One Generalist Or Several Specialist Species?

Home , Cyrtophora, Cyrtophorinae, Ephialtini, Eruga, Parasitoid, Sinarachna

4 Article type : Original Article

7 AID: 12307

8 9 ED: Karsten Schonrogge 10 AE: Gavin Broad 11 12 One generalist or several specialist species? Wide host range and diverse manipulations of 13 the hosts’ web building behaviour in the true spider parasitoid Zatypota kauros 14 (Hymenoptera: Ichneumonidae) 15 16 Running title: One generalist or several specialist species? 17 18 Stanislav Korenko*1, Tamara Spasojevic2,3, Stano Pekár4, Gimme. H. Walter5, Vlasta 19 Korenková6, Kateřina Hamouzová1, Michaela Kolářová1, Kristýna Kysilková1, Seraina 20 Klopfstein2,3 21 22 1 Department of Agroecology and Biometeorology, Faculty of Agrobiology, Food and Natural 23 Resources, Czech University of Life Sciences Prague, Kamýcká 129, 165 21 Prague 6, Suchdol, 24 Czech Republic 25 2 Naturhistorisches Museum Bern, Abteilung Wirbellose Tiere, Bernastr. 15, CH-3005 Bern, 26 Switzerland 3 27 Institute of EcologyAuthor Manuscript and Evolution, University of Bern, Baltzerstr. 6, CH-3012 Bern, 28 Switzerland

This is the author manuscript accepted for publication and has undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/icad.12307

This article is protected by copyright. All rights reserved 29 4 Department of Botany and Zoology, Faculty of Science, Masaryk University, Kotlářská 2, 30 611 37 Brno, Czech Republic 31 5 School of Biological Sciences, The University of Queensland, Brisbane QLD 4072, Australia 32 6 Institute of Biotechnology, Academy of Sciences of the Czech Republic, Vídeňská 1083, 142 33 20 Praha 4, Prague, Czech Republic 34 * Corresponding author: [email protected] 35 Abstract 36 1. Parasitoid wasps of the Polysphincta genus-group are highly specialised on their spider 37 hosts, and most of them are known to manipulate their hosts into building a special web in 38 which the parasitoid pupates. Trophic niche and the plasticity of host use were investigated 39 in the koinobiont parasitoid Zatypota kauros Gauld from Queensland, Australia. 40 2. We found that Z. kauros attacks spider hosts from different families, each differing widely 41 in their web-building behaviours, which makes it unique in the breadth of its host range. 42 Molecular analyses revealed that the taxon Zatypota kauros contains three divergent 43 mitochondrial lineages. Lineage A was associated exclusively with spiders of the genus 44 Anelosimus (Theridiidae), which builds tangle webs; lineage B was associated with the genus 45 Cyrtophora (Araneidae), which weaves tent webs; and lineage C was associated with a broad 46 range of hosts, including spiders of both the families Araneidae and Theridiidae. Unique host 47 manipulations could be observed in the web-building behaviours of the different host 48 groups. However, nuclear data from two ribosomal genes and three introns did not add any 49 support to the existence of different evolutionary lineages, nor did they coincide with the 50 different host groups. 51 3. The partial correspondence of mitochondrial lineage and host use, together with an 52 apparent mito-nuclear conflict might indicate maternal effects or very recent and/or 53 incomplete speciation in this taxon. Given their wide host range and intriguing interactions 54 with their hosts, the Z. kauros complex represents a promising system for studying parasitoid 55 specialization and its potential impact on speciation. 56

57 Keywords: behaviouralAuthor Manuscript manipulation – co-evolution – interactions – koinobionts – speciation 58 – silk– wasp – web architecture 59 60 Introduction

This article is protected by copyright. All rights reserved 61 Understanding speciation is a major goal of evolutionary ecologists, but the processes 62 driving it remain poorly understood in most groups. This is also the case in insect parasitoids, 63 which have received only limited attention in speciation research (but see, e.g., Shaw, 2002; 64 Forbes et al., 2009; König et al., 2015), despite them constituting more than 5% of all 65 described species of multicellular organisms (Vié et al., 2009; Aguiar et al., 2013). Applying 66 ecological speciation theory (Schluter, 2009) to parasitoids, one would assume that the 67 major mechanisms associated with speciation are shifts in host-ranges and/or in the degree 68 of specialisation (e.g., Shaw, 2002). Unfortunately, detailed studies of the evolution of host 69 ranges in parasitoids are hampered by a lack of knowledge on the phylogeny of closely- 70 related species and on their host relations (even though there are notable exceptions, e.g., 71 (Shaw & Horstmann, 1997; Kankare et al., 2005; Tschopp et al., 2013). 72 The order Hymenoptera contains the most diversified parasitoids, both taxonomically 73 and ecologically (Eggleton & Belshaw, 1992). Some parasitoid species have been reported to 74 have wide host ranges which encompass insects or spiders from different families or even 75 orders, while other groups are much more specialized and have rather narrow host ranges 76 (Godfray, 1994, Yu et al., 2012). As a rule of thumb, the longer-lasting the association 77 between a parasitoid larva and its host, the higher the degree of specialization: species that 78 allow their hosts to continue their development, so-called koinobionts, tend to be more 79 specialized than idiobionts, which stop host development at the time of parasitization 80 (Althoff, 2003). 81 The Polysphincta genus-group (sensu Gauld & Dubois, 2006) (Ichneumonidae, 82 Pimplinae, Ephialtini) consists exclusively of koinobiont ectoparasitoids of spiders. Female 83 wasps of this group attach their eggs externally onto the opisthosoma or prosoma of spiders, 84 where the larvae manage to remain through several moult cycles of their hosts (Nielsen, 85 1923; Eberhard, 2000; Korenko et al., 2014). This strategy probably evolved from species 86 that feed, as larvae, on spider eggs, and the transition from egg mass scavengers to true 87 parasitoids of spiders probably occurred in a species that attacked the female of a hunter 88 spider species guarding its egg sac (Dubois et al., 2002; Gauld et al., 2002; Matsumoto,

89 2016). Author Manuscript 90 Polysphinctines are described as highly host-specific (e.g. Fitton et al., 1987; 91 Matsumoto, 2016) and exhibit a unique mode of host utilisation, including complex 92 behavioural repertoires (e.g. Eberhard, 2000; Matsumoto, 2009; Takasuka et al., 2017;

This article is protected by copyright. All rights reserved 93 Messas et al. 2017; Korenko et al., 2018). Behavioural adaptations such as host manipulation 94 probably evolved through intimate interaction with the host behaviour and presumably 95 resulted in the restricted host ranges and high specificity of mutual interaction between 96 parasitoids and their spider hosts. Even though polysphinctines as a whole are associated 97 with spiders from different taxonomic groups utilizing different foraging techniques, the host 98 spectrum of a particular wasp species is usually restricted to a small group of taxonomically 99 closely-related species with similar behaviours. In all the species for which sufficient data are 100 available, the hosts always belong strictly to a single family (Fitton et al., 1987; Korenko et 101 al., 2011). The only exception is the recently studied Hymenoepimecis japi Loffredo & 102 Penteado-Dias, which is associated with orb-web building spiders from two families 103 (Araneidae and Tetragnathidae) (Messas et al., 2017). 104 The final instar larvae of polysphinctines have evolved an ability to manipulate the 105 web-spinning behaviour of the spider host shortly before the wasp pupates. They cause the 106 spider to construct a modified web structure enabling the wasp pupa to complete its 107 development in safe conditions (Kloss et al., 2016). Two different strategies can be 108 identified. In the first, the spider host is forced to build an additional or completely new, 109 three-dimensional silk barrier as a shelter for the wasp pupa (Matsumoto, 2009; Korenko & 110 Pekár, 2011; Korenko, et al., 2014). In the second, the manipulated spider reduces the 111 normal web to a simple and sparse, but strong silk construction (Eberhard, 2000; Eberhard, 112 2001; Korenko et al., 2015a; Kloss et al., 2016; Takasuka et al., 2015, 2017). These 113 modifications of the web structure into a more persistent cocoon web ascertain that the 114 wasp can pupate safely after the spider’s death (e.g. Kloss et al. 2016; Takasuka et al., 2015). 115 The type of behavioural manipulation in the spider host varies among groups and has to be

