Expressionsanalyse Von Chemorezeptoren Und Funktionale Charakterisierung Des Riechrezeptors OR2AT4 in Chronisch Myeloischen Leukämiezellen

Home , Endothelin B receptor, GPR155, OR11H4, OR1G1, OR2AG1, Polygodial

Expressionsanalyse von Chemorezeptoren und funktionale Charakterisierung des Riechrezeptors OR2AT4 in chronisch myeloischen Leukämiezellen

Dissertation zur Erlangung des Grades eines Doktors der Naturwissenschaften der Fakultät für Biologie und Biotechnologie an der Internationalen Graduiertenschule Biowissenschaften der Ruhr-Universität Bochum

vorgelegt von STAVROS MANTENIOTIS

aus Troisdorf

angefertigt am Lehrstuhl für Zellphysiologie, Prof. Dr. Dr. Dr. Hanns Hatt

Bochum, Januar 2015 Expression Analysis of Chemosensory Receptors and Functional Characterization of the Olfactory Receptor OR2AT4 in Myelogenous Leukemia Cells

Dissertation to obtain the degree Doctor Rerum Naturalium (Dr. rer. nat.) at the Faculty of Biology and Biotechnology International Graduate School Biosciences Ruhr-University Bochum

submitted by STAVROS MANTENIOTIS

from Troisdorf

Department of Cellphysiology, Prof. Dr. Dr. Dr. Hanns Hatt

Bochum, January 2015

Referent: Prof. Dr. Dr. Dr. Hanns Hatt Korreferent: PD Dr. Matthias Schmidt

„Die Wissenschaft fängt eigentlich erst da an interessant zu werden, wo sie aufhört.“ -Justus von Liebig

Für meine Familie…

Erklärung

Hiermit erkläre ich, dass ich die Arbeit selbständig verfasst und bei keiner anderen Fakultät eingereicht und dass ich keine anderen als die angegebenen Hilfsmittel verwendet habe. Es handelt sich bei der von mir eingereichten Dissertation um sechs in Wort und Bild völlig übereinstimmende Exemplare. Weiterhin erkläre ich, dass digitale Abbildungen nur die originalen Daten enthalten und in keinem Fall inhaltsverändernde Bildbearbeitung vorgenommen wurden.

(Stavros Manteniotis) Bochum, den 15-01-2015

Inhaltsverzeichnis

Kapitel 1 - Einleitung ...... 1 1.0 Chemosensorik - ein allgemeiner Überblick ...... 1 1.1 Die Klasse der olfaktorischen Rezeptoren ...... 5 1.1.2 Die olfaktorische Signalkaskade ...... 7 1.1.3 Die ektopische Expression von olfaktorischen Rezeptoren...... 8 1.2 Ionenkanäle und G-Protein gekoppelte Rezeptoren in der Chemosensorik ...... 10 1.3 Calcium als intrazellulärer Botenstoff ...... 13 1.4 Mitogen-aktivierte Proteinkinasen ...... 14 1.4.1 Die p44/42-MAPK ...... 15 1.4.2 Die p38-MAPK ...... 16 1.6 Exkurs: Leukämie ...... 17 1.6.1 Die chronisch myeloische Leukämie ...... 18 1.6.2 Die CML-Zelllinie K562 ...... 19 Kapitel 2 - Zielsetzung ...... 21 Kapitel 3 - Comprehensive RNA-Seq Expression Analysis of Sensory Ganglia with a Focus on Ion Channels and GPCRs in Trigeminal Ganglia ...... 23 Kapitel 4 - Expression Profile of Ectopic Olfactory Receptors Determined by Deep Sequencing ...... 27 Kapitel 5 - Characterization of the ectopically expressed OR2AT4 in human myelogenous leukemia cells ...... 33 Kapitel 6 - Diskussion ...... 35 6.1 RNA-Seq Expressionsanalyse sensorischer Neurone mit Fokus auf das trigeminale Ganglion ...... 36 6.1.1 Die Expression von GPCRs im trigeminalen System ...... 37 6.1.2 Die Expression von olfaktorischen Rezeptoren im trigeminalen System ...... 39 6.1.3 Die Expression von Ionenkanälen im trigeminalen System ...... 42 6.1.4 Differenziell-exprimierte Gene im trigeminalen- und dorsalen Wurzelganglion ...... 45 6.1.5 Die Problematik der differentiellen Expressionsanalyse ...... 47 6.1.6 Zusammenfassung der Expressionsanalyse im trigeminalen Ganglion ...... 48 6.2. Erstellung eines Expressionsprofils ektopisch exprimierter olfaktorischer Rezeptoren mittels der Next-Generation Sequenzierung ...... 49 6.2.1 Die ektopische Expression von olfaktorischen Rezeptoren...... 50 6.2.2 Die Entdeckung von bislang unbekannten chimären OR-Transkripten ...... 52 6.2.3 Zusammenfassung der ektopischen Expression von ORs ...... 53

