An Olfactory Cilia Pattern in the Mammalian Nose Ensures High Sensitivity to Odors

University of Pennsylvania ScholarlyCommons

Publicly Accessible Penn Dissertations

2016

Rosemary Challis University of Pennsylvania, [email protected]

Follow this and additional works at: https://repository.upenn.edu/edissertations

Part of the Cell Biology Commons, Neuroscience and Neurobiology Commons, and the Physiology Commons

Recommended Citation Challis, Rosemary, "An Olfactory Cilia Pattern in the Mammalian Nose Ensures High Sensitivity to Odors" (2016). Publicly Accessible Penn Dissertations. 1641. https://repository.upenn.edu/edissertations/1641

This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1641 For more information, please contact [email protected]. An Olfactory Cilia Pattern in the Mammalian Nose Ensures High Sensitivity to Odors

Abstract In many sensory organs, specialized receptors are strategically arranged to enhance detection sensitivity and acuity. It is unclear whether the olfactory system utilizes a similar organizational scheme to facilitate odor detection. Curiously, olfactory sensory neurons (OSNs) in the mouse nose are differentially stimulated depending on the cell location. We therefore asked whether OSNs in different locations evolve unique structural and/or functional features to optimize odor detection and discrimination. Using immunohistochemistry, computational fluid dynamics modeling, and patch clamp recording, we discovered that OSNs situated in highly stimulated regions have much longer cilia and are more sensitive to odorants than those in weakly stimulated regions. Surprisingly, reduction in neuronal excitability or ablation of the olfactory G protein in OSNs does not alter the cilia length pattern, indicating that neither spontaneous nor odor-evoked activity is required for its establishment. Furthermore, the pattern is evident at birth, maintained into adulthood, and restored following pharmacologically induced degeneration of the olfactory epithelium, suggesting that it is intrinsically programmed. Intriguingly, type III adenylyl cyclase (ACIII), a key protein in olfactory signal transduction and ubiquitous marker for primary cilia, exhibits location-dependent gene expression levels. Moreover, genetic ablation or reduction of ACIII levels dramatically alters the cilia pattern. These findings reveal an intrinsically programmed, activity- independent configuration in the nose to ensure high sensitivity to odors and a novel role of ACIII in mediating olfactory cilia length. Together, this work has broad implications for how sensory receptors optimize detection sensitivity in various physiological contexts and offers new insights into the regulation of cilia morphology and function.

Degree Type Dissertation

Degree Name Doctor of Philosophy (PhD)

Graduate Group Cell & Molecular Biology

First Advisor Minghong Ma

Keywords airflow, computational fluid dynamics model, odorant absorption, olfactory cilia, patch clamp, type III adenylyl cyclase

Subject Categories Cell Biology | Neuroscience and Neurobiology | Physiology

This dissertation is available at ScholarlyCommons: https://repository.upenn.edu/edissertations/1641

AN OLFACTORY CILIA PATTERN IN THE MAMMALIAN NOSE ENSURES HIGH

SENSITVITY TO ODORS

2016

Rosemary C. Challis

This work is licensed under the

Creative Commons Attribution-

NonCommercial-ShareAlike 3.0

License

To view a copy of this license, visit

https://creativecommons.org/licenses/by-nc-sa/3.0/us/ Acknowledgements

First and foremost, I would like to thank my mentor, Minghong Ma, for her

patience and dedication in training me as a scientist. Without her guidance I would not be

ready to begin the next chapter in my professional life.

Io would like als to thank the members of my committee – Dr. Kevin Foskett, Dr.

Erika Holzbaur, Dr. Noam Cohen, and Dr. Joel Mainland – for all of their advice and

support throughout this project. Also, to Dr. Carol Deutsch and Dr. Wenqin Luo for their

enthusiasm and encouragement during my time at Penn.

To the members of the Ma lab, who provided an easy-going environment in which to conduct research, and the Luo lab, for teaching me new techniques. I am

grateful to both labs for their advice and friendship. Thank you to the Cell and Molecular

Biology Graduate Group, specifically the faculty, students, and staff in the Cell Biology,

Physiology, and Metabolism subgroup. The biweekly meetings were invaluable for

learning how to communicate science to friends and colleagues.

To my parents, who have encouraged me in my pursuit of life-long learning as

long as I can remember. I cannot fully comprehend the sacrifices they have made to help

me be where I am today, but I am extremely grateful for all they have done. Also, thank you to my siblings, their families, and my friends, both near and far, for their friendship.

Lastly, to my husband Collin. Your unconditional love constantly reminds me of

how lucky I am to have you. Thank you for your patience, especially during the past year.

I can’t wait to see what the future has in store for us.

iii ABSTRACT

AN OLFACTORY CILIA PATTERN IN THE MAMMALIAN NOSE ENSURES HIGH

SENSITIVITY TO ODORS

Rosemary C. Challis

Minghong Ma

In many sensory organs, specialized receptors are strategically arranged to enhance detection sensitivity and acuity. It is unclear whether the olfactory system utilizes a similar organizational scheme to facilitate odor detection. Curiously, olfactory sensory neurons (OSNs) in the mouse nose are differentially stimulated depending on the cell location. We therefore asked whether OSNs in different locations evolve unique structural and/or functional features to optimize odor detection and discrimination. Using immunohistochemistry, computational fluid dynamics modeling, and patch clamp recording, we discovered that OSNs situated in highly stimulated regions have much longer cilia and are more sensitive to odorants than those in weakly stimulated regions.

Surprisingly, reduction in neuronal excitability or ablation of the olfactory G protein in

OSNs does not alter the cilia length pattern, indicating that neither spontaneous nor odor- evoked activity is required for its establishment. Furthermore, the pattern is evident at birth, maintained into adulthood, and restored following pharmacologically induced degeneration of the olfactory epithelium, suggesting that it is intrinsically programmed.

Intriguingly, type III adenylyl cyclase (ACIII), a key protein in olfactory signal

transduction and ubiquitous marker for primary cilia, exhibits location-dependent gene

expression levels. Moreover, genetic ablation or reduction of ACIII levels dramatically iv alters the cilia pattern. These findings reveal an intrinsically programmed, activity- independent configuration in the nose to ensure high sensitivity to odors and a novel role of ACIII in mediating olfactory cilia length. Together, this work has broad implications for how sensory receptors optimize detection sensitivity in various physiological contexts and offers new insights into the regulation of cilia morphology and function.

v Table of Contents

List of Tables……………………………………………………………………………vii

List of Figures……………………………………………………………………….viii-ix

Chapter 1…………………………………………………………………………………1 Introduction

Chapter 2………………………………………………………………………………..14 An olfactory cilia pattern in the mammalian nose ensures high sensitivity to odors

Chapter 3………………………………………………………………………………..46 Genetic ablation of type III adenylyl cyclase exerts region-specific effects on olfactory cilia architecture in the mouse nose

Chapter 4………………………………………………………………………………..56 General Discussion

Appendix I………………………………………………………………………………73 List of abbreviations used

List of References…………………………………………………………………….....74

vi List of Tables

Chapter 2 – An olfactory cilia pattern in the mammalian nose ensures high sensitivity to odors

2.1 Cilia length quantification from C57Bl/6J mice

2.2 Cilia length quantification from mice tested under various conditions

Chapter 3 – Genetic ablation of type III adenylyl cyclase exerts region-specific effects

on olfactory cilia architecture in the mouse nose

3.1 Cilia length quantification from mice with altered ACIII levels

vii List of Figures

Chapter 1 – Introduction 1.1 Olfactory signal transduction cascade 1.2 Anatomical organization of the rodent nose

Chapter 2 – An olfactory cilia pattern in the mammalian nose ensures high sensitivity to odors

2.1 The ventral zone, as well as the dorsal zone along the endoturbinates, do not

exhibit systematic regional differences in cilia length

2.2 Olfactory cilia length depends on the cell location in the olfactory epithelium

2.3 mOR-EG proteins are distributed throughout the entire cilia, and DBA labels

OSNs other than mOR-EG and MOR18-2 cells

2.4 The cilia length pattern applies to OSNs expressing other OR types

2.5 The cilia pattern is positively correlated with odorant absorption

2.6 The cilia pattern is established by an activity-independent mechanism

2.7 The cilia pattern is evident throughout postnatal development

2.8 The cilia pattern is restored following OSN regeneration

2.9 Genetic ablation of ACIII disrupts the cilia pattern

2.10 OSNs with longer cilia are more sensitive to odorants

2.11 Odor stimulation elicits larger EOG signals in the anterior versus the

posterior septum

viii Chapter 3 – Genetic ablation of type III adenylyl cyclase exerts region-specific effects on olfactory cilia architecture in the mouse nose

3.1 Genetic ablation of PDEs disrupts the cilia pattern

3.2 Ablation of PDEs or ACIII differentially impacts cilia length

Chapter 4 – General Discussion

4.1 An olfactory cilia pattern in the mammalian nose ensures high sensitivity to

odors

ix Chapter 1

Introduction

The ability to detect and respond to sensory cues is essential for the survival and reproduction of all species. From archaea to man, organisms have evolved dedicated sensory systems to identify relevant stimuli in both their internal and external environments. Bacteria, plants, and animals are each equipped to respond to a variety of physical and chemical modalities including light, temperature, mechanical force, and chemical compounds. Animals are unique in that they possess distinct sensory organs comprised of specialized sensory cells, or receptors, which mediate the detection of extracellular stimuli. For example, light is detected by photoreceptors in the eye, pressure by mechanoreceptors in the skin, and airborne chemicals, or odorants, by olfactory sensory neurons in the nose.

Sensory receptors detect environmental cues via a common mechanism. First, external chemical or physical stimuli directly interact with molecular receptors on the plasma membrane of sensory cells. This interaction results in an intracellular response, which is subsequently transduced into an electrical signal. Electrical signals are then relayed to higher-order structures in the central nervous system and translated by the brain to produce a specific behavioral output. Depending on the stimuli, the behavioral outcome may include finding mates, avoiding predators, or foraging for food or shelter.

Sensory detection therefore involves cooperation at many levels, from the initial detection event to the final behavioral result.

1 Sensory organs have evolved efficient strategies to optimize detection sensitivity.

At the molecular and cellular levels, sensory cells use highly specialized transmembrane protein receptors such as G protein-coupled receptors (GPCRs) and ion channels, often situated in cytoskeletal-based organelles (i.e., cilia and microvilli), to detect stimuli in the environment. At the anatomical level, sensory cells are strategically arranged in sensory organs to enhance detection of relevant stimuli. Examples of this anatomical organization are evident in the human retina and skin, where sensory receptors are arranged to match cell sensitivity with the incoming stimulation (Osterberg, 1935; Weber, 1834). Such spatial coding is critical for sensory systems in which stimuli are differentially delivered across the sensory organ. Intriguingly, the mammalian nose experiences dramatic region- dependent stimulation (Jiang and Zhao, 2010; Kimbell et al., 1997; Scott et al., 2014;

Yang et al., 2007; Zhao et al., 2006). However, unlike the visual and somatosensory systems, it is unclear whether sensory receptors in the olfactory system are spatially organized to optimize detection sensitivity.

The focus of this thesis is to increase our understanding of the cellular and anatomical organization of the peripheral olfactory system, with emphasis on the structural and functional properties of sensory cells in different regions throughout the mouse olfactory epithelium. In this chapter, I will first present an overview of the molecular, cellular, and anatomical basis of peripheral sensory detection. I will then focus on the organization of the mammalian olfactory epithelium and highlight the evidence for a potential spatial component in peripheral olfactory coding. Lastly, I will present my overall hypothesis.

2 Overview: molecular and cellular basis of sensory detection

Molecular components of sensory detection

At the molecular level, sensory cells rely on transmembrane protein receptors to

detect physical and chemical modalities in the environment. Molecular receptors can be

classified into two major groups, GPCRs and ion channels (Julius and Nathans, 2012).

Each plays distinct roles in different cell types to perform specialized physiological

functions. Ion channels mediate thermosensation, mechanosensation, and salty and sour tastes in sensory cells of the skin, ear, and oral cavity, respectively. GPCRs, on the other hand, mediate vision, olfaction, and sweet, bitter, and umami tastes. Upon activation by external stimuli, GPCRs trigger multicomponent signaling systems in which several molecules, including second messengers, contribute to transducing sensory cues into an intracellular electrical signal. In contrast, ion channels are directly gated by extracellular

stimuli, leading to translocation of ions and membrane potential changes. Thus, sensory

cells equipped with ion channels respond rapidly to external signals, typically on a

timescale of microseconds, whereas cells with GPCRs respond more slowly, often on a

timescale of many milliseconds. In general, GPCRs endow cells with signal amplification, which in many cases leads to increased sensitivity to stimuli, as in phototransduction by photoreceptors. Ion channels endow cells with fast response kinetics, which are critical for the detection of fast-changing stimuli, as in sound transduction by hair cells. Both types of molecular receptors equip various sensory cells with the molecular tools they need to effectively respond to signals in the external world.

3 Cellular components of sensory detection

In sensory cells, GPCRs and ion channels are typically enriched in microtubule- or actin-based cellular structures, such as cilia or microvilli, respectively. These cytoskeletal structures are remarkably diverse in their numbers, lengths, and morphologies and are found protruding from a number of sensory receptors throughout the body (Berbari et al., 2009; Choksi et al., 2014; Sauvanet et al., 2015; Sekerkova et al.,

2006; Silverman and Leroux, 2009). Cilia and microvilli facilitate sensory detection using two main strategies. First, these organelles provide a structural scaffold for molecular receptors and downstream signaling components. Second, they increase the cell surface area, which increases not only their chance of encountering stimuli but also the surface area to volume ratio for effective intracellular diffusion during signaling. Cilia and microvilli have therefore evolved efficient means to serve as signaling hubs for cells.

Microvilli have long been recognized for increasing the absorptive and secretory capacity of intestinal epithelial cells but are often overlooked for their critical functions in mammalian sensory physiology (Sekerkova et al., 2006). Multiple sensory receptors possess microvilli of varying numbers and lengths including hair cells in the ear, taste cells in the tongue, and chemosensory cells in the nose. Similar to microvilli, cilia also serve as sensory organelles in a variety of organs. Once considered rare and vestigial, cilia are evolutionarily conserved structures that are now believed to be present on most mammalian cell types. These organelles are critical for countless developmental and physiological processes including detection of sensory stimuli like light, mechanical force, and odor molecules (Berbari et al., 2009). Disruptions in cilia structure and/or function result in ciliopathies, which are pleiotropic disorders characterized by

4 developmental abnormalities, retinal degeneration, renal disease, and anosmia, or loss of

smell (Hildebrandt et al., 2011; Jenkins et al., 2009; Waters and Beales, 2011). Great

efforts continue to be made to identify the components involved in maintaining cilia,

which may lead to the development of therapeutic treatments for cilia-related diseases.

Spatial organization of sensory receptors in sensory organs

Cytoskeletal structures and transmembrane protein receptors form the basis of

mammalian sensory detection at the cellular and molecular levels, respectively. On a

gross anatomical level, the organization of receptor cells in tissues and organs also plays

a critical role in sensory detection and discrimination. Intriguingly, most sensory

receptors are arranged to optimize detection sensitivity. One of the most well-known

examples of this strategic organization is seen in the human retina, which contains rod and cone photoreceptors. Classic work by Osterberg in the early 20th century showed that

rods and cones are each uniquely distributed throughout the retina (Osterberg, 1935).

Rods are dispersed throughout most of the retina, except in a very small region at the

center called the fovea, which is almost exclusively comprised of cones. The spatial

arrangement of photoreceptors in the retina is critical for the functional specialization of

rods and cones in different types of vision, rods for light sensitivity and cones for visual

acuity.

Another example of such spatial organization is seen in the somatosensory

system. Investigations by Weber in the 19th century first demonstrated that the human body is not equally sensitive to touch (Weber, 1834). By measuring the distance at which two points are perceived as separate (i.e., the two point discrimination threshold), Weber showed that different regions across the skin have different sensitivities, a phenomenon

5 attributed to the uneven distribution of mechanoreceptors throughout the body. The fingertips, for example, have a much lower two point discrimination threshold compared to the forearms. This difference reflects the fact that the fingertips have a higher concentration of mechanoreceptors with small receptive fields, a feature used to facilitate fine touch.

As the above examples suggest, sensory systems are arranged to match cell sensitivity with the incoming stimulation. This topographical design is optimized at the

molecular, cellular, and anatomical levels. Dedicated molecular receptors, specialized

cellular architecture, and strategic placement of sensory cells within tissues together

ensure high sensitivity to relevant stimuli. As seen in the retina and skin, spatial

organization is critical for the sensitivity and acuity of sensory organs. The mammalian

nose is an anatomically complex sensory organ, and different regions experience

dramatically different stimulation (e.g., airflow rates and odorant concentrations) (Jiang and Zhao, 2010; Kimbell et al., 1997; Scott et al., 2014; Yang et al., 2007; Zhao et al.,

2006). However, it is unclear whether sensory cells in the nose are strategically arranged

to enhance detection sensitivity.

Current understanding of olfactory epithelium organization in rodents

Molecular and cellular organization of the olfactory epithelium

The primary sensory cells in the nose are called olfactory sensory neurons

(OSNs). In mammals, OSNs are located in the main olfactory epithelium, a

pseudostratified epithelium situated in the posterior portion of the nasal cavity. OSNs are

bipolar neurons, which have one axon that projects to a glomerulus in the olfactory bulb

in the brain, and one dendrite that extends into the mucous covering the surface of the

6 Figure 1.1. Olfactory signal transduction cascade.

Odorant binding to ORs on the cilia of OSNs activates (green arrows) the olfactory signal transduction cascade and results in cell depolarization and the firing of action potentials. For simplicity, only two events involved in adaptation and termination of the olfactory response are shown (red arrow and dashed line).

epithelium (Figures 1.1 and 1.2). Each dendrite terminates in a “knob” at the air-mucous interface. From each knob emanate up to 30 immotile cilia, which contain the key proteins involved in olfactory signal transduction. The mouse olfactory epithelium contains several million OSNs, each of which expresses one G protein-coupled odorant receptor (OR) type (Buck and Axel, 1991; Chess et al., 1994; Serizawa et al., 2000) from a repertoire of approximately 1200 (Zhang et al., 2007). Odor detection begins when odor molecules are absorbed into the mucous covering the surface of the epithelium and bind to ORs on the cilia of OSNs (Figure 1.1) (Menco et al., 1997). Odorant binding leads to activation of type III adenylyl cyclase (ACIII) and a subsequent increase in intracellular cyclic adenosine monophosphate (cAMP) levels. Cyclic AMP then binds and opens a cyclic nucleotide-gated (CNG) channel, which causes Na+ and Ca2+ influx and cell

depolarization. Ca2+ ions activate a Cl- channel, causing Cl- efflux and amplification of

7 the signal. Membrane depolarization leads to action potentials that transmit odor information to the olfactory bulb (Mombaerts, 2006; Su et al., 2009). Adaptation and termination of the olfactory response are mediated in part by phosphodiesterases (PDEs)

1C and 4A (Cygnar and Zhao, 2009), which hydrolyze cAMP to AMP, and a Na+-Ca2+ exchanger that removes Ca2+ from the cytosol (Stephan et al., 2012).

OR gene expression is segregated into anatomical zones (Figure 1.2) (Ressler et al., 1993; Strotmann et al., 1994; Sullivan et al., 1996; Vassar et al., 1993). ORs were initially ascribed to one of four distinct zones in the olfactory epithelium, but the regional distribution of OSNs expressing distinct ORs is more broad than originally thought, since zones appear more like wide, overlapping stripes rather than distinctly demarcated regions (Iwema et al., 2004; Miyamichi et al., 2005). OSNs are therefore broadly distributed into what are referred to as the dorsal and ventral zones, which span the dorsal and ventral parts of the olfactory epithelium, respectively (Figure 1.2). These zones are determined by zone-specific markers (Oka et al., 2003; Yoshihara et al., 1997) and OR expression patterns. Intriguingly, out of the two general classes (i.e., class I and class II) of ORs found in mammals and amphibians (Freitag et al., 1995; Glusman et al., 2000), class I, or “fish-like”, ORs are only found in the dorsal zone and class II ORs are found throughout the entire epithelium (Zhang et al., 2004). Given that fish only have class I

ORs, it is hypothesized that these ORs are more responsive to hydrophilic odorants, although this has not been directly tested. Within a single zone, about 6,000 OSNs expressing the same OR are scattered from the anterior to the posterior epithelium

(Figure 1.2) (Bressel et al., 2016).

