US 2013/0334131 A1 Allen Et Al

Total Page:16

File Type:pdf, Size:1020Kb

US 2013/0334131 A1 Allen Et Al US 2013 0334131A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2013/0334131 A1 Allen et al. (43) Pub. Date: Dec. 19, 2013 (54) IDENTIFICATION OF AND COMPOSITIONS Publication Classification CONTAINING POLYPHOSPHATE ACCUMULATING BACTERIA (51) Int. C. CI2N I/20 (2006.01) (71) Applicants: UNIVERSITY OF NORTH TEXAS, CO2F 3/34 (2006.01) Denton, TX (US); TENFOLD CI2O I/68 (2006.01) TECHNOLOGIES LLC, Pilot Point, (52) U.S. C. TX (US) CPC CI2N 1/20 (2013.01); C12O 1/689 (2013.01); C02F 3/34 (2013.01) (72) Inventors: Michael Allen, Denton, TX (US); USPC ...... 210/601; 435/252.1; 435/6.11: 435/6.12: Michael LaMontagne, Denton, TX (US) 536/24.32:536/24.33 (21) Appl. No.: 13/842,400 (57) ABSTRACT (22) Filed: Mar 15, 2013 Provided are compositions comprising polyphosphate accu mulating bacteria as well as a method for identifying said Related U.S. Application Data polyphosphate accumulating bacteria. Additionally provided (60) Provisional application No. 61/659,333, filed on Jun. is a method for treating various Substances with said compo 13, 2012. sitions. Patent Application Publication Dec. 19, 2013 US 2013/0334131 A1 FIGURE 1 Actinomyces sp. B-79 O l-PES5 |- Pass S, - Pass 8, 4.322 C. 1492PC3 - 192PCS, g 1492Pic: 1. 1492 cSt cklister 30 a82P5 1C Thacilis certifas S57, 18S Rhodocyclis tenuis DSN410 S: Uncutti exi Candidatus. Accurriulibacterspy clofie EMB; clofie: 12. F- Rhodocyatts sp.FR6 cities EEPR SERA220) OO Rhodocyclispirpureus. Zoogloea amigea (8 Thauera.sp. mztt Linctitt exi Aiz?ays: sagine: 1. PAE53, P&BS - 1492c1 92 - 1492P 1. 9. - 1492PC3, O 92 - 1492Plc2. 1920; a92PC. tG is 89:448 P45 US 2013/0334131 A1 Dec. 19, 2013 IDENTIFICATION OF AND COMPOSITIONS 0007 (a) comprises a nucleotide sequence, wherein said CONTAINING POLYPHOSPHATE sequence has at least about 97% homology, identity or simi ACCUMULATING BACTERA larity to at least one of the nucleotide sequences set forth in SEQID NOs: 1-6: TECHNICAL FIELD 0001 Provided are compositions comprising novel poly phosphate accumulating bacteria related to polyphosphate SEQ ID NO: 1: S1492Plc8 accumulating microbes. Further provided is a method for ACGGGGGCAACCCTGGTGGCGAGTGGCGAACGGGTGAGTAATGCATCGGA identifying said bacteria in a sample. Additionally provided is ACATACCCAGTCGTGGGGGATAACGTAGCGAAAGTTACGCTAATACCGCA a method for treating various Substances with said composi tions. TACGTCCTGAGGGAGAAAGCGGGGGATCGCAAGACCTCGCGCGATTGGAG TGGCCGATGTCAGATTAGCTAGTTGGTGGGGTAAAGGCCCACCAAGGCGA BACKGROUND 0002 Excessive nutrient runoff, particularly phosphorus, CGATCTGTAGCGGGTCTGAGAGGATGATCCGCCACACTGGGACTGAGACA in a lake or other body of water typically results in plant and CGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATTTTGGACAATGGGG algal blooms. Subsequent decomposition of these blooms depletes the Supply of oxygen, creating anoxic conditions and GCAACCCTGATCCAGCCATGCCGCGTGCGGGAAGAAGGCCTTCGGGTTGT death of animal life. AAACCGCTTTCGGACGGAAAGAAATCGCCATCTCTAACATAGGTGGTGGA 0003. An important aspect of wastewater treatment is the removal of excess nutrients. The removal of phosphorus (P) TGACGGTACCGTAAGAAGAAGCACCGGCTAACTACGTGCCAGCAGCCGCG from wastewater can be accomplished either by chemical precipitation or by a biological mechanism in a process GTAATACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTG named enhanced biological phosphorus removal (EBPR). CGCAGGCGGTTTCTTAAGCCAGACGTGAAATCCCCGGGCTTAACCTGGGA The latter requires microorganisms known as polyphosphate accumulating microorganisms or bacteria (PAOS), which can ACTGCGTTTGGAACTGGGAGACTAGAGTGTGTCAGAGGGAGGTGGAATTC store phosphate as intracellular polyphosphate granules; CGCGTGTAGCAGTGAAATGCGTAGATATGCGGAGGAACACCGATGGCGAA therefore, removal of a portion of the growing biomass con taining a high polyphosphate content (waste-activated GGCAGCCTCCTGGGATAACACTGACGCTCATGCACGAAAGCGTGGGGAGC