6.2.4 Die Expression von olfaktorischen Rezeptor-spezifischen Bestandteilen der Signalkaskade ...... 54 6.2.5 Die ektopische Expression von olfaktorischen Rezeptoren in Tumorzellen ...... 55 6.3 Die Expression von olfaktorischen Rezeptoren in Zellen der myeloischen Leukämie ...... 55 6.3.1 Die Sandalore-induzierte Signalkaskade in der humanen CML-Zellinie K562 ...... 57 6.3.2 Die Sandalore-induzierte Signalkaskade im AML-Patientenblut...... 59 6.3.3 Mögliche nachgeschaltete Ionenkanäle in K562 ...... 60 6.3.4 Die physiologisch Funktion des OR2AT4 an der Proliferation ...... 60 6.3.5 Die Beteiligung des OR2AT4 an der Sandalore-induzierten Apoptose ...... 62 6.3.6 Die Beteiligung der OR2AT4-vermittelten Calciumerhöhung an der MAPK-Phosphorylierung ...... 63 6.3.7 Sandalore erhöht den Hämoglobingehalt in K562 Zellen ...... 63 6.3.8 Zusammenfassung - Die Charakterisierung des OR2AT4 in K562 und AML-Patientenblut ...... 65 Kapitel 7 - Zusammenfassung ...... 67 Chapter 7 - Conclusion ...... 69 Abbildungsverzeichnis ...... 71 Abkürzungsverzeichnis ...... 74 Publikationsliste...... 76 Poster ...... 76 Eigenanteil ...... 77 Curriculum Vitae ...... 78 Danksagung ...... 80 Literaturverzeichnis ...... 81

Kapitel 1 - Einleitung

Kapitel 1

Einleitung 1.0 Chemosensorik – ein allgemeiner Überblick Die Wahrnehmung von Vertebraten umfasst die fünf Sinne Sehen, Hören, Tasten, Schmecken und Riechen und ermöglicht es ihnen, auf einwirkende Umwelteinflüsse entsprechend zu reagieren. Die auditive und die visuelle Wahrnehmung, wie auch der Tastsinn, verarbeiten Reize, die sich durch wenige physikalische Modalitäten charakterisieren lassen. Die Wellen- länge des Lichts, der Schalldruck, die Frequenz der Tonhöhe und der mechanische Druck des Ertastens ermöglichen eine einfache Form der sensorischen Wahrnehmung. Komplexere Systeme, wie das chemosensorische System hingegen, erfassen und unterscheiden eine Vielfalt an chemischen Verbindungen. In höheren Organismen umfasst die Chemosensorik den Geruchs- und den Geschmackssinn. Beide Sinnesmodalitäten werden durch ein drittes chemosensorische System beeinflusst: das trigeminale System. In der Chemosensorik gilt der Geschmacksinn als der einfachste chemische Sinn und ist auf die fünf Basisqualitäten süß, sauer, bitter, salzig und umami beschränkt. Die chemischen Reize werden durch knospenartig angeordnete Sinneszellen auf der Zungenoberfläche detektiert. Je nach Größe umfasst eine Geschmacksknospe zwischen 10 und 50 individuelle Zellen. Mehrere Geschmacksknospen bilden untereinander die sogenannten Geschmackspapillen, die zudem noch aus Stütz-, Versorgungs- und Basalzellen bestehen. Jede geschmackliche Richtung wird durch unterschiedliche Weise mittels einer spezifischen Sinneszelle detektiert. Salzige und saure Sinneseindrücke werden direkt durch ionotrope Chemorezeptoren wahrgenommen. Metabotrope Rezeptoren hingegen sind verantwortlich für die süße, umami und bittere Geschmacksempfindung. Ähnlich wie die gustatorische Wahrnehmung gilt auch die olfaktorische Wahrnehmung als einer der ältesten chemosensorischen Systeme in Vertebraten. Schon bei niederen Invertebraten wurden phylogenetisch verwandte Mechanismen entdeckt. So entwickelte der Fadenwurm (C. elegans) einen funktionalen Geruchsinn, besitzt aber keine Möglichkeit visuelle Informationen zu verarbeiten und ist dennoch in der Lage mittels seines Geruchsinns

Kapitel 1 - Einleitung

Abbildung 1.1: Verarbeitung eines Duftmoleküls im Riechsystem des Menschen. Volatile Geruchstoffmoleküle gelangen durch den Luftstrom an die Riechschleimhaut der Nase und aktivieren dort lokalisierte ORs. Der chemische Reiz wird in den olfaktorischen Rezeptorneuronen in ein elektrisches Aktivitätsmuster umgewandelt und entlang der Axone in den Bulbus olfactorious geleitet. Von dort aus gelangt das elektrische Signal über die Glomeruli zu den Mitralzellen und wird dort verstärkt. Im Anschluss wird das Signal an höhere Hirnregionen weitergeleitet (modifiziert nach: Axel und Buck, 2004).

