A Novel Zebrafish Model of Metastasis Identifies the Hsd11b1 Inhibitor

Published OnlineFirst November 20, 2019; DOI: 10.1158/1541-7786.MCR-19-0759

MOLECULAR CANCER RESEARCH | NEW HORIZONS IN CANCER BIOLOGY

A Novel Zebraﬁsh Model of Metastasis Identiﬁes the HSD11b1 Inhibitor Adrenosterone as a Suppressor of Epithelial–Mesenchymal Transition and Metastatic Dissemination Joji Nakayama1,2,3, Jeng-Wei Lu1, Hideki Makinoshima2,4, and Zhiyuan Gong1

ABSTRACT ◥ Metastasis of cancer cells is multi-step process and dissemination 1 (HSD11b1), has a suppressor effect on cell dissemination in this is an initial step. Here we report a tamoxifen-controllable Twist1a- model. Pharmacologic and genetic inhibition of HSD11b1 sup- ERT2 transgenic zebrafish line as a new animal model for metastasis pressed metastatic dissemination of highly metastatic human cell research, and demonstrate that this model can serve as a novel lines in a zebrafish xenotransplantation model. Through down- platform for discovery of antimetastasis drugs targeting metastatic regulation of Snail and Slug, adrenosterone-treated cells recovered dissemination of cancer cells. By crossing Twist1a-ERT2 with xmrk expression of E-cadherin and other epithelial markers and lost (a homolog of hyperactive form of EGFR) transgenic zebrafish, partial expression of mesenchymal markers compared with vehicle- which develops hepatocellular carcinoma, approximately 80% of treated cells. Taken together, our model offers a useful platform for the double transgenic zebrafish showed spontaneous cell dissem- the discovery of antimetastasis drugs targeting metastatic dissemination of mCherry-labeled hepatocytes from the liver to the entire ination of cancer cells. abdomen region and the tail region. The dissemination is accom- plished in 5 days through induction of an epithelial-to- Implications: This study describes a transgenic zebrafish model for mesenchymal transition. Using this model, we conducted in vivo liver tumor metastasis and it has been successfully used for iden- drug screening and identified three hit drugs. One of them, adre- tification of some drugs to inhibit metastatic dissemination of nosterone, an inhibitor for hydroxysteroid (11-beta) dehydrogenase human cancer cells.

Introduction of cell polarity, loss of cell–cell adhesions, and induction of epithelial- to-mesenchymal transition (EMT; ref. 6). Overt metastases, the end result of malignant alteration of cancer EMT plays a central role in early embryonic morphogenesis, its cells, are responsible for approximately 90% of cancer-associated program enables various types of epithelial cells to convert into mortality. Metastasis consists of multiple processes: invasion, intra- mesenchymal cells through a downregulation of epithelial markers vasation, survival in the circulatory system, extravasation, coloniza- such as E-cadherin, and an upregulation of mesenchymal markers tion, andtumor formation insecondary organs withangiogenesis (1, 2). such as vimentin. Experimental studies demonstrated that EMT also Metastatic dissemination of cancer cells was traditionally viewed as a contributes to metastatic progression by conferring invasiveness, late stage event of cancer progression (3). However, this paradigm has motility, and an increased resistance to chemotherapy and apoptosis been challenged by recent studies, in which mammary epithelial cells on cancer cells. EMT is initiated and orchestrated by multiple signaling disseminated systemically from early neoplastic lesions of Her2 and pathways and transcriptional factor networks: TGFb, BMP, and Wnt- PyMT transgenic mice and from ductal carcinoma in situ in patients mediated signaling; and Snail, Slug, and Twist-mediated transcrip- with breast cancer (4, 5). Molecular mechanisms that promote dis- tional networks (7–9). semination involve the breakdown of local basement membrane, loss Twist, a basic helix-loop-helix transcription factor, plays a critical role in inducing the EMT program. It was first identified in Drosophila melanogaster as an organizer of EMT during fly gastrulation and a 1Department of Biological Sciences, National University of Singapore, Singapore. regulator of mesoderm differentiation (10). However, in the last 2Tsuruoka Metabolomics Laboratory, National Cancer Center, Tsuruoka, Japan. decade, experimental studies have demonstrated an additional role 3 4 Shonai Regional Industry Promotion Center, Tsuruoka, Japan. Division of of Twist—ectopic expression of Twist confers metastatic properties on Translational Research, Exploratory Oncology Research and Clinical Trial Center, cancer cells through induction of EMT. Moreover, clinical studies have National Cancer Center, Kashiwa, Japan. revealed elevated expression of Twist is associated with poor survival Note: Supplementary data for this article are available at Molecular Cancer rates in patients with cancer (8, 11, 12). Research Online (http://mcr.aacrjournals.org/). Cancer research using zebrafish as a model has attracted attention Corresponding Authors: Zhiyuan Gong, National University of Singapore, because this model offers many unique advantages that are not readily 14 Science Drive 4, Singapore 115473, Singapore. Phone: 656-516-2860; provided by other animal models (13). Moreover, the zebrafish has Fax: 656-779-2486; E-mail: [email protected]; and Joji Nakayama, Tsuruoka become a popular platform for drug screening to discover anticancer Metabolomics Laboratory, National Cancer Center, Tsuruoka, Japan. fi E-mail: [email protected] drugs (14); however, a zebra sh model that develops spontaneous metastases has not previously been reported. Mol Cancer Res 2020;18:477–87 Here we report a tamoxifen-controllable Twist1a-ERT2 transgenic doi: 10.1158/1541-7786.MCR-19-0759 zebrafish as a new animal model for metastasis research, and show that 2019 American Association for Cancer Research. this model serves as a novel platform for discovery of antimetastasis

AACRJournals.org | 477

Nakayama et al.