116 seen in connection to the spiders’ normal web building behaviour (e.g. Gonzaga et al., 2015). 117 Several studies have described behavioural manipulations of web-building spiders by 118 polysphinctine parasitoids from all over the world (Eberhard, 2000; Gonzaga et al., 2015; 119 Matsumoto, 2009; Korenko & Pekár, 2011; Korenko, 2016; Kloss et al., 2016; Takasuka et al., 120 2015, 2017). However, no such study was ever conducted in Australia, where 18 species of

121 the Polysphincta genusAuthor Manuscript -group have been reported to occur (Gauld, 1984). Certainly, this 122 number will increase given that several undescribed species are already known. Until now, 123 nothing was known about their ecology, including host association and behaviour. Here, we 124 describe for the first time host-parasitoid interactions in Zatypota kauros Gauld, an endemic

This article is protected by copyright. All rights reserved 125 species in Australia. We focus on the host range of this parasitoid and on the behavioural 126 manipulations induced by the final instar larvae in their spider hosts, and find surprising 127 variability in both. By a combination of behavioural and molecular analyses, we investigate 128 whether the taxon currently known as Z. kauros represents a single, polyphagous and 129 behaviourally plastic species, or whether it constitutes a complex of more specialized 130 lineages. 131 132 Materials and methods 133 Field sampling 134 The host spectrum of Z. kauros, i.e. the range of potentially and actually parasitised hosts, 135 was surveyed in bushes (between 40 and 200 cm above ground) at two suburban sites in 136 Brisbane (Queensland, Australia): Gaythorne (bushland with dominant Eucalyptus spp. close 137 to residential areas, 27°25'25’S, 152°57'30’E) and Enoggera (bushland on the banks of a 138 small creek – Ferguson Park, 27°25'12’S, 152°59'19’E). As other Zatypota species are known 139 to be associated with tangle-web building spiders from the families Theridiidae and 140 Dictynidae (e.g. Fitton et al., 1987; Korenko et al., 2011; Korenko, 2017) and with sheet web 141 builders from the families Linyphiidae (Matsumoto & Takasuka, 2010) and Araneidae 142 (Korenko et al., 2015b), all aerial web building spider species were considered as potential 143 hosts of Z. kauros. Seventeen one-day excursions were conducted once a week between the 144 beginning of July and the end of October 2013. The collected spiders were identified to 145 family and genus with the aid of Agnarsson (2012); Agnarsson et al. (2006); Jocqué & 146 Dippenaar-Schoeman (2007) and Whyte & Anderson (2017). All collected spiders were 147 inspected under a hand lens for the presence of parasitoids. The parasitism rate was defined 148 as the proportion of parasitised spiders in the population at a given time. All parasitised (N = 149 60) and some unparasitised spiders (N = 25) were taken to the laboratory for further 150 examination and for the rearing of parasitoids to adulthood. Parasitoid wasps were 151 identified using the key devised by (Gauld, 1984). All reared wasps were morphologically Z. 152 kauros sensu (Gauld, 1984) (N = 43). An initial morphological investigation (SKl and Kees

153 Zwakhals, personalAuthor Manuscript communication) found no clear morphological differences among either 154 larvae or wasps reared from different spider hosts. The colouration of adult wasps was 155 highly variable, as was already noted in the original description (Gauld, 1984). Voucher 156 specimens of spiders and wasps are deposited in the collections of Kees Zwakhals (Arkel, The

This article is protected by copyright. All rights reserved 157 Netherlands) and at the Department of Agroecology and Biometeorology, CULS (Prague, 158 Czech Republic). The body length (prosoma + ophistosoma) of both unparasitised and 159 parasitised spiders was measured using an ocular ruler in a stereomicroscope. 160 161 Molecular methods 162 Genomic DNA was isolated from the hind legs of 26 Z. kauros individuals from different hosts 163 and from 14 specimens of other Zatypota species (collected in various parts of the world, 164 see Additional file 1) and preserved in 90% ethanol using the PrepGEM DNA isolation kit for 165 insects (ZyGEM) or the Qiagen QIAamp DNA Micro kit (Qiagen) according to the 166 manufacturers’ instructions. Prior to isolation, the legs were cut into small pieces. 167 Polymerase chain reaction (PCR) was performed using primers for the 5’ portion of the 168 mitochondrial cytochrome c oxidase subunit I (COI) gene (Table 1). Given the potential for 169 the existence of several cryptic species in Zatypota kauros indicated by the mitochondrial 170 results, we also investigated nuclear diversity in a subset of specimens from each 171 mitochondrial lineage. Unfortunately, we only had workable extractions left from a handful 172 of specimens. We first targeted the ribosomal RNA genes 28S and ITS2, which both proved 173 largely uninformative. We thus used transcriptome data from ten ichneumonid wasps to 174 develop primers for introns in protein-coding genes, using preliminary sequences of 175 Zatypota kauros specimens as a target. These are the first intron markers to be used for 176 species delimitation in this family (Table 1, gene names according to the annotation of the 177 Nasonia genome, OGS2: Rago et al. 2016). As intron markers are difficult to align between 178 different species, we did not use any outgroup sequences but instead rooted the trees on an 179 arbitrarily chosen branch. 180 PCR reactions either contained 8 µl DNA sample, 0.2 µl Phusion Hot Start II DNA 181 Polymerase, 2 µl 10 uM primer (final concentration 1000 nM), 4 µl 5x Phusion HF Buffer, 0.4 182 µl 10 nM dNTPs and 5.4 µl RNAse free water (for most of the COI amplifications), or 1.5 µl 183 DNA, 12.5 µl of GoTaq® Green Hot Start Master Mix, 2 µl primer (10μM), and 6.5 µl nuclease 184 free water (for ITS2, 28S, introns, and some of the COI amplifications) The primer annealing

185 temperatures usedAuthor Manuscript for the PCR temperature protocol are given in Table 1. PCR products 186 were either purified using the Zymoclean Gel DNA Recovery Kit (Zymo Research) and 187 sequenced on an ABI Prism 310 automated sequencer using Big Dye Terminator technology 188 (Applied Biosystems), or directly submitted for sequencing to LGC Genomics (Berlin). The

This article is protected by copyright. All rights reserved 189 sequences have been deposited in GenBank under accession nos. KU904368 – KU904393 190 (Supplementary Table S1). 191 Additional sequences of Zatypota and outgroup species were downloaded from 192 Genbank and from the BOLD database. All COI sequences were aligned with MUSCLE (Edgar, 193 2004) after translation into amino acids using Mega 6.06 (Tamura et al., 2013). Alignment 194 was straightforward because no indels were detected. The alignment can be downloaded 195 from TreeBASE (Gen Bank accession numbers: MF085406-MF085443). Uncorrected pairwise 196 distances (p-distances) were calculated in Mega 6.06 with pair-wise deletion. 197 Phylogenetic analyses were performed under a Bayesian approach in MrBayes 3.2.2 198 (Ronquist et al., 2012). We used a “mixed” substitution model (integrating over the GTR 199 model space; Huelsenbeck et al., 2004) and gamma-distributed among-site rate variation, 200 including a proportion of invariant sites. For the COI gene, separate substitution models 201 were included for the combined first and second codon positions versus the third codon 202 positions. Four independent MCMC runs with one cold and three heated chains were 203 conducted for 10,000,000 generations and sampled every 1,000th generation. As a 204 conservative burn-in, we used half of the generations. Convergence was judged from the 205 average standard deviation of split frequencies (ASDSF) for the topology parameter and from 206 the potential scale reduction factor (PSRF) for the scalar parameters (ASDSF < 0.005, PSRF < 207 1.001 for all parameters). All analyses were run on the University of Bern Linux Cluster 208 UBELIX. 209 210 Laboratory study of web-building manipulation 211 The web-building behaviour of parasitised and unparasitised spiders was studied in the 212 laboratory. "Cocoon web" refers to the unique web built by the spider host under the 213 manipulation of the final instar larva, while we denote “normal web” as referring to the web 214 built by unparasitised spiders. Spiders were placed individually in experimental arenas (with 215 a base area of at least 100 x 100 mm and a height of 130 mm) with an installed twig or frame 216 providing support for the web. They were kept at room temperature (22 ± 3°C) and under