Nahrungsquellen oder andere Tiere zu lokalisieren. Zugleich ist der Geruchsinn ein Warnsystem und kann toxische Substanzen, die auf Gefahren hindeuten, frühzeitig erkennen. Beim Menschen gelangen volatile Geruchsmoleküle (< 400 Dalton) über die Luft in die Nasenhöhle zum Riechepithel (Regio olfactoria), welches transversal an der oberen Nasenhöhle lokalisiert ist. Dort diffundieren Duftstoffe durch den Schleim (Mucus) und gelangen an die Zilien der Riechsinneszellen, welche von Stütz-, Drüsen- und Basalzellen umgeben sind (Abbildung 1.1). In der Zilienmembran des Riechepithels binden Duftstoffe an die dort lokalisierten olfaktorischen Rezeptoren (ORs) und lösen eine Depolarisation der Sinneszellen aus. Mit ungefähr 400 funktional exprimierten ORs ist der Mensch in der Lage, über 1 Billion olfaktorische Stimuli wahrzunehmen und voneinander zu unterscheiden (Bushdid et al., 2014; Mainland et al., 2014). Gelangen genügend Duftstoffmoleküle an die Riechzelle, entsteht ein Calcium- und Natriumeinstrom sowie ein Chloridausstrom der groß genug ist, um eine Depolarisation der Sinneszelle zu erzeugen und die erhaltene Information in Form eines

Kapitel 1 - Einleitung

elektrischen Aktionspotenzials über die Axone des ersten Hirnnervs, dem Nervus olfactorius, durch die Lamina cribrosa, weiter an den vorgelagerten Hirnteil, dem Riechkolben (Bulbus olfactorius), zu leiten. Im Bulbus olfactorius wird das erfasste Signal in die Glomeruli geleitet und mithilfe von Mitralzellen verstärkt. Von dort aus gelangt das Signal an den primären olfaktorischen Cortex, welcher die erfassten Informationen zum Hyphothalamus, dem orbitofrontalen Assoziationskortex und ins limbische System weiter verschaltet. Neuere Studien deuten auf eine Interaktion zwischen dem olfaktorischen und trigeminalen System hin (Hummel und Livermore 2002; Rothermel et al., 2011; Brand 2006; Croy et al., 2014; Chevy und Klingler 2014). Die Schleimhäute außerhalb und innerhalb des Riechepithels werden durch freie Nervenendigungen des fünften kranialen Nervs, Nervus (N.) trigeminalis, innerviert und können auch chemische Substanzen detektieren. Im trigeminalen Ganglion (TG, Ganglion gasseri) liegen die Perykarien pseudounipolarer Nervenzellen, dessen Dendriten den N. trigeminus und die sensorischen Nervenenden in den Schleimhäuten bilden. Die sensiblen Nervenfasern (Radix sensoria) der trigeminalen Ganglien leiten die erhaltenen Informationen an die Hirnkerne des trigeminalen Nucleolus weiter. Insgesamt entstehen aus dem TG vier distal gerichtete trigeminale Nerven, drei sensorische und ein motorischer. Diese Nerven werden unterteilt in Nucleus mesencephalicus Nervi trigemini, Nucleus pontinus Nervi trigemini, Nucleus spinalis Nervi trigemini und Nucleus motorius Nervi trigemini. Die Nerven des TGs bündeln sich zu drei Ästen, dem Augenast (V1: N. ophthalmicus), dem Oberkieferast (V2: N. maxillaris) und dem Unterkieferast (V3: N. mandibularis) (Abbildung 1.2). Der V1, wie auch der V2, bestehen ausschließlich aus sensorischen Fasern und innervieren deutlich voneinander getrennte Bereiche in den Schleim- häuten und dem Gesichtsbereich. Der V1 zweigt sich in den N. nasociliaris, den N. frontalis und den N. lacrimalis und innerviert das nasale Septum, Siebbein, Keilbein und Teile des

Auges, wie beispielsweise die Bindehaut und die Kornea. Der V2 innerviert durch seine drei Äste den R. ganglionares, den N. zygomaticus und den N. infraorbitalis die Schleimhäute der

Nasen- und Mundhöhle, Teile der Gesichtshaut, den Oberkiefer und den Gaumen. Der V3 zweigt sich in insgesamt vier Äste, dem N. auriculotemporalis, dem N. alveolaris inferior, dem

N. lingualis und dem N. buccalis. Entgegen des V1 und des V2 enthält der V3 zusätzlich zu den chemosensorischen Fasern auch motorische (Radix motoria), welche sowohl die Kau- als auch die Gesichtsmuskulatur innervieren. Die chemosensorischen Fasern des V3 innervieren die Speicheldrüse, die Mundschleimhäute, Teile der Zunge, den Unterkiefer und die Gesichtshaut.

