time, species are under intense contest competition for limited resource during larval development in fly hosts. In addition, a competitive hierarchy exists among the parasitoids attacking

Rhagoletis flies in order of dominance from D. alloeum, to U. canaliculatus, to D. mellea. Furthermore, competition is mitigated among the three wasps by their temporal subdivision of shared host fly resources as well as difference in morphological features that enable their co-existence. As a result, the seasonal subdivision of fly resources is accentuating allochronic isolation among conspecific wasps attacking different host flies, generating increased reproductive isolation and potentially facilitating population divergence, speciation and the formation of community-level biodiversity.

4.2 Introduction

A fundamental problem in biology is to understand the ecological and evolutionary factors responsible for generating and maintaining biodiversity (Pennisi

2005). Several interacting processes and considerations are involved in making life diverse. One is ecological adaptation by natural selection. By evolving to use different resources and responding to varying environmental challenges, natural selection has and is creating a vast array of different life forms, transforming variation within populations into the differences that we observe between species (Schluter 2000a, Coyne and Orr

2004, Nosil 2012). In addition, coevolutionary interactions among organisms in which phenotypic and genetic changes in species reciprocally affect each other’s evolution enhance the effects of natural selection in generating biodiversity (Dieckmann and

Doebeli 1999, Agrawal 2001, Thompson 2004, Whitham et al. 2006, Abrahamson and

Blair 2008, Feder and Forbes 2010, Rabosky 2013, Winkelmann et al. 2014).

Specifically, when populations diverge into different lineages, they can create new opportunities and resources for associated organisms to adapt to. Thus, in certain

circumstances, “biodiversity begets biodiversity” as entire groups of coevolved organisms diversify and radiate in concert (Butterfield 2001, Emerson and Kolm 2008.

Erwin 2005, 2008, Feder and Forbes 2010, Bush et al. 2011, Hood et al. 2015).

Competition is a process that can contribute to biodiversity through natural selection. For example, when individuals within a population compete for limited resources, intraspecific interactions can generate frequency dependent selection resulting in niche expansion to utilize a new resource or niche specialization to more finely subdivide a shared resource (Rosenzweig 1978, Wilson and Turelli 1986, Doebeli 1996,

Johnson and Gullberg 1998, Dieckmann and Doebeli 1999, Kondrashov and Kondrashov

1999, Doebeli and Dieckmann 2000, Drossel and McKane 2000, Kawata 2001,

Ackermann and Doebeli 2004, Bolnick 2004, Burger et al. 2006, Svanback and Bolnick

2007, Pennings et al. 2008, Agashe and Bolnick 2010). In both of these scenarios, intraspecific competition could facilitate speciation if reproductive isolation evolves as a by-product of adaptation associated with using new or subdividing common resources.

Interspecific competition between taxa could also be a source of divergent selection and coevolution promoting speciation (Grant and Grant 2006, Rundle and Nosil

2005, Hood et al. 2012, Rabosky 2013). For example, where individuals from different populations overlap, ecological character displacement can occur in which taxa diverge to utilize different aspects of a shared resource, allowing them to co-exist (Brown and

Wilson 1956, Schluter 2000b, Prichard and Schulter 2001, Pfennig and Pfennig 2009,

Lamichhaney et al. 2016). Normally such character displacement, especially involving sister taxa, is envisioned as generating species differences rather than directly contributing to the evolution of reproductive isolation during speciation (Albert and 97

Schluter 2004, Dayan and Simberloff 2005). However, if populations outside a contact area do not experience the same selection pressures as those within, then it is possible that ecological character displacement could generate a degree of reproductive isolation between conspecific populations across their range (and in zones of secondary contact) facilitating speciation (Fishman and Wyatt 1999, Hobel and Gerhardt 2003, Pfennig and

Rice 2007).

Here, we test a variant of the interspecific character displacement hypothesis, involving host shifts of a community of parasitoid wasps to utilize new host fly resources.

Specifically, we examine whether interspecific competition among three solitary and specialist endoparasitoid wasps, Utetes canaliculatus, Diachasmimorpha mellea, and

Diachasma alloeum (Hymenoptera: Braconidae) attacking shared fruit flies in the

Rhagoletis pomonella species complex (Diptera: Tephritidae) contributes to the evolution of temporal isolation and divergence of wasps attacking different fly hosts. Interspecific competition is potentially a key aspect in the Rhagoletis-parasitoid system linking ecological adaptation and coevolutionary interactions and facilitating “starbursts” of adaptive radiation across the wasp community (Hood et al. 2012, Hood et al. 2015).

Previous studies have shown that flies and wasps are engaged in a tri-trophic escape and radiate coevolutionary game of hide and seek (Feder 1995, Forbes et al. 2009, Hood et al.

2012, Hood et al. 2015). Specifically, as Rhagoletis flies shift to infest the fruit of novel plants, the wasps have followed suit and diverged in kind, resulting in the multiplicative amplification of diversity as the effects of divergent ecology cascades upward across trophic levels from plant, to fly, to wasps (Forbes et al. 2009, Hood et al. 2015). A key factor in the evolution of host race formation in Rhagoletis is an initial escape from 98

parasitism (to enemy free space) following their shifts to novel plants (Feder 1995). Also, reduced competition among Rhagoletis feeding internally within novel host fruit from other conspecifics and interspecific moth and beetle larvae can also favor utilization of the new resource, especially if the novel fruit is initially not as nutritionally conducive for survival as the ancestral host fruit (Feder et al. 1995, Feder 1995). Eventually, however, the wasps find the flies and adapt to utilize the new host fly resource, sequentially forming host races in conjunction with their fly hosts.

A primary axis of ecological adaptation for both flies and wasps in their sequential coevolutionary interplay is host plant fruiting phenology. The flies are host specialists on the fruit of different, non-overlapping sets of host plants (Bush 1969). The different host plants used by Rhagoletis taxa all fruit at different times of the year

(Dambroski and Feder 2007, Hood et al. 2015). Flies overwinter as pupae in the soil and eclose as adults the following summer, with adults living for about 1 month and having only one generation per year. Thus, flies must time when they terminate diapause and eclose as adults to match when ripe host fruit is available for flies to mate on and oviposit into. As a consequence, when Rhagoletis shift to utilize a novel host plant, the resulting adaptive changes in their diapause life history timing generates allochronic mating isolation between derived and ancestral fly populations due to limited adult longevity

(Berlocher 2000, Dambroski and Feder 2007, Powell et al. 2013, Egan et al. 2015,

Mattsson et al. 2015).

The same selection pressures on life history timing affecting Rhagoletis apply to the members of the parasitoid community, as well. Wasps larval consume their fly hosts and diapause in the fly puparium in the soil (Lathrop and Newton 1933, Wharton and 99

Marsh 1978, Hood et al. 2015). Selection on the timing of adult eclosion can be even more acute for the wasps than the flies, as adults live less than 2 weeks under ideal laboratory conditions (Forbes et al. 2009, Hood et al. 2015). Interspecific interactions among wasps can also be intense, as multiple species can oviposit into a single fly host, but only one parasitoid has been reported to emerge per parasitized fly (Lathrop and

Newton 1933, Hood et al. 2012). Thus, in addition to evolving different diapause life histories to track seasonal differences among host flies, different parasitoids attacking the same host fly may be selected to vary in their eclosion times to ameliorate the effects of interspecific competition and allow (promote) species coexistence. If true, then selection pressures mediating interspecific competition may foster diversity by allowing more parasitoids to temporally pack into and use the same fly resource niche. In addition, the temporal subdivision of resources within a fly host could result in a wasp taxon attacking different fly hosts being more allochronically isolated from one another than in the absence of competition and resource subdivision. Thus, interspecific competition, or more precisely, its alleviation through the temporal narrowing of host niches (i.e., ecological character displacement), could generate ecologically-based prezygotic reproductive isolation facilitating sequential divergence across the wasp community.

Here, we employ a six-prong strategy to test for an effect of interspecific competition on wasp diversity. First, we surveyed blueberry, apple, and hawthorn- infesting Rhagoletis populations across the Midwestern U.S. to measure rates of parasitism, discern patterns of host use, and confirm that U. canaliculatus D. mellea, and

D. alloeum, co-occur on the same fly hosts in nature, setting the stage for potential interspecific competition. Second, to confirm that fly resources are limiting for wasps and 100

that competition for fly resources can be severe, we reared fly puparium generated from field collected fruit separately to measure the amount of fly material remaining in parasitized individuals and confirm that no more than one wasp ever survives per host.

Third, we examined interspecific interactions among wasps attacking blueberry-, apple-and hawthorn-infesting fly host to verify that the parasitoids co-occur within individual flies and determine whether a competitive hierarchy exists among wasp species. Unfortunately, determining if a fly specimen is un-parasitized, or parasitized by a single or multiple wasps is destructive. We therefore employed a genetic detection strategy based on diagnostic mitochondrial DNA (mtDNA) differences distinguishing wasp species to infer competitive interactions. Previous studies have indicated that parasitoid eggs do not hatch in their Rhagoletis hosts until after flies have burrowed into the soil and formed puparia (Lathrop and Newton 1933, Wharton and Marsh 1978,

Forbes et al. 2010, Hood et al. 2012), likely to minimize any adverse effects of parasitism on host growth and development when flies are still feeding within fruit. By 20 days post puparium formation, however, wasps have typically consumed their fly hosts (G. Hood, pers. obser.). In addition, wasps rely on flies to form puparia that the parasitoids overwinter within. Thus, we genetically scored fly larvae immediately after they emerged from feeding within host fruits and soon after puparia formed to establish baseline rates of single and multiparasitism. By genetically scoring pupae in subsequent subsamples from the same initial collection in staged intervals every 3 or 5 days up to 20 days, we could infer the occurrence of interspecific competition, its severity, and the existence of a competitive hierarchy based on changes in the composition of the wasp community parasitizing flies through time. 101

Fourth, we characterized the temporal (seasonal) and spatial distributions of wasps attacking blueberry-, apple-, or hawthorn-infesting fly hosts through: (1) analysis of adult eclosion curves for wasps reared under controlled laboratory conditions, (2) sweep net collections of adult wasps captured directly from host plants and from fallen fruit in the field, and (3) rearing studies of parasitized flies collected from fruit sampled from the plant and the ground over the course of the field season. Collectively, these three surveys allowed us to assess if a chronological order exists in the utilization of shared host resources across wasps subdividing flies by attacking different temporal resource windows. In this regard, U. canaliculatus is an egg parasitoid, while D. mellea and D. alloeum attack late instar maggots feeding within host fruit (Forbes et al. 2010,

Hood et al. 2012). Thus, a priori, a degree of host fly life stage specialization is known to exist in the system. A corollary prediction from detecting a competitive hierarchy among the wasps is that the chronology of host utilization from earliest to latest may follow the order of interspecific competitive ability from least to best. In other words, wasps that are competitively inferior may be driven to extinction by competitively superior species unless they gain a fitness advantage from ovipositing earlier than their competitors, as has been observed in many parasitoid systems (Cusumano et al. 2012, Harvey et al. 2013,

Hood et al. in prep.).

Fifth, to explore factors in addition to phenology potentially contributing to parasitoid co-existence, we performed a morphometric analysis of wasp tibia length (a proxy for body size), ovipositor length (a gauge of wasp ability to attack flies residing at different depths in host fruit), and wing size (a predictor of dispersal ability). We predicted that wasps that are inferior competitors might compensate by being better 102

dispersers (have an increased ability to find pristine flies), and/or being better suited to attacking a wider spectrum of host fly resources in fruit. Sixth, we characterized the seasonal differences among conspecific wasp populations attacking different blueberry-, apple-, and hawthorn-infesting fly hosts. From these data, we estimated and compared the degree of temporal overlap that would exist in the presence versus absence of heterospecific competitors to quantify the effect that interspecific interactions may have in accentuating allochronic isolation.

4.3 Materials and Methods

4.3.1 Study System

Fruit flies in the genus Rhagoletis are a model for ecological speciation with gene flow via host plant shifting in sympatry in the absence of complete geographic isolation

(Berlocher and Feder 2002, Funk et al. 2002). In particular, the R. pomonella sibling species group has been proposed to have radiated via flies shifting and adapting to use the fruit of novel host plants (Bush 1969). The most well-known example is the recent shift in the mid-1800s of the species R. pomonella from its ancestral host hawthorn (Crataegus spp.) to form a new host race on introduced, domesticated apple (Malus domestica)

(Walsh 1867, Bush 1969, Feder et al. 1988, Filchak et al. 2000, Coyne and Orr 2004,

Egan et al. 2015). Host races are hypothesized to represent an early, partially reproductively isolated stage of ecological speciation (Dres and Mallet 2002). The other members of the R. pomonella group attack different native host plants including Cornus florida (the undescribed flowering dogwood fly, a sister taxon to R. pomonella),

103

blueberries (R. mendax), snowberries (R. zephyria), and silky dogwood, C. amomum, (R. cornivora) (Hood et al. 2015). Differences in diapause life history timing adapting R. pomonella flies to variation in the fruiting times of their respective host plant are key traits generating allochronic mating isolation and helping initiate ecological divergence with gene flow (Dambroski and Feder 2007). Rhagoletis display genetically-based differences in adult eclosion times matching host fruiting phenology in both the field and when reared in the laboratory under controlled conditions (Filchak et al. 2000, Michel et al. 2010, Powell et al. 2013, Egan et al. 2015).

Previously, we documented that three members of the solitary endoparasitoid wasp community, Utetes canaliculatus, Diachasmimorpha mellea and Diachasma alloeum, that are specialists attacking R. pomonella group flies, are sequentially diverging in parallel with their fly hosts (Forbes et al. 2009, Hood et al. 2015). Wasp species have life histories that mirror those of their host flies. Wasps terminate larval diapause, complete development, and eclose as adults at times in the summer matching when fly larvae are active in host fruit. In addition, wasps mate on or near the fruit of their host flies and females land on host fruit to find flies for oviposition. Utetes canaliculatus oviposits into fly eggs laid underneath the skin of host fruit, while D. mellea and D. alloeum oviposit into late second and third instar maggots feeding within fruit. Genetic analysis of the three wasp species showed that populations attacking different fly hosts display significant microsatellite allele frequency differences (Forbes et al. 2009; Hood et al. 2015). Interestingly, for D. mellea and D. alloeum, wasps attacking the apple race of

R. pomonella may have shifted from populations attacking R. mendax (host: blueberries), rather than hawthorn-infesting populations of R. pomonella. Thus, coevolution may be 104

more diffuse instead of involving strict 1:1 “follow the leader” type of co-divergence between flies and wasps. We, thus, concentrated on the hawthorn- and apple-infesting host races of R. pomonella, and blueberry-infesting populations of R. mendax in the current study.

4.3.2 Rates of Parasitism and Community Composition

Rates of parasitism and the composition of the wasp communities attacking blueberry, apple, hawthorn flies were determined from rearing studies conducted using samples of infested fruit collected from five sites in the Midwestern U.S. over a ten year period from 2003–2013 (Table C.1). Rearing methods followed those described in Forbes et al. (2009, 2010) and Hood et al. (2015). Infested fruit were picked directly from host plants and from the ground beneath plants and transported to a greenhouse at the

University of Notre Dame, Notre Dame, IN, USA. Here, fruit where placed on wire mesh racks held over plastic collecting trays that were monitored daily for newly emerging fly larvae. Once emerged fly larvae formed puparia, they were placed in plastic Petri dished filled with moist vermiculite and exposed to a pre-winter treatment of 21C, 14:10 light

(L):dark (D) cycle for eight days. The Petri dishes were then moved to a refrigerator and overwintered for four months at 4C. After four months, Petri dishes were removed from the cold and placed in individual 15 cm × 15 cm × 25 cm Plexiglas cages, stocked with food (a mixture of brewer’s yeast and honey) and water, and held at 24C with a 14:10

L:D cycle. The cages were monitored daily for newly eclosing adult flies and wasps.

Eclosing wasps were sexed and taxonomically identified using the keys of Wharton and

Marsh (1978), Wharton (1997), and Wharton and Yoder (2016).

105

Percent parasitism of flies by wasps was calculated by dividing the total number of eclosed parasitoids of a given species by the total number of all eclosed parasitoids and flies (Feder 1995). Infested fruit were sampled from the field before fly larvae had emerged from fruit. Thus, not all flies were fully exposed to attack prior to being transported to the greenhouse. As a result, our reported rates of percent parasitism should be considered as lower bound estimates, particularly for the larval stage parasitoids D. alloeum and D. mellea. Arcsine-square-root-transformed parasitism rates were compared via two-way ANOVAs, with parasitoid species and host treated as fixed effects.

Parasitism rates used for the ANOVA were calculated by pooling data for a given wasp species attacking a given host species across sites and years, as no significant variation was detected among sites or years (see Table C.1 for parasitism rates).

4.3.3 Assessing Resource Limitation

To confirm that resources are limiting during development of immature parasitoids and that no more than one wasp emergences from a parasitized fly, we individually reared 1125 hawthorn and 960 apple-origin puparium collected from Grant,

MI, USA in 2009 and 2010, respectively. We used the same husbandry methods described above except fly puparia were placed individually into 0.2 ml micro-centrifuge tubes. Each tube had four holes poked in the lid of the tube to allow air-flow. The tubes were then placed in the wells of a 96-well microtiter plate. Each plate was placed on top of a stand in a closed plastic box containing a saturated potassium chloride solution that maintained relative humidity in the box at 85% (Winston and Bates 1960, Ragland et al.

2012). The boxes were stored at 24C, 14:10 hour L:D in an incubator, with fly and

106

parasitoid emergence monitored daily. Following parasitoid eclosion, fly puparia were dissected under a microscope for the presence of any “leftover” fly resources. Resources were considered limiting when the fly pupal case was empty. Additionally, for a subset of ten pupal cases each from apple and hawthorn flies from which a parasitoid emerged, we genetically tested the puparium for the presence of fly DNA using a Rhagoletis specific microsatellite marker (see methods below).

4.3.4 Tests of Multiple Parasitism and a Competitive Hierarchy of Interspecific

Competition

To infer whether individual flies were parasitized by multiple wasps, if contest competition occurs in instances of multiparasitism, and whether a competitive hierarchy exists among wasp species, we developed a PCR amplification protocol. First, we used previously published mtDNA cytochrome oxidase subunit I (COI) sequences for D. alloeum (Forbes et al. 2009; Genbank accession numbers EU881512-881682) and D. mellea and U. canaliculatus (Hood et al. 2015; Genbank accession numbers KT761291-

KT761497) to identify regions where multiple single nucleotide polymorphisms (SNPs) and/or insertion/deletion polymorphisms exist distinguishing the three wasp species.

Next, three different sets of forward and reverse primers were developed for the region that PCR amplify presence/absence products of different fragment lengths distinguishing

U. canaliculatus (320 bp), D. mellea (128 bp), and D. alloeum (410 bp) (Table C.2). We confirmed the species specificity of each of the three sets of primer pairs through trial

PCR runs using DNA isolated from taxonomically known adult U. canaliculatus, D. mellea and D. alloeum wasps reared from R. mendax, and the apple and hawthorn host

107

races of R. pomonella. In all cases, the unique primer pair for a given wasp successfully amplified the target species only.

Our strategy for testing for multiparasitism and competition involved PCR surveying DNA isolated from blueberry-, apple-, and hawthorn-origin flies across eight developmentally staged classes: late instar larvae immediately after emergence from fruit, newly pupariating flies, and pupae 3-, 6-, 9-, 12-, 15- and 20-days post pupariation. Our rationale was that newly emerging larvae and pupariating flies provided baseline estimates of parasitism. By subsequently determining how rates of single and multiple parasitism changed through time for 3 to 20 days post pupariation, we could infer whether interspecific competition occurred and which wasps were competitively superior.

Host fly defense mechanisms such as encapsulation (i.e., a common form of insect host defense that kills parasitoid eggs) could also potentially influence rates of parasitism and alter the composition of the wasp community through time (Gillespie et al. 1997). While we cannot completely discount a contributing effect of fly immune defense, if estimated rates of parasitism for a wasp species were to remain relatively constant through time after appropriately accounting for initial levels of multiparasitism in the baseline controls, encapsulation is likely not a significant cause of mortality for the wasp.

Parasitized flies used in the PCR genetic analysis were collected from the ground at field sites in Grant, MI (apples and hawthorns) and Fennville, MI (blueberries, apples, and hawthorns) in 2010 and 2011. Fruit were treated using the same husbandry methods outlined above (see Table C.3 for collection dates and samples sizes for each host fly life stage). DNA was isolated and purified separately from whole body tissue of each specimen using PURGENE extraction kits (Gentra Systems). Purified DNA samples 108

were transferred to 96-well plates for PCR amplification. PCR amplification was performed separately on each DNA sample using one of the three pairs of wasp specific primers. In addition, we also performed a separate PCR reactions using a Rhagoletis- specific nuclear encoding microsatellite (designated P23) that amplifies a fragment 200 to

220 bp in length for R. mendax and R. pomonella, as described in Velez et al. (2006) and

Michel et al (2010). The inclusion of the microsatellite P23 in our assay allowed us to adjust estimates of parasitism taking into account background levels of fly mortality through time (see below).

PCR reactions were performed in a total volume of 25 μL containing 3 μL of template DNA. After an initial denaturing period of 5 mins. at 94C, DNA was amplified for 35 cycles (denaturation: 94C for 30 seconds; reannealing: 50C for U. canaliculatus,

52C for D. mellea and D. alloeum, and 58C for Rhagoletis, for 1 minutes; extension:

72C for 1.5 minutes) followed by a final extension for 10 minutes at 72C. The PCR products from each species-specific primer pair for a given individual were then pooled and run together in a 2.0% agarose gel for band visualization and sizing compared to a

100 bp ladder. Positive and negative controls were included for the three wasp species and Rhagoletis flies in each set of PCR reactions performed.

To test whether a competitive hierarchy exists among wasp species, we performed linear regression analyses between arcsine-square-root-transformed percent parasitism of wasps and days post larval emergence. Parasitism levels were calculated by dividing the number of wasps of a given species genetically detected in a sample by the total number of puparium scored as “living” in the sample, as indicated by a positive PCR amplification for the fly microsatellite and/or a parasitoid(s) mtDNA marker. Parasitism 109

rates were thus corrected for background levels of mortality occurring during the course of the experiment by including only “living” puparium in the denominator. We also calculated levels of single and multiparasitism for each wasp species attacking each fly host at each life stage in the study to help further discern the nature of competitive interactions among wasps and test for (exclude) encapsulation (see Table C.3 for calculations of parasitism). These latter calculations included considering parasitism levels for U. canaliculatus and D. mellea after eliminating puparia that tested positive for

D. alloeum.

4.3.5 Temporal and Spatial Resource Partitioning

To assess the degree to which wasps temporally (and spatially) subdivide shared host fly resources, we (1) monitored eclosion timing in the laboratory, (2) determined the phenology of adult activity in the field, and (3) quantified the seasonally distribution of wasps parasitizing flies in the field. Infested fruit used to characterize eclosion curves and to quantify the season distributions of parasitoids were collected directly off the plant and from the ground beneath apple and hawthorn trees at Grant, MI, Fennville, MI, and South

Bend, IN, and blueberry bushes at Fennville, MI, on six different sampling points in 2010 and 2011. Methods for insect rearing followed those described above for the population surveys in the Midwest. Cumulative eclosion curves were derived for each wasp attacking a given host fly using pooled data across collecting dates and sites, as a previous study showed no significant variation in eclosion time across dates or sampling locations (Hood et al. 2015). Eclosion curves between different wasp species were compared by Kolmogorov–Smirnov (K-S) tests (Powell et al. 2014, Hood et al. 2015)

110

performed in R v3.2.3 (R Development Core). Temporal isolation (TI) (i.e., reduction in overlap) between heterospecific pairs of wasps parasitizing the same fly host was calculated according to the formula:

xi yi TI 1 2 2 xi yi where xi and yi are the proportions of wasp species x and y predicted to be present on day  i based on eclosion curves and probabilities of survival from eclosion to day i derived from estimates of mean longevity (~ 13 days for each species) taken from Forbes et al.

(2009) and Hood et al. (2015).

To quantify the seasonal and spatial distribution of parasitoids attacking fly hosts, we calculated percent parasitism by dividing the total number of eclosed parasitoids of each species by the total number of all eclosed parasitoids and flies at each collection date (1 through 6) and locations (plant versus ground), pooling data across collecting sites and years for analysis (see Table C.4 for number of wasps reared from fruit). Estimates of

TI were calculated from percent parasitism values on each of the collecting dates in R using the package ‘overlap’ (Ridout and Linkie 2009). We performed G-tests to compare parasitism rates among wasps through time and between sampling locations (plant versus ground) within and between parasitoid species. Two-way ANOVAs were also conducted based on square-root transformed parasitism rates with wasp species, fruit sampling location and time sampled fixed factors.

To determine the seasonal and spatial distributions of adult wasps in the field, we performed a sweep net study on the same dates and at the same collecting sites that fruit were sampled for the eclosion time and parasitoid distribution experiments. At each site 111

on each collecting date, we spent a total of 90 minutes sweep netting for wasps evenly split between fruit in the plant canopy and fruit fallen beneath host plants on the ground.

Upon capture, wasps were aspirated into 50 ml centrifuge tubes filled with 95% ethanol for later taxonomic identification, as described above (see Table C.4 for capture numbers). TI values, G-tests, and ANOVA’s were performed on the sweep net data using the same methods described above for the seasonal distribution of wasps attacking flies.

4.3.6 Morphometrics

To test for morphological differences among wasp species, we measured hind tibia length (an indicator of overall body size in hymenoptera; Teuscher et al. 2009,

Hamerlinck et al. 2016), wing length, and ovipositor length for female specimens to the nearest 0.1 mm using a stereo dissecting microscope fitted with an ocular micrometer, as described in Hood and Ott (2011). Adult females used in the morphological analysis were randomly chosen from wasps reared in the population surveys described above.

4.3.7 Intraspecific Temporal Isolation

Data from the eclosion, sweep net, and seasonal distribution studies were also used to estimate the degree to which interspecific competition among wasps may accentuate allochronic isolation between conspecific parasitoid populations attacking different fly hosts. To evaluate this possibility, cumulative eclosion curves between conspecific populations of wasps attacking different fly hosts were compared via K-S tests, as described above for the within host interspecific analysis. In addition, pairwise TI values between conspecific wasps parasitizing different hosts were calculated from the eclosion time, sweep net, and seasonal distribution data. These values were compared

112

with TI values estimated for the total combined parasitoid community attacking each host, with the latter values providing baseline estimates of allochronic isolation expected in the absence of interspecific competition and temporal subdivision of host fly resources by wasps.

4.4 Results

4.4.1 Rates of Parasitism and Community Composition

All three wasp species, U. canaliculatus, D. alloeum, and D. mellea, attacked populations of apple and hawthorn flies at each of the five collecting sites in each of the ten years (2003-2013) that populations were surveyed in the Midwest, while only D. alloeum and D. mellea were detected parasitizing blueberry flies (Fig. 4.1; Table C.1).

Rates of parasitism differed among apple, hawthorn, and blueberry flies (F2, 336 = 47.77, P

< 0.0001). Total parasitism was highest for hawthorn flies (mean 24.4  1.2%, range =

5.7–42.0%), followed by blueberry flies (mean: 17.1  2.6%, range = 8.0–34.8%), and apple flies (12.2  1.5%, range = 4.5–48.1%). In addition, rates of parasitism also differed significantly among species (F2, 336 = 195.18, P < 0.0001). The most common parasitoid across all fly hosts was D. alloeum (mean = 12.2  0.7%, range = 2.5–31.5%), followed by U. canaliculatus (mean = 4.7  0.2%, range = 0.8–14.1%), and D. mellea

(mean = 1.91  0.4%, range = 0.1–9.8%) (Fig. 4.1, Table C.1). The pattern was consistent at every site and across all years of the survey, implying that the composition of the parasitoid community is relatively constant and that the three wasp species stably co-exist across the Midwestern U.S.

113

Figure 4.1: Mean percent parasitism  SE of blueberry, apple, and hawthorn flies by U. canaliculatus, D. mellea and D. alloeum wasps estimated from a population survey conducted across five sites in the Midwestern U.S. from 2003-2013. See Table C.1 for details of the collecting site locations and a breakdown of parasitism rates for each wasp species for each fly host at each site in each year of the survey.

4.4.2 Resource Limitation

Results from the rearing of individual fly puparium indicated that host fly resources were completely consumed by wasps (Fig. 4.2). From 1,125 puparia reared from field collected hawthorn fruit sampled in 2009, a total of 630 adult flies (56.0%) and

134 parasitoids (11.9%) eclosed. From 960 puparia reared from field collected apple fruit sampled in 2010, a total of 518 adult flies (54%) and 55 parasitoids (5.7%) eclosed.

Dissection of the pupal cases of the 189 parasitized apple and hawthorn flies under a

114

)LJXUH $ (PSW\ 5KDJROHWLV SRPRQHOOD SXSDO FDVHV IURP ZKLFK D SDUDVLWRLGZDVSHPHUJHGDQG % DQHPSW\GLVVHFWHGSXSDOFDVHWKDWLVGHYRLG RIKRVWIO\UHVRXUFHV3KRWRFUHGLW+DQQHV6FKXOHU

PLFURVFRSHUHYHDOHGWKDWLQHYHU\LQVWDQFHKRVWUHVRXUFHVZHUHFRPSOHWHO\FRQVXPHG

)LJ $WWHPSWVWR3&5DPSOLI\D5KDJROHWLVVSHFLILFPLFURVDWHOOLWH3IURP

SDUDVLWL]HGSXSDOFDVHV Q HDFKIURPDSSOHDQGKDZWKRUQRULJLQIOLHV ZHUH

XQVXFFHVVIXOIXUWKHUVXSSRUWLQJWKHREVHUYDWLRQVWKDWZDVSVHQWLUHO\FRQVXPHGIO\KRVWV

1RPRUHWKDQRQHZDVSHFORVHGIURPHDFKSDUDVLWL]HGSXSDULXPLPSO\LQJWKDWLI

PXOWLSDUDVLWLVPRIWKHVDPHIO\RFFXUVWKHQFRQWHVWFRPSHWLWLRQIRUOLPLWLQJUHVRXUFHV

DPRQJLPPDWXUHZDVSVIRUOLPLWLQJUHVRXUFHVLVVHYHUH

4.4.3 Multiple Parasitism

Genetic testing of newly emerging larvae from host fruit and newly pupariating flies indicated that multiparasitism of Rhagoletis is common (Table C.3). The mean percentage of total parasitism (single and multiple attack) estimated from genetic analysis of larvae and newly formed puparia was 25.8% for hawthorn flies (n = 592), 19.9% for blueberry flies (n = 256), and 11.7% for apple flies (n = 592). These values closely approximated parasitism rates in the Midwestern U.S. determined from the field surveys above (hawthorn = 24.4%, blueberry = 17.1%, apple = 12.2%), suggesting that encapsulation or other fly defense mechanisms may not be a significant source of parasitoid mortality following pupariation. A substantial proportion of parasitized flies were attacked by more than one wasp species (mean across hosts = 45.8%).

Multiparasitism rates varied significantly, however, among blueberry (27.5%), hawthorn

(49.0%), and apple (60.9%) flies. Most instances of multiple parasitism involved attack from two different wasp species; in only two cases were all three parasitoid taxa detected attacking the same R. pomonella host (once each for apple and hawthorn flies).

Multiparasitism rates increased in relation to host fruit size from blueberries (smallest fruit with mean radius = 0.75), to hawthorns (radius = 1.6 cm), to apples (largest fruit with mean radius = 5.2 cm) (Prokopy et al. 1985, Feder 1995, Hamerlinck et al. 2016)

(Table C.3). The relationship between multiparasitism rate and fruit size suggests that fly larvae may be less vulnerable to attack in larger fruit (apple flies had the lowest overall levels of parasitism in the study), but that when flies are exposed in larger fruit they are subject to increased oviposition from multiple wasp species (apple flies had the highest percentage of multiparasitism). 116

The high proportion of multiparasitism implies that wasps, at least interspecifics, are not avoiding one another. The egg parasitoid U. canaliculatus oviposits before the larval parasites D. alloeum and D. mellea, and, thus, is not capable of selecting fly hosts to avoid sharing resources with other wasps. However, female D. alloeum and D. mellea, in principle, may be capable of such a choice. Nevertheless, observed levels of double parasitism between D. mellea and U. canaliculatus for hawthorn and apple flies (1.0% and 0.8%, respectively) were not lower than predicted rates assuming random oviposition

(1.1% and 0.3%, respectively, calculated as the product of the overall parasitism rates for the two wasps). Indeed, in the case of apple flies, the observed multiparasitism rate was actually statistically greater than the predicted value of expected double parasitism assuming oviposition independence (Chi-squared test = 9.28, P = 0.002, 1 df). The most common parasitoid D. alloeum also showed greater rates of multiparasitism than would be predicted by random association (observed rate of double parasitism for D. alloeum with U. canaliculatus vs. predicted level for hawthorn = 5.9% vs. 2.3%, and apple =

3.9% vs. 0.6%; observed double parasitism of D. alloeum with D. mellea vs. predicted for hawthorn = 5.7% vs. 1.4%, apple = 2.4% vs. 0.3%, and blueberry = 2.4% vs. 0.2%; P <

0.0001 in all cases as determined by Chi-squared tests with 1 df). Thus, it would appear that D. alloeum attacks any fly larva it detects and not uncommonly these individuals are already parasitized by another wasp. The genetic assays did not allow measurement of multiparasitism by conspecifics. Future studies are required to determine if wasps avoid ovipositing into hosts that are parasitized by conspecifics.

117

4.4.4 Evidence of Interspecific Competition and a Competitive Hierarchy

Results from the genetic analysis of time staged fly samples provided evidence for interspecific contest competition among parasitoids, further argued against encapsulation following pupariation as a cause of wasp mortality, and supported a competitive hierarchy in order of increasing competitive ability from D. mellea to U. canaliculatus to

D. alloeum. Strong evidence for contest competition was evident from rates of multiple parasitism for newly eclosing fly larvae and pupariating flies decreasing from 2.4%,

7.1%, and 12.7% of blueberry, apple and, hawthorn flies, respectively, to 0% by 20 day post puparium formation for all three fly hosts (Fig. 4.3, Table C.3). Thus, no fly was parasitized by more than one wasp species in any of the staged samples by day 20.

Overall parasitism rates for D. alloeum attacking blueberry, apple, and hawthorn flies remained essentially constant, however, across the staged samples (range ~ 17-19%, 6-

8%, and 17-18%, respectively, across staged samples). Therefore, D. alloeum did not appear to die during the experiment, discounting encapsulation. Rather, the results imply that D. alloeum outcompeted and ate interspecific wasps they shared the same host fly with. Consequently, all cases of multiparasitism involving D. alloeum were transformed into parasitism by a single surviving D. alloeum by day 20 and, thus, the parasitism rate for the wasp did not change with time.

When restricting the genetic analysis to just those flies parasitized by D. mellea and U. canaliculatus alone or in combination, U. canaliculatus appeared to be a superior competitor to D. mellea. Parasitism rates for U. canaliculatus attacking apple and hawthorn flies remained relatively constant across the staged samples compared to D. mellea, while the latter species decreased with time (apple: r2 = 0.66, P = 0.01; 118

hawthorn: r2 = 0.77, P = 0.004) (Fig. 4.3, Table C.3). Thus, in the absence of D. alloeum,

U. canaliculatus did not appear to die in the experiment, but rather outcompeted and consumed D. mellea in shared fly hosts. Rates of single parasitism by D. mellea considered alone in the absence of D. alloeum and U. canaliculatus were essentially constant or slightly increased through time for staged blueberry and apple fly samples

(Fig. 4.3F, Table C.3) There was a slight, but non-significant trend, for single parasitism rates for D. mellea attacking hawthorn flies to decrease with time (r2 = 0.42, P = 0.08).

Thus, in the absence of interspecific competitors, D. mellea did not appear to die during the course of the genetic study as the result of encapsulation or other unknown causes, although further work is needed to confirm this finding for the hawthorn fly attacking population of the wasp.

4.4.5 Temporal and Spatial Resource Partitioning

Evidence from adult eclosion curves, sweep netting of adults, and rearing studies of infested fruit indicated that U. canaliculatus, D. mellea, and D. alloeum temporally subdivide shared host fly resources. Eclosion times of wasps significantly differed in a consistent manner within each host fly taxa attacked, with U. canaliculatus eclosing the earliest, followed by D. mellea, and D. alloeum (Fig. 4.4; Table 4.1). As a result, estimates of TI between heterospecific wasp species attacking the same fly hosts ranged from 75%, 11-71%, and 13-41%, for blueberry, apple and hawthorn fly origin wasps, respectively (Table 4.2).

The temporal distributions of field caught adult wasps determined from sweep net studies of blueberry, apple, and hawthorn host plants mirrored the differences observed in

120

Figure 4.4: Cumulative eclosion curves for Rhagoletis flies (diamond symbols) and infesting (A) blueberry, (B) apple, and (C) hawthorn host plants and the parasitoid wasps U. canaliculatus (squares), D. mellea (triangles), and D. alloeum (circles) attacking the flies. See Table 4.1 for mean eclosion times  SE and Kolmogorov–Smirnov significance tests for differences in eclosion time among populations. eclosion time, with U. canaliculatus captured the earliest in the season, followed by D. mellea, and then D. alloeum (G-tests: P < 0.0001 in all cases) (Fig. 4.5, Table C.4). We also found a significant interaction in ANOVA analyses between wasp species and collecting date for blueberry (F10, 10 = 7.20, P = 0.002), apple (F10, 10 = 12.62, P = 0.0002), and hawthorn (F10, 10 = 15.21, P = 0.005) host plants. As a result, TI between interspecific populations of adult wasps in the field based on the sweep net data ranged from 84%, 32-

121

83%, and 39-86%, for parasitoids attacking blueberry, apple, and hawthorn flies, respectively (Table 4.2).