217 natural light, and fedAuthor Manuscript with a surplus of fruit flies (Drosophila melanogaster Meigen) and 218 various insects collected in the field. The architecture of the webs built by parasitised spiders 219 was recorded on video until the larva killed and consumed the spider and pupated. Spider 220 parasitoids were allowed to pupate in the cocoon web and were kept at room temperature

This article is protected by copyright. All rights reserved 221 for the next two weeks to allow the adult wasps to emerge. Forty-three of the 60 parasitised 222 specimens emerged as adult wasps; they were killed in 90% ethanol for further analysis. The 223 web architecture of unparasitised spiders was observed for at least two weeks as a control 224 (N = 5 to 20 per spider species). The web-building behaviour of both unparasitised and 225 parasitised spiders was recorded using a Canon EOS 500 digital camera with an EF-S 18-55 226 mm lens or a macro lens EF 100 mm f/2,8L IS USM. 227 228 Results 229 Parasitization in the field 230 Numerous juvenile and adult web-building spiders (N = 1,557) were collected individually by 231 carefully searching bush branches, and 1,446 were identified as potential hosts of Z. kauros 232 (spiders from families known to be accepted as hosts by other species of Zatypota). Of these, 233 60 juvenile spiders were parasitised by Z. kauros (Table 2). They belonged to five different 234 species from three different subfamilies of Araneidae (Araneinae, Cyrtophorinae and 235 Nephilinae) and from the family Theridiidae. The body lengths of Z. kauros hosts were on 236 average 2.55 mm (SD = 0.28, N = 60, Table 2). 237 238 Molecular analyses 239 To investigate whether the observed broad host range is indeed realized by a single species, 240 we examined mitochondrial and nuclear diversity in the parasitoids. Both phylogenetic 241 analysis and the pairwise distances of the mitochondrial data partition suggest that the 242 taxon currently known as Z. kauros consists of a complex of two or three putative species, 243 lineages A, B and C (Fig. 1). Lineages B and C might or might not constitute a monophyletic 244 clade; the COI analysis is ambiguous in this question, as the European species Zatypota 245 picticollis (Thomson) clusters with B, but with low support (especially from the maximum 246 likelihood analysis). Pairwise distances between lineage A on the one hand and lineages B 247 and C on the other ranged from 1.7 - 4.3%, while B and C were separated by 2.3 – 3.2%. 248 Intra-lineage distances were considerably smaller (maximum 0.6% within A, 0.3% in B, 0.8%

249 in C). The distancesAuthor Manuscript between the three lineages were in general larger than the distances 250 between lineages B and C and the European species Z. picticollis (2.1-2.6% and 2.3-3.2%, 251 respectively). The nuclear data from five different markers mostly proved inconclusive (Fig. 252 2), and the three mitochondrial lineages were not recovered in any of the gene trees. All

This article is protected by copyright. All rights reserved 253 markers including the introns showed very low variability (1–3 variable sites in the introns, 254 and three indels in one of the introns), and many of the variable positions appeared as 255 heterozygous in one or both lineages, indicating either standing variation or gene flow 256 (Additional file 2). 257 258 Host associations per lineage and phenology 259 Lineage A wasps attacked exclusively juveniles or adults of tangle-web weavers from the 260 family Theridiidae, with the highest parasitism rate in July (Fig. 3) when most hosts were still 261 juvenile. In the following months, an increasing proportion of the observed theridiid spider 262 hosts were adult females protecting their egg sacs. In contrast, lineage B wasps attacked 263 only tent-web weavers from the subfamily Cyrtophorinae (family Araneidae), while lineage C 264 was reared from Theridiidae and three subfamilies of Araneidae (Araneinae, Cyrtophorinae, 265 Nephilinae). The most frequently parasitised spiders were those of the subfamilies 266 Araneinae and Cyrtophorinae from June to August and juvenile spiders of the subfamily 267 Nephilinae from September to October (Fig. 3). Our limited sampling even seems to suggest 268 that wasps of lineage C shift their host preferences according to seasonal changes in the 269 abundance of hosts of suitable body length (Fig. 4), although additional collection is needed 270 to confirm this observation. 271 272 Behavioural observations 273 We observed the web building behaviour of spiders and its manipulation by parasitoids in 58 274 parasitised spiders in the laboratory. Wasps of lineage A did not induce any observable 275 change in the web architecture of their tangle-web-weaving hosts (genus Anelosimus, 276 Theridiidae), as shown by comparison with the webs built by unparasitised spiders 277 (Additional file 3: Video 1) shelter in the centre, usually at the base of three twigs. 278 Parasitised Anelosimus hosts stayed in their shelters, where they died and were consumed, 279 and the parasitoid larvae invariably built their cocoons and pupated at the entrance of this 280 shelter (N = 19). We did not observe any obvious differences in thread density nor web

281 architecture betweenAuthor Manuscript parasitised and unparasitised hosts. 282 Parasitoids of lineage B attacked araneids of the subfamily Cyrtophorinae. In our 283 observations, Cyrtophora hirta L. Koch built a typical tent web with a horizontal sheet and a 284 funnel-like shelter at its centre, surrounded by a sparse, 3-dimensional (3D) tangle (Fig. 5A,

This article is protected by copyright. All rights reserved 285 Additional file 4: Video 2, s01). Under manipulation by the final-instar larva of the wasp, C. 286 hirta removed the horizontal sheet and all threads surrounding the shelter (Additional file 4: 287 Video 2, s04), and the wasp cocoon was invariably placed at the entrance of the shelter (N = 288 16, Figs 5A, B, Additional file 4: Video 2, s06). The tent-web building spider C. exanthematica 289 Doleschall also built a tent web consisting of a horizontal sheet and a 3D tangle, but without 290 a funnel shelter. Under manipulation by the parasitoid, it removed the horizontal sheet and 291 threads. The wasp cocoon was constructed within the sparse tangle, which remained in all 292 cases (N = 4). 293 The other araneid spiders (unidentified Araneinae) built a typical araneid orb-web 294 (Fig. 6A). Under manipulation by the wasp, they built unique webs consisting of a reduced 295 number of radial threads originating from the central hub, where the wasp cocoon was 296 attached perpendicularly to the plane of the web (N = 12, Fig. 6B). 297 Wasps of lineage C exhibited high plasticity in host utilisation and induced different 298 modifications in the web architecture of spiders from different families. Seven wasps were 299 found to attack Nephila plumipes Latreille, which built orb webs with sparse tangled threads 300 at both sides of the web plane (Fig. 6C). In five of the seven cases, the spider host completely 301 removed the web and built a 3D structure, in the centre of which the wasp placed its pupa, 302 the apical end of the cocoon directed towards the ground (Fig. 6D, Additional file 5: Video 3). 303 In one case, the web was only partially removed and a reduced number of radial threads 304 served as support for the parasitoid pupa, which was placed in a horizontal position on one 305 side of the centre of the orb web (Fig. 6E). It was similar in one spider host, which did not 306 alter the web at all (Fig. 6F) and the larva pupated in a small tangle at the edge of the orb 307 web attached to central hub of orb by basal end of cocoon. 308 309 Discussion 310 Host ranges in the Z. kauros complex and related species 311 Here, we present evidence that the taxon currently known as Z. kauros attacks a wide 312 variety of spider hosts and even induces a wide range of changes in their web-building