Kapitel 1 - Einleitung

Abbildung 1.2: Anatomie des Nervus Trigeminus. Schematische Abbildung der peripheren trigeminalen Innervation des Menschen. Die sensorische und motorische Wurzel des Trigeminus formen das trigeminale Ganglion. Das trigeminale Ganglion spaltet sich in die drei trigeminalen Hauptäste Nervus opthalamicus (V1), Nervus maxillaris (V2) und Nervus mandibularis (V3). Die Äste des Nervus mandibularis bestehen aus teils sensorischen und teils motorischen Fasern. Jeder Zweig innerviert verschiedene Bereiche des Gesichtes, der Hirnhaut, die Zähne, der Haut und der Nasen- sowie der Mundschleimhäute (modifiziert nach: Neuroscience, 3td Edition, Sinauer 2004).

Die sensorischen Fasern des N. lingualis verbinden sich mit dem siebten kranialen Nerv (N. facialis) und innervieren zwei Drittel der somatosensorischen und gustatorischen Wahrnehmung des frontalen Teils der Zunge. Die trigeminalen Nervenenden können mittels polymodal exprimierten Nozizeptoren, Thermo-, Chemo- und Mechanorezeptoren verschiedene physikalische Reize wie Druck und Temperatur, aber auch chemische Reize, wie die beißende Schärfe von Capsaicin oder die kühlende Wirkung von Menthol, wahrnehmen (Julius und Basbaum 2001; Sekizawa und Tsubone 1994). Durch diese Fähigkeit, beeinflusst das trigeminale System sowohl die gustatorische als auch die olfaktorische Wahrnehmung. Die Stimulation der freien Nervenenden durch Duftstoffe oder Säuren und scharf schmeckenden Substanzen wird durch mehrere im trigeminalen Ganglion exprimierte Ionenkanäle und GPCRs ermöglicht. In der Chemosensorik wird insbesondere den transient receptor potential (TRP) Kanälen und den Kaliumkanälen große Aufmerksamkeit gewidmet. Für beide Rezeptorklassen konnte gezeigt werden, dass sie eine zentrale Rolle in der Detektion von Schmerzen, Temperaturen und chemischen Substanzen einnehmen (McKemy et al., 2002; Caterina et al., 1997). Bis heute sind die Grundlagen der zellulären und molekularen Mechanismen der Chemo- sensorik durch das trigeminale System nicht völlig verstanden. Die meisten Geruchsmoleküle werden sowohl von ORs im Nasenephithel als auch vom N. trigeminus erfasst (Croy et al.,

Kapitel 1 - Einleitung

2014; Brand 2006; Doty et al., 1978). Vorangegangene Studien belegen, dass die beiden intranasalen Subsysteme eng miteinander verbunden sind und dass eine Stimulation des N. trigeminus die Geruchswahrnehmung beeinflussen kann. So ist aber auch Gegenteiliges möglich, dass eine Geruchswahrnehmung die trigeminale Wahrnehmung beeinflusst (Cain und Murphy 1980; Gudziol et al., 2001; Hummel und Livermore 2002; Daiber et al., 2013). Bislang ist nur wenig über die chemosensorischen Verarbeitung des N. trigeminus und über die Interaktion mit dem olfaktorischen System bekannt. Lediglich die Funktion der bekanntesten Ionenkanäle und die der G-Protein gekoppelten Rezeptoren (GPCR) wurden bisher untersucht. Unklar ist, welche weiteren Arten von Rezeptoren im N. trigeminus exprimiert werden und wie diese sich auf die chemosensorische Wahrnehmung auswirken könnten. Bisher existieren wenige Expressionsstudien über das trigeminalen Ganglion, welche oftmals nur einen kleinen Teil der bereits bekannten Membrankanäle und Rezeptoren abdecken (Lazarov 2002). Im Rahmen der vorliegenden Arbeit habe ich mich mit der Untersuchung von Chemo- rezeptoren, insbesondere mit der ektopischen Expression von ORs im trigeminalen System der Maus und in unterschiedlichen Geweben im Menschen, befasst. Mit Hilfe der Next-Generation Sequenzierung war es möglich, die Expression von allen bekannten GPCRs und Ionenkanälen im TG zu beschreiben und mit anderen sensorischen und nicht-sensorischen Geweben zu vergleichen. Des Weiteren wurde auch die ektopische Expression von ORs im humanen Gewebe mit Hilfe der Next-Generation Sequenzierung durchgeführt. Die anschließende funktionale Charakterisierung eines ektopisch, in humanen Leukämiezellen exprimierten Riechrezeptor- Proteins konnte mit Hilfe bildgebender Verfahren sowohl an der Leukämiezelllinie K562, als auch am Blut akut erkrankter Leukämiepatienten durchgeführt und die physiologische Rolle des ORs bestimmt werden.

