US 2013 0334131A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2013/0334131 A1 Allen et al. (43) Pub. Date: Dec. 19, 2013 (54) IDENTIFICATION OF AND COMPOSITIONS Publication Classification CONTAINING POLYPHOSPHATE ACCUMULATING BACTERIA (51) Int. C. CI2N I/20 (2006.01) (71) Applicants: UNIVERSITY OF NORTH TEXAS, CO2F 3/34 (2006.01) Denton, TX (US); TENFOLD CI2O I/68 (2006.01) TECHNOLOGIES LLC, Pilot Point, (52) U.S. C. TX (US) CPC CI2N 1/20 (2013.01); C12O 1/689 (2013.01); C02F 3/34 (2013.01) (72) Inventors: Michael Allen, Denton, TX (US); USPC ...... 210/601; 435/252.1; 435/6.11: 435/6.12: Michael LaMontagne, Denton, TX (US) 536/24.32:536/24.33 (21) Appl. No.: 13/842,400 (57) ABSTRACT (22) Filed: Mar 15, 2013 Provided are compositions comprising polyphosphate accu mulating bacteria as well as a method for identifying said Related U.S. Application Data polyphosphate accumulating bacteria. Additionally provided (60) Provisional application No. 61/659,333, filed on Jun. is a method for treating various Substances with said compo 13, 2012. sitions. Patent Application Publication Dec. 19, 2013 US 2013/0334131 A1 FIGURE 1 Actinomyces sp. B-79 O l-PES5 |- Pass S, - Pass 8, 4.322 C. 1492PC3 - 192PCS, g 1492Pic: 1. 1492 cSt cklister 30 a82P5 1C Thacilis certifas S57, 18S Rhodocyclis tenuis DSN410 S: Uncutti exi Candidatus. Accurriulibacterspy clofie EMB; clofie: 12. F- Rhodocyatts sp.FR6 cities EEPR SERA220) OO Rhodocyclispirpureus. Zoogloea amigea (8 Thauera.sp. mztt Linctitt exi Aiz?ays: sagine: 1. PAE53, P&BS - 1492c1 92 - 1492P 1. 9. - 1492PC3, O 92 - 1492Plc2. 1920; a92PC. tG is 89:448 P45 US 2013/0334131 A1 Dec. 19, 2013 IDENTIFICATION OF AND COMPOSITIONS 0007 (a) comprises a nucleotide sequence, wherein said CONTAINING POLYPHOSPHATE sequence has at least about 97% homology, identity or simi ACCUMULATING BACTERA larity to at least one of the nucleotide sequences set forth in SEQID NOs: 1-6: TECHNICAL FIELD 0001 Provided are compositions comprising novel poly phosphate accumulating bacteria related to polyphosphate SEQ ID NO: 1: S1492Plc8 accumulating microbes. Further provided is a method for ACGGGGGCAACCCTGGTGGCGAGTGGCGAACGGGTGAGTAATGCATCGGA identifying said bacteria in a sample. Additionally provided is ACATACCCAGTCGTGGGGGATAACGTAGCGAAAGTTACGCTAATACCGCA a method for treating various Substances with said composi tions. TACGTCCTGAGGGAGAAAGCGGGGGATCGCAAGACCTCGCGCGATTGGAG TGGCCGATGTCAGATTAGCTAGTTGGTGGGGTAAAGGCCCACCAAGGCGA BACKGROUND 0002 Excessive nutrient runoff, particularly phosphorus, CGATCTGTAGCGGGTCTGAGAGGATGATCCGCCACACTGGGACTGAGACA in a lake or other body of water typically results in plant and CGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATTTTGGACAATGGGG algal blooms. Subsequent decomposition of these blooms depletes the Supply of oxygen, creating anoxic conditions and GCAACCCTGATCCAGCCATGCCGCGTGCGGGAAGAAGGCCTTCGGGTTGT death of animal life. AAACCGCTTTCGGACGGAAAGAAATCGCCATCTCTAACATAGGTGGTGGA 0003. An important aspect of wastewater treatment is the removal of excess nutrients. The removal of phosphorus (P) TGACGGTACCGTAAGAAGAAGCACCGGCTAACTACGTGCCAGCAGCCGCG from wastewater can be accomplished either by chemical precipitation or by a