Utetes canaliculatus, D. mellea, and D. alloeum also differed significantly in where they were captured on host plants (G-test: P < 0.01 in all cases). A greater number of U. canaliculatus were caught in the canopy of apple (86%, P = 0.0006, n = 22, as determined by Chi-squared test for 50:50 expectation) and hawthorn trees (76%, P =

0.005, n = 29) compared to abscised fruit beneath trees (Fig. 4.5). Adult D. mellea also tended to be netted in roughly equal proportions in the canopy of blueberry (67%, P =

0.41, n = 6), apple (47%, P = 0.81, n = 17) and hawthorn plants (63%, P = 0.24, n = 16) than from fruit on the ground (Fig. 4.5). In contrast, D. alloeum were captured most often from apple (71%, P = 0.003, n = 49) and hawthorn ground fruit (81%, P = 0.0001, n =

99), and in equal proportions from blueberry bushes versus ground fruit (ground = 48%,

P = 0.85, n = 29). As a result, ANOVA revealed a significant two-way interactions between species and sampling location (canopy versus ground) for apple hosts only (F2, 12

= 4.92, P = 0.03). Further studies are needed to discern whether the spatial differences in where wasps were captured reflect differences in their search behavior or are an outcome of the differences in their seasonal distributions. As fruit initially present on hosts will increasingly abscise and be found on the ground beneath plants as the season progresses, early eclosing U. canaliculatus will naturally be found in greater numbers on unabscised fruit compared to the later eclosing D. alloeum on fallen fruit on the ground.

The seasonal differences in eclosion time affecting the distribution of adult wasps in the field subsequently translated into differences in the temporal pattern of parasitoids attacking host flies in the rearing study of infested fruit. As before, U. canaliculatus was 122

TABLE 4.1:

NUMBER OF DAYS TO ECLOSION AND STATISTICAL DIFFERENCES IN

CUMULATIVE ECLOSION CURVES BETWEEN DIFFERENT WASP ATTACKING

THE SAME AND DIFFERENT FLY HOSTS

Host plant Species Mean days to eclosion  SE Blueberry R. mendax 48.65 ± 0.33 (632) D. mellea 70.31 ± 1.28 (36) D. alleoum 90.66 ± 0.76 (100) Apple R. pomonella 58.53 ± 0.29 (1827) U. canaliculatus 80.02 ± 0.92 (108) D. mellea 89.57 ± 0.81 (28) D. alloeum 99.86 ± 0.53 (128) Hawthorn R. pomonella 68.36 ± 0.24 (3540) U. canaliculatus 95.83 ± 0.94 (140) D. mellea 103.90 ± 1.71 (48) D. alloeum 113.92 ± 0.62 (393) Host plant Within host comparison D P Blueberry Dm and Da 0.19 0.001 Apple Uc and Dm 0.29 0.000001 Uc and Da 0.36 0.00000001 Dm and Da 0.15 0.02 Hawthorn Uc and Dm 0.15 0.03 Uc and Da 0.21 0.001 Dm and Da 0.14 0.03 Host plant Between host comparison D P Blueberry vs. Apple D. mellea 0.25 0.0001 D. alloeum 0.17 0.01 Blueberry vs. Hawthorn D. mellea 0.37 0.00000001 D. alloeum 0.27 0.00001 Apple vs. Hawthorn U. canaliculatus 0.20 0.005 D. mellea 0.25 0.0002 D. alloeum 0.21 0.001 Note: Abbreviations: (D. alloeum [Da], D. mellea [Dm] and U. canaliculatus [Uc]). Sample sizes are given in parentheses and collecting sites for study are listed in Table C.4. Also given are D statistics and probability values (P) for K-S tests between cumulative eclosion curves of different wasp attacking the same and different fly hosts, as indicated. 123

TABLE 4.2:

TEMPORAL ISOLATION BETWEEN WASP SPECIES ATTACKING THE SAME

AND DIFFERENT FLY HOSTS BASED ON ADULT ECLOSION TIME, SWEEP

NET STUDIES AND WASPS REARED FROM FIELD COLLECTED FRUIT.

Study Host Within host comparison TI Eclosion study Blueberry Dm and Da 74.73 Apple Uc and Dm 11.45 Uc and Da 70.85 Dm and Da 46.24 Hawthorn Uc and Dm 13.33 Uc and Da 41.09 Dm and Da 26.71 Sweep net study Blueberry Dm and Da 84.28 Apple Uc and Dm 31.79 Uc and Da 74.20 Dm and Da 82.84 Hawthorn Uc and Dm 38.92 Uc and Da 73.45 Dm and Da 86.46 Rearing study Blueberry Dm and Da 65.49 Apple Uc and Dm 77.39 Uc and Da 85.60 Dm and Da 64.50 Hawthorn Uc and Dm 68.65 Uc and Da 87.00 Between host comparison Eclosion study Blueberry vs. Apple One species 5.77 Dm 83.17 Da 11.21 Blueberry vs. Hawthorn One species 42.84 Dm 93.91 Eclosion study Blueberry vs. Hawthorn Da 58.73 Apple vs. Hawthorn One species 35.65 Uc 49.73

124

TABLE 4.2 (CONTINUED)

Study Host Between host comparison TI Eclosion study Apple vs. Hawthorn Dm 36.36 Da 43.33 Sweep net study Blueberry vs. Apple One species 34.25 Dm 67.10 Da 50.66 Blueberry vs. Hawthorn One species 66.80 Dm 90.02 Da 93.74 Apple vs. Hawthorn One species 43.68 Uc 44.40 Dm 63.22 Da 55.17 Rearing study Blueberry vs. Apple One species 40.33 Dm 71.84 Da 59.75 Blueberry vs. Hawthorn One species 67.14 Dm 98.32 Da 93.16 Apple vs. Hawthorn One species 37.21 Uc 75.54 Dm 74.44 Da 57.33 Note: Abbreviations: D. alloeum (Da), D. mellea (Dm) and U. canaliculatus (Uc). Also given for between host comparisons are TI estimates if only a single wasp taxon were to utilize the entire resource distribution of each alternative fly hosts (designated one species), as a baseline for evaluating the effects of the presence of interspecific parasitoids on increasing temporal isolation. reared in highest proportion from fruit sampled earliest in the season at sites, followed by

D. mellea, and then D. alloeum from later collected fruit (G test: P < 0.001 in all cases).

We also found a significant interaction in ANOVA analyses between wasp species and collecting date for blueberry (F10, 10 = 48.78, P = 0.0001), apple (F10, 10 = 15.86, P =

0.0001), and hawthorn (F10, 10 = 14.61, P = 0.0001) host fruit (Fig. 4.6, Table C.4).

Indeed, D. alloeum was completely absent from apple and hawthorn fruit collected

125

D. mellea and U. canaliculatus were reared at low numbers or absent from fruit collections. Temporal isolation (TI) between wasp species based on the rearing study of field collected fruit ranged from 65%, 65-86%, and 59-87%, for blueberry, apple and hawthorn fly origin wasps, respectively (Table 2).

126

The spatial partitioning of host use observed in the sweep net data extended to parasitoids reared from field collected fruit, as well (G-test: P < 0.01 in all cases).

Significantly higher percentages of U. canaliculatus were reared from tree picked versus ground collected apple (85%, P = 0.0001, n = 108, as determined by Chi-squared test for

50:50 expectation) and hawthorn fruit (92%, P = 0.0001, n = 140). In comparison, more equitable proportions of D. mellea were reared from canopy vs. ground fruit (canopy apple = 50%, P = 1.0, n = 8; hawthorn = 63%, P = 0.08, n = 48), while D. alloeum predominated in ground collected fruit (apple = 65%, n = 128, P = 0.0008; hawthorn =

66%, n = 393) (Fig. 4.6). In blueberries, where U. canaliculatus was not present, D. alloeum were reared from plant vs. ground collected fruit in equal proportions (canopy =

54%, P = 0.48, n = 99), while a higher proportion of D. mellea were reared from fruit picked off bushes (75%, P = 0.003, n = 36) (Fig. 4.6). Consequently, ANOVA revealed a significant interaction between species and sampling location (canopy vs. ground) for blueberry (F2, 10 = 6.49, P = 0.02), apple (F2, 10 = 6.72, P = 0.01), and hawthorn hosts (F2,

10 = 5.55, P = 0.02).

4.4.6 Morphometrics

Based on adult hind tibia length, D. alloeum was the largest parasitoid attacking all three host flies (blueberry = 1.04 ± 0.01 mm, n = 12; apple = 1.23 ± 0.02 mm, n = 38; hawthorn = 1.29 ± 0.02 mm, n = 109), followed by D. mellea (blueberry = 0.94 mm ±

0.02, n = 10; apple = 1.01 ± 0.02 mm, n = 17; hawthorn = 1.00 ± 0.01 mm, n = 33), and

U. canaliculatus (apple = 0.84 ± 0.01 mm, n = 25; hawthorn = 0.89 ± 0.01 mm, n = 394)

(Fig. 4.7). For D. alloeum and D. mellea, wasps reared from apple and hawthorn flies 127

Figure 4.6: Percent parasitism ± SE across sites of blueberry-, apple- and hawthorn- infesting flies by U. canaliculatus, D. mellea and D. alloeum from the rearing study of infest fruit collected directly from host plants (grey circles) and the ground beneath host plants (black circles) at six different sampling times through the field season. The number of parasitoids caught at each location at each site and sampling time is given Table C.4. were larger than those attacking blueberry flies. Diachasma alloeum females also had longer wings (blueberry: 2.06 ± 0.01 mm; apple: 2.31 ± 0.02 mm; hawthorn: 2.46 ± 0.02 mm) and ovipositors (blueberry: 2.41 ± 0.02 mm; apple: 3.58 ± 0.06 mm; hawthorn: 3.4

± 0.05 mm) than D. mellea (wing length blueberry: 1.91 ± 0.01 mm; apple: 1.93 ± 0.09 mm; hawthorn: 1.94 ± 0.03 mm; ovipositor length blueberry: 2.21 ±0.03 mm; apple: 3.29

± 0.11 mm; hawthorn: 3.11 ± 0.09 mm) and U. canaliculatus (wing length apple: 1.61

128

±0.03 mm; hawthorn: 1.75 ± 0.03 mm; ovipositor length apple: 0.57 ± 0.03 mm; hawthorn: 0.61 ± 0.03 mm). Although smaller in absolute size, after standardizing for tibia length (a measure of body size), D. mellea and U. canaliculatus tended to proportionately have larger wing lengths than D. alloeum (Fig. 4.7). In addition, D. mellea females possessed relatively longer ovipositors than Diachasma alloeum, with the difference being more pronounced for wasps attacking flies infesting the larger-sized hawthorn and apple fruit, than blueberries (Fig.4.7). As would be expected, the egg parasitoid U. canaliculatus consistently had the shortest ovipositor. Thus, D. mellea and

U. canaliculatus may have relatively greater dispersal capacity than D. alloeum, and D. mellea a comparatively longer ovipositor useful for attacking younger fly larvae feeding more internally in host fruit.

4.4.7 Interspecific Competition and Allochronic Isolation

Conspecific populations of U. canaliculatus, D. mellea, and D. alloeum attacking blueberry, apple, and hawthorn flies differed in their eclosion times, seasonal distributions as adults on host plants, temporal patterns parasitizing flies in host fruit

(Figs. 4.3-4.6; Tables 4.1, 4.2). The three wasp species were collectively captured earliest in the season on blueberries, then apples, and finally hawthorns (G =173.24, P <

0.00001), following the chronology that fruit ripen on these plants and are infested by flies (Hood et al. 2015). Thus, U. canaliculatus, D. mellea, and D. alloeum temporally subdivide fly resources they share in common, have shifted their life histories to attack different host flies having different seasonalities, and maintain the same relative phenology to one another across plant and fly hosts. Consequently, the temporal 129

Figure 4.7: (A, D and E) Frequency of hind tibia lengths (a measure of body size), (B, E and H) wing size standardized by body size, and (C, F and I) ovipositor length standardized by body size for D. alloeum (Da = open circles), D. mellea (Dm = gray squares) and U. canaliculatus (Uc = black triangles) attacking blueberry-, apple- and hawthorn-infesting flies. Note that each axis is scaled differently. narrowing of resource windows among heterospecific wasps attacking the same fly generates increased allochronic isolation between U. canaliculatus, D. mellea, and D. alloeum populations attacking different hosts when compared to if each wasp parasitize a given fly alone and could utilize the entire resource distribution (Table 4.2). Considering the results for the rearing study of field collected fruit, which reflects both the effects of 130

temporal premating isolation and subsequent survivorship (competition) in causing reproductive isolation between conspecific wasps attacking different hosts, TI values between conspecific pairs of wasps increased by 48-78% between blueberry and apple fly hosts, 39-46% between blueberry and hawthorn fly hosts, and 54-103% between apple and hawthorn hosts when interspecific competitors were present compared to values estimated in their absence (Table 4.2).

4.5 Discussion

Through a series of rearing experiments, field observations, and genetic analyses, we showed that parasitoid wasps attacking Rhagoletis flies compete for limited resources and a competitive hierarchy exists among wasp species in order of dominance from D. alloeum, to U. canaliculatus, to D. mellea. Thus, it appears competition is mitigated among the three wasps by their temporal subdivision of shared host fly resources, enabling their co-existence. The seasonal subdivision of fly resources is accentuating allochronic isolation among conspecific wasps attacking different host flies, generating increased reproductive isolation and potentially facilitating population divergence and speciation across the wasp community (Forbes et al. 2009, Hood et al. 2015). Future manipulative experiments and next-generation DNA sequencing studies are needed to further quantify the mechanisms and more directly measure the effects of competition on resource partitioning and genome divergence for the wasps. Work is currently underway evaluating whether the reduced adult life spans and narrower seasonal resource windows of wasps translates into greater allochronic reproductive isolation, and consequently

131

increased host-related genomic and population divergence along the speciation continuum, in the parasitoids compared to their Rhagoletis fly hosts.

It is noteworthy that the competitive hierarchy among Rhagoletis parasitoids appears to be absolute. Whenever D. alloeum parasitizes a fly with another wasp present it dominates in a winner take all contest. Thus, although U. canaliculatus oviposits into eggs and D. mellea tends to oviposit into earlier instar larvae than D. alloeum, this temporal head start does not translate into a competitive advantage for these two wasps versus D. alloeum, as is the case in other parasitoid systems (Cusumano et al. 2012,

Harvey et al. 2013). At fly pupariation, when parasitoid eggs hatch, if D. alloeum is present, then it devours its interspecific competitors, as well as any conspecific wasp present. This advantage may stem, in part, from early instar D. alloeum larvae possessing large sickle-shaped mandibles (G. Hood, pers. obs.) that make them better equipped for battle during direct interactions with heterospecifics (Godfrey 1987, Harvey and

Partridge 1987, Harvey et al. 2000, van Nouhuys and Punju 2009). It is not known whether U. canaliculatus or D. mellea possess similar mandibles. In addition, adult D. alloeum are larger than U. canaliculatus and D. mellea, which may mean that D. alloeum eggs and larvae are also larger. If this is true, even if immature U. canaliculatus or D. mellea did possess fighting mandibles, they would still find themselves in an undersized gladiator-like death match of “David vs. Goliath” like proportions with the superior opponent which they may be doomed to lose (Harvey and Partridge 1987). Indeed, larger egg size (DeMoraes et al. 1999), larval size (Marktl et al. 2002: Yamamoto et al. 2007) and greater larval aggression and motility (Salt 1961: Boivin and van Baaren 2000;

132

Pexton et al. 2003; Pexton and Mayhew 2004) have been linked to success during interspecific competition in several other parasitoid systems (Harvey and Partridge 1987).

Thus, from a competitive standpoint, there would appear to be nothing impeding D. alloeum from shifting its life history earlier to broaden the temporal range of fly larvae it attacks. Why is this not occurring?

We hypothesize that niche specialization, rather than interspecific competition, is likely responsible for D. alloeum having a comparatively late life history and attacking more fully developed larval hosts than the other two wasps. Third instar fly larvae may be the most optimal life stage for wasps to parasitize to maximize survivorship and fecundity. Late instar fly larvae will have a higher probability of survival to pupariation than earlier host life stages and may predictively be larger and have more host resources available for wasps at the time of pupariation. Thus, D. alloeum may be ecologically, rather than competitively, adapted to having a relatively late phenology to synchronize its life history with the larval resource window of highest quality. In this regard, there would appear to be no genetic constraint to D. alloeum broadening the temporal range of fly larvae it attacks, as the wasp appears to have ample standing variation to eclose earlier (or later), having already evolved to attack different fly taxa infesting host plants that fruit throughout the season (Forbes et al. 2009, 2010, Hood et al. 2015). However, temporal niche expansion is not occurring nor may it be ecologically favored for D. alloeum because later instar fly larvae are superior resources and are sufficiently available such that the potential benefits of reduced intraspecific competition do not outweigh the

133

reduction in fitness associated with parasitizing earlier instar larvae, given the limited life span (< 2 weeks) of adult wasps.

We cannot, however, completely discount the possibility that the earlier life histories of U. canaliculatus and D. mellea may provide an advantage through other means, such as via the chemical or microbial killing of D. alloeum eggs or the triggering of the fly immune system to induce encapsulation (i.e., physiological suppression;

Cusumano et a1 2012, Harvey et al. 2013). Such effects are not uncommon and have been documented in a number of other parasitoid systems (Strand 1986; Harvey 2005;

Pennacchio and Strand 2006). However, there are reasons to believe that this is not the case in the Rhagoletis system, including that D. alloeum is not avoiding ovipositing into fly larvae already parasitized by U. canaliculatus and/or D. mellea. Indeed, rates of multiple parasitism at pupariation are significantly higher than predicted by chance, which is not expected if D. alloeum was being negatively affected by U. canaliculatus or

D. mellea prior to host pupariation.

The increased allochronic isolation of U. canaliculatus attacking different flies appears due to a combination of ecological specialization and interspecific competition.

Our staged genetic experiment implies that U. canaliculatus is always outcompeted by D. alloeum. Utetes canaliculatus is an egg parasitoid, it is smallest in adult size, and females have the shortest ovipositors. Thus, even if U. canaliculatus could attack later instar fly larvae, there are physical limitations to it effectively doing so. Attacking fly eggs is an open niche, representing the first life stage available for parasitism. Although it is competitively inferior, not all flies parasitized by U. canaliculatus will be subsequently

134

attacked as larvae by D. alloeum. Thus, specializing on eggs may be an adaptive strategy ameliorating interspecific competition sufficiently to allow U. canaliculatus to co-exist with D. alloeum. Increased multiparasitism of fly larvae feeding later in the season may limit the temporal window of U. canaliculatus to successfully attacking the earliest portion of eggs oviposited by a particular host species of fly. The reason for this is that fly eggs laid later in the season are likely to share host fruit with other fly larvae and/or insects such as plum curculio and micro lepidopteran that are further along developmentally. Previous studies have shown that when these fly eggs hatch and feed as maggots, they tend to be forced by larger conspecifics and interspecific competitors toward the surface of fruit, where they experience higher parasitism rates (Feder 1995,

Feder et al. 1995). As a result, seasonally late fly eggs parasitized by U. canaliculatus have a much greater chance of being detected and attacked by D. alloeum. The increased

TI between U. canaliculatus and D. alloeum based on parasitoids reared from apple and hawthorn fruit (85.6% and 87%, respectively) compared to field captured adults (74.2% and 73.5%, respectively) is consistent with this hypothesis.

The reason that U. canaliculatus does not parasitize blueberry flies must still be resolved, however. One possibility is that the seasonal distribution of R. mendax eggs in early fruiting blueberries is too early for U. canaliculatus to track. However, given that R. mendax has evolved to terminate diapause and eclose early enough to utilize blueberries as a host fruit, it would seem that U. canaliculatus would be able to as well. A second possibility may be that the small size of blueberry fruit and R. mendax flies means that the fly eggs may be too small to detect or for wasps to successfully oviposit into. In

135

addition, the smaller fruit size of blueberries may also mean that a high proportion of developing fly larvae parasitized by U. canaliculatus as eggs are susceptible to attack from D. alloeum prior to pupariation, however, our extensive population surveys and others (Forbes et al. 2010) did not reveal a single U. canaliculatus attacking blueberry flies. Nevertheless, while this scenario may be possible, why D. mellea would not also be excluded from blueberries is an open question.

Finally, D. mellea is outcompeted by both U. canaliculatus and D. alloeum. The results from the current study strongly imply that competition from D. alloeum, in particular, is narrowing the temporal resource window for D. mellea to attack less mature second and third instar larvae than are likely optimum for wasp fitness. Ecological and morphological considerations may be restricting D. mellea from evolving an earlier life history and attacking less well developed fly larvae. Given its smaller size and shorter ovipositor, D. mellea is not capable of attacking these larvae, as following hatching, fly larvae tunnel toward the center of fruit to feed and develop during early instar stages

(Feder 1995, Feder et al. 1995). Moreover, the presence of U. canaliculatus in apples and hawthorns precludes the egg niche from D. mellea.

How then does D. mellea persist despite faring so poorly in direct contest competition? First, our morphometric analysis suggests that D. mellea is a strong disperser compared to the other wasps, when scaled for body size, being better equipped for long distance dispersal (Sivinski and Dodson 1992; Sekar 2012). Second, D. mellea possesses a relatively longer ovipositor than the other two wasps. Hence, D. mellea may be more efficient in searching and finding a comparatively wider range of developing fly

136

larvae for oviposition than D. alloeum. As a result, D. mellea may locally persist by attacking enough fly larvae that D. alloeum does not subsequently detect. The wasp may also be able to globally persist by being better able to track flies as they colonize new areas in response to spatial and temporal vagaries in host fruiting success across the landscape, a proposed mechanism of co-existence for other parasitoid species that are inferior larval competitors (Amarasekare 2000). Additional work is needed to confirm or reject the dispersal hypothesis for D. mellea. Third, U. canaliculatus and D. mellea occasionally attack the undescribed flowering dogwood fly (host: Cornus florida), not parasitized by D. alloeum. In addition, D. mellea parasitizes the eastern cherry fruit fly,

R. cingulata (host: Prunus serotina, black cherry). Flowering dogwood has a late phenology, with fruit ripening 2-3 weeks after hawthorns in the Midwest (Forbes et al.

2010, Hood et al. 2015). The late fruiting time of C. florida may preclude attack from the comparatively late eclosing D. alloeum. Black cherry fruit contain cyanide compounds which may inhibit U. canaliculatus and D. alloeum from attacking R. cingulata (Swain et al. 1992). While speculative, it is possible that these alternate host flies lacking D. alloeum could serve as source populations for D. mellea attacking blueberry, apple, and hawthorn flies. We consider this latter hypothesis less likely than the alternatives, however, because microsatellites imply that flowering dogwood and black cherry wasps are much more highly genetically diverged, than blueberry, apple, and hawthorn populations are from each other (Hood et al. 2015).

The absolute nature of the competitive hierarchy among Rhagoletis parasitoids regardless of oviposition order differs from the majority of studies on parasitoids reported

137

in the literature (i.e. Force 1974, Slansky 1996, Cusumano et al. 2012, Harvey et al.

2013). In a meta-analysis, Hood et al. (in prep.) found that in 50 of 64 studies (78%) in which pairs of parasitoid species were manipulated to oviposit at different times in insect hosts, offspring of the parasitoid ovipositing earliest experienced a competitive advantage. Moreover, in 37 of these experiments, the survivorship advantage of the first species increased significantly as a function of increases in the interval between the timing of interspecific oviposition bouts. However, in Rhagoletis, parasitoid eggs do not hatch until after fly larvae have finished feeding and pupariated (Lathrop and Newton

1933, Wharton and Marsh 1978), likely to insure that wasps do not adversely affect host development and that flies reach maximal size while feeding in fruit. The starting line for competition begins at pupariation in the Rhagoletis system, regardless of when a parasitoid egg is oviposited. Thus, the Rhagoletis-parasitoid system appears to be the exception, rather than the rule, in terms of how oviposition timing effects larval competition between parasitoid species. Nevertheless, variation in life history timing is still a critical axis of differentiation and resources partitioning among Rhagoletis parasitoids, allowing multiple host specialists to co-exist and shaping community biodiversity, as is the case in many other systems (Kronfeld-Schor and Dayan 2003).

4.6 Conclusion

Here, we present evidence that temporal subdivision of fly resources is accentuating allochronic isolation among conspecific wasps attacking different

Rhagoletis fly hosts, generating increased reproductive isolation, and potentially

138

facilitating population divergence and speciation. This is just a single case, however.

How often do interspecific competitive interactions results in the temporal subdivision of shared, limiting resource in nature? In a recent review, Kronfeld-Schor and Dayan (2003) stated that “relatively few studies demonstrate a temporal shift that is…competition- induced…[and]…temporal resource partitioning is not perceived as a common mechanisms of co-existence”. We argue that for smaller organisms like parasitoids that can partition resources on a fine scale (Bush 1993), interspecific competition may commonly promotes the temporal subdivision of resources (Loreau 1992). Indeed, a number of examples exist in the different insect groups (e.g., ants: Albrecht and Gotellil

2001; damselflies: Fincke 1992; butterflies, beetles and wasps: Kalapanida and Petrakis

2012; weevils: Venner et al. 2011), but we are not aware of a single examples that has directly linked interspecific competition and the temporal subdivision of resources to increased reproductive isolation and population divergence (Rundle and Nosil 2005,

Hood et al. 2012). Potential test cases exist, however. One involves gall-forming thrips in the genus Kladothrips (Thysanoptera: Phlaeothripidae) and the community of parasitic thrips in the genus Koptothrips that attack the gall-former (Crespi and Abbott 1999).

Similar to the Rhagoletis-parasitoid system, several species of kleptoparasitic thrips are diversifying along with the gall thrips on Acacia plants in Australia. Here, host plant phenology influences the timing of life history in both host and parasite, and parasites compete directly with thrip soliders that guard the gall resource. As a consequence, it has been hypothesized that intense competition between Kopthtrips for gall resources that often plays out in a “mortal combat” might contribute to population divergence (Crespi et

139

al. 2004, Abrahamson and Blair 2008). Similar examples exist in the insect literature (i.e., parasites that attack Eurosta galls on Solidago plants) where multiple species of parasites that share insect hosts are contrained by host phenology, suggesting that co-existence on shared insect hosts resources may be driven by interspecific interactions (reviewed in

Abrahamson and Blair 2008). Given that plant feeding insects and their parasitoids comprise as much as 25-40% of the worlds biodiversity (La Salle and Gauld 1991) and that most insect hosts support multiple parasitoid specialists (Hawkins and Lawton 1987,

Hawkins 1990), the role of interspecific competition in promoting temporal subidivision of shared host resources and generating increased reproductive isolation may be an important process in nature facilitating population divergence and the formation of community-level biodiversity.

4.7 Acknowledgments

Funding was provided to GRH by the Entomological Society of America, Indiana

Academy of Science, Sigma Xi, National Science Foundation (NSF) and an NSF-IGERT

GLOBES Fellowship from the University of Notre Dame, and to JLF and AAF by NSF and to JLF from the USDA. The authors thank P.R. Nelson, D. Bowie, L. Reed, G. Ragland,

S. Berlocher, J. Smith, M. Glover, P. Meyers, H. Schuler, and especially M. Doellman for stimulating discussion and thoughtful insights. GRH also thanks P. Morton and W.

Wamano for encouragement and support.

140

4.8 Literature Cited

Abrahamson, W.G. and Blair, C.P. 2008. Sequential radiation through host-race formation: herbivore diversity leads to diversity in natural enemies in Specialization, Speciation, and Radiation: The Evolutionary Biology of Herbivorous Insects (ed. K.J. Tilmon). University of California Press, Oakland, CA. pp 188-202.

Ackermann, M. and Doebeli, M. 2004. Evolution of niche width and adaptive diversification. Evolution 58:2599-2612.

Agashe, D. and Bolnick, D.I. 2010. Intraspecific genetic variation and competition interact to influence niche expansion. Proceedings of the Royal Society of London B: Biological Sciences 277:2915-2924.

Agrawal, A.A. 2001. Phenotypic plasticity in the interactions and evolution of species. Science 294:321-326.

Albert, A. and Schluter, D. 2004. Reproductive character displacement of male stickleback mate preference: reinforcement or direct selection? Evolution 58:1099-1107.

Albrecht, M. and Gotelli, N.J. 2001. Spatial and temporal niche partitioning in grassland ants. Oecologia 126:134-141.

Amarasekare, P. 2000. Coexistence of competing parasitoids on a patchily distributed host: local vs. spatial mechanisms. Ecology 81:1286-1296.

Berlocher, S.H. 2000. Radiation and divergence in the Rhagoletis pomonella species group: Inferences from allozymes. Evolution 54:543-557.

Berlocher, S.H. and Feder, J.L. 2002. Sympatric speciation in phytophagous insects: moving beyond controversy? Annual Review of Entomology 47:773-815.

Boivin, G., and van Baaren, J. 2000. The role of larval aggression and mobility in the transition between solitary and gregarious development in parasitoid wasps. Ecology Letters 3:469-474.

Bolnick, D.I. 2004. Can intraspecific competition drive disruptive selection? An experimental test in natural populations of sticklebacks. Evolution 58:608-618.

Brown, J.R. and Wilson, E.O. 1956. Character displacement. Systematic Zoology 5:49- 64.

141

Burger, R., Schneider, K.A. and Willensdorer, M. 2006. The conditions for speciation through intraspecific competition. Evolution 60:2185-2206.

Bush, G.L. 1969. Sympatric host race formation and speciation in frugivorous flies of the genus Rhagoletis (Diptera: Tephritidae). Evolution 23:237-251.

Bush, G.L. 1993. A reaffirmation of Santa Rosalia, or why there are so many kinds of small animals? Evolutionary Patterns and Processes, eds Edwards D, Lees DR (Academic Press, New York) pp 229-249.

Butterfield, N.J. 2001. The Ecology of the Cambrian Region. Columbus University Press, New York, NY, USA.

Coyne, J.A. and Orr, H.A. 2004. Speciation. Sinauer, Sunderland, MA.

Crespi, B. and Abbot, P. 1999. The behavioral ecology and evolution of kleptoparasitism in Australina gall thrips. Florida Entomologist 82:147-164.

Crespi, B.J., Morris, D.C. and Mound, L.A. 2004. Evolution of ecological and behavioural diversity: Australian Acacia thrips as model organisms. Australian Biological Resources Study and CSIRO Entomology, Canberra, Australia.

Cusumano, A., Peri, E., Vinson, B. and Colazza, S. 2012. Interspecific extrinsic and intrinsic competitive interactions in egg parasitoids. Biocontrol 57:719-734.

Dayan, T. and Simberloff, D. 2005. Ecological and community wide character displacement: the next generation. Ecology Letters 8:875-894.

Dieckmann, U. and Doebeli, M. 1999. On the origin of species by sympatric speciation. Nature 400:354-357.

Dobeli, M. 1996. A quantitative genetic competition model for sympatric speciation. Journal of Evolutionary Biology 9:893-909.

142

Doebeli, M. and Dieckmann, U. 2000. Evolutionary branching and sympatric speciation caused by different types of ecological interactions. The American Naturalist 156:S77-S101.

Drossel, B. and McKane, A. 2000. Competitive speciation in quantitative genetic models. Journal of Theoretical Biology 204:467-478.

DeMoraes, C.M., Cortesero, A.M., Stapel, J.O. and Lewis, W.J. 1999. Intrinsic and extrinsic competition between two larval parsitoids of Heliothis virescens. Ecological Entomology 24:402-410.

Emerson, B.C. and Kolm, N. 2005. Species diversity can drive speciation. Nature 434:1015-1017.

Erwin, D.H. 2005. Seeds of diversity. Science 57:168-172.

Erwin, D.H. 2008. Macroevolution of ecosystem engineering, niche construction and diversity. Trends in Ecology and Evolution 23:168-172.

Feder, J.L., Chilcote, C.A. and Bush, G.L. 1988. Genetic differentiation between sympatric host races of the apple maggot fly, Rhagoletis pomonella. 336:61-64.

Feder, J.L. 1995. The effects of parasitoids on sympatric host races of Rhagoletis pomonella (Diptera, Tephritidae). Ecology 76:801-813.

Feder, J.L., Reynolds, K., Go, W. and Wang, E.C. 1995. Intra- and inter-specific competition and host race formation in the apple maggot fly, Rhagoletis pomonella (Diptera: Tephritidae). Oecologia 101:416-425.

Feder, J.L. Forbes, A.A. 2010. Sequential divergence and the diversity of parasitic insects. Ecological Entomology 35:67-76.

Filchak, K.E., Roethele, J.B. and Feder, J.L. 2000. Natural selection and sympatric divergence in the apple maggot Rhagoletis pomonella. Nature 407:739-742.

143

Fincke, O.M. 1992. Interspecific competition for tree holes: consequences for mating systems and coexistence in neotropical damselflies. American Naturalist 139:80- 101.

Funk, D.J., Filchak, K. and Feder, J. 2002. Herbivorous insects: model systems for the comparative study of speciation ecology. Genetica 116:251-267.

Fishman, L. and Wyatt, R. 1999. Pollinator-mediated competition, reproductive character displacement, and the evolution of selfing in Arenaria uniflora (Caryophyllaceae). Evolution 53:1723-1733.

Forbes, A.A., Powell, T.H.Q., Stelinski, L.L. Smith, J.J. and Feder, J.L. 2009. Sequential sympatric speciation across trophic levels. Science 323:776-779.

Force, D.C. 1974. Ecology of insect host-parasitoid communities. Science 184:624-632.

Gillespie, J.P., Kanost, M.R. and Trenczek, T. 1997. Biological mediators of insect immunity. Annual Review of Entomology 42:611-643.

Godfray, H.C.J. 1987. The evolution of clutch size in parasitic wasps. American Naturalist 129:221-233.

Grant, P.R. and Grant, B.R. 2006. Evolution of character displacement in Darwin’s finches. Science 313:224-226.

Hamerlinck, G., Lemoine, N.P., Hood, G.R., Abbott, K.C. and Forbes, A.A. 2016. Meek mothers and powerful daughters: effects of the novel host environments and small trait differences on parasitoid competition. Oikos. DOI: 10.1111/oik.02701.

Harvey, P.H. and Partridge, L. 1987. Murderous mandibles and black holes in hymenopteran wasps. Nature 326:128-129.

Harvey, J.A., Corley, L.S. and Strand, M.R. 2000. Competition induces adaptive shifts in caste ratios of a polyembryonic wasp. Nature 406:183-186.

Harvey, J.A. 2005. Factors affecting the evolution of development strategies in parasitoid wasps: the importance of functional constraints and incorporating complexity. Entomologia Experimentalis et Applicata 117:1-13.

Harvey, J.A., Poelman, E.H., Tanaka, T. 2013. Intrinsic inter- and intraspecific competition in parasitoid wasps. Annual Review of Entomology 58:333-351.

144

Hawkins, B.A. and Lawton, J.H. 1987. Species richness for parasitoids of British phytophagous insects. Nature 326:788-790.

Hawkins, B.A. 1990. Global patterns of parasitoid assemblage size. Journal of Animal Ecology 59:57-72.

Hobel, G. and Gerhardt, H.C. 2003. Reproductive character displacement in the acoustic communication system of green tree frogs (Hyla cinerea). Evolution 57:894-904.

Hood, G.R. and Ott, J.R. 2011. Generational shape shifting: changes in egg shape and size between asexual and sexual generations of a cyclically parthenogenic gall former. Entomologia Experimentalis et Applicata 141:88-96.

Hood, G.R., Egan, S.P. and Feder, J.L. 2012. Interspecific competition and speciation in endoparasitoids. Evolutionary Biology 39:219-230.

Johnson, P.A. and Gullberg, U. 1998. Theory and models of sympatric speciation. In D.J. Howard and S.H. Berlocher (Eds.), Endless Forms Species and Speciation (pp. 79-89). Oxford University Press, New York, NY.

Kalapanida, M. and Petrakis, P.V. 2012. Temporal partitioning is an assemblage of insect defoliators feeding on oak on a Mediterranean mountain. European Journal of Entomology 109:55-69.

Kawata, M. 2002. Invasion of vacant niches and subsequent sympatric speciation. Proceedings of the Royal Society B: Biological Sciences 269:55-63.

Kondrashov, A.S. and Kondrashov, F.A. 1999. Interactions among quantitative traits in the course of sympatric speciation. Nature 400:351-354.

Kronfeld-Schor, N. and Dayan, T. 2003. Partitioning of time as an ecological resource. Annual Review of Ecology, Evolution and Systematics 34:153-181.

La Salle, J. and Gauld, I.D. 1991. Parasitic Hymenoptera and the biodiversity crisis. Redia 74:315-334.

Lamichhaney, S., Han, F., Berglund, J., Wang, C., Almen, M.S., Webster, M.T., Grant, B.R., P.R. Grant and Anderson, L. 2016. A break size locus in Darwin’s finches facilitated character displacement during a drought.

145

Lathrop, F.H. and Newton, R.C. 1933. The biology of Opius melleus Gahan, a parasite of the blueberry maggot. Journal of Agricultural Research 46:143-160.

Loreau, M. 1992. Time scale of resource dynamics and coexistence through time partitioning. Theoretical Population Biology 41:401-412.

Marktl, R.C., Stauffer, C. and Schopf, A. 2002. Interspecific competition between the braconid endoparasitoids Glyptapanteles porthetriae and Glyptapanteles liparidis in Lymantria dispar larvae. Entomologia Experimentalis et Applicata 105:97-109.

Mattsson, M., Hood, G.R., Feder, J.L. and Ruedas, L.A. 2015. Rapid and repeatable shifts in life-history timing of Rhagoletis pomonella (Diptera: Tephritidae) following colonization of novel host plants in the Pacific Northwestern United States. Ecology and Evolution 5:5823-5837.

Nosil, P. 2012. Ecological Speciation. Oxford University Press, Oxford.

Pennacchio, F. and Strand, M.R. 2006. Evolution of developmental strategies in parasitic Hymenoptera. Annual Review of Entomology 51:233-258.

Pennings, P.S., Kopp, M., Meszena, G., Dieckmann, U. and Hermisson, J. 2008. An analytically tractable model for competitive speciation. The American Naturalist 171:E44-E71.

Pennisi, E. 2005. What determines species diversity? Science 309:90.

Pexton, J.J., Rankin, D.J., Dytham, C. and Mayhew, P.J. 2003. Asymmetric larval mobility and the evolutionary transition from siblicide to nonsiblicidal behavior in parasitoid wasps. Behavioral Ecology 14:182-193.

Pexton, J.J. and Mayhew, P.J. 2004. Competitive interactions between parasitoid larvae and the evolution of gregarious development. Oecologia 141:179-190.

Pfennig, D.W. and Rice, A.M. 2007. An experimental test of character displacement’s role in promoting postmating isolation between conspecific populations in contrasting competitive environments. Evolution 61:2433-2443.

Pfennig, K.S. and Pfennig, D.W. 2009. Character displacement: ecological and reproductive responses to a common evolutionary problem. Quarterly Review of Biology 84:253-276.

146

Powell, T.H.Q., Forbes, A.A., Hood, G.R. and Feder, J.L. 2014. Ecological adaptation and the reproductive isolation in sympatry: genetic and phenotypic evidence for native host races of Rhagoletis pomonella. Molecular Ecology 23:688-704.