sludge) results in the net removal of P from the wastewater (Oehmen et al., 2007). However, little is known of the genet AAACAGGATTAGATACCCTGGTAGTCCACGCCCTAAACGATGTCAACTGG ics or biochemistry of the organisms responsible for poly CTGTTGGGAGAGAAATCTTTCAGTAGCGAAGCTAACGCGTGAAGTTGANC phosphate-accumulation because they have not yet been iso lated in pure culture, leading to poor stability and reliability of GCCTGGGGAGTACGGCCGCAAGGTTGAAACT CAAAGGAATTGANGGGGCC EBPR. Previous studies using 16S rRNA directed probes have identified the dominant polyphosphate-accumulating CGCACAAGCGGTGGATGATGTGGATTAATTCGATGCAACGCGAAGAACCT bacteria in acetate-fed laboratory scale sequencing batch TACCTACCCTTGACATGCCAGGAATCCCGNANAGATCTGGGGG reactors as members of the phylogenetically defined SEO ID NO: 2 Rhodocyclus group in the B-proteobacteria (Crocetti et al., P4B58 2000, WO 01/46459). In addition, the Rhodocyclus related TCGGNTCCNCTAGTAACGGCCGCCAGTGTGCTGGAATTCGCCCTTACGGG organisms have been repeatedly enriched and one such mem ber is tentatively named Candidatus accumulibacter phos GGCAACCCTGGTGGCGAGCGGCGAACGGGTGAGTAACACATCGGAACGTA phatis (Hesselmann et al., 2000). The involvement of Accu CCCTGTCGTGGGGGATAGCCCGGCGAAAGCCGGATTAATACCGCATACGA mulibacter-related organisms in EBPR was confirmed in full scale EBPR wastewater treatment plants (Kong et al., 2004). CCTGAGGGTGAAAGCGGGGGATCGCAAGACCTCGCGCGATAGGAGCGGCC Nevertheless, it is unlikely that Accumulibacter are the only phosphate accumulating bacteria groups in EBPR systems GATGGCGGATTAGCTAGTTGGTGGGGTAAAGGCCTACCAAGGCGACGATC based on FISH studies that have observed poly-phosphate in CGTAGCTGGTCTGAGAGGACGACCAGCCACACTGGAACTGAGACACGGTC other unrelated organisms in these communities (He et al., 2008). However, to date, it has not been possible to obtain CAGACTCCTACGGGAGGCAGCAGTGGGGAATTTTGGACAATGGGGGCAAC pure cultures of polyphosphate accumulating bacteria. CCTGGTCCAGCCATGCCGCGTGCGGGAAGAAGGCCTTCGGGTTGTAAACC 0004 Phosphorous has also been found to accumulate in Solid waste as well. US Patent Publication No. 20120103037 GCTTTCGGACAGAAAGAAATCGTTCGCTCTAACATAGCGGATGGATGACG discloses a method for treating Solid waste with a combina tion of leaching and polyphosphate accumulating microor GTACTGTAAGAAGAAGCACCGGCTAACTACGTGCCAGCAGCCGCGGTAAT ganisms. ACGCAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAG 0005. There is clearly a need for an efficient system and/or effective composition for removing phosphates from various GCGGATATGTAAGTCAGACGTGAAATCCCCGGGCTTAACCTGGGAATTGC liquid and solid locations. It is an objective to provide Such a system and/or compositions. GTTTGAAACTGTATATCTAGAGTGCGTCAGAGGGGGGTGGAATTCCACGT GTAGCAGTGAAATGCGTAGATATGCGGAGGAACACCGATGGCGAAGGCAA SUMMARY OF DISCLOSURE 0006 Provided is a composition comprising or population TCCCCTGGGCCTGTACTGACGCTCATGCACGAAAGCGTGGGGAGCAAACA of one or more polyphosphate accumulating microorganisms, GGATTAGATACCCTGGTAGTCCACGCCCTAAACGATGTCAACTGGCTGTT wherein said microorganism: US 2013/0334131 A1 Dec. 19, 2013 - Continued having about 90-95% homology, identity or similarity to Rhodocyclus tenuis DSM 110 and/or Candidatus accumuli CCTGGGGAGTACGGCCGCAAGGTTGAAACT CAAAGGAATTGACGGGGGCC bacter, CGCACAAGCGGTGGATGATGTGGATTAATTCGATGCAACGCGAAGAACCT 00.15 (b) identifying polyphosphate accumulating bacte TACCTACCCTTGACATGCCAGGAATCCCGGAGANATCTGGGGG ria in said bioreactor of (a) and 0016 (c) obtaining a composition containing an amount of and polyphosphate accumulating bacteria identified in (b) suffi 0008 (b) comprises nucleotide sequences having about cient to decrease the presence of inorganic phosphate from a 90-95% homology, identity or similarity to Rhodocyclus location. tenuis DSM110 and/or Candidatus accumulibacter: 0017. As will be set forth infurther detail below, polyphos 0009. In a particular embodiment, the composition is phate accumulating bacteria may be identified by determin