313 behaviours. These Author Manuscript results are surprising both with respect to the taxonomic width of the 314 host range and the diversity of host ecologies. The genus Zatypota includes more than 50 315 described species (Gauld & Dubois, 2006; Fritzén, 2010; Matsumoto & Takasuka, 2010; Yu et 316 al., 2012), and most of them are associated with a particular genus or a few related genera

This article is protected by copyright. All rights reserved 317 of spiders of the family Theridiidae, which build three-dimensional webs. There are only 318 three other Zatypota species that attack hosts from different spider families. The Japanese 319 species Z. sulcata is associated with the sheet-web weaving spider Turinyphia yunohamensis 320 from the family Linyphiidae (Matsumoto & Takasuka, 2010); the Holarctic Z. anomala attacks 321 cribellate tangle-web weaving spiders of the genus Dictyna in Europe (Korenko, 2017) and 322 the genus Mallos pallidus (Banks) in North America (Vincent, 1979), both from the family 323 Dictynidae; and the European Z. picticollis is associated with the orb-web weavers Mangora 324 acalypha (Walckenaer), Cyclosa conica (Pallas) and Zilla diodia (Walckenaer) from the family 325 Araneidae (Korenko, 2015b). 326 COI analyses (Fig. 2) suggest that Z. picticollis and Z. anomala are closely related to Z. 327 kauros (Z. sulcata has not yet been sequenced). The morphological phylogeny provided by 328 (Gauld & Dubois, 2006) also grouped Z. kauros with Z. anomala (but did not include the 329 other species in question). And finally, Matsumoto & Takasuka (2010) mention that the 330 Japanese species Z. sulcata is closely related to Z. kauros in morphology. This species group 331 within the genus Zatypota thus seems to have switched to hosts of different families, many 332 of which build different web types from the hosts of the other Zatypota species. If this is the 333 case, then the evolution of host ranges might proceed faster in this species group than in the 334 rest of the genus. 335 336 Host manipulation by wasps of the Z. kauros species complex 337 Several distinct forms of manipulation of the web building behaviour of spider hosts were 338 observed in Z. kauros and these manipulations seem to be host-specific. All web-building 339 manipulations that have been recorded so far in other species of the Polysphincta genus- 340 group have been found to be species-specific, with each wasp species typically causing one 341 particular alteration in the web-architecture of its host (e.g. Korenko & Pekár, 2011; Korenko 342 et al., 2014, 2015a,b, 2018; Messas et al., 2017; Sobczak et al., 2014), even though one 343 spider species is sometimes attacked by several parasitoid wasp species (Eberhard, 2013; 344 Gonzaga et al., 2010). The high plasticity in both host range and host manipulation in Z.

345 kauros is unusual andAuthor Manuscript might indicate a complex of several, more specialized cryptic species. 346 347 How many species does the Z. kauros complex contain?

This article is protected by copyright. All rights reserved 348 Our results from the study of host ranges, behavioural manipulations and COI all suggest 349 that there are at least two or three biological species within the taxon currently known as Z. 350 kauros, while the nuclear markers do not confirm this notion. Despite the integrative 351 approach we have taken here, the question whether this taxon consists of a single or several 352 independently evolving lineages thus cannot be answered yet. 353 On one hand, our COI results show distinct lineages with only partially overlapping 354 host-ranges. Lineages A and B are further apart from each other than B is from the European 355 species Z. picticollis, from which Z. kauros differs clearly in morphology (Gauld, 1984 vs. 356 Zwakhals, 2006). The pairwise distances between the lineages are typical for species-level 357 divergences in ichneumonid wasps (Quicke et al., 2012; Klopfstein, 2014) and could thus be 358 interpreted as indicative of several biological species in this group. If we assume that 359 substitution rates from other taxa can be taken as a reasonable guide (about 2.3 – 3.5 % 360 sequence divergence per million years; Brower, 1994; Papadopoulou et al., 2010), the three 361 lineages in Z. kauros would have diverged about half a million years ago – ample time to 362 evolve ecological differences (Hendry et al., 2007). The broad polyphagy and wide range of 363 host manipulations in lineage C might even point to additional diversity hidden within this 364 lineage. Several studies have used COI sequences to study parasitoid wasp diversity at the 365 species level, and many of them reported that species assumed to be polyphagous actually 366 represent complexes of more specialized, cryptic species (König et al., 2015; Smith et al., 367 2008); Z. kauros might have to be added to this list.) 368 On the other hand, the mitochondrial lineages could not be confirmed by any of the 369 nuclear markers studied here. We included ITS2, which has proven useful in previous studies 370 on species delimitation in ichneumonid wasps (Klopfstein, 2014; Klopfstein et al., 2016), and 371 we even developed new intron markers to study the nuclear diversity of the taxon. However, 372 the limited variation present in these markers did not follow any clearly discernible pattern 373 with respect to mitochondrial lineages or host groups. It remains unclear if these results are 374 indicative of gene flow between lineages and thus presence of a single biological species, or 375 if our nuclear data does not offer enough power to detect potential species due to low

376 marker variability andAuthor Manuscript the fact that only a small number of specimens could be studied. 377 An initial morphological investigation by specialists of the group (SKl and Kees 378 Zwakhals, personal communication) found no clear morphological characters that would 379 distinguish the mitochondrial lineages from each other, nor between specimens reared from

This article is protected by copyright. All rights reserved 380 the three host families. Colouration is highly variable in this taxon, as already noted in the 381 original description (Gauld, 1984), but it seems to co-vary at most partially with the 382 mitochondrial lineages or hosts. However, we cannot exclude that a more detailed, 383 quantitative study of the morphology of Z. kauros might reveal diagnostic characters. 384 385 Conclusions and future directions

386 In conclusion, the question of the number of species within the Z. kauros complex remains 387 unresolved. The only clear evidence for the presence of multiple species stems from 388 mitochondrial DNA, which is only maternally inherited and whose population biology can be 389 influenced by endosymbiontic bacteria (Hurst & Jiggins, 2005; Klopfstein et al., 2016); it thus 390 might not accurately reflect the species history. Z. kauros might thus represent a single 391 biological species, and the divergence in mtDNA could stem either from geographically 392 isolated population in the past, from introgression from other species, potentially via 393 endosymbionts (Klopfstein et al., 2016), or it might simply represent incompletely sorted 394 ancestral lineages. The partial correspondence of the mtDNA lineages with host choice could 395 then be explained by maternal effects or associative learning, such as post-emergence 396 imprinting. All these have been shown to play a role in host choice in other parasitoid groups 397 (Kester & Barbosa, 1991; Beltman & Metz, 2005; König et al., 2015). 398 Alternatively, Z. kauros represent a complex of well-differentiated biological species 399 which our nuclear data simply is not powerful enough to resolve. Recent genomic analyses 400 of closely related species have in any case demonstrated that even morphologically and 401 ecologically distinct species can be very difficult to diagnose with individual nuclear markers 402 (Nater et al., 2015). In Z. kauros, additional molecular data, such as microsatellites or even 403 full-genome sequence data from specimens reared from different hosts and populations will 404 be required to clarify the number of species present in this lineage. 405 Speciation in parasitoids is often accompanied by host shifts, although the exact 406 mechanisms and sequences of events often remain elusive (Shaw, 2002; Forbes et al., 2009; 407 König et al., 2015). Closely-related parasitoid species typically attack phylogenetically or at Author Manuscript 408 least ecologically similar hosts or even retain some overlap in their host ranges (Shaw, 1994; 409 Shaw, 2002). The Zatypota kauros complex is unique among koinobiont spider parasitoids in 410 that it attacks hosts of different, ecologically divergent families, some of which are tangle-