Prichard, J.R. and Schluter, D. 2001. Declining interspecific competition during character displacement: summoning the ghost of competition past. Evolutionary Ecology Research 3:209-220.

Prokopy, R.J., Kallet, C. and Cooley, S.S. 1985. Fruit-acceptance pattern of Rhagoletis pomonella (Diptera: Tephritidae) flies from different geographic regions. Annals of the Entomological Society of America 78:799-803.

Ragland, G.J., Sim, S.B., Goudarzi, S., Feder, J.L. and Hahn, D.A. 2012. Environmental interactions during host race formation: host fruit environment moderates a seasonal shift in phenology in host races of Rhagoletis pomonella.

Rabosky, D.L. 2013. Diversity-dependence, ecological speciation, and the role of competition in marcroevolution. Annual Review of Ecology, Evolution and Systematics 44:481-502.

Ridout, M.S. and Linkie, M. 2009. Estimating overlap of daily activity patterns from camera trap data. Journal of Agricultural, Biological and Environmental Statistics 14:322-337.

Rosenzweig, M.L. 1978. Competitive speciation. Biological Journal of the Linnean Society 10:275-289.

Rundle, H.D. and Nosil, P. 2005. Ecological speciation. Ecology Letters 8:336-352.

Salt, G. 1961. Competition among insect parasitoids. Symposia of the Society for Experimental Biology 15:96-119.

Schluter, D. 2000a. The Ecology of Adaptive Radiation. Oxford University Press, Oxford.

Schluter, D. 2000b. Ecological character displacement in adaptive radiation. American Naturalist S4-S16.

Sekar, S. 2012. A meta-analysis of the traits affecting dispersal ability in butterflies: can wingspan be used as a proxy? Journal of Animal Ecology 81:174-184.

147

Sivinski, J.M. and Dodson, G. 1992. Sexual dimorphism in Anastrepha suspense (Loew) and other tephritid fruit flies (Diptera: Tephritidae): possible roles of developmental rate, fecundity, and dispersal. Journal of Insect Behavior 5:491- 506.

Slansky, F. 1986. Nutritional ecology of endoparasitic insects and their hosts: an overview. Journal of Insect Physiology 32:255:261.

Strand, M.R. 1986. The physiological interactions of parasitoids with their hosts and their influence on reproductive strategies. In J. Waage and D. Greathead (Eds.), Insect Parasitoids. London: Academic Press.

Svanback, R. and Bolnick, D.I. 2007. Intraspecific competition drives resource use diversity within a natural population. Proceedings of the Royal Society of London B: Biological Sciences 274:839-844.

Swain, E., Li, C.P. and Poulton, J.E. 1992. Development of the potential for cyanogenesis in maturing black cherry (Prunus serotina Ehrh.) fruits. Plant Physiology 98:1423-1428.

Teuscher, M., Brandle, M., Traxel, V. and Brandl, R. 2009. Allometry between leg and body length of insects: lack of support for the size-grain hypothesis. Ecological Entomology 34:718-724.

Thompson, J.N. 2004. The Geographic Mosiac of Coevolution. University of Chicago Press, Chicago, IL, USA.

Van Nouhuys, S. and Punju, E. 2009. Coexistence of competing parasitoids: which is the fugitive and where does it hide? Oikos 119:61-70.

Velez, S., Taylor, M.S., Noor, M.A.F., Lobo, N.F. and Feder, J.L. 2006. Isolation and characterization of microsatellite loci from the apple maggot fly Rhagoletis pomonella (Diptera: Tephritidae). Molecular Ecology Notes 6:90-92.

Venner, S., Pelisson, P.F., Bel-Venner, M.C., Debias, F., Rajon, E. and Menu, F. 2011. Coexistence of insect species competing for a pulosed resource: towards a unified theory of biodiversity in fluctuating environments. PLoS One:e18039.

Walsh, B.D. 1867. The apple-worm and apple maggot. Journal of Horticulture 2:338-343.

Wharton, R.A. and Marsh, P.M. 1978. New world Opiinae (Hymenoptera: Braconidae) parasitic on Tephritidae (Diptera). Journal of the Washington Academy of Sciences 68:147-167.

148

Wharton, R.A. 1997. Generic relationships of opine Braconidae (Hymenoptera) parasitic on fruit infesting Tephritidae (Diptera). Contributions of the American Entomoogical Institute 30:1-53.

Wharton, R.A. and Yoder, M.J. 2016. Parasitoid of the fruit infesting Tephritidae. Available at paroffit.org/public/site/paroffit/home. Accessed March 16, 2016.

Winkelmann, K., Genner, M.J., Takahashi, T. and Ruber, L. 2014. Competition-driven speciation in cichlid fish. Nature Communications 5:3.

Wilson, D.S. and Turelli, M. 1986. Stable underdominance and the evolutionary invasion of empty niches. The America Naturalist 127:835-850.

Winston, P.W. and Bates, D.H. 1960. Saturated solutions for the control of humidity in biological research. Ecology 41:232-237.

Yamamoto, D., Henderson, R., Corley, L.S. and Iwabuchi, K. 2007. Intrinsic, interspecific competition between egg, egg-larval, and larval-larval parasitoids of plusiine loopers. Ecological Entomology 32:221-228.

149

CHAPTER 5:

TEMPORAL RESOURCE PARTITIONING PROMOTES PARASITOID

BIODIVERSITY

5.1 Abstract

Does the temporal partitioning of shared resources allow for competing taxa to coexist and diversify, and if so, how is this accomplished in nature? Here, we explore this issue in one of the worlds most biodiverse group of animals, insect parasites (i.e, parasitoids). Specifically, we conducted a meta-analysis to determine if temporal partitioning of host resources via variation in oviposition (i.e., egg deposition) timing mitigates competition among parasitoid insects sharing the same phytophagous insect hosts. In our analysis of 64 oviposition manipulation studies, we found that, in the absence of a difference in the timing of oviposition, competition was common and one species was typically competitive superior (survived to adulthood a greater proportion of the time). In most cases, however, the competitively inferior species could gain an advantage over the superior competitor by ovipositing first into shared hosts.

Furthermore, this competitive advantage increased as the interval between oviposition times increased. These results were also linked to patterns observed in nature. We found that the more competitively inferior a species was in the oviposition manipulation experiments, the larger the time difference was between when competing species

150

oviposited in nature. In addition, the larger the difference between the timing of oviposition, the more abundant the inferior species was in natural populations. Overall, our analysis suggests that the order and timing of oviposition is an important life history strategy mediating competition between parasitoids and may allow for multiple taxa to co-exist on shared hosts and may play a critical role in structuring insect communities and contributing to the great diversity of parasitoid species in nature.

5.2 Introduction

Interspecific competition can both constrain and foster species richness in organismal communities (Connell 1961, Tilman 1987, Bengtsson 1989, Ives et al. 1999,

Bolnick et al. 2010, Hood et al. 2012). When species overlap too broadly in how, where, and when they use shared resources, they can competitively exclude one other, reducing biodiversity (Chesson 2000, Mayfield and Levine 2010). However, factors mitigating competition that allow species to partition a shared resource can accentuate biodiversity by permitting more species to co-exist than would otherwise be the case (Stevens 1989,

Chesson 2000). Interspecific competition could also potentially increase biodiversity by facilitating speciation (Rundle and Nosil 2005, Hood et al. 2012, Rabosky 2013). For example, if a population evolves differences in its behavior, morphology, physiology, or life history to co-exist with another species that cause it to become reproductively isolated from conspecific populations elsewhere not experiencing the same competitive selection pressures, then speciation is possible (Schluter 2000, Grant and Grant 2006,

Grether et al. 2009). Thus, understanding the process of interspecific competition, its

151

mechanisms of action, and its outcomes, are seminal questions in the fields of ecology and evolutionary biology.

Here, we focus on the issue of whether and how the temporal partitioning of shared resources allow competing taxa to co-exist and diversify. In particular, we employ a meta-analytic approach to test the hypothesis that differences in the timing of egg deposition (i.e., oviposition) may be a critical factor mitigating interspecific competition among insect parasitoids that attack shared plant-eating insect hosts. Understanding the role of competition in structuring phytophagous insect/parasitoid communities is important because together these two groups constitute the most numerous multicellular organisms on the planet (La Salle and Gauld 1991, Foottit and Adler 2009), comprising as much as 25-40% of the worlds biodiversity (Erwin 1982, Bush and Butlin 2004). Thus, discerning the processes and mechanisms contributing to the great variety of phytophagous insects and their parasitoids significantly contributes to answering the question of why and how life is so diverse.

Part of the reason that insects are so diverse is that many species are specialists and, in particular, most are specialist feeders on one or a few host plant species (Mitter et al. 1988, Jaenike 1990, Bush 1993, Bernays and Chapman 1994). Moreover, at the higher parasitoid trophic level, many parasitic insects are host-specific, attacking a single or limited number of plant-feeding insects (Hawkins and Lawton 1987). As a result, host specialization can have a cascading effect on multiplying biodiversity, moving from plants, to plant-eating insects, to insect-eating insect parasites in ecosystems (Stireman et al. 2006, Abrahamson and Blair 2008, Forbes et al. 2009, Feder and Forbes 2010, Hood

152

et al. 2015). In this regard, our mammalian/anthropogenic perspective of the world can bias our perception that top consumers in ecosystems are often relatively large and less numerous than their prey. Indeed, due to the loss of usable energy when traversing trophic levels, biomass typically decreases and large consumers must be supported by more food items at lower trophic levels. However, not all higher level consumers need be large (Lafferty et al. 2006, Brose et al. 2006). Parasitic insects are usually much smaller than their hosts, especially when they are internal feeders (Harvey et al. 2013).

Consequently, a single insect host population can support at least one and often many parasitoid species (Hawkins and Lawton 1987, Hawkins 1990). As a result, this can lead to increases rather that decreases in biodiversity at the higher parasitoid trophic level if insects can evolve mechanisms to mitigate competition and co-exist to avoid excluding one another when they share a common host resource (Cusumano et al. 2012a, Harvey et al. 2013).

We hypothesize that an important and perhaps primary way that phytophagous insect parasitoids partition host resources is through variation in the timing of their oviposition. Specifically, differences in the life history timing, dispersal, or host finding abilities of parasitoids may allow taxa that are poorer in direct contest competition for host resources to persist due to an advantage they gain by ovipositing earlier (or later) into an insect host shared with a more competitively dominant species (Cusumano et al.

2012, Harvey et al. 2013). Thus, temporal oviposition partitioning may allow insect diversity to increase multiplicatively (non-linearly) moving from the phytophagous insect to the higher parasitoid trophic level (Bonsall et al. 2002, Hood et al. 2012, Hood et al. in

153

prep.). To address this question, we conducted a meta-analysis based of published studies in which the order and timing that pairs of parasitoid species where allowed to oviposit into a shared host insect were manipulated in the laboratory. These studies allowed us to

(1) confirm that interspecific competition was occurring between parasitoid species and

(2) investigate the degree to which differences in oviposition timing between species mitigated the outcome of competition (i.e., survivorship vs. death). We hypothesize that differences in the timing of oviposition will permit competitively inferior parasitoids to persist with dominant species by allowing them to utilize a different temporal component of the resource niche or provide a developmental advantage offsetting their otherwise poor performance.

Several features of phytophagous insect-parasitoid systems make them ideal for such a meta-analysis (Hood et al. 2012). First, many species are well-studied as biocontrol agents of agricultural insect pests (Hagvar 1989, La Salle 1993, Sithanantham et al. 2013). As a result, a rich literature exists regarding the prevalence and effects of competition among parasitoid species. Moreover, details of parasitoid natural histories are often known, including how prevalent different species are and when they oviposit into hosts in the field, allowing results from laboratory manipulation studies to be translated to patterns observed in nature. Second, detailed natural history makes parasitoids well-suited for testing for competition. Most species spend their immature life stages feeding internally within or externally on a single insect host (Godfray 1994).

During development, many species completely consume their host. Also, multiparasitism is common and, when it occurs, the competitively dominant species often consumes its

154

rivals (Cusumano et al. 2012, Harvey et al. 2013). Thus, during multiparasitism, species are confined to a closed host arena where the outcome of direct and intense contest competition is clear and measurable (adult emergence for the victor and death for the loser). As a consequence, the strategies employed by parasitoids to mitigate and accentuate competitive interactions are generally known, and many studies have been performed, making a meta-analysis possible (Salt 1961, Hagvar 1989, Brodeur and

Boivin 2004, Cusumano et al. 2012, Harvey et al. 2013). In addition, many studies include a number of manipulative experiments assessing whether and how a head start in oviposition may confer a competitive advantage for competing parasitoid species (e.g.,

Fisher 1961, Force 1974, Hagvar 1989, Slansky 1996, Agboka et al. 2002, Boivin and

Brodeur 2006, Cusumano et al. 2012, Harvey et al. 2013). Third, most parasitoids, but not all, are host specific at the family, genus or species level. Thus, it is difficult for many taxa to escape the consequences of competition and diffuse its effects through the use of enemy free space by attacking alternative hosts lacking interspecific rivals. Finally, phytophagous insect parasitoids have evolved different life styles, life histories, and host associations that can be investigated for their possible effects on competition and oviposition timing. We have included the following characteristics of competing parasitoid species in our analysis: (1) the degree of host specificity (specialist or generalist), (2) egg laying behaviors (solitary or gregarious), (3) location of oviposition/feeding habitat of larvae (ectoparasitic or endoparasitic), (4) native or recently introduced, (5) phylogenetic similarity of competitors, and (6) taxonomy of the host insect attacked.

155

5.3 Materials and Methods

5.3.1 Identifying and Selecting Studies for Inclusion in the Meta-Analysis

We used a three-fold strategy to identify studies testing whether and how the order and timing of oviposition affected interspecific competition between phytophagous insect parasitoids. First, we surveyed the literature for reviews citing individual studies of competition between immature parasitoids (e.g., Hagvar 1989, Boivin and Brodeur 2006,

Cusumano et al. 2012, Harvey et al. 2013). Second, we searched the Web of Science

(Thomson Reuters) database, using combinations of the following key words:

‘interspecific*’, ‘intrinsic, competition*’, ‘parasitoid, ‘endoparasitoid’, ‘parasitic insect’,

‘oviposition*’, and ‘timing*’. Third, for each study identified, we examined the reference cited section to look for possible additional studies not found in our initial search.

Our search yielded 100 experiments of interspecific competition and oviposition timing manipulation. However, we were only able to use those studies that met two specific criteria. First, for a study to be included in the meta-analysis, the outcome of multiparasitism had to be measured as successful emergence for the survivor (or confirmation of survivorship via dissection) and death for the loser. A small number of studies that reported successful survival of both species were also included in our analysis. However, replicates in which no parasitoids emerged from a trial were not included in our analysis, as we could not determine if competition or some extrinsic factor was the cause of death in these cases. Second, each study had to include a minimum of two time points (treatments) that experimentally manipulated the interval

(measured in hours) between oviposition bouts of competing species. In each of these 156

cases, each treatment was replicated, with paired oviposition bouts into shared hosts being the level of replication. Most of these studies (55/64 = 86%), contained treatments in which the order that the two species were allowed to oviposit was reversed (i.e., both species allowed to oviposited first and both species allowed to oviposit second). In addition, most of the studies (44/64 = 69%) included a treatment where both species were allowed to oviposit at the same time (or within minutes of each other) into a shared host henceforth referred to as t0, providing a measure of competitive ability between the taxa in the absence of an oviposition timing difference.

Our search yielded 64 oviposition manipulative experiments taken from 41 published studies comprising 383 paired oviposition events across 22,944 replicates.

Taxonomically, studies included 12 parasitoid families, spread across 48 genera comprising a total of 66 species that attacked 32 different insect hosts (see Table D.1-D.3 and for a list of all studies used in the meta-analysis and taxonomic information and life history characteristics associated with each parasitoid species and their insect host).

5.3.2 Compiling and Calculating Effect Sizes and Statistical Analyses

For each study, we initially designated one of the competing parasitoids at random as “species 1” and the other as “species 2”. The data from each study was then coded with three possible outcomes: species 1 emerged and species 2 died (1, 0), species

1 died and species 2 emerged (0, 1), or both species emerged (0.5, 0.5). To scale the timing of oviposition equivalently between studies, we transformed the interval between oviposition times (recorded in hours) from -1 (the largest interval between oviposition times with species 2 ovipositing first) to 1 (the largest interval between oviposition times 157

with species 1 oviposits first). We then determined which of the species was competitively superior by either calculating which parasitoid had higher relative survivorship at t0 when both taxa were allowed to oviposit at the same time (n = 44 studies) or by regressing survivorship of the species originally designated as “species 1” and the difference in oviposition time though t0 and determining whether the y-intercept of survivorship was > 50% survivorship (species 1 competitively superior) or < 50%

(species 1 inferior) (n = 20 studies). We subsequently designated species 1 as the parasitoid that was competitively inferior at t0 and recoded the oviposition timing and survivorship data accordingly (see Fig. 5.1).

To test for evidence of significant differences in competitive ability in the absence of an oviposition timing advantage, we compared the survivorships of species 1 and species 2 at the t0 treatment where the two parasitoids were allowed to oviposit at the same time. Specifically, for each of these 44 studies that possessed a t0 treatment, we compared observed survivorship values to a 50:50 null expectation of survivorship via

158

chi-squared tests. Next, we tested for a significant effect of the order (ovipositing first or second) of oviposition timing on the outcome of competition. Here, for each of these 55 studies, survivorship across all replicates in all treatments when species 1 oviposited first was compared to all replicates in all treatments when species 2 oviposited first via

Fisher’s exact tests.

Lastly, to test for a difference in the timing of oviposition on competition, we calculated Spearman’s rank correlation coefficients (rho) for each of the 64 studies included in the meta-analysis between percent survivorship of species 1 and the time interval between oviposition events of competing species. To calculate a summary effect size across all 64 studies, we used the mixed effects models described in Borenstein et al.

(2009) and advocated in recent reviews (Gurevitch and Hedges 1999, Rosenberg et al.

2000) where correlation coefficients are weighted by the inverse of their sampling variance (e.g., Arnqvist et al. 1996, Bender et al. 1998, Soininen et al. 2012). Therefore, studies with low sample size, and thus a greater probability of type II error, contribute less weight in the overall analyses compared to those with greater statistical power

(Bender et al. 1998). Here, Fisher’s transformation (Fisher 1921) was used to calculate Z scores for correlation coefficients (Zrho = 0.5 ln [(1 + rho)/(1 – rho)]) and asymptotic variance of Z (Zvar = 1 / [n – 3], where n is the sample size) for analysis as a means to normalize their distribution (Altman and Gardner 2000, Borenstein et al. 2009, Shafer and Wolf 2013). A mean Z score was then calculated and back-transformed to generate

an average effect size ( rhoz ) across studies. In addition, effect sizes of individual studies

 159

were also back-transformed (rhoz) and UL and LL 99% CI were calculated for display

(Rosenberg and Adams 2000, Vazquez et al. 2007).

An additional set of analyses was also performed to determine if life history characteristics and taxonomy (predictor variables or sub-level covariates) significantly affected effect sizes between survivorship and the timing of oviposition. Essentially, a sub-group analysis is an analog to an analysis of variance where a mean effect size is compared between groups in an effort to partition variance in effect size to covariates

(Borenstein et al. 2009). For each of the 64 studies in the meta-analysis, we categorized whether the pair of parasitoid species were (1) generalists or specialists, (2) solitary or gregarious, (3) endoparasitic or ectoparasitic, (4) native or introduced (5) phylogenetically related (at the genus, family and order levels), and (6) associated with particular insect hosts (order and family). Specialists were defined as parasitoids that attacked a single host or related group of hosts in the same genus. All other species were categorized as generalists. For the categorical analyzes, we only analyzed response variables with at least three observations (studies) in each of the alternative categories being compared.

All analyses were conducted in R v.3.1.2 (R Development Core) and JMP v.7

(SAS Institute 2007). We used a conservative P < 0.01 value (and corresponding 99%

CIs) for determining statistical significance in all analyses (unless noted) due to issues with multiple comparisons that inflate the probability of a type I error, as advocated by

Gates (2002). In all analyses, effect sizes that had 99% CIs that did not bracket zero were considered statistically significant. We also calculated and compared within (QW) and

160

between group heterogeneity (QB) against a chi-square distribution to determine if significant differences existed among effect sizes in the main analysis and predictor variables in each sub-analysis (Kaplan and Denno 2007, Borenstein et al. 2009).

Meta-analyses must address the “file drawer problem” where non-significant effects are less likely to be published. Given that the majority of the studies included in our analyses were undertaken to assess the efficacy of using single versus multiple parasitoid species for the biocontrol of economically important pest insects, significant and non-significant results seem equally likely to be published given their ramifications.

Nevertheless, to account for a possible file drawer effect, we implemented Rosenthal’s

Method (alpha = 0.01) to calculate fail-safe values for each variable in our dataset

(Rosenthal 1979, Rosenberg et al. 2000). Fail safe values represent the number of non- significant studies that would need to be added to the analysis to reduce an overall significant effect size to non-significant. Base on fail-safe estimates, we found little evidence for publication bias in our dataset. Most fail-safe values were large, being >

5000 for analyzes involving the full 64 study data set and > 50 for 22 of the 23 significant categorical sub-analyses we performed. The only exception was the test assessing host taxonomic level of the host attacked for the order Diptera, where the failsafe value was

17. We also visualized funnel plots and normal quantile plots to assess potential abnormalities and publication bias in our data and found that patterns conformed to the assumptions of normality (Fig. 5.2).

161

Figure 5.2: (A) Funnel plot displaying the relationship between effect size (Spearman’s rhoz) and the number of observations for each of the 64 studies used in the meta-analysis. A funnel shaped pattern distributed symmetrically about the mean effect size (a non- significant correlation coefficient r = 0.14, P = 0.24) is indicative of a lack of publication bias. Values falling along the solid black line indicate an effect size of zero. The best-fit dashed line is displayed to visualize the non-significant relationship. (B) Normal quantile plot between effect size (Spearman’s rhoz) and the ranked based Z-score (drawn from a normal distribution with a mean of 0 and a standard deviation of 1). A coefficient of determination close to 1 (r2 = 0.98) is indicative of normality. 162

5.3.3 Timing of Oviposition and Patterns of Species Abundance in Nature

To discern how the results from the meta-analysis translated to patterns observed in nature, we examined whether the competitive abilities between taxa estimated from the manipulative experiments are related to differences in oviposition timing and abundances in the field. First, we searched the literature for estimates of ovipositing timing and abundance of competing parasitoid species in nature. Unfortunately, precise details on oviposition timing in the wild could not be obtained from the literature. However, information concerning the host life stages (i.e., egg, instar, pupae) attacked in nature by all 64 pairs of parasitoid species in the meta-analysis were available. This allowed us to derive a metric of the relative difference in oviposition times between taxa based on the difference in life stage that two parasitoids oviposited into. Additionally, abundances of co-occurring parasitoids species in nature were obtainable for only 34 of the 64 species pairs in the meta-analysis. In cases where abundance data existed for multiple years, sites, or studies, we used the mean value for analysis (see below). See Table D.4 for the relative abundance, timing of oviposition estimates extracted from the literature, a description of how data was transformed for analysis and a list of studies used to determine oviposition timing and parasitoid abundance.

Next, we conducted a series of correlations between estimates of the relative competitive abilities of pairs of taxa at t0 from the manipulative oviposition experiments and (1) the difference in oviposition times in nature and (2) relative abundances in nature

These correlations allowed us test whether competitively inferior species oviposited increasing earlier or later than dominant species in order to persist (i.e., be more

163

abundant) in nature. We performed these correlations using the entire data set and four subsets of data: (1) species pairs showing a positive relationship between oviposition timing and survivorship of the competitively inferior species in the manipulation studies

(i.e., the inferior species does better the earlier it is oviposited), (2) species pairs showing a negative relationship between oviposition timing and survivorship of the competitively inferior species in the manipulation studies (i.e., the inferior species does better the later it is oviposited), (3) species pairs in which the competitively inferior species oviposited earlier in nature, and (4) species pairs in which the competitively inferior species oviposited later in nature.

5.4 Results

5.4.1 Evidence for Competition

Support for interspecific competition between parasitoids was evident from the treatment in which species were allowed to oviposit at the same time (t0) into a shared host. In 28 of these 44 experiments (64%), survivorship for one of the species was significantly greater that the 50% null expectation of competitive equivalence (Fig. 5.3;

Table D.5). Overall, mean survivorship across the 44 studies for the species having the highest survivorship was 75% (CI = 69.07 – 80.93%, range = 50.00 – 97.93%), while survivorship for the 28 studies displaying a statistically significant difference increased to

85% (CI = 80.34 – 88.94%, range = 66.72 – 97.93%). Thus, when parasitoids were manipulated to attack a host at (or near) the same time, one species is typically intrinsically competitively superior. 164

5.4.2 Competition and the Order and Timing of Oviposition

The order of oviposition had a significant effect on the outcome of interspecific competition. In 33 of these 55 studies (60%), survivorship of the inferior species was significantly higher across all earlier ovipositing treatment when compared to later ovipositing treatments. In only three cases (5.4%) did the species ovipositing later experience significantly higher survivorship (Fig. 5.4; Table D.6). Of these 33 studies, 26 contained a treatment at t0. In 23 of these 26 cases (88%), survivorship of the competitively superior parasitoid species at t0 was higher across all earlier ovipositing time treatments

165

Figure 5.4: The distribution of the difference in survivorship (average survivorship of the species ovipositing first across all treatments – survivorship of the species ovipositing second across all treatments) for 55 studies. Negative values indicate the species ovipositing second experienced increased survivorship and positive values indicate the species ovipositing first experienced increased survivorship. All data are displayed in rank order of effect size and UL and LL 99% CI. The dashed line represents the mean and the grey area about the dashed line represents 99% CIs about the mean. See Table D.6 for effect sizes and statistical analyses.

(mean survivorship = 79.87%) than it was at t0 (mean survivorship = 70.57%). Moreover, in these same 23 studies, offspring survivorship of the competitively inferior parasitoid species at t0 was also higher across all earlier oviposition time treatments (mean survivorship = 76.09%) than it was at t0 (mean survivorship = 29.43%). Thus, in most cases, the competitive inferior species at t0 gained an advantage over the superior species by ovipositing earlier in shared hosts.

166

The time interval between oviposition events also significantly affected the outcome between competing parasitoid species. In 50 of the 64 studies (78%), we detected a positive correlation between survivorship and oviposition timing of the competitively inferior species. In addition, in 37 of these 50 cases, the correlation coefficient was statistically significantly (Fig. 5.5; Table D.3). Thus, in the majority of studies, as the interval between oviposition times increases, survivorship of the inferior species also increases (Fig. 5.5; Table D.3). As a result, the summary effect size describing the relationship between survivorship and oviposition timing for the competitively inferior species across all studies was positive and highly significant ( rhoz

= 0.29 [99% CI = 0.20 – 0.37], P < 0.01 × 10-30; Fig. 5.5).

Significant heterogeneity existed, however, in these effect sizes across the 64

-30 studies in the meta-analysis (QW = 1422.89, P < 0.01 × 10 ), indicating that there was not a common effect size across all systems (Fig. 5.5; Table D.7). Indeed, 14 of the 64 studies (22%) displayed a negative relationship between survivorship and time of oviposition for the competitively inferior species, and in 3 of these cases the correlation coefficient was statistically significant (Fig. 5.5; Table D.3). Thus, it is possible that two different classes of relationships exist between oviposition time and survivorship during interspecific competition. In the majority of cases, the competitively inferior species gains an advantage the earlier it oviposits. However, in a few instances, the competitively inferior species experiences increased survivorship the later it oviposits.

167

5.4.3 Competition and Oviposition Timing in Nature

The difference in the competitive abilities between parasitoids estimated in the laboratory manipulation studies were significantly related to the difference in oviposition timing between the species in nature. For all 64 studies in the meta-analysis, an estimate of the difference in competitive ability between a pair of taxa could be made either directly based on their survivorship difference at t0 (in cases where this treatment was performed) or indirectly by interpolation or extrapolation through t0 across the series of

168

treatments in which the oviposition interval between species was varied (in cases where no t0 treatment was performed). For the 64 studies, a significant positive relationship existed between survivorship of the inferior species at t0 and the interval between oviposition times of competing species in nature (r = 0.48, P = 0.00003; Fig. 5.6). We obtained similar results after subsetting the data. A positive correlation existed for those species pairs in which only a positive (r = 0.41, P = 0.001, n = 50) or negative relationship (r = 0.72, P = 0.002, n = 14) was observed between survivorship and oviposition timing of the competitively inferior species in manipulative experiments.

Similarly, the relationship held when considering those cases in which the competitively inferior species oviposited earlier (r = 0.40, P = 0.003, n = 47) or later (r = 0.65, P =

0.002, n = 17) in nature separately.

5.4.4 Competition, Oviposition Timing, and Parasitoid Abundance

The difference in the time between when parasitoids oviposit in nature was significantly related to abundance in the field for the 34 studies. A significant positive relationship existed between oviposition times of competing parasitoids and the relative difference in their abundances in nature (r = 0.60, P = 0.00008; Fig. 5.6). That is, the larger the difference between the timing of oviposition, the more abundant the competitively inferior species was in nature. Again, we obtained similar results after subsetting the data. A positive correlation existed for those species pairs in which only a positive relationship existed between survivorship and oviposition time of the competitively inferior species in manipulative experiments (r = 0.62, P = 0.0004, n = 25).

In those species pairs in which a negative relationship existed, the correlation was 169

)LJXUH $ 7KH UHODWLRQVKLS EHWZHHQ VXUYLYRUVKLS RI WKH FRPSHWLWLYHO\ LQIHULRU VSHFLHVRYLSRVLWLQJDWWKHVDPHWLPH W DQGWKHGLIIHUHQFHEHWZHHQWLPLQJRIRYLSRVLWLRQ LQ QDWXUH RI FRPSHWLQJ VSHFLHV % 7KH UHODWLRQVKLS EHWZHHQ WKH GLIIHUHQFH EHWZHHQ WLPLQJ RI RYLSRVLWLRQ LQ QDWXUH RI FRPSHWLQJ VSHFLHV DQG WKH DEXQGDQFH RI WKH FRPSHWLWLYHO\ LQIHULRU VSHFLHV LQ QDWXUH $OVR JLYH DUH WKH FRUUHODWLRQ FRHIILFLHQWV U VLJQLILFDQFHYDOXHV 3 DQGWKHVDPSOHVL]H Q IRUHDFKFRUUHODWLRQ6HH7DEOHV'IRU GDWDXVHGWRIRUPHDFKUHJUHVVLRQ

positive but not significant (r = 0.49, P = 0.09, n = 9). Moreover, the relationship held when considering those case in which the competitively inferior species oviposited earlier

(r = 0.50, P = 0.02, n = 18) or later (r = 0.62, P = 0.002, n = 16) in nature separately.

Thus, competitively inferior species become increasingly abundant in the field as they reduced overlap in the timing of oviposition into shared hosts with competitive inferior species.

5.4.5 Effects of Life History and Phylogenetic Relationships

We found no difference in the effect sizes of the relationships between survivorship and the timing of oviposition of the inferior species across categories in any of the following sub-analyses: (1) the degree of host specificity (specialist versus generalist), (2) egg laying behaviors (solitary versus gregarious), (3) location of oviposition/feeding habitat of larvae (ectoparasitic versus endoparasitic), (4) native versus recently introduced, (5) phylogenetic similarity (order, family and genus) and the

(6) taxonomy of the insect host attacked (order and family) (as determined by between group heterogeneity comparisons; P > 0.01 in all cases; Fig. 5.7, 5.8). Thus, our covariates did not account for the observed variation (heterogeneity) in effect sizes seen in the full analysis.

5.5 Discussion

The results from the meta-analysis imply that intraspecific competition plays a key role in structuring communities of phytophagous insect-attacking parasitoids.

Moreover, our results suggest that a major way in which competition may be mitigated to 171

allow the persistence of competitively inferior parasitoids fostering biodiversity is through the temporal partitioning of host insect resources via variation in oviposition timing. Indeed, estimates of the relative competitive abilities of parasitoids derived from manipulative laboratory experiments in the meta-analysis were strikingly related to the difference in the timing of oviposition in nature. Moreover, the difference in the timing of oviposition in nature was also related to the relative abundance of competing taxa in nature. Thus, our results are suggestive that interspecific competition may be a critical axis of differentiation structuring parasitoid communities along a temporal axis of oviposition timing which has consequences for other major aspects of these insects’ ecology, biology, and natural history.

The relationship between competitive ability and oviposition timing appears to be general, involving parasitoids having a variety of different types of ecologies and lifestyles (e.g., generalist or specialist, solitary or gregarious, endoparasite or ectoparasitic), natural histories (native or introduced), phylogenetic relationships

(competitors belong to the same genera, family, or order), and host affiliations. However, effect sizes tended to be lower, but not significantly so, for comparisons involving competing pairs of gregarious and ectoparasite species (Fig. 5.7). In addition, overall effect sizes appeared to be smaller for parasites attacking Lepidopterans in the family

Noctuidae and flies in the order Diptera (Fig. 5.8). Indeed, many of competitively inferior species displaying a negative relationship between survivorship and oviposition time

(11/14 = 78%) involved Noctuid hosts. Additional studies are needed to build the sample

172

Figure 5.7: The weighted mean effect size (rhoz ) and UL and LL 99% CI of the relationship between survivorship and the timing of oviposition between competing parasitoids in four different life history categories: (A) level of specialization (generalist vs. specialist), (B) egg laying strategies (solitary vs. gregarious), (C) larval feeding habitat/placement of eggs, (ectoparasitoid vs. endoparasitoid), and (D) native vs. introduced species. Numbers above bars represent observations per group. 173

Figure 5.8: The weighted mean effect size (rhoz ) and UL and LL 99% CI of the relationship between survivorship and the timing of oviposition during intrinsic, interspecific competition between immature parasitoids (A) across varying levels of phylogentic similarity (order, family and genus), and (B) ovipositing into host taxa at varying phylogenetic levels (order and family). For panel A, order, family and genus represent the lowest shared classification for competing parasitoids. For panel B, order and family represent the lowest taxonomic level for which replication was large enough to analyze. Numbers above bars represent observations per group. 174

sizes for these life style and host categories to confirm whether these differences have biological meaning, as opposed to being due to vagaries in sampling.

In most of the manipulative experiments in the meta-analysis (72% = 50/64), the competitively inferior parasitoid gained an advantage by ovipositing earlier than the dominant species, providing the first broad support for the “early-acting competitive superiority” hypothesis (Force 1974, Fisher 1961, Slansky 1986, Cusumano 2012,

Harvey et al. 2013). However, significant heterogeneity existed in effect sizes among studies, implying that the relationship between survivorship and oviposition timing may be a system-specific phenomenon. Indeed, in 22% of the studies (14/64), offspring of the competitively inferior species experienced increases survived the later they were oviposited. Thus, it may be more accurate to state that, in general, the less competitive a given parasitoid is, the greater the difference (either early or later) that females of the species oviposit into shared hosts than the dominant taxon in nature. Further studies clarifying the nature of the relationship is needed, as our estimates of oviposition time were crude and based on the life stages of hosts attacked in the field. Detailed work measuring the temporal distributions of oviposition times of competing species and their overlap in nature is required to more accurately quantify the relationship. Nevertheless, even the rough approximations currently available in the literature revealed a strong and significant relation between oviposition time and competitive ability.

A series of important questions also remain concerning how the mechanisms used by species in direct competitive interactions are mitigated by oviposition timing. The strategies that govern competition fall into two categories: physical attack and

175

physiological suppression (Cusumano et al. 2012, Harvey et al. 2013). Earlier ovipositing species may be at a competitive advantage because they are better equipped for direct combat. Most solitary parasitoid species that lay a single egg into their host possess large sickle shaped mouthparts as first instar larvae used in bouts of direct combat to kill the eggs or larvae of competing parasitoids (Salt 1961, Jervis and Copland 1996, Cusumano et al. 2012, Harvey et al. 2013). Additionally, solitary species have a modified caudal appendage that enables movement through the host hemolymph to seek out and destroy competitors (Harvey et al. 2013). Moreover, even if they do not fare well in direct physical confrontation, an earlier oviposited species, by consuming limited resources before competitors, may reduce the quantity and quality of the host or limit the motility of later ovipositiong species sufficiently to dramatically increase their survivorship relative to competitors (Collier and Hunter 2001; Harvey et al. 2009).

Clearly, an earlier oviposited parasitoid may experience an advantage by being further developed and potentially larger-sized at the timing of oviposition by competitors.

However, many species of parasitoids shed their mandibles after molting to 2nd instars.

Thus, older parasitoids oviposited first may be physically defenseless during encounters with younger parasitoid species that possess fighting mandibles that they might normally consume at equivalent developmental stages (Pschorn-Walcher 1971; Marktl et al. 2002;

Persad and Hoy 2003). Similarly, the “facultative hyperparasitoid” hypothesis suggests that later ovipositing species may have an advantage if they lay their eggs into a developing endoparasitoid that has already partially or completely consumed the host internally (Strand 1986, Sullivan and Volkl 1999). Of the 14 studies displaying negative

176

relationships in the meta-analysis, at least one of the interactions involving Dinarmus basalis competing with Eupelmus vuilleti (study 17, Table D.1) would appear to represent facultative hyperparasitism (Rojas-Rousse 2010).

In contrast to solitary species, gregarious parasitoids that deposit multiple eggs in the same host typically have smaller mandibles or succulent mouthparts, lack a caudal appendage, and are immobile during development (Harvey et al. 2013). Thus, being further developed and larger-sized are unlikely to be the primary ways that gregarious species outcompete other taxa. Instead, physiological suppression, in which competitors are elimination by chemical or pathogenic mechanisms, may be more important (Fisher

1963, Fisher 1971, Vinson and Iwantsch 1980, Vinson and Hegazi 1998, Uka 2006,

Harvey et al. 2013). Physiological suppression can occur through diverse means including the secretion of regulatory factors, toxic venoms, or heterospecific ovicides

(substances that kill eggs) by a species, the presence of taxon associated viruses or microorganisms, and/or the induction of the host immune systems, in ways that negatively impact competitors (Laing and Corrigan 1987, Fleming, 1992; Beckage and

Gelman, 2004; Harvey et al. 2013). In these cases, the species that oviposits first could chemically manipulate the internal environment of the host making it toxic during development for later ovipositing competitors.