obtainable from a bioreactor. In another particular embodi ing if there bacteria containing any of the nucleotide ment, the polyphosphate accumulating microorganisms are sequences having at least about 97% identity to a sequence, bacteria (PAB). The composition of PAB may be used to wherein said sequence is at least one of SEQ ID NOs: 1-6. reduce the amount of inorganic phosphate in a waste-stream Once such bacteria are identified, they may further be tested including but not limited to sewage treatment plant effluent, for various metabolic properties such as the ability to accu Solid waste, sludge, agricultural drainage and industrial efflu mulate P. The bacteria obtained may be formulated into com ent positions that may be used to develop a treatment or produc 0010. In a related aspect, also provided is a method of tion process that applies these polyphosphate accumulating identifying these polyphosphate accumulating microorgan bacteria. isms which comprises contacting a sample with one or more 0018 Provided is a method for decreasing the amount of probe or primers comprising a sequence, wherein said dissolved inorganic phosphate in an effluent in need thereof sequence has at least about 97% homology, identity or simi comprising applying the composition set forth above in an larity to a nucleotide sequence selected from the group con amount effective to reduce said inorganic phosphate in said sisting of: SEQID NOS:9-10: effluent. The phosphate may be reduced by greater than about 80%. The effluent may be P-laden waste which includes but is not limited to waste water, sewage sludge or agricultural Rcyc 69F: ACGGGGGCAACCCTGGT; (SEO ID NO: 9) drainage. Rcyc 149F: ATAACCTGGCGAAAGCCAGG (SEQ ID NO: 10) BRIEF DESCRIPTION OF THE FIGURES and detecting the presence or absence of said polyphosphate accumulating microorganisms. (0019 FIG. 1 shows
Recommended publications
  • The 2014 Golden Gate National Parks Bioblitz - Data Management and the Event Species List Achieving a Quality Dataset from a Large Scale Event
    National Park Service U.S. Department of the Interior Natural Resource Stewardship and Science The 2014 Golden Gate National Parks BioBlitz - Data Management and the Event Species List Achieving a Quality Dataset from a Large Scale Event Natural Resource Report NPS/GOGA/NRR—2016/1147 ON THIS PAGE Photograph of BioBlitz participants conducting data entry into iNaturalist. Photograph courtesy of the National Park Service. ON THE COVER Photograph of BioBlitz participants collecting aquatic species data in the Presidio of San Francisco. Photograph courtesy of National Park Service. The 2014 Golden Gate National Parks BioBlitz - Data Management and the Event Species List Achieving a Quality Dataset from a Large Scale Event Natural Resource Report NPS/GOGA/NRR—2016/1147 Elizabeth Edson1, Michelle O’Herron1, Alison Forrestel2, Daniel George3 1Golden Gate Parks Conservancy Building 201 Fort Mason San Francisco, CA 94129 2National Park Service. Golden Gate National Recreation Area Fort Cronkhite, Bldg. 1061 Sausalito, CA 94965 3National Park Service. San Francisco Bay Area Network Inventory & Monitoring Program Manager Fort Cronkhite, Bldg. 1063 Sausalito, CA 94965 March 2016 U.S. Department of the Interior National Park Service Natural Resource Stewardship and Science Fort Collins, Colorado The National Park Service, Natural Resource Stewardship and Science office in Fort Collins, Colorado, publishes a range of reports that address natural resource topics. These reports are of interest and applicability to a broad audience in the National Park Service and others in natural resource management, including scientists, conservation and environmental constituencies, and the public. The Natural Resource Report Series is used to disseminate comprehensive information and analysis about natural resources and related topics concerning lands managed by the National Park Service.