drugs targeting metastatic dissemination of cancer cells. Through and Y27632 were purchased from Cayman Chemical and R&D in vivo drug screening using this model, we found that adrenosterone Systems, respectively. Doxycycline, 4-hydroxytamoxifen (4-OHT), has suppressor effects on cell dissemination in both this model and adrenosterone, and rabeprazole were purchased from Sigma-Aldrich. human cancer cells. Finally, we demonstrated that pharmacologic and Olmesartan was purchased from Cayman Chemical. genetic inhibition of hydroxysteroid (11-beta) dehydrogenase 1 (HSD11b1), a primary target of adrenosterone, suppressed metastatic In vivo drug screen dissemination of highly metastatic human cancer cells in a zebrafish Larvae of Twist1a-ERT2/xmrk double transgenic zebrafish at 8 days xenotransplantation model. postfertilization (dpf) were treated with 30 mg/mL of doxycycline in E3 medium for 3 days to induce xmrk expression and then aliquoted Materials and Methods approximately 20 larvae into each well of a 6-well plate with 8 mL of E3 medium containing doxycycline. Drugs from the Prestwick Chemical fi Zebra sh Library were added to each well of the plates at a final concentration of fi Transgenic zebra sh lines Tg(fabp10a:mCherry-T2A-Twist1a- 5 mmol/L. Twelve hours after drug addition, 4-OHT was added to each T2 T2 ER ) and Tg(fabp10a:mCherry-T2A-ER ) were generated through well of the plates at a final concentration of 0.1 mmol/L to induce Ac/Ds transposon system (15). Five to 10 pg of either fabp10a: Twist1a-ERT2 biological activity. Five days after drug addition, the T2 T2 mCherry-T2A-Twist1a-ER or fabp10a:mCherry-T2A-ER plas- larvae were investigated under a fluorescence microscope and the fi – mid was coinjected into wild-type zebra sh embryos with 25 50 pg pattern of cell dissemination was quantified. The number of the larvae – of in vitro synthesized AC transposase mRNA at the 1 2 cell stage. Tg showing each dissemination pattern of mCherry-labeled cells from the fi (fabp10a:TA; TRE:xmrk; krt4:GFP) transgenic zebra sh line known as liver were counted. xmrk was described previously (16). Tg(kdrl:eGFP) zebrafish was provided by Dr. Stainier (Max Planck Institute for Heart and Lung Immunoblotting Research). The study protocol was approved by the Institutional Western blotting was performed as described previously (20). Animal Care and Use Committee of the National University of Anti-E-cadherin and anti-b-actin antibodies were purchased Singapore (protocol number: 096/12). from BD Biosciences and Sigma, respectively. Anti-GAPDH, anti-Snail, anti-Slug, and anti-Histon H3 antibodies were purchased Plasmids þ þ from Cell Signaling Technology. Anti-HSD11b1, anti-H /K -ATPase DNA fragments coding for mCherry-T2A, ERT2, and zebrafish beta, anti-Vimentin, and Twist1 antibodies were purchased from Twist1a were amplified by PCR with primers containing restriction Abcam. Anti-PCNA, anti-a-tubulin, anti-Occludin, anti-Claudin6, enzyme recognition sequences. mCherry-T2A–coding fragment was anti-KRT14, anti-KRT19, anti-MMP1, anti-MMP2, and anti- amplified from hsp70l:mCherry-T2A-CreERT2 plasmid (17). ERT2 S100A4 antibodies were purchased from Santa Cruz Biotechnology. coding DNA fragment was amplified from pCAG-Cre-ERT2 plas- fi fi mid (18). The fragments of zebra sh Twist1a was ampli ed from Cell culture and cell viability assay cDNA that was prepared from wild-type zebrafish embryos at sphere MCF7, MDA-MB-231, MDA-MB-435, MIA-PaCa2, PC3, and stage. The amplified fragments were cloned into the pDS (19). SW620 cells were acquired from ATCC. HCCLM3 cells were provided PCR by Dr. Tang, Zhong Shan Hospital of Fudan University (Shanghai, China; ref. 22). All culture methods followed the manufacturer's Total RNA was extracted from various adult organs in Twist1a-ERT2 instruction. Cell viability assay was performed as described transgenic zebrafish and also from the livers of wild-type and ERT2 previously (23). transgenic zebrafish. cDNA was synthesized from the total RNA as described previously (20). qPCR using SYBR-Green Master PCR Mix Boyden chamber assay (Applied Biosystems) were conducted in triplicates. All quantitation Boyden chamber assay was performed as described previously was normalized to an endogenous control gapdh. Primer sequences are (23). Either 3 105 MDA-MB-231, 5 105 HCCLM3, or 1 106 presented in Supplementary Table S1. MDA-MB-435 cells were applied to each top well. Immunofluorescence microscopy assay – Immunofluorescence microscopy assay was performed as described Short hairpin RNA mediated gene knockdown previously (21). Goat anti-mouse and goat anti-rabbit IgG antibodies The short hairpin RNA (shRNA)-expressing lentivirus vectors were b conjugated to Alexa Fluor 488 (Life Technologies) and diluted at 1:100 constructed using pLVX-shRNA1 vector (Clontech). HSD11 1- 0 – were used. Nuclei were visualized by the addition of 2 mg/mL of 4 , shRNA_#1 targeting sequence is GCTCCAAGGAAAGAAAGT- b – 6-diamidino-2-phenylindole and photographed at 100 magnifica- GAT; HSD11 1-shRNA_#2 targeting sequence is CGAGCTATAA- – tion by a fluorescence microscope (Zeiss). TATGGACAGAT. ATP4b-shRNA_#1 targeting sequence is TAACCTTAAGGCCGGATGTTT; ATP4b-shRNA_#2–targeting Confocal microscope assay sequence TGAAACACGGCTTACACTAAT. LacZ-shRNA– Living fry zebrafish were anesthetized using 0.02% phenoxyethanol targeting sequence is CTACACAAATCAGCGATT. and were then embedded with 30% methylcellulose in a lateral view orientation. Serial sections were captured in 8 mm Z-step intervals by a Xenotransplantation Leica TCS SP5X confocal microscope system (Leica). Z-stack images Zebrafish embryos that were derived from Tg (kgrl:eGFP) were processed by using image analysis software, Imaris (Bitplane). transgenic zebrafish line were maintained in E3 medium containing 200 mmol/L 1-phenyl-2-thiourea. Approximately 100–400 Reagents of red fluorescence protein (RFP)-labeled HCCLM3 or MDA- FDA, European Medicines Agency, and other agencies approved MB-231 cells were injected into the duct of Cuvier of the zebrafish chemical libraries were purchased from Prestwick Chemical. Ki16425 at 2 dpf.