Finally, species that are inferior as direct competitors within hosts may have attributes that afford an advantages in contests external to hosts, such as having superior dispersal or host finding abilities (Amarasekare 2000), being able to distinguish already parasitized hosts (McBrien and Mackauer 1990), living longer or being more fecund

177

(Bonsall et al. 2004), that explain their continued persistence within communities on shared hosts. All of these considerations with the exception of parasitoid detection can potentially apply whether the inferior competitor oviposited prior to or after a dominant species. However, they cannot account for the observed changes in competitive ability between species pairs observed in the manipulation experiments (negative or positive correlations), where these factors did not come into play. Thus, other mechanisms must be involved to explain the relationships observed in the laboratory studies.

5.5.1 Oviposition Timing and Biological Control

Understanding how the order and timing of oviposition mediate the outcome of competitive interactions can help inform biocontrol programs and insect pest suppression.

The majority of the studies included in our meta-analysis involved agricultural systems in which the parasitoids being studied represent natural enemies of pest insects or are being considered for introduction for biocontrol. There are two schools of thought regarding the use of parasitoids as biocontrol agents: the single vs. multiple species approaches. The single parasitoid strategy advocates releasing only the best species for pest insect control to decrease interspecific competition among taxa (Debach 1966; Stiling and Cornelissen

2005), while the alternative multiple species approach contends that despite competition, the combined net effect of several species on host insect suppression should exceed that of a single species alone (Donoth et al. 2002). In this regard, our analysis informs biocontrol programs in two ways. First, the order and timing of oviposition can affect the survivorship of competing parasitoids in a system specific manner. Thus, it is important to know whether the order and timing of oviposition advantageously or detrimentally 178

impacts competing species oviposition timing. Second, the majority of systems analyzed in our study may have an ideal oviposition interval that would maximize survivorship for both competing species. In this case, there may be an optimal point where the survivorship of both species is collectively higher and both can be supported stably on a shared host when both taxa are introduced to control a targeted pest. In contrast, releasing a combination of species prior to or after this time point may favor one species over another, reducing the overall effectiveness of the biocontrol program and likely driving the competitively inferior species to local extinction.

5.5.2 Conclusion and Future Directions

Our results indicate that variation in oviposition timing can promote parasitoid biodiversity by allowing temporal resource partitioning and increased packing of species on shared insect hosts. Other axes are also likely involved in mitigating interspecific competition an increasing biodiversity, such as differences in parasitoid dispersal or host finding ability (Amarasekare, 2000). It is possible that differences in these traits may help account for species co-existence in those cases in which the competitive abilities of parasitoids do not change with oviposition timing and one species always prevails in direct internal contest competition. We have recently shown that this may be the case for three parasitoid braconid wasp species Diachasma alloeum, Diachasmimorpha mellea, and Utetes canaliculatus attacking fruit flies in the genus Rhagoletis (Hood et al., in prep). An invariant competitive hierarchy exists among these taxa with D. alloeum being competitively superior followed by U. canaliculatus, and then D. mellea. Nevertheless, even in this case, the three parasitoids temporally subdivide the host fly resource with U. 179

canaliculatus, being an egg parasitoid, ovipositing the earliest in nature, followed by D. mellea which attacks second and early third instar fly larvae preferentially, and finally D. alloeum that oviposits into later instar larvae. Utetes canaliculatus and D. mellea, although being smaller in absolute body size, have relatively larger wings than D. alloeum, and, thus, may be better dispersers. These two species may find and oviposit into enough hosts not subsequently parasitized by D. alloeum, allowing them to persist within the parasitoid community. Further work on the natural history and biology of parasitoids is needed to integrate with data on competition and oviposition timing to gain a full understanding of the consequences and mechanisms that temporal host resource partitioning have for biodiversity. Our meta-analysis suggests that general rules and relationships may exist for phytophagous insect-attacking parasitoids that may be distilled into quantitative predictions concerning the composition and structure of whole communities. We note that an important consideration in this regard will be expanding analysis of species interactions from the pairs of parasitoids investigated in most studies in the literature to more complex multi-species assemblages, as well as assessing other important aspects of population dynamics and demographics, such as effects of host resource distributions and competition on sex allocation (ratio) strategies and various fitness components of competing parasitoid species (i.e., body size, fecundity and longevity).

Future work is also need to investigate the consequences of temporal resource partition and oviposition timing for speciation. Our study was primarily ecological and did not directly consider the evolutionary dimension of how divergence in life history

180

traits affecting oviposition timing may generate reproductive isolation between conspecific parasitoid populations specialized on different hosts with varying seasonal phenologies. In this regard, Hood et al. (in prep) found evidence for such a scenario of sequential divergence associate with host switching and allochronic mating isolation in the Rhagoletis attacking parasitoid system discussed above. In this case, competition among wasps restricts the temporal windows that they attack fly hosts such that populations parasitizing different Rhagoletis species are more seasonally isolated from one another when other parasitoids are present than in their absence. The presence of conspecific variation within and among populations in life history traits affecting oviposition timing (e.g., diapause termination and adult eclosion), will eventually allow the genetic and physiological/developmental bases for temporal resource partitioning to be resolved for these parasitoids, and perhaps for other systems, as well.

Although our focus here has been on phytophagous insect parasitoids, our findings likely have broader significance for biodiversity, in general. Phytophagous insect specialist may also be prone to competition and temporally subdividing resources or vary spatially and temporally in their distributions to avoid detection by parasitoids. Plants can also vary in their flowering and fruiting phenologies in response to pollinators and differences in abiotic conditions. Indeed, the timing of life history events is critically important for all living things (Kronfeld-Schor and Dayan 2003). Thus, temporal partitioning of resources may be a key consideration affecting and generating biodiversity, in general. In phytophagous insects and their parasitoids, this axis is played out in terms of oviposition timing. Similarly, in other groups, oviposition timing

181

specifically and the timing of life history events more generally may be related to differences in the breeding system, developmental rate, foraging strategies and circadian rhythms (Kronfeld-Schor and Dayan 2003). Thus, equivalents may be drawn across life and it may be that while timing is not everything, it is a principle axis available for organisms to adapt along, mitigating competition and fostering diversity.

5.6 Acknowledgments

Funding was provided to GRH by the Entomological Society of America, Indiana

Academy of Science, Sigma Xi, National Science Foundation (NSF) (DEB 1310850) and an NSF-IGERT GLOBES Fellowship from the University of Notre Dame, to DB by an

NSF-GLOBES REU Fellowship from the University of Notre Dame and to JLF by NSF

(DEB-1145573). The authors thank G. Ragland, S. Egan, M. Glover, P. Meyers, C. Tait,

A. Miller, H. Schuler, and especially M. Doellman for stimulating discussion and thoughtful insights. GRH also thanks D. Sanford, K. Gomez, T. Brown and most importantly P. Morton for continued encouragement and support.

5.7 Literature Cited

Agboka, K., Schulthess, F., Chabi-Olaye, A., Labo, I, Gounou, S. and Smith, H. 2002. Self-, intra-, and interspecific host discrimination in Telenomus busseolae Gahan

182

and T. isis Polaszek Hymenoptera: Scelionidae), sympatric egg parasitoids of the African cereal stem borer Sesamia calamistis Hampson (Lepidoptera: Noctuidae). Journal of Insect Behavior 15:1-12.

Altman, D.G. and Gardner, M.J. 2000. Regression and Correlation. In D.G. Altman, D. Machin, T.N. Bryant and M.J. Gardner (Eds.), Statistics With Confidence (2nd Ed.). BMJ Books: London, United Kingdom.

Amarasekare, P. 2000. Coexistence of competing parasitoids on a patchily distributed host: local vs. spatial mechanisms. Ecology 81:1286-1296. Arnqvist, G., Rowe, L., Krupa, J.J. and Sih A. 1996. Assortative mating by size: a meta- analysis of mating patterns in water striders. Evolutionary Ecology 10:265-284.

Beckage, N.E. and Gelman, D.B. 2004. Wasp parasitoid disruption of host development: implications for new biologically-based strategies for insect control. Annual Review of Entomology 51:419-438.

Bender, D.J. Contreras, T.A. and Fahrid, L. 1998. Habitat loss and population decline: a meta-analysis of the patch size effect. Ecology 79:517-533.

Bengtsson, J. 1989. Interspecific competition increases local extinction rate in metapopulation system. Nature 340:713-715.

Bernays, E.A. and Chapman, R.E. 1994. Host plant selection by phytophagous insects. Chapman and Hall, New York, NY, USA.

Boivin, G. and Brodeur, J. 2006. Intra- and interspecific interactions among parasitoids: mechanisms, outcomes and biological control. In G. Boivin and J. Brodeur (Eds.), Trophic and Guild Interactions in Biological Control. Netherlands: Springer.

Bolnick, D.I., Ingram, T., Stutz, W.E., Snowberg, L.K., Lau, O.L. and Paull, J.S. 2010. Ecological release from interspecific competition leads to decoupled changes in population and individual niche width. Proceedings of the Royal Society of London B: Biological Sciences 277:1789-1797.

Bonsall, M.B., Hassell, M.P. and Asefa, G. 2002. Ecological trade-offs, resource partitioining, and coexistence in a host-parasitoid assemblage. Ecology 83:925- 934.

Bonsall, M.B., Jansen, V.A.A. and Hassell, M.P. 2004. Life history trade-offs assemble ecological guilds. Science 306:111-113.

Borenstein, M., Hedges, L.V., Higgins, J.P.T. and Rothstein, H.R. 2009. Introduction to Meta-analysis. John and Wiley Sons, Oxford, U.K. 183

Brodeur, J. and Boivin, G. 2004. Functional ecology of immature parasitoids. Annual Review of Entomology 49:27-49.

Brose, U., Jonsson, T., Berlow, E.L. Warren, P., Banasek-Richter, C., Bersier, L.F., Blanchard, J.L., Brey, T., Carpenter, S.R., Blandenier, M.F.C., Cushing, L., Dawah, H.A., Dell, T., Edward, F., Harper-Smith, S., Jacob, U., Ledger, M.E., Martinez, N.D., Memmott, J., Mintenbeck, K., Pinnegar, J.K., Rall, B.C., Rayner, T.S., Reuman, D.C., Ruess, L., Ulrich, W., Williams, R.J., Woodward, G and Cohen, J.E. 2006. Consumer-resource body-size relationships in natural food webs. Ecology 87 2411-2417.

Bush, G.L. 1993. A reaffirmation of Santa Rosalia, or why there are so many kinds of small animals? Evolutionary Patterns and Processes, eds Edwards D, Lees DR (Academic Press, New York) pp 229-249.

Bush, G.L. and Butlin, R.K. 2004. Sympatric speciation in insects In: Adaptive Speciation (eds: U. Dieckmann, M. Doebeli, J.A.J. Metz and D. Tautz). pp. 229- 248. Cambridge University Press, Cambridge, U.K.

Chesson, P. Mechanisms of maintenance of species diversity. Annual Review of Ecology and Systematics 31:343-366.

Collier, T.R. and Hunter, M.S. 2001. Lethal interference competition in the whitefly parasitoids Eretmocerus eremicus and Encarsia Sophia. Oecologia 129:147-154.

Connell, J.H. 1961. On the prevalence and relative importance of interspecific competition: evidence from field experiments. American Naturalist 122:661-696.

Cusumano, A., Peri, E., Vinson, B. and Colazza, S. 2012. Interspecific extrinsic and intrinsic competitive interactions in egg parasitoids. Biocontrol 57:719-734.

Debach, P. 1966. The competitive displacement and coexistence principles. Annual Review of Entomology 11:183-212.

Donoth, M., Frid, L. and Myers, J.H. 2002. Multiple agents in biological control: improving the odds? Biological Control 24:20-30.

Erwin, T.L. 1982. Tropical forests: their richness in Coleoptera and other arthropod species. Coleopterists Bulletin 36:74-75.

Feder, J.L. Forbes, A.A. 2010. Sequential divergence and the diversity of parasitic insects. Ecological Entomology 35:67-76.

184

Fisher, R.A. 1921. On the “probable error” of a coefficient of correlation deduced from a small sample. Metron 1:3-32.

Fisher, R.C. 1961. A study of insect multiparasitism II. The mechanisms and control of competition for possession of the host. Journal of Experimental Biology 38:605- 628.

Fisher, R.C. 1963. Oxygen requirements and the physiological suppression o supernumery insect parasitoids. Journal of Experimentla Biology 40:531-540. Fisher, R.C. 1971. Aspects of physiological of endoparasitic Hymenoptera. Biological Reviews 46:243-278.

Fleming, J. 1992. Polydnaviruses-Mutualists and pathogens. Annual Review of Entomology 37:401-425.

Force, D.C. 1974. Ecology of insect host-parasitoid communities. Science 184:624-632. Foottit, R.G. and Adler, P.H. 2009. Insect Biodiversity: Science and Society. John and Wiley Sons, Oxford, U.K.

Gates, S. 2002. Review of methodology of quantitative reviews using meta-analysis in ecology. Journal of Animal Ecology 71:547-557.

Godfrey, H.C.J. 1994. Parasitoids: Behavioral and evolutionary ecology. Princeton, NJ: Princeton University Press.

Grant, P.R. and Grant, B.R. 2006. Evolution of character displacement in Darwin’s finches. Science 313:224-226.

Grether, G.F., Losin, N., Anderson, C.N. and Okamoto, K. 2009. The role of interspecific interference competition in character displacement and the evolution of competitor recognition. Biological Reviews 84:617-635.

Gurevitch, J. and Hedges, L.V. 1999. Statistical issues in ecological meta-analyses. Ecology 80:1142-1149.

Hagvar, E.B. 1989. Interspecific competition in parasitoids with implications for biological control. ActaEntomologica Bohemoslovaka 86: 321-335.

185

Harvey, J.A., Gols, R. and Strand, M.R. 2009. Intrinsic competition and its effects on the survival and development of three species of endoparasitoids. Entomologia Experimentalis et Applicata 130:238-258.

Harvey, J.A., Poelman, E.H., Tanaka, T. 2013. Intrinsic inter- and intraspecific competition in parasitoid wasps. Annual Review of Entomology 58:333-351.

Hawkins, B.A. and Lawton, J.H. 1987. Species richness for parasitoids of British phytophagous insects. Nature 326:788-790.

Hawkins, B.A. 1990. Global patterns of parasitoid assemblage size. Journal of Animal Ecology 59:57-72.

Hood, G.R., Egan, S.P. and Feder, J.L. 2012. Interspecific competition and speciation in endoparasitoids. Evolutionary Biology 39:219-230.

Ives, A.R., Gross, K. and Klug, J.L. 1999. Stability and variability in competitive communities. Science 286:542-544.

Jaenike, J. 1990. Host specialization in phytophagous insects. Annual Review of Ecology and Systematics 21:243-273.

Jervis, M.A. and Copeland, M.J.W. 1996. The life cycle. In M.A. Jervis and N. Kidd (Eds.), Insect Natural Enemies. London: Chapman and Hall.

Kaplan, I. and Denno, R.F. 2007. Interspecific interactions in phytophagous insects revisited: a quantitative assessment of competition theory. Ecology Letters 10:977-994.

Kronfeld-Schor, N. and Dayan, T. 2003. Partitioning of time as an ecological resource. Annual Review of Ecology, Evolution and Systematics 34:153-181.

La Salle, J. and Gauld, I.D. 1991. Parasitic Hymenoptera and the biodiversity crisis. Redia 74:315-334.

La Salle, J. 1993. Parasitic Hymenopteara biological control and biodiversity in Hymenoptear and biodiversity (eds. J. La Salle and I.D. Gould). Oxford University Press, England.

186

Lafferty, K.D., Dobson, A.P. and Kuris, A.M. 2006. Parasites dominate food web links. Proceedings of the National Academy of Sciences 103:11211-11216.

Laing, J.E. and Corrigan, J.E. 1987. Intrinsic competition between the gregarious parasite, Cotesia glomeratus and the solitary parasite, Cotesia rubecula (Hymenoptera: Braconidae) for their host, Artogeia rapae (Lepidoptera: Pieridae). Entomophaga 32:493-501.

Marktl, R.C., Stauffer, C. and Schopf, A. 2002. Interspecific competition between the braconid endoparasitoids Glyptapanteles porthetriae and Glyptapanteles liaridis in Lymantria dispar larvae. Entomologia Experimentalis et Applicata 105:97-109.

Mayfield, M.M. and Levine, J.M. 2010. Opposing effects of competitive exclusion on the phylogenetic structure of communities. Ecology Letters 13:1085-1093.

McBrien, H. and Mackauer, M. 1990. Heterospecific larval competition and host discrimination in two species of aphid parasitoids: Aphidius ervi and Aphidius smithi. Entomologia Experimentalis et Applicata 56:145-153.

Mitter, C., Farrell, B. and Wiegmann, B. 1988. The phylogenetic study of adaptive zones: has phytophagy promoted insect diversification? American Naturalist 132:107- 128.

Persad, A.B. and Hoy, M.A. 2003. Intra- and interspecific interactions between Lysiphlebus testaceipes and Lipolexis scutellaris (Hymenoptera: Aphidiidae) reared on Toxoptera citricidae Homoptera: Aphididae). Journal of Economic Entomology 96:564-569.

Pschorn-Walcher, H. 1971. Experiments of inter-specific competition between three species of Tachinids attacking the sugar cane moth borer, Diatraea saccharalis (F.). Entomophaga 16:125-131.

R Core Team 2014. A Language and Environment for Statistical Computing Computer Program, Version 3.1.2. Team, R.C., Vienna, Austria.

Rabosky, D.L. 2013. Diversity-dependence, ecological speciation, and the role of competition in marcroevolution. Annual Review of Ecology, Evolution and Systematics 44:481-502.

Rojas-Rousse, D. 2010. Facultative hyperparasitism: extreme survival behavior of the primary solitary ectoparasitoid, Dinarmus basalis. Journal of Insect Science 10:1- 13.

187

Rosenberg, M.S. and Adams, D.C. 2000. MetaWin user’s manual: statistical software for meta-analysis. Sinauer, Sunderland, USA.

Rosenthal, R. 1979. The “file drawer problem” and tolerance for null results. Psychological Bulletin 85:638-641.

Rundle, H.D. and Nosil, P. 2005. Ecological speciation. Ecology Letters 8:336-352.

SAS Institute. 2007. JMP version 7.0. SAS Institute, Cary, NC.

Salt, G. 1961. Competition among insect parasitoids. Symposia of the Society for Experimental Biology 15:96-119.

Schluter, D. 2000. Ecological character displacement in adaptive radiation. American Naturalist S4-S16.

Shafer, A.B.A. and Wolf J.B.W. 2013. Widespread evidence for incipient ecological speciation: a meta-analysis of isolation-by-ecology. Ecology Letters 16:940-950.

Sithanantham, S., Ballal, C.R., Jalali, S.K. and Bakthavatsalam, N. 2013. Biological Control of Insect Pests Using Egg Parasitoids. Springer, New York, NY. Slansky, F. 1986. Nutritional ecology of endoparasitic insects and their hosts: an overview. Journal of Insect Physiology 32:255:261.

Soininen, J., Passy, S. and Hillebrand, H. 2012. The relationship between species richness and evenness: a meta-analysis of studies across aquatic ecosystems. Oecologia 169:803-809.

Stevens, G.C. 1989. The latitudinal gradient in geographical range: how so many species coexist in the tropics. American Naturalist 133:240-256.

Stiling, P. and Cornelissen, T. 2005. What makes a successful bio-control agent? A meta- analysis of biological control agent performance. Biological Control 34:236-246.

Sullivan, D.J. and Volkl, Wolfgang. 1999. Hyperparasitism: multitrophic ecology and behavior. Annual Review of Entomology 44:291-315. 188

Tilman, D. 1987. The importance of the mechanisms of interspecific competition. American Naturalist 129:769-774.

Uka, D., Hiraoka, T. and Iwabunchi, K. 2006. Physiological suppression of the larval parasitoid Glyptapanteles pallipes by the polyembryonic parasitoids Copidosoma floridanum. Journal of Insect Physiology 52:1137-1142.

Vazqeez, D.P., Melian, C.J., Williams, N.M., Bluthgen, N., Krasnov, B.R. and Poulin, R. 2007. Species abundance and asymmetric interaction strength in ecological networks. Oikos 116:1120-1127.

Vinson, S.B. and Iwantsch, G.F. 1980. Host suitability for insect parasitoids. Annual Review of Entomology 25:397-419.

Vinson, S.B. and Hegazi, E.M. 1998. A possible mechanism for physiological suppression of conspecific eggs and larvae following superparasitism by solitary endoparasitoids. Journal of Insect Physiology 44: 703-712.

189

CHAPTER 6:

CONCLUSION

6.1 Introduction

What causes biodiversity and generates the (en)tangled bank of life? One key factor may be biodiversity itself. In the concluding paragraph of the Origin of Species,

Darwin wrote: “It is interesting to contemplate an entangled bank, clothed with many plants of many kinds, with birds singing on the bushes, with various insects flitting about, and with worms crawling through the damp earth, and to reflect that these elaborately construct forms, so different from each other, and dependent upon each other in so complex a manner, have all been produced by laws acting around us.” (Darwin, pp. 478).

Darwin’s closing comments suggest that he was keenly aware the biodiversity itself may help solve his “mystery of mysteries”. Still, to this day, the majority of studies of species formation (speciation) focus explicitly on how variation within a population is transformed by natural selection to differences between taxa. What is less well understood is how these changes might reverberate across trophic levels to effect entire communities of associated organisms. For my Ph.D. dissertation, I used the fruit flies in the Rhagoletis pomonella species complex, a model system for speciation-with-gene-flow

(Berlocher and Feder 2002, Funk et al. 2002, Coyne and Orr 2004, Bolnick and

Fitzpatrick 2007), and the community of parasitoid wasps that attack these flies, to 190

address the “biodiversity begets biodiversity” hypothesis. In this final chapter, I review the finding from the previous four research chapters, describe how these findings contribute to the study of the formation of (insect) biodiversity and detail future avenues of research that may help to solve Darwin’s “mystery of mysteries” and understand if and how sequential divergence may contribute to the origin of species.

6.2 Summary of Research Chapters

A major goals of evolutionary ecology is to understand how new biodiversity is created and structured into communities. In Chapter 2, I combined published records from the literature with my own collection of Rhagoletis-attacking parasitoid wasps and previously unpublished collections from other researchers to provide a synthetic view of the known geographic ranges and broader host associations of the community of parasitoid wasps attacking flies in the R. pomonella species complex in North America.

In this Chapter, I asked three main questions: (1) do different wasps species that co-occur in sympatry attack different life-stages of the fly, (2) do locally co-occurring wasps share some fly species in common but are unique to other fly hosts; and (3) do wasps vary on a regional scale in their geographic distributions? I found that indeed, multiple species of wasps do co-occur in sympatry and attack several of the same host fly species (e.g., D. alloeum, D. mellea and U. canaliculatus all attacking apple and hawthorn flies; Table

2.1). However, several fly hosts are home to a reduced diversity of wasp species (e.g., the flowering dogwood fly is parasitized by D. mellea and U. canaliculatus but not D. alloeum while the blueberry fly is attacked by D. alloeum and D. mellea only; Table 2.1).

191

Additionally, when wasps are found in sympatry, they appear to attack different life stages of the fly host (e.g. U. canaliculatus attacks fly eggs, while D. mellea and D. alloeum attack larval instars) suggesting that parasitoid species co-exist by subdividing the host fly resource (see Chapter 4). Lastly, I found that several wasp species are isolated to specific regions (e.g., U. lectoides is found only in the Pacific Northwestern

U.S. while U. canaliculatus is found only in the midwestern and Northeastern U.S.; Fig.

2.1, 2.2). This work was important because it provided the geographic context necessary to being my work on investigating sequential divergence of the broader wasp community attacking R. pomonella group flies in the midwestern U.S. (see Chapter 3) and the role that interspecific competition and resource partitioning has in multiplicatively amplifying biodiversity in this system (see Chapter 4).

The idea that “biodiversity begets biodiversity” is an important but relatively empirically unexplored concept in evolutionary ecology. I began Chapter 3 by providing a list of eight conditions (criteria) conducive to and supporting hypotheses of sympatric host race formation and sequential divergence in insect parasites that can help guide future studies in the field (Table 3.1). This list of criteria provides the template necessary to test for sequential divergence in the Rhagoletis-parasitoid system. In this chapter, evidence from population genetic studies (Figs. 3.5-3.7, Tables B.3, B.4, B.7), field based behavior observations, assay of host fruit odor discrimination (Figs. 3.8, 3.9), and analyses of the timing of life history (Figs. 3.10, 3.11) suggesting that three members of the community of parasitoid wasps is diversifying in parallel with their Rhagoletis hosts, including the recently diverged apple and hawthorn host races of R. pomonella formed

192

within the last 160 years. Furthermore, it appears that the host-associated ecological adaptations (life history timing and host odor recognition; Fig. 3.8-3.11) that generate reproductive isolation and speciation in the flies are likely the same adaptations generating divergence in all three species of wasps (Tables 3.2, 3.3). As a result, 7 of the

8 criteria supporting sequential divergence were met in the Rhagoletis-parasitoid system.

Therefore, divergent ecological selection pressures imposed by the host plants on

Rhagoletis are transmitted upward, across trophic levels, to their insect parasites, inducing multiple speciation events within the wasp community. This discovery of a starburst of adaptive radiation in the Rhagoletis parasitoid community may have broad implications for the understanding the genesis of new biodiversity and help shape the perspective concerning the role that biodiversity itself plays in generating more biodiversity. While I acknowledge that the results from this study represent a single datum, I have shown the process of sequential divergence may be common within a single system. The challenge is now to determine how widespread the process may be across systems to elucidate the relative contribution of sequential divergence to generating (insect) biodiversity in nature (Hood and Feder 2016).

While it is established that interspecific competition occurs commonly in nature

(Connell 1975, Schoener 1983, Goldberg and Barton 1992, Gurevitch et al. 1992, Denno et al. 1995, Maestre et al. 2005, Kaplan and Denno 2005), the evidence for competitions’ involvement in population divergence and speciation is less clear (Rundle and Nosil

2005, Hood et al. 2012). In Chapter 4, I explored the role that interspecific competition and temporal partitioning of resources play during sequential divergence in the

193

Rhagoletis-parasitoid system. Using a series of rearing experiments, field observations and diagnostic genetic analyses, I was able to determine the following. First, populations of each species of parasitoid appear to co-exist over space and time (Fig. 4.1). Second, host resources are limited during immature parasitoid feeding and development as no more than one species emerges from a single fly pupal case (Fig. 4.2). Third, species intensely compete for these limited resources (Fig. 4.3). Fourth, a competitive hierarchy exists among the parasitoids attacking Rhagoletis flies in order of dominance from D. alloeum, to U. canaliculatus, to D. mellea. Fifth, species subdivide the resource temporally and to a degree spatially (Fig. 4.4-4.6). Sixth, morphological features may allow the superior competitors to co-exist. Collectively, these results imply that interspecific competition promotes temporal resource partitioning that allows species to co-exist on shared host fly resources. As a result, this temporal subdivision appears to be accentuating allochronic isolation among conspecific wasps attacking different host flies, generating increased reproductive isolation and potentially facilitating population divergence, speciation and the formation of community-level biodiversity.

Plant feeding insects and the parasitoids that attack them are the most biodiverse groups of multicellular organisms (La Salle and Gauld 1991, Foottit and Adler 2009) on the planet. This begs the age old question: “Why are there so many insect species”

(Walsh 1864, Janzen 1977, Bush 1993, Novotny 2006, Mayhew 2007)? In Chapter 5, to better understand the origins of parasitoid biodiversity, I ask whether the temporal partitioning of host resources may mitigate competitive interactions to allow multiple parasitoid species to co-exist on the same insect host. Specifically, I used a meta-analysis

194

of 64 observations from 41 published studies to quantitatively assess if and to what degree the order and timing of oviposition affects the outcome of interspecific competition between immature parasitoids simultaneously developing within the same insect host. In this chapter, I had three main goals: (1) to assess how common competition is by testing for significant differences in the survivorship of two species parasitoids cohabitating the same host after manipulating the relative order and timing of oviposition; (2) to determine if and how the competitive ability of two parasitoid species oviposited at the same time affects their relative survivorships; and (3) to investigate if and how the oviposition manipulation experiments translate into differences in the timing of oviposition and abundance in natural populations. I found when both species oviposit at the same time, on average, one species is a superior competitor. In most cases, however, the competitively inferior species could gain an advantage over the superior competitor by ovipositing first into shared hosts. Furthermore, this competitive advantage increased as the interval between oviposition times increased. These results were also linked to patterns observed in nature. The more competitively inferior a species was in the oviposition manipulation experiments, the larger the time difference was between when competing species oviposited in nature. In addition, the larger the difference between the timing of oviposition in nature, the more abundant the inferior species was in natural populations. Similar to the results in Chapter 4, these results suggest that a greater number of species may be able to utilize a given host by temporally subdividing the resource. Intrinsically poor competitors may be able to persist in a given area (i.e., on a given host) or even gain an advantage by ovipositing at variable times into a shared host.

195

As a consequence, entire communities of parasitoids may be able to share a host by subdividing the resource. Thus, the results of the meta-analysis suggest that temporal axes of niche partitioning are important during resource utilization and may help to increasing biodiversity in a multiplicative manner in certain systems.

6.3 Further Avenues of Research

Is sequential divergence an important factor that generates biodiversity and in particular the incredible diversity the plant-feeding insects and the communities of insect parasites that attack these insects? Until recently, most evidence for sequential speciation had been inferred from studies of adaptive radiations following mass extinctions, community level studies of species richness and comparative phylogenetic analyses of clade diversity. However, my Ph.D. dissertation research suggests that the process may be common within systems that meet a certain set of criteria (Table 3.1). Furthermore, I have provided evidence in the Rhagoletis-parasitoid system and in parasitoids in general that temporal axes of resource partitioning may be critically important processes in promoting the co-existence of multiple parasitoid species, and facilitating sequential divergence. However, to better understand if and how sequential divergence contributes to the genesis of biodiversity, several questions need attention in future research.

First, while I outlined the criteria supporting hypotheses of sympatric host race formation and sequential divergence, it is important to know which types of systems are less likely to undergo the process. In this regard, the handful of systems have reported the apparent absence of sequential speciation (Cronin and Abrahamson 2001, Baer et al.

196

2004, Althoff 2008, Lozier et al. 2008, Dickey and Medina 2011). A common theme among these systems is that the parasitoids in question have multivoltine life cycles (i.e., more than one generation per year), a trait which reduces the potential for allochronic isolation. In addition, several of these studies have attributed negative results to (1) host plant discrimination behavior that is learned rather than genetically based and (2) external feeding of the host on their host plant which elevates the importance of visual cues while decreasing the significance of plant-associated chemical cues for locating and differentiating between hosts. Future studies documenting negative results are just as important to publish as the positive results and will help delineate the ecological characteristics that preclude sequential divergence.

Second, it is important to determine the frequency of sequential speciation both within and between systems? Is the community-wide, non-linear amplification of biodiversity seen in the Rhagoletis-parasitoid system more a rule or an exception? What restricts the number of parasitoids that can sequentially radiate on a given inset host? To this effect, an interesting secondary finding of Chapter 3 is that mtDNA analysis uncovered two cryptic but highly diverged haplotypes of Utetes attacking two fly hosts.

While I restricted analysis of Utetes to the single haplotype attacking all Rhagoletis hosts, this finding suggests that sequential speciation may be even more common than I document and opens previously unknown avenues for future research. Additionally, I have ongoing collaborations to investigate sequential divergence in the Rhagoletis- parasitoid system in an even more proximate geographic context in the Pacific

Northwestern U.S. Here, the fly was introduced ~ 60 years ago via larval infested apples

197

and has established host races on three different host plants: apples, native black hawthorn (C. douglasii) and the introduced, ornamental hawthorn (C. monogyna) (Linn et al. 2012, Sim et al. 2012, Hood et al. 2013, Mattsson et al. 2015). Preliminary results of host odor preference and life history timing suggest that all three parasitoid species attacking flies infesting these plants are also diverging in parallel with their fly hosts while results genetic analyses are currently pending. Similarly, how far up the trophic web can the effects of divergent ecological selection transcend to amplify biodiversity? In many systems, hyperparsitoids (parasitoids of parasitoids) are common and may experience the same divergent selection pressures as their lower trophic level counterparts. Furthermore, while phytophagous insects and their natural enemies have attributes that a priori may make them more prone to sequential divergence, a more balanced view of the prevalence of the process requires study of other types of organismal interactions. For example, recent phylogenetic studies suggest that the process may be common in birds and their parasites (Johnson et al. 2002). However, a deeper ecological inquiry into the barriers that reduce gene flow and generate reproductive isolation between sequentially diverging parasite populations coupled with genetic patterns of population divergence are needed in most of these cases. Finally, it may be that escape from parasitism and other natural enemies may favor host shifting in phytophagous insect specialists (Brown et al. 1995, Feder 1995). This tri-trophic, coevolutionary game of hide and seek, which may spin off several new life forms, may be a powerful force rapidly generating insect biodiversity at multiple trophic levels.

198

Third, for future studies, it is important to distinguish sequential divergence from strict co-speciation (see Chapter 3; Fig. 3.1). Sequential divergence requires that divergent ecological selection pressures cascade across trophic levels to cause linked patterns of diversity. However, sequential speciation is just one process that can increase clade richness across communities. In this regard, during co-speciation, concordant divergence across trophic levels is due to host and parasite populations being jointly geographically isolated, resulting in parallel allopatric speciation and/or parasites being vertically transmitted and lacking a sexually reproductive adult life stage independent of the host (de Vienne et al. 2013). Strict co-speciation is therefore not driven by the creation of new biological niches that result in ecological diversification (i.e., coevolutionary processes), but rather by the concordant geographic and reproductive separation of host and parasite populations. Distinguishing sequential divergence from strict co-speciation therefore requires study systems having appropriate natural histories

(e.g., those having free-living sexually reproductive life stages), known biogeographies

(to rule out non-ecologically based reproductive isolation as the primary cause for divergence), and well-resolved phylogenies documenting histories of parasite host shifting. An additional consideration for phylogenetics tests of sequential speciation is that in must be shown that a degree of divergent ecological adaptation accompanied (was required for) the host shift, and that parasites are not merely shifting between geographically separated hosts. Broad scale geographic sampling of species in areas of allopatry and sympatry coupled with genomic sequencing and trait mapping will help

199

estimate levels of gene flow between diverging populations and locate regions under divergent selection associated with ecological adaptation and sequential divergence.

Lastly, while interspecific competition is often cited as one of the major ecological factors shaping patterns of distribution, abundance, richness and diversity within and among populations and communities (Tilman 1982, Grover 1997), its role in ecological speciation is less understood (Rundle and Nosil 2005). While empirical studies have supported patterns of ecological character displacement (a process whereby species diverge to utilize different aspects of a shared resource distribution where taxa co-occur), driven by interspecific competition (Schluter 2000, Prichard and Schluter 2001, Pfennig and Pfennig 2009, Bolnick et al. 2010), no study has directly linked interspecific competition to the evolution of reproductive isolation and population divergence (Rundle and Nosil 2005). Furthermore, while the role of temporal isolation between diverging populations is an important component of many models of speciation-with-gene-flow in phytophagous insect specialists (e.g., Dres and Mallet 2002, Bush and Butlin 2004), little is known about how interspecific competition can help to accentuate this type of isolation

(but see Weiblen and Bush 2002). However, I contend that parasitoids are ideal systems to investigate the effects of interspecific competition on the speciation process (see an explanation in the Introduction of Chapter 5, Hood et al. 2012). For example, one hypothesis is that interspecific competition between species may exert selection pressures on the inferior competitor to switch and adapt to a secondary, non-utilized host (Feder et al. 1995, Weiblen and Bush 2002, Hood et al. 2012). In this scenario, subsequent adaptation to the new, derived host is the source for ecologically based reproductive

200

isolation that may lead to host race formation and speciation. To test this hypothesis, one would need to implement (1) genetic studies to confirm that populations attacking alternate hosts represent evolutionarily derived populations that are genetically differentiated and (2) perform a number of manipulative experiments in the field and laboratory to confirm that populations owe their reproductive isolation to ecological adaptations resulting from host shifts imposed upon them by competitors on the ancestral host. Unfortunately, I am unable to manipulate the Rhagoletis-attacking parasitoid in a laboratory setting at this time to directly test this hypothesis. However, many parasitoid systems are amendable to experimental manipulation (see Chapter 5) and high levels of replication which allow one to directly test if and how interspecific competition influences population divergence, host race formation and speciation.

6.4 Final Thoughts

The apple maggot fly, Rhagoletis pomonella, has long been recognized as a textbook example of host race formation and ecological speciation via host plant shift and has been an important model system in understanding how new biodiversity is formed in the face of gene flow. In this dissertation, using the Rhagoletis-parasitoid system, I have provided the first example that sequential divergence can amplify biodiversity across trophic levels not only linearly (1 fly to 1 parasitoid), but multiplicatively (1 fly to many parasitoids) and (2) that interspecific competition increases temporal isolation between diverging populations and facilitates this process. Now, the apple maggot fly and its parasitoid community may serve as a case study for understanding how “biodiversity

201

begets biodiversity” and new communities are multiplicatively assembled. Even if the process is rare in nature, it could, through this multiplicative effect, be an important process contributing to the evolution of new taxa. In particular, for organisms such as insects and their parasites that experience the environment and partition resources on a fine scale, the effects of new niche construction may ripple through the ecosystem and have important implications for biodiversity. Given that (1) over half of all animals may be parasites in a road sense, (2) insects are the most speciose group of animals on the plant, (3) an estimated 10-30 million plant-feeding insects species exist, (4) each plant- feeding insect is likely attacked by at least 1 insect natural enemy, (5) and insect parasites account for an estimated 25% of insect species, there is a world of opportunity for sequential to contribute to the origin of species.

6.5 Literature Cited

Althoff, D.M. 2008. A test of host-associated differentiation across the ‘parasite continuum’ in the tri-trophic interaction among yuccas, bogus yucca moths, and parasitoids. Molecular Ecology 17:3917-3927.

Baer, C.F., Tripp, D.W. Bjorksten, T.A. and Antolin, M.F. 2004. Phylogeography of a parasitoid wasp (Diaeretiella rapae): no evidence of host-associatd lineages. Journal of Evolutionary Biology 14:406-417.

Berlocher, S.H. and Feder, J.L. 2002. Sympatric speciation in phytophagous insects: moving beyond controversy? Annual Review of Entomology 47:773-815.

Bolnick, D.I. and Fitzpatrick, B.M. 2007. Sympatric speciation models and empirical evidence. Annual Review of Ecology, Evolution and Systematics 38:459-487.

Bolnick D.I., Ingram, T., Stutz, W.E., Snowberg, L.K., Lau, O.L. and Paull, J.S. 2010. Ecological release from interspecific competition leads to decoupled changes in population and individual niche width. Proceedings of the Royal Society B: Biological Sciences 277:1789-1797.