    [Show full text]
  • Core Bacterial Taxon from Municipal Wastewater Treatment Plants
    ENVIRONMENTAL MICROBIOLOGY crossm Casimicrobium huifangae gen. nov., sp. nov., a Ubiquitous “Most-Wanted” Core Bacterial Taxon from Municipal Wastewater Treatment Plants Yang Song,a,b,c,d,g Cheng-Ying Jiang,a,b,c,d Zong-Lin Liang,a,b,c,g Bao-Jun Wang,a Yong Jiang,e Ye Yin,f Hai-Zhen Zhu,a,b,c,g Ya-Ling Qin,a,b,c,g Rui-Xue Cheng,a Zhi-Pei Liu,a,b,c,d Yao Liu,e Tao Jin,f Philippe F.-X. Corvini,h Korneel Rabaey,i Downloaded from Ai-Jie Wang,a,d,g Shuang-Jiang Liua,b,c,d,g aKey Laboratory of Environmental Biotechnology at Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing, China bState Key Laboratory of Microbial Resources at Institute of Microbiology, Chinese Academy of Sciences, Beijing, China cEnvironmental Microbiology Research Center at Institute of Microbiology, Chinese Academy of Sciences, Beijing, China dRCEES-IMCAS-UCAS Joint-Lab of Microbial Technology for Environmental Science, Beijing, China eBeijing Drainage Group Co., Ltd., Beijing, China f BGI-Qingdao, Qingdao, China http://aem.asm.org/ gUniversity of Chinese Academy of Sciences, Beijing, China hUniversity of Applied Sciences and Arts Northwestern Switzerland, Muttenz, Switzerland iCenter for Microbial Ecology and Technology (CMET), Ghent University, Ghent, Belgium Yang Song and Cheng-Ying Jiang contributed equally to this work. Author order was determined by drawing straws. ABSTRACT Microorganisms in wastewater treatment plants (WWTPs) play a key role in the removal of pollutants from municipal and industrial wastewaters. A recent study estimated that activated sludge from global municipal WWTPs har- on June 19, 2020 by guest bors 1 ϫ 109 to 2 ϫ 109 microbial species, the majority of which have not yet been cultivated, and 28 core taxa were identified as “most-wanted” ones (L.
    [Show full text]
  • Bacteria Coated Cathodes As an In-Situ Hydrogen Evolving Platform for Microbial Electrosynthesis
    www.nature.com/scientificreports OPEN Bacteria coated cathodes as an in‑situ hydrogen evolving platform for microbial electrosynthesis Elisabet Perona‑Vico1, Laura Feliu‑Paradeda1, Sebasti Puig2 & Lluis Bañeras1* Hydrogen is a key intermediate element in microbial electrosynthesis as a mediator of the reduction of carbon dioxide (CO2) into added value compounds. In the present work we aimed at studying the biological production of hydrogen in biocathodes operated at − 1.0 V vs. Ag/AgCl, using a highly comparable technology and CO2 as carbon feedstock. Ten bacterial strains were chosen from genera Rhodobacter, Rhodopseudomonas, Rhodocyclus, Desulfovibrio and Sporomusa, all described as hydrogen producing candidates. Monospecifc bioflms were formed on carbon cloth cathodes and hydrogen evolution was constantly monitored using a microsensor. Eight over ten bacteria strains showed electroactivity and H2 production rates increased signifcantly (two to eightfold) compared to abiotic conditions for two of them (Desulfovibrio paquesii and Desulfovibrio desulfuricans). D. paquesii DSM 16681 exhibited the highest production rate (45.6 ± 18.8 µM min−1) compared to abiotic conditions (5.5 ± 0.6 µM min−1), although specifc production rates (per 16S rRNA copy) were similar to those obtained for other strains. This study demonstrated that many microorganisms are suspected to participate in net hydrogen production but inherent diferences among strains do occur, which are relevant for future developments of resilient bioflm coated cathodes as a stable hydrogen production platform in microbial electrosynthesis. Microbial electrosynthesis (MES) is engineered to use electric power and carbon dioxide (CO2) as the only energy and carbon sources in reductive bioelectrochemical processes for biosynthesis 1.