8 Figure 1.2. Anatomical organization of the rodent nose.

(A) The septum is located along the medial aspect of the nasal cavity. The blue dashed line marks the dorsal airstream during inspiration. Light and dark gray denote the dorsal and ventral zones, respectively. Green and pink dots represent OSNs expressing a given OR. Cells located along the medial aspect of the nose project to a single medial glomerulus in the olfactory bulb (OB). (B) The turbinates are located along the lateral aspect of the nasal cavity. OSNs along and within the turbinates project to a single lateral glomerulus. Hence, OSNs expressing the same OR project to both a medial (A) and lateral glomerulus (B). The dorsal recess (DR) folds from the medial to the lateral side and is therefore depicted in both (A and B). NPH = nasopharynx; RE = respiratory epithelium; SO = septal organ; VNO = vomeronasal organ.

Anatomical organization of the olfactory epithelium

The dorsal and ventral zones are found in both the medial and lateral aspects of the nasal cavity (Figure 1.2). The lateral sides include the turbinates, which are convoluted cartilaginous structures that serve to increase the surface area of the epithelium. The medial side includes the septum, a flat piece of cartilage and bone that divides the nose into two cavities. OSNs located in the medial and lateral parts of the

nose project to medial and lateral glomeruli, respectively (Levai et al., 2003; Schoenfeld

et al., 1994). Likewise, cells in the dorsal and ventral zones project to glomeruli situated

in the dorsal and ventral portions of the olfactory bulb (Astic and Saucier, 1986;

Miyamichi et al., 2005; Saucier and Astic, 1986). Hence, topographic relationships in the

9 olfactory epithelium are maintained in the olfactory bulb (Figure 1.2). This organization

is thought to effect spatial coding, given that the brain is extracting information across

peripheral space.

Spatial patterns of activity across the olfactory epithelium

Imposed patterns

The complex molecular, cellular, and anatomical organization of the peripheral olfactory system points to a potential spatial component in odor detection. Curiously, in

both mammals and amphibians, different regions of the nose experience different odor stimulation, a phenomenon attributed to multiple factors including airflow rates, nasal geometry, and the physicochemical properties of odor molecules. In vivo electrophysiological and chromatographic studies in the frog were among the first to suggest that spatiotemporal patterns of odor-induced activity across the olfactory epithelium depend on the differential migration of odor molecules through the mucous

(Mozell, 1964, 1966, 1970; Mozell and Jagodowicz, 1973). Analogous to a gas chromatograph that separates chemical compounds based on their retention times, the frog olfactory mucosa separates inhaled odorants based on their mucosal solubility. For example, the more soluble an odorant is, the more easily it will be deposited in upstream versus downstream regions. Hence, different odorants are accessible to different regions of the nose, creating “imposed” gradients of odor-induced activity (Moulton, 1976).

Physiological and computational work in rodents has since strengthened the claim that

odor sorptiveness (i.e., volatility and mucosal solubility) effects the migration of odorants

through the nasal cavity (Kent et al., 1996; Scott et al., 2014; Yang et al., 2007; Zhao et

al., 2006). The “sorption theory” therefore alleges that the physicochemical properties of

10 odor molecules influence their spatial distribution across the olfactory epithelium, leading

to region-specific stimulation and the hypothesis that imposed odor-induced mucosal activity patterns contribute to odor coding.

Inherent patterns

The olfactory epithelium also exhibits “inherent” gradients of activation across its

surface (Moulton, 1976). In contrast to imposed patterning, inherent patterning is shaped

by the intrinsic properties of OSNs. In a series of studies, researchers eliminated the

contribution of imposed activity by directly applying odors to different regions of the rat,

frog, or salamander epithelium and measured odor-induced responses using voltage-

sensitive dyes or electroolfactogram (EOG) recordings, which measure field potentials

summated from populations of OSNs (Kent and Mozell, 1992; Mackay-Sim and

Kesteven, 1994; Mackay-Sim et al., 1982; Youngentob et al., 1995). Intriguingly, these

studies revealed inherent regional differences in odor-induced activity across the

olfactory epithelium, independent of odorant concentration. That is, each odorant tested elicited a unique pattern of activation across the mucosa. These observations may be the result of different sensitivities or numbers of sensory receptors in various locations.

Composite patterns

Location-dependent activity across the olfactory epithelium can originate from either inherent or imposed patterns. However, the interaction of both (i.e., “composite” representation) is thought to affect odor detection and discrimination (Kent et al., 1996;

Mozell et al., 1987). Below, I briefly describe how composite patterns of activity are compatible with the molecular, cellular, and anatomical organization of the mammalian nose.

11 Studies in rats demonstrate that the dorsal recess, which lies above the medial septum in the dorsal zone, experiences higher airflow rates and odorant concentrations compared to the lateral turbinates (Figure 1.2) (Jiang and Zhao, 2010; Kimbell et al.,

1997; Scott et al., 2014; Yang et al., 2007; Zhao et al., 2006). This phenomenon appears to be the result of imposed patterns and supports the sorption theory. Odorants with high mucosal solubility are deposited along the medial aspect of the dorsal zone (e.g., the dorsal recess), where the airflow reaches first, while odorants with low mucosal solubility are absorbed equally, albeit at lower concentrations compared to soluble odorants, throughout the entire nasal cavity including the turbinates. Intriguingly, these imposed patterns are correlated with inherent odor sensitivity. EOG recordings from a variety of locations throughout the olfactory epithelium support that upstream (e.g., medial) and downstream (e.g., lateral) regions generally exhibit greater inherent responses to soluble and insoluble odorants, respectively (Scott et al., 2000; Scott et al., 1996; Scott et al.,

1997). The molecular mechanism underlying these observations may be related to the different sensitivities of OSNs expressing distinct ORs, given that the medial and lateral recording locations in these studies strongly correlated with the dorsal and ventral zones, respectively.

Hypothesis

Together, the literature suggests that the medial, lateral, dorsal, and ventral regions of the olfactory epithelium are poised for detecting different stimulation.

Moreover, within one broad zone, OSNs expressing the same OR are scattered from the anterior to the posterior epithelium (Figure 1.2), indicating that OSNs are differentially

stimulated depending on the cell location. Based on these observations, I asked whether

12 OSNs in the mouse nose possess structural and/or functional properties to ensure high sensitivity to odors. To test this hypothesis, I utilized immunohistochemical, computational, and electrophysiological tools to explore the morphology and function of

OSNs in the dorsal and ventral zones throughout the medial and lateral aspects of the mouse nose.

13 Chapter 2

An olfactory cilia pattern in the mammalian nose ensures high sensitivity to odors

Rosemary C. Challis1, Huikai Tian1, Jue Wang1, Jiwei He1, Jianbo Jiang2, Xuanmao

Chen3, Wenbin Yin1,4, Timothy Connelly1, Limei Ma5, C. Ron Yu5, Jennifer L.

Pluznick6, Daniel R. Storm3, Liquan Huang2,7, Kai Zhao2, and Minghong Ma1

1Department of Neuroscience, University of Pennsylvania Perelman School of Medicine,

Philadelphia, PA 19104, USA

2Monell Chemical Senses Center, Philadelphia, PA 19104, USA

3Department of Pharmacology, University of Washington School of Medicine, Seattle,

WA 98195, USA

4Department of Geriatrics, Qilu Hospital of Shandong University, Jinan, Shandong

250012, China

5Stowers Institute for Medical Research, Kansas City, MO 64110, USA

6Department of Physiology, Johns Hopkins University, Baltimore, MD 21205, USA

7College of Life Sciences, Zhejiang University, Hangzhou, Zhejiang 315008, China

Acknowledgements

We are grateful to Drs. Yoshihiro Yoshihara and Gilad Barnea for generously providing the antibodies against mOR-EG and MOR28, respectively. We thank Penn Vet

Imaging Core (supported by the National Center for Research Resources

1S10RR024583) for obtaining microCT scans of the mouse nasal cavity and Drs.

14 Dewight Williams and Ray Meade at the Penn Electron Microscopy Resource Laboratory

for performing scanning EM experiments. We thank Hugh Huang and Marina Zhang for

their help in quantification of cilia lengths, and Dr. Wenqin Luo’s lab for helpful

discussions. This work was supported by grants from the NIDCD, NIH (F31DC013945 to

R.C.C., R01DC011554 and R01DC006213 to M.M., R03DC008187 to K.Z., and

R21DC013177 to L.H.).

Conceptualization, R.C.C., H.T., K.Z., and M.M.; Investigation, R.C.C., H.T.,

J.W., J.H., J.J., X.C., W.Y., T.C., K.Z., and M.M.; Resources, X.C., L.M., C.R.Y., J.L.P.,

D.R.S., and L.H.; Writing – Original draft, R.C.C., K.Z., M.M.; Writing – Review &

Editing, R.C.C., C.R.Y., L.H., K.Z., and M.M.

The work in this chapter was published in Current Biology in 2015: Challis R.C.,

Tian H., Wang J., He J., Jiang J., Chen X., Yin W., Connelly T., Ma L., Yu C.R.,

Pluznick J.L., Storm D.R., Huang L., Zhao K., and Ma M. (2015). An olfactory cilia

pattern in the mammalian nose ensures high sensitivity to odors. Curr. Biol. 25, 2503-

2512.

15 Summary

sensory neurons (OSNs) in the mouse nose are differentially stimulated depending on the

cell location. We therefore asked whether OSNs in different locations evolve unique

structural and/or functional features to optimize odor detection and discrimination. Using

immunohistochemistry, computational fluid dynamics modeling, and patch clamp

recording, we discovered that OSNs situated in highly stimulated regions have much longer cilia and are more sensitive to odorants than those in weakly stimulated regions.

Surprisingly, reduction in neuronal excitability or ablation of the olfactory G protein in

Intriguingly, type III adenylyl cyclase (ACIII), a key protein in olfactory signal transduction and ubiquitous marker for primary cilia, exhibits location-dependent gene expression levels, and genetic ablation of ACIII dramatically alters the cilia pattern.

These findings reveal an intrinsically programmed configuration in the nose to ensure high sensitivity to odors.

16 Introduction

In order to detect and discriminate a wide variety of stimuli in the environment, sensory organs have developed specialized structures to optimize their functional

performance. For example, cone photoreceptors are densely packed in the fovea of the

retina to achieve visual acuity, and most sensitive mechanoreceptors with small receptive

fields are concentrated in the fingertips for fine touch. However, it is unclear whether the

olfactory system uses a similar scheme to facilitate odor detection.

The mouse main olfactory epithelium contains several million olfactory sensory

neurons (OSNs), each of which expresses one G protein-coupled odorant receptor (OR)

type from a repertoire of ~1200 (Zhang et al., 2007). A few thousand OSNs expressing

the same OR are scattered within one broad zone, while their axons coalesce typically

onto two discrete glomeruli (one medial and one lateral) in each olfactory bulb

(Mombaerts, 2006; Mori and Sakano, 2011). Odor detection begins when odorants are

absorbed into the mucus layer covering the epithelium and bind to ORs on the cilia of

OSNs. Odorant binding leads to increased intraciliary cyclic AMP (cAMP) levels via

sequential activation of olfactory G protein (Golf) and type III adenylyl cyclase (ACIII).

Subsequent opening of a cyclic nucleotide-gated channel and a Ca2+-activated Cl- channel depolarizes OSNs, which fire action potentials and transmit odor information to the brain

(Su et al., 2009).

Olfactory cilia, a hallmark of OSN maturation (Menco and Farbman, 1985;

Schwarzenbacher et al., 2005), are essential for OSNs to convert external chemical stimuli into intracellular electrical responses (McEwen et al., 2008; Menco, 1997). Each

17 OSN possesses a single dendrite that extends apically and ends in a “knob” at the epithelial surface near the nasal air-mucus interface. From each dendritic knob emanate multiple cilia, which contain the key proteins involved in olfactory signal transduction.

Structural and/or functional disruption of olfactory cilia leads to anosmia (Kaneko-Goto et al., 2013; Kulaga et al., 2004; McEwen et al., 2007; McIntyre et al., 2012; Tadenev et al., 2011), which highlights the importance of these organelles for smell perception.

It has recently become clear that microtubule-based cilia are present in nearly all mammalian cell types and play critical roles in many developmental and physiological processes (Berbari et al., 2009; Guemez-Gamboa et al., 2014; Louvi and Grove, 2011).

Defects in cilia formation and/or function lead to ciliopathies, human diseases characterized by symptoms ranging from anosmia and blindness to cystic kidney disorder, brain malformation, obesity, and cognitive deficits (Hildebrandt et al., 2011;

Jenkins et al., 2009; Sheffield, 2011; Valente et al., 2014). Interestingly, cilia in different cell types show distinct morphologies with specific numbers and lengths, suggesting that cilia morphology is under tight biological regulation (Ishikawa and Marshall, 2011). The factors that sculpt cilia morphology have begun to emerge in recent years, but it remains unclear how the length of a cilium impacts its function.

By combining fluorescence and electron microscopy, computational fluid dynamics modeling, mouse genetics, and electrophysiology, we report a novel spatial organization of OSNs regarding their cilia length and cell function. OSNs situated in highly stimulated regions have longer cilia and are more sensitive to odorants than those in weakly stimulated regions. Sensory experience and neuronal activity are not required for the establishment and maintenance of the cilia length pattern, but ACIII, a ubiquitous

18 marker for primary cilia, plays a role in this process. These findings have significant

implications for both sensory information processing and cilia biology.

Results

Olfactory cilia length depends on the cell location in the olfactory epithelium

Given the size and geometry of the nasal cavity, OSNs are differentially

stimulated depending on the cell location. Cells along the dorsal recess, for example,

continuously experience higher airflow rates and odor concentrations than those within

the turbinates (Kimbell et al., 1997; Scott et al., 2014; Yang et al., 2007). This prompted

us to ask whether cells in different locations evolve unique structural and/or functional

features to optimize sensory detection and discrimination. We first examined the

morphology of distinct subtypes of OSNs in two different zones: the dorsal zone and the

ventral zone from whole-mount olfactory epithelial preparations. We only included cells

with sensory cilia, presumably mature OSNs, in our analysis. Using an antibody specific

to the MOR28 receptor (Olfr1507 or MOR244-1) (Barnea et al., 2004), we found no

systematic difference in the cilia morphology of OSNs in the ventral zone (Figure 2.1A

and B). However, antibody staining against the mOR-EG receptor (Olfr73 or MOR174-9) in the dorsal zone (Kaneko-Goto et al., 2008) reveals that the cilia length of mOR-EG cells changes systematically with the cell location (Figure 2.2A-C and Table 2.1); cilia in the anterior septum (Ant) are up to five times longer than those in the posterior septum

(Pos). The middle region (Mid) contains cells with intermediate cilia lengths, and the longest cilia are found in the dorsal recess (DR) (Figures 2.2B and 2.3C). The number of cilia per cell also varies among different regions; for instance, a single cell in the anterior septum has 14.0 ± 2.9 cilia (mean ± SD, n = 43 cells) with similar lengths, versus 5.6 ±

19 Figure 2.1. The ventral zone, as well as the dorsal zone along the endoturbinates, do not exhibit systematic regional differences in cilia length.

In whole mount epithelia from mOR-EG-IRES-gapEGFP mice, mOR-EG cells were examined via the endogenous GFP signal (green) and MOR28 cells via an antibody against the MOR28 receptor (red). (A and B) A coronal section of the nose (A) indicates the approximate regions in which confocal images were taken (B): endoturbinate II, ventral septum, endoturbinate IV, and ectoturbinate 2. See (C) for a sagittal view of the medial surface of the endoturbinates. We noticed that MOR28 cells in the ectoturbinates have slightly longer cilia than those along the septum and endoturbinates. This difference is likely attributed to variations in multiple factors including mucosal environment and cell dynamics among different regions. For simplicity, we refer to regions with mOR-EG and MOR28 positive cells as the dorsal and ventral zones, respectively. Note that mOR-EG and MOR28 cells are observed simultaneously in narrow transitional regions (B, II), which presumably represent the intermediate zone between the dorsal and ventral zones. (C-G) Schematic of the medial surface of endoturbinates II-IV (C): A = anterior; D = dorsal; P = posterior; V = ventral. Images were taken from the anterior and posterior regions of turbinates II (D), II’ (E), III (F), and IV (G). Scale bar in (G) applies to (D-G). (H) The bar graph shows quantification of cilia length (mean ± SD). II – Ant: 10.1 ± 4.2 µm, n = 53 cilia; Pos: 8.3 ± 4.1 µm, n = 65 cilia; II’ – Ant: 8.7 ± 3.4 µm, n = 61 cilia; Pos: 9.2 ± 4.2 µm, n = 55 cilia; III – Ant: 9.1 ± 2.8 µm, n = 66 cilia; Pos: 9.3 ± 6.7 µm, n = 57 cilia; IV – Ant: 7.8 ± 1.9 µm, n = 54 cilia; Pos: 8.0 ± 2.9 µm, n = 64 cilia; one-way ANOVA, F = 111.4; Tukey’s multiple comparisons test, **** p < 0.0001, ns – not significant. See Figure 2.2 and Table 2.1 for quantification from the septum.

1.8 cilia (n = 47 cells) in the posterior septum, where cells may have more cilia that are too short to be counted. Control experiments indicate that the short cilia are not due to failure of mOR-EG protein transport to the distal cilia (Figure 2.3A and B). 20 Figure 2.2. Olfactory cilia length depends on the cell location in the olfactory epithelium.

(A) Subdivision of the dorsal zone of the mouse nasal septum. The olfactory epithelium is outlined in blue. The white dashed line marks the dorsal airstream during inspiration. No mOR-EG cells are found in the gray region, which is outside of the dorsal zone. Ant = anterior; Mid = middle; Pos = posterior; DR = dorsal recess. MOB = main olfactory bulb; NPH = nasopharynx; RE = respiratory epithelium; SO = septal organ; VNO = vomeronasal organ. The yellow star denotes the most dorsal point where the nasal septal cartilage meets the ethmoid bone and was used to facilitate comparisons between tissues (see Experimental Procedures). (B) Whole-mount olfactory epithelia were stained with the mOR-EG antibody (n = 10 animals). Confocal images were taken from the four different regions shown in (A). Arrows mark dendritic knobs, which in areas with longer cilia, are presumably covered by ciliary mesh (see also Figures 2.3 and 2.4). (C) Cumulative frequency (%) of cilia length from mOR-EG cells in the dorsal recess (magenta), anterior (orange), middle (gray), and posterior (blue) regions. The bar graph shows quantification of cilia length (mean ± SD); Tukey’s multiple comparisons test, **** p < 0.0001. See also Table 2.1. (D) Surface SEM images were taken from the anterior and posterior septum (n = 3 animals).

Interestingly, mOR-EG cells along the surface of endoturbinates II-IV do not exhibit dramatic regional differences in cilia length, and most cilia resemble those found in the middle region along the septum (Figure 2.1C-H).

To test whether the location-dependent cilia length pattern along the septum and dorsal recess applies to OSNs expressing other dorsal zone ORs, we utilized an antibody specific to MOR18-2 (Olfr78) (Pluznick et al., 2011), as well as a plant lectin, Dolichos biflorus agglutinin (DBA) (Lipscomb et al., 2002), which labels subsets of OSNs from 21 Figure 2.3. mOR-EG proteins are distributed throughout the entire cilia, and DBA labels OSNs other than mOR-EG and MOR18-2 cells.