202

Brown, J.M., Abrahamson, W.G., Packer, R.A. and Way, P.A. 1995. The role of natural- enemy escape in a gallmaker host-plant shift. Oecologia 104:52-60.

Bush, G.L. 1993. A reaffirmation of Santa Rosalia, or why there are so many kinds of small animals? Evolutionary Patterns and Processes, eds Edwards D, Lees DR (Academic Press, New York) pp 229-249.

Bush, G.L and Bultin, R.K. 2004. Sympatric Speciation in Insects In: Adaptive Speciation eds. Dieckmann, U., Doebeli, M., Metz, J.A.J. and Tautz, D. pp. 229- 248. Cambridge University Press, U.K.

Connell, J.H. 1975. Some mechanisms producing structure in natural communities: a model and evidence from field experiments. Pp 460-490 in M. Cody and J. Diamond, eds. Ecology and evolution of communities. Harvard University Press, Cambridge, Mass.

Coyne J.A., Orr, H.A. 2004. Speciation. Sinauer, Sunderland, MA, USA.

Cronin, J.T. and Abrahamson, W.G. 2001. Do parasitoids diversify in response to host- platn shifts by herbivorous insects? Ecological Entomology 26:347-355.

Darwin, C. 1859. On the Origin of Species by Means of Natural Selection or the Preservation of Favored Races in the Struggle for Life. J. Marray, London.

Denno, R.F., McClure, M.S. and Ott, J.R. 1995. Interspecific interactions in phytophagous insects: competition reexamined and resurrected. Annual Review of Entomology 40: 297-331.

Dickey, A.M. and Medina, D.R. 2012. Lack of sequential radiation in a parasitoid of a host-associated aphid. Entomologia Experimentalis et Applicata 139:154-160.

Feder, J.L., Reynolds, K., Go, W. and Wang, E.C. 1995. Intra- and interspecific competition and host race formation in the apple maggot fly, Rhagoletis pomonella (Diptera: Tephritidae). Oecoogia 101:416-425.

Feder, J.L. 1995. The effects of parasitoids on sympatric host races of the apple maggot fly, Rhagoletis pomonella (Diptera: Tephritidae). Ecology 76:801-813.

Foottit, R.G. and Adler, P.H. 2009. Insect Biodiversity: Science and Society. Wiley, Oxford, UK.

203

Funk, D.J., Filchak, K. and Feder, J. 2002. Herbivorous insects: model systems for the comparative study of speciation ecology. Genetica 116:251-267.

Goldberg, D.E. and Barton, A.M. 1992. Patterns and Consequences of interspecific competition in natural communities: a review of field experiments with plants. American Naturalist 139:771-801.

Grover, J. 1997. Resource Competition. Chapman and Hall, London.

Gurevitch, J., Morrow, L.L., Wallace, A. and Walsh, J.S. 1992. A meta-analysis of competition in field experiments. American Naturalist 140:539-572.

Hood, G.R., Egan, S.P. and Feder, J.L. 2012. Interspecific competition and speciation in endoparasitoids. Evolutionary Biology 39:219-230.

Hood, G.R., Yee, W.L., Goughnour, R.B., Sim, S.B., Egan, S.P. Arcella, T., St. Jean, G., Powell, T.H.Q., Xu, C. and Feder, J.L. 2013. The geographic distribution of Rhagoeltis pomonella (Diptera: Tephritidae) in the western United States: introduced species of native population? Annals of the Entomological Society of America 106:59-65.

Janzen, D.H. 1977. Why are there so many species of insects? International Congress of Entomology. Washington D.C., U.S.A. 19-27 Aug. 1976.

Johnson, K.P., Adams, R.J., Page, R.D.M. and Clayton, D.H. When do parasites fail to speciation in response to host speciation? Systematic Biology 52:37-47.

Kaplan, I., and Denno, R.F. 2007. Interspecific interactions in phytophagous insects revisited: a quantitative assessment of competition theory. Ecology Letters 10:977-994.

La Salle, J. and Gauld, I.D. 1991. Parasitic Hymenoptera and the biodiversity crisis. Redia 74:315-334.

Linn, C.E., Yee, W., Sim, S.B., Cha, D.H., Powell, T.H.Q., Goughnour, R.B., Feder, J.L. 2012. Behavioral evidence for fruit odor discrimination and sympatric host races of Rhagoletis pomonella flies in the western United States. Evolution 66:3632- 3641.

Maestre, F.T., Valladares, F. and Reynolds, J.F. 2005. Is the change of plant-plant interactions with abiotic stress predictable? A meta-analysis of field results in arid environments. Journal of Ecology 93:748-757.

Mattsson, M., Hood, G.R., Feder, J.L. and Ruedas, L.A. 2015. Rapid and repeatable shifts in life-history of Rhagoletis pomonella (Diptera: Tephritidae) following 204

colonization of novel host plants in the pacific Northwestern United States. Ecology and Evolution 5:5823-5837.

Mayhew, P.J. 2007. Why are there so many insect species? Perspectives from fossils and phylogenies. Biological Reviews 82:425-454.

Novotny, V., Drozd, P., Miller, S.E., Kulfan, M., Janda, M., Basset, Y. and Weiblen, G.D. 2006. Why are there so man species of herbivorous insects in tropical rainforests? Science 25:1115-1118.

Pfennig, K.S. and Pfennig, D.W. 2009. Character displacement: ecological and reproductive reponses to a common evolutionary problem. The Quarterly Review of Biology 84:253-276.

Prichard, J.R. and Schluter, D. 2001. Decline interspecific competition during character displacement: summoning the ghost of competition past. Evoutionary Ecology Research 3:209-220.

Rundle, H.D. and Nosil, P. 2005. Ecological speciation. Ecology Leters 8:336-352.

Schluter, D. 2000. Ecological character displacement in adaptive radiation. American Naturalist 156:S4-S16.

Schoener, T.W. 1983. Field experiments on interspecific competition. American Naturalist 122:240-285.

Sim, S.B., Mattsson, M., Feder, J.L., Cha, D.H., Yee, W.L., Goughnour, R.B., Linn, C.E. and Feder, J.L. 2012. A field test for host fruit odour discrimination and avoidance behavior for Rhagoletis pomonella flies in the western United States. Journal of Evolutionary Biology 25:961-971.

Tilman, D. 1982. Resource Competition and Community Structure. Princeton University Press, Princeton, NJ. de Vienne, D.M., Refreigier, G., Lopez-Villavicencio, M., Tellier, A., Hood, M.E. and Giraud, T. 2013. Cospeciation vs. host-shift speciation: methods for testing, evidence for natural associations and relation to coevolution. New Phytologist 198:347-385.

Walsh, B.D. 1864. On phytophagic varieties and phytophagic species. Proceedings of the Entomolgoical Society of Philadelphia 3:403-430.

Weiblen, G.D. and Bush, G.L. 2002. Speciation in fig pollinators and parasites. Molecular Ecology 11:1573-1578.

205

APPENDIX A:

SUPPLEMENTAL MATERIAL FOR CHAPTER 2

A.1 Description of Appendix for Chapter 2

The appendix for Chapter 2 includes records of Rhagoletis-attacking parasitoid wasps (Hymenoptera: Braconidae) from personal collections and citations in the literature. Each record includes: city and state (and country, if outside the U.S.), host fly species, host plant species, total number of wasps collected (left blank if unknown), and literature cited for each collection.

206

TABLE A.1:

RECORDS OF PARASOTOID WASPS ATTACKING FRUIT FLIES IN THE RHAGOLETIS POMONELLA SPECIES

COMPLEX.

Spp. Location Fly host Plant host N Ref. Da Acton, ME R. mendax V. corymbosum 4 New Da Aiken, SC R. mendax V. stamineum 1 New Da Anna, IL R. sp. nr. pomonella C. florida 8 New Da Byron, GA R. sp. nr. mendax V. arboreum 271 New 207 Da Casnovia, MI R. pomonella C. mollis 44 Rull et al. 2009 Da Casnovia, MI R. pomonella C. mollis 246 New Da Chatsworth, NJ R. mendax V. corymbosum 27 New Da Colchester, CN R. pomonella M. domestica 4 Maier 1981 Da Columbia, SC R. sp. nr. mendax V. arboreum 4 New Da Como, Canada R. pomonella M. domestica 106 Cameron & Morrison 1977 Da Decatur, MI R. pomonella M. domestica 6 New Da Dowagiac, MI R. pomonella C. mollis 44 New Da Dowagiac, MI R. pomonella M. domestica 102 New Da East Lansing, MI R. mendax V. corymbosum 29 New Da East Lansing, MI R. pomonella C. mollis 1134 New Da East Lansing, MI R. pomonella M. domestica 136 New Da East Lansing, MI R. zephyria S. albus 6 New TABLE A.1 (CONTINUED)

Spp. Location Fly host Plant host N Ref. Da Fennville, MI R. mendax V. corymbosum 128 New Da Fennville, MI R. mendax V. corymbosum 18 New Da Fennville, MI R. pomonella C. mollis 148 New Da Fennville, MI R. pomonella C. mollis 20 Rull et al. 2009 Da Fennville, MI R. pomonella C. mollis 29 Forbes et al. 2008 Da Fennville, MI R. pomonella C. mollis 33 New Da Fennville, MI R. pomonella M. domestica 50 Forbes et al. 2008 Da Fennville, MI R. pomonella M. domestica 1 New Da Fennville, MI R. pomonella M. domestica 41 New Da Fort Valley, GA R. sp. nr. mendax V. arboreum 21 New 208 Da Galladin County, IL R. sp. nr. pomonella C. florida 2 New Da Geneva, NY R. pomonella M. domestica Dean & Chapman 1973 Da Gonzales, TX R. pomonella C. viridis 13 New Da Granger, IN R. pomonella C. mollis 8 Rull et al. 2009 Da Grant, MI R. pomonella C. mollis 115 Rull et al. 2009 Da Grant, MI R. pomonella C. mollis 54 This paper Da Grant, MI R. pomonella M. domestica 20 This paper Da Grant, MI R. pomonella M. domestica 19 This paper Da Hamden, CN R. pomonella M. domestica 1 Maier 1981 Da Hamden, CN R. pomonella M. domestica 3 Maier 1981 Da Holland, MI R. mendax V. corymbosum 8 Forbes et al. 2009 Da Ithaca, NY R. pomonella M. domestica 1 Middlekauff 1941 Da Kalamazoo, MI R. pomonella M. domestica 3 New TABLE A.1 (CONTINUED)

Spp. Location Fly host Plant host N Ref. Da Lake Woods, IL R. pomonella C. mollis 17 New Da Lincoln, Canada R. pomonella M. domestica Monteith 1977 Da Lincoln, NE R. zephyria S. occidentalis 4 New Da Livingston, TX R. pomonella C. opaca 1 New Da Lizella, GA R. pomonella C. flabatella 3 New Da Lyons, GA R. sp. nr. mendax V. arboreum 5 New Da Madison, WI R. pomonella M. domestica 1000 Boush & Baerwald 1967 Da Madison, WI R. pomonella M. domestica 200 Boush & Baerwald 1967 Da Medaryville, IN R. mendax G. dumosa 1 New Da Needville, TX R. pomonella C. mollis 1 New 209 Da Needville, TX R. pomonella C. viridis 1 New Da New Madrid, MO R. pomonella C. mollis 1 New Da Niagra, Canada R. pomonella M. domestica Monteith 1977 Da Niles, MI R. pomonella C. mollis 13 New Da Notre Dame, IN R. pomonella C. mollis 24 New Da Orono, ME R. pomonella M. domestica 6 Muesebeck 1956 Da Red Hook, NJ R. pomonella M. domestica 4 Muesebeck 1956 Da Sawyer, MI R. mendax V. corymbosum 2 New Da Sawyer, MI R. pomonella M. domestica 1 New Da Scotts Ferry, SC R. sp. nr. mendax V. arboreum 14 New Da Sheridan, WY R. zephyria S. occidentalis New Da Silver Springs, FL R. sp. nr. mendax V. arboreum 1 New Da South Bend, IN R. pomonella C. mollis 53 Rull et al. 2009

TABLE A.1 (CONTINUED)

Spp. Location Fly host Plant host N Ref. Da South Bend, IN R. pomonella C. mollis 51 New Da St. Bruno, Canada R. pomonella M. domestica 6 Rivard 1967 Da Staples, MN R. zephyria S. albus 22 New Da State College, PN R. mendax V. corymbosum 4 New Da State College, PN R. zephyria S. albus 67 New Da State College, PN Lonicera hybrid L. spp. 42 New Da Texarkana, TX R. pomonella C. brachycantha 3 New Da Three Oaks, MI R. pomonella C. mollis 382 New Da Three Oaks, MI R. pomonella M. domestica 2 New Da Tuskeegee, AL R. sp. nr. mendax V. arboreum 85 New 210 Da Urbana, IL R. pomonella C. mollis 43 New Da Urbana, IL R. pomonella M. domestica 2 New Da Wainfleet, Canada R. mendax V. corymbosum 2 New Da Wallingford, CN R. pomonella M. domestica 9 Muesebeck 1956 Da Washington D.C. R. pomonella M. floribunda 3 New Da Worcester, MA R. pomonella C. mollis 3 New Dm Baton Rouge, LA R. sp. nr. pomonella C. florida 99 New Dm Bogalusa, LA R. sp. nr. pomonella C. florida 8 New Dm Byron, GA R. sp. nr. pomonella C. florida 2 New Dm Casnovia, MI R. pomonella C. mollis 2 Rull et al. 2009 Dm Chatsworth, NJ R. mendax V. corymbosum 26 New Dm Cherryfield, ME R. mendax V. corymbosum 21 Woods 1915 Dm Cherryfield, ME R. mendax V. corymbosum 4040 Lathrop & Newton 1933 TABLE A.1 (CONTINUED)

Spp. Location Fly host Plant host N Ref. Dm Clemson, SC R. sp. nr. pomonella C. florida New Dm Digby, Canada R. pomonella M. domestica 1 Good 1916 Dm Douglas, GA R. sp. nr. pomonella C. florida 3 New Dm Dowagiac, MI R. pomonella C. mollis 3 New Dm Dowagiac, MI R. pomonella M. domestica 3 New Dm East Lansing, MI R. pomonella C. mollis 12 New Dm East Lansing, MI R. pomonella M. domestica 59 New Dm East Lansing, MI R. zephyria S. albus 3 New Dm Fennville, MI R. mendax V. corymbosum 50 New Dm Fennville, MI R. pomonella C. mollis 3 Rull et al. 2009 211 Dm Fennville, MI R. pomonella C. mollis 4 New Dm Fennville, MI R. pomonella C. mollis 3 New Dm Fennville, MI R. pomonella M. domestica 24 New Dm Folkston, GA R. sp. nr. pomonella C. florida New Dm Fort Valley, GA R. sp. nr. pomonella C. florida New Dm Geneva, NY R. pomonella M. domestica Dean & Chapman 1973 Dm Geneva, NY R. zephyria S. albus 4 New Dm Goshen, CN R. pomonella C. mollis 2 Maier 1981 Dm Goshen, CN R. pomonella C. mollis 2 Maier 1981 Dm Goshen, CN R. pomonella C. mollis 12 Maier 1981 Dm Granger, IN R. cingulata P. serotina 45 New Dm Granger, IN R. sp. nr. pomonella C. florida 3 New Dm Grant, MI R. pomonella C. mollis 35 New

TABLE A.1 (CONTINUED)

Spp. Location Fly host Plant host N Ref. Dm Grant, MI R. pomonella C. mollis 351 Feder 1995 Dm Grant, MI R. pomonella M. domestica 3 New Dm Grant, MI R. pomonella M. domestica 1026 Feder 1995 Dm Hamden, CN R. pomonella M. domestica 1 Maier 1981 Dm Hamden, CN R. pomonella M. domestica 4 Maier 1981 Dm Kalamazoo, MI R. pomonella M. domestica 5 New Dm Lincoln, Canada R. pomonella M. domestica 53 Monteith 1971 Dm Mansfield, CN R. pomonella C. mollis 1 Maier 1981 Dm Mansfield, CN R. pomonella M. domestica 2 Maier 1981 Dm Mt. Washington, NH Not specified Not specified 1 Slossen 1900 212 Dm Nacogdoches, TX R. sp. nr. pomonella C. florida 6 New Dm Niagara, Canada R. pomonella P. domestica 34 Monteith 1971 Dm Oak Park, GA R. sp. nr. pomonella C. florida 4 New Dm Orono, ME R. pomonella M. domestica Woods 1915 Dm Rednersville, Canada R. pomonella M. domestica Monteith 1977 Dm Rocky Mount, NC R. sp. nr. pomonella C. florida 2 New Dm Saint Cloud, WA R. pomonella C. douglasii 78 Gut & Brunner 1994 Dm Saint Cloud, WA R. pomonella C. douglasii 36 Gut & Brunner 1994 Dm San Francisco, Mexico R. pomonella C. rosei 1 Rull et al. 2009 Dm Sawyer, MI R. mendax V. corymbosum 1 New Dm South Bend, IN R. pomonella C. mollis 1 New Dm Stafford, CN R. pomonella M. domestica 1 Maier 1981 Dm State College, PN Lonicera hybrid L. spp 36 New TABLE A.1 (CONTINUED)

Spp. Location Fly host Plant host N Ref. Dm Stevenson, WA R. pomonella C. douglasii 13 Gut & Brunner 1994 Dm Syre, MN R. pomonella C. mollis 1 New Dm Texarkana, TX R. sp. nr. pomonella C. florida 17 New Dm Tuskeegee, AL R. sp. nr. pomonella C. florida 1 New Dm Union, CN R. pomonella M. domestica 12 Maier 1981 Dm Urbana, IL R. pomonella C. mollis 1 New Dm Wainfleet, Canada R. mendax V. corymbosum 1 New Dm Washington Co., MA R. mendax V. corymbosum Woods 1915 Dm Windham, CN R. pomonella M. domestica 1 Maier 1981 Dm Xoxonacaxtla, Mexico R. pomonella C. mexicana 2 Rull et al. 2009 213 Od Door County, WI R. tabellaria C. stolonifera 7 New Od Eagle Creek, OR R. pomonella C. monogyna 136 AliNiazee 1985 Od Eagle Creek, OR R. pomonella M. domestica 2 AliNiazee 1985 Od Eagle Creek, OR R. zephyria S. albus 25 AliNiazee 1985 Od Mansfield, CN R. pomonella C. mollis 17 Maier 1981 Od Missoula, MT R. zephyria S. occidentalis 1 New Od Philomath, OR R. zephyria S. rivularis 4 New Od Saint Cloud, WA R. pomonella C. monogyna 22 Gut & Brunner 1994 Od Vancouver, WA R. pomonella C. monogyna 205 Gut & Brunner 1994 Od Victoria, Canada R. zephyria S. racemosus 16 Downes 1919 Od Walla Walla, WA R. zephyria S. albus 15 New Od Waukesha, WI R. zephyria S. occidentalis 1 New Uc Anna, IL R. sp. nr. pomonella C. florida 3 New TABLE A.1 (CONTINUED)

Spp. Location Fly host Plant host N Ref. Uc Anna, IL R. sp. nr. pomonella C. florida 10 New Uc Baton Rouge, LA R. sp. nr. pomonella C. florida 6 New Uc Bogalusa, LA R. sp. nr. pomonella C. florida 22 New Uc Byron, GA R. sp. nr. pomonella C. florida 11 New Uc Casnovia, MI R. pomonella C. mollis 13 Rull et al. 2009 Uc Casnovia, MI R. pomonella C. mollis 73 New Uc Cassopolis, MI R. sp. nr. pomonella C. florida 1 New Uc Centralia, IL R. sp. nr. pomonella C. florida 75 New Uc Cherryfield, ME R. pomonella M. domestica 3 Gahan 1919 Uc Puebla, Mexico R. pomonella C. gracilor 8 Rull et al. 2009 214 Uc Colchester, CN R. pomonella M. domestica 1 Maier 1981 Uc Como, Canada R. pomonella M. domestica 91 Cameron & Morrison 1977 Uc Cornwall, CN R. pomonella M. domestica 3 Maier 1981 Uc Decatur, MI R. pomonella M. domestica 1 New Uc Douglas, GA R. sp. nr. pomonella C. florida 11 New Uc Dowagiac, MI R. pomonella C. mollis 38 New Uc Dowagiac, MI R. pomonella M. domestica 35 New Uc Durango, Mexico R. pomonella C. rosei 1 Rull et al. 2009 Uc East Lansing, MI R. pomonella C. mollis 451 New Uc East Lansing, MI R. pomonella M. domestica 10 New Uc East Lansing, MI R. zephyria S. albus 1 New Uc East Lansing, MI R. zephyria S. albus New Uc Fayetteville, NC R. sp. nr. pomonella C. florida 2 New TABLE A.1 (CONTINUED)

Spp. Location Fly host Plant host N Ref. Uc Fennville, MI R. pomonella C. mollis 97 Rull et al. 2009 Uc Fennville, MI R. pomonella C. mollis 19 New Uc Fennville, MI R. pomonella M. domestica 2 New Uc Folkston, GA R. sp. nr. pomonella C. florida New Uc Gainsville, FL R. sp. nr. pomonella C. florida 2 New Uc Geneva, NY R. pomonella M. domestica Dean & Chapman 1973 Uc Geneva, NY R. zephyria S. albus 30 New Uc Goshen, CN R. pomonella C. mollis 3 Maier 1981 Uc Goshen, CN R. pomonella C. mollis 7 Maier 1981 Uc Granger, IN R. sp. nr. pomonella C. florida 30+ New 215 Uc Granger, IN R. sp. nr. pomonella C. florida 96 New Uc Grant, MI R. pomonella C. mollis 38 Rull et al. 2009 Uc Grant, MI R. pomonella C. mollis 91 New Uc Grant, MI R. pomonella C. mollis 1 Feder 1995 Uc Grant, MI R. pomonella M. domestica 13 New Uc Grant, MI R. pomonella M. domestica 497 Feder 1995 Uc Hamden, CN R. pomonella M. domestica 1 Maier 1981 Uc Ithaca, NY R. pomonella M. domestica 19 Middlekauff 1941 Uc Ixmiquilpan, Mexico R. pomonella C. rosei 202 Rull et al. 2009 Uc Ixmiquilpan, Mexico R. pomonella C. rosei 45 Rull et al. 2009 Uc Kisatche, LA R. sp. nr. pomonella C. florida 14 New Uc La Mojonera, Mexico R. pomonella C. gracilor 3 Rull et al. (2009) Uc Lincoln, Canada R. pomonella M. domestica 4 Monteith (1971)

TABLE A.1 (CONTINUED)

Spp. Location Fly host Plant host N Ref. Uc Duraznos, Mexico R. pomonella C. gracilor 5 Rull et al. (2009) Uc Mansfield, CN R. pomonella C. mollis 12 Maier 1981 Uc Mansfield, CN R. pomonella C. mollis 14 Maier 1981 Uc Mansfield, CN R. pomonella M. domestica 37 Maier 1981 Uc Niagra, Canada R. pomonella M. domestica Monteith 1971 Uc Niagra, Canada R. pomonella P. domestica 1 Monteith 1971 Uc Niles, MI R. pomonella C. mollis 169 New Uc Notre Dame, IN R. pomonella C. mollis 8 New Uc Oak Park, GA R. sp. nr. pomonella C. florida 8 New Uc Rednersville, Canada R. pomonella M. domestica Monteith 1971 216 Uc Rocky Mount, NC R. sp. nr. pomonella C. florida 1 New Uc Santa Ana, Mexico R. pomonella C. gracilor 3 Rull et al. 2009 Uc South Bend, IN R. pomonella C. mollis 5 Rull et al. 2009 Uc South Bend, IN R. pomonella C. mollis 35 New Uc Montarville, Canada R. pomonella M. domestica 22 Rivard 1967 Uc State College, PN Lonicera hybrid L. spp 50 New Uc Tancitaro, Mexico R. pomonella C. mexicana 1 Rull et al. 2009 Uc Three Oaks, MI R. pomonella C. mollis 86 New Uc Three Oaks, MI R. pomonella M. domestica 7 New Uc Tolland, CN R. pomonella M. domestica 1 Maier 1981 Uc Tuskeegee, AL R. sp. nr. pomonella C. florida 10 New Uc Union, CN R. pomonella M. domestica 10 Maier 1981 Uc Valdosta, GA R. sp. nr. pomonella C. florida 1 New TABLE A.1 (CONTINUED)

Spp. Location Fly host Plant host N Ref. Uc Windham, CN R. pomonella M. domestica 5 Maier 1981 Uc Windham, CN R. pomonella M. domestica 2 Maier 1981 Uc Xoxonacaxtla, Mexico R. pomonella C. mexicana 64 Rull et al. 2009 Uc Zoquitlan, Mexico R. pomonella C. rosei 5 Rull et al. 2009 Ul Benton, OR R. zephyria S. albus 1 New Ul Corvallis, OR R. zephyria S. albus Gahan 1919 Ul Douglas, OR R. zephyria S. albus 5 New Ul Eagle Creek, OR R. pomonella C. monogyna 4 AliNiazee 1985 Ul Eagle Creek, OR R. zephyria S. albus 29 AliNiazee 1985 Ul Gaston, OR R. zephyria S. albus 19 New 217 Ul Kalispell, MT R. zephyria S. occidentalis 1 New Ul Missoula, MT R. zephyria S. occidentalis 38 New Ul Park Rapids, MN R. pomonella C. mollis 2 New Ul Park Rapids, MN R. zephyria S. occidentalis 7 New Ul Park Rapids, MN R. zephyria S. occidentalis 9 New Ul Philomath, OR R. zephyria S. albus 52 New Ul Philomath, OR R. zephyria S. rivularis 4 New Ul Rednersville, Canada R. pomonella M. domestica Monteith 1977 Ul Staples, MN R. pomonella C. mollis 6 New Ul Staples, MN R. zephyria S. occidentalis 8 New Ul Syre, MN R. pomonella C. mollis 6 New Ul Syre, MN R. zephyria S. occidentalis 14 New Ul Walla Walla, WA R. zephyria S. albus 1 New TABLE A.1 (CONTINUED)

Spp. Location Fly host Plant host N Ref. Ur Byron, GA R. sp. nr. mendax V. arboreum 6 New Ur Chatsworth, NJ R. mendax V. corymbosum 1 New Ur Cherryfield, ME R. mendax V. corymbosum 4 Gahan (1919) Ur Fennville, MI R. mendax V. corymbosum 1 New Ur Lake of the Woods, IL R. cornivora C. amomum 1 New Ur State College, PN R. cornivora C. amomum 126 Juliano & Borowicz 1987 Ur Washington Co., MA R. mendax V. corymbosum Lathrop & Nickels 1931 Note: Localities missing references information are from personal collections documented for the first time herein. Abbreviations: Diachasma alloeum (Da), Diachasmimorpha mellea (Dm), Opius, downesi (Od), Utetes canaliculatus (Uc), U. lectoides (Ul) and U. richmondi (Ur). 218

A.2 Literature Cited

Boush, G. M., and R. J. Baerwald. 1967. Courtship behavior and evidence for a sex pheromone in the apple maggot parasite, Opius alloeus (Hymenoptera: Braconidae). Annals of the Entomological Society of America 60:865-866.

Cameron, P. J., and F. O. Morrison. 1977. Analysis of mortality in the apple maggot, Rhagoletis pomonella (Diptera: Tephritidae), in Quebec. The Canadian Entomologist 109:769-787.

Dean, R. W., and P. J. Chapman. 1973. Bionomics of the apple maggot in Eastern New York. Search Agriculture 3:10.

Downes, W. 1919. The apple maggot in British Columbia. The Canadian Entomologist 51:2-4.

Feder, J. L. 1995. The Effects of Parasitoids on Sympatric Host Races of Rhagoletis- pomonella (Diptera, Tephritidae). Ecology 76:801-813.

Forbes, A. A., T. H. Q. Powell, M. A. F. Noor, N. F. Lobo, and J. L. Feder. 2008. Development of novel microsatellite loci for Diachasma alloeum (Hymenoptera: Braconidae), a parasitoid of Rhagoletis pomonella. Molecular Ecology Resources 8:373-376.

Forbes, A. A., T. H. Q. Powell, L. L. Stelinski, J. J. Smith, and J. L. Feder. 2009. Sequential sympatric speciation across trophic levels. Science 323:776-779.

Gahan, A. B. 1919. Descriptions of seven new species of Opius (Hymenoptera: Braconidae). Proceedings of the Entomological Society of Washington 21:161- 170.

Gahan, A. B. 1930. Synonymical and descriptive notes on parasitic Hymenoptera. Proceedings of the United States National Museum 77:1-12.

Good, C. A. 1916. A few observations on the apple maggot parasite - Biosteres rhagoletis Richmond. The Canadian Entomologist 48:168.

Gut, L. J., and J. F. Brunner. 1994. Parasitism of the apple maggot, Rhagoletis pomonella, infesting hawthorns in Washington. Entomophaga 39:41-49.

Juliano, S. A., and V. A. Borowicz. 1987. Parasitism of a frugivorous fly, Rhagoletis cornivora, by the wasp Opius richmondi: relationships to fruit and host density. Canadian Journal of Zoology-Revue Canadienne De Zoologie 65:1326-1330.

Lathrop, F. H., and R. C. Newton. 1933. The Biology of Opuis melleus Gahan, a parasite of the blueberry maggot. Journal of Agricultural Research 46:143-160.

219

Lathrop, F. H., and C. B. Nickels. 1931. The blueberry maggot from an ecological viewpoint. Annals of the Entomological Society of America 24:260-281.

Maier, C. T. 1981. Parasitoids emerging from puparia of Rhagoletis pomonella (Diptera: Tephritidae) infesting hawthorn and apple in Connecticut. The Canadian Entomologist 113:867-870.

Middlekauff, W. W. 1941. Some biological observations of the adults of the apple maggot and the cherry fruitflies. Journal of Economic Entomology 34:621-624.

Monteith, L. G. 1971. The status of parasites of the apple maggot, Rhagoletis pomonella (Diptera: Tephritidae), in Ontario. The Canadian Entomologist 103:507-512.

Monteith, L. G. 1977. Additional records and the role of the parasites of the apple maggot Rhagoletis pomonella (Diptera: Tephritidae) in Ontario. Proceedings of the Entomological Society of Ontario 108:3-6.

Muesebeck, C. F. W. 1956. On Opius ferrugineus Gahan and two closely similar new species (Hymenoptera: Braconidae). Entomological News 67:99-102.

Rivard, I. 1967. Opius lectus and O. alloeus (Hymenoptera: Braconidae), larval parasitoids of the apple maggot, Rhagoletis pomonella (Diptera: Tephritidae), in Quebec. The Canadian Entomologist 99:895-896.

Rull, J., R. Wharton, J. L. Feder, L. Gullien, J. Sivinski, A. Forbes, and M. Aluja. 2009. Latitudinal variation in parasitoid guild composition and parasitism rates of North American hawthorn infesting Rhagoletis. Environmental Entomology 38:588-599.

Slossen, A. T. 1900. Additional list of insects taken in alpine region of Mount Washington. Entomological News 11:319-323.

Woods, W. C. 1915. Biosteres rhagoletis Richmond, a parasite of Rhagoletis pomonella Walsh. The Canadian Entomologist 47:292-295.

220

APPENDIX B:

SUPPLAMENTAL TEXT AND TABLES FOR CHAPTER 3

B.1 Description of Appendix for Chapter 3

The appendix for Chapter 3 contains supplemental text and a series of supplemental tables. The supplemental text details parasitoid biology, biogeography and host associations. The supplemental tables detail sampling locations and characteristics of each microsatellite genotyped as well as summary statistics of eclosion and host odor discrimination studies and results from statistical analyses.

B.2 Parasitoid Biology

Diachasma alloeum, Diachasmimorpha mellea and Utetes canaliculatus

(Hymenoptera: Braconidae: Opiinae) are all endoparasitoid wasps specific throughout their life cycle to flies in the genus Rhagoletis (Forbes et al. 2010) (Fig 3.2). Utetes attacks eggs of Rhagoletis laid beneath the surface of fruit, while D. alloeum and D. mellea lay their eggs into 2nd and 3rd instar fly larvae feeding within fruit (Forbes et al.

2010). Like their fly hosts, each wasp species is univoltine, having one generation per year. Females alight on a host fruit and examine its surface with their antennae to detect fly eggs or larvae. When a fly is found, a female wasp will thrust her ovipositor into the egg or larvae in the fruit (Lathrop and Newton 1933, Forbes et al. 2010). When a parasitized fly larva is finished feeding and the fruit falls to the ground, the maggot will

221

leave the fruit, burrow into the soil, enter a facultative diapause, and pupate. The parasitoid larva will then consume its fly host and overwinter in the pupal case of the consumed fly. The next summer, the wasp will complete development and eclose (Fig.

3.2E). Free-living adult wasps reach sexual maturity within a few days and then search for host fruit to find mates and oviposition sites (Lathrop and Newton 1933, Forbes et al.

2010).

B.3 Host Ranges, Geographic Distributions, and Parasitism Rates

Diachasma alloeum is a member of the ferrugineum species group (Wharton and

Marsh 1978, Forbes et al. 2010). Endemic to North America, D. alloeum is primarily restricted to the eastern U.S. where it attacks four fly hosts: the apple and hawthorn- infesting host races of R. pomonella, the blueberry fly, R. mendax, and the snowberry fly,

R. zephyria (Forbes et al. 2010). The wasp has been found as far west as Wyoming and as far south as Texas (Forbes et al. 2010). Diachasma alloeum is the most common

Rhagoletis-attacking parasitoid in the eastern U.S. Parasitism rates from D. alloeum can be as high as 50% for hawthorn flies (Feder 1995, Forbes et al. 2010, Hood et al. 2012).

Parasitism is less common for apple flies, but can still be over 10% (Feder 1995, Forbes et al. 2010, Hood et al. 2012).

Utetes canaliculatus is a member of the truncates species group endemic to North

America (Wharton and Marsh 1978, Forbes et al. 2010). While members of this group have been reared from several species of Rhagoletis (U. frequens attacks the western cherry fruit fly [R. indifferens]; U. juniperi attacks the juniper berry fly [R. juniperina];

U. rosae attacks the rose hip fly [R. basiola], and U. tabellariae attacks the red osier

222

dogwood fly [R. tabellaria]), all of these wasps are morphologically distinguishable from

U. canaliculatus attacking R. pomonella (Lathrop and Newton 1933, Wharton and Marsh

1978, Forbes et al. 2010, Hood et al. 2012). Utetes canaliculatus is restricted to attacking four taxa in the R. pomonella complex: the apple and hawthorn-infesting host races of R. pomonella, R. zephyria, and the flowering dogwood fly (Forbes et al. 2010, Hood et al.

2012). Unlike D. alloeum, U. canaliculatus is rarely reared from the blueberry fly, R. mendax (Forbes et al. 2010, Hood et al. 2012). The geographic distribution of U. canaliculatus is restricted to the eastern U.S. and southeastern Canada, ranging as far west as eastern Minnesota and south to Texas (Forbes et al. 2010). Parasitism rates of U. canaliculatus vary depending on location, host-association, and year sampled. Typically,

U. canaliculatus is relatively rare, with parasitism rates ranging from ~ 1–8 % (Forbes et al. 2010, Hood et al. 2012).

Diachasmimorpha is the sister genus to Diachasma (Wharton 1997) and is a member of the mexicana species group endemic to North America (Wharton and Marsh

1978, Forbes et al. 2010). While members of the genus have been reared from walnut husk flies (R. juglandis attacks R. boycei and R. juglandis in the southwestern U.S.), D. mellea is restricted to attacking four fly taxa in the midwestern and northeastern U.S.: the apple and hawthorn-infesting host races of R. pomonella, the blueberry fly, R. mendax, and the eastern cherry fly, R. cingulata (host: black cherry, Prunus serotina). The geographic distribution of D. mellea is similar to that of D. alloeum, with the major difference being that D. mellea also extends into the central highlands of Mexico (Forbes et al. 2010, Hood et al. 2012). Diachasmimorpha mellea is the rarest of the parasitoids investigated in the study, with parasitism rates in the eastern U.S. often ≤ 1% (Feder

223 1995, Forbes et al. 2010, Hood et al. 2012). Diachasmimorpha mellea and D. alloeum are morphologically similar, differing only in the length of the clypeus, a broad plate located on the front of the head between the labrum and the frons, which is shorter in D. alloeum

(Wharton and Yoder 2015) (see Fig. 3.2).

B.4 Literature Cited

Feder, J.L. 1995. The effects of parasitoids on sympatric host races of the apple maggot fly, Rhagoletis pomonella (Diptera: Tephritidae). Ecology 76:801-813.

Hood, G.R., Egan, S.P. and Feder, J.L. 2012. Interspecific competition and speciation in endoparasitoids. Evolutionary Biology 39:219-230.

Lathrop, F.H. and Newton, R.C. 1933. The biology of Opius melleus Gahan, a parasite of the blueberry maggot. Journal of Agricultural Research 48:143-160.

Wharton, W.A. and Marsh, P.M. 1978. New World Opiinae (Hymenoptera: Braconidae) parasitic on Tephritidae (Diptera). Journal of the Washington Academy of Sciences 68:147-167.

Wharton, R.A. 1997. Generic relationships of opine Braconidae (Hymenoptera) parasitic on fruit infesting Tephritidae (Diptera). Contributions of the American Entomological Institute 30:1-53.

Wharton, R.A. and Yoder, M.J. Parasitoids of Fruit-Infesting Tephritidae. Available at: paroffit.org/ [Accessed July 2, 2015].