478 Mol Cancer Res; 18(3) March 2020 MOLECULAR CANCER RESEARCH

Zebraﬁsh-Based Screening for Antimetastasis Drugs

Statistical analysis repression of E-cadherin through downregulating the promoter activ- Data were analyzed by Student t test and P < 0.05 was considered ity of E-cadherin (7, 12). Both 0.1 and 0.5 mmol/L 4-OHT treatments significant. for 48 hours decreased E-cadherin expression in the liver of the fish. This decreased expression was not observed in the liver of ERT2 fish (Fig. 1C). Moreover, IHC staining revealed that Twist1a-ERT2 acti- Results vation disrupted cell–cell adhesion of hepatic cells with a decrease of E- Twist1a-ERT2 activation induced EMT in the liver. cadherin and an increase of vimentin in the presence of oncogene- Twist1a was selected as the metastasis-inducible transgene in the mediated signals that were induced by crossing Twist1a-ERT2 fish with zebrafish model based on the following two criteria: (i) loss of function xmrk transgenic zebrafish. In contrast, a morphologic change was not of Twist1a interfered with metastatic potential of highly metastatic observed in the liver of ERT2/xmrk double transgenic fish (Fig. 1D; cancer cells in in vivo experiments using mouse metastasis models, and Supplementary Fig. S1B). (ii) in clinical studies, elevated expression of Twist1a was observed in These results indicated that Twist1a-ERT2 activation through metastasized cancer cells in patients suffering from cancer (11, 12). 4-OHT treatment for 48 hours enabled the conversion of epithelial Biological activity of Twist1a is controlled through a tamoxifen- cells into mesenchymal cells in the liver. inducible system by fusion of the gene with the estrogen receptor T2 (ERT2), and the transgene is expressed as a single open reading frame Twist1a-ER /xmrk double transgenic fish induced coding for mCherry and Twist1a-ERT2 separated by a viral T2A dissemination of mCherry-labeled hepatic cells peptide sequence under the control of a liver-specific promoter We examined whether Twist1a-ERT2 activation could induce dis- (fabp10a; Fig. 1A). semination of hepatic cells. Twist1a-ERT2 fish were treated with We microinjected wild-type zebrafish embryos at the single-cell 0.1mmol/L 4-OHT from 8 dpf for more than 3 weeks, but none of stage of development with a plasmid of either fabp10a:mCherry-T2A- them (n 50) showed dissemination from the liver compartment Twist1a-ERT2 or fabp10a:mCherry-T2A-ERT2 as a control, generating (data not shown). Akin to the fish, it has been reported that in Twist- fi F0 founder sh mosaic for expression of these transgenes. Germline inducible mice, long-term induction of Twist alone did not give rise to transmission with Mendelian ratios for single insertion was confirmed any skin abnormalities, and that only primary tumor cells (papillomas) T2 in the F1 generation. Tg(fabp10a:mCherry-T2A-Twist1a-ER ) and Tg that were developed through 12-O-tetra decanoylphorbol-13-acetate (fabp10a:mCherry-T2A-ERT2) zebrafish are shorted as Twist1a-ERT2 treatment migrated out of the skin and disseminated throughout the and ERT2, respectively, in the following description. To demonstrate body (24). Therefore, we crossed the fish with xmrk transgenic liver-specific expression of the transgene, we isolated RNA from the zebrafish, which develop hepatocellular carcinoma through expression T2 T2 fi livers and other organs from adult Twist1a-ER and ER sh at the F2 of a constitutively active form of an EGFR homologue in a doxycycline- generation and confirmed liver-specific expression of the Twist1a- dependent manner (16). Biological activities of the proteins coded by ERT2 transgene (Fig. 1B; Supplementary Fig. S1A). We then examined two transgenes were sequentially induced in an independent manner: whether Twist1a-ERT2 activation through tamoxifen (4-OHT) treat- first xmrk transcription was initiated through doxycycline treatment ment could induce EMT in the liver of the fish through Western blot from 8 dpf, and then Twist1a-ERT2 was activated through 4-OHT analysis. It is well known that loss of E-cadherin expression is the most treatment from 11dpf in presence of doxycycline (Fig. 2A). As shown predominant hallmark of EMT, and that Twist causes transcriptional in Fig. 1D, loss of cell–cell adhesion of hepatic cells with decreased E-

Figure 1. Twist1a-ERT2 activation induced EMT in the liver. A, Scheme of fabp10a:mCherry-T2A-Twist1a-ERT2 (top) and fabp10a:mCherry-T2A-ERT2 (bottom) transgene con- structs. B, Twist1a-ERT2 and ERT2 transgene expression in the liver of wild-type (WT), ERT2, and Twist1a-ERT2 transgenic fish by RT-PCR. C, E-cadherin expression levels in the liver of ERT2 and Twist1a-ERT2 transgenic fish. These fish were treated with either 0, 0.1, or 0.5 mmol/L 4-OHT for 48 hours. mCherry-positive cells were collected from the liver of these zebrafish under fluorescence microscope, lysed, and then subjected to Western blot analysis. D, Immunofluorescence images of E-cadherin expression (green), mCherry (red), and nuclei (blue) in the liver of Twist1a-ERT2/xmrk or ERT2/xmrk double transgenic fish. These fish were treated with doxycycline and 4-OHT by following experimental design in Fig. 2A. After 48 hours from 4-OHT addition, these fish were fixed with 4% paraformaldehyde and then subjected to frozen section procedure. The images were taken in 100 magnification.

AACRJournals.org Mol Cancer Res; 18(3) March 2020 479

Nakayama et al.

cadherin was observed in the liver of Twist1a-ERT2/xmrk fish 48 hours after 4-OHT treatment; conversely, the abnormalities were not observed in the liver of ERT2/xmrk fish. Fluorescence and confocal microscopy analysis revealed that Twist1a-ERT2/xmrk fish showed dissemination of mCherry-positive cells from the liver at day 5 from 4-OHT treatment (Fig. 2B). The dissemination patterns were generally divided into three categories: (i) local dissemination, in which disseminated mCherry-positive cells exist in close proximity to the liver; (ii) abdominal dissemination, in which the cells spread throughout the abdomen; and (iii) distant dissemination, in which the cells were observed over a broad region from the trunk to the tail (Fig. 2C). Three independent experiments showed that 39.48% 18.05% and 45.7% 5.60% of Twist1a-ERT2/xmrk fish showed abdominal and distant dissemination, respectively. In addition, 13.3% 5.61% of the fish showed both patterns of dissemination and were redundantly counted in both cases in this analysis. Also, 4.98% 1.45% of the fish showed local dissemination and 22.50% 4.37% of the fish did not show any cell dissemination. In contrast, only 0.96% 0.92% of ERT2/ xmrk fish showed abdominal dissemination and none of the fish showed distant dissemination. In addition, only 6.84% 0.44% of the fish showed local dissemination and 92.19% 0.86% of the fish did not show any cell dissemination. Neither ERT2 nor Twist1a-ERT2 fish showed cell dissemination. Statistical analysis using Student t test revealed that the frequency of Twist1a-ERT2/xmrk fish showing abdominal and distant disseminations significantly increased over that of ERT2/xmrk fish (P ¼ 0.02, P < 0.01). In contrast, a significant difference was not observed between the frequencies of Twist1a-ERT2/ xmrk and ERT2/xmrk fish showing local dissemination (Fig. 2D; Supplementary Table S2). These results suggested that in this model, Twist1a-ERT2–driven EMT alone would not be sufficient to induce abdominal and distant cell dissemination and that cooperation of oncogene-driven cellular events would be required for the dissemination. The statistical analysis revealed that these dissemination events were predominantly observed in Twist1a-ERT2/xmrk fish, but not ERT2/xmrk fish. This indicates that these dissemination events resulted from Twist1a-ERT2–driven EMT, but are not affected by xmrk-induced events. Thus, measurement of dissemination to the regions defined in this model might provide a novel way to measure metastatic potential.

Twist1a-ERT2/xmrk double transgenic zebrafish enabled the screening of chemicals/drugs for identification of antimetastatic potential Figure 2. We hypothesized that the rapid and high frequency induction of Twist1a-ERT2 activation induced cell dissemination of mCherry-positive cells dissemination of mCherry-positive cells from the liver in the Twist1a- in Twist1a-ERT2/xmrk double transgenic zebrafish. A, The experimental ERT2/xmrk model might provide a novel way to screen chemicals/ design is outlined. From 8 dpf, doxycycline treatment was started. From drugs in vivo for identification of antimetastasis drugs targeting 11 dpf, 4-OHT treatment was done in presence of doxycycline. B, Represen- metastatic dissemination of cancer cells. Therefore, we conducted tative images of dissemination of mCherry-labeled hepatic cells from the liver in ERT2, Twist1a-ERT2,ERT2/xmrk,orTwist1a-ERT2/xmrk double trans- preliminary experiments that investigated whether ki16425 (a LPA1 genic fish. Some disseminated mCherry-positive cells are indicated by inhibitor) or Y27632 (an inhibitor of Rho-associated, coiled-coil arrowheads. The images are shown as Z-stack images using 100 magni- containing protein kinase), which have been reported to suppress fication. Scale bar, 200 mm. C, Representative images of dissemination metastasis progression in metastatic mouse models (25, 26), could T2 patterns of mCherry-positive cells in Twist1a-ER /xmrk double transgenic suppress cell dissemination in the fish model. The basic experimental fi sh. mCherry-positive cells disseminated to closed region from the liver process followed the experimental design in Fig. 2A except that fish (top), whole region of the abdomen (middle), or the region distributing from the trunk to the tail (bottom) of the fish. D, The mean frequencies of the fish were treated with doxycycline and 4-OHT for 5 days in presence of showing the dissemination patterns in ERT2,Twist1a-ERT2,ERT2/xmrk,or either vehicle (DMSO), ki16425, or Y27632. Twist1a-ERT2/xmrk double transgenic fish. Each value is presented as mean Two independent experiments revealed that the frequency of the SEM of three independent experiments. Supplementary Table S2 provides fish showing either abdominal or distant cell dissemination in the more precise information. ki16425-treated group significantly decreased to 20.93% 2.93% or