(A and B) Whole-mount olfactory epithelia from transgenic mOR-EG-IRES-gapEGFP mice (n = 3 animals) were double-stained with antibodies against GFP, which labels the entire ciliary membrane, and mOR-EG, which labels the receptor protein. Co-localization of the mOR-EG and GFP signals indicates that the mOR-EG protein is distributed along the entire cilia. Confocal images were taken from the anterior (A) and posterior septum (B). Note that a few cells in the posterior region are only stained with the mOR-EG antibody because these cells express one of the endogenous mOR-EG alleles and thus do not express EGFP. (C and D) mOR-EG cells (C) and OSNs under SEM (D) from the dorsal recess have visible dendritic knobs (marked by arrows) in regions with lower cell density. Scale bar in (C) applies to (A-C). (E and F) DBA labels OSNs other than mOR-EG (E) and MOR18-2 cells (F). Scale bar in (F) applies to (E and F).

tens of different OR types (Lipscomb et al., 2003). The cilia lengths of MOR18-2 and

DBA cells display the same location-dependent pattern as observed with mOR-EG cells

(Figure 2.3E and F, Figure 2.4, and Table 2.1). Furthermore, under scanning electron microscopy (SEM), the dorsal recess and anterior septum exhibit the characteristic

22 Figure 2.4. The cilia length pattern applies to OSNs expressing other OR types.

(A) Whole-mount olfactory epithelia were stained with the MOR18-2 antibody (n = 5 animals). Confocal images were taken from the dorsal recess, anterior, middle, and posterior septum. The arrow marks a dendritic knob. (B) Cumulative frequency (%) of cilia length from MOR18-2 cells in all four regions. The bar graph shows quantification of cilia length (mean ± SD); Tukey’s multiple comparisons test, **** p < 0.0001. (C) Whole-mount olfactory epithelia were stained with DBA (n = 16 animals stained with DBA alone or combined with either the mOR-EG or MOR18-2 antibody) and images were taken as in (A). (D) Cumulative frequency (%) of cilia length from DBA+ cells in all four regions. The bar graph shows quantification of cilia length (mean ± SD); Tukey’s multiple comparisons test, ** p < 0.01, **** p < 0.0001. See also Figure 2.3 and Table 2.1.

Cilia Length (µm, mean ± SD ), Cilia Number (n) Genotype Antibody Statistical Test F p DR n Ant n Mid n Pos n mOR-EG 29.6 ± 11.0 99 14.7 ± 10.7 116 8.1 ± 4.6 106 2.8 ± 2.1 126 One-way ANOVA 228.2 < 0.0001

C57Bl/6J MOR18-2 23.9 ± 4.6 89 14.9 ± 5.9 97 7.5 ± 2.9 76 2.4 ± 1.1 115 One-way ANOVA 535.7 < 0.0001

DBA 34.6 ± 11.5 44 22.9 ± 10.1 42 10.2 ± 5.3 47 4.7 ± 2.1 51 One-way ANOVA 131.2 < 0.0001

Table 2.1. Cilia length quantification from C57Bl/6J mice.

In all experiments, pairwise comparisons result in significant differences in cilia length between regions.

meshwork of olfactory cilia (McEwen et al., 2008), while the posterior septum reveals much shorter cilia (Figures 2.2D and 2.3D).

Because OSNs in the ventral zone do not display substantial regional differences in cilia length (Figure 2.1), our subsequent analysis focuses on the cilia pattern within the23 dorsal zone, specifically along the medial aspect where we observed robust location- dependent changes in cilia length.

The cilia pattern is positively correlated with odorant absorption

We next asked whether cilia length is correlated with sensory stimulation (e.g., odorant absorption), which also shows location dependence. Because both odorant absorption and cilia length show little regional variation throughout the ventral zone

(Figure 2.1) (Scott et al., 2014), we restricted our correlation analysis to the dorsal zone

where significant regional differences in cilia length are observed. To quantify the cilia

pattern, we measured the cilia length of mOR-EG cells along the medial (dorsal recess

and septum) and lateral (endoturbinates) aspects of the nasal cavity and generated

heatmaps (Figure 2.5A). To assess odorant absorption in the nasal cavity, we built a 3D

computational fluid dynamics model of the mouse nose based on micro-computed

tomography (microCT) scans from a young adult animal. We simulated a series of

parameters under physiological conditions of sniffing and, based on the physicochemical

properties of eugenol, a ligand of the mOR-EG receptor, generated a steady state odorant

absorption map throughout the nose (Figure 2.5B). We found a significant positive

correlation between the simulated eugenol absorption pattern and the mOR-EG cilia

length heatmaps (Figure 2.5C). Eugenol absorption is highest in the dorsal recess and

decreases from the anterior to the posterior nasal cavity due to the gradual reduction of

local airflow rates and depletion of odor molecules remaining in the air phase. Odorants

with moderate to high mucosal solubility exhibit comparable absorption gradients (Scott

et al., 2014), and because the cilia pattern applies to multiple OR types (Figures 2.2-2.4),

24 the correlation suggests that in the dorsal zone OSNs with longer cilia are concentrated in highly stimulated regions of the nose.

Figure 2.5. The cilia pattern is positively correlated with odorant absorption.

The solid black lines mark the contour of the olfactory epithelium along the medial (dorsal recess and septum) and lateral (endoturbinates) aspects of the dorsal zone. A = anterior; D = dorsal; P = posterior; V = ventral. (A) Cilia length heatmaps. There are no mOR-EG cells in the gray region. (B) Computational simulation of eugenol absorption along the medial and lateral aspects of the nasal cavity. The nasal airflow simulation assumes steady-state inspiration at 100 mL/min (sniffing state for mouse) with a non-saturating eugenol concentration of 100 ppm in the inspired air. Odorant absorption (µM/L) is linearly scaled to the incoming odorant concentration up to ~10,000 ppm, which is beyond the typical range of odor stimulation. (C) Odorant absorption values are plotted versus the corresponding average cilia length in each location. Cilia length is positively correlated with eugenol absorption (linear regression fitting: y = 35.8x -167.8; r = Pearson correlation).

The cilia pattern is established by an activity-independent mechanism

Because of the positive correlation between the cilia pattern and odorant absorption map, we considered whether OSN activation influences cilia length. Cyclic

AMP signaling has been reported to positively regulate cilia length in several cell types including OSNs (Abdul-Majeed et al., 2012; Besschetnova et al., 2010; Kaneko-Goto et al., 2013). We therefore asked whether odor-induced cAMP signaling is required for establishing the cilia pattern. We first examined olfactory epithelia from Gγ13-/- mice, in

25 which Cre-mediated ablation of Gγ13 prevents proper formation and ciliary targeting of

Golf in OSNs and eliminates odor-induced electroolfactogram (EOG) signals (Li et al.,

2013). Surprisingly, the cilia pattern remains completely intact in these animals (Figure

2.6A-C and Table 2.2), suggesting that Golf-mediated activity is not required for the formation and maintenance of the cilia pattern. We also tested the effects of sensory deprivation and dampened neuronal excitability on the cilia pattern by examining the olfactory epithelia from animals that underwent unilateral neonatal naris closure or overexpressed the inward rectifying K+ channel Kir2.1 (Yu et al., 2004), respectively. In both cases, the cilia length gradient is preserved; cells in the dorsal recess and anterior septum have much longer cilia than those in the posterior septum (Figure 2.6D-G and

Table 2.2). Together, these results imply that the cilia pattern is established by an activity-independent mechanism. Moreover, the cilia pattern is established at birth

(Figure 2.7 and Table 2.2), maintained into adulthood, and restored following regeneration of the olfactory epithelium (Figure 2.8), suggesting that the pattern is intrinsically programmed.

Genetic ablation of ACIII disrupts the cilia pattern

Since ACIII is a ubiquitous marker for neuronal cilia (Bishop et al., 2007) and cAMP may regulate olfactory cilia length (Kaneko-Goto et al., 2013), we considered whether Golf-independent, ACIII-mediated signaling impacts the cilia length of OSNs and examined the cilia pattern in ACIII-/- mice. Remarkably, the pattern is significantly disrupted in these animals (Figure 2.9A-C and Table 2.2). Consistent with the notion that ablation of ACIII delays terminal differentiation of OSNs (Lyons et al., 2013), we found that ~30% of labeled cells in knockout mice do not possess cilia. These “bare knobs” are

26 Figure 2.6. The cilia pattern is established by an activity-independent mechanism.

(A and B) Whole-mount olfactory epithelia from Gγ13 littermate controls (A) and Gγ13-/- mice (B) (n = 3 animals per genotype) were stained with MOR18-2 (red) and DBA (green). Confocal images were taken from the dorsal recess, anterior, and posterior septum. Arrows mark dendritic knobs. (C) Cumulative frequency (%) of cilia length from MOR18-2 cells in different regions. The bar graph shows quantification of cilia length (mean ± SD); Tukey’s multiple comparisons test, ns – not significant. (D) Four weeks after naris closure (n = 8 animals), during which one nostril is deprived of both airflow and odorant influx, the olfactory epithelium was stained and imaged as in (A). (E) Cumulative frequency (%) of cilia length from MOR18-2 cells in different regions in the deprived side. The bar graph shows quantification of cilia length (mean ± SD); Tukey’s multiple comparisons test, ** p < 0.01, **** p < 0.0001. Cilia are slightly longer in all regions compared to un-manipulated controls (see also Figure 2.4 and Tables 2.1 and 2.2), which may be attributed to multiple factors like better protection from physical damage and alterations in cell dynamics (i.e., OSN maturation stages), microenvironment, and/or expression of signaling molecules including upregulation of ACIII (Coppola and Waggener, 2012; He et al., 2012) (see Discussion). (F) Whole-mount olfactory epithelia from Kir2.1 transgenic mice (n = 3 animals) were stained and imaged as in (A). Scale bar in (F) applies to all images. In these mice, olfactory marker protein (OMP) drives the expression of the inward rectifying K+ channel Kir2.1, which results in dampened neuronal excitability in mature OSNs but does not affect the upstream olfactory signal transduction events. (G) Cumulative frequency (%) of cilia length from MOR18-2 cells in different regions in Kir2.1 mice. The bar graph shows quantification of cilia length (mean ± SD); Tukey’s multiple comparisons test, ** p < 0.01, **** p < 0.0001. See also Table 2.2. 27 Figure 2.7. The cilia pattern is evident throughout postnatal development.

Whole-mount olfactory epithelia were stained with DBA at P0 (A), P7 (C), and P14 (E). Scale bar in (E) applies to all images. Arrows mark dendritic knobs. (B, D, and F) Cumulative frequency (%) of cilia length from DBA+ cells in all three regions at different ages. The bar graph shows quantification of cilia length (mean ± SD); Tukey’s multiple comparisons test, **** p < 0.0001. See also Table 2.2.

rarely encountered in wild-type mice, especially in regions with long cilia. To minimize the potential developmental effects of ACIII ablation, we only examined cells with cilia,

which are presumably mature. The differences in cilia length between the dorsal recess,

anterior, and posterior septum are considerably reduced, and cells in these regions are

nearly indistinguishable from one another. OSNs in the dorsal recess and anterior septum

possess much shorter cilia compared to controls, suggesting that ACIII-mediated signaling plays a role in regulating cilia growth. We then asked whether wild-type animals would have higher Adcy3 expression levels in areas with longer cilia versus 28 Figure 2.8. The cilia pattern is restored following OSN regeneration.

(A-C) Three-week-old animals were injected with either PBS (A) or methimazole (B and C). Whole- mount olfactory epithelia were stained with DBA four days (B) or eight weeks (A and C) post injection. Scale bar in (C) applies to all images. For simplicity, the cilia lengths from the anterior and posterior septum are compared and quantified. (D) Cumulative frequency (%) of cilia length from DBA+ cells in the anterior and posterior regions eight weeks post PBS (control) or methimazole (regenerated) injection. The bar graph shows quantification of cilia length (mean ± SD). Control – Ant: 14.6 ± 6.6 µm, n = 58 cilia; Pos: 5.2 ± 2.4 µm, n = 46 cilia; Regenerated – Ant: 15.6 ± 4.8 µm, n = 47 cilia; Pos: 4.0 ± 2.0 µm, n = 43 cilia; two-way ANOVA, main effect of region: F = 256.6, p < 0.0001; main effect of treatment: F = 0.03, p = 0.87; Tukey’s multiple comparisons test, ns – not significant.

29 shorter cilia. Using qRT-PCR, we found that the Adcy3 expression level in the dorsal

recess and anterior septum is ~40% higher than that in the posterior septum (Figure

2.9D). Together, these results reveal that Adcy3 is correlated with cilia length and may be

a required component for the establishment of the cilia pattern, independent of odor-

induced activity.

Figure 2.9. Genetic ablation of ACIII disrupts the cilia pattern.

(A and B) Whole-mount olfactory epithelia from ACIII+/+ (n = 4 animals) (A) and ACIII-/- mice (n = 6 animals) (B) were stained with MOR18-2 (red) and DBA (green). Scale bar in (B) applies to all images. Arrows mark dendritic knobs. (C) Cumulative frequency (%) of cilia length from DBA+ cells in different regions. The bar graph shows quantification of cilia length (mean ± SD); Tukey’s multiple comparisons test, ns – not significant. See also Table 2.2. On average, cells in all regions possess 6.7 ± 2.8 cilia (n = 50 cells), similar to that observed in the posterior septum of wild-type mice (see Results). (D) Adcy3 gene expression in wild-type olfactory epithelia (n = 3 animals and 3 replicates per animal) was measured using qRT-PCR and normalized to Omp expression. Adcy3 expression (mean fold change ± SD) in the dorsal recess and anterior regions relative to the posterior septum: DR, 1.36 ± 0.08; Ant, 1.43 ± 0.13; one-way ANOVA, Dunnett’s multiple comparisons test, F = 20.2, ** p < 0.01.

30 Cilia Length (µm, mean ± SD ), Cilia Number (n) Genotype or Condition Antibody Statistical Test F p DR n Ant n Pos n

Gγ13+/+ MOR18-2 24.4 ± 5.6 30 15.9 ± 5.6 38 2.4 ± 1.8 50 Two-way ANOVAa 273.2 < 0.0001 Gγ13-/- MOR18-2 28.3 ± 11.6 30 16.6 ± 8.2 47 2.8 ± 1.6 46

C57Bl/6J Naris Closed MOR18-2 34.6 ± 11.8 55 28.8 ± 11.4 48 6.6 ± 3.5 50 One-way ANOVA 118.4 < 0.0001

Kir2.1 MOR18-2 24.3 ± 6.6 52 20.3 ± 8.1 50 5.0 ± 2.7 46 One-way ANOVA 124.8 < 0.0001

C57Bl/6J P0 DBA 23.3 ± 5.5 35 15.3 ± 5.9 111 3.1 ± 1.8 66 One-way ANOVA 220.3 < 0.0001

C57Bl/6J P7 DBA 26.3 ± 7.8 34 16.5 ± 7.4 114 3.3 ± 1.6 110 One-way ANOVA 264.5 < 0.0001

C57Bl/6J P14 DBA 32.6 ± 10.3 28 18.8 ± 8.2 97 3.0 ± 1.9 79 One-way ANOVA 224.8 < 0.0001

ACIII+/+ DBA 27.0 ± 16.2 39 14.7 ± 6.2 48 5.1 ± 2.6 43 27.9 Two-way ANOVA (genotype x region < 0.0001 ACIII-/- DBA 9.3 ± 8.5 59 8.6 ± 8.1 50 5.5 ± 4.6 52 interaction)

Table 2.2. Cilia length quantification from mice tested under various conditions.

a For Gγ13 experiments, there is no interaction between genotype and region. The main effect of region is shown here because the multiple comparisons between genotypes are already included in Figure 2.6C, which shows no significant differences in cilia length for each region.

OSNs with longer cilia are more sensitive to odorants

To determine if cilia length impacts the function of OSNs, we performed patch clamp recordings on individual OSNs in the intact olfactory epithelium (Grosmaitre et al.,

2006) and measured eugenol-induced responses from genetically labeled mOR-EG cells

(Oka et al., 2006). We first recorded from cells in the dorsal recess and posterior septum since these regions contain OSNs with the longest and shortest cilia, respectively.

Compared to posterior cells, OSNs in the dorsal recess showed a lower threshold to eugenol and a larger maximum response at all pulse durations (Figure 2.10A and B). To test whether OSNs expressing ORs other than mOR-EG exhibit location-dependent differences in odorant sensitivity, we measured odorant-induced responses from randomly selected, unlabeled cells in the dorsal recess and anterior and posterior septum of wild-type mice. As expected, cells in both the dorsal recess and anterior regions

Figure 2.10. OSNs with longer cilia are more sensitive to odorants.

(A) Representative traces from mOR-EG cells recorded alternately from the dorsal recess (n = 10 cells) and posterior (n = 9 cells) septum under current clamp mode. To stimulate cells with different eugenol concentrations, we delivered pressure pulses at different lengths (up to 400 ms) from a pipette containing 10 µM eugenol. Arrows mark the onset of the stimuli and dashed lines indicate -60 mV. (B) Summary of eugenol-induced responses (mean ± SE). Dose response curves are fit with the Hill equation. K1/2 is 12.7 and 35.0 ms for cells in the dorsal recess and posterior septum, respectively (two- way ANOVA, F = 3.2, ** p < 0.01). The dendritic knobs of mOR-EG cells in the anterior septum appeared smaller and slightly deeper from the surface, which made recordings from this region extremely difficult. In contrast, the dorsal recess has more cells to choose from and the posterior septum contains slightly bigger knobs. The anterior septum is included in randomly patched OSNs and in EOG recordings (see below). (C) Representative traces from randomly selected cells recorded from the dorsal recess (n = 28 cells), anterior (n = 31 cells), and posterior septum (n = 36 cells). We delivered pressure pulses as in (A) from a pipette containing a mixture of ten odorants (each at 10 µM). OR identity and ligand specificity were unknown since cells were arbitrarily chosen for recording. Therefore, approximately 50% of all recorded cells showed odorant-induced responses. (D) Summary of odor-induced responses from randomly selected cells. K1/2 is 15.1, 43.4, and 80.8 ms for cells in the dorsal recess, anterior and posterior septum, respectively (two-way ANOVA, F = 6.3, **** p < 0.0001). Randomly selected cells showed lower sensitivity than mOR-EG cells because some OSNs were only weakly stimulated by the odorant mixture. The difference in response sensitivity between anterior and posterior cells was further validated using EOG recordings (see also Figure 2.11). 32 showed larger responses to odorants at all pulse lengths compared to those in the posterior region (Figure 2.10C and D, and Figure 2.11). Together, these data support that

in the dorsal zone longer cilia render OSNs with higher sensitivity and stronger responses

to odor stimulation.

Figure 2.11. Odor stimulation elicits larger EOG signals in the anterior versus the posterior septum.

(A) Representative EOG responses in the anterior and posterior septum (n = 10 animals). The arrow marks the onset of the stimulus (an odorant mixture; see Experimental Procedures). (B) Average peak amplitudes from EOG recordings (mean ± SE). Ant: 10.0 ± 4.1 mV; Pos: 3.0 ± 1.4 mV; paired two- tailed t test, * p < 0.05.

Discussion

This study reveals a novel spatial organization of OSNs in the mouse nose, i.e.,

OSNs with longer cilia and higher sensitivity have better access to odor molecules.

Sensory experience and neuronal activity are not required for establishing the cilia length

gradient, which is determined by intrinsic mechanisms. Intriguingly, ACIII exhibits

location-dependent gene expression levels, and genetic ablation of ACIII dramatically

alters the cilia pattern, independent of odor-induced signaling. These findings offer new

insights into peripheral coding and processing of odor information and regulation of cilia

morphology and function. Moreover, this work has broad implications for how sensory

receptors optimize detection sensitivity in various physiological contexts. 33 Spatial organization in the main olfactory epithelium

The zonal organization of OR gene expression in the rodent nose has prompted active investigation into a potential spatial component in peripheral olfactory coding.