1.1 Die Klasse der olfaktorischen Rezeptoren Die Entdeckung der G-Protein gekoppelten OR-Multigenfamilie im Riechepithel der Ratte durch Linda Buck und Richard Axel war ein Meilenstein in der Geruchsforschung und wurde 2004 mit dem Nobelpreis für Medizin und Physiologie gekürt (Buck und Axel 1991). ORs sind sowohl an der Detektion als auch an der Differenzierung chemischer Verbindungen beteiligt und bilden in allen Vertebraten mit Abstand die größte Klasse an Chemorezeptoren (Fredriksson et al., 2003).

Kapitel 1 - Einleitung

Abbildung 1.2: Anordnung der Aminosäuren- struktur in ORs. ORs bestehen aus sieben Trans- membrandomänen mit einem intra- zellulären C-Terminus und einem extrazellulären N-Terminus. Die blau markierten Aminosäuren sind hoch konservierte Regionen, welche in allen ORs vorkommen. Die rot markierten Aminosäuren sind hoch variable Regionen (modifiziert nach: Stryer, 2004).

Die codierenden Gene für ORs sind in Clustern angeordnet und verteilen sich im gesamten menschlichen Genom mit Ausnahme der Chromosomen 20 und Y (Ben-Arie et al., 1994; Glusman et al., 2001; Fredriksson und Schiöth 2005). Im Menschen werden von den etwa 1200 OR-Genen ~400 funktional exprimiert (Mainland et al., 2014). Wie alle GPCRs, besitzen auch ORs sieben Transmembrandomänen, welche über drei extra- und drei intrazelluläre Schleifen miteinander verbunden sind. Der extrazelluläre N-Terminus dieser Rezeptoren ist im Vergleich zu anderen relativ klein und weist putative N-Glykosylierungsstellen mit funktionaler Relevanz auf (Gat et al., 1994). Die charakteristische dritte Transmembrandomäne bildet auch in ORs eine hochkonservierte Asp-Arg-Tyr Kette (DRY-Motiv), welche bei allen Klasse A Rezeptoren zu finden ist (Wilbanks et al., 2002). Die Sequenz der Transmembrandomänen I, IV, V und VI variieren innerhalb der ORs und bilden die unterschiedlichen Bindestellen für Duftstoff- moleküle (Pilpel und Lancet 1999; Fuchs et al., 2001; Katada et al., 2005; Abaffy et al., 2007; Doszczak et al., 2007; Gelis et al., 2012) (Abbildung 1.2). Trotz den ungefähr 400 funktional exprimierten ORs ist der Mensch in der Lage, viele unterschiedliche Duftstoffe zu unterscheiden (Hatt 2004; Bushdid et al., 2014). Zum einen kann ein Duftstoff verschiedene ORs in einer spezifischen Weise binden und aktivieren (broadly tuned) (Malnic et al., 1999; Kajiya et al., 2001), sodass jede Kombination der duftstoffaktivierten Rezeptoren die olfaktorische Wahrnehmung definieren könnte (Malnic et al., 1999; Kajiya et al., 2001; Bushdid et al., 2014). Zum anderen könnten ORs nur ein kleines Spektrum an strukturell ähnlichen Duftstoffen (norrowly tuned receptor) mit unterschiedlich starker Affinität binden (Krautwurst et al., 1998; Zhao et al., 1998; Malnic et al., 1999; Wetzel et al., 1999; Spehr et al., 2003; Busse et al., 2014; Mombaerts 2004; Schmiedeberg et al., 2007). Neuere Studien zeigen, dass für ORs auch Antagonisten existieren, die einen Riechrezeptor mit noch stärkerer Affinität binden und

Kapitel 1 - Einleitung

somit dessen Möglichkeit Duftstoffe wahrzunehmen inhibieren (Spehr et al., 2003; Oka et al., 2004; Shirokova et al., 2005; Abaffy et al., 2007; Busse et al., 2014; Neuhaus et al., 2009).