480 Mol Cancer Res; 18(3) March 2020 MOLECULAR CANCER RESEARCH

Zebraﬁsh-Based Screening for Antimetastasis Drugs

T2 4.71% 6.67% when compared with those in the control (vehicle In vivo drug screening using Twist1a-ER /xmrk double treated) group; 53.10% 7.0145% or 45.04% 4.39% for abdominal transgenic zebrafish identified adrenosterone, rabeprazole, or distant cell dissemination. Similar to the ki16425-treated group, the and olmesartan Y27632-treated group also significantly decreased the frequency of Next, we subjected 67 FDA-approved drugs to this screening. A abdominal and distant cell dissemination to 9.15% 5.50% and 6.52% protocol for the screening followed the above experiment except 9.22%, respectively. In contrast, the frequency of the fish showing approximately 20 Twist1a-ERT2/xmrk double transgenic zebrafish local dissemination in ki16425- or Y27632-treated group, slightly were placed in each well of a 6-well plate and were treated with vehicle increased to 8.99% 3.30% or 11.36% 3.78%, respectively, when or each of the drugs for 5 days in presence of doxycycline and 4-OHT. the frequencies were compared with that in vehicle-treated group On the basis of the three categories that are indicated in Fig. 2C, the (3.46% 0.34%). Moreover, the frequency of fish that did not show fish in vehicle (DMSO) or drug-treated groups were subdivided, and any cell dissemination in the ki16425- or the Y27632-treated group, then the effects of the drugs were evaluated through comparing the significantly increased to 68.01% 2.81% and 76.21% 6.34%, frequencies of the fish showing the abdominal and distant dissemi- respectively, when the frequencies were compared with that in vehi- nation patterns with those in the vehicle-treated group. cle-treated group (27.96% 7.60%; Fig. 3A and B; Supplementary The screening assay showed that 63 drugs did not affect the Table S3). frequency of the fish showing cell dissemination, and one drug had These results indicated that the reported antimetastasis drugs a lethal effect on the fish. Only three drugs; adrenosterone, rabeprazole, (ki16425 and Y27632) could suppress abdominal and distant dissem- and olmesartan affected the frequency of the fish showing cell dis- ination, and that the cells that failed to disseminate to these regions semination, and in each of these drugs the treated group was lower were stuck either in a region close to the liver or within the liver than that in the vehicle-treated group. compartment by the effect of ki16425 or Y27632. These results To obtain more precise data, we conducted large scale experiments suggested that indeed, this model provided a valid and novel approach with each of these three drugs to determine whether they could to screen chemicals/drugs in vivo for identification of antimetastatic suppress cell dissemination in this model. potential. Two independent experiments revealed the frequencies of the fish showing abdominal and distant dissemination in the adrenosterone- treated group significantly decreased to 2.94% 4.16% and 0% when compared with those in vehicle-treated group; 53.33% 2.11% and 46.41% 2.78% for abdominal and distant dissemination, respectively. Similar effects were observed in rabeprazole- and olmesartan- treated groups: dissemination in the rabeprazole-treated group significantly decreased to 4.74% 2.42% or 0%; in the olmesartan-treated group the frequencies decreased to 27.79% 12.55% or 6.35% 5.16%. Conversely, the frequency of the fish that did not show any cell dissemination in adrenosterone-, rabeprazole-, or olmesartan-treated group, significantly increased to 94.92% 1.15%, 85.97% 1.59%, or 64.10% 1.08% when the frequencies were compared with that in the vehicle-treated group (27.77% 2.70%). The frequency of the fish showing local dissemination in rabeprazole-treated group significantly increased to 9.38% 0.41% but that in olmesartan-treated groups only slightly increased to 6.79% 9.55% when the frequencies were compared with that in the vehicle-treated group. In the adrenosterone-treated group the frequency was 2.13% 3.01% (Fig. 4A and B; Supplementary Table S4). To eliminate the possibility that the suppressor effects of these drugs might result from inhibition of xmrk-driven primary tumor growth of the liver in the fish, we investigated whether each of these drugs might affect growth. Each of the drug-treated fish showed enlarged livers that were similar to those of vehicle-treated fish. Imaging analyses revealed that the size of the liver and the frequencies of proliferating cell nuclear antigen and cleaved caspase 3–positive cells in the livers of these fish were same. Moreover, survival analysis showed each of the drug- Figure 3. treated fish survived as long as vehicle-treated fish (Supplementary Reported antimetastasis drugs: ki16425 and Y27632 could suppress dissemination of mCherry-labeled hepatic cells from the liver of Twist1a-ERT2/xmrk Fig. S2). double transgenic zebrafish. A, Representative images of the dissemination in These results demonstrate that this model offers a new high- the fish that were treated with doxycycline and 4-OHT in presence of vehicle throughput platform for identifying antimetastasis drugs, and suggests (left), 10 mmol/L of ki16425 (middle), or 10 mmol/L of Y27632 (right) by following that these drugs might have a potential to suppress metastatic dis- experimental design in Fig. 2A. Some disseminated mCherry-positive cells are semination of cancer cells without affecting primary tumor growth. indicated by arrowheads. The images were shown as Z-stack images using 100 fi m fi magni cation. Scale bar, 200 m. B, The mean frequencies of the sh showing Adrenosterone and rabeprazole suppressed cell motility and the dissemination patterns in the vehicle-, ki16425-, or Y27632-treated groups. in vitro Each value is presented as mean SEM of two independent experiments. invasion of highly metastatic human cancer cells Statistical analysis was determined by Student t test. Supplementary Table S3 Zebrafish have orthologues to 86% of 1,318 human drug targets as provides more precise information. reported previously (27). However, it is unclear whether the identified

AACRJournals.org Mol Cancer Res; 18(3) March 2020 481

Nakayama et al.

þ þ with cell lines with low metastatic potential (MCF7). H /K -ATPase beta expression was observed in all of the investigated cell lines except PC3, but the expression level did not correlate with metastatic properties (Fig. 5A). Although these drugs did not affect cell viability of HCCLM3, MDA-MB-231, and MDA-MB-435 cells, these drugs inhibited cell motility and invasion of these cells in dose-dependent manners (Fig. 5B and C; Supplementary Fig. S3). Olmesartan also inhibited cell motility and invasion of these cells without affecting their cell viability (data not shown). To eliminate the possibility that the metastasis-suppressing effects of the identified drugs might result from off-target effects of the drugs, we conducted validation experiments to determine whether knockdown of the gene encoding the protein that the drugs target would show the same effects. HCCLM3 cells expressing shRNA for either þ þ HSD11b1orH /K -ATPase beta showed decreased cell motility and invasion without affecting cell viability (Fig. 5D–F; Supplementary Fig. S3). These results demonstrated that the drugs that were identified through the zebrafish-based screening assay were able to show the same suppressor effects on cell motility and invasion of human cancer cells.