According to the “sorption theory”, the physicochemical properties of odorants (e.g., volatility and water solubility) influence their spatial absorption across the main olfactory epithelium (Kent et al., 1996; Schoenfeld and Cleland, 2006; Scott, 2006; Scott et al.,

2014). Hydrophilic molecules, which are highly absorptive and better retained in the aqueous mucus, are deposited in the dorsal zone along the medial aspect of the nose where the airflow reaches first. Hydrophobic molecules, on the other hand, are less absorptive and uniformly deposited throughout the dorsal and ventral zones in both the medial and lateral regions (Scott et al., 2014). Here, we describe a spatial organization in which olfactory cilia length depends on OSN location in the olfactory epithelium. The dorsal zone exhibits a robust cilia length gradient that is positively correlated with odorant absorption (Figure 2.5). The ventral zone, however, shows no location-dependent changes in cilia length (Figure 2.1), presumably suited for detecting hydrophobic odorants, which exhibit a relatively flat absorption pattern (Scott et al., 2014).

Within the dorsal zone, OSNs expressing the same OR along the medial and lateral regions target medial and lateral glomeruli, respectively (Schoenfeld and Cleland,

2005). Generally, OSNs in the dorsal recess and septum innervate medial glomeruli, while those along and within the turbinates innervate lateral glomeruli. Dorsal zone

OSNs with very long cilia are only observed in the dorsal recess and anterior septum

(Figures 2.2 and 2.4), a finding that may contribute to a previously reported medial- lateral timing difference in olfactory bulb neurons (Zhou and Belluscio, 2012).

34 The most dramatic difference in cilia length is found along the medial aspect of

the dorsal zone; i.e., a single medial glomerulus receives inputs from OSNs that are heterogeneous in their cilia lengths (Figures 2.2, 2.4, and 2.5). Patch clamp analysis reveals that OSNs in the dorsal recess and anterior septum (with longer cilia) are more sensitive to odorants compared to cells in the posterior septum (with shorter cilia) (Figure

2.10). This can be explained by the fact that longer cilia have a larger surface area for contacting odors. Based on the cable theory, the length constant of olfactory cilia is estimated to be ~220 µm when the membrane is not leaky (i.e., with negligible channel opening). This suggests that upon stimulation by faint odors, the electrical signals generated along a long cilium can travel far enough to the cell body and contribute to membrane depolarization. Due to spatial summation, cells with longer cilia would show a higher sensitivity and larger response to low concentrations of odors. Conceivably, placing OSNs with longer cilia in highly stimulated regions would increase their chance of encountering faint odors and boost the sensitivity of the system.

Compared to their long-cilia counterparts, short-cilia cells have a higher response threshold and are less likely to reach saturation, making them better suited for coding intensity differences at higher concentrations. Therefore, placing OSNs with shorter cilia in the posterior septum, which is only reached by strong odor stimuli, would ensure a broad dynamic range of the system. If these neurons were designed to carry redundant information, OSNs in the posterior septum should grow longer cilia to compensate for weaker stimulation. Our work reveals the opposite scenario, suggesting that the peripheral olfactory system is spatially organized to match cell sensitivity with the incoming stimuli, adding a new dimension to the “sorption theory”.

35 Regulation of olfactory cilia length and the cilia pattern

Contrary to the common belief that OSNs have rather uniform morphology, we

demonstrate that OSNs are intrinsically programmed to grow longer or shorter cilia

depending on their location in the olfactory epithelium. Intriguingly, the cilia length

gradient is observed throughout development, after regeneration, or following sensory

deprivation or elimination of spontaneous and evoked OSN activity (Figures 2.6-2.8).

These findings exclude a number of factors possibly involved in regulating the formation

and maintenance of the cilia pattern (i.e., the length gradient).

Genetic ablation of ACIII disrupts the cilia pattern (Figure 2.9), revealing a

potential role of ACIII in regulating cilia length and the establishment of the cilia pattern.

Curiously, Golf-dependent activity is not required for the cilia length gradient, suggesting

that ACIII acts via a Golf-independent mechanism. It is possible that odor-induced

intracellular cAMP changes are transient and not sufficient to impact the cilia pattern, but

ligand-independent ACIII activity may cause sustained cAMP elevation to affect cilia growth and maintenance. Although we cannot rule out the possibility that ablation of

ACIII sequesters some OSNs at a developmentally delayed stage (Lyons et al., 2013), thus preventing the growth of longer cilia, our finding is consistent with a previously reported role of cAMP in mediating olfactory cilia length (Kaneko-Goto et al., 2013).

Given that ciliary localization of ACIII is not required for cilia growth (McIntyre et al.,

2015), the pattern may be the result of intrinsic, location-dependent regulation of Adcy3

gene expression, leading to differential cAMP levels and transcription of downstream

cilia proteins. This is supported by the fact that Adcy3 expression is higher in regions with longer cilia versus shorter cilia (Figure 2.9). The positive correlation between ACIII

36 levels and cilia length is also observed following sensory deprivation, which results in upregulation of ACIII mRNA and protein levels (Coppola and Waggener, 2012; He et al.,

2012) and increased cilia length in all regions throughout the epithelium (Figure 2.6).

These data support the ACIII-/- phenotype and a potential causal link between ACIII and cilia length. Interestingly, pharmacological inhibition of ACIII has been reported to increase primary cilia length in certain cell types (Ou et al., 2009). This apparently conflicting finding may be because (1) ACIII has differential effects on various cell types and/or (2) the pharmacological treatments affect molecular targets other than ACIII.

A number of molecules (cAMP, Centrin2, Goofy, and Bardet-Biedl syndrome, intraflagellar transport, and Meckel Gruber syndrome proteins) play critical roles in the

formation and/or maintenance of olfactory cilia (Kaneko-Goto et al., 2013; Kulaga et al.,

2004; McIntyre et al., 2012; Pluznick et al., 2011; Tadenev et al., 2011; Williams et al.,

2014; Ying et al., 2014). Disruption of these cilia-related proteins results in abnormal

ACIII expression and shortened, malformed, or absent olfactory cilia. Whether or not these factors show location-dependent expression and are involved in the establishment of the cilia pattern remains to be determined. Interestingly, Adcy3 expression is comparable between the dorsal recess and anterior septum (Figure 2.9), even though these regions exhibit different cilia lengths, indicating that additional molecules may contribute to the location-dependent regulation of cilia length. Together, it is likely that the formation and maintenance of the cilia pattern is governed by multiple factors, which remain to be identified in future investigations.

Experimental Procedures

Animals

37 All animals were housed in conventional (non-barrier) animal facilities and were

3-8 weeks old, unless otherwise specified. Wild-type C57Bl/6J mice were originally purchased from Jackson Laboratories. The transgenic mouse line mOR-EG-IRES- gapEGFP (IRES = internal ribosome entry site; gapEGFP = GAP-43 N-terminal 20 amino acids fused to enhanced green fluorescent protein) was provided by Dr. Kazushige

Touhara’s lab (Oka et al., 2006). Olfactory specific Gγ13-/- animals were generated by

crossing mice with a floxed Gng13 gene, which encodes Gγ13 protein (Li et al., 2013),

and OMPCre mice, in which OMP drives expression of Cre recombinase in mature OSNs

(Li et al., 2004). All Gγ13-/- animals tested were also OMPCre/Cre (Gγ13-/-/OMPCre/Cre), but

displayed similar cilia patterns as Gγ13+/+/OMPCre/Cre and Gγ13+/-/OMPCre/Cre mice. All

littermate controls had at least one functional copy of Gng13 and Omp. Kir2.1 mice were

obtained by crossing OMP-IRES-tTA mice, in which OMP positive cells also express the

transcriptional activator tTA directed by IRES, and teto-Kir2.1-IRES-taulacZ mice, in

which the tTA-responsive promoter teto drives the bicistronic expression of the inward

rectifying potassium channel Kir2.1 and the marker tau-lacZ (Yu et al., 2004). ACIII-/-

mice and ACIII+/+ littermate controls were bred from heterozygous ACIII+/- mice (Wong

et al., 2000). Although these genetically modified mouse lines were generated using

embryos from mixed C57Bl/6J x 129 or C57Bl/6J x DBA2J backgrounds, they were all

crossed to C57Bl/6J mice for breeding. For unilateral naris closure, one nostril was

briefly cauterized (~1 s) using a cauterizer (Fine Science Tools, Foster City, CA, USA) at

postnatal day 3. After 4 weeks, naris closure was confirmed and olfactory epithelia were

examined. To induce degeneration of the olfactory epithelium, three-week-old animals

were injected intraperitoneally with a single dose (75 mg/kg) of methimazole (Santa Cruz

38 Biotechnology, Santa Cruz, CA, USA) in PBS. Animals were sacrificed at different time points (4 days, 2 weeks, 3 weeks, and 8 weeks after injection) in order to ensure degeneration of the epithelium and monitor recovery over time (Suzukawa et al., 2011).

All procedures were approved by the Institutional Animal Care and Use Committee.

Immunohistochemistry

Mice were anesthetized by ketamine/xylazine injection (200 and 20 mg/kg body weight) and then decapitated. Newborn pups were anesthetized by hypothermia. Partially dissected heads were fixed in 4% paraformaldehyde (Sigma-Aldrich, St. Louis, MO,

USA) in 1X phosphate buffered saline (PBS) overnight at 4°C and washed 3x for 5 min in PBS the next day. The nasal septum or turbinates were dissected out en bloc, washed

3x in PBS, and blocked for 1–2 h at room temperature (RT) in 3% bovine serum albumin

(Jackson ImmunoResearch Laboratories, West Grove, PA, USA) in PBS. Incubation with primary antibodies in blocking solution was performed overnight at 4°C. The primary antibodies include guinea pig anti-mOR-EG (1:250), rabbit anti-GFP (1:1000; A11122,

Life Technologies, Carlsbad, CA, USA), rabbit anti-MOR18-2 (1:400), biotinylated

Dolichos biflorus agglutinin (DBA) (5 mg/mL, 1:300 working dilution; B-1035, Vector

Laboratories, Burlingame, CA, USA), and rabbit anti-MOR28 (1:6000). Tissues were washed 3x with 0.3% Triton-X-100 (Roche Diagnostics, Indianapolis, IN, USA) in PBS

(TPBS), and then incubated for 1 h at RT with secondary antibodies conjugated to Alexa

Fluors (Life Technologies). The secondary antibodies include goat anti-guinea pig IgG

(1:400; A11073 and A11075), donkey anti-rabbit IgG (1:400, A21206 and A10042), and streptavidin conjugate (1:1000; S32354 and S11226). Tissues were then washed 2x for 5 min in TPBS and 1x for 5 min in PBS. To facilitate comparison among different

39 preparations, olfactory epithelia along the septum were marked with a small quantity of colored tissue dye (1163, Bradley Products, Inc., Bloomington, MN, USA) at a fixed location, defined as the most dorsal point where the nasal septal cartilage meets the ethmoid bone (see Figure 2.2A). Olfactory mucosa were peeled away from the underlying bone and mounted in Vectashield mounting medium (Vector Laboratories).

Images (z-step = 1 µm) were taken under a Leica TCS SP5 II confocal microscope (Leica

Microsystems, Buffalo Grove, IL, USA) with a 40x oil objective. Cilia were traced using

Leica LAS AF Lite software.

Regional subdivisions and cilia quantification

The olfactory epithelium along the septum was divided into four regions (DR,

Ant, Mid, and Pos) based on the cilia morphology characteristically found in each area.

During imaging, regional boundaries were measured with respect to their distance from a

fixed location, which was marked with dye prior to mounting the tissues (see

Immunohistochemistry and Figure 2.2A). The center of the Ant, Mid, and Pos regions is

approximately 1.5 mm anterior, 0.5 mm ventral; 1 mm posterior, 0.5 mm ventral; and 2

mm posterior, 1.5 mm ventral to the dye mark, respectively. The DR can be identified

without reference to the dye mark since it is not attached to the septum and easily

recognized by gross anatomy. The Mid and Pos regions (i.e., where cells with shorter

cilia are observed) are typically the smallest areas, while the DR and Ant regions (i.e.,

where cells with longer cilia are observed) are the largest areas. Cilia from the Mid and

Pos regions are mostly non-overlapping and can be unambiguously measured. In the DR

and Ant, many cilia are difficult to trace from the origin to the end, but some cells stand

alone and allow accurate measurement of their cilia length (see Figure 2.3). Because all

40 animals under the same condition showed similar cilia length patterns, we sampled cilia from representative images for each condition.

Scanning electron microscopy

Samples for SEM were dissected and fixed in 2.5% glutaraldehyde and 2.0% paraformaldehyde in 0.1 M cacodylate buffer (pH 7.4) overnight at 4ºC. After several buffer washes, samples were post-fixed in 2.0% osmium tetroxide for 1 hr, washed again in buffer, and dehydrated in a graded ethanol series. Samples were treated several times with hexamethyldisilazane (HMDS) and then allowed to air dry prior to mounting and sputter coating with gold/palladium. SEM examinations were made, and images were taken in a Philips XL20 scanning electron microscope. qRT-PCR

The DR, Ant, and Pos regions of the olfactory epithelia from three wild-type

littermates were dissected in ice-cold RNAse-free 1X PBS and snap frozen on dry ice.

The left and right epithelia of each animal were pooled; biological replicates remained

separate. RNA was purified using the RNAeasy Mini Kit (Qiagen, Valencia, CA, USA),

including a DNAse I digestion step (Qiagen). Total RNA was reverse transcribed using

SuperScript III First Strand Synthesis System (Invitrogen, Carlsbad, CA, USA).

Quantitative PCR was performed using SYBR Green PCR Master Mix (Applied

Biosystems, Carlsbad, CA, USA) and 1 ng cDNA (i.e., 1 ng RNA converted 1:1 to

cDNA) per reaction. Primers were designed to span an exon-exon junction whenever

possible to prevent amplification of genomic DNA. Adcy3 forward –

CCCAGAGATGGAAACACGCT; Adcy3 reverse – TTTGTCATCAGCCAGGGGTC;

Omp primers were used as reported previously (Li et al., 2013). All biological replicates

41 were run in triplicate. Adcy3 expression was analyzed using the comparative cycle

threshold (CT) (ΔΔ CT) method and was normalized to Omp expression. Fold change is reported as mean ± standard deviation (SD) across all three animals.

Cilia length heatmaps

Cilia length heatmaps were generated by averaging the cilia lengths of mOR-EG

cells from over 60 evenly distributed locations (each at 400 x 400 μm2) throughout the

dorsal recess, septum, and endoturbinates and filling in the non-measured areas by linear

interpolation function.

Computational fluid dynamics model and correlation analysis

A six-week-old B6129PF2/J mouse was euthanized with CO2 and decapitated.

The head was fixed in 4% paraformaldehyde overnight at 4°C. The specimen was then

wrapped and sealed with Parafilm before being placed in a Viva CT 40 microCT scanner

(Scanco USA, Inc.). A total of 3300 images, 2048 x 2048 pixels each and with an

isotropic resolution of 10.5 µm per pixel, were obtained with a bulb setting of 70 kv and

114 µA. A 3D median filter with a mask of 5 x 5 x 7 pixels was applied to remove image

noise and preserve the edge between the airway and mucosa.

An anatomically accurate 3D nasal model was constructed based on the segmentation of the microCT images using three different types of software: AMIRA

(Visualization Sciences Group, Burlington, MA, USA), ICEM, and FLUENT (both from

Ansys, Inc., Canonsburg, PA, USA) with a total of 1.8×107 cells in order to completely

resolve the airspace and the boundary layer where odorant molecules become trapped

(Jiang and Zhao, 2010; Zhao et al., 2006). The steady state odorant deposition through

airflow and mucosal uptake of vaporized eugenol was simulated based on the calculated

42 airflow field and estimated physicochemical properties (Kurtz et al., 2004). In short,

∂C′ odorant concentration at the boundary of the air-mucus interface satisfied: + CK ′ = 0 ∂y′

in Dd m with K = , where din is the hydraulic diameter (4 × area / perimeter) of the βHD ma

-6 2 nostril, Dm is the eugenol diffusion coefficient in water (6.47 × 10 cm /s), β is the

air/water partition coefficient (defined by the ratio of odorant concentration in the air

-6 phase to the concentration in mucus, 1.95 × 10 ), Hm is the thickness of the mucosal

layer and also the path length that odorant molecules need to diffuse through (30 µm),

2 and Da represents the diffusivity of odorant molecules through air (0.062 cm /s).

The potential correlation was evaluated by plotting odorant absorption values

from 55 evenly distributed locations throughout the dorsal zone versus the corresponding

average cilia length measurement from each location (see Figure 2.5C). The number of

locations in each region is approximately proportional to its surface area (n = 28 from

dorsal recess, 17 from the septum, and 10 from the endoturbinates). Analysis was

performed using the Pearson correlation calculation.

Patch clamp recordings and dose response curves

Intact epithelia were prepared as in our published procedures (Grosmaitre et al.,

2006; Ma et al., 1999). Mice were deeply anesthetized by ketamine injection and then decapitated. The head was immediately placed into ice-cold Ringer’s solution which contained (in mM): 124 NaCl, 3 KCl, 1.3 MgSO4, 2 CaCl2, 26 NaHCO3, 1.25 NaH2PO4, and 15 glucose (pH 7.6 and 305 mOsm); the pH was kept at 7.4 after bubbling with 95%

O2 and 5% CO2. The nose was dissected out en bloc, and the olfactory epithelium

attached to the nasal septum and the dorsal recess was removed and kept in oxygenated 43 Ringer’s. Before use, the entire epithelium was peeled away from the underlying bone and transferred to a recording chamber with the mucus layer facing up. Oxygenated

Ringer’s was continuously perfused at 25 ± 2ºC.

The dendritic knobs of OSNs were visualized through an upright microscope

(Olympus BX61WI) with a cooled CCD camera (SensiCam QE, PCO) and a 40x water- immersion objective. An extra 4x magnification was achieved by an accessory lens in the light path. GFP-tagged cells were visualized under fluorescent illumination.

Superimposition of the fluorescent and bright field images allowed identification of fluorescent cells under bright field, which directed the recording pipettes (Grosmaitre et al., 2006). Electrophysiological recordings were controlled by an EPC-9 amplifier combined with Pulse software (HEKA Electronic, Germany). Perforated patch-clamp was performed on the dendritic knobs by including 260 µM nystatin in the recording pipette, which was filled with the following solution (in mM): KCl 70, KOH 53, methanesulfonic acid 30, EGTA 5.0, HEPES 10, sucrose 70; pH 7.2 (KOH) and 310 mOsm. The junction potential was ~ 9 mV and corrected off-line.

A glass pipette was used to deliver stimuli by pressure ejection (20 psi or 138 kPa) through a picospritzer (Pressure System IIe, Fairfield, NJ, USA) at different pulse lengths (0 to 400 ms). Longer pulses elicited larger responses in all cells due to higher concentrations reaching the recording site. Dose response curves were fit by the Hill

n equation: V = Vmax / (1 + (K1/2 + C) ), where V represents the peak receptor potential, Vmax the maximum response at the saturating pulse length, K1/2 the pulse length at which half of the maximum response was reached, C the pulse length and n the Hill coefficient.

Only cells tested at a minimum of three pulse lengths were included in the analysis.

44 Eugenol (Sigma) and the odorant mixture (see EOG Recordings) were prepared as 0.5 M solutions in DMSO and kept at –20°C. Final solutions were prepared before each experiment by adding Ringer’s.

EOG recordings

EOG recordings were performed as previously described (Chen et al., 2012;

Wong et al., 2000). Mice (8 to 12 weeks old) were sacrificed by decapitation, and the nose was dissected out en bloc. Odorized air was produced by blowing nitrogen (2.4

L/min at 22°C) through a horizontal glass cylinder filled halfway with an odorant mixture comprised of acetophenone, butyric acid, R-(−)-carvone, citralva, ethyl vanillin, eugenol,

1-heptanol, 2-heptanone, 3-heptanone, R-(+)-limonene, S-(−)-limonene, and octanal, each at 100 μM in Ringer’s solution containing ≤ 0.2% dimethyl sulfoxide (DMSO). Air puffs were delivered locally to either the anterior or posterior regions of the exposed nasal septum for 200 ms using an automated four-way slider valve (P/N: 330224S303,

ASCO) controlled by a computer via an S48 Stimulator (Glass Technologies). The tip of the puff application tube was 1.5–2.0 cm away from the surface of the epithelium and pointed directly at the recording site.