    [Show full text]
  • Photosynthesis Is Widely Distributed Among Proteobacteria As Demonstrated by the Phylogeny of Puflm Reaction Center Proteins
    fmicb-08-02679 January 20, 2018 Time: 16:46 # 1 ORIGINAL RESEARCH published: 23 January 2018 doi: 10.3389/fmicb.2017.02679 Photosynthesis Is Widely Distributed among Proteobacteria as Demonstrated by the Phylogeny of PufLM Reaction Center Proteins Johannes F. Imhoff1*, Tanja Rahn1, Sven Künzel2 and Sven C. Neulinger3 1 Research Unit Marine Microbiology, GEOMAR Helmholtz Centre for Ocean Research, Kiel, Germany, 2 Max Planck Institute for Evolutionary Biology, Plön, Germany, 3 omics2view.consulting GbR, Kiel, Germany Two different photosystems for performing bacteriochlorophyll-mediated photosynthetic energy conversion are employed in different bacterial phyla. Those bacteria employing a photosystem II type of photosynthetic apparatus include the phototrophic purple bacteria (Proteobacteria), Gemmatimonas and Chloroflexus with their photosynthetic relatives. The proteins of the photosynthetic reaction center PufL and PufM are essential components and are common to all bacteria with a type-II photosynthetic apparatus, including the anaerobic as well as the aerobic phototrophic Proteobacteria. Edited by: Therefore, PufL and PufM proteins and their genes are perfect tools to evaluate the Marina G. Kalyuzhanaya, phylogeny of the photosynthetic apparatus and to study the diversity of the bacteria San Diego State University, United States employing this photosystem in nature. Almost complete pufLM gene sequences and Reviewed by: the derived protein sequences from 152 type strains and 45 additional strains of Nikolai Ravin, phototrophic Proteobacteria employing photosystem II were compared. The results Research Center for Biotechnology (RAS), Russia give interesting and comprehensive insights into the phylogeny of the photosynthetic Ivan A. Berg, apparatus and clearly define Chromatiales, Rhodobacterales, Sphingomonadales as Universität Münster, Germany major groups distinct from other Alphaproteobacteria, from Betaproteobacteria and from *Correspondence: Caulobacterales (Brevundimonas subvibrioides).
    [Show full text]
  • Comparative Genomics Provides Insights Into the Taxonomy of Azoarcus and Reveals Separate Origins of Nif Genes in the Proposed Azoarcus and Aromatoleum Genera
    G C A T T A C G G C A T genes Article Comparative Genomics Provides Insights into the Taxonomy of Azoarcus and Reveals Separate Origins of Nif Genes in the Proposed Azoarcus and Aromatoleum Genera Roberto Tadeu Raittz 1,*,† , Camilla Reginatto De Pierri 2,† , Marta Maluk 3 , Marcelo Bueno Batista 4, Manuel Carmona 5 , Madan Junghare 6, Helisson Faoro 7, Leonardo M. Cruz 2 , Federico Battistoni 8, Emanuel de Souza 2,Fábio de Oliveira Pedrosa 2, Wen-Ming Chen 9, Philip S. Poole 10, Ray A. Dixon 4,* and Euan K. James 3,* 1 Laboratory of Artificial Intelligence Applied to Bioinformatics, Professional and Technical Education Sector—SEPT, UFPR, Curitiba, PR 81520-260, Brazil 2 Department of Biochemistry and Molecular Biology, UFPR, Curitiba, PR 81531-980, Brazil; [email protected] (C.R.D.P.); [email protected] (L.M.C.); [email protected] (E.d.S.); [email protected] (F.d.O.P.) 3 The James Hutton Institute, Invergowrie, Dundee DD2 5DA, UK; [email protected] 4 John Innes Centre, Department of Molecular Microbiology, Norwich NR4 7UH, UK; [email protected] 5 Centro de Investigaciones Biológicas Margarita Salas-CSIC, Department of Biotechnology of Microbes and Plants, Ramiro de Maeztu 9, 28040 Madrid, Spain; [email protected] 6 Faculty of Chemistry, Biotechnology and Food Science, NMBU—Norwegian University of Life Sciences, 1430 Ås, Norway; [email protected] 7 Laboratory for Science and Technology Applied in Health, Carlos Chagas Institute, Fiocruz, Curitiba, PR 81310-020, Brazil; helisson.faoro@fiocruz.br 8 Department of Microbial Biochemistry and Genomics, IIBCE, Montevideo 11600, Uruguay; [email protected] Citation: Raittz, R.T.; Reginatto De 9 Laboratory of Microbiology, Department of Seafood Science, NKMU, Kaohsiung City 811, Taiwan; Pierri, C.; Maluk, M.; Bueno Batista, [email protected] M.; Carmona, M.; Junghare, M.; Faoro, 10 Department of Plant Sciences, University of Oxford, South Parks Road, Oxford OX1 3RB, UK; H.; Cruz, L.M.; Battistoni, F.; Souza, [email protected] E.d.; et al.