1.1.2 Die olfaktorische Signalkaskade In den Riechzellen der Säuger erfolgt die klassische Signalkaskade von ORs in den olfaktorischen Rezeptorneuronen durch die Aktivierung von Golf und dem cAMP vermittelten Signalweg (Abbildung 1.3). Hierbei werden ORs in den Zilien durch volatile Duftstoffe aktiviert. Dadurch ändert der OR seine Konformation und aktiviert ein heterotrimeres G-Protein, wodurch GDP zu GTP ausgetauscht wird. Durch die Bindung von GTP wird das olfaktorische G-Protein aktiviert und instabil, so dass es in zwei Teile dissoziiert, in die Gaolf und die 113-Untereinheit (Jones und Reed 1989; Kerr et al., 2008). Die aktive Gaolf Unter- einheit aktiviert die membranständige Adenylatcyclase III, welche die Umsetzung von ATP zu cAMP katalysiert (Bakalyar und Reed 1990; Wong et al., 2000). Der steigende cAMP Gehalt in der Zelle führt zur Öffnung von zyklisch Nukleotid-gesteuerten (CNG) Kanäle, wodurch Calcium und Natrium in die Zelle gelangt (Zufall et al., 1993; Frings et al., 1995; Torre et al., 1995). Zwei cAMP Moleküle reichen hier aus, um einen CNG Kanal zu öffnen (Nakamura und Gold 1987; Dhallan et al., 1990; Firestein 2001; Thüraüf et al., 1996). Die intrazelluläre Calciumerhöhung führt schließlich zur Aktivierung Calcium-aktivierter Chloridkanäle (CaCC) und veranlasst einen Chloridausstrom (Rasche et al., 2010; Kleene und Gesteland 1991; Kurahashi und Yau 1993; Reisert et al., 2003; Pifferi et al., 2006).

Abbildung 1.3 Die klassische Signalkaskade in olfaktorischen Rezeptorneuronen.

Die Aktivierung eines ORs durch einen Liganden führt zur Dissoziierung der Golf Untereinheit und damit zur Aktivierung der Adenylatcyclase III. Der intrazelluläre cAMP-Gehalt steigt, membran- ständige CNG Kanäle werden geöffnet und extrazelluläres Calcium und Natrium strömt in die Zelle. Der Anstieg an intrazellulärem Calcium öffnet nachgeschaltete CaCC (modifiziert nach: Firestein, 2001).

Kapitel 1 - Einleitung

2010 konnte am Lehrstuhl für Zellphysiologie der Ruhr-Universität Bochum gezeigt werden, dass der in dem Prozess wichtigste CaCC Kanal der TMEM16b ist (Rasche et al., 2010). Bei ausreichender Menge an Rezeptor stimulierenden Duftstoffmolekülen steigt die intrazelluläre Konzentration an positiven Ladungen an, wobei gleichzeitig der Anteil an negativ geladenen Chlorid-Ionen abnimmt, so dass die Zellen depolarisieren und ein Aktionspotential am Axonhügel generieren (Restrepo et al., 1993; Tareilus et al., 1995). Neben dem TMEM16b spielt in den olfaktorischen Rezeptorneuronen auch der Natrium- Kalium-Chlorid Cotransporter 1 (NKCC1) eine essentielle Rolle, da er durch seine Aktivität die nötige Chloridhomöostase in den Zellen einstellt, um den notwendigen exzitatorischen Chloridstrom während eines positiven Ioneneinstroms zu erlangen (Kaneko et al., 2001; Kaneko et al., 2004; Reisert et al., 2005). Bis heute konnten von den 400 funktional exprimierten ORs nur wenige deorphanisiert werden, da diese sich nur schwer in heterologen Zellsystemen wie den HEK293-Zellen transfizieren und exprimieren lassen. Der OR17-40 war der erste funktional exprimierte OR und konnte von Wetzel und Mitarbeiter 1999 charakterisiert werden (Wetzel et al., 1999). Weitere deorphanisierte humane ORs sind, OR1D2 (Spehr et al., 2003), OR52D1 (Sanz et al., 2005), OR1G1 (Sanz et al., 2005), OR2AG1 (Neuhaus et al., 2006), OR1A1 (Schmiedeberg et al., 2007), OR1A2 (Schmiedeberg et al., 2007), OR51E1 (Fujita et al., 2007), OR7D4 (Keller et al., 2007), OR51E2 (Neuhaus et al., 2009), OR11H7P, OR11H4 und OR11H6 (Menashe et al., 2007), OR4D1 (Veitinger et al., 2011), OR7A5 (Veitinger et al., 2011) sowie OR2AT4 (Busse et al., 2014). Durch Calcium-Imaging Experimente gelang es vor kurzen am Lehrsuhl für Zellphysiolgie der Ruhr-Universität Bochum 18 weitere humane ORs zu deorphanisieren (Baghaei, 2013). Die Deorphanisierung von weiteren ORs erfolgte kürzlich auch mit neueren Methoden, wie dem dualen CRE-(cAMP responsive element) Luciferase Assay (Saito et al., 2009; Adipietro et al., 2012; Mainland et al., 2014).