Adrenosterone suppressed metastatic dissemination of highly metastatic human cancer cells in vivo Although the identified drugs inhibited cell motility and invasion of highly metastatic cell lines in vitro, it was unclear whether the drugs could suppress metastatic dissemination of human cancer cells in vivo. Therefore, we examined whether the identified drugs could suppress metastatic dissemination of these cells in a zebrafish xenotransplantation model. Adrenosterone was selected as a test drug in the examination because HSD11b1 was overexpressed only in highly metastatic cell lines, suggesting it could be a novel target for blocking metastatic dissemination of cancer cells (Fig. 5A). RFP-labeled Figure 4. HCCLM3 (HCCLM3R) cells were injected into the duct of Cuvier of Identified drugs suppressed dissemination of mCherry-positive cells from the Tg(kdrl:eGFP) zebrafish at 2 dpf and then maintained in the presence liver of Twist1a-ERT2/xmrk double transgenic zebrafish. A, Representative of either vehicle or adrenosterone. Twenty-four hours after injection, images of effect of adrenosterone, rabeprazole, or olmesartan on the dissem- the frequencies of the fish showing metastatic dissemination of the ination of the fish. The dissemination in vehicle (top, left), olmesartan (top, right), inoculated cells were measured under fluorescence microscopy rabeprazole (bottom, left), or adrenosterone (bottom, right)-treated the fish. (Fig. 6A). In this model, the dissemination patterns were generally Some disseminated mCherry-positive cells are indicated by arrowheads. The images are shown as Z-stack images using 100 magnification. Scale bar, divided into three categories: (i) head dissemination, in which dis- 100 mm. B, The mean frequencies of the fish showing the dissemination patterns seminated HCCLM3R cells exist in the vessel of the head part; (ii) in the vehicle-, adrenosterone-, rabeprazole-, or olmesartan-treated groups. trunk dissemination, in which the cells were observed in the vessel Each value is presented as mean SEM of two independent experiments. radiating from the trunk to the tail; and (iii) end-tail dissemination, in Statistical analysis was determined by Student t test. Supplementary Table S4 which the cells were observed in the vessel of the end-tail part (Fig. 6B). provides more precise information. Two independent experiments revealed that the frequencies of the fish in adrenosterone-treated group showing head, trunk, or end-tail drugs through this zebrafish-based screening would show the same dissemination significantly decreased to 55.3% 7.5%, 28.5% 5.0%, suppressor effects on metastatic dissemination of human cancer cells. or 43.5% 19.1%, respectively, when compared with those in vehicle- We, therefore, examined whether the identified drugs could suppress treated group; 95.8% 5.8%, 47.1% 7.7%, 82.6% 12.7%. Con- metastatic dissemination and invasion of highly metastatic human cell versely, the frequency of the fish in adrenosterone-treated group not lines. Adrenosterone, rabeprazole, and olmesartan are reported to showing any dissemination significantly increased to 45.4% 0.5% þ þ block HSD11b1, hydrogen/potassium-transporting ATPase (H /K - when compared with those in the vehicle-treated group, 2.0% 2.9% ATPase) and angiotensin 2 type 1 receptor (AT1), respectively (28–30). (Fig. 6C; Supplementary Table S5). AT1-mediated signaling has been demonstrated to promote metastasis Similar effects were observed in another xenograft experiment using progression through in vivo and vitro studies (31). However, the RFP-labeled MDA-MB-231 (231R) cells. This experiment followed the þ þ involvement of HSD11b1 and H /K -ATPase in metastasis progres- experimental design in Fig. 5A. In adrenosterone-treated group, the þ þ sion is not known. We investigated HSD11b1 and H /K -ATPase frequencies of the fish showing head, trunk, or end-tail dissemination, beta expression in human cell lines possessing different metastatic significantly decreased to 27.9% 25.3%, 33.3% 11.7%, or 51.2% properties. Western blot analysis revealed that highly metastatic cell 15.9%; conversely, the frequency of the fish not showing any dissem- lines (MDA-MB-231, MDA-MB-435, MIA-PaCa2, PC3, SW620, and ination, significantly increased to 39.1% 8.2% when compared with HCCLM3) expressed a higher amount of HSD11b1 when compared those in the vehicle-treated group; 75.2% 23.2%, 57.7% 6.7%,

482 Mol Cancer Res; 18(3) March 2020 MOLECULAR CANCER RESEARCH

Zebraﬁsh-Based Screening for Antimetastasis Drugs

Figure 5. Identiﬁed drugs inhibited cell motility and invasion of highly metastatic human breast cancer cell line. A, Western blot analysis of HSD11b1 (top) and Hþ/Kþ- ATPase beta (middle) levels in lower metastatic human cancer cell line, MCF7 and highly metastatic human cancer cell lines, MDA-MB-231 (breast), MDA-MB-435 (skin), HCCLM3 (liver), MIA-PaCa2 (pancreas), PC3 (prostate), and SW620 (colon); GAPDH-loading control is shown in the bottom. B and C, Concentration- dependent effect of adrenosterone (B) and rabeprazole (C) on cell motility and invasion of HCCLM3, MDA- MB-231, and MDA-MB-435 cells. Vehicle-, adrenosterone-, or rabeprazole-treated these cells were subjected to Boyden chamber assay. FBS (1%, v/v) was used as the chemoattractant in the assay. Each experiment was performed at least twice. D and E, Knockdown of HSD11b1(D)orHþ/Kþ-ATPase beta (E) in HCCLM3 cells. Reduced HSD11b1 and Hþ/Kþ-ATPase beta expressions, determined by Western blot analysis, in parental and subcell lines of HCCLM3 cells expressing shRNA targeting for either LacZ as control shRNA, HSD11b1, or shATP4b. GAPDH levels as loading control. F, Effect of shRNAs targeting either HSD11b1 or ATP4b on cell motility and invasion of HCCLM3 cells. Above described cells were subjected to Boyden chamber assays. FBS (1%, v/v) was used as the chemoattractant in both assays. Each experiment was performed at least twice.