    [Show full text]
  • Isolation and Characterization of Bacteria in a Toluene-Producing Enrichment Culture Derived from Contaminated Groundwater at a Louisiana Superfund Site
    Louisiana State University LSU Digital Commons LSU Master's Theses Graduate School August 2020 Isolation and Characterization of Bacteria in a Toluene-Producing Enrichment Culture Derived from Contaminated Groundwater at a Louisiana Superfund Site Madison Mikes Louisiana State University and Agricultural and Mechanical College Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_theses Part of the Civil and Environmental Engineering Commons, and the Microbiology Commons Recommended Citation Mikes, Madison, "Isolation and Characterization of Bacteria in a Toluene-Producing Enrichment Culture Derived from Contaminated Groundwater at a Louisiana Superfund Site" (2020). LSU Master's Theses. 5206. https://digitalcommons.lsu.edu/gradschool_theses/5206 This Thesis is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Master's Theses by an authorized graduate school editor of LSU Digital Commons. For more information, please contact [email protected]. ISOLATION AND CHARACTERIZATION OF BACTERIA IN A TOLUENE- PRODUCING ENRICHMENT CULTURE DERIVED FROM CONTAMINATED GROUNDWATER AT A LOUISIANA SUPERFUND SITE A Thesis Submitted to the Graduate Faculty of the Louisiana State University and Agriculture and Mechanical College in partial fulfillment of the requirements for the degree of Master of Science in The Department of Civil and Environmental Engineering by Madison Colleen Mikes B.S., Louisiana State University, 2018 December 2020 1 ACKNOWLEDGEMENTS I would like to take the time to thank all of those who have supported and assisted me during my graduate program. First and foremost, I would like to thank Dr. Bill Moe for all of the time he has spent teaching me and mentoring me through my thesis work.
    [Show full text]
  • Anaerobic Degradation of Steroid Hormones by Novel Denitrifying Bacteria
    Anaerobic degradation of steroid hormones by novel denitrifying bacteria Von der Fakultät für Mathematik, Informatik und Naturwissenschaften der Rheinisch- Westfälischen Technischen Hochschule Aachen zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften genehmigte Dissertation vorgelegt von Diplom-Biologe Michael Fahrbach aus Bad Mergentheim (Baden-Württemberg) Berichter: Professor Dr. Juliane Hollender Professor Dr. Andreas Schäffer Tag der mündlichen Prüfung: 12. Dezember 2006 Diese Dissertation ist auf den Internetseiten der Hochschulbibliothek online verfügbar. Table of Contents 1 Introduction.....................................................................................................................1 1.1 General information on steroids ...............................................................................1 1.2 Steroid hormones in the environment.......................................................................2 1.2.1 Natural and anthropogenic sources and deposits ............................................2 1.2.2 Potential impact on the environment ................................................................3 1.2.3 Fate of steroid hormones..................................................................................4 1.3 Microbial degradation of steroid hormones and sterols............................................5 1.3.1 Aerobic degradation..........................................................................................5 1.3.2 Anaerobic degradation......................................................................................7
    [Show full text]
  • Notes on the Characterization of Prokaryote Strains for Taxonomic
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Digital.CSIC International Journal of Systematic and Evolutionary Microbiology (2010), 60, 249–266 DOI 10.1099/ijs.0.016949-0 Taxonomic Notes on the characterization of prokaryote strains Note for taxonomic purposes B. J. Tindall,1 R. Rossello´-Mo´ra,2 H.-J. Busse,3 W. Ludwig4 and P. Ka¨mpfer5 Correspondence 1DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Inhoffenstraße 7B, Brian J. Tindall D-38124 Braunschweig, Germany [email protected] 2Grup de Microbiologia Marina, Departament d’Ecologia I Recursos Marins, IMEDEA (CSIC-UIB), C/Miquel Marque´s 21, E-07190, Esporles, Spain 3Institut fu¨r Bakteriologie, Mykologie und Hygiene, University of Veterinary Medicine Vienna, Veterina¨rplatz 1, A-1210 Vienna, Austria 4Lehrstuhl fu¨r Mikrobiologie, Technische Universita¨t Mu¨nchen, Am Hochanger 4, D-85354 Freising-Weihenstephan, Germany 5Institut fu¨r Angewandte Mikrobiologie, Justus-Liebig-Universita¨t Giessen, Heinrich-Buff-Ring 26- 32 (IFZ), D-35392 Giessen, Germany Taxonomy relies on three key elements: characterization, classification and nomenclature. All three elements are dynamic fields, but each step depends on the one which precedes it. Thus, the nomenclature of a group of organisms depends on the way they are classified, and the classification (among other elements) depends on the information gathered as a result of characterization. While nomenclature is governed by the Bacteriological Code, the classification and characterization of prokaryotes is an area that is not formally regulated and one in which numerous changes have taken place in the last 50 years.