This article is protected by copyright. All rights reserved 411 web weavers, while others create orb-webs. As we show here, it manipulates them into 412 building a diverse array of special cocoon webs for the parasitoids to pupate in, a breadth of 413 behavioural repertoires not reported in any other parasitoid species. It remains to be shown 414 how changes in host choice, hunting behaviour, and physiological interactions with the host 415 concur in this system to create such ecological diversity, and how this diversity pertains to 416 molecular divergence and species status in these parasitoids. All these aspects make the Z. 417 kauros complex an intriguing and highly promising system for studying parasitoid host range 418 evolution and specialization and their effect on speciation. 419 420 Acknowledgements 421 The authors would like to thank colleagues from the University of Queensland and Czech 422 University of Life Sciences which assisted with data and sample collection. Kees Zwakhals 423 (Arkel, The Netherlands) kindly agreed to check several specimens of each lineage for 424 morphological differences. Calculations were performed on UBELIX 425 (http://www.id.unibe.ch/hpc), the HPC cluster at the University of Bern. This research was 426 supported by the Institutional Support Program for Long Term Conceptual Development of 427 Research Institutions provided by the Ministry of Education, Youth and Sports of the Czech 428 Republic. TS and SKl were supported by grant PZ00P3_154791 of the Swiss National Science 429 Foundation. VK was supported by CAS (RVO: 86652036), project Introduction of new 430 research methods to BIOCEV (CZ.1.05/2.1.00/19.0390) from the ERDF. 431 432 References 433 Agnarson, I. (2012) Systematics of new subsocial and solitary Australasian Anelosimus 434 species (Araneae: Theridiidae). Invertebrate Systematics, 26, 1–16. 435 Agnarson, I. & Zhang, J.X. (2006) New species of Anelosimus (Araneae: Theridiidae) from 436 Africa and Southeast Asia, with notes on sociality and color polymorphism. Zootaxa, 1147, 437 1–34. 438 Aguiar, A.P., Deans, A.R., Engel, M.S., Forshage, M., Huber, J.T., Jennings, J.T., Johnson,

439 N.F., Lelej, A.S., LonginoAuthor Manuscript , J.T., Lohrmann, V., Miko, I., Ohl, M., Rasmussen, C., Taeger, A. & Yu, 440 D.S. (2013) Order Hymenoptera. Zootaxa, 3703, 1–82. 441 Althoff, D.M. (2003) Does parasitoid attack strategy influence host specificity? A test with 442 New World braconids. Ecological Entomology, 28, 500–502.

This article is protected by copyright. All rights reserved 443 Beltman, J.B. & Metz, J.A. (2005) Speciation: more likely through a genetic or through a 444 learned habitat preference? Proceedings of the Royal Society B, 272, 1455–63. 445 Brower, A.V.Z. (1994) Rapid morphological radiation and convergence among races of the 446 butterfly Heliconius erato inferred from patterns of mitochondrial DNA evolution. 447 Proceedings of the National Academy of Sciences, 91, 6491–6495. 448 Dubois, J., Rollard, C., Villemant, C. & Gauld, I.D. (2002) The phylogenetic position of 449 parasitoids of spiders within Pimplinae (Hymenoptera, Ichneumonidae). In: Samu F, Szinetár 450 Cs, eds. Proceedings of the 20th European Colloquium of Arachnology. Szombathely 22-26 451 July, 27–35. 452 Eberhard, W.G. (2000) Spider manipulation by a wasp larva. Nature, 406, 255–256. 453 Eberhard, W.G. (2001) Under the influence: webs and building behaviour of Plesiometa 454 argyra (Araneae, Tetragnathidae) when parasitized by Hymenoepimecis argyraphaga 455 (Hymenopera, Ichneumonidae). Journal of Arachnology, 29, 354–366. 456 Eberhard, W.G. (2013) The Polysphinctine wasps Acrotaphus tibialis, Eruga ca. gutfreundi, 457 and Hymenoepimecis tedfordi (Hymenoptera, Ichneumonidae, Pimplinae) induce their host 458 spiders to build modified webs. Annals of the Entomological Society of America, 106, 652– 459 660. 460 Edgar, R.C. (2004) MUSCLE: multiple sequence alignment with high accuracy and high 461 throughput. Nucleic Acids Research, 32, 1792–1797. 462 Eggleton, P. & Belshaw, R. (1992) Insect parasitoids: An evolutionary overview. 463 Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences, 337, 464 1–20. 465 Fitton, M.G., Shaw, M.R. & Austin, A.D. (1987) The Hymenoptera associated with spiders 466 in Europe. Zoological Journal of the Linnean Society, 90, 65–93. 467 468 Forbes, A.A., Stelinski, L.L., Powell T.H.W., Smith, J.J. & Feder, J.L. (2009) Sequential 469 sympatric speciation across trophic levels. Science, 323, 776–779. 470 Fritzén, N.R. (2010) Natural history and description of Zatypota kerstinae sp. nov.

471 (Hymenoptera: Ichneumonidae)Author Manuscript reared from Theridion palmgreni Marusik et Tsellarius 472 (Araneae: Theridiidae) in Finland. Zootaxa, 2487, 52–60.

This article is protected by copyright. All rights reserved 473 Gauld, I.D. & Dubois, J. (2006) Phylogeny of the Polysphincta group of genera 474 (Hymenoptera: Ichneumonidae; Pimplinae), a taxonomic revision of spider ectoparasitoids. 475 Systematic Entomology, 31, 529–564. 476 Gauld, I.D., Wahl, D.B. & Broad, G.R. (2002) The suprageneric groups of the Pimplinae 477 (Hymenoptera: Ichneumonidae): a cladistic re-evaluation and evalutionary biological study. 478 Zoological Journal of the Linnean Society, 136, 421–485. 479 Gauld, I.D. (1984) The Pimplinae, Xoridinae, Acaenitinae and Lycorininae (Hymenoptera: 480 Ichneumonidae) of Australia. Bulletin of the British Museum (Natural History) (Entomology), 481 49, 235–339. 482 Godfray, H.C.J. (1994) Parasitoids behavioral and evolutionary ecology. Princeton 483 University Press, Princeton. 484 Gonzaga, M.O., Moura R.R., Pêgo P.T., Bang D.L. & Meira F.A. (2015) Changes to web 485 architecture of Leucauge volupis (Araneae: Tetragnathidae) induced by the parasitoid 486 Hymenoepimecis jordanensis (Hymenoptera: Ichneumonidae). Behaviour 152, 181–193. 487 Gonzaga, M.O., Sobczak, J.F., Penteado-Dias, A.M., Eberhard, W.G. (2010) Modification of 488 Nephila clavipes (Araneae Nephilidae) webs induced by the parasitoids Hymenoepimecis 489 bicolor and H. robertsae (Hymenoptera Ichneumonidae). Ethology Ecology & Evolution, 22, 490 151–165. 491 Hendry, A.P., Nosil, P. & Riesenberg, L.H. (2007) The speed of ecological speciation. 492 Functional Ecology, 21, 455–464. 493 Huelsenbeck, J.P., Larget, B. & Alfaro, M.E. (2004) Bayesian phylogenetic model selection 494 using reversible jump Markov chain Monte Carlo. Molecular Biology and Evolution, 21, 495 1123–1133. 496 Hurst, G.D.D. & Jiggins, F.M. (2005) Problems with mitochondrial DNA as a marker in 497 population, phylogeographic and phylogenetic studies: the effects of inherited symbionts. 498 Proceedings of the Royal Society B, 272, 1525–1534. 499 Jocqué, R. & Dippenaar-Schoeman, A.S. (2007) Spider families of the world. RMCA: 500 Tervuren.

501 Kankare, M., StefanescuAuthor Manuscript , C., van Nouhuys, S. & Shaw, M.R. (2005) Host specialization by 502 Cotesia wasps (Hymenoptera: Braconidae) parasitizing species-rich Melitaeini (Lepidoptera: 503 Nymphalidae) communities in north-eastern Spain. Biological Journal of the Linnean Society, 504 86, 45–65.