biological mechanism in a process GTAATACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTG named enhanced biological phosphorus removal (EBPR). CGCAGGCGGTTTCTTAAGCCAGACGTGAAATCCCCGGGCTTAACCTGGGA The latter requires microorganisms known as polyphosphate accumulating microorganisms or bacteria (PAOS), which can ACTGCGTTTGGAACTGGGAGACTAGAGTGTGTCAGAGGGAGGTGGAATTC store phosphate as intracellular polyphosphate granules; CGCGTGTAGCAGTGAAATGCGTAGATATGCGGAGGAACACCGATGGCGAA therefore, removal of a portion of the growing biomass con taining a high polyphosphate content (waste-activated GGCAGCCTCCTGGGATAACACTGACGCTCATGCACGAAAGCGTGGGGAGC sludge) results in the net removal of P from the wastewater (Oehmen et al., 2007). However, little is known of the genet AAACAGGATTAGATACCCTGGTAGTCCACGCCCTAAACGATGTCAACTGG ics or biochemistry of the organisms responsible for poly CTGTTGGGAGAGAAATCTTTCAGTAGCGAAGCTAACGCGTGAAGTTGANC phosphate-accumulation because they have not yet been iso lated in pure culture, leading to poor stability and reliability of GCCTGGGGAGTACGGCCGCAAGGTTGAAACT CAAAGGAATTGANGGGGCC EBPR. Previous studies using 16S rRNA directed probes have identified the dominant polyphosphate-accumulating CGCACAAGCGGTGGATGATGTGGATTAATTCGATGCAACGCGAAGAACCT bacteria in acetate-fed laboratory scale sequencing batch TACCTACCCTTGACATGCCAGGAATCCCGNANAGATCTGGGGG reactors as members of the phylogenetically defined SEO ID NO: 2 Rhodocyclus group in the B-proteobacteria (Crocetti et al., P4B58 2000, WO 01/46459). In addition, the Rhodocyclus related TCGGNTCCNCTAGTAACGGCCGCCAGTGTGCTGGAATTCGCCCTTACGGG organisms have been repeatedly enriched and one such mem ber is tentatively named Candidatus accumulibacter phos GGCAACCCTGGTGGCGAGCGGCGAACGGGTGAGTAACACATCGGAACGTA phatis (Hesselmann et al., 2000). The involvement of Accu CCCTGTCGTGGGGGATAGCCCGGCGAAAGCCGGATTAATACCGCATACGA mulibacter-related organisms in EBPR was confirmed in full scale EBPR wastewater treatment plants (Kong et al., 2004). CCTGAGGGTGAAAGCGGGGGATCGCAAGACCTCGCGCGATAGGAGCGGCC Nevertheless, it is unlikely that Accumulibacter are the only phosphate accumulating bacteria groups in EBPR systems GATGGCGGATTAGCTAGTTGGTGGGGTAAAGGCCTACCAAGGCGACGATC based on FISH studies that have observed poly-phosphate in CGTAGCTGGTCTGAGAGGACGACCAGCCACACTGGAACTGAGACACGGTC other unrelated organisms in these communities (He et al., 2008). However, to date, it has not been possible to obtain CAGACTCCTACGGGAGGCAGCAGTGGGGAATTTTGGACAATGGGGGCAAC pure cultures of polyphosphate accumulating bacteria. CCTGGTCCAGCCATGCCGCGTGCGGGAAGAAGGCCTTCGGGTTGTAAACC 0004 Phosphorous has also been found to accumulate in Solid waste as well. US Patent Publication No. 20120103037 GCTTTCGGACAGAAAGAAATCGTTCGCTCTAACATAGCGGATGGATGACG discloses a method for treating Solid waste with a combina tion of leaching and polyphosphate accumulating microor GTACTGTAAGAAGAAGCACCGGCTAACTACGTGCCAGCAGCCGCGGTAAT ganisms. ACGCAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAG 0005. There is clearly a need for an efficient system and/or effective composition for removing phosphates from various GCGGATATGTAAGTCAGACGTGAAATCCCCGGGCTTAACCTGGGAATTGC liquid and solid locations. It is an