    [Show full text]
  • Open Whole HZ.Pdf
    The Pennsylvania State University The Graduate School Department of Civil and Environmental Engineering ANALYSIS OF MICROBIAL COMMUNITIES AND DESIGN OF BIOREACTORS USED FOR PERCHLORATE REMEDIATION AND BIOHYDROGEN PRODUCTION A Thesis in Environmental Engineering by Husen Zhang © 2005 Husen Zhang Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy May 2005 The thesis of Husen Zhang has been reviewed and approved* by the following: Bruce E. Logan Kappe Professor of Environmental Engineering Thesis Advisor Chair of Committee Mary Ann Bruns Assistant Professor of Crop and Soil Sciences John M. Regan Assistant Professor of Environmental Engineering William D. Burgos Associate Professor of Environmental Engineering Andrew Scanlon Professor of Civil Engineering Head of the Department of Civil and Environmental Engineering *Signatures are on file in the Graduate School. ABSTRACT A chemolithoautotrophic bacterium (strain HZ) was isolated from biofilm samples in an unsaturated-flow, packed-bed reactor treating perchlorate-contaminated groundwater. Dilution- to-extinction method was used for isolation. Purity was initially examined microscopically, and confirmed by identical intergenic ribosomal RNA spacer sequences from multiple clones. Strain HZ is a Gram-negative, rod-shaped facultative anaerobe that can use oxygen, perchlorate, chlorate, or nitrate as an electron acceptor and hydrogen gas or acetate as an electron donor. Growth on hydrogen gas was coupled with complete perchlorate (10 mM) reduction to chloride with a maximum doubling time of 8.9 hours. Autotrophic growth with carbon dioxide as the sole carbon source was confirmed by demonstrating that biomass carbon (100.9%) was derived from 14 CO2. Phylogenetic analysis based upon the 16S rRNA sequence indicated that strain HZ belongs to the genus Dechloromonas within the β subgroup of the Proteobacteria.
    [Show full text]
  • Phylogenomics of Rhodocyclales and Its Distribution in Wastewater Treatment Systems Zhongjie Wang1, Wenqing Li2, Hao Li1, Wei Zheng1 & Feng Guo1*
    www.nature.com/scientificreports OPEN Phylogenomics of Rhodocyclales and its distribution in wastewater treatment systems Zhongjie Wang1, Wenqing Li2, Hao Li1, Wei Zheng1 & Feng Guo1* Rhodocyclales is an abundant bacterial order in wastewater treatment systems and putatively plays key roles in multiple functions. Its phylogenomics, prevalence of denitrifying genes in sub-lineages and distribution in wastewater treatment plants (WWTPs) worldwide have not been well characterized. In the present study, we collected 78 Rhodocyclales genomes, including 17 from type strains, non-type strains and genome bins contributed by this study. Phylogenomics indicated that the order could be divided into fve family-level lineages. With only a few exceptions (mostly in Rhodocyclaceae), nirS- containing genomes in this order usually contained the downstream genes of norB and nosZ. Multicopy of denitrifying genes occurred frequently and events of within-order horizontal transfer of denitrifying genes were phylogenetically deduced. The distribution of Rhodocyclaceae, Zoogloeaceae and Azonexaceae in global WWTPs were signifcantly governed by temperature, mixed liquor suspended solids, etc. Metagenomic survey showed that the order generally ranked at the top or second for diferent denitrifying genes in wastewater treatment systems. Our results provided comprehensive genomic insights into the phylogeny and features of denitrifying genes of Rhodocyclales. Its contribution to the denitrifying gene pool in WWTPs was proved. Activated sludge, which is a widely utilized biological process for the treatment of municipal and industrial waste- waters around the world for over a century1,2, relies on a complex consortium of microorganisms to remove pollutants and facilitate separation of focs and water3. A key functional microbial taxon in wastewater treatment systems is Rhodocyclales, which is dominant in activated sludge samples according to the relative abundance of 16S rRNA genes and hybridization approach4,5.