This article is protected by copyright. All rights reserved 505 Kester, K.M. & Barbosa, P. (1991) Postemergence learning in the insect parasitoid, Cotesia 506 congregata (Say) (Hymenoptera: Braconidae). Journal of Insect Behavior, 4, 727–742. 507 Klopfstein, S., Kropf, C. & Baur, H. (2016) Wolbachia endosymbionts distort DNA 508 barcoding in the parasitoid wasp genus Diplazon (Hymenoptera: Ichneumonidae). Zoological 509 Journal of the Linnean Society, 177, 541–557. 510 Klopfstein, S. (2014) Revision of the Western Palaearctic Diplazontinae (Hymenoptera, 511 Ichneumonidae). Zootaxa, 3801, 1–143. 512 Kloss, T.G., Gonzaga, M.O., Roxinol, J.A.M. & Sperber, C.F. (2016) Host behavioural 513 manipulation of two orb-weaver spiders by parasitoid wasps. Animal Behaviour, 111, 289– 514 296. 515 Korenko, S. (2017) First record from Italy of Zatypota anomala (Ichneumonidae, 516 Ephialtini), a parasitoid of the cribellate spider Dictyna pussila (Araneae, Dictynidae). 517 Arachnologische Mitteilungen, 54, 1–4. 518 Korenko, S. (2016) Web architecture alteration of the orb web weaving spider Metellina 519 merianae (Araneae, Tetragnathidae) induced by the parasitoid Megaetaira madida 520 (Ichneumonidae, Polysphincta group). Arachnologische Mitteilungen, 52, 35–37. 521 Korenko, S., Korenková, B., Satrapová, J., Hamouzová, K. & Belgers, D. (2015a) 522 Modification of Tetragnatha montana (Araneae, Tetragnathidae) web architecture induced 523 by larva of the parasitoid Acrodactyla quadrisculpta (Hymenoptera, Ichneumonidae, 524 Polysphincta genus-group). Zoological Studies, 54, 40. 525 Korenko, S., Satrapová, J. & Zwakhals, K. (2015b) Manipulation of araneid spider web 526 architecture by the polysphinctine parasitoid Zatypota picticollis (Hymenoptera: 527 Ichneumonidae: Pimlinae). Journal of Entomological Science, 18, 383–388. 528 Korenko, S., Hamouzová, K., Kysilková, K., Kolářová, M., Kloss, T.G., Takasuka, K. & Pekár, 529 S. (2018) Divergence in host utilisation by two spider ectoparasitoids within the genus 530 Eriostethus (Ichneumonidae, Pimplinae). Zoologischer Anzeiger, 272, 1-5. 531 Korenko, S., Isaia, M., Satrapová, J. & Pekár, S. (2014) Parazitoid genus-specific 532 manipulation of orb-web host spiders (Araneae, Araneidae). Ecological Entomology, 39, 30–

533 38. Author Manuscript 534 Korenko, S., Michalková, V., Zwakhals, K. & Pekár, S. (2011) Host specificity and temporal 535 and seasonal shifts in host preference of a web-spider parasitoid Zatypota percontatoria. 536 Journal of Insect Science, 11, 101.

This article is protected by copyright. All rights reserved 537 Korenko, S. & Pekár, S. (2011) A parasitoid wasp induces overwintering behaviour in its 538 spider host. PLOS One, 6, e24628. 539 540 König, K., Krimmer, E., Brose, S., Ganter, C., Buschlüter, I., König, C., Klopfstein, S., Wendt, 541 I., Baur, H., Krogmann, L. & Steidle, J.L.M. (2015) Does early learning drive ecological 542 divergence during speciation processes in parasitoid wasps? Proceedings of the Royal Society 543 of London Series B, 282, 20141850. 544 Matsumoto, R. (2009) ‘‘Veils’’ against predators: Modified web structure of a host spider 545 induced by an ichneumonid parasitiod, Brachyzapus nikkoensis (Uchida) (Hymenoptera). 546 Journal of Insect Behavior, 22, 39–48. 547 Matsumoto, R. (2016) Molecular phylogeny and systematics of the Polysphincta group of 548 genera (Hymenoptera, Ichneumonidae, Pimplinae). Systematic Entomology, 41, 854–864.

549 Matsumoto, R. & Takasuka, K. (2010) A revision of the genus Zatypota Förster of Japan, 550 with descriptions of nine new species and notes on their hosts (Hymenoptera: 551 Ichneumonidae: Pimplinae). Zootaxa, 2522, 1–43. 552 Messas, Y.F., Sobczak, J.F. &Vasconcellos-Neto, J. (2017) An alternative host of 553 Hymenoepimecis japi (Hymenoptera, Ichneumonidae) on a novel family (Araneae, 554 Araneidae), with notes on behavioral manipulations. Journal of Hymenoptera Research, 60, 555 111–118. 556 Nater, A., Burri, R., Kawakami, T., Smeds, L. & Ellegren, H. (2015) Resolving evolutionary 557 relationships in closely related species with whole-genome sequencing data. Systematic 558 Biology, 64, 1000–1017. 559 Nielsen, E. (1923) Contributions to the life history of the pimpline spider parasites 560 (Polysphincta, Zaglyptus, Tromatobia) (Hym. Ichneumon.). Entomologiske meddelelser, 14, 561 137–205. 562 563 Quicke, D.L.J., Smith, M.A., Janzen, D.H., Hallwachs, W., Fernandez-Triana, J., Laurenne, 564 N.M., Zaldívar-Riverón, A., Shaw, M.R., Broad, G.R., Klopfstein, S., Shaw, S., et al. (2012) Author Manuscript 565 Utility of the DNA barcoding gene fragment for parasitic wasp phylogeny (Hymenoptera: 566 Ichneumonoidea): data release and new measure of taxonomic congruence. Molecular 567 Ecology Resources, 12, 676–685.

This article is protected by copyright. All rights reserved 568 Papadopoulou, A., Anastasiou, I. & Vogler, A.P. (2010) Revisiting the insect mitochondrial 569 molecular clock: the mid-Aegean trench calibration. Molecular Biology and Evolution, 27, 570 1659–1672. 571 Rafter, M.A., Hereward, J.P., Walter, G.H. (2013) Species limits, quarantine risk and the 572 intrigue of a polyphagous invasive pest with highly restricted host relationships in its area of 573 invasion. Evolutionary Applications, 6, 1195–1207. 574 Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D.L., Darling, A., Höhna, S., Larget, B., 575 Liu, L., Suchard, M.A. & Huelsenbeck, J.P. (2012) Mrbayes 3.2: Efficient Bayesian 576 phylogenetic inference and model choice across a large model space. Systematic Biology, 61, 577 539–542. 578 Rago, A., Gilberg, D.G., Choi, J.H., Sackton, T.B., Wang, X., Kelkar, Y.D., Werren, J.H. & 579 Colbourne, J.K. (2016) OGS2: genome re-annotation of the jewel wasp Nasonia vitripennis. 580 BMC Genomics, 17, 678.