1.1.3 Die ektopische Expression von olfaktorischen Rezeptoren Die ektopische Expression von ORs wurde erstmalig 1992 von Parmentier und Arbeitskollegen im Hoden von Mensch und Hund beobachtet (Parmentier et al., 1992). Im Laufe der letzten Jahre belegten immer mehr Studien das Vorkommen von ORs im nicht-olfaktorischen humanen Gewebe. Dazu zählen Expressionsnachweise in Erythrozyten (Feingold et al., 1999), in der Zunge (Gaudin et al., 2001; Durzyński et al., 2005), in peripheren Ganglien des autonomen Nervensystems (Weber et al., 2002) oder in der Milz (Raming et al., 1998). Durch die Transkriptomanalyse mittels Microarry-Chips oder Next-Generation Sequencing konnte eine

Kapitel 1 - Einleitung

Vielzahl von ektopisch exprimierten ORs in nahezu allen untersuchten Geweben gefunden werden (Feldmesser et al., 2006; Zhang und Firestein 2007; Flegel et al., 2013). Die Transkriptomanalysen ermöglichen heutzutage durch ihre massiven und parallelen Sequenzierungen von Millionen RNA-Fragmenten in einem einzigen Sequenzierlauf eine akkurate und schnelle Analyse der Genexpression in Geweben. Trotz der Entdeckung von ektopisch exprimierten ORs in humanen Geweben ist deren physiologische Bedeutung bislang nur für die wenigsten beschrieben worden. Wie schon erwähnt, war OR1D2 der erste ektopisch exprimierte OR dessen Funktion in humanen Spermienzellen charakterisiert werden konnte (Spehr et al., 2003). Das Riech- rezeptor-Protein wird durch den Duftstoff Bourgeonal aktiviert und erhöht dadurch die intrazelluläre Calciumkonzentration der Spermien. Des Weiteren löst die Aktivierung des OR1D2 eine chemotaktische Bewegung der Spermien in Richtung des Duftstoffes aus und scheint in der Kommunikation zwischen Spermien und Eizelle involviert zu sein (Spehr et al., 2003). Eisenbach und Gakamsky konnten die Daten bestätigen und zeigten, dass Bourgeonal und Progesteron die Schwimmgeschwindigkeit von Spermien erhöhen (Gakamsky et al., 2009). Mittlerweile konnten auch in anderen Spezies über 50 verschiedene Riechrezeptoren aus Hoden cDNA amplifiziert werden (Vanderhaeghen et al., 1997a; Zhang und Firestein 2002; Feldmesser et al., 2006; Flegel et al., 2013). Nach der Entdeckung von ORs in Spermien konnte kurz darauf die Expression von ORs in enterochromaffinen Zellen des menschlichen Dünndarms gezeigt werden (Braun et al., 2007). Die Applikation von OR-spezifischen Duftstoffen an luminalen Zellen des Dünndarms erhöhte den intrazellulären Calciumspiegel und stimulierte dabei die Serotoninausschüttung im Darm. 2009 konnte am Lehrstuhl für Zellphysiologie an der Ruhr-Universität Bochum gezeigt werden, dass der OR51E2 (PSGR) in Prostatakrebszellen exprimiert wird und dort durch den Duftstoff β-Ionon und durch endogene Steroidhormone (Androstenon-Derivate) aktiviert wird. Eine Stimulation des ORs mit den Duftstoffen hatte eine signifikante Inhibition der Krebszellen zur Folge (Neuhaus et al., 2009). 2012 wurde die ektopische Expression des OR1A2 und OR2A4 in der humanen Epithel- zelllinie eines Cervixkarzinoms beschrieben und eine Assoziation zwischen der Expressions- stärke und der Cytokinese gezeigt (Zhang et al., 2012). Im selben Jahr belegte die Arbeits- gruppe von Zhao, dass ORs auch in mononukeären Zellen des peripheren Blutes (PBMC) exprimiert werden und eine Rolle bei Schädel-Hirn-Trauma-Patienten spielen. Diese werden bei Patienten runterreguliert und können somit als Marker für traumatische Hirnverletzungen genutzt werden (Zhao et al., 2013). 9

Kapitel 1 - Einleitung

Zwei Jahre später konnte die Expression und die physiologische Bedeutung des OR2AT4 in humanen Keratinozyten charakterisiert werden (Busse et al., 2014). Der OR2AT4 fungiert dort als Chemorezeptor und lässt sich durch die strukturell ähnlichen Substanzen Sandalore, Brahmanol und Javanol aktivieren. Eine Stimulation des ORs führt über den cAMP- vermittelten Signalweg zu einer intrazellulären Calciumerhöhung durch die Aktivierung nachgeschalteter CNG-Kanäle. Die Stimulation des ORs durch dessen Liganden fördert die Proliferation und die Wundheilungsprozesse in der Haut. Die Ergebnisse zeigen, dass ektopisch exprimierte ORs als Chemorezeptoren fungieren und je nach Gewebe unterschiedliche physiologische Funktionen einnehmen. So können Riech- rezeptoren je nach exprimierten Zelltyp sogar gegenteilige Aufgaben übernehmen, wie die Förderung von Proliferation in Hautzellen oder die Proliferationsinhibierung in Prostata- krebszellen. Studien mit ektopisch exprimierten ORs in malignen Tumorzellen, wie beispielsweise in Prostatakrebs, zeigen die Beteiligung der Riechrezeptoren an der Proliferationsinhibierung. Es scheint möglich, dass die Expression von ORs in anderen malignen Tumoren auch eine regulatorische Funktion einnehmen. Um einen weiteren Aufschluss über die physiologische Funktionen ektopisch exprimierter Geruchsrezeptoren zu bekommen, sind weitere Studien nötig, die auch zelluläre Mechanismen, wie die Differenzierung oder die induzierte Apoptose, untersuchen. Doch neben den ORs spielen in der Chemosensorik auch weitere Klassen von GPCRs und Ionenkanälen eine essentielle Rolle.