85.7% 3.4%, or 2.0% 2.9%, respectively (Fig. 6D; Supplementary that were inoculated with shLacZ HCCLM3R cells; 80.7% 27.1%, Table S5). 49.3% 4.5%, 79.1% 7.7%, or 0% (Fig. 6E; Supplementary To eliminate the possibility that the metastasis-suppressing Table S5). effects of adrenosterone might result from off-target effects of it, These results indicated that adrenosterone could suppress meta- we conducted validation experiments to determine whether knock- static dissemination of human cancer cells in vivo. down of HSD11b1 would show the same effects. The basic experimental process followed the experimental design in Fig. 5A except Adrenosterone-treated HCCLM3 cells recovered epithelial that subclones of HCCLM3R cells that express shRNA targeting markers either LacZ or HSD11b1 were injected into the fish at 2 dpf and the It was unclear how adrenosterone suppressed metastatic dissemi- fish were maintained without drug. In the fish that were inoculated nation of cancer cells. Therefore, we elucidated the mechanism of with shHSD11b1 HCCLM3R cells, the frequencies of the fish action of it. The screen reported here relies upon cell dissemination showing head, trunk, and end-tail dissemination, significantly that is induced by Twist1a-driven EMT. Previously, HCCLM3, MDA- decreased to 27.3% 4.9%, 14.8% 0.7%, or 49.8% 16.5%; MB-231, and MDA-MB-435 cell lines have been reported to express conversely, the frequency of the fish not showing any dissemination, Twist and possess mesenchymal properties (12, 32). Thus, adrenos- significantly increased to 49.2% 4.4% compared with those fish terone was expected to suppress cell motility and invasion of these cells

AACRJournals.org Mol Cancer Res; 18(3) March 2020 483

Nakayama et al.

Figure 6. Pharmacologic and genetic inhibition of HSD11b1 suppressed metastatic dissemination of HCCLM3 cells in a zebrafish xenotransplantation model. A, The experimental design is outlined. B, Representative images of dissemination patterns of HCCLM3R cells in a zebrafish xenotransplantation model. Disseminated HCCLM3R cells (red) resided in the vessel (green) of the head part (top, left), the vessel radiating from the trunk to the tail parts (bottom), or the vessel in end-tail part (top, left) of the fish. The images are shown in 4 magnification. Scale bar, 100 mm.C–E, Representative images of dissemination of HCCLM3R, 231R, shLacZ HCCLM3R, or shHSD11b1 HCCLM3R cells in the fish. The fish that were inoculated with HCCLM3R cells were treated with either vehicle (top, left) or adrenosterone (bottom, left; C). The fish that were inoculated with 231R cells were treated with either vehicle (top, left) or adrenosterone (bottom; D). The fish that were inoculated with either shLacZ HCCLM3R (top, left) or shHSD11b1 HCCLM3R cells (bottom, left; E). White arrows head indicate disseminated HCCLM3R cells. The images are shown in 4 magnification. Scale bar, 100 mm. The mean frequencies of the fish are indicated as graph on the right of each panel. Each value is indicated as the mean SEM of two independent experiments. The statistical analysis was determined by Student t test. Supplementary Table S5 provides more precise information.

that had already transitioned to mesenchymal-like traits via EMT, not same effects (Fig. 7D). However, adrenosterone-treated cells did not inhibit EMT itself. HSD11b1 is NADPH-dependent enzyme that show decreased expression of mesenchymal makers such as N- catalyzes the interconversion of the steroid pair of the inactive cadherin and vimentin when compared with vehicle-treated cells metabolite cortisone and the stress hormone cortisol. It is reported (Supplementary Fig. S4A). that a transcriptional activation of the glucocorticoid receptor, which is A recent study demonstrated that cancer cells can stably exist in a a receptor for cortisol, upregulates EMT-inducing transcriptional hybrid epithelial–mesenchymal state where they coexpress epithelial factors such as snail and slug (33). Therefore, we speculate that and mesenchymal markers (34). Therefore, we further investigated adrenosterone might interfere with the acquired mesenchymal traits whether adrenosterone-treated cells might exit in such a hybrid state. of these cells through downregulation of these genes. Western blot FACS analysis demonstrated that the percentage of E-cadherin– þ analysis revealed Snail and Slug expression in adrenosterone-treated positive cells (E-cad cells) in adrenosterone-treated HCCLM3 HCCLM3 and MDA-MB-231 cells was markedly decreased compared (30%; Fig. 7E), and immunoﬂuorescence analysis revealed the þ with vehicle-treated cells (Fig. 7A). Subsequently, E-cadherin expres- E-cad cells showed cell–cell adhesion; conversely, E-cadherin– sions in adrenosterone-treated these cells were restored at both the negative cells maintained a loss of cell–cell contact (Supplementary mRNA and the protein levels compared with that in vehicle-treated Fig. S4B). mRNA expression of other EMT-related epithelial markers: these cells (Fig. 7B and C). Also, knockdown of HSD11b1 showed the CDH1, OCLN, CLDN3, CLDN6, CLDN7, KRT14, and KRT19 in the

484 Mol Cancer Res; 18(3) March 2020 MOLECULAR CANCER RESEARCH

Zebraﬁsh-Based Screening for Antimetastasis Drugs

Figure 7. Adrenosterone-treated cells recovered epithelial traits. A, Snail and Slug expressions in either vehicle or adrenosterone-treated HCCLM3 (left) and MDA-MB-231 (right) cells through Western blot analysis. B and C, E-cadherin (CDH1) expressions in either vehicle or adrenosterone-treated HCCLM3 (left) and MDA-MB-231 (right) cells were shown at mRNA level through qRT- PCR analysis (B) and protein level through Western blot analysis (C). Values were normalized by vehicle-treated cells in B and Histone H3 was a loading control in C. D, E- cadherin expressions in subclone of HCCLM3 express shRNA targeting for LacZ or HSD11b1, GAPDH as a loading control (bottom) is shown. E, Surface expression of E- cadherin in either vehicle (grey) or adrenosterone (open)-treated HCCLM3 cells through FACS analysis. Nonstained controls are shown in gray. F and G, Expres- sions of epithelial and mesenchymal markers in control HCCLM3 (vehicle), adrenosterone-treated HCCLM3 cells (adrenosterone), and E-cadþ HCCLM3 after adrenosterone treatment (E-cadþ) as determined by qRT-PCR (F) or by Western blot analysis (G). Gene expression values are relative to those in vehicle-treated cells in F.

þ E-cad cells was more than 2.5-fold increase when compared with Discussion vehicle-treated cells. Conversely, expression of mesenchymal markers, þ The zebrafish system has been increasingly recognized as a platform MMP1, MMP2, and S100A4, in the E-cad cells was decreased to less for chemical screening because it provides the advantage of high- than half of that in vehicle-treated cells (Fig. 7F), while expression of a throughput screening in an in vivo vertebrate setting with physiologic few other mesenchymal markers (CDH2, VIM, FN1, SMA, MMP7, relevance to humans (14). This study demonstrated that approximate- MMP9, and MMP14) was similar to that in vehicle-treated cells ly 80% of Twist1a-ERT2/xmrk double transgenic zebrafish induced (Supplementary Fig. S4A). In addition, consistent changes at protein dissemination of mCherry-labeled hepatic cells from the liver within levels of these genes were also observed (Fig. 7G). 5 days through induction of EMT. This rapid and high frequency These results indicated a fraction of adrenosterone-treated induction of cell dissemination enabled us to perform an in vivo HCCLM3 cells existed in a hybrid epithelial–mesenchymal state chemical screen for identification of antimetastasis drugs targeting through recovery of epithelial markers but not lose of mesenchymal metastatic dissemination of cancer cells. Indeed, this screen identified markers with the exception of MMP1, MMP2, and S100A4. Accu- three FDA-approved drugs; adrenosterone, rabeprazole, and olme- mulating evidence demonstrates that reexpression of either E- sartan, that suppressed cell dissemination. The antimetastatic poten- cadherin or claudin7 is enough to interfere with metastatic progression tial of these drugs was confirmed in in vitro experiment using highly of cancer cells (35, 36). Therefore, we conclude that adrenosterone metastatic human cell lines. Especially, adrenosterone was able to could suppress metastatic dissemination of HCCLM3 and MDA-MB suppress metastatic dissemination of these cells in a zebrafish 231 cells through recovery of epithelial markers.