224

8 3 6 18 23 20 28 61 23 18 Dm ♀ n

2 9 6 12 18 10 13 12 32 14 Dm ♂ ymenopterans n . H

4 3 4 6 5 Uc ♀ 42 14 19 18 18 15 37 23 39 19 34 11 28 n

genotyped

2 8 1 1 3 4 6 Uc ♂ 14 23 15 16 27 24 11 14 32 n

D. mellea 5.97 and 1.80/86.63 41.75/86.19 Lat./long. 43.35/85.86 42.73/84.46 42.60/86/15 41.96/86.14 4 41.75/86.22 40.09/88.21 42.88/77.01 43.35/85.86 42.72/84.48 42.60/86.16 41.96/86.14 41.80/86.63 41.74/86.19 42.01/8 41.75/86.19 42.60/86/15 42.74/84.48 40.81/77.8

U. canaliculatus

South Bend, IN South Bend, Location MI Grant, MI EastLansing, MI Fennville, MI Dowagiac, MI Three Oaks, IN South Bend, MI Urbana, NY Geneva, MI Grant, MI East Lansing, MI Fennville, MI Dowagiac, MI Three Oaks, IN South Bend, MI Dowagiac, IN South Bend, MI Fennville, MI East Lansing, PA College, State

TABLE B.1:TABLE

pomonella

nr. R. cingulata Host fly origin Host R. pomonella R. pomonella R. R. mendax R. zephyria

)

) Cornus florida Cornus

Prunus emarginata) Prunus Symphoricarpos albus Symphoricarpos Vaccinium corybosum Vaccinium Crataegus spp. Crataegus COLLECTING SITES SITES AND ECOOGICALLY GENETICALLYCOLLECTING ANALYZED CHAPTER 3 IN Malus domesticus Malus Flowering dogwood ( dogwood Flowering ( Blueberry ( Snowberry ( Cherry Black Apple ( Apple Host plant origin plant Host ( Hawthorn

3 2 9 6 3 4 5 6 4 6 5 6 7 8 1 2 1 2 3 4 No. are haplodiploid, the maximum number thus allelesof scored at each inlocus each population calculatedis by adding the number of males and timestwo the number females.of Note: Given are designations,site host associations, and number of andmale female

225 TABLE B.2:

LIST OF MICROSATELLITES GENOTYPED IN CHAPTER 3

No. Locus Forward Primer Sequence (5'-3') Reverse Primer Sequence (5'-3') alleles Alleles pooled UC08 GTGCTGATGTGAGCAGGAAA GATGAGAGAGGCCAGAATGC 12 103 UC10 GGATTCCTTGAAACGGGATA CGTTCACGAGGACCTTCATA 11 123 UC12 CGTTGGTAACGGAACGAAAT GGTAAGTTGGCATCGAGAA 13 199, 200, 205 UC14 GTGAAACGGAAAATGGCAAC CAGGCCAATGTACGTCTCCT 11 215, 219, 225, 231, 253, 255 UC16 ATCCACCCCCTTTACGTTTT CATATCCAAAATCCCGATGC 12 226, 232, 237 UC18 CCATTTGGGCCTCTACAAAA TGGGACCCAAAAAGAACAAA 14 100, 108, 110, 112, 119, 132 UC19 TCTAAAATATGATCGCCAATTTC CCAAAAATCTCTGGGAAACAA 10 120, 122 UC22 ACCGTTTGACCGTAGCAAAA TCTCACGAGCACATCGAAAC 8 233, 237 UC32 TGGAAGTTGAGTGAAACTGCT CCTCGGTGATTTTCCTTCTG 8 244

226 UC47 TACAAACGGCAGCTACGATG GTCTGTACACCGAGGGAGGA 10 176 UC48 CCCTCTCTCGCCCTATCTTT ATTTTCGGGACGTGGCTTAG 10 168, 172 UC50 CATCCAATCCCTTCACTCGT GGGAGGTCTCGTAGCATTGA 10 175, 179, 181, 195 UC52 TACCCAAGACCCAGCTCAAC TGGGTCCCTTTTACCCTTTC 18 144, 148, 152, 159, 163 UC53 TCCTTCTTCCAACAATTTTTCT ATCGTTTCGACATGTGTTGC 14 145, 161, 169, 177 UC54 TCAAAATCCAGTGGAAAATCC CGGTGAAAATCACATCACATTC 14 156, 160 UC57 GCCAAGGAGAAGAGAGACTCC GACTCGATCGCGAAGATAGG 8 173 UC59 TAGGGGTACATGGGTCTTGG CAAATAACCCGAAGGCAATG 12 167, 175, 184, 185 UC60 GGATACGCTCGAGTCTCCTG CCCCGATGACAACAGATTTT 20 210, 218, 222 UC61 GCATGACTACGGCGTACAAA TGTTTTGGTATTCAGAGAGCATTC 12 190 UC65 CGTAACAAAATGCAGGGAGA AGAAAACGCTTGGCATCAAT 13 113 DM01 CCGCGGATTATACTGAAACAA ATGCCCTAGCTGGCATGATA 8 228 DM06 CGAGTTGCATATCGTTTTTCG TTGCTAGCAGTATTCGTTCGTT 10 204, 214, 216, 220 TABLE B.2 (CONTINUED)

No. Locus Forward Primer Sequence (5'-3') Reverse Primer Sequence (5'-3') alleles Alleles pooled DM14 CCGGACATTACCAGCAAACT TCTGCTTTGGTTTGGAGTGA 32 138, 143, 145, 147, 150, 154, 158, 160, 162, 168, 170, 172 174, 178, 180 DM15 GGCACAAAGCCTCGTGTATC ATTTGGGTCTGTTTGGGTCA 22 140, 143, 145, 148, 151, 159 DM18 CCACCTGTCTGGGTAACACC AGATCTTGGGCTCAAAGCAC 9 269, 286, 290 DM19 TCTTTGTTCCCCTCATTTCG AACCGAAGGGAATGGAGAAG 25 135, 143, 145, 147, 151, 155, 173, 177, 181, 183 DM24 TGAATCGTTTGATGCGTCTC CGCACATCCGGTCTTACTCT 6 181, 183, 189 DM25 GCGAGCGCATCATTTATTCT TCATTATAGGGAGATGTGAAATCAA 6 119, 125, 127 DM28 TGAGTCCTAAGGGAAATGAGG CACCGAACAAAATGAATGGA 5 246 DM31 AAGTTTCCATGTCCAATGCTG CGCTTGTTTGCCATTTCATA 20 222, 223, 252 227 DM32 AAGGGAATCAGAGGGAGGAA GAGCTCGCGTATTTCAAAGC 17 187, 191, 197, 203, 205

DM33 ACCGCGAAAACCCTACTTTT ACGGTCTACGCCTGCTTTT 13 194, 196, 200, 202 DM36 CTGTCGATGTCATTCGCAGT TGCCTGTCACATGAAAAAGAG 7 153 DM42 CGCCAAGGTCACCTATTGA CGATACTACCGCGACCATCT 8 160, 174, 178 DM44 TCATCGAAATTTTTCTTAGCTTTTC GAACTGCCAGTGGGTCAAAT 7 220, 222, 226 DM48 GGTGGGAGGTGCCAAATTAT GCAACCCTCAAATGTATACGC 8 138, 148, 156 201, 203, 207, 209, 213, 215, DM51 GTTGCACGTTTTACGGTGAC CAAAGCCGTCTGAAAATCCA 13 218 DM53 CCTTCCAAGTGGGATAAAAGTG ACGATGGGATTTCTCACGTC 8 170, 172, 182 DM61 CTCTGGCTCTCTCCCTTCCT AAAGGGGTGTGCAGTAGACG 12 168, 175, 179, 185, 187 DM62 AAAAAGTGGTTTTTGTTTTGACTTT TCATGCAAAGAAACGAGTGG 11 179, 187, 191, 197 DM65 CGTAACAAAATGCAGGGAGA AGAAAACGCTTGGCATCAAT 8 147, 155 Note: Included are the oligonucleotide primer pairs (forward and reverse) used to PCR amplify loci for U. canaliculatus (UC) and D. mellea (DM). Also given for each locus are the number of alleles, and the designation of alleles pooled into one of the two alternate classes used for GLM analyses. TABLE B.3:

MONTE CARLO NON-PARAMETIC TESTS FOR SIGNIFICANT MICROSATELLITE ALLELE FREQUENCY

DIFFERENCES

Apple Apple Apple Haw Apple Apple Haw Apple Apple Apple Haw Locus Haw (1) Haw (2) Snow (2) Snow (2) Haw (3) Blue (3) Blue (3) Haw (4) Haw (6) Chry (6) Chry (6) UC8 UC10 *** * * * UC12 **** ** **** UC14 * UC16 ** * * *

228 UC18 UC19 * * UC22 * ** **** * * UC32 * * UC47 * * * UC48 * UC50 * UC52 * UC53 *** **** UC54 ** * ** ** UC57 UC59 * *** UC60 ** UC61 UC65 * **** TABLE B.3 (CONTINUED)

Apple Apple Apple Haw Apple Apple Haw Apple Apple Apple Haw Locus Haw (1) Haw (2) Snow (2) Snow (2) Haw (3) Blue (3) Blue (3) Haw (4) Haw (6) Chry (6) Chry (6) DM01 ** DM06 * * DM14 ** ** DM15 ** ** DM18 DM19 ** ** * ** * DM24 ** DM25 * DM28 * DM31 * DM32 **** **** ** * 229 DM33

DM36 ** * DM42 ** * * DM44 DM48 * * ** DM51 * * ** DM53 * DM61 ** ** ** DM62 * * * DM65 * ** *** ** Note: Microsatellite allele frequency differences between U. canaliculatus (UC) and D. mellea (DM) populations attacking pairs of different fly hosts at sympatric sites designated by numbers in parentheses (Fig. 3.2; Table B.1) following host designations. *P = 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001. TABLE B.4:

GENERALIZED LINEAR MODELS FOR HOST AND LATITUDE-RELATED MICROSATELLITE DIFFERENTIATION

Host Latitude Interaction Host Latitude Interaction Locus F P F P F P Locus F P F P F P UC8 15.99 * 1.58 1.02 DM01 0.05 6.78 ** 3.28 UC10 2.71 0.55 0.01 DM06 0.26 7.39 ** 0.5 UC12 6.09 * 0.08 2.02 DM14 103.51 *** 6.41 * 6.35 * UC14 16.18 ** 5.9 * 25.55 *** DM15 17.19 *** 4.67 * 0.22 UC16 2.57 0.83 0.7 DM18 0.12 0.22 0.29 UC18 4.55 0.35 0.04 DM19 3.21 8.12 ** 0.39 UC19 0.1 0.21 0.01 DM24 1.47 0.01 4.19 UC22 0.03 0.98 0.7 DM25 6.71 * 2.08 0.58 UC32 6.89 * 1.32 0.06 DM28 1.14 6.54 * 0.77 230 UC47 10.9 ** 0.94 1.27 DM31 1.11 0.02 0.17 UC48 3.16 2.41 3.24 DM32 2.3 0.45 0.83 UC50 0.02 1.19 1.33 DM33 2.02 1.33 1.44 UC52 6.67 * 0.01 0.08 DM36 0.87 0.01 1.09 UC53 17.35 ** 0.51 0.02 DM42 0.12 0.21 0.01 UC54 0.08 0.19 0.25 DM44 0.18 1.55 1.35 UC57 0.77 0.01 0.18 DM48 1.78 0.22 0.02 UC59 1.89 0.66 1.09 DM51 1.61 0.64 0.73 UC60 3.29 2.4 3.97 DM53 3.59 2.53 0.11 UC61 3.07 12.04 ** 0.99 DM61 6.35 * 1.88 0.25 UC65 0.85 0.25 0.02 DM62 1.22 0.02 0.02 DM65 1.51 0.05 0.21 Note: Host and latitude-related microsatellite differentiation for U. canaliculatus (UC) and D. mellea (DM) attacking apple versus hawthorn flies at sympatric sites. Given are F values and probability levels (P) for host, latitude, and host  latitude interactions for each locus. *P = 0.05; **P < 0.01; ***P < 0.001. TABLE B.5:

PERCENTAGE INCREASE OR DECREASE OF WASPS OF DIFFERENT HOST FLY-ORIGINS TO FRUIT ODOR

SOURCES

Fly host origin of wasp Species Odor source Hawthorn Apple Flwr Dgwd Snowberry U. canaliculatus Hawthorn (blend) +67% (115)**** -52% (35)* -41% (41)* -59% (20)* Apple (fruit) -40% (106)** +83% (35)*** -41% (41)* -61% (21)* Flwr Dgwd (blend) -47% (75)** -84% (21)* +52% (39)** -59% (20)* Snowberry (fruit) -37% (38) -40% (28) -50% (21) +65% (20)* Blueberry (fruit) -22% (97) -24% (31) -18% (34) -73% (20)*

231 Mean avoidance -37% ± 5 -50% ± 13 -38% ± 7 -63% ± 3 Control 25% (118) 30% (37) 29% (40) 36% (22) D. mellea Odor source Hawthorn Apple Blueberry Black Cherry Hawthorn (blend) +36% (77)* -26% (65) -34%(52)* -76% (23)** Apple (fruit) -50% (72)** +63% (65)*** -9% (52) -53% (23)* Snowberry (fruit) -100% (10)* -100% (8)* -6% (28) -73% (20)* Blueberry (fruit) -43% (69)** -22% (65) +62% (52)*** -39% (22) Flwr Dgwd (blend) -30% (64) -18% (65) -54% (52)** -66% (16)* Black Cherry (fruit) -56% (38)** -67% (8) -47% (5) +97% (22)** Mean avoidance -56% ± 12 -47% ± 16 -30% ± 10 -61% ± 7 Control 36% (86) 38% (65) 38% (50) 37% (23) D. alloeum Odor source Hawthorn Apple Blueberry Snowberry Hawthorn (blend) +44% (330)*** -33% (201)*** -34% (110)*** -14% (9) TABLE B.5 (CONTINUED)

Fly host origin of wasp D. alloeum Apple (fruit) -18% (330)** +54% (201)*** -29% (110)** -14% (9) Snowberry (fruit) -77% (330)*** -23% (201)*** -11% (110) 0% (9) +42% Blueberry (fruit) -28% (330)** -46% (201)*** -14% (9) (110)*** Flwr Dgwd (blend) -16% (330)*** -36% (201)*** -53% (110)*** -14% (9) Mean avoidance -35% ± 14 -35% ± 5 -32% ± 9 -14% Control 38% (330) 38% (201) 39% (110) 39% (9) Cross reared D. Odor source Haw in apple Blue in apple alloeum Hawthorn (blend) +167% (22)*** -100% (5) 232 Apple (fruit) -7% (22) Blueberry (fruit) +233 (5)** Control 33% (22) 30% (5) Note: Percentage increase (preference [+]) or decrease (avoidance [-]) of U. canaliculatus, D. mellea and D. alloeum of different host fly-origins to fruit odor sources (synthetic volatile blends or whole, ripe fruit) relative to an odorless control arm in Y-tube olfactometer assays. Also given are preference and avoidance behaviors for D. alloeum of hawthorn and blueberry fly-origin reared for one generation in the laboratory on apple flies in apple fruit. Mean avoidance (± SE) is the average percentage orientation of wasps to all non-natal fruit odors tested relative to the odorless control arm. Control values denote the mean percentages of wasps from each fly host orienting to the control arms (the average of the right and the left arms) of the Y-tube when no odor was present. Numbers of individuals tested are given in parentheses. Data from D. alloeum from Forbes et al. (2009). *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. TABLE B.6:

FRUITING TIMES OF HOST PLANTS AND MEAN ECLOSION TIMES FOR HOST-ASSOCIATED POPULATIONS OF

RHAGOLETIS AND WASPS AT SYMPATRIC STUDY SITES

Site Apple Hawthorn Snowberry Blueberry Flwr Dogwood Black Cherry Fruiting time early August early September August July late September late August

Rhagoletis Grant, MI 56.52±0.41 (709)a 65.07±0.89 (215)b E. Lansing, MI 58.77±1.04 (187)a 77.11±0.61 (1095)b 67.42±0.46 (134)c Fennville, MI 58.55±0.32 (1000)a 65.13±0.28 (1644)b 55.15±0.37 (512)a Dowagiac, MI 73.76±0.39 (1598)a 74.51±0.81 (528)a 91.19±2.20 (42)b

233 Three Oaks, MI 58.39±1.83 (54)a 81.18±0.62 (374)b South Bend, IN 55.39±0.70 (446)a 72.85±1.01 (259)b 110.14±0.93 (140)c 47.92±1.54 (36)d Urbana, IL 64.42±1.83 (111)a 75.70±2.56 (47)b Mean 60.83±2.41 (7) 73.07±2.27 (7) 67.42 (1) 55.15 (1) 100.67±9.48 (2) 47.92 (1)

D. alloeum Grant, MI 96.32±2.48 (19)a 108.67±0.97 (147)b E. Lansing, MI 105.57±0.96 (136)a 108.28±0.21 (1083)b 107.27±1.81 (11)ab Fennville, MI 96.63±1.56 (40)a 111.37±2.06 (62)b 93.33±0.75 (146)c Dowagiac, MI 112.92±1.01 (102)a 111.11±1.13 (44)a Urbana, IL 121.45±1.34 (43) Mean 102.86±3.98 (4) 112.18±2.40 (5) 107.27 (1) 93.33 (1)

U. canaliculatus Grant, MI 87.69±2.38 (42)a 99.31±0.63 (337)b TABLE B.6 (CONTINUED)

Site Apple Hawthorn Snowberry Blueberry Flwr Dogwood Black Cherry E. Lansing, MI 89.26±3.88 (19)a 100.08±0.46 (458)b 88.35±1.92 (17)a Fennville, MI 84.04±2.97 (25)a 94.31±0.75 (371)b Dowagiac, MI 102.83±1.05 (35)a 102.71±1.18 (38)a Three Oaks, MI 86.90±5.35 (10)a 96.65±1.31 (86)b South Bend, IN 74.77±5.79 (9)a 102.60±0.61 (234)b 141.83±5.75(6) Urbana, IL 88.47±2.51 (30) Mean 87.44±3.72 (6) 97.73±1.92 (7) 88.35 (1) 141.83 (1)

D.mellea a b

234 Grant, MI 90.2±2.35 (15) 105.09±0.93 (115) E. Lansing, MI 92.78±1.27 (88)a 100.11±1.03 (28)b

Fennville, MI 86.64±4.42 (14)a 100.03±1.36 (29)b 80.81±1.73 (103)c South Bend, IN 89.29±3.73 (17)a 101.75±2.73 (16)b 98.40±1.43 (55)a Mean 89.72±1.26 (4) 101.75±1.18 (4) 80.81 (1) 98.40 (1) Note: Fruiting times of host plants and mean eclosion times (± SE) for host-associated populations of Rhagoletis and wasps at sympatric study sites (sample sizes in parentheses). At each site, values not sharing a letter (a, b, c or d) in common differ significantly, as determined by Kolmogorov– Smirnov tests. Fruiting time data for apple and hawthorn trees come from Filchak et al. (2002) and for blueberry, black cherry, and flowering dogwoods from the United States Department of Agriculture (www.plants.usda/plantguide.gov). Data for D. alloeum (except for those individuals attacking snowberry flies) modified from Forbes et al. (2009). TABLE B.7:

GENETIC ASSOCIATIONS OF MICROSATELLITES WITH THE TIMING OF ADULT WASP ECLOSION

Female Male Female Male Genotype Genotype Genotype Genotype × Locus Genotype Genotype Locus Genotype Genotype × host × host × host host UC8 DM01 UC10 * DM06 UC12 ** DM14 UC14 * ** *** DM15 UC16 DM18 * ** UC18 * DM19 ** UC19 DM24

235 UC22 DM25 * UC32 * * DM28 *** UC47 * DM31 UC48 * DM32 UC50 DM33 * UC52 ** * DM36 * ** UC53 * DM42 UC54 ** DM44 UC57 DM48 UC59 ** * DM51 UC60 * * DM53 UC61 DM61 * UC65 DM62 DM65 Note: Shown are the microsatellites for U. canaliculatus (UC) and D. mellea (DM) displaying significant genotype and host × genotype interactions with eclosion time for wasps attacking apple and hawthorn flies in ANOVA analyses. *P < 0.05; **P < 0.01; ***P < 0.001. APPENDIX C:

SUPPLAMENTAL TABLES FOR CHAPTER 4

C.1 Description of Appendix for Chapter 4

The appendix for Chapter 4 contains a series of supplemental tables and literature cited. The supplemental tables detail parasitism rates, the species specific mtDNA markers used to test for multiparasitism, single and multiparasitism rates detected using these genetic markers, and parasitism rates from fruit collection across the field season and the number of adult parasitoids caught in sweep nets across the field season.

236

4 3 7 9

14 10 21 91 95 19 19 15 24 30 29

328 184 451 IN No. Uc

SM 4 8 6 4 2 2 4 3 5 9 8 2 5 27 16 22 10 12

No. Dm

82 35 44 13 29 33 80 66 60 44 16 18

688 251 345 274 1134 No. Da

94 35 71 447 259 395 840 110 288 333 295 344 149 2824 1219 1710 1644 4004 Flies

2006 2009 2010 2011 2012 2013 2003 2004 2005 2006 2007 2009 2010 2011 2012 2013 2006 2003 Year

42.73/84.46 Lat./long. 41.74/86.22 42.60/86.15

TABLE C.1:TABLE CHAPTER 4

Bend, St. Joseph Co., IN

Lansing, Ingham Lansing, Co., MI

ite E. S So. Fennville, Allegan Co., MI

Fly Host Rhagoletis pomonella HOST PLANT AND PLANT HOST MONITORED ASSOCIATIONS HOST FORFLY PARASITI

) spp.

Crataegus

COLLECTION SITES AND SITES COLLECTION Host Plant Hawthorn (

237 TABLE C.1 (CONTINUED)

No. No. No. Host Plant Fly Host Site Lat./long. Year Flies Da Dm Uc 2009 402 55 36 40 2010 1095 199 18 97 Hawthorn (Crataegus spp.) Rhagoletis pomonella E. Lansing, Ingham Co., MI 42.73/84.46 2011 399 85 20 45 2012 551 101 31 40 2013 121 23 5 10 Grant, Newaygo Co., MI 43.35/85.86 2005 40 15 6 8 2006 1020 386 51 148 2009 215 26 2 12 2010 921 187 25 90 2011 751 155 10 35 238 2012 154 44 9 11 2013 73 18 3 8 Urbana, Champaign Co., IL 40.09/88.21 2006 121 43 1 5 2010 47 20 2 5 2011 188 44 1 30 2012 95 22 1 10 2013 77 10 2 6 Apple (Malus domesticus) Rhagoletis pomonella So. Bend, St. Joseph Co., IN 41.74/86.19 2006 2575 145 9 47 2009 219 45 1 6 2010 500 35 8 9 41.74/86.19 2011 225 20 2 9 2012 145 10 2 3 2013 48 5 1 2 Fennville, Allegan Co., MI 42.60/86/16 2003 999 200 5 10 2004 608 30 3 5 TABLE C.1 (CONTINUED)

No. No. No. Host Plant Fly Host Site Lat./long. Year Flies Da Dm Uc 42.60/86/16 2005 97 46 4 7 2006 29 5 1 2 Apple (Malus domesticus) Rhagoletis pomonella Fennville, Allegan Co., MI 2007 1335 41 2 22 2009 1250 65 7 16 2010 291 13 6 8 2011 900 55 7 19 2012 271 10 3 9 2013 556 31 2 12 E. Lansing, Ingham Co., MI 42.72/84.48 2006 1986 136 33 54 2009 867 145 21 66 239 2010 215 8 1 2 2011 512 29 13 19 2012 114 9 3 4 Grant, Newaygo Co., MI 43.35/85.86 2005 28 17 2 7 2006 564 38 7 13 2007 249 19 3 7 2009 709 40 2 6 Apple (Malus domesticus) Rhagoletis pomonella Grant, Newaygo Co., MI 43.35/85.86 2010 232 14 5 6 2011 862 66 4 13 2010 75 8 1 2 2012 339 22 3 9 2013 2104 75 9 21 Urbana, Champaign Co., IL 40.11/88.20 2006 381 10 2 6 2010 111 12 4 7 2011 212 11 1 6 TABLE C.1 (CONTINUED)

No. No. No. Host Plant Fly Host Site Lat./long. Year Flies Da Dm Uc 2012 121 9 3 4 Apple (Malus domesticus) Rhagoletis pomonella Urbana, Champaign Co., IL 40.11/88.20 2013 101 7 1 2 2006 334 128 50 Blueberry (Vaccinium Rhagoletis mendax Fennville, Allegan Co., MI 42.60/86.15 2007 329 37 9 corymbosum) 2009 512 71 12 2010 254 35 8 2011 309 25 2 2012 245 55 15 2013 28 5 2 E. Lansing, Ingham Co., MI 42.71/84.49 2009 110 15 2 240 2010 85 14 1

Note: Also given is the year flies were samples, the number of adult flies, Diachasma alloeum (Da), Diachasmimorpha mellea (Dm) and Utetes canaliculatus (Uc) that eclosed, the percent parasitism of each species and total parasitism for each year and site. Parasitism was calculated by dividing the total number of eclosed parasitoids of each species by the total number of all eclosed parasitoid species and flies.

0 2

ize 200 Frag. s 320 128 410

emp (°C) emp 58 Anneal t 50 52 52

AA 3') - Reverse Primer Sequence (5' Sequence Primer Reverse AATTGATCTAACTTAATTAT CCCTAATATTAAAGGTACCAAC ACTTAATTGCTCAAACTTTAT GCACTTTGTCGTTGATGCAC

3')

- TABLE C.2:TABLE rag. Size) each of primer pair. (F Forward Primer Sequence (5' Sequence Primer Forward ATTAATTCCTTCATTAATATTA AGGATATTGATAAGAGATCAAC AGATTGTTAAATGATCAGA AAACTGCCTTGCCTGTCATT

FORWARD AND REVERSE USED FORWARD AND DNA. DETECT TO WASPPRIMERS FLY AND

Utetes canaliculatus Utetes mellea Diachasmimorpha alloeum Diachasma pomonella Rhagoletis Species Note: For primerall wasps, pairs generatedwere using sequences thefrom cytochrome oxidase I subunit region theof mitochrondrial genome published in Forbes et al. 2009 and Hood 2015. et al. flies, For used the we nuclear encoded microsatellite (P23) Velez from et al. 2006. given Also are anelingthe temperatures (Anneal temp) and amplicon size

241

41 25 0 0 0 1 6 20 29 14 0 0 0 3 8 10 14 10 No detect 0 0 0 1 17 30 (no (no

)

1 1 4 3 2 2 1 1 1 1 0 3 1 3 2 2 2 1 Dm Da 10 5 4 5 5 2

(no )

18 12 9 8 6 6 8 6 6 7 Uc Da 21 23 17 16 17 17 Dm

+ Ut

0 0 0 0 1 0 0 0 0 0 Da + 0 0 1 0 0 0 + includedthe numberare flies of in tested each

0 0 3 2 1 1 0 0 0 0 Dm Uc 3 3 1 0 1 0

). Uc). Als ( Da Uc 17 18 15 16 11 3 1 0 13 10 8 8 5 3 1 0

1 0 0 0 Da Dm 18 16 13 12 7 0 0 0 8 6 6 7 7 1 0 0 6 8 5 5

EACH OF EIGHT FLY STAGES EIGHT OF EACH HOST FLY LIFE

Uc alone 18 20 16 16 16 17 18 12 6 6 5 5 8 6 6 7 AT

Utetes canaliculatus ) and the number of number the and ) replicates which nofor DNA was detected (No detect).

), ),

2 2 2 1 Dm alone 7 2 3 5 4 2 1 1 1 1 1 1 1 1 1 1 0 3 1 3 Dm Rhag (

TABLE C.3:TABLE

24 24 23 13 Da alone 13 18 21 25 23 42 44 33 3 10 3 6 10 14 23 16 18 16 17 19

2 Uc 38 41 33 3 28 20 19 12 22 18 15 14 13 9 7 7

3 2 2 1 Dm 28 21 18 17 12 2 1 1 12 9 9 9 8 2 1 1 6 11 6 8

Diachasmimorpha mellea 25 24 23 13 Da 48 52 50 53 41 45 45 33 24 26 18 21 22 18 24 16 24 24 22 24 ), ), Da

(

270 261 166 128 128 128 125 120 117 111 57 296 296 296 295 279 265 245 152 296 296 296 295 290 Rhag

296 296 192 128 128 128 128 128 128 128 72 296 296 296 296 296 296 296 192 296 296 296 296 296 Rep OF WASPS GENETICALLY OF WASPSDETECTED GENETICALLY

Diachasma alloeumDiachasma

Day Day Day Day Day Day Day Day Day ------Day Day Day Day Day Day Day Day Day ------tage 12 15 20 Larval Puparium 3 6 9 12 15 20 Larval Puparium 3 6 9 12 15 20 Larval Puparium 3 6 9 Fly life s NUMBER NUMBER

Blueberry Apple Host plant Hawthorn life (Rep), stage the of number replicates DNA wasforfly which detected ( Note: Abbreviations:

242

0 1 1 0 0 0 1 2 1 0 0 0 0 0 6 3 0 0 No. Dm

0 1 4 9 0 0 0 0 6 9 0 0 0 0 3 0 10 22 No. Da

s No. flie

No. pupae

FIELD SEASONFIELD

Ground Ground Ground Ground Ground Ground Plant Plant Plant Plant Plant Plant Ground Ground Ground Ground Ground Ground Location

8/1/2010 9/3/2010 8/12/2010 8/24/2010 9/18/2010 10/2/2010 7/30/2010 8/10/2010 8/20/2010 8/30/2010 9/15/2010 9/30/2010 7/30/2010 8/10/2010 8/20/2010 8/30/2010 9/15/2010 9/30/2010 Collection Date

2 3 4 5 6 1 2 3 4 5 6 1 2 3 4 5 6 1 Time

TABLE C.4:TABLE aught in sweep nets aught in sweep nets C

Experiment C

ANT AND ON THE GROUND BENEATH PLANTS THE ACROSS

Pooled across sites Pooled across sites Site Pooled across sites

THE PLTHE

Apple Apple Host Plant Blueberry THE NUMBER OF WASPS NUMBER OF SWEETTHE REAREDNETS FRUIT AND COLLECTED FROM FROMDIRECTLY CAUGHT IN

243 TABLE C.4 (CONTINUED)

Host Collection No. No. No. No. Site Experiment Time Location Plant Date pupae flies Da Dm Apple Pooled across sites Caught in sweep nets 1 8/1/2010 Plant 0 0 2 8/12/2010 Plant 0 0 3 8/24/2010 Plant 2 7 4 9/3/2010 Plant 5 1 5 9/18/2010 Plant 7 0 6 10/2/2010 Plant 0 0 Hawthorn Pooled across sites 1 8/1/2010 Ground 0 0 2 8/12/2010 Ground 0 0 3 8/24/2010 Ground 0 0

244 4 9/3/2010 Ground 4 4 5 9/18/2010 Ground 26 2

6 10/2/2010 Ground 50 0 1 8/1/2010 Plant 0 0 2 8/12/2010 Plant 0 0 3 8/24/2010 Plant 0 0 4 9/3/2010 Plant 2 6 5 9/18/2010 Plant 5 4 6 10/2/2010 Plant 12 0 Blueberry Fennville, Allegan Co., MI 1 7/30/2010 Ground 49 35 1 7 2 8/10/2010 Ground 59 39 1 2 3 8/20/2010 Ground 84 71 19 0 4 8/30/2010 Ground 97 77 26 0 5 9/15/2010 Ground 0 0 0 0 6 9/30/2010 Ground 0 0 0 0 1 7/30/2010 Plant 98 76 0 14 TABLE C.4 (CONTINUED)

Host Collection No. No. No. No. Site Experiment Time Location Plant Date pupae flies Da Dm Blueberry Fennville, Allegan Co., MI Caught in sweep nets 2 8/10/2010 Plant 145 105 3 9 3 8/20/2010 Plant 159 141 28 3 4 8/30/2010 Plant 107 88 22 1 5 9/15/2010 Plant 0 0 0 0 6 9/30/2010 Plant 0 0 0 0 Apple Fennville, Allegan Co., MI Collected from fruit 1 7/30/2010 Ground 0 0 0 0 2 8/10/2010 Ground 37 35 0 1 3 8/20/2010 Ground 99 90 1 2 4 8/30/2010 Ground 179 140 14 1

245 5 9/15/2010 Ground 221 135 18 0 6 9/30/2010 Ground 0 0 0 0

1 7/30/2010 Plant 0 0 0 0 2 8/10/2010 Plant 69 60 0 1 3 8/20/2010 Plant 133 110 2 5 4 8/30/2010 Plant 199 160 10 0 5 9/15/2010 Plant 55 40 6 0 6 9/30/2010 Plant 0 0 0 0 Grant, Newaygo Co., MI 1 7/30/2010 Ground 0 0 0 0 2 8/10/2010 Ground 32 27 0 1 3 8/20/2010 Ground 77 55 1 2 4 8/30/2010 Ground 120 90 14 1 5 9/15/2010 Ground 115 70 10 0 Apple Grant, Newaygo Co., MI Collected from fruit 6 9/30/2010 Ground 0 0 0 0 1 7/30/2010 Plant 0 0 0 0 2 8/10/2010 Plant 100 77 0 1 TABLE C.4 (CONTINUED)

Host Collection No. No. No. No. Site Experiment Time Location Plant Date pupae flies Da Dm

Apple Grant, Newaygo Co., MI Collected from fruit 3 8/20/2010 Plant 115 90 0 3 4 8/30/2010 Plant 145 130 8 0 5 9/15/2010 Plant 77 64 6 0 6 9/30/2010 Plant 0 0 0 0 So. Bend, St. Joseph Co., IN 1 8/1/2010 Ground 0 0 0 0 2 8/12/2010 Ground 39 33 0 1 3 8/24/2010 Ground 76 59 1 3 4 9/3/2010 Ground 101 79 14 2 5 9/18/2010 Ground 135 80 10 0

246 6 10/2/2010 Ground 0 0 0 0 1 8/1/2010 Plant 0 0 0 0

2 8/12/2010 Plant 33 23 0 1 3 8/24/2010 Plant 66 58 0 3 4 9/3/2010 Plant 112 99 9 0 5 9/18/2010 Plant 71 52 4 0 6 10/2/2010 Plant 0 0 0 0 Hawthorn Fennville, Allegan Co., MI 1 7/30/2010 Ground 0 0 0 0 2 8/10/2010 Ground 0 0 0 3 8/20/2010 Ground 50 44 0 1 4 8/30/2010 Ground 79 59 4 3 5 9/15/2010 Ground 190 155 21 1 6 9/30/2010 Ground 319 241 68 0 1 7/30/2010 Plant 0 0 0 0 2 8/10/2010 Plant 0 0 0 0 3 8/20/2010 Plant 115 95 0 3

TABLE C.4 (CONTINUED)

Host Collection No. No. No. No. Site Experiment Time Location Plant Date pupae flies Da Dm Hawthorn Fennville, Allegan Co, MI Collected from fruit 4 8/30/2010 Plant 145 121 2 7 5 9/15/2010 Plant 291 204 21 0 6 9/30/2010 Plant 102 70 16 0 Grant, Newaygo Co., MI 1 7/30/2010 Ground 0 0 0 0 2 8/10/2010 Ground 0 0 0 0 3 8/20/2010 Ground 34 25 0 1 4 8/30/2010 Ground 117 94 5 5 5 9/15/2010 Ground 222 177 25 1 6 9/30/2010 Ground 399 311 64 0

247 1 7/30/2010 Plant 0 0 0 0 2 8/10/2010 Plant 0 0 0 0

3 8/20/2010 Plant 140 120 0 2 4 8/30/2010 Plant 255 199 3 7 5 9/15/2010 Plant 313 219 29 0 6 9/30/2010 Plant 198 171 18 0 So. Bend, St. Joseph Co., IN 1 8/1/2010 Ground 0 0 0 0 2 8/12/2010 Ground 0 0 0 0 3 8/24/2010 Ground 31 26 0 1 4 9/3/2010 Ground 112 100 3 3 5 9/18/2010 Ground 190 171 20 2 6 10/2/2010 Ground 261 200 50 0 1 8/1/2010 Plant 0 0 0 0 Hawthorn So. Bend, St. Joseph Co., IN Collected from fruit 2 8/12/2010 Plant 0 0 0 0 3 8/24/2010 Plant 215 156 0 2 4 9/3/2010 Plant 319 271 4 9 TABLE C.4 (CONTINUED)

Host Collection No. No. No. No. Site Experiment Time Location Plant Date pupae flies Da Dm

Hawthorn So. Bend, St. Joseph Co., IN Collected from fruit 5 9/18/2010 Plant 257 200 25 0 6 10/2/2010 Plant 149 111 15 0 Note: Abbreviations: Diachasma alloeum (Da), Diachasmimorpha mellea (Dm) and Utetes canaliculatus (Uc). Also given is the date that each sweep net assay and fruit collection took place. 248

C.2 Literature Cited

Forbes, A.A., Powell, T.H.Q., Stelinski, L.L. Smith, J.J. and Feder, J.L. 2009. Sequential sympatric speciation across trophic levels. Science 323:776-779.

249 APPENDIX D:

SUPPLEMENTARY TABLES FOR CHAPTER 5

D.1 Description of Appendix for Chapter 5

The appendix for Chapter 5 contains a series of supplemental tables and literature cited. The supplemental tables detail the studies included in the meta-analysis, results from the statistical analyses, estimates of the timing of oviposition and abundance of competing species in nature the reference from which this information was obtained.