581 Shaw, M.R. (2002) Host ranges of Aleiodes species (Hymenoptera: Braconidae), and an 582 evolutionary hypothesis. In: Melika G and Thuroczy C. eds. Parasitic wasps: evolution, 583 systematics, biodiversity and biological control. pp. 321–327. Budapest, Agroinform. 584 585 Shaw, M.R & Horstmann, K. (1997) An analysis of host range in the Diadegma nanus 586 group of parasitoids in Western Europe, with a key to species (Hymenotpera: 587 Ichneumonidae: Campopleginae). Journal of Hymenoptera Research, 6, 273–296. 588 Shaw, M.R. (1994) Parasitoid host ranges. In: Hawkins, B.A., and W. Sheehan eds. 589 Parasitoid community ecology. pp. 111–144. Oxford University Press, Oxford, UK. 590 Schluter, D. (2009) Evidence for ecological speciation and its alternative. Science, 323, 591 737–739. 592 Smith, M.A., Rodriguez, J.J., Whitfield, J.B., Deans, A.R., Janzen, D.H., Hallwachs, W., 593 Hebert, P.D.N. (2008) Extreme diversity of tropical parasitoid wasps exposed by iterative 594 integration of natural history, DNA barcoding, morphology, and collections. Proceedings of 595 the National Academy of Sciences USA, 105, 12359–12364. Author Manuscript

596 Sobczak, J.F., Moura-Sobczak, J.C.M.S., Messas, Y.F., Souza, H.S. & Vasconcellos-Neto, J. 597 (2014) A New record of a host-parasitoid interaction: Hymenoepimecis veranii Lofredo &

This article is protected by copyright. All rights reserved 598 Penteado-Dias, 2009 (Hymenoptera: Ichneumonidae) parasitizing Araneus orgaos Levi, 1991 599 (Araneae: Araneidae). Journal of Insect Behavior, 27, 753–758. 600 Takasuka, K., Yasui, T., Ishigami, T., Nakata, K., Matsumoto, R., Ikeda, K. & Maeto, K. 601 (2015) Host manipulation by an ichneumonid spider ectoparasitoid that takes advantage of 602 preprogrammed web-building behaviour for its cocoon protection. Journal of Experimental 603 Biology, 218, 2326–2332. 604 Takasuka, K., Korenko, S., Kysilková, K., Štefánik, M., Černecká, Ľ., Mihál, I., Dolejš, P., 605 Holý, K. (2017) Host utilization of koinobiont spider-ectoparasitoids (Ichneumonidae, 606 Ephialtini, Polysphincta genus-group) associated with Cyclosa spp. (Araneae, Araneidae) 607 across the Palaearctic. Zoologischer Anzeiger, 267, 8–14. 608 Tamura, K., Stecher, G., Peterson, D., Filipski, A. & Kumar, S. (2013) MEGA6: Molecular 609 Evolutionary Genetics Analysis Version 6.0. Molecular Biology and Evolution, 30, 2725–2729. 610 Tschopp, A., Riedel, M., Kropf, C., Nentwig, W. & Klopfstein, S. (2013) The evolution of 611 host associations in the parasitic wasp genus Ichneumon (Hymenoptera: Ichneumonidae): 612 convergent adaptations to host pupation sites. BMC Evolutionary Biology, 13, 74. 613 Vié, J.C., Hilton-Taylor, C. & Stuart, S.N. (2009) Wildlife in a Changing World – An Analysis 614 of the 2008 IUCN Red List of Threatened Species. Gland, Switzerland, IUCN. 615 Vincent, L.S. (1979) A new record for Sinarachna anomala (Hymenoptera: 616 Ichneumonidae), an external parasitoid of Mallos pallidus (Araneae: Dictynidae). The Pan- 617 Pacific entomologist, 553, 192–194. 618 Whyte, R. & Anderson, G.A. (2017) Field Guide to Spiders of Australia. CSIRO Publishing, 619 Melbourne. 620 Yu, D.S., van Achterberg, C. & Horstmann, K. (2012). Taxapad 2012, Ichneumonoidea 621 2011. Taxonomy, biology, morphology and distribution. January 622 2017. 623 Zwakhals, K. (2006) The European species of the genera Zatypota and Sinarachna 624 (Hymenoptera: Ichneumonidae, Pimplinae, Polysphinctini). Entomologische Berichten, 66, 625 34–37.

626 Author Manuscript

627 Table 1. List of primers used in the molecular study with their annealing temperatures. Gene Primer Sequence 5’-3’ Reference Annealing

This article is protected by copyright. All rights reserved temperature COI Lep_Fw ATTCAACCAATCATAAAG ATATTGG Miller et al., 2013 50 oC LCO GGTCAACAAATCATAAAGATATTGG Folmer et al., 1994 50-51 oC HCO2198_Rv TAAACTTCAGGGTGACCAAAAAATCA Folmer et al., 1994 50-51 oC

28S D2-D3 fwd AAGAGAGAGTTCAAGAGTACGTG Belshaw and 52 oC Quicke, 1997

D2-D3 rev TAGTTCACCATCTTTCGGGTCCC Mardulyn and 52 oC Whitfield, 1999 ITS2 fwd TGTGAACTGCAGGACACATG Quicke et al., 2006 50-51 oC rev ATGCTTAAATTTAGGGGGT Quicke et al., 2006 50-51 oC Nasvi2EG0 fwd CCTGGATTTATCAGAGCTCG this study 54-59 oC 05150 intron 4 rev GACCATATTGTATCGGACAT this study 54 oC Nasvi2EG0 fwd GCTTACAGGAACAAACTCGA this study 56 oC 11352 intron 2 rev GCATCTTTCGTATTGTCGTTCG this study 56-60 oC Nasvi2EG0 fwd GCTTACAGGAACAAACTCGA this study 56 oC 11352 intron 3 rev GCCAACGAAAATCCGAGAAC this study 56-60 oC 628

629

630 Author Manuscript 631 Table 2. Host associations and sample sizes of Z. kauros lineages. Average host length in mm.

632 Ntot stands for the total number of collected spiders, Npar stands for the number of 633 parasitised spiders. * number represents all spiders of the genus Nephila, including N. 634 plumipes.

A/C Theridiidae Anelosimus sp. 2.29 422 19 B Araneidae/Araneinae Unid. araneinae 2.25 330 12 B/C Araneidae/Cyrtophorinae Cyrtophora hirta 2.7 323 17 C. exanthematica 2.6 98 4 C Araneidae/Nephilinae* Nephila plumipes 2.9 273* 8 635 636 637 Figures 638 Figure 1. Majority-rule consensus tree based on COI sequences of the genus Zatypota 639 including the Zatypota kauros complex, obtained using partitioned Bayesian inference. 640 Spider host species and family are shown at the tips. The numbers at the nodes represent 641 posterior probabilities and bootstrap values from the maximum likelihood analysis, 642 respectively, with values at recent divergences omitted for clarity; the scale bar is in 643 substitutions per site. 644 645 Figure 2. Majority-rule consensus trees of five nuclear markers in specimens of the Zatypota 646 kauros complex, obtained using partitioned Bayesian inference. Spider host species and 647 mitochondrial lineages are shown at the tips. The numbers at the nodes represent posterior 648 probabilities and bootstrap values from the maximum likelihood analysis, respectively, with 649 values at recent divergences omitted for clarity; the scale bar is in substitutions per site. 650 651 Figure 3. Change in the frequency of spider hosts parasitised by Zatypota kauros from July to 652 October 2013. 653 654 Figure 4. Comparison of average body length of Cyrtophora hirta and Nephila plumipes 655 spider hosts parasitised by the Zatypota kauros lineage B/C combination between July and 656 October 2013 comparedAuthor Manuscript with the expected body length preference calculated from the 657 average of all actually parasitised spiders (dotted line). Nephila spiders are separated into 658 adults and juveniles. 659

This article is protected by copyright. All rights reserved 660 Figure 5. Web architecture alteration in C. hirta induced by final-instar larva of Zatypota 661 kauros. The parasitised spider removes the sheet web from the surroundings of the funnel- 662 like shelter (a). Wasp cocoon placed at the entrance of the funnel-like shelter (b). 663 664 Figure 6. Unmodified webs and cocoon webs of two-dimensional orb-web building spider 665 hosts, as induced by final-instar larvae of Zatypota kauros. Unmodified orb web of an 666 unidentified Araneinae host before manipulation (a) and cocoon web with wasp cocoon 667 placed in the centre of the web modified by the Araneinae host (b). Orb web of Nephila 668 plumipes before manipulation (c). Cocoon web of N. plumipes when orb web has been 669 completely removed and wasp cocoon is placed in the newly built 3D tangle cocoon web (d). 670 Cocoon web with partially altered architecture, the wasp cocoon located at the edge of a 671 partially reduced orb web (e), and with no alteration to the web architecture, the wasp 672 cocoon placed at the edge of the normal nephilid orb web (f, lateral view). Arrow shows 673 wasp cocoon surrounded by sparse 3D tangle. 674 675 676 677 678 679 680 681 682 683 684 685 686 687

688 Additional files Author Manuscript 689 Additional file 1. List of Zatypota kauros and outgroup specimens included in the molecular 690 study, including host information and Genbank accessions; single Genbank accession 691 numbers are accessions for the COI sequences.