AACRJournals.org Mol Cancer Res; 18(3) March 2020 485

Nakayama et al.

xenotransplantation model, demonstrating that the drugs identified like traits in HCCLM3 and MDA-MB-231 cells. Previous studies through this zebrafish-based screen showed similar suppressor effects demonstrated that transcriptional activation of glucocorticoid recep- on human cancer cells. Thus, this model offers a novel platform for tor upregulates EMT-inducing transcription factors such as Snail and discovery of antimetastasis drugs targeting metastatic dissemination of Slug, and cortisol promotes metastatic progression of breast cancer human cancer cells. cells (33, 40). This evidence supports adrenosterone as a suppressor of This study revealed a new role for adrenosterone as a potential metastatic progression of human cancer cells. inhibitor of metastatic dissemination of cancer cells. Adrenosterone was originally isolated from the adrenal cortex of the fish as a Disclosure of Potential Conflicts of Interest steroid hormone with a weak androgenic effect, and currently used No potential conflicts of interest were disclosed. as a daily supplement for bodybuilders (28, 37). As a competitive inhibitor of HSD11b1, which catalyzes the interconversion of the Authors’ Contributions steroid pair of the inactive metabolite cortisone and the stress Conception and design: J. Nakayama, Z. Gong hormone cortisol, adrenosterone decreases the amount of cortisol. Development of methodology: J. Nakayama HSD11b1 is normally expressed in key metabolic tissues including Acquisition of data (provided animals, acquired and managed patients, provided the liver, adipose tissue, and the central nervous system (28). Here, facilities, etc.): J. Nakayama, J.-W. Lu Analysis and interpretation of data (e.g., statistical analysis, biostatistics, we provide the first evidence that elevated expression of HSD11b1 computational analysis): J. Nakayama, J.-W. Lu, H. Makinoshima was observed only in highly metastatic human cell lines but not in Writing, review, and/or revision of the manuscript: J. Nakayama, J.-W. Lu, poorly metastatic cell lines. Pharmacologic inhibition of HSD11b1 H. Makinoshima, Z. Gong enabled suppression of both spontaneous cell dissemination from a Administrative, technical, or material support (i.e., reporting or organizing data, primary tumor site in Twist1a-ERT2/xmrk double transgenic zebra- constructing databases): J. Nakayama, H. Makinoshima fish and metastatic dissemination of human cancer cells in a Study supervision: J. Nakayama, Z. Gong zebrafish xenotransplantation model, and genetic inhibition of HSD11b1 showed the same effects. Therefore, HSD11b1 could be Acknowledgments a novel therapeutic target for inhibiting metastatic dissemination of We sincerely appreciate Drs. Joshua Collins (NIH/NIDCR) for helping in this cancer cells. research; Diane Palmieri (NIH/NCI), Daniel Fitzgerald (Otsuka Maryland Medical Laboratories), Natascia Marino (Indiana University), and Takashi Hoshino (Takeda We also showed the effects of adrenosterone on HCCLM3 cells were þ Pharmaceutical Company, Ltd.) for editing this article; Motomi Osato (National heterogeneous and E-cad cells in adrenosterone-treated HCCLM3 University of Singapore), Michael Brand (Dresden University of Technology, Ger- cells showed elevated expression of several epithelial makers compared many), and Zhao-You Tang (Fudan University) for providing pCAG-Cre-ERT2, with adrenosterone-treated E-cadherin–negative cells. These results hsp70:mCherry-T2A-CreERT2 vector, and HCCLM3 cells; and Shu Wang for pro- indicate effects of adrenosterone on these cells are heterogeneous and viding cell culture facilities. This study was funded by National Medical Research some of the cells were able to recover epithelial markers in the presence Council of Singapore (R-154000547511) and Ministry of Education of Singapore (R- 154000A23112) to Z. Gong. of adrenosterone. The heterogeneity might result from clonality of HCCLM3 and MDA-MB-231 cell lines, which are composed of The costs of publication of this article were defrayed in part by the payment of page multiple clones and each clone shows different gene expressions and charges. This article must therefore be hereby marked advertisement in accordance different metastatic potencies (38, 39). with 18 U.S.C. Section 1734 solely to indicate this fact. This report did not address whether transcriptional activation of glucocorticoid receptor, which is a receptor for cortisol, might induce Received July 24, 2019; revised September 12, 2019; accepted November 5, 2019; EMT in epithelial cells and be essential for maintaining mesenchymal- published first November 20, 2019.

References 1. Fidler IJ. The pathogenesis of cancer metastasis: the 'seed and soil' hypothesis 11. Lee TK, Poon RT, Yuen AP, Ling MT, Kwok WK, Wang XH, et al. Twist revisited. Nat Rev Cancer 2003;3:453–8. overexpression correlates with hepatocellular carcinoma metastasis through 2. Steeg PS. Metastasis suppressors alter the signal transduction of cancer cells. induction of epithelial-mesenchymal transition. Clin Cancer Res 2006;12: Nat Rev Cancer 2003;3:55–63. 5369–76. 3. Hanahan D, Weinberg RA. The hallmarks of cancer. Cell 2000;7:57. 12. Yang J, Mani SA, Donaher JL, Ramaswamy S, Itzykson RA, Come C, et al. Twist, a 4. Weng D, Penzner JH, Song B, Koido S, Calderwood SK, Gong J. Metastasis is an master regulator of morphogenesis, plays an essential role in tumor metastasis. early event in mouse mammary carcinomas and is associated with cells bearing Cell 2004;117:927–39. stem cell markers. Breast Cancer Res 2012;14:R18. 13. White R, Rose K, Zon L. Zebrafish cancer: the state of the art and the path 5. Husemann Y, Geigl JB, Schubert F, Musiani P, Meyer M, Burghart E, et al. forward. Nat Rev Cancer 2013;13:624–36. Systemic spread is an early step in breast cancer. Cancer Cell 2008;13:58– 14. Zon LI, Peterson RT. In vivo drug discovery in the zebrafish. Nat Rev Drug 68. Discov 2005;4:35–44. 6. Chaffer CL, Weinberg RA. A perspective on cancer cell metastasis. Science 2011; 15. Emelyanov A, Gao Y, Naqvi NI, Parinov S. Trans-kingdom transposition of the 331:1559–64. maize dissociation element. Genetics 2006;174:1095–104. 7. Thiery JP, Acloque H, Huang RY, Nieto MA. Epithelial-mesenchymal transi- 16. Li Z, Huang X, Zhan H, Zeng Z, Li C, Spitsbergen JM, et al. Inducible and tions in development and disease. Cell 2009;139:871–90. repressable oncogene-addicted hepatocellular carcinoma in Tet-on xmrk trans- 8. Tsai JH, Yang J. Epithelial-mesenchymal plasticity in carcinoma metastasis. genic zebrafish. J Hepatol 2012;56:419–25. Genes Develop 2013;27:2192–206. 17. Hans S, Kaslin J, Freudenreich D, Brand M. Temporally-controlled site-specific 9. Fischer KR, Durrans A, Lee S, Sheng J, Li F, Wong STC, et al. Epithelial-to- recombination in zebrafish. PLoS One 2009;4:e4640. mesenchymal transition is not required for lung metastasis but contributes to 18. Matsuda T, Cepko CL. Controlled expression of transgenes introduced by in vivo chemoresistance. Nature 2015;527:472–6. electroporation. Proc Natl Acad Sci U S A 2007;104:1027–32. 10. Thisse B, el Messal M, Perrin-Schmitt F. The twist gene: isolation of a Drosophila 19. Nguyen AT, Emelyanov A, Koh CH, Spitsbergen JM, Parinov S, Gong Z. An zygotic gene necessary for the establishment of dorsoventral pattern. inducible kras(V12) transgenic zebrafish model for liver tumorigenesis and Nucleic Acids Res 1987;15:3439–53. chemical drug screening. Dis Model Mech 2012;5:63–72.