objective to provide Such a system and/or compositions. GTTTGAAACTGTATATCTAGAGTGCGTCAGAGGGGGGTGGAATTCCACGT GTAGCAGTGAAATGCGTAGATATGCGGAGGAACACCGATGGCGAAGGCAA SUMMARY OF DISCLOSURE 0006 Provided is a composition comprising or population TCCCCTGGGCCTGTACTGACGCTCATGCACGAAAGCGTGGGGAGCAAACA of one or more polyphosphate accumulating microorganisms, GGATTAGATACCCTGGTAGTCCACGCCCTAAACGATGTCAACTGGCTGTT wherein said microorganism: US 2013/0334131 A1 Dec. 19, 2013 - Continued having about 90-95% homology, identity or similarity to Rhodocyclus tenuis DSM 110 and/or Candidatus accumuli CCTGGGGAGTACGGCCGCAAGGTTGAAACT CAAAGGAATTGACGGGGGCC bacter, CGCACAAGCGGTGGATGATGTGGATTAATTCGATGCAACGCGAAGAACCT 00.15 (b) identifying polyphosphate accumulating bacte TACCTACCCTTGACATGCCAGGAATCCCGGAGANATCTGGGGG ria in said bioreactor of (a) and 0016 (c) obtaining a composition containing an amount of and polyphosphate accumulating bacteria identified in (b) suffi 0008 (b) comprises nucleotide sequences having about cient to decrease the presence of inorganic phosphate from a 90-95% homology, identity or similarity to Rhodocyclus location. tenuis DSM110 and/or Candidatus accumulibacter: 0017. As will be set forth infurther detail below, polyphos 0009. In a particular embodiment, the composition is phate accumulating bacteria may be identified by determin obtainable from a bioreactor. In another particular embodi ing if there bacteria containing any of the nucleotide ment, the polyphosphate accumulating microorganisms are sequences having at least about 97% identity to a sequence, bacteria (PAB). The composition of PAB may be used to wherein said sequence is at least one of SEQ ID NOs: 1-6. reduce the amount of inorganic phosphate in a waste-stream Once such bacteria are identified, they may further be tested including but not limited to sewage treatment plant effluent, for various metabolic properties such as the ability to accu Solid waste, sludge, agricultural drainage and industrial efflu mulate P. The bacteria obtained may be formulated into com ent positions that may be used to develop a treatment or produc 0010. In a related aspect, also provided is a method of tion process that applies these polyphosphate accumulating identifying these polyphosphate accumulating microorgan bacteria. isms which comprises contacting a sample with one or more 0018 Provided is a method for decreasing the amount of probe or primers comprising a sequence, wherein said dissolved inorganic phosphate in an effluent in need thereof sequence has at least about 97% homology, identity or simi comprising applying the composition set forth above in an larity to a nucleotide sequence selected from the group con amount effective to reduce said inorganic phosphate in said sisting of: SEQID NOS:9-10: effluent. The phosphate may be reduced by greater than about 80%. The effluent may be P-laden waste which includes but is not limited to waste water, sewage sludge or agricultural Rcyc 69F: ACGGGGGCAACCCTGGT; (SEO ID NO: 9) drainage. Rcyc 149F: ATAACCTGGCGAAAGCCAGG (SEQ ID NO: 10) BRIEF DESCRIPTION OF THE FIGURES and detecting the presence or absence of said polyphosphate accumulating microorganisms. (0019 FIG. 1 shows