This article is protected by copyright. All rights reserved 692 693 Additional file 2. Parsimony informative intron sites. Nucleotide symbol (A, T, G, C) is 694 highlighted when a nucleotide is different from the consensus nucleotide; light blue area 695 designates quality of chromatogram. We used IUPAC ambiguity codes to express uncertain 696 base reads or heterozygote sites. We interpreted ambiguous reads as heterozygote sites 697 (designated with an asterisk) when we could resolve sequence stutter and when there was 698 evidence that both bases were present at that site in the alignment. Symbols A, B and C next 699 to the specimen numbers indicate the COI lineages. 700 701 Additional file 3. Video 1 – Interaction between Zatypota kauros and theridiid host 702 Anelosimus sp. 703 704 Additional file 4. Video 2 – Interaction between Zatypota kauros and araneid host 705 Cyrtophora hirta (Cyrtophorinae). 706 707 Additional file 5. Video 3 – Interaction between Zatypota kauros and araneid host Nephila 708 plumipes (Nephilinae). Author Manuscript

This article is protected by copyright. All rights reserved Zatypota kauros 2050 Anelosimus sp. ▪ Spider host (sub)families Zatypota kauros 2403 host unknown Zatypota kauros 2052 Anelosimus sp. ▪ Cyrtophorinae 3D web Zatypota kauros ZASW01 Anelosimus sp. ▪ * Zatypota kauros ZASW17 Anelosimus sp. A Araneinae • 2D web Araneidae ▪ Nephilinae ▲ 2D web Zatypota kauros 2406 host unknown Dictynidae ♦ 3D web 1.0/100 Zatypota kauros 2491 Anelosimus sp. ▪ Theridiidae 3D web Zatypota kauros w19 Anelosimus sp. ▪ ▪ Zatypota kauros w21 Anelosimus sp. ▪ Zatypota kauros 2046 Cyrtophora sp. * CO1 lineages Zatypota kauros 2048 Cyrtophora sp. 1.0/83 Zatypota kauros 2402 host unknown * A B 1.0/94 Zatypota kauros w16 Cyrtophora hirta B Zatypota kauros 2413 Cyrtophora exanthematica* .96/55 * C Zatypota kauros ZCHW09 Cyrtophora sp. * Zatypota picticollis w14 Zilla diodia • 1.0/100 Zatypota picticollis w15 Zilla diodia • .76/36 Zatypota kauros 2493 Cyrtophora hirta Zatypota kauros 2405 host unknown * 0.3 1.0/99 1.0/81 Zatypota kauros ZCHW06 Cyrtophora hirta Zatypota kauros ZNPW02 Nephila plumipes* ▲ Zatypota kauros 2404 host unknown Zatypota kauros 2414 Nephila plumipes ▲ C 1.0/83 Zatypota kauros 2412 host unknown (2D web) .97/68 Zatypota kauros 2409 Anelosimus sp. ▪ Zatypota kauros 2410 Anelosimus sp. ▪ Zatypota kauros 2492 Cyrtophora hirta* .61/35 Zatypota kauros 2411 host unknown (2D web) Zatypota anomala w12 Dictyna sp. ♦ .55/22 Zatypota alborhombarta w6 Cryptachaea migrans ▪ Zatypota bohemani BOLD PWSH00613 Zatypota cingulata BOLD CNFNN35414 host unknown Zatypota discolor PxAxW01 Theridion sp. ▪ Zatypota discolor ZpPiW18 Phylloneta impressa 1.0/88 ▪ Zatypota discolor ZxTxWGer Theridion sp. ▪ 1.0/45 Zatypota discolor ZdTvW37 Theridion varians ▪ Zatypota percontatoria CCDB-08110-H04 .99/99 Zatypota percontatoria BOLD CNPKG95414 .51/13 Zatypota percontatoria ZdTtW02 Theridion tinctum ▪ Zatypota percontatoria ZxTtW05 Theridion tinctum ▪ 1.0/96 Zatypota percontatoria ZpTxW40 Theridion sp. ▪ Zatypota percontatoria ZxTxW02 Theridion sp. ▪ Zatypota percontatoria ZpTxW39 Theridion sp.▪ Zatypota percontatoria ZpTpW04 Theridion sp.▪ Acrodactyla degener BOLD CNGLF60313

Author Manuscript icad_12307_f1.eps

Cyrtophorinae Zatypota kauros 2403 host unknown A * Araneidae .71/68 Nephilinae ▲ Zatypota kauros 2406 host unknown A .54/63 Zatypota kauros 2491 Anelosimus sp. A Theridiidae ▪ .43/35 ▪ Zatypota kauros 2409 Anelosimus sp. C .30/- ▪ Zatypota kauros 2411 host unknown C Zatypota kauros 2402 host unknown B CO1 lineage Zatypota kauros 2414 Nephila plumipes▲ C A Zatypota kauros 2492 Cyrtophora hirta C B .42/- * C Zatypota kauros 2493 Cyrtophora hirta* C .71/68 Zatypota kauros 2405 host unknown C Zatypota kauros 2404 host unknown C 0.05

Nasvi2EG011352 intron 2 Nasvi2EG011352 intron 3 Zatypota kauros 2491 Anelosimus sp. ▪ A Zatypota kauros 2402 host unknown B .45/- Zatypota kauros 2405 host unknown .27/- .24/- C Zatypota kauros 2404 host unknown C Zatypota kauros 2409 Anelosimus sp. C Zatypota kauros 2405 host unknown C .39/- ▪ Zatypota kauros 2406 host unknown A Zatypota kauros 2492 Cyrtophora hirta C .39/- * Zatypota kauros 2403 host unknown A Zatypota kauros 2414 Nephila plumipes ▲ C .78/100 Zatypota kauros 2410 Anelosimus sp. C Zatypota kauros 2409 Anelosimus sp. ▪ C .30/- ▪ .27/- Zatypota kauros 2411 host unknown C Zatypota kauros 2403 host unknown A Zatypota kauros 2402 host unknown B Zatypota kauros 2411 host unknown C .24/- .43/50 Zatypota kauros 2410 Anelosimus sp. C Zatypota kauros 2492 Cyrtophora hirta C .27/- ▪ * Zatypota kauros 2406 host unknown .45/- Zatypota kauros 2404 host unknown C A 1.0/100 Zatypota kauros 2414 host unknown C Zatypota kauros 2491 Anelosimus sp. ▪ A 0.09 0.09

28S rRNA ITS2 rRNA Cyrtophora Zatypota kauros 2413 B Zatypota kauros 2412 host unknown C exanthematica* .97/90 Zatypota kauros 2402 host unknown5 B Zatypota kauros 2411 host unknown C

Zatypota kauros 2404 host unknown C .80/55 Zatypota kauros 2405 host unknown C 1.0/94 1.0/100 Zatypota kauros 2406 host unknown A Zatypota kauros 2413 Cyrtophora B .34/75 exanthematica * Zatypota kauros 2410 Anelosimus sp. ▪ C Zatypota kauros 2402 host unknown B Zatypota kauros 2412 host unknown C 1.0/100 Zatypota kauros 2414 Nephila plumipes▲ C .19/55 Zatypota kauros 2414 Nephila plumipes▲ C Zatypota kauros 2404 host unknown C Zatypota kauros 2409 Anelosimus sp. ▪ C Zatypota kauros 2409 Anelosimus sp. ▪ C Zatypota kauros 2403 host unknown A Zatypota kauros 2406 host unknown A Author Manuscript .39/- Zatypota kauros 2405 host unknown C Zatypota kauros 2403 host unknown A Zatypota kauros 2411 host unknown C Zatypota kauros 2410 Anelosimus sp. ▪ C Sinarachna pallipes 2408 Sinarachna pallipes 2408 0.005 0.03