486 Mol Cancer Res; 18(3) March 2020 MOLECULAR CANCER RESEARCH

Zebraﬁsh-Based Screening for Antimetastasis Drugs

20. Nakayama J, Yamamoto M, Hayashi K, Satoh H, Bundo K, Kubo M, et al. BLNK 30. George AJ, Thomas WG, Hannan RD. The renin-angiotensin system and cancer: suppresses pre-B-cell leukemogenesis through inhibition of JAK3. Blood 2009; old dog, new tricks. Nat Rev Cancer 2010;10:745–59. 113:1483–92. 31. Rodrigues-Ferreira S, Abdelkarim M, Dillenburg-Pilla P, Luissint AC, di- 21. Marino N, Marshall JC, Collins JW, Zhou M, Qian Y, Veenstra T, et al. Nm23-h1 TommasoA,DeshayesF,etal.Angiotensin II facilitates breast cancer cell binds to gelsolin and inactivates its actin-severing capacity to promote tumor cell migration and metastasis. PLoS One 2012;7:e35667. motility and metastasis. Cancer Res 2013;73:5949–62. 32. Blick T, Widodo E, Hugo H, Waltham M, Lenburg ME, Neve RM, et al. Epithelial 22. Yang J, Qin LX, Li Y, Ye SL, Liu YK, Gao DM, et al. Molecular cytogenetic mesenchymal transition traits in human breast cancer cell lines. Clin Exp characteristics of the human hepatocellular carcinoma cell line HCCLM3 with Metastasis 2008;25:629–42. high metastatic potential: comparative genomic hybridization and multiplex 33. Zhang L, Lei W, Wang X, Tang Y, Song J. Glucocorticoid induces mesenchymal- fluorescence in situ hybridization. Cancer Genet Cytogenet 2005;158:180. to-epithelial transition and inhibits TGF-b1-induced epithelial-to-mesenchymal 23. Horak CE, Mendoza A, Vega-Valle E, Albaugh M, Graff-Cherry C, McDermott transition and cell migration. FEBS Lett 2010;584:4646–54. WG, et al. Nm23-H1 suppresses metastasis by inhibiting expression of the 34. Pastushenko I, Brisebarre A, Sifrim A, Fioramonti M, Revenco T, Boumahdi S, lysophosphatidic acid receptor EDG2. Cancer Res 2007;67:11751–9. et al. Identification of the tumour transition states occurring during EMT. Nature 24. Tsai JH, Donaher JL, Murphy DA, Chau S, Yang J. Spatiotemporal regulation of 2018;556:463–8. epithelial-mesenchymal transition is essential for squamous cell carcinoma 35. Bhat AA, Pope JL, Smith JJ, Ahmad R, Chen X, Washington MK, et al. Claudin-7 metastasis. Cancer Cell 2012;22:725–36. expression induces mesenchymal to epithelial transformation (MET) to inhibit 25. Itoh K, Yoshioka K, Akedo H, Uehata M, Ishizaki T, Narumiya S. An essential colon tumorigenesis. Oncogene 2015;34:4570–80. part for Rho-associated kinase in the transcellular invasion of tumor cells. 36. Chao YL, Shepard CR, Wells A. Breast carcinoma cells re-express E-cadherin Nat Med 1999;5:221–5. during mesenchymal to epithelial reverting transition. Mol Cancer 2010;9: 26. Boucharaba A, Serre CM, Guglielmi J, Bordet JC, Clezardin P, Peyruchaud O. 179. The type 1 lysophosphatidic acid receptor is a target for therapy in bone 37. Goh W, Sleptsova-Freidrich I, Petrovic N. Use of proton pump inhibitors as metastases. Proc Natl Acad Sci U S A 2006;103:9643–8. adjunct treatment for triple-negative breast cancers. An introductory study. 27. Gunnarsson L, Jauhiainen A, Kristiansson E, Nerman O, Larsson DGJ. Evolu- J Pharm Pharm Sci 2014;17:439. tionary conservation of human drug targets in organisms used for environmental 38. Minn AJ, Gupta GP, Siegel PM, Bos PD, Shu W, Giri DD, et al. Genes that risk assessments. Environ Sci Technol 2008;42:5807–13. mediate breast cancer metastasis to lung. Nature 2005;436:518–24. 28. Tomlinson JW, Walker EA, Bujalska IJ, Draper N, Lavery GG, Cooper MS, et al. 39. Zhe G, Jing-Hang J, Jun Z, Hao-Jie Y, Yan-Ping Z, Jie S, et al. Side population in 11beta-hydroxysteroid dehydrogenase type 1: a tissue-specific regulator of hepatocellular carcinoma HCCLM3 cells is enriched with stem-like cancer cells. glucocorticoid response. Endocr Rev 2004;25:831–66. Oncol Lett 2016;11:3145–51. 29. Sachs G, Shin JM, Howden CW. Review article: the clinical pharmacology of 40. Obradovic MMS, Hamelin B, Manevski N, Couto JP, Sethi A, Coissieux MM, proton pump inhibitors. Aliment Pharmacol Ther 2006;23:2–8. et al. Glucocorticoids promote breast cancer metastasis. Nature 2019;567:540–4.

AACRJournals.org Mol Cancer Res; 18(3) March 2020 487

A Novel Zebrafish Model of Metastasis Identifies the HSD11β1 Inhibitor Adrenosterone as a Suppressor of Epithelial− Mesenchymal Transition and Metastatic Dissemination

Joji Nakayama, Jeng-Wei Lu, Hideki Makinoshima, et al.

Mol Cancer Res 2020;18:477-487. Published OnlineFirst November 20, 2019.

Updated version Access the most recent version of this article at: doi:10.1158/1541-7786.MCR-19-0759

Supplementary Access the most recent supplemental material at: Material http://mcr.aacrjournals.org/content/suppl/2019/11/09/1541-7786.MCR-19-0759.DC1

Cited articles This article cites 40 articles, 10 of which you can access for free at: http://mcr.aacrjournals.org/content/18/3/477.full#ref-list-1

Citing articles This article has been cited by 5 HighWire-hosted articles. Access the articles at: http://mcr.aacrjournals.org/content/18/3/477.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mcr.aacrjournals.org/content/18/3/477. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.