The EOG field potential was detected with a glass microelectrode filled with agar and Ringer’s solution. EOG signals were amplified with a CyberAmp 320, digitized at 1–

10 kHz using Digidata 1332A and MiniDigi 1A processors, and acquired with pClamp

10.3 and Axoscope 10 software (Molecular Devices). Exclusion of artifacts during EOG recordings and data analyses was performed as previously described (Chen et al., 2012).

45 Chapter 3

Genetic ablation of type III adenylyl cyclase exerts region-specific effects on cilia architecture in the mouse nose

Rosemary C. Challis1, Huikai Tian1, Wenbin Yin1,2, and Minghong Ma1

1Department of Neuroscience, University of Pennsylvania Perelman School of Medicine,

Philadelphia, PA 19104, USA

2Department of Geriatrics, Qilu Hospital of Shandong University, Jinan, Shandong

250012, China

Acknowledgements

We thank Christopher Ferguson and Dr. Haiqing Zhao for providing the

PDE1C+/-;PDE4A+/- mice, Drs. Daniel R. Storm and Xuanmao Chen for the ACIII+/+ and

ACIII-/- mice, and Dr. Qizhi Gong for the OMP antibody. This work was supported by

grants from the NIDCD, NIH (F31DC013945 to R.C.C. and R01DC011554 and

R01DC006213 to M.M.).

Conceptualization, R.C.C. and M.M.; Investigation, R.C.C., H.T., and W.Y.

Writing, R.C.C. and M.M.

The work in this chapter is under review at PLOS ONE: Challis, R.C., Tian, H.,

Yin, W., and Ma, M. (2016) Genetic ablation of type III adenylyl cyclase exerts region-

specific effects on cilia architecture in the mouse nose.

46 Summary

We recently reported that olfactory sensory neurons in the dorsal zone of the

mouse olfactory epithelium exhibit drastic location-dependent differences in cilia length.

Furthermore, genetic ablation of type III adenylyl cyclase (ACIII), a key olfactory

signaling protein and ubiquitous marker for primary cilia, disrupts the cilia length pattern

and results in considerably shorter cilia, independent of odor-induced activity. Given the

significant impact of ACIII on cilia length in the dorsal zone, we sought to further

investigate the relationship between cilia length and ACIII level in various regions

throughout the mouse olfactory epithelium. We employed whole-mount

immunohistochemical staining to examine olfactory cilia morphology in

phosphodiesterase (PDE) 1C-/-;PDE4A-/- (simplified as PDEs-/- hereafter) and ACIII-/-

mice in which ACIII levels are reduced and ablated, respectively. As expected, PDEs-/- animals exhibit dramatically shorter cilia in the dorsal zone (i.e., where the cilia pattern is found), similar to our previous observation in ACIII-/- mice. Remarkably, in a region not included in our previous study, ACIII-/- animals (but not PDEs-/- mice) have dramatically

elongated, comet-shaped cilia, as opposed to characteristic star-shaped olfactory cilia.

Here, we reveal that genetic ablation of ACIII has drastic, location-dependent effects on

cilia architecture in the mouse nose. These results add a new dimension to our current

understanding of olfactory cilia structure and regional organization of the olfactory

epithelium. Together, these findings have significant implications for both cilia and

sensory biology.

47 Introduction

Cilia are remarkably diverse in their numbers, lengths, and morphologies and are

therefore well-suited for mediating various cellular functions, such as fluid transport, cell

motility, and detection of sensory stimuli (Berbari et al., 2009; Choksi et al., 2014).

Defects in cilia structure and/or function cause a host of diseases, which can manifest in

multiple organs and result in severe sensory impairments like anosmia, or loss of smell

(Hildebrandt et al., 2011; Jenkins et al., 2009; Waters and Beales, 2011). Understanding

how cilia architecture (i.e., length and/or shape) and function are regulated in different

cell types is critical for the future therapeutic treatment of these disorders.

The mammalian olfactory system is a unique model for studying cilia structure

and function, given that olfactory sensory neurons (OSNs) in the mouse nose possess

cilia with different lengths and sensitivities, depending on the cell location in the

olfactory epithelium (Challis et al., 2015). Each OSN can possess up to 30 immotile cilia,

which extend in a star-like arrangement from the dendritic knob and house the key

proteins involved in olfactory signal transduction (McEwen et al., 2008; Menco, 1997).

Odor detection begins when odor molecules bind to odorant receptors on the ciliary

membrane, leading to G protein (Golf)-dependent activation of type III adenylyl cyclase

(ACIII) and an increase in intraciliary cyclic adenosine monophosphate (cAMP) levels.

Opening of downstream channels, including a cyclic nucleotide-gated channel,

depolarizes OSNs, which send action potentials to the brain for odor processing

(Mombaerts, 2004; Su et al., 2009). Termination and adaptation of the olfactory response

is critical for proper olfactory function and is mediated in part by phosphodiesterases

(PDEs), which hydrolyze cAMP to AMP (Cygnar and Zhao, 2009).

48 Curiously, several studies have reported a role of olfactory signaling molecules in shaping olfactory cilia architecture in both Caenorhabditis elegans and mice (Challis et al., 2015; Kaneko-Goto et al., 2013; Mukhopadhyay et al., 2008; Roayaie et al., 1998).

These data suggest that signaling components may play dual roles in sensing external stimuli and sculpting the shape of a cilium. We previously reported that ACIII, a key olfactory signaling molecule and ubiquitous marker for primary cilia (Bishop et al.,

2007), is involved in regulating olfactory cilia length and the establishment of the cilia pattern in the dorsal zone of the mouse olfactory epithelium (Challis et al., 2015). Here, we further explore the relationship between cilia structure and ACIII level in various locations throughout the mouse nose.

Results

Genetic ablation of PDEs disrupts the cilia pattern

In mouse OSNs, decreased cAMP signaling (Kaneko-Goto et al., 2013) or ablation of ACIII (Challis et al., 2015) results in shortened cilia, suggesting that cAMP signaling or ACIII may positively regulate olfactory cilia length. Given these findings, we asked whether OSNs with decreased ACIII levels, and presumably cAMP signals, exhibit defects in cilia length. To answer this question, we examined the cilia pattern via the plant lectin Dolichos biflorus agglutinin (DBA) (Lipscomb et al., 2002) staining when two olfactory PDEs, PDE1C and PDE4A, are genetically ablated (Cygnar and Zhao,

2009). PDEs-/- mice have two potential side effects: reduced ACIII level and prolonged, odor-induced cAMP level. We previously showed that disruption of odor-induced cAMP signaling through Golf does not alter the cilia pattern (Challis et al., 2015), suggesting that the major effects of PDE deletion would be due to decreased ACIII expression.

Figure 3.1. Genetic ablation of PDEs disrupts the cilia pattern.

(A) Regional subdivision of the mouse nasal septum (adapted from (Challis et al., 2015)). The white dashed line marks the dorsal airstream during inspiration, and the olfactory epithelium is outlined in blue. The dorsal zone is divided into four regions: Ant = anterior; Mid = middle; Pos = posterior; DR = dorsal recess. The Mid region was previously analyzed and only shown for illustrative purposes. The striped region refers to the comet-like region and is described, along with boxes E and F, in Figure 3.2. The gray region approximately marks the ventral zone. MOB = main olfactory bulb; NPH = nasopharynx; RE = respiratory epithelium; SO = septal organ; VNO = vomeronasal organ. The yellow star marks the most dorsal point where the nasal septal cartilage intersects with the ethmoid bone and was used to facilitate comparisons between tissues (see Experimental Procedures). (B and C) Whole- mount olfactory epithelia from PDE1C+/-;PDE4A+/- (simplified as PDEs+/- ) (B) and PDEs-/- mice (C) were stained with DBA, which labels a subset of OSNs (Challis et al., 2015; Lipscomb et al., 2002). Confocal images were taken from the dorsal recess (magenta), anterior (orange), and posterior (blue), as shown in (A). Scale bar in (C) applies to all images. Arrows mark dendritic knobs. (D) Cumulative frequency (%) of cilia length from DBA+ cells in different regions. The bar graph shows quantification of cilia length (mean ± SD); Tukey’s multiple comparisons test, **** p < 0.0001. See also Table 3.1. 50

Consistent with this notion, we observed much shorter cilia in the dorsal recess and anterior septum of PDEs-/- mice compared to controls (Figure 3.1 and Table 3.1). The cilia pattern is therefore significantly disrupted, similar to the phenotype we previously observed in ACIII-/- mice (Challis et al., 2015) (Table 3.1). These data support the

hypothesis that ACIII levels are positively correlated with olfactory cilia length and

provide additional evidence that ACIII is involved in regulating cilia length and the

establishment of the cilia pattern in the dorsal zone.

Ablation of PDEs or ACIII differentially impacts cilia length

Although genetic ablation of PDEs or ACIII results in shorter olfactory cilia in the dorsal zone, drastically different phenotypes are observed in a region (termed “comet- like” region) situated in the middle to ventral nasal septum outlined in Figure 3.1A. As expected, cilia of PDEs-/- mice are significantly shorter compared to controls (Figure

3.2A and B and Table 3.1) and similar in length to cilia in the dorsal zone of PDEs-/-

animals (Figure 3.1C and D and Table 3.1). Cilia in the same region of ACIII-/- mice

(Wong et al., 2000), however, have a striking appearance. In contrast to controls (Figure

3.2C and Table 3.1), and the dorsal zone of ACIII-/- animals (Table 3.1) (Challis et al.,

2015), cilia are extremely long, reaching up to 100 µm (Figure 3.2D-G and Table 3.1).

Furthermore, all cilia align in the same direction, presumably the direction of airflow

(Jiang and Zhao, 2010; Kimbell et al., 1997), resulting in a comet-like appearance. We

confirmed that these comet-like cells are OSNs by double staining with DBA and

olfactory marker protein (OMP), a marker for mature OSNs (Figure 3.2E and F). These

results reveal that manipulation of ACIII levels causes drastic, location-dependent

differences in olfactory cilia architecture. 51

Fig 3.2. Ablation of PDEs or ACIII differentially impacts cilia length.

(A-D) Whole-mount olfactory epithelia from PDEs+/- (A), PDEs-/- (B), ACIII+/+ (C), and ACIII-/- (D) mice were stained with DBA. Images were taken from the comet-like region, as shown in Figure 3.1A. Scale bar in (D) applies to all images. Arrows mark dendritic knobs. (E and F) DBA+ cells with comet- like morphology in ACIII-/- mice appear similar in size and shape to OMP+ cells (red). Colocalization is not always obvious, potentially due to variable OMP expression in OSNs. Boxes E and F in Figure 3.1A indicate the approximate locations in which images were taken. Note the sharp contrast between the olfactory epithelium (with comets) and RE (no staining) in (F). (G) Cumulative frequency (%) of cilia length from DBA+ cells in the comet-like region of all genotypes. The bar graph shows quantification of cilia length (mean ± SD); Tukey’s multiple comparisons test, **** p < 0.0001. See also Table 3.1.

Cilia Length (µm, mean ± SD ), Cilia Number (n) Genotype Statistical Test F p DR n Ant n Pos n Comet-like n PDEs+/- 34.8 ± 11.6 39 14.8 ± 7.7 57 4.0 ± 2.4 49 25.7 ± 6.6 35 Two-way ANOVA 125.4 * < 0.0001 PDEs-/- 7.0 ± 3.7 30 6.7 ± 3.4 48 5.2 ± 2.5 45 6.5 ± 2.3 56

ACIII+/+ 27.0 ± 16.2 39 14.7 ± 6.2 48 5.1 ± 2.6 43 23.4 ± 12.6 60 Two-way ANOVA 27.9 * < 0.0001 ACIII-/- 9.3 ± 8.5 59 8.6 ± 8.1 50 5.5 ± 4.6 52 72.5 ± 23.1 37 One-way ANOVA; F = 202.8; p < 0.0001

Table 3.1. Cilia length quantification from mice with altered ACIII levels.

Standard, bold, and italic texts are used to show which data were compared and analyzed. Standard and bold texts indicate data collected in Figures 3.1 and 3.2, respectively; italic text indicates previously analyzed data (Challis et al., 2015). The asterisk (*) denotes a statistical interaction (genotype x region).

52 Discussion

Here, we provide additional evidence that ACIII plays critical roles in mediating olfactory cilia length. These data support previous work suggesting that ACIII or cAMP may be involved in positively regulating cilia length in different cell types, including

OSNs. Surprisingly, however, genetic ablation of ACIII has region-specific effects on cilia morphology in the olfactory epithelium, revealing that ACIII may differentially modulate cilia architecture in the mammalian nose. These results provide novel insights into the role of ACIII in cilia and sensory biology and enhance our current understanding of regional subdivisions in the olfactory epithelium.

Multiple studies imply that ACIII, cAMP, or both are involved in positively regulating cilia length in various mammalian cell types (Abdul-Majeed et al., 2012;

Besschetnova et al., 2010; Challis et al., 2015; Kaneko-Goto et al., 2013). We recently demonstrated that in mouse OSNs, genetic ablation of ACIII results in dramatically shorter olfactory cilia, thereby disrupting the cilia pattern in the dorsal zone (Challis et al., 2015). Consistent with this finding, the cilia pattern is similarly disrupted in PDEs-/-

mice (Figure 3.1), which have significantly reduced ACIII levels (Cygnar and Zhao,

2009). Interestingly, cAMP also plays a role in cilia growth, since OSNs expressing a

dominant negative protein kinase A have shorter olfactory cilia (Kaneko-Goto et al.,

2013). Whether ACIII levels are decreased in these mice remains to be determined.

Nevertheless, these data together support a positive correlation between ACIII, cAMP,

and cilia length in the dorsal zone.

Contrary to these findings, there is also evidence suggesting that ACIII may negatively regulate mammalian cilia length (Ou et al., 2009). In support of this notion,

53 genetic ablation of ACIII has a striking effect on olfactory cilia architecture in the comet-

like region (Figure 3.2), where cilia are markedly elongated and comet-shaped, as opposed to star-shaped. Curiously, PDEs-/- mice, which have reduced ACIII levels, do not

exhibit this phenotype. These results suggest that the role of ACIII in mediating cilia

length is more complex than previously anticipated. Although trafficking of ACIII to the

cilia is not required for olfactory cilia maintenance (McIntyre et al., 2015), ACIII may

play a structural role, directly or indirectly, in determining cilia morphology. It is possible

that ACIII works in concert with region-specific factors (e.g., structural molecules and/or

sensory stimuli, such as airflow) to regulate cilia architecture in different locations.

Further experiments are needed to identify additional factors that may be involved in differentially regulating cilia morphology in the dorsal zone and comet-like region.

Experimental Procedures

Animals

All animals were housed in conventional (non-barrier) animal facilities and were

3-8 weeks old. PDEs-/- mice were generated by crossing PDE1C+/-;PDE4A-/- with

PDE1C-/-;PDE4A+/- mice. Double heterozygous PDE1C+/-;PDE4A+/- mice were provided

by Haiqing Zhao’s lab (Cygnar and Zhao, 2009). ACIII-/- mice and ACIII+/+ littermate

controls were bred from heterozygous ACIII+/- mice and provided by Daniel Storm’s lab

(Wong et al., 2000). All procedures were approved by the Institutional Animal Care and

Use Committee of the University of Pennsylvania.

Immunohistochemistry

Olfactory epithelia were processed as previously reported (Challis et al., 2015).

Briefly, mice were anesthetized by ketamine/xylazine injection (200 and 20 mg/kg body

54 weight) and then decapitated. After fixation, the nasal septum was dissected out en bloc and incubated with primary antibodies overnight in blocking solution. The primary antibodies include biotinylated Dolichos biflorus agglutinin (DBA) (5 mg/mL, 1:300 working dilution; B-1035, Vector Laboratories, Burlingame, CA, USA) and chicken anti-

OMP (1:500; kind gift of Dr. Qizhi Gong, UC Davis). The septum was washed and incubated for 1-2 h at room temperature with secondary antibodies conjugated to Alexa

Fluors (Life Technologies). The secondary antibodies include streptavidin conjugate

(1:1000; S32354 and S11226) and goat anti-chicken IgG (1:400; A21449). Olfactory epithelia were marked with a small quantity of tissue dye (1163, Bradley Products, Inc.,

Bloomington, MN, USA) at a fixed location (i.e., the most dorsal point where the septal cartilage meets the ethmoid bone; see yellow star in Figure 3.1A). Olfactory mucosa were peeled away from the underlying cartilage and bone and mounted in Vectashield mounting medium (Vector Laboratories). Images (z-step = 1 µm) were taken using a

Leica TCS SP5 II confocal microscope (Leica Microsystems) with a 40x oil objective.

Cilia were traced using Leica LAS AF Lite software, as previously described (Challis et al., 2015).

55 Chapter 4

General Discussion

In many sensory organs, specialized sensory receptors are strategically arranged to enhance detection sensitivity and acuity. For example, cone photoreceptors are packed in the fovea of the retina for visual acuity, and most sensitive mechanoreceptors with small receptive fields are concentrated in the fingertips for fine touch. The goal of this work is to establish whether the olfactory system uses a similar organizational scheme to facilitate odor detection.

In both amphibians and rodents, sensory cells in the olfactory epithelium are differentially stimulated depending on the cell location. Region-dependent stimulation is attributed to multiple factors including nasal geometry, airflow rates and distribution patterns, and the physicochemical properties of odorants. The rodent nasal cavity is a large, highly convoluted structure comprised of cartilaginous turbinates that extend laterally and a septum that divides the cavity into two channels. The main olfactory epithelium is distributed along the septum, throughout the turbinates, and above the septum in a region called the dorsal recess (Figure 1.2). A number of studies suggest that the dorsal recess and anterior septum experience higher stimulation (e.g., airflow rates and odor concentrations) compared to the posterior septum and turbinates (Jiang and

Zhao, 2010; Kimbell et al., 1997; Scott et al., 2014; Yang et al., 2007; Zhao et al., 2006).

Moreover, within one zone, OSNs expressing the same OR are scattered from the anterior to the posterior epithelium, indicating that these neurons encounter different stimulation depending on their location.

56 Based on these data, I asked whether cells in various locations evolve unique structural and/or functional features to optimize detection sensitivity. Using immunohistochemistry, computational fluid dynamics modeling, and electrophysiological methods, I discovered a novel spatial organization in which OSNs with longer cilia and higher sensitivity are placed in highly stimulated regions of the nose (Figure 4.1). Below,

I highlight key points of my work that I believe make important advances. I also discuss the possible limitations of my experiments and speculate on how these limitations might be addressed in future research.

Figure 4.1. An olfactory cilia pattern in the mammalian nose ensures high sensitivity to odors. 57 I. Functional significance of the cilia pattern

Relationship between odorant absorption and cilia length in the dorsal and ventral

zones

In this work, the cilia length gradient is observed in the dorsal zone of the mouse

nose (Figure 1.2) (Challis et al., 2015). Cells in the ventral zone, on the other hand, do not show systematic regional differences in cilia length. Furthermore, the dorsal zone exhibits an imposed odorant absorption pattern, but no location-dependent differences in

odorant absorption are found in the ventral zone (Scott et al., 2014). Given that the dorsal

and ventral zones experience different location-dependent stimulation, cells in these

regions likely evolved distinct cilia lengths for detecting relevant stimuli.

Remarkably, the cilia length gradient is positively correlated with odorant absorption in the dorsal zone (Challis et al., 2015). Eugenol absorption is highest in the dorsal recess and decreases from the anterior to the posterior septum due to the gradual reduction of local airflow rates and depletion of odor molecules remaining in the air phase. Odorants with moderate to high mucosal solubility exhibit comparable absorption gradients (Scott et al., 2014), and because the cilia pattern applies to OSNs expressing

multiple OR types, the correlation suggests that in the dorsal zone cells with longer cilia

are placed in highly stimulated regions of the nose.