    [Show full text]
  • Outline Release 7 7C
    Taxonomic Outline of Bacteria and Archaea, Release 7.7 Taxonomic Outline of the Bacteria and Archaea, Release 7.7 March 6, 2007. Part 4 – The Bacteria: Phylum “Proteobacteria”, Class Betaproteobacteria George M. Garrity, Timothy G. Lilburn, James R. Cole, Scott H. Harrison, Jean Euzéby, and Brian J. Tindall Class Betaproteobacteria VP Garrity et al 2006. N4Lid DOI: 10.1601/nm.16162 Order Burkholderiales VP Garrity et al 2006. N4Lid DOI: 10.1601/nm.1617 Family Burkholderiaceae VP Garrity et al 2006. N4Lid DOI: 10.1601/nm.1618 Genus Burkholderia VP Yabuuchi et al. 1993. GOLD ID: Gi01836. GCAT ID: 001596_GCAT. Sequenced strain: SRMrh-20 is from a non-type strain. Genome sequencing is incomplete. Number of genomes of this species sequenced 2 (GOLD) 1 (NCBI). N4Lid DOI: 10.1601/nm.1619 Burkholderia cepacia VP (Palleroni and Holmes 1981) Yabuuchi et al. 1993. <== Pseudomonas cepacia (basonym). Synonym links through N4Lid: 10.1601/ex.2584. Source of type material recommended for DOE sponsored genome sequencing by the JGI: ATCC 25416. High-quality 16S rRNA sequence S000438917 (RDP), U96927 (Genbank). GOLD ID: Gc00309. GCAT ID: 000301_GCAT. Entrez genome id: 10695. Sequenced strain: ATCC 17760, LMG 6991, NCIMB9086 is from a non-type strain. Genome sequencing is completed. Number of genomes of this species sequenced 1 (GOLD) 1 (NCBI). N4Lid DOI: 10.1601/nm.1620 Pseudomonas cepacia VP (ex Burkholder 1950) Palleroni and Holmes 1981. ==> Burkholderia cepacia (new combination). Synonym links through N4Lid: 10.1601/ex.2584. Source of type material recommended for DOE sponsored genome sequencing by the JGI: ATCC 25416. High- quality 16S rRNA sequence S000438917 (RDP), U96927 (Genbank).
    [Show full text]
  • Rugosibacter Aromaticivorans Gen. Nov., Sp. Nov., a Bacterium Within
    NOTE Corteselli et al., Int J Syst Evol Microbiol 2014;67:311–318 DOI 10.1099/ijsem.0.001622 Rugosibacter aromaticivorans gen. nov., sp. nov., a bacterium within the family Rhodocyclaceae, isolated from contaminated soil, capable of degrading aromatic compounds Elizabeth M. Corteselli, Michael D. Aitken and David R. Singleton* Abstract A bacterial strain designated Ca6T was isolated from polycyclic aromatic hydrocarbon (PAH)-contaminated soil from the site of a former manufactured gas plant in Charlotte, NC, USA, and linked phylogenetically to the family Rhodocyclaceae of the class Betaproteobacteria. Its 16S rRNA gene sequence was highly similar to globally distributed environmental sequences, including those previously designated ‘Pyrene Group 1’ demonstrated to grow on the PAHs phenanthrene and pyrene by stable-isotope probing. The most closely related described relative was Sulfuritalea hydrogenivorans strain sk43HT (93.6 % 16S rRNA gene sequence identity). In addition to a limited number of organic acids, Ca6T was capable of growth on the monoaromatic compounds benzene and toluene, and the azaarene carbazole, as sole sources of carbon and energy. Growth on the PAHs phenanthrene and pyrene was also confirmed. Optimal growth was observed aerobically under mesophilic temperature, neutral pH and low salinity conditions. Major fatty acids present included summed feature 3 (C16 : 1!7c or C16 : 1 !6c) and C16 : 0. The DNA G+C content of the single chromosome was 55.14 mol% as determined by complete genome sequencing. Due to its distinct genetic and physiological properties, strain Ca6T is proposed as a member of a novel genus and species within the family Rhodocyclaceae, for which the name Rugosibacter aromaticivorans gen.
    [Show full text]