250

cerasicola chrysostictos chrysostictos chrysostictos chrysostictos chrysostictos marginiventris marginiventris demolitor demolitor sonorensis demolitor croceipes argenteopilosus basalis porthetriae testaceipes Parasitoid 2 species luteola isis

Ephedrus Horogenes Horogenes Horogenes Horogenes Horogenes Cotesia Cotesia Microplitis Microplitis Campoletis Microplitis Microplitis Eriborus Dinarmus Glyptapanteles Lysiphlebus Parasitoid genus 2 Encarsia Telenomus

sa formo busseolae chlorideae vuilleti liparidis scutellaris Parasitoid 1 species colemani canescens canescens canescens canescens canescens croceipes nigriceps sonorensis sonorensis croceipes croceipes nigriceps

Campoletis Eupelmus Glyptapanteles Lipolexis Parasitoid genus 1 Encarsia Telenomus Aphidius Nemeritis Nemeritis Nemeritis Nemeritis Nemeritis Microplitis Cardiochiles Campoletis Campoletis Micropliti Microplitis Cardiochiles

TABLE D.1: D.1: TABLE

litura atrolineatus dispar citricida Host species spp. calamistis persicae sericarium sericarium sericarium sericarium grisella virescens virescens includens virescens virescens virescens virescens

oia Spodoptera Bruchidius Lymantria Toxoptera Host genus general Sesamia Myzus Ephestia Ephestia Ephestia Ephestia Achr Heliothis Heliothis Pseudoplusia Heliothis Heliothis Heliothis Heliothis IES AND SPECIES INCLUDED IN THE SPECIES AND META-ANALYSISIN IES INCLUDED

STUD

and Hoy, 2003and Hoy, vey, Gols, andvey, Strand 2009 De Moraes and Mescher 2005 Har Gols,Harvey, and Strand 2009 Gols,Harvey, and Strand 2009 Gols,Harvey, and Strand 2009 De Moraes et al. 1999 Bajpai et al. 2006 Leveque et al. 1993 Marktl, Stauffer, and Schopf 2002 Persad Citation Collier et al. 2007 Agboka et al. 2002 Hagvar and Hofsvang 1988 Fisher 1961 Fisher 1961 Fisher 1961 Fisher 1961 Fisher 1961 De Moraes and Mescher 2005

13 14 15 16 17 18 19 7 8 9 10 11 12 No. 1 2 3 4 5 6 Study

251 TABLE D.1 (CONTINUED)

Study Parasitoid Parasitoid Parasitoid Parasitoid Citation Host genus Host species No. genus 1 species 1 genus 2 species 2 20 Shi, Li, Li, and Liu 2001 Plutella xylostella Diadegma semiclausum Oomyzus sokolowskii 21 Reitz 1995 Helicoverpa zea Eucelatoria bryani Eucelatoria rubentis 22 Bai and Mackauer 1991 Acyrthosiphon pisum Aphidius ervi Aphelinus asychis 23 Baur and Yeargan 1995 Plathypena scabra Cotesia marginiventris Diolcogaster facetosa 24 Baur and Yeargan 1995 Plathypena scabra Cotesia marginiventris Aleiodes nolophanae 25 Baur and Yeargan 1995 Plathypena scabra Diolcogaster facetosa Aleiodes nolophanae 26 Browning and Oatman 1984 Trichoplusia ni Voria ruralis Copidosoma truncatellum 27 Chow and Mackauer 1984 Acyrthosiphon pisum Aphidius smithi Praon pequodorum 28 Godwin and Odell 1984 Lymantria dispar Parasetigena silvestris Blepharipa pratensis 29 Isenhour 1988 Spodoptera frugiperda Campoletis sonorensis Rogas laphygmae 30 Krause et al. 1990 Lymantria dispar Glyptapanteles flavicoxis Cotesia melanoscelus 31 Laing and Corrigan 1987 Artogeia rapae Cotesia rubecula Cotesia glomeratus

252 32 Muli et al. 2006 Chilo partellus Xanthopimpla stemmator Dentichasmias busseolae 33 Pedata et al. 2002 Trialeurodes vaporariorum Encarsia formosa Encarsia pergandiella

34 Pijls et al. 1995 Phenacoccus manihoti Apoanagyrus lopezi Apoanagyrus diversicornis 35 Pschorn-Walcher 1971 Diatraea saccharalis Lixophaga diatraeae Paratheresia claripalpis 36 Pschorn-Walcher 1971 Diatraea saccharalis Lixophaga diatraeae Metagonistylum minense 37 Pschorn-Walcher 1971 Diatraea saccharalis Paratheresia claripalpis Metagonistylum minense 38 Reineke et al. 2004 Ephestia kuehniella Venturia canescens (RM) Venturia canescens (RP) 39 Sallam et al. 2002 Chilo partellus Cotesia flavipes Cotesia sesamiae 40 Steinburg et al. 1987 Chrysomphalus aonidum Pteroptrix smithi Aphytis holoxanthus 41 Ueno 1999 Galleria mellonella Itoplectis naranyae Pimpla nipponica 42 van Strien-van Liempt 1982 Drosophila melanogaster Asobara tabida Leptopilina heterotoma 43 Vinson and Ables 1980 Heliothis virescens Chelonus insularis Cardiochiles nigriceps 44 Vinson and Ables 1980 Heliothis virescens Chelonus insularis Microplitis croceipes 45 Vinson and Ables 1980 Heliothis virescens Chelonus insularis Campoletis sonorensis 46 Wallner et al. 1982 Lymantria dispar Rogas lymantriae Apanteles melanoscelus 47 Weir and Sagarzazu 1998 Diatraea saccharalis Metagonystilum minense Cotesia flavipes 48 Wylie 1972 Musca domestica Nasonia vitripennis Spalangia cameroni 49 Wylie 1972 Musca domestica Muscidifurax zaraptor Spalangia cameroni TABLE D.1 (CONTINUED)

Study Parasitoid Parasitoid Parasitoid Parasitoid Citation Host genus Host species No. genus 1 species 1 genus 2 species 2 50 Wylie 1972 Musca domestica Nasonia vitripennis Muscidifurax zaraptor 51 Chua et al. 1990 Acrythosiphon pisum Aphidius ervi Aphidius smithi 52 Fleury et al. 2000 Drosophila melanogaster Leptopilina heterotoma Leptopilina boulardi 53 Muturi et al. 2006 Chilo partellus Xanthopimpla stemmator Pediobius furvus 54 Muturi et al. 2006 Busseola fusca Xanthopimpla stemmator Pediobius furvus 55 Tillman and Powell 1992 Heliothis virescens Microplitis demolitor Cotesia kazak 56 Tillman and Powell 1992 Heliothis virescens Microplitis demolitor Microplitis croceipes 57 Tillman and Powell 1992 Heliothis virescens Microplitis demolitor Hyposoter didymator 58 Tillman and Powell 1992 Heliothis virescens Cotesia kazak Microplitis croceipes 59 Tillman and Powell 1992 Heliothis virescens Cotesia kazak Hyposoter didymator 60 Tillman and Powell 1992 Heliothis virescens Microplitis croceipes Hyposoter didymator 61 Sidney et al. 2010 Macrosiphum euphorbiae Aphidius ervi Praon volucre 253 62 Gauthier et al. 1999 Callosobruchus maculatus Dinarmus basalis Epelmus vuilleti 63 Alim and Lim 2011 Riptortus pedestris Gryon japonicum Ooencyrtus nezarae

64 Alim and Lim 2011 Riptortus pedestris Gryon japonicum Ooencyrtus nezarae

e LYSES nativ native native native native native native native introduced introduced native introduced native native introduced Native or intro 2 spp. native native

-ANA or UB

- spp. 2 spp.

endo endo endo endo endo endo endo endo endo endo endo endo endo endo ecto Endo ecto endo endo

y 2 spp. y solitary solitary solitary Gregarious or solitar solitary solitary solitary solitary solitary solitary solitar solitary solitary solitary solitary solitary solitary solitary

ralist specialist specialist generalist Generalist or specialist spp. 2 generalist generalist specialist generalist generalist generalist generalist generalist generalist generalist gene generalist generalist generalist

TABLE D.2: TABLE native native introduced Native or intro 1 spp. native native introduced native native native native native native native native native native native

- spp. 1 spp.

endo endo ecto Endo ecto endo endo endo endo endo endo endo endo endo endo endo endo endo endo

solitary solitary solitary solitary solitary solitary solitary solitary solitary Gregarious or solitary 1 spp. solitary solitary solitary solitary solitary solitary solitary solitary

st specialist specialist generalist generalist specialist specialist speciali generalist generalist Generalist or specialist spp. 1 generalist generalist specialist generalist generalist generalist generalist generalist

12 13 14 15 16 17 6 7 8 9 10 11 No. 1 2 3 4 5 Study LIFE HISTORY CHARACTERISTICS OF COMPETING PARASITOID OF HISTORY S CHARACTERISTICS SPECIES LIFE IN INCLUDED

254 TABLE D.2 (CONTINUED)

Study Generalist or Gregarious or Endo- or Native or Generalist or Gregarious or Endo- or Native or No. specialist spp. 1 solitary spp. 1 ecto-spp. 1 intro spp. 1 specialist spp. 2 solitary spp. 2 ecto-spp. 2 intro spp. 2 18 generalist gregarious endo native generalist solitary endo native 19 specialist solitary endo introduced specialist solitary endo native 20 specialist solitary endo introduced specialist gregarious endo introduced 21 specialist gregarious endo native generalist gregarious endo native 22 specialist solitary endo introduced generalist solitary endo introduced 23 generalist solitary endo native specialist solitary endo native 24 generalist solitary endo native specialist solitary endo native 25 specialist solitary endo native specialist solitary endo native 26 generalist gregarious endo native generalist gregarious endo native 27 specialist solitary endo introduced specialist solitary endo native 28 specialist solitary ecto introduced generalist solitary ecto introduced 29 generalist solitary endo native generalist solitary endo native 255 30 generalist gregarious endo introduced specialist solitary endo introduced 31 specialist solitary endo introduced generalist gregarious endo introduced 32 specialist solitary endo introduced specialist solitary endo native 33 generalist solitary endo introduced generalist solitary endo introduced 34 specialist solitary endo introduced generalist solitary endo introduced 35 generalist gregarious endo introduced specialist gregarious endo introduced 36 generalist gregarious endo introduced specialist solitary endo introduced 37 specialist gregarious endo introduced specialist solitary endo introduced 38 specialist solitary endo native specialist solitary endo native 39 generalist gregarious endo introduced generalist gregarious endo native 40 specialist gregarious endo introduced specialist gregarious ecto introduced 41 generalist solitary endo native generalist solitary endo native 42 specialist solitary endo native specialist solitary endo native 43 specialist solitary endo native specialist solitary endo native 44 specialist solitary endo native specialist solitary endo native 45 specialist solitary endo native generalist solitary endo native TABLE D.2 (CONTINUED)

Study Generalist or Gregarious or Endo- or Native or Generalist or Gregarious or Endo- or Native or No. specialist spp. 1 solitary spp. 1 ecto-spp. 1 intro spp. 1 specialist spp. 2 solitary spp. 2 ecto-spp. 2 intro spp. 2 46 specialist solitary endo introduced specialist solitary endo introduced 47 specialist solitary endo native generalist gregarious endo native 48 generalist gregarious ecto native specialist solitary ecto native 49 specialist solitary ecto native specialist solitary ecto native 50 generalist gregarious ecto native specialist solitary ecto native 51 specialist solitary endo introduced specialist solitary endo introduced 52 specialist solitary endo native specialist solitary endo native 53 specialist solitary endo introduced generalist gregarious endo native 54 specialist solitary endo introduced generalist gregarious endo native 55 generalist solitary endo introduced generalist solitary endo introduced 56 generalist solitary endo introduced specialist solitary endo native 57 generalist solitary endo introduced generalist solitary endo introduced 256 58 generalist solitary endo introduced specialist solitary endo native 59 generalist solitary endo introduced generalist solitary endo introduced 60 specialist solitary endo native generalist solitary endo introduced 61 specialist solitary endo introduced generalist solitary endo introduced 62 generalist solitary ecto introduced specialist solitary ecto native 63 specialist solitary endo native generalist gregarious endo native 64 specialist solitary endo native generalist gregarious endo native TABLE D.3:

SUMMARY STATISTICS OF CORRELATIONS BETWEEN SURVIVORSHIP AND THE TIMING OF OVIPOSITION

Study Spearman's rho P- Study weights rhoz (back rhoz UL CI 99% rhoz UL CI 99% Observations Var No. rho value (%) transform) (back transform) (back transform) 1 421 0.0520 0.2874 0.0024 1.6394 0.0516 0.1763 -0.0740 2 800 0.5254 <0.00001 0.0013 1.6628 0.5253 0.5883 0.4561 3 1862 0.1814 <0.00001 0.0005 1.6779 0.1814 0.2386 0.1229 4 70 0.3861 0.0005 0.0149 1.4193 0.3861 0.6184 0.0918

257 257 5 71 0.6151 <0.00001 0.0147 1.4226 0.6151 0.7739 0.3836 6 324 0.6427 <0.00001 0.0031 1.6249 0.6427 0.7195 0.5502 7 133 0.7885 <0.00001 0.0077 1.5385 0.7885 0.8601 0.6865 8 127 0.5970 <0.00001 0.0081 1.5319 0.5970 0.7260 0.4274 9 1652 0.3154 <0.00001 0.0006 1.6765 0.3154 0.3715 0.2571 10 1361 0.5696 <0.00001 0.0007 1.6737 0.5696 0.6150 0.5204 11 100 0.1814 0.0710 0.0103 1.4931 0.1814 0.4181 -0.0784 12 59 0.2182 0.0970 0.0179 1.3761 0.2182 0.5128 -0.1224 13 85 0.5750 <0.00001 0.0122 1.4621 0.5750 0.7351 0.3540 14 94 0.4006 <0.00001 0.0110 1.4818 0.4006 0.6011 0.1527 15 1110 0.5619 <0.00001 0.0009 1.6702 0.5619 0.6126 0.5065 16 407 0.5903 <0.00001 0.0025 1.6377 0.5903 0.6677 0.5004 17 394 -0.1523 0.0012 0.0026 1.6361 -0.1523 -0.0230 -0.2766 18 103 0.5997 <0.00001 0.0100 1.4984 0.5992 0.7401 0.4092 TABLE D.3 (CONTINUED)

Study Spearman's rho P- Study weights rhoz (back rhoz UL CI 99% rhoz UL CI 99% Observations Var No. rho value (%) transform) (back transform) (back transform) 19 724 0.2435 <0.00001 0.0014 1.6601 0.2435 0.3316 0.1513 20 228 0.4982 <0.00001 0.0044 1.5988 0.4982 0.6162 0.3583 21 186 -0.0883 0.2306 0.0055 1.5794 -0.0883 0.1018 -0.2722 22 663 0.0018 0.9635 0.0015 1.6574 0.0018 0.1019 -0.0983 23 135 -0.0592 0.4955 0.0076 1.5406 -0.0592 0.1638 -0.2764 24 96 -0.4971 <0.00001 0.0108 1.4857 -0.4971 -0.2710 -0.6712 25 62 -0.4067 0.0010 0.0169 1.3892 -0.4067 -0.0955 -0.6455 26 137 -0.1865 0.0291 0.0075 1.5426 -0.1865 0.0341 -0.3899 27 1086 0.3650 <0.00001 0.0009 1.6698 0.3650 0.4309 0.2952 28 484 0.1865 <0.00001 0.0021 1.6458 0.1865 0.2972 0.0710 29 339 0.3590 <0.00001 0.0030 1.6277 0.3590 0.4750 0.2308 30 360 0.2909 <0.00001 0.0028 1.6312 0.2908 0.4104 0.1615 258 31 225 0.2893 <0.00001 0.0045 1.5977 0.2893 0.4390 0.1240 32 107 0.6090 <0.00001 0.0096 1.5049 0.6090 0.7444 0.4255 33 573 0.5382 <0.00001 0.0018 1.6525 0.5382 0.6105 0.4571 34 225 0.3066 <0.00001 0.0045 1.5977 0.3066 0.4542 0.1426 35 836 0.2439 <0.00001 0.0012 1.6640 0.2439 0.3260 0.1582 36 1099 0.4121 <0.00001 0.0009 1.6700 0.4121 0.4746 0.3454 37 588 0.4766 <0.00001 0.0017 1.6534 0.4766 0.5547 0.3900 38 640 -0.0048 0.9034 0.0016 1.6563 -0.0048 0.0971 -0.1066 39 51 0.2893 0.0395 0.0208 1.3348 0.2893 0.5851 -0.0744 40 125 0.3145 0.0004 0.0082 1.5296 0.3145 0.5073 0.0917 41 437 0.6081 <0.00001 0.0023 1.6412 0.6081 0.6803 0.5242 42 218 0.3742 <0.00001 0.0047 1.5948 0.3741 0.5148 0.2139 43 46 0.1114 0.4613 0.0233 1.3030 0.1114 0.4662 -0.2744 44 55 0.9641 <0.00001 0.0192 1.3567 0.9641 0.9823 0.9279 45 50 -0.0346 0.8112 0.0213 1.3289 -0.0346 0.3290 -0.3893 46 495 0.3081 <0.00001 0.0020 1.6468 0.3081 0.4093 0.1994 TABLE D.3 (CONTINUED)

Study Spearman's rho P- Study weights rhoz (back rhoz UL CI 99% rhoz UL CI 99% Observations Var No. rho value (%) transform) (back transform) (back transform) 47 77 0.6914 <0.00001 0.0135 1.4411 0.6914 0.8180 0.5011 48 95 0.0548 0.5981 0.0109 1.4838 0.0548 0.3129 -0.2109 49 191 0.0032 0.9644 0.0053 1.5821 0.0032 0.1891 -0.1828 50 204 0.5893 <0.00001 0.0050 1.5886 0.5893 0.6955 0.4579 51 461 0.5964 <0.00001 0.0022 1.6437 0.5964 0.6685 0.5131 52 198 0.2012 0.0045 0.0051 1.5857 0.2012 0.3703 0.0193 53 140 0.2195 0.0092 0.0073 1.5456 0.2195 0.4166 0.0028 54 145 0.1063 0.2032 0.0070 1.5502 0.1063 0.3124 -0.1094 55 200 -0.0762 0.2838 0.0051 1.5867 -0.0762 0.1071 -0.2544 56 226 -0.1581 0.0174 0.0045 1.5981 -0.1581 0.0133 -0.3205 57 200 -0.1204 0.0894 0.0051 1.5867 -0.1204 0.0627 -0.2957 58 131 -0.2200 0.0116 0.0078 1.5364 -0.2200 0.0044 -0.4233 259 59 191 -0.1487 0.0401 0.0053 1.5821 -0.1487 0.0384 -0.3256 60 201 0.0656 0.3550 0.0051 1.5872 0.0656 0.2440 -0.1171 61 151 -0.0173 0.8328 0.0068 1.5554 -0.0173 0.1923 -0.2255 62 470 0.0671 0.1465 0.0021 1.6445 0.0671 0.1844 -0.0522 63 106 0.1192 0.2237 0.0097 1.5033 0.1192 0.3574 -0.1337 64 114 0.1308 0.1655 0.0090 1.5153 0.1308 0.3596 -0.1129 Note: Also included are the number of observations, the Spearman’s rank correlation coefficient (Spearman’s rhoz), the associated P-value and variance, the study weights (given as a %), and the back transformed associated with each study. Correlation coefficients are displayed in Fig. 5.5.

oviposition . 1994 .

tions Perez et al -

Olaye et al. 1997, 2001, Ndemah - 1999, Bosque De Moraes and Lewis 1999, etManley al. 1991, Pair et al. 1982, King et al. 1985, Soteres et al. 1984, Stadelbacher et al. 1984 De Moraes and Lewis 1999, etManley al. 1991, Pair et al. 1982, King et al. 1985, Stadelbacher et al. 1984 Abundance estimate and preference cita Riley & Ciomperlik 1997, et Schuster al. 1998 Chabi

Strand 1990 Fye McAda& 1972 Life Life stage of host citations Bellows Bryne & 1991 Bonato Schulthess & 1998 Horsfall 1924 Fisher 1961 Fisher 1961 Fisher 1961 Fisher 1961 Fisher 1961 Fye McAda& 1972 Fye McAda& 1972

Avg. abund. 2 spp. 70.11 30.00 18.04 63.59 TABLE D.4: TABLE

Avg. abund. 1 spp. 29.89 70.00 81.96 36.41

4th 4th instar 2nd instar 2nd instar 2nd instar - - - - 4th 4th instar 1st 1st instar 1st 1st Stage 2spp. attacks 3rd old1 day eggs 4th instar and pupae 4th instar 4th instar 4th instar 4th instar

4th 4th instar 5th instar 5th instar 5th instar 5th instar 5th instar 5th instar 4th instar 4th instar 4th instar ------2 day old2 day eggs - 4th 4th 3rd 1st 1st Stage 1spp. attacks 1st 1 4th instar and pupae 4th 4th 4th 4th

DATA USED TO CALCULATE THE OVIPOSITION USED TO TIMING AND DATA OF NATURE ABUNDANCE IN

5 5 5 5 5 5 5 5 4 7 4 5 No. host instars

10 11 12 5 6 7 8 9 1 2 3 4 Study

260 TABLE D.4 (CONTINUED)

Study No. host Stage spp. 1 Stage spp. 2 Avg. abund. Avg. abund. Life stage of host Abundance estimate and oviposition instars attacks attacks spp. 1 spp. 2 citations preference citations 13 5 3rd instar 1st-5th instar 87.26 12.74 Fye & McAda 1972 Powell 1988, Tillman & Powell 1989, Hu & Vinson 2000, Hopper & King 1984, Bidlack et al. 1991, Manley et al. 1991, Pair et al. 1982, Stadelbacher et al. 1984 14 5 1st-5th instar 1st-5th instar Fye & McAda 1972 15 5 3rd-4th instar 3rd instar 31.41 68.59 Fye & McAda 1972 Hopper & King 1984, Bidlack et al. 1991, Pair et al. 1982, King et al. 1985, Manley et al. 1991, Stadelbacher et al. 1984 16 6 1st-2nd instar 1st-2nd instar Bomford and Isman 1996 17 5 1st-5th instar and 1st-5th instar Alzouma and

261 261 pupae and pupae Huignard 1981 18 5.5 late 1st-3rd instar 1st-2nd instar 64.35 35.65 McManus et al. 1992 Hoch et al. 2001 19 4 2nd-3rd instar 2nd-3rd instar Walker & Hoey 2003 20 4 1st-4th instar 3rd-4th instar 83.20 16.80 Talekar & Shelton Talekar & Hu 1996, Furlong & Zalucki 1993 2007 21 6 1st-5th instar 1st-5th instar Neunzig 1969 22 4 late 2nd instar 1st-2nd instar 80.09 19.91 Santos et al. 2003 Sequeira & MacKauer 2011, Arheampong et al. 2012 23 6 1st and 2nd instar 2nd-3rd instar 38.34 61.66 Stone & Pedigo 1972 Baur & Yeargan 1995, 1996 24 6 1st and 2nd instar 3rd-4th instar 65.25 34.75 Stone & Pedigo 1972 Baur & Yeargan 1995, 1996 25 6 2nd and 3rd instar 3rd-4th instar 74.35 25.65 Stone & Pedigo 1972 Baur & Yeargan 1995, 1996 26 5 1st-5th instar eggs 56.22 43.78 Jones & Wache 1998 Capinera 1999, Elsey & Rabb 1970, Ehler & Van Den Bosch 1974 27 4 2nd instar 3rd instar 2.00 98.00 Gerling et al. 1990 Danyk 1992, Shands et al. 1972a, 1972b 28 5.5 5th-6th instar 5th-6th instars McManus et al. 1992 29 6 1st-4th instar early 2nd instar 70.20 29.80 Santos et al. 2003 Pair et al. 1986a, 1986b, Riggin et al. 1993, Wyckhuys & O'Neil 2006 TABLE D.4 (CONTINUED)

Study No. host Stage spp. 1 Stage spp. 2 Avg. abund. Avg. abund. Life stage of host Abundance estimate and oviposition instars attacks attacks spp. 1 spp. 2 citations preference citations 30 5.5 1st-3rd instar 1st-2nd instar 1.00 99.00 McManus et al. 1992 Krause et al. 1990 31 5 1st-5th instar 1st-2nd instar 78.16 21.84 Richards 1940 Mattiacci & Dicke 1995a, 1995b, Karowe & Schoonhoven 1992, Benson et al. 2003a, 2003b 32 5 pupae pupae Alghali 1986 33 4 1st-4th instar 3rd-4th instar 2.43 97.57 Campos et al. 2003 Donnell & Hunter 2002, Schuster et al. 1998 34 4 3rd instar 3rd-4th instar 99.30 0.70 Barilli et al. 2014 Lohr et al. 1990, Hillocks et al. 2001 35 5 1st-5th instar 4th-5th instar 62.84 37.16 Hill 2008 Gilichet 1975, Thompson 1986 36 5 1st-5th instar 3rd instar Hill 2008 37 5 4th-5th instar 3rd instar 44.94 55.06 Hill 2008 Galichet 1975

262 262 38 4 2nd-5th instar 2nd-5th instar Athanassiou 2008 39 6 3rd-6th instar 1st-2nd instar 36.93 63.07 Obonyo et al. 2008 Sallem 2002, Songa et al. 2001, Cugala et al. 2006 Mailafiya et al. 2009 40 5 2nd-5th instar 2nd-5th instar Steinberg et al. 1987 41 7 pupae pupae Granger and Sehnal 1974 42 3 2nd-3rd instar 2nd-3rd instar Arbeitman et al. 2002 43 5 eggs 3rd-4th instar Fye & McAda 1972 44 5 eggs 4th-5th instar 0.47 99.53 Fye & McAda 1972 Soteres et al. 1984b 45 5 eggs 1st-4th instar 50.71 49.29 Fye & McAda 1972 Wyckhuys & O'Neil 2006, Soteres et al. 1984a, Pair et al. 1986a, Jourdie et al. 2008 46 5.5 1st-3rd instar 1st-3rd instar McManus et al. 1992 47 6 5th-6th instar 3rd instar 20.00 80.00 Hill 2008 Weir et al. 2007, Lv et al. 2011 48 3 pupae pupae Hewitt 1907 49 3 pupae pupae Hewitt 1907 50 3 pupae pupae Hewitt 1907 51 4 1st-4th instar 2nd instar 54.64 45.36 Moran 1992 Campbell & Mackauer 1973, Angalet & Fuester 1977 TABLE D.4 (CONTINUED)

Study No. host Stage spp. 1 Stage spp. 2 Avg. abund. Avg. abund. Life stage of host Abundance estimate and oviposition instars attacks attacks spp. 1 spp. 2 citations preference citations 52 3 2nd instar 2nd instar Arbeitman et al. 2002 53 6 pupae pupae Obonyo et al. 2008 54 6 pupae pupae Obonyo et al. 2008 55 5 1st-5th instar 1st-4th instar Fye & McAda 1972 56 5 1st-5th instar 1st-5th instar Fye & McAda 1972 57 5 1st-5th instar 1st-4th instar 44.02 55.98 Fye & McAda 1972 Tillman & Powell 1989, Sertkaya et al. 2004 58 5 1st-4th instar 1st-5th instar 58.37 41.63 Fye & McAda 1972 Tillman & Powell 1989, Cameron et al. 2006 59 5 1st-4th 1st-2nd instar 81.07 18.93 Fye & McAda 1972 Tillman & Powell 1989, Torres-Vila et al. 2000 60 5 late 1st instar 1st-5th instar 44.02 55.98 Fye & McAda 1972 Tillman & Powell 1989, Sertkaya et al. 263 263 2004 61 4 1st-5th instar 2nd-3rd instar 57.81 42.19 MacGillivray & Rehman & Powell 2010, Deconti et al. Anderson 1964 2008, Sidney et al. 2010 62 5 late 2nd instar 4th instar, pupae 40.00 60.00 Cope & Fox 2003 Mohamad et al. 2011 63 5 4th-5th instar, old eggs 46.00 54.00 Tabuchi et al. 2007 Kim & Lim 2010, Mainali & Lim 2012 pupae 64 5 early eggs old eggs 46.00 54.00 Tabuchi et al. 2007 Kim & Lim 2010, Mainali & Lim 2012 Note: Information about the timing of oviposition timing (n = 64 studies) and abundance (n = 35 studies) of competing species from nature. To estimate the time at which each parasitoid species is ovipositing, we determined the host life stage or range of host life stages at which each parasitoid species attacks (Stage spp. 1 attacks and Stage spp. 2 attacks) and scaled this to the total number of life stages of each host species (No. host instars). Also given are the average abundance values taken from surveys from the literature (Avg. abund. spp. 1 and avg. abund. spp. 2). Also given are the citations used to estimate the number of host life stages and the timing of oviposition and abundance in nature. These data were used to determine the relationships displayed in Fig. 5.6. TABLE D.5:

CHI-SQUARE TEST RESULTS COMPARING SURVIVORSHIP OF SPECIES 1 TO A NULL OF 50% SURVIVORSHIP (I.E.,

COMPETITIVE EQUIVALENCE) WHEN BOTH SPECIES OVIPOSIT AT THE SAME TIME

No spp. 1 No spp. 2 Survivorship Survivorship Stdev LL 99% UL 99% Study χ2 P-value survived survived spp. 1 spp.2 survivorship CI CI

264 264 2 92 308 0.2300 0.7700 0.4214 116.6 < 0.0001 0.7158 0.8242 3 22 283 0.0721 0.9279 0.2591 223.4 < 0.0001 0.8898 0.966 4 11 13 0.4583 0.5417 0.5090 0.167 0.68 0.2796 0.8036 5 11 12 0.4783 0.5217 0.5108 0.043 0.83 0.2534 0.79 6 18 32 0.3600 0.6400 0.4849 3.92 0.05 0.4651 0.8149 7 8 13 0.3810 0.6190 0.4976 1.19 0.28 0.346 0.892 8 7 23 0.2333 0.7667 0.4302 8.53 0.004 0.5678 0.9656 9 97 198 0.3288 0.6712 0.3879 34.58 < 0.0001 0.6007 0.7417 10 24 223 0.0972 0.9028 0.2606 160.3 < 0.0001 0.8552 0.9514 11 6 10 0.3750 0.6250 0.4521 1.00 0.32 0.3132 0.9368 12 7 9 0.4375 0.5625 0.4919 0.62 0.7515 0.24 0.88 13 5 24 0.1724 0.8276 0.3311 2.45 0.0004 0.6469 1.0083 14 3 10 0.2308 0.7692 0.4225 3.77 0.05 0.4682 1.0702 TABLE D.5 (CONTINUED)

No spp. 1 No spp. 2 Survivorship Survivorship Stdev LL 99% UL 99% Study χ2 P-value survived survived spp. 1 spp.2 survivorship CI CI 15 4 26 0.1333 0.8667 0.3457 16.13 < 0.0001 0.7069 1.0265 16 16 53 0.2319 0.7681 0.3445 19.84 < 0.0001 0.6372 0.90 18 11 47 0.1897 0.8103 0.3955 22.35 < 0.0001 0.6777 0.9429 20 5 131 0.0368 0.9632 0.2191 116.7 < 0.0001 0.9216 1.0048 21 34 34 0.5000 0.5000 0.5020 0 1.0 0.3438 0.6562 22 6 153 0.0377 0.9623 0.2129 135.9 < 0.0001 0.9232 1.0012 27 2 95 0.0206 0.9794 0.1417 89.17 < 0.0001 0.9423 1.0165 32 4 49 0.0755 0.9245 0.2843 38.21 < 0.0001 0.83 1.02

265 265 33 38 150 0.2021 0.7979 0.3959 66.73 < 0.0001 0.7225 0.8733 34 19 103 0.1557 0.8443 0.3887 57.84 < 0.0001 0.7597 0.9289 35 144 158 0.4768 0.5232 0.5003 0.51 0.65 0.42 0.5971 36 197 395 0.3328 0.6672 0.4716 66.22 < 0.0001 0.6173 0.7171 37 42 217 0.1622 0.8378 0.3693 118.2 < 0.0001 0.7788 0.8968 39 1 16 0.0588 0.9412 0.2425 13.24 0.0003 0.7942 1.0882 40 21 21 0.5000 0.5000 0.4962 0 1 0.3013 0.6987 42 32 39 0.4507 0.5493 0.5011 0.69 0.41 0.3972 0.7014 46 71 90 0.4410 0.5590 0.4962 2.42 0.13 0.4582 0.6598 48 4 30 0.1176 0.8824 0.3270 19.88 < 0.0001 0.7401 1.0247 49 15 44 0.2542 0.7458 0.4392 14.25 0.0002 0.5998 0.8918 50 26 40 0.3939 0.6061 0.4924 2.97 0.08 0.4512 0.76 51 25 79 0.2404 0.7596 0.3495 28.04 < 0.0001 0.6517 0.8675 53 1 33 0.0294 0.9706 0.1265 30.12 < 0.0001 0.90 1.0452 TABLE D.5 (CONTINUED)

No spp. 1 No spp. 2 Survivorship Survivorship Stdev LL 99% UL 99% Study χ2 P-value survived survived spp. 1 spp.2 survivorship CI CI 54 4 34 0.1053 0.8947 0.2419 23.68 < 0.0001 0.7664 1.02 55 8 64 0.1111 0.8889 0.3165 43.56 < 0.0001 0.7935 0.9843 56 29 47 0.3816 0.6184 0.4890 4.26 0.04 0.4749 0.7619 57 7 50 0.1228 0.8772 0.3311 32.44 < 0.0001 0.7652 0.9892 58 8 57 0.1231 0.8769 0.3311 36.94 < 0.0001 0.7719 0.9819 59 13 74 0.1494 0.8506 0.3586 42.77 < 0.0001 0.7522 0.95 60 24 63 0.2759 0.7241 0.4495 17.48 < 0.0001 0.6007 0.8475 63 20 37 0.3509 0.6491 0.4789 5.07 0.02 0.4863 0.8119 64 28 30 0.4828 0.5172 0.4513 0.07 0.79 0.3482 0.6882 266 266 Note: Chi-square test results for 44 studies included in the meta-analysis that measured survivorship at t0. Given are the number of replicates for which species 1 and species 2 successfully survived (No. spp. 1 survived, No. spp. 2 survived), survivorship of both species (Survivorship spp. 1 and Survivorship spp. 2), and standard deviation or survivorship, as well the test statistic (χ2-value), statistical significance (P-value) and the upper level (UL) and lower level (LL) 99% confidence intervals (CI) displayed in Fig. 5.3 are also given. TABLE D.6:

FISHER EXACT TEST ASSESSING THE EFFECT OF THE ORDER OF OVIPOSITION ON SURVIVORSHIP

267 267 4 6 18 0.2500 16 6 0.7273 0.4773 0.0980 0.7056 0.001 5 3 26 0.1034 16 3 0.8421 0.7387 0.3686 0.8787 3.13E-07 6 30 133 0.1840 105 6 0.9459 0.7619 0.6385 0.8356 8.21E-40 7 3 52 0.0545 55 2 0.9649 0.9104 0.7251 0.9598 1.15E-25 8 3 43 0.0652 30 21 0.5882 0.5230 0.2853 0.6875 2.08E-08 9 95 652 0.1272 234 376 0.3836 0.2564 0.1962 0.3153 0.000001 10 250 332 0.4296 499 33 0.9380 0.5084 0.4466 0.5653 0.000001 11 23 16 0.5897 34 11 0.7556 0.1658 -0.0927 0.4024 0.08 12 12 10 0.5455 17 4 0.8095 0.2641 -0.0983 0.5471 0.06 13 9 19 0.3214 26 2 0.9286 0.6071 0.2794 0.7894 0.000002 14 19 22 0.4634 38 2 0.9500 0.4866 0.2319 0.6721 8.63E-07 15 43 497 0.0796 290 250 0.5370 0.4574 0.3917 0.5174 0.000001 16 57 109 0.3434 155 17 0.9012 0.5578 0.4338 0.6558 5.18E-28 17 126 85 0.5972 77 106 0.4208 -0.1764 -0.2984 -0.0463 0.0003 TABLE D.6 (CONTINUED)

No. surv. spp. No. die spp. 1 Surv. spp. 1 No. surv. spp. No. die spp. 1 Surv. spp. 1 Diff. LL UL Study 1 oviposit 2nd oviposit 2nd oviposit 2nd 1 oviposit 1st oviposit 1st oviposit 1st surv. 99% CI 99% CI Fisher P 18 0 19 0.0000 18 3 0.8571 0.8571 0.4777 0.9631 1.17E-08 19 139 197 0.4137 223 165 0.5747 0.1611 0.0651 0.2528 0.00001 20 20 29 0.4082 39 4 0.9070 0.4988 0.2479 0.6707 3.61E-07 21 35 24 0.5932 30 29 0.5085 -0.0847 -0.3019 0.1444 0.23 22 174 7 0.9613 246 8 0.9685 0.0072 -0.0411 0.0662 0.44 27 5 305 0.0161 159 453 0.2598 0.2437 0.1907 0.2929 1.63E-25 28 96 136 0.4138 138 90 0.6053 0.1915 0.0714 0.3039 0.00003 29 88 78 0.5301 132 41 0.7630 0.2329 0.0994 0.3557 0.000005 30 43 168 0.2038 69 80 0.4631 0.2593 0.1302 0.3808 1.64E-07 31 112 13 0.8960 100 0 1.0000 0.1040 0.0073 0.1858 0.0004 32 3 24 0.1111 24 3 0.8889 0.7778 0.4440 0.8945 4.46E-09

268 268 33 17 79 0.1771 188 101 0.6505 0.4734 0.3319 0.5773 2.02E-16 34 16 18 0.4706 63 6 0.9130 0.4425 0.1999 0.6469 0.000002 35 119 98 0.5484 256 61 0.8076 0.2592 0.1539 0.3599 1.37E-10 36 111 230 0.3255 152 14 0.9157 0.5901 0.4905 0.6639 1.01E-39 37 71 111 0.3901 138 9 0.9388 0.5487 0.4364 0.6484 1.25E-27 38 198 122 0.6188 159 161 0.4969 -0.1219 -0.2195 -0.0208 0.001 39 3 1 0.7500 29 0 1.0000 0.2500 -0.0280 0.7806 0.12 40 14 25 0.3590 29 15 0.6591 0.3001 0.0184 0.5234 0.006 41 51 202 0.2016 129 55 0.7011 0.4995 0.3820 0.5966 2.73E-26 42 22 50 0.3056 57 18 0.7600 0.4544 0.2451 0.6110 2.53E-08 46 56 111 0.3353 115 52 0.6886 0.3533 0.2141 0.4734 7.07E-11 47 22 20 0.5238 33 2 0.9429 0.4190 0.1586 0.6123 0.00003 48 29 2 0.9355 29 1 0.9667 0.0312 -0.1739 0.2386 0.51 49 88 13 0.8713 29 2 0.9355 0.0642 -0.1507 0.1850 0.26 50 7 24 0.2258 94 8 0.9216 0.6958 0.4457 0.8370 9.85E-07 51 57 115 0.3314 169 16 0.9135 0.5821 0.4632 0.6757 2.44E-39 TABLE D.6 (CONTINUED)

No. surv. spp. No. die spp. 1 Surv. spp. 1 No. surv. spp. No. die spp. 1 Surv. spp. 1 Diff. LL UL Study 1 oviposit 2nd oviposit 2nd oviposit 2nd 1 oviposit 1st oviposit 1st oviposit 1st surv. 99% CI 99% CI Fisher P 53 36 2 0.9474 56 0 1.0000 0.0526 -0.0885 0.2111 0.16 54 49 7 0.8750 47 1 0.9792 0.1042 -0.0501 0.2597 0.048 55 8 16 0.3333 14 90 0.1346 -0.1987 -0.4651 0.0167 0.03 56 19 25 0.4318 36 70 0.3396 -0.0922 -0.3084 0.1192 0.19 57 4 29 0.1212 4 106 0.0364 -0.0848 -0.2976 0.0302 0.08 58 23 19 0.5476 4 20 0.1667 -0.3810 -0.5928 -0.0586 0.002 59 17 25 0.4048 25 37 0.4032 -0.0015 -0.2325 0.2434 0.57 60 15 24 0.3846 46 29 0.6133 0.2287 -0.0227 0.4423 0.017 61 23 49 0.3194 24 55 0.3038 -0.0156 -0.2051 0.1726 0.49 62 15 179 0.0773 37 239 0.1341 0.0567 -0.0215 0.1283 0.0357 63 0 29 0.0000 0 20 0.0000 0.0000 -0.1862 0.2491 1

269 269 64 0 29 0.0000 4 23 0.1481 0.1481 -0.0646 0.3899 0.04778 Note: Fisher exact test assessing the effect of the order of oviposition on survivorship for 55 studies included in the meta-analysis. Shown are the number of individuals of species 1 that survived and died when species 1 oviposited second (No. surv. Spp. 1 oviposit 2nd, No. die spp. 1 oviposit 2nd), and the number of individuals of species 1 that survived when species 1 oviposited first (No. surv. spp. 1 oviposit 1st, No. die spp. 1 oviposit 1st) across all replicates at all treatments. Also given survivorship when species 1 oviposits second (Surv. spp. 1 oviposit 2nd) and when species 1 oviposits 1st (Surv. spp. 1 oviposit 1st). Also given is the difference between survivorship estimates when species 1 oviposits first and when species 1 oviposits second (Diff. surv.) and the upper level (UL) and lower level (LL) 99% confidence intervals (CI) of each difference displayed in Fig. 5.4. A positive value in this column indicates that survivorship for species 1 is higher when species 1 oviposits first and a negative value indicates that survivorship for species 1 is lower when species 1 oviposits first. A value of 0 would indicate equivalent survivorship regardless of the order of oviposition. Included are the Fisher's probability (Fisher's one-tailed P value) of the difference between survivorship when species 1 oviposits second and when species 1 oviposits first (at test of the significance of the general order of oviposition. Data displayed in Fig. 5.4.