In contrast to the dorsal zone, the ventral zone does not experience a gradient in

odorant absorption (Scott et al., 2014). Given that highly soluble odorants are deposited

upstream (e.g., in the dorsal recess and anterior septum), only odorants with low mucosal

solubility are deposited downstream (i.e., in the ventral zone). Since insoluble odorants

are not easily absorbed and cannot form imposed absorption gradients, they are uniformly

58 deposited, albeit at lower concentrations than soluble odorants, throughout the entire nasal cavity. Intriguingly, cilia length is also uniform throughout the ventral zone (Challis et al., 2015), which suggests that this zone might be poised to detect odorants with lower mucosal solubility.

Specificity of the cilia pattern to the medial aspect of the dorsal zone

Curiously, the cilia pattern is only found along the medial aspect of the dorsal zone (i.e., along the dorsal recess and septum, not the turbinates) (Figure 1.2) (Challis et al., 2015). The reason for this arrangement is not understood, but it may be linked to the unique functions of the medial and lateral parts of the nasal cavity. OSNs expressing the same OR along the medial and lateral olfactory epithelium target medial and lateral glomeruli, respectively (Figure 1.2) (Levai et al., 2003; Schoenfeld et al., 1994).

Therefore, OSNs in the dorsal recess and septum innervate medial glomeruli, while those along and within the turbinates innervate lateral glomeruli. Interestingly, the medial septum is activated earlier than the lateral turbinates following odor stimulation, potentially due to differential odorant absorption in the nasal cavity (Ezeh et al., 1995).

Furthermore, a recent study reports a medial to lateral timing difference in olfactory bulb neurons that is likely initiated in the olfactory epithelium and responsible for coding odorant intensity (Zhou and Belluscio, 2012). My work shows that the longest, most sensitive cilia in the dorsal zone are located along the medial aspect of the nose (i.e., the dorsal recess and anterior septum), not along the lateral sides (i.e., the turbinates) (Challis et al., 2015). Given that these long cilia are the first to encounter odorants, the cilia pattern may be utilized by the olfactory system to optimize the coding of different odorant concentrations. In future experiments, it will be important to investigate how the

59 cilia pattern influences the medial to lateral timing difference. The results will provide

necessary insight into the mechanism(s) underlying the function of the cilia pattern in

vivo.

Cilia length and cell sensitivity

Patch clamp analysis reveals that OSNs in the dorsal recess and anterior septum

(with longer cilia) are inherently more sensitive to odorants compared to cells in the posterior septum (with shorter cilia) (Challis et al., 2015). That is, cells with longer cilia have a lower response threshold and larger maximum response at all odorant concentrations. Cilia length likely affects the function of OSNs in two ways. 1. Longer

cilia have a larger surface area for contacting odors, similar to retinal rods that ensure

high sensitivity in light detection by containing large outer segments packed with

rhodopsin-enriched membrane discs. 2. A longer cilium generates a stronger electrical

signal upon odor stimulation. This can be explained using cable theory, which estimates

the current and associated voltage generated along a passive cable (Koch, 1999). The

1/2 electrical length constant (λ) of olfactory cilia is defined as (d·Rm/(4Ri)) = 220 µm,

where d (the diameter of a cilium) = 0.2 µm, Rm (the membrane resistance within one

2 unit area) = 10000 Ωcm , and Ri (the cytosol resistance within one unit length) = 100

Ωcm. This indicates that an electrical signal (V) generated at the tip of a cilium can travel

220 µm before it reduces to 37%V, assuming that the membrane is not leaky (i.e. with negligible channel opening). This suggests that upon stimulation by faint odors, the electrical signals generated along a long cilium can travel far enough to the cell body and contribute to membrane depolarization. Due to spatial summation, cells with longer cilia would show a higher sensitivity and larger response to low concentrations of odors. Since

60 cells with longer cilia begin to saturate at a lower concentration compared to cells with shorter cilia (Challis et al., 2015), cells with shorter cilia are able to code intensity differences at higher concentrations compared to their long-cilia counterparts. Hence,

OSNs with short cilia are better suited for differentiating high concentrations of odors.

Given the effects of cilia length on cell sensitivity, there are two possible arrangements of OSNs that could have evolved to optimize odor detection. 1. More sensitive OSNs (i.e., those with longer cilia) are placed in weakly stimulated regions, such as the posterior septum, and less sensitive OSNs (i.e., those with shorter cilia) are placed in highly stimulated regions, such as the dorsal recess. In this case, glomeruli would receive relatively uniform inputs from OSNs, supporting the commonly held belief that OSNs expressing a given OR send redundant information to the brain. 2. More sensitive OSNs are placed in highly stimulated regions, and less sensitive OSNs are placed in weakly stimulated regions (Figure 4.1). Placing OSNs with longer cilia in highly stimulated regions would increase their chance of encountering faint odors and boost the sensitivity of the system. Moreover, placing OSNs with shorter cilia in the posterior septum, which only experiences strong odor stimuli, would ensure a broad dynamic range of the system. This can be explained by the fact that under saturating conditions, cells in the dorsal recess and anterior septum cannot differentiate high concentrations of odors. Cells in the posterior septum, however, can differentiate changes in intensity, thereby increasing the dynamic range of sensory detection. Contrary to the common belief in the field, glomeruli would receive non-uniform inputs from OSNs expressing the same OR.

61 Interpretation of the cilia pattern by the olfactory bulb

The prevailing theory in the field of olfaction is that OSNs expressing the same

OR carry redundant information to the olfactory bulb in the brain. Here, I present

evidence that OSNs are organized to match cell sensitivity with the incoming stimulation.

This finding revolutionizes the current view on peripheral coding and processing of odor

information.

How the brain integrates and interprets electrical signals from OSNs with different cilia lengths and sensitivities is not understood. Spatial organization in the periphery is maintained in the olfactory bulb (Figure 1.2) (Astic and Saucier, 1986; Levai

et al., 2003; Miyamichi et al., 2005; Saucier and Astic, 1986; Schoenfeld et al., 1994),

and the axons of OSNs expressing the same OR converge onto the same glomeruli in the

bulb (Ressler et al., 1994; Vassar et al., 1994). Since the cilia pattern is only observed in

the medial aspect of the dorsal zone, and OSNs expressing a given OR exhibit location-

dependent differences in cilia length, OSNs with different cilia lengths and sensitivities

project to the same medial glomerulus. How, then, might postsynaptic neurons in the

olfactory bulb differentiate heterogeneous responses from OSNs? One possibility is that

OSNs from the posterior septum synapse onto a different population of postsynaptic

neurons than OSNs from the dorsal recess and anterior septum. A single glomerulus may

therefore be able to separate differential inputs based on the cell location. Alternatively, cells from different regions might synapse onto the same postsynaptic neurons, in which case inputs are not separated but rather combined. The next step for future experiments will be to investigate patterns of OSN connectivity in a single medial glomerulus in the olfactory bulb. With recent advances in viral-mediated circuit mapping, the field will

62 soon be able to dissect these connections in detail to better understand how peripheral

information is encoded in the brain.

II. Regulation of the cilia pattern

Establishment and maintenance of the cilia pattern in the dorsal zone

Contrary to the common belief that OSNs have rather uniform morphology, I demonstrate that olfactory cilia length depends on the cell location in the mouse olfactory epithelium (Challis et al., 2015). In an effort to identify the mechanism(s) underlying the

cilia length gradient, I examined the cilia pattern following a number of genetic,

developmental, and pharmacological manipulations. Given that cilia length is positively

correlated with odorant absorption, and cells with longer cilia are more sensitive to odors,

I investigated the potential impact of OSN activity on the establishment of the cilia

pattern. Surprisingly, overexpression of Kir2.1 and ablation of Gγ13 do not alter the cilia

length gradient, suggesting that neither spontaneous nor odor-evoked activity is required

for the formation and maintenance of the cilia pattern. These data reveal that the pattern

is established by an intrinsic, activity-independent mechanism. This hypothesis is further

supported by the fact that the cilia pattern is established at birth and regenerated after

pharmacologically-induced degeneration of the olfactory epithelium.

Consistent with a potential role of cAMP in regulating olfactory cilia length

(Kaneko-Goto et al., 2013), ACIII is required for the establishment and maintenance of

the cilia pattern, independent of odor-evoked activity. In PDEs-/- and ACIII-/- mice, which have reduced (Cygnar and Zhao, 2009) and ablated ACIII levels (Wong et al., 2000), respectively, the differences in cilia length between the dorsal recess, anterior, and posterior septum are considerably reduced, and cells in these regions are nearly

63 indistinguishable from one another (Challis et al., 2016; Challis et al., 2015). OSNs in the

dorsal recess and anterior septum possess much shorter cilia compared to controls, which

points to a role of ACIII in mediating cilia growth. Together, these data imply that the

ACIII level itself, perhaps together with Golf-independent activation of ACIII, impacts

cilia length.

Limitations of the ACIII-/- model

ACIII has a dramatic effect on the cilia length gradient. However, limitations of

the ACIII-/- model complicate the interpretation of the ACIII-/- phenotype. In addition to

dramatically altering the cilia pattern (Challis et al., 2015), ablation of ACIII results in severe developmental abnormalities including axon targeting defects (Chesler et al.,

2007; Col et al., 2007; Zou et al., 2007), reduced OSN longevity (Santoro and Dulac,

2012) and delayed terminal differentiation of OSNs (Lyons et al., 2013). Therefore,

OSNs in ACIII-/- mice may possess shorter cilia due to indirect effects of ACIII deletion.

Intriguingly, olfactory epithelia from ACIII-/- animals contain a mixture of cells with

longer cilia, shorter cilia, and no cilia in all regions. To minimize the potential

contribution of developmental effects, I only examined cells with cilia, which are

presumably differentiated OSNs. However, it is possible that the cells with shorter cilia

failed to reach their full potential in growing longer cilia, either because OSNs in ACIII-/-

mice do not survive long enough to develop longer cilia, or because they are not yet fully

differentiated. OSN maturation is a gradual process with several notable milestones

including protrusion of the dendritic knob from the epithelial surface, formation of cilia,

and expression of olfactory marker protein (OMP) (Rodriguez-Gil et al., 2015;

Schwarzenbacher et al., 2005). Cilia growth likely continues well after the onset of OMP

64 expression. To bypass the potential impact of OSN development on cilia length, future

experiments will determine how ablation of ACIII impacts cilia length in mature, OMP+

OSNs. The results will help to establish a role of ACIII in controlling cilia length,

independent of developmental events leading to OSN maturation.

Potential mechanisms underlying the cilia pattern

Based on the data presented in Challis, et al. (2015) and Challis, et al. (2016), two

mechanisms, which may work separately or together, are likely to account for regional

differences in cilia length. 1. ACIII level itself, and/or 2. Golf-independent activation of

ACIII. Teasing apart these possibilities will help to more definitively determine the role

of ACIII in regulating cilia length and the establishment of the cilia pattern in the dorsal zone.

ACIII level

The cilia pattern may be established, in part, by the ACIII level in OSNs. Genetic

ablation of PDEs and ACIII, which results in reduced and ablated ACIII levels,

respectively, disrupts the cilia pattern and results in significantly shorter olfactory cilia,

independent of odor-induced activity. In wild-type animals, ACIII gene expression is

higher in regions with longer cilia versus shorter cilia (Challis et al., 2015), and in

sensory deprived animals, in which one nostril is occluded at birth, ACIII mRNA and

protein levels are significantly upregulated on the closed side (Coppola and Waggener,

2012; He et al., 2012), which shows increased cilia length in all regions compared to un-

manipulated controls (Challis et al., 2015). Together, these findings suggest that ACIII

level is positively correlated with cilia length. The mechanism by which ACIII might be

exerting region-specific effects on cilia length is not understood, but it may occur directly

65 or indirectly. 1. Direct role of ACIII. One possibility is that ACIII itself acts as a

structural molecule, providing physical support for cilia. Since ciliary localization of

ACIII is not required for olfactory cilia growth (McIntyre et al., 2015), ACIII may be

able to exert these effects near the base of the cilia in the dendritic knob. 2. Indirect role

of ACIII. Intrinsic, region-dependent expression of ACIII may result in differential

cAMP levels, which could affect cilia length. This is consistent with the observation that

cAMP induces cilia growth in cultured cells (Abdul-Majeed et al., 2012; Besschetnova et al., 2010) and is positively correlated with cilia length in OSNs (Kaneko-Goto et al.,

2013). Whether cAMP influences cilia length directly or indirectly is not known. Given

that cAMP activates protein kinase A and the downstream cAMP response element in

OSNs, it is tempting to speculate that an ACIII-dependent gradient in cAMP across the

epithelium causes differential transcription of target genes required for olfactory cilia

maintenance. Presumably, differences in expression of cilia-related genes would lead to different cilia lengths.

Regardless of whether ACIII exerts its effects directly or indirectly, it is important

to consider the possibility that the positive correlation between ACIII level and cilia

length is the result, rather than the cause, of the cilia pattern. That is, cells with longer

cilia would likely have higher ACIII expression since more ACIII is localized to the

ciliary membrane. To strengthen the argument for a role of ACIII in mediating cilia

growth, future studies will establish whether the ACIII-/- phenotype can be rescued in

vivo. OSNs are amenable to infection by adenovirus via intranasal delivery methods (Ivic

et al., 2000; McIntyre et al., 2012; Zhao et al., 1998; Zhao et al., 1996). Previously,

adenovirus-mediated expression of intraflagellar transport protein 88 (IFT88), a protein

66 implicated in cilia formation and maintenance (Pazour et al., 2002; Pazour et al., 2000;

Yoder et al., 2002), was utilized to rescue olfactory cilia structural and functional defects

in mice with a hypomorphic mutation in the Ift88 gene (McIntyre et al., 2012). If ACIII is

involved in regulating cilia length, then adenovirus-mediated expression of ACIII in

OSNs of ACIII-/- mice may be sufficient to correct cilia defects. The results would clarify

the role of ACIII in mediating cilia length and the cilia pattern.

Golf-independent activation of ACIII

If ACIII-mediated cAMP signaling plays a role in regulating the cilia pattern

(e.g., via cAMP), why does the cilia length gradient remain intact in the absence of odor-

induced cAMP signaling? It is possible that odor-evoked intracellular cAMP changes are

transient and not sufficient to impact the cilia pattern. However, ligand-independent

activation of ACIII may cause sustained cAMP elevation to affect cilia growth and

maintenance. In OSNs, stimulatory G protein (Gs)-mediated cAMP signaling is distinct

from odor-induced Golf-mediated cAMP signaling (Imai et al., 2006; Nakashima et al.,

2013). Therefore, Golf-independent activation of ACIII likely occurs through Gs. In

future experiments, it will be important to determine the impact of Gs signaling on the cilia pattern. By ablating Gs in OSNs, it may be possible to resolve whether ACIII plays a

direct or indirect role in establishing the cilia length gradient.

Region-specific effects of ACIII on cilia length

Curiously, ACIII has striking region-specific effects on cilia length (Challis et al.,

2016). In a region situated in the middle to ventral septum (“comet-like” region), ACIII-/-

mice have dramatically elongated, comet-shaped cilia, as opposed to characteristic star-

shaped olfactory cilia. Furthermore, all cilia align in the same direction, presumably the

67 direction of airflow (Jiang and Zhao, 2010; Kimbell et al., 1997). Intriguingly, only

ACIII-/- mice, not PDEs-/- mice, exhibit this unique phenotype, even though PDEs-/- and

ACIII-/- mice have reduced (Cygnar and Zhao, 2009) and ablated ACIII levels (Wong et

al., 2000), respectively. These data indicate that manipulation of ACIII levels causes drastic, location-dependent differences in olfactory cilia architecture. The observation

that cilia length increases in the absence of ACIII supports a previous study, which

demonstrates that ACIII negatively regulates cilia length in cultured neurons and

astrocytes (Ou et al., 2009). It is feasible that ACIII works together with region-specific factors (e.g., structural molecules and sensory stimulation, such as airflow) to regulate cilia length in different locations. Whether this comet-like region is associated with the dorsal or ventral zones remains unknown. Based on its anatomical location, the comet- like region appears to be situated within the ventral zone, although this has not been tested. Future experiments will need to characterize its precise anatomical location by using zone-specific markers (Oka et al., 2003; Yoshihara et al., 1997) and examining OR expression patterns. Given that the dorsal and ventral zones experience different sensory stimulation and cilia organization (Challis et al., 2015), it is possible that ACIII plays zone-specific roles in OSN spatial organization.

In an effort to identify molecules that may regulate the formation of comet-like cells, I performed RNA sequencing on the comet-like regions from ACIII+/+ and ACIII-/-

animals. The top differentially expressed genes, second to Adcy3, were chitinase-like 3

(Ym1) and chitinase-like 4 (Ym2), which code for proteins (referred to collectively as

Ym1/2) expressed in supporting cells in the ventral zone and that are implicated in olfactory epithelium regeneration (my unpublished observations) (Giannetti et al., 2004).

68 Whether or not Ym1/2 works in concert with ACIII to affect cilia growth and

maintenance is not known and is the focus of future experiments.

Additional factors involved in olfactory cilia growth

Cilia-related genes

In this work, the only manipulations that disrupt the cilia pattern are those in

which ACIII levels are reduced or ablated (Challis et al., 2016; Challis et al., 2015). In

addition to ACIII, it will be imperative to consider the potential roles of other cilia-

related genes in mediating cilia length. Recent years have witnessed rapid progress in

identifying molecules involved in cilia growth and maintenance. These include over 40

structural and signaling modulators (Avasthi and Marshall, 2012). A number of these

molecules are proteins involved in the evolutionarily conserved process known as

intraflagellar transport (IFT), the bidirectional movement of particles along the length of

a cilium. A growing number of proteins have been found to contribute to IFT including

supramolecular complexes that carry cargo (e.g., signaling proteins and tubulin) via the

molecular motors kinesin-II and cytoplasmic dynein 2 (Lechtreck, 2015). Since IFT’s

discovery in the flagella of Chlamydomonas reinhardtii (Kozminski et al., 1993),

countless IFT-related proteins have been implicated in cilia length control in a wide range

of protist and animal species. In mice, a number of known IFT-related proteins (IFT88,

and Bardet Biedl syndrome (BBS) proteins BBS1, BBS4, and BBS8) (Kulaga et al.,

2004; McIntyre et al., 2012; Tadenev et al., 2011) play critical roles in the maintenance of olfactory cilia. Intriguingly, disruption of these molecules results in abnormal ACIII expression and shortened, malformed, or absent olfactory cilia. Whether IFT-related proteins, or other molecules found to affect olfactory cilia maintenance (Goofy, Meckel-

69 Gruber syndrome protein MKS3, and Centrin 2) (Kaneko-Goto et al., 2013; Pluznick et

al., 2011; Ying et al., 2014) exhibit location-dependent gene expression patterns like

ACIII remains to be determined. Recently, Williams et al. monitored mammalian IFT in

live olfactory cilia located on the lateral turbinates (Williams et al., 2014). Understanding the dynamics of IFT in OSNs with long and short cilia along the septum will be a critical next step in elucidating the potential mechanisms underlying the cilia length gradient.

In an effort to identify potential candidate molecules involved in cilia growth and the establishment of the cilia pattern, I analyzed microarray data collected from the dorsal recess, anterior, and posterior septum of young adult wild-type mice. No obvious cilia- related genes have been identified, possibly due to technical reasons. Because the cilia pattern is present at birth (Challis et al., 2015), and many developmental patterns are established prenatally, it may be critical to utilize genomics methods during embryonic development. This approach might yield results that provide a more comprehensive molecular basis for the establishment of the cilia length gradient.

Environmental factors

In addition to the over 40 molecules found to effect cilia length (Avasthi and

Marshall, 2012), environmental cues may also modulate cilia architecture (i.e., length

and/or shape). In Caenorhabditis elegans, for example, decreased sensory stimulation dramatically alters olfactory cilia morphology (Mukhopadhyay et al., 2008). In this work,

the cilia pattern remains intact following sensory deprivation, however cilia are longer in

all regions along the septum (Challis et al., 2015). This phenomenon may be attributed to

better protection from physical damage and alterations in cell dynamics (i.e., OSN

maturation stages) (Farbman et al., 1988), microenvironment, and/or expression of

70 signaling molecules including upregulation of ACIII (Coppola and Waggener, 2012; He et al., 2012). Intriguingly, housing mice in different types of environments dramatically impacts the cilia pattern (my unpublished observations). Mice reared in conventional facilities exhibit robust cilia patterns, but animals raised in barrier facilities do not show an obvious gradient in cilia length, and all cilia appear relatively long. The cilia pattern may not be observed in barrier facilities due to dramatically decreased sensory stimulation, which could be the result of altered airflow and/or microbial environment since these facilities are specifically designed to prevent pathogens. Teasing apart which environmental variables modify the cilia pattern is currently not practical. Nonetheless, this observation highlights the impact that environmental conditions may have on olfactory cilia, which are directly exposed to the external environment.

Conclusion

Here, I report a novel spatial organization of the mouse nose in which OSNs with longer cilia and higher sensitivity have better access to odor molecules (Figure 4.1).

Together, this work makes a number of significant advances. 1. It suggests that a spatial component, comprised of both imposed and inherent properties of the olfactory epithelium, contributes to odor detection. 2. It amends the current view in the olfactory field that OSNs send redundant information to the brain. 3. It provides new insights into the regulation of sensory cilia length and demonstrates that ACIII, a ubiquitous marker for neuronal cilia, plays a significant role in mediating cilia architecture. In addition to advancing our knowledge of olfactory system organization and function, this work raises important questions that will be the focus of future investigations. 1. How does the brain integrate and interpret information from OSNs with different cilia lengths and

71 sensitivities? 2. What is the molecular mechanism regulating the cilia length pattern?

Addressing these questions will enhance our understanding of how spatial organization in the periphery impacts sensory physiology and cilia biology.

72 Appendix I

List of abbreviations used

ACIII – type III adenylyl cyclase

cAMP – cyclic adenosine monophosphate

DBA – Dolichos biflorus agglutinin, labels a subset of OSNs and their cilia

EOG – electroolfactogram, measures field potentials from populations of OSNs

Golf – olfactory G protein

GPCR – G protein-coupled receptor

MOR18-2 – olfactory receptor 78, a dorsal zone OR

MOR28 – olfactory receptor 1507 (or MOR244-1), a ventral zone OR mOR-EG – olfactory receptor 73 (or MOR174-9), a dorsal zone OR

OMP – olfactory marker protein, labels mature OSNs

OR – odorant receptor

OSN – olfactory sensory neuron

PDE – phosphodiesterase

73 List of References

Chapter 1

Astic, L., and Saucier, D. (1986). Anatomical mapping of the neuroepithelial projection to the olfactory bulb in the rat. Brain Res. Bull. 16, 445-454.

Berbari, N.F., O'Connor, A.K., Haycraft, C.J., and Yoder, B.K. (2009). The primary cilium as a complex signaling center. Curr. Biol. 19, R526-R535.

Bressel, O.C., Khan, M., and Mombaerts, P. (2016). Linear correlation between the number of olfactory sensory neurons expressing a given mouse odorant receptor gene and the total volume of the corresponding glomeruli in the olfactory bulb. J. Comp. Neurol. 524, 199-209.

Buck, L., and Axel, R. (1991). A novel multigene family may encode odorant receptors: a molecular basis for odor recognition. Cell 65, 175-187.

Chess, A., Simon, I., Cedar, H., and Axel, R. (1994). Allelic inactivation regulates olfactory receptor gene expression. Cell 78, 823-834.

Choksi, S.P., Lauter, G., Swoboda, P., and Roy, S. (2014). Switching on cilia: transcriptional networks regulating ciliogenesis. Development 141, 1427-1441.

Cygnar, K.D., and Zhao, H.Q. (2009). Phosphodiesterase 1C is dispensable for rapid response termination of olfactory sensory neurons. Nat. Neurosci. 12, 454-462.

Freitag, J., Krieger, J., Strotmann, J., and Breer, H. (1995). Two classes of olfactory receptors in Xenopus laevis. Neuron 15, 1383-1392.

Glusman, G., Bahar, A., Sharon, D., Pilpel, Y., White, J., and Lancet, D. (2000). The olfactory receptor gene superfamily: data mining, classification, and nomenclature. Mamm. Genome 11, 1016-1023.

Hildebrandt, F., Benzing, T., and Katsanis, N. (2011). Ciliopathies. N. Engl. J. Med. 364, 1533-1543.

Iwema, C.L., Fang, H.S., Kurtz, D.B., Youngentob, S.L., and Schwob, J.E. (2004). Odorant receptor expression patterns are restored in lesion-recovered rat olfactory epithelium. J. Neurosci. 24, 356-369.

Jenkins, P.M., McEwen, D.P., and Martens, J.R. (2009). Olfactory cilia: linking sensory cilia function and human disease. Chem. Senses 34, 451-464.

Jiang, J.B., and Zhao, K. (2010). Airflow and nanoparticle deposition in rat nose under various breathing and sniffing conditions: a computational evaluation of the unsteady and turbulent effect. J. Aerosol. Sci. 41, 1030-1043. 74 Julius, D., and Nathans, J. (2012). Signaling by sensory receptors. Cold Spring Harbor Perspect. Biol. 4.

Kent, P.F., and Mozell, M.M. (1992). The recording of odorant-induced mucosal activity patterns with a voltage-sensitive dye. J. Neurophysiol. 68, 1804-1819.

Kent, P.F., Mozell, M.M., Murphy, S.J., and Hornung, D.E. (1996). The interaction of imposed and inherent olfactory mucosal activity patterns and their composite representation in a mammalian species using voltage-sensitive dyes. J. Neurosci. 16, 345-353.

Kimbell, J.S., Godo, M.N., Gross, E.A., Joyner, D.R., Richardson, R.B., and Morgan, K.T. (1997). Computer simulation of inspiratory airflow in all regions of the F344 rat nasal passages. Toxicol. Appl. Pharmacol. 145, 388-398.

Levai, O., Breer, H., and Strotmann, J. (2003). Subzonal organization of olfactory sensory neurons projecting to distinct glomeruli within the mouse olfactory bulb. J. Comp. Neurol. 458, 209-220.

Mackay-Sim, A., and Kesteven, S. (1994). Topographic patterns of responsiveness to odorants in the rat olfactory epithelium. J. Neurophysiol. 71, 150-160.

Mackay-Sim, A., Shaman, P., and Moulton, D.G. (1982). Topographic coding of olfactory quality: odorant-specific patterns of epithelial responsivity in the salamander. J. Neurophysiol. 48, 584-596.

Menco, B.P.M., Cunningham, A.M., Qasba, P., Levy, N., and Reed, R.R. (1997). Putative odour receptors localize in cilia of olfactory receptor cells in rat and mouse: a freeze-substitution ultrastructural study. J. Neurocytol. 26, 691-706.

Miyamichi, K., Serizawa, S., Kimura, H.M., and Sakano, H. (2005). Continuous and overlapping expression domains of odorant receptor genes in the olfactory epithelium determine the dorsal/ventral positioning of glomeruli in the olfactory bulb. J. Neurosci. 25, 3586-3592.

Mombaerts, P. (2006). Axonal wiring in the mouse olfactory system. Annu. Rev. Cell Dev. Biol. 22, 713-737.

Moulton, D.G. (1976). Spatial patterning of response to odors in the peripheral olfactory system. Physiol. Rev. 56, 578-593.

Mozell, M.M. (1964). Evidence for sorption as mechanism of olfactory analysis of vapours. Nature 203, 1181-1182.

Mozell, M.M. (1966). Spatiotemporal analysis of odorants at level of olfactory receptor sheet. J. Gen. Physiol. 50, 25-41.

75 Mozell, M.M. (1970). Evidence for a chromatographic model of olfaction. J. Gen. Physiol. 56, 46-63.

Mozell, M.M., and Jagodowicz, M. (1973). Chromatographic separation of odorants by the nose: retention times measured across in vivo olfactory mucosa. Science 181, 1247-1249.

Mozell, M.M., Sheehe, P.R., Hornung, D.E., Kent, P.F., Youngentob, S.L., and Murphy, S.J. (1987). Imposed and inherent mucosal activity patterns. Their composite representation of olfactory stimuli. J. Gen. Physiol. 90, 625-650.

Oka, Y., Kobayakawa, K., Nishizumi, H., Miyamichi, K., Hirose, S., Tsuboi, A., and Sakano, H. (2003). O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone- specific manner. Eur. J. Biochem. 270, 1995-2004.

Osterberg, G. (1935). Topography of the layer of rods and cones in the human retina. Acta Ophthalmologica Supplement 6, 1-103.

Ressler, K.J., Sullivan, S.L., and Buck, L.B. (1993). A zonal organization of odorant receptor gene expression in the olfactory epithelium. Cell 73, 597-609.

Saucier, D., and Astic, L. (1986). Analysis of the topographical organization of olfactory epithelium projections in the rat. Brain Res. Bull. 16, 455-462.

Sauvanet, C., Wayt, J., Pelaseyed, T., and Bretscher, A. (2015). Structure, regulation, and functional diversity of microvilli on the apical domain of epithelial cells. Annu. Rev. Cell and Dev. Biol. 31, 593-621.

Schoenfeld, T.A., Clancy, A.N., Forbes, W.B., and Macrides, F. (1994). The spatial organization of the peripheral olfactory system of the hamster. Part 1: receptor neuron projections to the main olfactory bulb. Brain Res. Bull. 34, 183-210.

Scott, J.W., Brierley, T., and Schmidt, F.H. (2000). Chemical determinants of the rat electro-olfactogram. J. Neurosci. 20, 4721-4731.

Scott, J.W., Davis, L.M., Shannon, D., and Kaplan, C. (1996). Relation of chemical structure to spatial distribution of sensory responses in rat olfactory epithelium. J. Neurophysiol. 75, 2036-2049.

Scott, J.W., Shannon, D.E., Charpentier, J., Davis, L.M., and Kaplan, C. (1997). Spatially organized response zones in rat olfactory epithelium. J. Neurophysiol. 77, 1950- 1962.

Scott, J.W., Sherrill, L., Jiang, J.B., and Zhao, K. (2014). Tuning to odor solubility and sorption pattern in olfactory epithelial responses. J. Neurosci. 34, 2025-2036.

76 Sekerkova, G., Zheng, L., Loomis, P.A., Mugnaini, E., and Bartles, J.R. (2006). Espins and the actin cytoskeleton of hair cell stereocilia and sensory cell microvilli. Cell. Mol. Life Sci. 63, 2329-2341.

Serizawa, S., Ishii, T., Nakatani, H., Tsuboi, A., Nagawa, F., Asano, M., Sudo, K., Sakagami, J., Sakano, H., Ijiri, T., et al. (2000). Mutually exclusive expression of odorant receptor transgenes. Nat. Neurosci. 3, 687-693.

Silverman, M.A., and Leroux, M.R. (2009). Intraflagellar transport and the generation of dynamic, structurally and functionally diverse cilia. Trends Cell Biol. 19, 306-316.

Stephan, A.B., Tobochnik, S., Dibattista, M., Wall, C.M., Reisert, J., and Zhao, H.Q. (2012). The Na+/Ca2+ exchanger NCKX4 governs termination and adaptation of the mammalian olfactory response. Nat. Neurosci. 15, 131-U164.

Strotmann, J., Wanner, I., Helfrich, T., Beck, A., and Breer, H. (1994). Rostro-caudal patterning of receptor-expressing olfactory neurons in the rat nasal cavity. Cell Tissue Res. 278, 11-20.

Su, C.Y., Menuz, K., and Carlson, J.R. (2009). Olfactory perception: receptors, cells, and circuits. Cell 139, 45-59.

Sullivan, S.L., Adamson, M.C., Ressler, K.J., Kozak, C.A., and Buck, L.B. (1996). The chromosomal distribution of mouse odorant receptor genes. Proc. Natl. Acad. Sci. U. S. A. 93, 884-888.

Vassar, R., Ngai, J., and Axel, R. (1993). Spatial segregation of odorant receptor expression in the mammalian olfactory epithelium. Cell 74, 309-318.

Waters, A.M., and Beales, P.L. (2011). Ciliopathies: an expanding disease spectrum. Pediatr. Nephrol. 26, 1039-1056.

Weber, E.H. (1834). On touch: anatomical and physiological notes. Leipzig, Germany: C.F. Koehler.

Yang, G.C., Scherer, P.W., Zhao, K., and Mozell, M.M. (2007). Numerical modeling of odorant uptake in the rat nasal cavity. Chem. Senses 32, 273-284.

Yoshihara, Y., Kawasaki, M., Tamada, A., Fujita, H., Hayashi, H., Kagamiyama, H., and Mori, K. (1997). OCAM: a new member of the neural cell adhesion molecule family related to zone-to-zone projection of olfactory and vomeronasal axons. J. Neurosci. 17, 5830-5842.

Youngentob, S.L., Kent, P.F., Sheehe, P.R., Schwob, J.E., and Tzoumaka, E. (1995). Mucosal inherent activity patterns in the rat: evidence from voltage-sensitive dyes. J. Neurophysiol. 73, 387-398.

77 Zhang, X.H., Zhang, X.M., and Firestein, S. (2007). Comparative genomics of odorant and pheromone receptor genes in rodents. Genomics 89, 441-450.

Zhang, X.M., Rogers, M., Tian, H.K., Zhang, X.H., Zou, D.J., Jian, L., Ma, M.H., Shepherd, G.M., and Firestein, S.J. (2004). High-throughput microarray detection of olfactory receptor gene expression in the mouse. Proc. Natl. Acad. Sci. U. S. A. 101, 14168-14173.

Zhao, K., Dalton, P., Yang, G.C., and Scherer, P.W. (2006). Numerical modeling of turbulent and laminar airflow and odorant transport during sniffing in the human and rat nose. Chem. Senses 31, 107-118.

Chapter 2

Abdul-Majeed, S., Moloney, B.C., and Nauli, S.M. (2012). Mechanisms regulating cilia growth and cilia function in endothelial cells. Cell. Mol. Life Sci. 69, 165-173.

Barnea, G., O'Donnell, S., Mancia, F., Sun, X., Nemes, A., Mendelsohn, M., and Axel, R. (2004). Odorant receptors on axon termini in the brain. Science 304, 1468.

Berbari, N.F., O'Connor, A.K., Haycraft, C.J., and Yoder, B.K. (2009). The primary cilium as a complex signaling center. Curr. Biol. 19, R526-535.

Besschetnova, T.Y., Kolpakova-Hart, E., Guan, Y., Zhou, J., Olsen, B.R., and Shah, J.V. (2010). Identification of signaling pathways regulating primary cilium length and flow-mediated adaptation. Curr. Biol. 20, 182-187.

Bishop, G.A., Berbari, N.F., Lewis, J., and Mykytyn, K. (2007). Type III adenylyl cyclase localizes to primary cilia throughout the adult mouse brain. J. Comp. Neurol. 505, 562-571.

Chen, X., Xia, Z., and Storm, D.R. (2012). Stimulation of electro-olfactogram responses in the main olfactory epithelia by airflow depends on the type 3 adenylyl cyclase. J. Neurosci. 32, 15769-15778.

Coppola, D.M., and Waggener, C.T. (2012). The effects of unilateral naris occlusion on gene expression profiles in mouse olfactory mucosa. J. Mol. Neurosci. 47, 604-618.

Grosmaitre, X., Vassalli, A., Mombaerts, P., Shepherd, G.M., and Ma, M. (2006). Odorant responses of olfactory sensory neurons expressing the odorant receptor MOR23: a patch clamp analysis in gene-targeted mice. Proc. Natl. Acad. Sci. U. S. A. 103, 1970-1975.

Guemez-Gamboa, A., Coufal, N.G., and Gleeson, J.G. (2014). Primary cilia in the developing and mature brain. Neuron 82, 511-521. 78

He, J., Tian, H., Lee, A.C., and Ma, M. (2012). Postnatal experience modulates functional properties of mouse olfactory sensory neurons. Eur. J. Neurosci. 36, 2452-2460.

Hildebrandt, F., Benzing, T., and Katsanis, N. (2011). Ciliopathies. N. Engl. J. Med. 364, 1533-1543.

Ishikawa, H., and Marshall, W.F. (2011). Ciliogenesis: building the cell's antenna. Nat. Rev. Mol. Cell. Biol. 12, 222-234.

Jenkins, P.M., McEwen, D.P., and Martens, J.R. (2009). Olfactory cilia: linking sensory cilia function and human disease. Chem. Senses 34, 451-464.

Jiang, J., and Zhao, K. (2010). Airflow and nanoparticle deposition in rat nose under various breathing and sniffing conditions: a computational evaluation of the unsteady effect. J. Aerosol. Sci. 41, 1030-1043.

Kaneko-Goto, T., Sato, Y., Katada, S., Kinameri, E., Yoshihara, S., Nishiyori, A., Kimura, M., Fujita, H., Touhara, K., Reed, R.R., et al. (2013). Goofy coordinates the acuity of olfactory signaling. J. Neurosci. 33, 12987-12996.

Kaneko-Goto, T., Yoshihara, S., Miyazaki, H., and Yoshihara, Y. (2008). BIG-2 mediates olfactory axon convergence to target glomeruli. Neuron 57, 834-846.

Kulaga, H.M., Leitch, C.C., Eichers, E.R., Badano, J.L., Lesemann, A., Hoskins, B.E., Lupski, J.R., Beales, P.L., Reed, R.R., and Katsanis, N. (2004). Loss of BBS proteins causes anosmia in humans and defects in olfactory cilia structure and function in the mouse. Nat. Genet. 36, 994-998.

Kurtz, D.B., Zhao, K., Hornung, D.E., and Scherer, P. (2004). Experimental and numerical determination of odorant solubility in nasal and olfactory mucosa. Chem. Senses 29, 763-773.

Li, F., Ponissery-Saidu, S., Yee, K.K., Wang, H., Chen, M.L., Iguchi, N., Zhang, G., Jiang, P., Reisert, J., and Huang, L. (2013). Heterotrimeric G protein subunit Ggamma13 is critical to olfaction. J. Neurosci. 33, 7975-7984.

79 Li, J., Ishii, T., Feinstein, P., and Mombaerts, P. (2004). Odorant receptor gene choice is reset by nuclear transfer from mouse olfactory sensory neurons. Nature 428, 393- 399.

Lipscomb, B.W., Treloar, H.B., and Greer, C.A. (2002). Cell surface carbohydrates reveal heterogeneity in olfactory receptor cell axons in the mouse. Cell Tissue Res. 308, 7-17.

Lipscomb, B.W., Treloar, H.B., Klenoff, J., and Greer, C.A. (2003). Cell surface carbohydrates and glomerular targeting of olfactory sensory neuron axons in the mouse. J. Comp. Neurol. 467, 22-31.

Louvi, A., and Grove, E.A. (2011). Cilia in the CNS: the quiet organelle claims center stage. Neuron 69, 1046-1060.

Lyons, D.B., Allen, W.E., Goh, T., Tsai, L., Barnea, G., and Lomvardas, S. (2013). An epigenetic trap stabilizes singular olfactory receptor expression. Cell 154, 325-336.

Ma, M., Chen, W.R., and Shepherd, G.M. (1999). Electrophysiological characterization of rat and mouse olfactory receptor neurons from an intact epithelial preparation. J. Neurosci. Methods 92, 31-40.

McEwen, D.P., Jenkins, P.M., and Martens, J.R. (2008). Olfactory cilia: our direct neuronal connection to the external world. Curr. Top. Dev. Biol. 85, 333-370.

McEwen, D.P., Koenekoop, R.K., Khanna, H., Jenkins, P.M., Lopez, I., Swaroop, A., and Martens, J.R. (2007). Hypomorphic CEP290/NPHP6 mutations result in anosmia caused by the selective loss of G proteins in cilia of olfactory sensory neurons. Proc. Natl. Acad. Sci. U. S. A. 104, 15917-15922.

McIntyre, J.C., Davis, E.E., Joiner, A., Williams, C.L., Tsai, I.C., Jenkins, P.M., McEwen, D.P., Zhang, L., Escobado, J., Thomas, S., et al. (2012). Gene therapy rescues cilia defects and restores olfactory function in a mammalian ciliopathy model. Nat. Med. 18, 1423-1428.