7 - 30 30 30 29 30 30 19 30 30 30 30 30 ------0.0004 value of

- < 0.01E < 0.01E < 0.01E < 0.01E < 0.01E < 0.01E < 0.01E < 0.01E < 0.01E < 0.01E < 0.01E P Q < 0.01E < 0.01E

) 36.91 38.39 97.94 Q 593.31 640.72 529.40 177.09 446.04 341.44 1511.80 1590.33 1009.51 1422.89 1108.75 Heterogeneityof effect ( sizes

) w Q Type of Heterogeneity ( Within

5 6 18 14 32 64 50 14 19 28 17 13 46 57

Sample size

TABLE D.7: TABLE

oparasitoid

only

HETEROGENEITY STATISTICS HETEROGENEITY

us us vs. gregarious studies only

Gregario Gregarious solitaryvs. Solitary vs. solitary Endoparasitoid endoparasitoid vs. Ectoparasitoid ect vs. Introduced introduced vs. Introduced native vs. Native native vs. Comparison All studies Positive Negative studies Generalist vs. generalist Generalist vs. specialist Specialist specialistvs.

nalysis strategy Larval feeding habitat orNative introduced Description of a Overall heterogeneity Degree hostof specificity laying Egg

analyses - Full analysesFull Sub Type of analysis

270 TABLE D.7 (CONTINUED)

Description of Sample Type of Heterogeneity of P-value of Type of analysis Comparison analysis size Heterogeneity effect sizes (Q) Q Sub-analyses Order of parasitoid Hymenoptera 58 1685.72 < 0.01 E-30 Diptera 6 99.85 < 0.01 E-20 Family of parasitoid Same family 47 1360.58 < 0.01 E-30 Different family 17 223.85 < 0.01 E-30 Genus of parasitoid Same genus 14 316.5 < 0.01 E-30 Different genus 50 1546.88 < 0.01 E-30 Host order Diptera 5 54.26 < 0.01 E-10 Hemiptera 12 255.50 < 0.01 E-30 Lepidoptera 45 977.11 < 0.01 E-30 Host family Aphididae 6 166.16 < 0.01 E-30

271 Crambidae 7 58.30 < 0.01 E-10 Lymantriidae 4 21.51 < 0.01 E-5 Muscidae 3 50.58 < 0.01 E-10 Noctuidae 25 914.21 < 0.01 E-30 Pyralidae 7 251.94 < 0.01 E-30 Degree of host Sub-analyses specificity Generalist/generalist vs. generalist/specialist 2 Between (QB) 2.05 0.15 Generalist/generalist vs. specialist/specialist 2 0.17 0.68 Generalist/specialist vs. specialist/specialist 2 5.00 0.02 Egg laying Gregarious/gregarious vs. strategy gregarious/solitary 2 5.27 0.02 Gregarious/gregarious vs. solitary/solitary 2 2.51 0.11 Gregarious/solitary vs. solitary/solitary 2 1.43 0.23 Larval feeding habitat Endo-/endo-parasitic vs. ecto-/ecto-parastic 2 2.41 0.12 Native or introduced Introduced/introduced vs. introduced/native 2 0.02 0.89 TABLE D.7 (CONTINUED)

Description of Sample Type of Heterogeneity of P-value of Type of analysis Comparison analysis size Heterogeneity effect sizes (Q) Q Sub-analyses Introduced/introduced vs. native/native 2 2.74 0.10 Introduced/native vs. native/native 2 2.85 0.09 Order of parasitoid Hymenoptera vs. Diptera 2 0.02 0.88 Family of Same family vs. different family parasitoid 2 4.96 0.02 Genus of Same genus vs. different genus parasitoid 2 0.41 0.52 Host order Diptera vs. Hemiptera 2 0.01 0.93 Diptera vs. Lepidoptera 2 0.96 0.33 Hemiptera vs. Lepidoptera 2 3.33 0.07 Host family Aphididae vs. Crambidae 2 3.57 0.06 Aphididae vs. Lymantriidae 2 0.76 0.38

272 Aphididae vs. Muscidae 2 0.0002 0.99 Aphididae vs. Noctuidae 2 0.04 0.85 Aphididae vs. Pyralidae 2 3.94 0.05 Crambidae vs. Lymantriidae 2 1.14 0.28 Crambidae vs. Muscidae 2 0.75 0.39 Crambidae vs. Noctuidae 2 0.88 0.35 Crambidae vs. Pyralidae 2 0.82 0.36 Lymantriidae vs. Muscidae 2 0.18 0.67 Lymantriidae vs. Noctuidae 2 0.30 0.58 Lymantriidae vs. Pyralidae 2 2.21 0.14 Muscidae vs. Noctuidae 2 0.02 0.88 Muscidae vs. Pyralidae 2 1.68 0.19 Noctuidae vs. Pyralidae 2 1.78 0.18 Note: Given are within (Qw) and between (QB) heterogeneity and significance (P-value of Q) for each comparison in the sub-analyses displayed in Figs. 5.7 and 5.8. D.2 Literature Cited

Agboka, K., Schulthess, F., Chabi-Olaye, A., Labo, I, Gounou, S. and Smith, H. 2002. Self-, intra-, and interspecific host discrimination in Telenomus busseolae Gahan and T. isis Polaszek Hymenoptera: Scelionidae), sympatric egg parasitoids of the African cereal stem borer Sesamia calamistis Hampson (Lepidoptera: Noctuidae). Journal of Insect Behavior 15:1-12.

Alghali, A.M. 1986. Effects of cuitivar, time and amount of Chilo partellus Winhoe (Lepidoptera: Pyralidae) infestation on sorghum yield components in Kenya. Tropical Pest Management 32:126-129.

Alim, A. and Lim U.T. 2011. Interspecific larval competition between two egg parasitoids in refrigerated host eggs of Riptortus pedestris (Hemiptera: Alydidae). Biocontrol Science and Technology 21:395-407.

Alzouma, I. and Huignard, J. 1981. Donnees preliminaires sur la biologie et le comportement de ponte de Bruchidius atrolineatus (Pic.) (Coleoptera: Bruchidae) dans une zone sud sahelienne au Niger. Acta Oecologia 2:391-400.

Angalet, G. and Fuester, R. 1977. The Aphidius parasites of the pea aphid Acyrthosiphon pisum in the eastern half of the United States. Annals of the Entomological Society of America 70:87-96.

Arbeitman, M.N., Furlong, E.E.M., Imam, F., Johnson, E., Null, B.H., Baker, B.S., Krasnow, M.A., Scott, M.P., Davis, R.W. and White, K.P. Gene expression during the life cycle of Drosophila melanogaster. Science 297:2270-2275.

Archaempong, S., Gillespie, D.R. and Quiring, D. 2012. Survey of parasitoids and hyperparsitoids (Hymenoptera) of the green peach aphid, Myzus persicae and the foxglove aphid, Aulacorthum solani (Hemiptera: Aphididae) in British Columbia. Journal of the Entomological Society of British Columbia 109:12-22.

Anthanassiou, C.G., Palyvos, N.E. and Kakouli-Duarte, T. 2008. Insecticidal effect of Steinernema feltiae (Filipjev) (Nematoda: Steinernematidae) against Tribolium confusum du Val (Coleoptera: Tenebrionidae) and Ephestia keuhniella (Zeller) (Lepidoptear: Pyralidae) in stored wheat. Journal of Store Products Research 44:52-57.

Bai, B. and Mackauer, M. 1991. Recognition of heterospecific parasitism: competition between Aphidiid (Aphidius ervi) and Aphelinid (Aphelinus asychis) parasitoids of aphids (Hymenoptera: Aphidiidae; Aphelinidae). Journal of Insect Behavior 4:333-345. 273 Bajpai, N.K., Ballal, C.R., Rao, N.S., Singh, S.P. and Bhaskaran, T.V. 2006. Competitive interactions between two ichneumonid parasitoids of Spodoptera litura. BioControl 51:419-438.

Barilli, D.R., Pietrowski, V., Wengrat, A.P.G.D.S., Gazola, D. and Ringenberg, R. 2014. Biological characteristics of the cassava mealybug Phenacoccus manihoti (Hemiptera: Pseudococcidae). Revista Colombiana de Entomologia 40:21-24.

Baur, M.E. and Yeargan, K.V. 1995. Host selection and larval interactions among three primary parasitoids of Plathypena scabra (Lepidoptera, Noctuidae) (Cotesia marginivestris, Biolcogaster facetosa, Aleiodes nolophanae, mandibulate parasitoid larvae). Entomophaga 40:357-366.

Baur, M.E. and Yeargan, K.V. 1996. Movement and response to semiochemicals by parasitoids of Plathypena scabra (Lepidoptera: Noctuidae). Journal of Kansas Entomologiacal Society 69:122-132.

Benson, J., Van Driesche, R.G. Pasquale, A. and Elkinton, J. 2003a. Introduced braconid parasitoids nad range reduction of a native butterfly in New England. Biological Control 28:197-213.

Benson, J., Pasquale, A., Van Driesche, R., Elkinton, J. 2003b. Assessment of risk posed by introduced braconid wasps to Pieris virginiensis, a native woodland butterfly in New England. Biological Control 26:83-93.

Bidlack, D.S., Grant, J.F. and Pless, C.D. 1991. Seasonal incidence of larvae of the tobacco budworm and corn earworm, and their parasitoids, on tobacco in eastern Tennessee. Journal of Agricultural Entomology 8:155-162.

Bomford, M.K. and Isman, M.B. 1996. Desensitization of fifth instar Spodoptera litura to azadirachtin and neem. Entomologia Experimentalis et Applicata 55:149-160.

Bonato, O. and Schulthess, F. 1998. Selecting a character for identifying larval instars of the lepidopteran stemborers Sesamia calamistis Hampson (Noctuidae) and Eldana saccharina walker (Pyralidae) in maize. International Journal of Tropical Insect Science 18:101-103.

Bosque-Perez, N.A., Ubeku, J.A. and Polaszek, A. 1994. Survey for parasites of Sesamia calamistis (Lep.: Noctuidae) and Eldana saccharina (Lep.: Pyralidae) in southwestern Nigeria. Entomophaga 39:367-376.

274 Browning, H.W. and Oatman, E.R. 1984. Intra- and interspecific relationships among some parasites of Trichoplusia ni (Lepidoptera: Noctuidae). Environmental Entomology 13:551-556.

Byrne, D.N. and Bellows, T.S. 1991. Whitefly biology. Annual Review of Entomology 36:431-457.

Cameron, P.J., Walker, G.P., Herman, T.J.B. and Wallace, A.R. 2006. Incidence of the introduced parasitoid Cotesia kazak and Microplitis croceipes (Hymenoptera: Braconidae) from Helicoverpa armigera (Lepidoptera: Noctuidae) in tomatoes, sweet corn, and lucerne in New Zealand. Biological Control 39:375-384.

Campbell, A. and Mackauer, M. 1973. Some climatic effects on the spread and abundance of two parasites of the pea aphid in British Columbia (Hymenoptera: Aphidiidae – Homoptera: Aphididae). Journal of Applied Entomology 74:47-55.

Campos, O.R., Crocomo, W.B., Labinas, A.M. 2003. Comparative biology of the white Trialeurodes vaporariorum (West.) (Hemiptera – Homoptera: Aleyrodidae) on soybean and bean cultivars. Neotropical Entomology 32:133-138.

Capinera, J.L. 1999. Trichoplusia ni (Hubner) (Insecta: Lepidoptera: Noctuidae). University of Florida Cooperative Extension Service, Institue of Food and Agricultural Sciences, EDIS.

Chabi-Olaye, A., Schulthess, F., Shanower, T.G. and Bosque-Perez, N.A. 1997a. Factors influencing the developmental rates and reproductive potentials of Telenomus busseolae (Gahan) (Hym.: Scelionidae), an egg parasitoid of Sesamia calamistis Hampton (Lep.: Noctuidae). Biological Control 8:15-21.

Chabi-Olaye, A., Schulthess, F., Poehling, H.M. and Borgemeister, C. 2001. Factors affecting the biology of Telenomus isis (Polaszek) (Hymenoptera: Scelionidae), an egg parasitoid of cereal stem borers in West Africa. Biological Control 21:44- 54.

Chiba-Olaye, A., Schulthess, F., Shanower, T.G. and Bosque-Perez, N.A. 1997. Factors influencing the bionomics of Telenomus busseolae (Gahan) (Hym.: Scelionidae) an egg parasitoid of Sesamia calamistis Hampson (Lep.: Noctuidae). Biological Control 8:15-21.

Chua, T.H., Gonzalez, D. and Bellows, T. 1990. Searching efficiency and multiparasitism in Aphidius smithi and A. ervi (Hym., Aphidiidae), parasites of pea aphid, Acyrthosiphon pisum (Hom., Aphididae). Journal of Applied Entomology 110:101-106.

275

Chow, F.J. and Mackauer, M. 1984. Inter- and intraspecific larval competition in Aphidius smithi and Praon pequodorum (Hymenoptera: Aphidiidae). Canadian Entomologist 116:1097-1107.

Collier, T.R., Hunter, M.S. and Kely, S.E. 2007. Heterospecific ovicide influences the outcome of competition between two endoparasitoids, Encarsia Formosa and Encarsia luteola. Ecological Entomology 32:70-75.

Cope, J.M. and Fox, C.W. 2003. Oviposition decisions in the seed beetle, Callosobruchus maculates (Coleoptera: Bruchidae): effects of seed size on superparasitism. Journal of Stored Products Research 39:355-365.

Cugala, D., Schulthess, F., Ogol C.P.O. and Omwega, C.A. 2006. Assessment of the impact of natural enemies on stemborer infestations and yield loss in maize using selected insecticides in Mozambique. International Journal of Entomology 42:503-510.

Danyk, T.P. 1992. Competitive interactions between the pea aphid parsitoids, Aphidius ervi and Praon pequodorum (Hymenoptera: Aphidiidae): influence on guild composition in southern British Columbia. Master’s Thesis. Simon Fraser University.

Donnell, D.M. and Hunter, M.S. 2002. Developmental rates of two congeneric parasitoids, Encarsia formosa and E. pergandiella (Hymenoptera: Aphelinidae) utilizing different egg provisioning strategies. Journal of Insect Physiology 48:487-493.

De Conti B.F., Bueno, V.H.P. and Sampaio, M.V.2008. The parasitoid Praon volucre (Hymenoptera: Braconidae: Aphidiinae) as a potential biological control agent of the aphid Uroleucon ambrosia (Hemiptera: Aphididae) on lettuce in Brazil. European Journal of Entomology 105:485-487.

De Moraes, C.M. and Mescher, M.C. 2005. Intrinsic competition between larval parasitoids with different degrees of host specificity. Ecological Entomology 30:564-570.

De Moraes, C.M., Cortesero, A.M., Stapel, J.O. and Lewis W.J. 1999. Intrinsic and extrinsic competitive interactions between two larval parasitoids of Heliothis virescens. Ecological Entomology 24:402-410.

De Moraes, C.M. and Lewis, W.J. 1999. Analyses of two parasitoids with convergent foraging strategies. Journal of Insect Behaviour 12:571-583.

276

Ehler, L.E. and Van Den Bosch, R. 1974. An analysis of the natural biological control of Trichoplusia ni (Lepidoptera: Noctuidae) on cotton in California. The Canadian Entomologist 106:1067-1073.

Elsey, K.D. and Rabb R.L. 1970. Analysis of the seasonal mortality of the cabbage looper in North Carolina. Annals of the Entomological Society of America 63:1597- 1604.

Fisher, R.C. 1961. A study of insect multiparasitism II. The mechanisms and control of competition for possession of the host. Journal of Experimental Biology 38:605- 628.

Furlong, M.J. and Zalucki, M.P. 2007. Parasitoid complex of diamondback moth in south-east Queensland: first records of Oomyzus sokolowskii (Hymenoptera: Eulophidae) in Austria. Australian Journal of Entomology 46:167-175,

Fye, R.E. and McAda, W.C. 1972. Laboratory studies on the development, ongevity and fecundity of six lepidopterous pests of cotton in Arizona. No. 1454. Agricultural Research Service, U.S. Department of Argiculture.

Fleury, F., Allemand, R., Vavre, F., Fouillet, P. and Bouletreau, M. 2000. Adaptive significance of a circadian clock: temporal segregation of activities reduces intrinsic competition inferiority in Drosophila parasitoids. Proceedings of the Royal Society B: Biological Sciences 267:1005-1010.

Galichet, P.F. 1975. Equilibres observes entre les populations des tachinaires parasites du genre Diatraea en Guadeloupe (Antilles francaises). Annales de la Societe Entomologique de France 11:791-807.

Gauthier, N., Sanon, A., Monge, J.P. and Huignard, J. 1999. Interspecific relations between two sympatric species of Hymenoptera, Dinarmus basalis (Rond) and Eupelmus vuilleti (Crw), ectoparasitoids of the Bruchid Callosobruchus maculates (F). Journal of Insect Behavior 12:399-414.

Gerling, D., Roitberg, B.D. and Mackauer, M. 1990. Instar-specific defense of the pea aphid, Acyrthosiphon pisum: influence on oviposition success of the parasite Aphelinus asychis (Hymenoptera: Aphelinidae). Journal of Insect Behavior 3:501- 514.

Godwin, P.A. and Odell, T.M. 1984. Laboratory study of competition between Blepharipa pratensis and Parasetigena silvestris (Diptera: Tachinidae) in Lymantria dispar (Lepidoptera: Lymantriidae). Environmental Entomology 13:1059-1063.

277

Granger, N.A. and Sehnal, F. 1975. Regular of larval corpora allata in Galleria mellonella. Nature 251:415-417.

Hagvar, E.B. and Hofsvang, T. 1988. Interspecific competition between the aphid parasitoids Aphidius colemani Viereck and Ephedrus cerasicola Stary (Hymenoptera: Aphididae). Entomologia Experimentalis et Applicata 59:145-150.

Hewitt, C.G. 1907. A Preliminary Account of the Life-history of the Common House Fly (Musca Domestica L.).

Hill, D.S. 2008. Pests of Crops in Warmer Climates and Their Control. Springer, New York, NY, USA.

Hillocks, R.J., Tresh, J.M. and Bellotti, A.C. 2001. Cassava Biology, Production and Utilization. CABI Publishing, New York.

Hoch, G., Zubrik, M., Novotny, J. and Schopf, A. 2001. The natural enemy complex of the gypsy moth, Lymantria dispar (Lep., Lymantriidae) in different phases of its population dynamics in eastern Austria and Slovakia-a comparative study. Journal of Applied Entomology 125:217-227.

Hofsvang, T. and Hagvar, E.G. 1986. Ovipositon behavior of Ephedrus cerasicola (Hym: Aphidiidae) parasitizing different instars of its aphid host. Entomophaga 31:261- 267.

Hopper, K.R. and King, E.G. 1984. Preference of Microplitis croceipes (Hymenoptera: Braconidae) for instars and species of Heliothis (Lepidoptera: Noctuidae). Environmental Entomology 13:1145-1150.

Horsefall, J.L. 1924. Life history studies of Myzus persicae Sulzer. Pennsylvania Agriculture Experiment Station Bulletin 418:1-64.

Hu, J.S. and Vinson, S.B. 2000. Interaction between the larval endoparasitoids Campoletis sonorensis (Hymenoptera: Ichneumonidae) and its host the tobacco budworm (Lepidoptera: Noctuidae). Annals of the Entomological Society of America 93:220-224.

Isenhour, D.J. 1988. Interactions between two hymenopterous parasitoids of the fall armyworm (Lepidoptera: Noctuidae). Environmental Entomology 17:616-620.

278

Jones, D., Wache, S. 1998. Preultimate 4th/5th instar Trichoplusia ni naturally-injected with venom/calyx fluid from Chelonus curvimaculatus precociously metamorphose, rather than obey the metamorphic size threshold that would normally compel molting to a 5th/6th instar. Journal of Insect Physiology 44:755- 765.

Jourdie, V., Alvarez, N. and Turlings, T.C.J. 2008. Identification of seven species of hymenopteran parasitoid of Spodoptera frugiperda, using polymerase chain reaction amplification and restriction enzyme digestion. Agricultural and Forest Entomology 10:129-136.

Karowe, D.N. and Schoonhoven, L.M. 1992. Interactions among three trophic levels: the influence of host plant on performance of Pieris brassicae and its parasitoid, Cotesia glomerata. Entomologia Experimentalis et Applicata 62:241-251.

Kim, S. and Lim U.T. 2010. Seasonal occurrence pattern and within-plant egg distribution of bean bug Riptortus pedestris (Fabricius) (Hemiptera: Alydidae), and its egg parasitoid in soybean fields. Applied Entomology and Zoology 45:457-464.

King, E.G., Powell, J.E. and Coleman, R.J. 1985. A high incidence of parasitism of Heliothis spp. (Lep. Noctuidae) larvae in cotton in southeastern Arkansas. Entomophaga 30:419-426.

Krause, S.C., Fuester, R.W. and Burbutis, P.P. 1990. Competitive interactios between Cotesia melanoscelus and Glyptapanteles flavicoxis (Hymenoptera: Braconidae): implications for biological control of gypsy moth (Lepidoptera: Lymantriidae). Environmental Entomology 19:1543-1546.

Leveque, L., Monge, J-P., Rojas-Rousse, D., Van Alebeek, F. and Huignard, J. 1993. Analysis of multiparasitism by Eupelmus vuilleti (Craw) (Eupelmidae) and Dinarmus basalis (Rond) (Pteromalidae) in the presence of one of their common hosts, Bruchidius atrolineatus (Pic) (Coleoptera Bruchidae). Oecologia 94:272- 277.

Lohr, B., Varela, A.M. and Santos, B. 1990. Exploration for natural enemies of the cassava mealybug, Phenacoccus manihoti (Homoptera: Pseudococcidae), in South America for the biological control of this introduced pest in Africa. Bulletin of Entomological Research 80:417-425.

279

Lv, J., Wilson, L.T., Beuzelin, J.M., White, W.H., Reagan, T.E. and Way, M.O. 2011. Impact of Cotesia flavipes (Hymenoptera: Braconidae) as an augmentative biocontrol agent for the sugarcane borer (Lepidoptera: Crambidae) on rice. Biological Control 56:159-169.

MacGillivary, M.E. and Anderson G.B. 1964. The effect of photoperiod and temperature on the production of gamic and agamic forms in Macrosiphum Euphorbiae (Thomas). Canadian Journal of Zoology 42:491-510.

Mailafiya, D.M., Le Ru, B.P., Kairu, E.W., Calatayud, P.A. and Dupas, S. 2009. Species diversity of lepidopteran stem borer parasites in cultivated and natural habitats in Kenya. Journal of Applied Entomology 133:416-429.

Mainali, B.P. and Lim U.T. 2012. Annual pattern of occurrence of Riptortus pedestris (Hemiptera: Alydidae) and its egg parasitoids Ooencyrtus nezarae Ishii and Gryon japonicum (Ashmead) in Andong, Korea. Crop Protection 36:37-42.

Manley, D.G., DuRant, J.A., Johnson, A.W., Roof, M.E. 1991. The tobacco budworm/bollworm complex (Lepidoptera: Noctuidae) and its parasites on field crops in South Carolina. Journal of Agricultural Entomology 8:169-178.

Mattiacci, L. and Dicke, M. 1995a. The parasitoid Cotesia glomerata (Hymenoptera: Braconidae) discriminates between first and fifth larval instars of its hosts, Pieris brassicae, on the basis of contract cues from frass, silk, and herbivore-damanged leaf tissue. Journal of Insect Behavior 8:485-498.

Mattiacci, L. and Dicke, M. 1995b. Host-age discrimination during host location by Cotesia glomerata, a larval parasitoid of Pieris brassicae. Entomologia Experimentalis et Applicata 76:37-48.

McManus, M., Schneeberger, N. Reardon, R. and Mason, G. 1992. Gypsy Moth. Forest Insect & Disease Leaflet 162. U.S. Department of Argiculture Forest Service.

Mitsui, H., Achterberg, K.V., Hordlander, G. and Kumura, M.T. 2007. Geographical distributions and host associations of larval parasitoids of frugivoruous Drosophilidae in Japan. Journal of Natural History 41:25-28.

280

Mohamad, R., Monge J-P. and Goubault, M. 2011. Agonistic interactions and their implications for parasitoid species coexistence. Behavioral Ecology 22:1114- 1122.

Moran, N.A. 1992. The evolution of aphid life cycles. Annual Review of Entomology 37:321-348.

Muli, B.K., Schulthess, F., Maranga, R.O., Kutima, H.L. and Jiang, N. 2006. Interspecific competition between Xanthopiimpla stemmator Thunberg and Dentichasmias busseolae Heinrich (Hymenoptera: Ichneumonidae), pupal parasitoids attacking Chilo partellus (Lepidoptera: Crambidae) in East Africa. Biological Control 36:163-170.

Muturi, J.J., Ngi-Song, A.J., Mueke, J.M., Setamou, M., Schulthess, F. and Jiang, N. 2006. Multiparasitism by the pupal parasitoids, Xanthopimpla stemmator (Hymenoptera: Ichneumonidae) and Pediobius furvus (Hymenoptera: Eulophidae) on two African cereal stemborers, Chilo partellus (Lepidoptera: Crambidae) and Busseola fusca (Lepidoptera: Noctuidae). Biocontrol Science and Technology 16:49-60.

Ndemah, R. 1999. Towards developing an integrated crop management strategy for the African stalk borer, Busseola fusca (Fuller) (Lepidoptera: Noctuidae) in maize systems in Cameroon. Ph.D. thesis. Hannover University.

Neunzig, H.H. 1969. The biology of the tobacco budworm and the corm earworm in North Carolina. North Carolina Agricultural Experimental Research Station Technical Bulletin 196.

Obonyo, D.N., Love, G.L., Songa, J.M., Oyieke, F.A., Mugo, S.N. and Nyamasyo, G.H.N. 2008. Developmental and mortality responses of Chilo partellus Swinhoe (Lepidoptera: Crambidae) and Sesamia calamistis Hampson (Lepidoptera: Noctuidae) following partial feeding on Bt-transgenic maize. Journal of Applied Biosciences 11:554-563.

Pair, S.D., Laster, M.L. and Martin, D.F. 1982. Parasitoids of Heliothis spp. (Lepidoptera: Noctuidae) larvae in Mississippi associated with Sesame interplantings in Cottom, 1971-1974: implications for host-habitat interactions. Environmental Entomology 11:509-512.

Pair, S.D., Raulston, J.R., Sparks, A.N. and Martin, P.B. 1986a. Fall armyworm (Lepidoptera: Noctuidae) parasitoids: differential spring distribution and incidence on corn and sorghum in the southern United States and northeastern Mexico. Environmental Entomology 15:342-348.

281

Pair, S.D., Wiseman, B.R. and Sparks, A.N. 1986b. Influence of four corn cultivars on fall armyworm (Lepidoptera: Noctuidae) establishment and parasitization. The Florida Entomologist 69:566-570.

Pedata, P.A., Giorgini, M. and Guerrieri E. 2002. Interspecific host discrimination and within-host competition between Encarsia formosa and E. pergandiella (Hymenoptera: Aphelinidae), two endoparasitoids of whiteflies (Hemiptera: Aleyrodidae). Bulletin of Entomological Research 92:521-528. Persad, A.B. and Hoy, M.A. 2003. Intra- and interspecific interactions between Lysiphlebus testaceipes and Lipolexis scutellaris (Hymenoptera: Aphidiidae) reared on Toxoptera citricidae Homoptera: Aphididae). Journal of Economic Entomology 96:564-569.

Pijls, J.W.A.M., Hofker, K.D., Van Staalduinen M.J. and Van Alphen, J.J.M. 1995. Ecological Entomology 20:326-332.

Powell, J.E. 1988. Development of Heliothis virescens (Lepidoptera: Noctuidae) larvae after parasitization by Microplitis croceipes and Microplitis demolitor (Hymenoptea: Braconidae). The Florida Entomologist 71:370-374.

Pschorn-Walcher, H. 1971. Experiments of inter-specific competition between three species of Tachinids attacking the sugar cane moth borer, Diatraea saccharalis (F.). Entomophaga 16:125-131.

Rehman, A. and Powell, W. 2010. Host selection behaviour of aphid parasitoids (Aphidiidae: Hymenoptera). Journal of Plant Breeding and Crop Science 2:299- 311.

Reineke, A., Roberts, H.L.S. and Schmidt, O. 2004. Two coexisting lines of the endoparasitoid Venturia canescens show differences in reproductive success under conspeific superparasitism. Journal of Insect Physiology 50:167-173.

Reitz, S. 1995. Superparasitism and intraspecific competition by the solitary larval-pupal parasitoid Archytas marmoratus (Diptera: Tachinidae). The Florida Entomologist 78:578-585.

Richards, O.W. 1940. The biology of the small white butterfly (Pieres rapae), with special reference to the factors controlling its abundance. Journal of Animal Ecology 9:243-288.

Riggin, T.M., Espelie, K.E., Wiseman, B.R. and Isenhour, D.J. 1993. Distribution of fall armyworm (Lepidoptera: Noctuidae) parasitoids on five corn genotypes in south Georgia. The Florida Entomologist 76:292-302.

282

Riley, D.G. and Ciomperlik M.A. 1997. Regional population dynamics of whitefly (Homoptera: Aleyrodidae) and associated parasitoids (Hymenoptera: Aphelinidae). Environmental Entomology 26:1049-1055.

Sallam, M.N., Overholt, W.A. and Kairu E. 2010. Intraspecific and interspecific competition between Cotesia flavipes and Cotesia sesamiae (Hymenoptera: Braconidae), gregarious larval endoparasitoids of Lepidopteran stemborers. Biocontrol Science and Technology 12:493-506.

Santos, L.M., Redaelli, L.R., Diefenbach, L.M.G. and Efrom, C.F.S. 2003. Larval and pupal stage of Spodoptera frugiperda (J.E. Smith) (Lepidopetera: Noctuidae) in sweet and field corn genotypes. Brazilian Journal of Bilogy 63:627-633.

Schuster, D.J., Evans, G.A., Bennett, F.D., Stansly, P.A., Jansson, R.K,, Leibee, G.L. and Webb S.E. 1998. A survey of parasitoids of Bemisia spp. whiteflies in Florida, the Caribbean, and Central and South America. International Journal of Pest Management 44:255-260.

Sertkaya, E., Bayram, A. and Kornosor, S. 2004. Egg and larval parasitoids of the Beet Armyworm Spodoptera exigua on maize in Turkey. Phytoparasitica 32:305-312.

Sequeira, R. and Mackauer, M. 1994. Variation in selected life-history parameters of the parasitoid wasp, Aphidius ervi: influence of host developmental stage. Entomologia Experimentalis et Applicata 71:15-22.

Shands, W.A., Simpson, G.W. and Wave, H.E. 1972a. Seasonal population trends and productiveness of the potato aphid on swamp rose in Northeastern Maine. Technical Bulletins of the Maine Agricultural and Forest Experiment Station. TB52. 38 pgs.

Shands, W.A., Simpson, G.W., Wave, H.E. and Gordon, C.C. 1972b. Importance of arthropod predators in controlling aphids on potatoes in northeastern Maine. University of Maine at Orono Technial Bulletin 54. 50 pgs.

Shi, Z., Li, Q., Li, X., Liu, S. 2001. Interspecific competition between Diadegma semiclausum and Oomyzus sokolowskii, parasitoids of diamondback moth, Plutella xylostella. In: The Management of the Diamonback Moth and other Crucifer Pests (eds. N. Endersby and P.M. Ridland). Proceedings of the 4th International Workshop, Melbourne, Australia.

Sidney, L.A., Bueno, V.H.P., Lins J.C., Sampaio, M.V. and Silva, D.B. 2010. Larval competition between Aphidius ervi and Praon volucre (Hymenoptera: Braconidae: Aphidiinae) in Macrosiphum euphorbiae (Hemiptera: Aphididae). Environmental Entomology 39:1500-1505.

283

Songa, J.M., Overholt, W.A., Mueke, J.M. and Okello, R.O. 2001. Colonisation of Cotesia flavipes (Hymenoptera: Braconidae) in stemborers in the semi-arid eastern province of Kenya. International Journal of Tropical Insect Science 21:289-295,

Soteres, K.M., Berberet, R.C. and McNew, R.W. 1984a. Parasitic insects associated with Lepidopterous herbivores on Alfalfa in Oklahoma. Environmental Entomology 13:787-793.

Soteres, K.M., Berberet, R.C. and McNew, R.W. 1984b. Parasites of larval Euxoa auxiliaries (Grote) and Peridroma saucia (Hubner) (Lepidoptera: Noctuidae) in Alfalfa fields in Oklahoma. Journal of the Kansas Entomological Society 57:63- 68.

Stadelbacher, E.A., Powell, J.E. and King, E.G. Parasitism of Heliothis zea and H. virescens (Lepidoptera: Noctuidae) larvae in wild and cultivated host plants in the delta of Mississippi. Environmental Entomology 15:1167-1172.

Steinberg, S., Podoler, H. and Rosen D. 1987. Competition between two parasities of the Florida res scale in Israel. Ecological Entomology 12:299-310.

Stone, J.D., Pedigo, L.P. 1972. Development and economic-injury level of the green cloverworm on Soybean in Iowa. Journal of Economic Entomology 65:197-201.

Strand, M.R. 1990. Characterization of larval development in Pseudoplusia includes (Walker) (Lepidoptera: Noctuidae). Annals of the Entomological Society of America 83:538-544.

Tabuchi, K., Moriya, S. and Ishizaki, M. 2007. Locomotion ability variation among instars of the bean bug Riptortus pedestris (Fabricius) (Heteroptera: Alydidae) nymphs. Environmental Entomology 36:871-877.

Talekar, N.S. and Shelton, A.M. 1993. Biology, ecology, and management of the diamondback moth. Annual Review of Entomology 38:275-301.

Talekar, N.S. and Hu, W.J. 1996. Characteristics of parasitism of Plutella xylostella (Lep., Plutellidae) by Oomyzus sokolowskii (Hym., Eulophidae). Entomophaga 41:45-42.

Thompson, S.N. 1986. Nutrition and in vitro culture of insect parasitoids. Annual Review of Entomology 31:197-219.

284

Tillman, P.G. and Powell, J.E. 1989. Comparison of acceptance of larval instars of the tobacco budworm (Lepidoptera: Noctuidae) by Microplitis croceipes, Microplitis demolitor, Cotesia kazak (Hymenoptera: Braconidae), and Hyposoter didymator (Hymenoptera: Ichneumonidae). Journal of Agricultural Entomology 6:201-209.

Tillman, P.G. and Powell, J.E. 1992. Interspecific discrimination and larval competition among Microplitis crocepies, Microplitis demolitor, Cotesia kazak (Hym.: Braconidae), and Hyposoter didymator (Hym.: Ichneumonidae), parasitoids of Heliothis virescens (Lep.: Noctuidae). Entomophaga 37:439-451.

Torres-Vila, L.M., Rodriguez-Molina, M.C., Palo, E. and Del Estal, P.L. 2000. The parasitoid complex of Helicoverpa armigera Hb. On tomatoes in Vegas del Guadiana plains. Doletin de Sanidad Vegetal, Plagas 26;323-333.

Ueno, T. 1999. Multiparasitism and host feeding by solitary parasitoid wasps (Hymenoptera: Ichneumonidae) based on the pay-off from parasitized hosts. Annals of the Entomological Society of America 92:601-608.

Vinson S.B. and Ables J.R. 1980. Interspecific competition among endoparasitoids of Tobacco Budworm larvae (Lep.: Noctuidae). Entomophaga 25:357-362.

Walker, A.M. and Hoy, M.A. 2003. Responses of Lipolexis oregmae (Hymenoptera: Aphidiidae) to different instars of Toxoptera citricida (Homoptera: Aphididae). Journal of Economic Entomology 96:1685-1692.

Wallner, W.E., Weseloh, R.M. and Grinberg, P.S. 1982. Intrinsic competition between Apanteles melanoscelus (Hym.: Braconidae) and Rogas lymantriae (Hym.: Braconidae) reared on Lymantria dispar (Lep.: Lymantriidae). Entomophaga 27:99-103.

Weir, E.H. and Sagarzazu, L. 1998. Interspecific competition between Matagonystilum minense (Diptera: Tachninidae) and Cotesia flavipes (Hymenoptera: Braconidae) parasitoids of surgarcane borers (Diatraea spp., Lepidoptera:Pyralidae). Revista de Biologia Tropical 46:1135-1139.

Weir, E.H., Contreras, W. and Gil de Weir, K.2007. Biological control of Diatraea spp. (Lepidoptera: Pyralidae) in sugarcane crops in Central Venezuela. Revista de Biologia Tropical 55:655-658.

Wyckhuys, K.A.G. and O’Neil, R.J. 2006. Population dynamics of Spodoptera frugiperda Smith (Lepidoptera: Noctuidae) and associated natural enemies in Honduran subsistence maize. Crop Protection 25:1180-1190.

285

Wylie, H.G. 1972. Larval competition among three hymenopterous parasite species on multiparasitized housefly (Diptera: Muscidae) pupae. The Canadian Entomologist 104:1181-1190.

286