McIntyre, J.C., Joiner, A.M., Zhang, L., Iniguez-Lluhi, J., and Martens, J.R. (2015). SUMOylation regulates ciliary localization of olfactory signaling proteins. J. Cell Sci. 128, 1934-1945.

Menco, B.P. (1997). Ultrastructural aspects of olfactory signaling. Chem. Senses 22, 295- 311.

Menco, B.P., and Farbman, A.I. (1985). Genesis of cilia and microvilli of rat nasal epithelia during pre-natal development. II. Olfactory epithelium, a morphometric analysis. J. Cell Sci. 78, 311-336.

80 Mombaerts, P. (2006). Axonal wiring in the mouse olfactory system. Annu. Rev. Cell Dev. Biol. 22, 713-737.

Mori, K., and Sakano, H. (2011). How is the olfactory map formed and interpreted in the mammalian brain? Annu. Rev. Neurosci. 34, 467-499.

Oka, Y., Katada, S., Omura, M., Suwa, M., Yoshihara, Y., and Touhara, K. (2006). Odorant receptor map in the mouse olfactory bulb: in vivo sensitivity and specificity of receptor-defined glomeruli. Neuron 52, 857-869.

Ou, Y., Ruan, Y., Cheng, M., Moser, J.J., Rattner, J.B., and van der Hoorn, F.A. (2009). Adenylate cyclase regulates elongation of mammalian primary cilia. Exp. Cell Res. 315, 2802-2817.

Pluznick, J.L., Rodriguez-Gil, D.J., Hull, M., Mistry, K., Gattone, V., Johnson, C.A., Weatherbee, S., Greer, C.A., and Caplan, M.J. (2011). Renal cystic disease proteins play critical roles in the organization of the olfactory epithelium. PLoS ONE 6, e19694.

Schoenfeld, T.A., and Cleland, T.A. (2005). The anatomical logic of smell. Trends Neurosci. 28, 620-627.

Schoenfeld, T.A., and Cleland, T.A. (2006). Anatomical contributions to odorant sampling and representation in rodents: zoning in on sniffing behavior. Chem. Senses 31, 131-144.

Schwarzenbacher, K., Fleischer, J., and Breer, H. (2005). Formation and maturation of olfactory cilia monitored by odorant receptor-specific antibodies. Histochem. Cell Biol. 123, 419-428.

Scott, J.W. (2006). Sniffing and spatiotemporal coding in olfaction. Chem. Senses 31, 119-130.

Scott, J.W., Sherrill, L., Jiang, J., and Zhao, K. (2014). Tuning to odor solubility and sorption pattern in olfactory epithelial responses. J. Neurosci. 34, 2025-2036.

Sheffield, V.C. (2011). The blind leading the obese: the molecular pathophysiology of a human obesity syndrome. Trans. Am. Clin. Climatol. Assoc. 121, 172-181.

Su, C.Y., Menuz, K., and Carlson, J.R. (2009). Olfactory perception: receptors, cells, and circuits. Cell 139, 45-59.

Suzukawa, K., Kondo, K., Kanaya, K., Sakamoto, T., Watanabe, K., Ushio, M., Kaga, K., and Yamasoba, T. (2011). Age-related changes of the regeneration mode in the mouse peripheral olfactory system following olfactotoxic drug methimazole-induced damage. J. Comp. Neurol. 519, 2154-2174. 81

Tadenev, A.L., Kulaga, H.M., May-Simera, H.L., Kelley, M.W., Katsanis, N., and Reed, R.R. (2011). Loss of Bardet-Biedl syndrome protein-8 (BBS8) perturbs olfactory function, protein localization, and axon targeting. Proc. Natl. Acad. Sci. U. S. A. 108, 10320-10325.

Valente, E.M., Rosti, R.O., Gibbs, E., and Gleeson, J.G. (2014). Primary cilia in neurodevelopmental disorders. Nat. Rev. Neurol. 10, 27-36.

Williams, C.L., McIntyre, J.C., Norris, S.R., Jenkins, P.M., Zhang, L., Pei, Q., Verhey, K., and Martens, J.R. (2014). Direct evidence for BBSome-associated intraflagellar transport reveals distinct properties of native mammalian cilia. Nat. Commun. 5, 5813.

Wong, S.T., Trinh, K., Hacker, B., Chan, G.C., Lowe, G., Gaggar, A., Xia, Z., Gold, G.H., and Storm, D.R. (2000). Disruption of the type III adenylyl cyclase gene leads to peripheral and behavioral anosmia in transgenic mice. Neuron 27, 487-497.

Yang, G.C., Scherer, P.W., Zhao, K., and Mozell, M.M. (2007). Numerical modeling of odorant uptake in the rat nasal cavity. Chem. Senses 32, 273-284.

Ying, G., Avasthi, P., Irwin, M., Gerstner, C.D., Frederick, J.M., Lucero, M.T., and Baehr, W. (2014). Centrin 2 is required for mouse olfactory ciliary trafficking and development of ependymal cilia planar polarity. J. Neurosci. 34, 6377-6388.

Yu, C.R., Power, J., Barnea, G., O'Donnell, S., Brown, H.E., Osborne, J., Axel, R., and Gogos, J.A. (2004). Spontaneous neural activity is required for the establishment and maintenance of the olfactory sensory map. Neuron. 42, 553-566.

Zhang, X., Zhang, X., and Firestein, S. (2007). Comparative genomics of odorant and pheromone receptor genes in rodents. Genomics 89, 441-450.

Zhou, Z., and Belluscio, L. (2012). Coding odorant concentration through activation timing between the medial and lateral olfactory bulb. Cell Rep. 2, 1143-1150.

Chapter 3

Abdul-Majeed, S., Moloney, B.C., and Nauli, S.M. (2012). Mechanisms regulating cilia growth and cilia function in endothelial cells. Cell. Mol. Life Sci. 69, 165-173.

82 Berbari, N.F., O'Connor, A.K., Haycraft, C.J., and Yoder, B.K. (2009). The primary cilium as a complex signaling center. Curr. Biol. 19, R526-535.

Bishop, G.A., Berbari, N.F., Lewis, J., and Mykytyn, K. (2007). Type III adenylyl cyclase localizes to primary cilia throughout the adult mouse brain. J. Comp. Neurol. 505, 562-571.

Challis, R.C., Tian, H.K., Wang, J., He, J.W., Jiang, J.B., Chen, X.M., Yin, W.B., Connelly, T., Ma, L.M., Yu, C.R., et al. (2015). An olfactory cilia pattern in the mammalian nose ensures high sensitivity to odors. Curr. Biol. 25, 2503-2512.

Choksi, S.P., Lauter, G., Swoboda, P., and Roy, S. (2014). Switching on cilia: transcriptional networks regulating ciliogenesis. Development 141, 1427-1441.

Cygnar, K.D., and Zhao, H. (2009). Phosphodiesterase 1C is dispensable for rapid response termination of olfactory sensory neurons. Nat. Neurosci. 12, 454-462.

Hildebrandt, F., Benzing, T., and Katsanis, N. (2011). Ciliopathies. N. Engl. J. Med. 364, 1533-1543.

Jenkins, P.M., McEwen, D.P., and Martens, J.R. (2009). Olfactory cilia: linking sensory cilia function and human disease. Chem. Senses 34, 451-464.

Lipscomb, B.W., Treloar, H.B., and Greer, C.A. (2002). Cell surface carbohydrates reveal heterogeneity in olfactory receptor cell axons in the mouse. Cell Tissue Res. 308, 7-17.

McEwen, D.P., Jenkins, P.M., and Martens, J.R. (2008). Olfactory cilia: our direct neuronal connection to the external world. Curr. Top. Dev. Biol. 85, 333-370.

83 McIntyre, J.C., Joiner, A.M., Zhang, L., Iniguez-Lluhi, J., and Martens, J.R. (2015). SUMOylation regulates ciliary localization of olfactory signaling proteins. J. Cell Sci. 128, 1934-1945.

Menco, B.P. (1997). Ultrastructural aspects of olfactory signaling. Chem. Senses 22, 295- 311.

Mombaerts, P. (2004). Genes and ligands for odorant, vomeronasal and taste receptors. Nat. Rev. 5, 263-278.

Mukhopadhyay, S., Lu, Y., Shaham, S., and Sengupta, P. (2008). Sensory signaling- dependent remodeling of olfactory cilia architecture in C. elegans. Dev. Cell 14, 762- 774.

Ou, Y., Ruan, Y., Cheng, M., Moser, J.J., Rattner, J.B., and van der Hoorn, F.A. (2009). Adenylate cyclase regulates elongation of mammalian primary cilia. Exp. Cell Res. 315, 2802-2817.

Roayaie, K., Crump, J.G., Sagasti, A., and Bargmann, C.I. (1998). The G alpha protein ODR-3 mediates olfactory and nociceptive function and controls cilium morphogenesis in C. elegans olfactory neurons. Neuron 20, 55-67.

Su, C.Y., Menuz, K., and Carlson, J.R. (2009). Olfactory perception: receptors, cells, and circuits. Cell 139, 45-59.

Waters, A.M., and Beales, P.L. (2011). Ciliopathies: an expanding disease spectrum. Pediatr. Nephrol. 26, 1039-1056.

Chapter 4

Abdul-Majeed, S., Moloney, B.C., and Nauli, S.M. (2012). Mechanisms regulating cilia growth and cilia function in endothelial cells. Cell. Mol. Life Sci. 69, 165-173.

Astic, L., and Saucier, D. (1986). Anatomical mapping of the neuroepithelial projection to the olfactory bulb in the rat. Brain Res. Bull. 16, 445-454.

Avasthi, P., and Marshall, W.F. (2012). Stages of ciliogenesis and regulation of ciliary length. Differentiation 83, S30-S42.

Besschetnova, T.Y., Kolpakova-Hart, E., Guan, Y.H., Zhou, J., Olsen, B.R., and Shah, J.V. (2010). Identification of signaling pathways regulating primary cilium length and flow-mediated adaptation. Curr. Biol. 20, 182-187. 84 Challis, R.C., Tian, H., Yin, W., and Ma, M. (2016). Genetic ablation of type III adenylyl cyclase exerts region-specific effects on cilia architecture in the mouse nose. PLOS ONE under review.

Chesler, A.T., Zou, D.J., Le Pichon, C.E., Peterlin, Z.A., Matthews, G.A., Pei, X., Miller, M.C., and Firestein, S. (2007). A G protein/cAMP signal cascade is required for axonal convergence into olfactory glomeruli. Proc. Natl. Acad. Sci. U. S. A. 104, 1039-1044.

Col, J.A.D., Matsuo, T., Storm, D.R., and Rodriguez, I. (2007). Adenylyl cyclase- dependent axonal targeting in the olfactory system. Development 134, 2481-2489.

Coppola, D.M., and Waggener, C.T. (2012). The effects of unilateral naris occlusion on gene expression profiles in mouse olfactory mucosa. J. Mol. Neurosci. 47, 604-618.

Cygnar, K.D., and Zhao, H.Q. (2009). Phosphodiesterase 1C is dispensable for rapid response termination of olfactory sensory neurons. Nat. Neurosci. 12, 454-462.

Ezeh, P.I., Davis, L.M., and Scott, J.W. (1995). Regional distribution of rat electroolfactogram. J. Neurophysiol. 73, 2207-2220.

Farbman, A.I., Brunjes, P.C., Rentfro, L., Michas, J., and Ritz, S. (1988). The effect of unilateral naris occlusion on cell dynamics in the developing rat olfactory epithelium. J. Neurosci. 8, 3290-3295.

Giannetti, N., Moyse, E., Ducray, A., Bondier, J.R., Jourdan, F., Propper, A., and Kastner, A. (2004). Accumulation of Ym1/2 protein in the mouse olfactory epithelium during regeneration and aging. Neuroscience 123, 907-917.

He, J.W., Tian, H.K., Lee, A.C., and Ma, M.H. (2012). Postnatal experience modulates functional properties of mouse olfactory sensory neurons. Eur. J. Neurosci. 36, 2452- 2460.

Imai, T., Suzuki, M., and Sakano, H. (2006). Odorant receptor-derived cAMP signals direct axonal targeting. Science 314, 657-661.

Ivic, L., Pyrski, M.M., Margolis, J.W., Richards, L.J., Firestein, S., and Margolis, F.L. (2000). Adenoviral vector-mediated rescue of the OMP-null phenotype in vivo. Nat. Neurosci. 3, 1113-1120.

Jiang, J.B., and Zhao, K. (2010). Airflow and nanoparticle deposition in rat nose under various breathing and sniffing conditions: a computational evaluation of the unsteady and turbulent effect. J. Aerosol. Sci. 41, 1030-1043. 85 Kaneko-Goto, T., Sato, Y., Katada, S., Kinameri, E., Yoshihara, S., Nishiyori, A., Kimura, M., Fujita, H., Touhara, K., Reed, R.R., et al. (2013). Goofy coordinates the acuity of olfactory signaling. J. Neurosci. 33, 12987-U12681.

Koch, C. (1999). Biophysics of computation: information processing in single neurons. Oxford University Press.

Kozminski, K.G., Johnson, K.A., Forscher, P., and Rosenbaum, J.L. (1993). A motility in the eukaryotic flagellum unrelated to flagellar beating. Proc. Natl. Acad. Sci. U. S. A. 90, 5519-5523.

Lechtreck, K.F. (2015). IFT-cargo interactions and protein transport in cilia. Trends Biochem. Sci. 40, 765-778.

Levai, O., Breer, H., and Strotmann, J. (2003). Subzonal organization of olfactory sensory neurons projecting to distinct glomeruli within the mouse olfactory bulb. J. Comp. Neurol. 458, 209-220.

Lyons, D.B., Allen, W.E., Goh, T., Tsai, L., Barnea, G., and Lomvardas, S. (2013). An epigenetic trap stabilizes singular olfactory receptor expression. Cell 154, 325-336.

McIntyre, J.C., Joiner, A.M., Zhang, L., Iniguez-Lluhi, J., and Martens, J.R. (2015). SUMOylation regulates ciliary localization of olfactory signaling proteins. J. Cell Sci. 128, 1934-1945.

Mukhopadhyay, S., Lu, Y., Shaham, S., and Sengupta, P. (2008). Sensory signaling- dependent remodeling of olfactory cilia architecture in C. Elegans. Dev. Cell 14, 762-774. 86 Nakashima, A., Takeuchi, H., Imai, T., Saito, H., Kiyonari, H., Abe, T., Chen, M., Weinstein, L.S., Yu, C.R., Storm, D.R., et al. (2013). Agonist-independent GPCR activity regulates anterior-posterior targeting of olfactory sensory neurons. Cell 154, 1314-1325.

Ou, Y., Ruan, Y.B., Chen, M., Moser, J.J., Rattner, J.B., and van der Hoorn, F.A. (2009). Adenylate cyclase regulates elongation of mammalian primary cilia. Exp. Cell Res. 315, 2802-2817.

Pazour, G.J., Baker, S.A., Deane, J.A., Cole, D.G., Dickert, B.L., Rosenbaum, J.L., Witman, G.B., and Besharse, J.C. (2002). The intraflagellar transport protein, IFT88, is essential for vertebrate photoreceptor assembly and maintenance. J. Cell Biol. 157, 103-113.

Pazour, G.J., Dickert, B.L., Vucica, Y., Seeley, E.S., Rosenbaum, J.L., Witman, G.B., and Cole, D.G. (2000). Chlamydomonas IFT88 and its mouse homologue, polycystic kidney disease gene tg737, are required for assembly of cilia and flagella. J. Cell Biol. 151, 709-718.

Ressler, K.J., Sullivan, S.L., and Buck, L.B. (1994). Information coding in the olfactory system: evidence for a stereotyped and highly organized epitope map in the olfactory bulb. Cell 79, 1245-1255.

Rodriguez-Gil, D.J., Bartel, D.L., Jaspers, A.W., Mobley, A.S., Imamura, F., and Greer, C.A. (2015). Odorant receptors regulate the final glomerular coalescence of olfactory sensory neuron axons. Proc. Natl. Acad. Sci. U. S. A. 112, 5821-5826.

Santoro, S.W., and Dulac, C. (2012). The activity-dependent histone variant H2BE modulates the life span of olfactory neurons. eLife 1, e00070.

Saucier, D., and Astic, L. (1986). Analysis of the topographical organization of olfactory epithelium projections in the rat. Brain Res. Bull. 16, 455-462.

87 Schwarzenbacher, K., Fleischer, J., and Breer, H. (2005). Formation and maturation of olfactory cilia monitored by odorant receptor-specific antibodies. Histochem. Cell Biol. 123, 419-428.

Scott, J.W., Sherrill, L., Jiang, J.B., and Zhao, K. (2014). Tuning to odor solubility and sorption pattern in olfactory epithelial responses. J. Neurosci. 34, 2025-2036.

Tadenev, A.L.D., Kulaga, H.M., May-Simera, H.L., Kelley, M.W., Katsanis, N., and Reed, R.R. (2011). Loss of bardet-biedl syndrome protein-8 (BBS8) perturbs olfactory function, protein localization, and axon targeting. Proc. Natl. Acad. Sci. U. S. A. 108, 10320-10325.

Vassar, R., Chao, S.K., Sitcheran, R., Nunez, J.M., Vosshall, L.B., and Axel, R. (1994). Topographic organization of sensory projections to the olfactory bulb. Cell 79, 981- 991.

Williams, C.L., McIntyre, J.C., Norris, S.R., Jenkins, P.M., Zhang, L., Pei, Q.L., Verhey, K., and Martens, J.R. (2014). Direct evidence for BBSome-associated intraflagellar transport reveals distinct properties of native mammalian cilia. Nat. Commun. 5., 5813.

Wong, S.T., Trinh, K., Hacker, B., Chan, G.C.K., Lowe, G., Gaggar, A., Xia, Z.G., Gold, G.H., and Storm, D.R. (2000). Disruption of the type III adenylyl cyclase gene leads to peripheral and behavioral anosmia in transgenic mice. Neuron 27, 487-497.

Yang, G.C., Scherer, P.W., Zhao, K., and Mozell, M.M. (2007). Numerical modeling of odorant uptake in the rat nasal cavity. Chem. Senses 32, 273-284.

Ying, G.X., Avasthi, P., Irwin, M., Gerstner, C.D., Frederick, J.M., Lucero, M.T., and Baehr, W. (2014). Centrin 2 is required for mouse olfactory ciliary trafficking and development of ependymal cilia planar polarity. J. Neurosci. 34, 6377-6388.

Yoder, B.K., Tousson, A., Millican, L., Wu, J.H., Bugg, C.E., Schafer, J.A., and Balkovetz, D.F. (2002). Polaris, a protein disrupted in orpk mutant mice, is required for assembly of renal cilium. Am. J. Physiol. Renal Physiol. 282, F541-F552.

Yoshihara, Y., Kawasaki, M., Tamada, A., Fujita, H., Hayashi, H., Kagamiyama, H., and Mori, K. (1997). OCAM: A new member of the neural cell adhesion molecule family related to zone-to-zone projection of olfactory and vomeronasal axons. J. Neurosci. 17, 5830-5842.

Zhao, H.Q., Ivic, L., Otaki, J.M., Hashimoto, M., Mikoshiba, K., and Firestein, S. (1998). Functional expression of a mammalian odorant receptor. Science 279, 237-242.

Zhao, H.Q., Otaki, J.M., and Firestein, S. (1996). Adenovirus-mediated gene transfer in olfactory neurons in vivo. J. Neurobiol. 30, 521-530.

88 Zhao, K., Dalton, P., Yang, G.C., and Scherer, P.W. (2006). Numerical modeling of turbulent and laminar airflow and odorant transport during sniffing in the human and rat nose. Chem. Senses 31, 107-118.

Zhou, Z.S., and Belluscio, L. (2012). Coding odorant concentration through activation timing between the medial and lateral olfactory bulb. Cell Rep. 2, 1143-1150.

Zou, D.J., Chesler, A.T., Le Pichon, C.E., Kuznetsov, A., Pei, X., Hwang, E.L., and Firestein, S. (2007). Absence of adenylyl cyclase 3 perturbs peripheral olfactory projections in mice. J. Neurosci. 27, 6675-6683.