1.2 Ionenkanäle und G-Protein gekoppelte Rezeptoren in der Chemosensorik Die Hauptaufgabe der Chemosensorik in allen höheren Eukaryoten beruht auf der Detektion und Differenzierung flüchtiger oder gelöster chemischer Verbindungen mittels Oberflächen- Rezeptoren (Shi und Zhang 2009). Diese sensorische Funktion beinhaltet auch die Aktivierung von Nozizeptoren und Thermorezeptoren und dient dem Organismus hauptsächlich als Schutzmechanismus vor schädlichen Reizen (Viana 2011). Insbesondere die chemosensorischen Eigenschaften der gustatorischen, olfaktorischen und trigeminalen Wahrnehmung spielen in Vertebraten eine essentielle Rolle (Gerhold und Bautista 2009). Diese drei Sinne lassen sich alle sowohl funktional als auch anatomisch voneinander unterscheiden. Freie Nervenendungen somatosensorischer trigeminaler Nerven sind in der Lage, ein breites Spektrum an Sinneseindrücken wie Druck, chemische Substanzen, Temperatur sowohl an der Gesichtshaut als auch an der Mund- und Nasenschleimhaut zu detektieren. Gerade hierbei spielt die Klasse der GPCRs und der Ionenkanäle eine zentrale Rolle.

Kapitel 1 - Einleitung

Die Klasse der GPCRs bildet mit über 1400 verschiedenen Mitgliedern die größte Genfamilie in Vertebraten. Sie bestehen aus sieben membrandurchspannenden -Helices, die durch drei extra- und drei intrazelluläre Schleifen (Loops) miteinander verbunden sind. Der N-Terminus dieser Rezeptoren befindet sich im extrazellulären Raum, wobei der C-Terminus intrazellulär lokalisiert ist. GPCRs bilden die wichtigste Klasse der Chemorezeptoren und können durch endogene oder exogene Liganden aktiviert werden und ein breites Spektrum an unterschiedlichen Substanzen binden, wie Neurotansmitter, Aminosäuren, chemische Substanzen, extrazellulares Calcium und Chromophore (Broeck 2001). Etwa 50 - 60 % aller heutigen zugelassenen Medikamente binden direkt an GPCRs und inhibieren oder verstärken deren Signalkaskaden (Overington et al., 2006; Lundstrom 2005). Durch extrazelluläre oder intrazelluläre Ligandenbindung leiten GPCRs Signale über eine G-Protein gekoppelte Signalkaskade weiter. Hierbei ändern GPCRs durch Bindung eines Liganden die Konformation und aktivieren dadurch an der Innenseite der Plasmamembran ein anliegendes heterotrimeres G-Protein, bestehend aus einer -, - und -Untereinheit. Dadurch wird GDP mit GTP an der -Untereinheit ausgetauscht und bleibt solange aktiv, bis GTP wieder zu GDP zurück hydrolysiert. Das G-Protein dissoziiert zu einer frei beweglichen -GTP–Untereinheit und einem stationären -Komplex. Beide Proteinuntereinheiten inhibieren oder aktivieren weitere zelluläre Effektorproteine. In der Familie der GPCRs existieren neben den ORs noch weitere unterschiedliche Arten an somatosensorischen Rezeptoren, wie etwa die Klasse der metabotropen Histaminrezeptoren, Taste-Rezeptoren, TAAR-Rezeptoren, der P2Y-Rezeptoren, der Opioidrezeptoren, der Chemokinrezeptoren oder der metabotropen Glutamatrezeptoren (Lazarov 2002). Gerade die strukturelle Vielfalt exprimierter GPCRs an trigeminalen Nervenenden spiegelt die große Diversität und Spezifität der chemo- und somatosensorischen Kapazität des Systems wieder. Doch neben den bereits bekannten Rezeptoren werden auch immer wieder neue Klassen an GCPRs entdeckt, die in der Chemosensorik eine zentrale Rolle spielen könnten. Bestes Beispiel hierfür ist die vor etwa einem Jahrzehnt entdeckte Klasse der Mas-related GCPRs (MRGPR) (Dong et al., 2001). Dong und Mitarbeiter detektierten 2001 erstmals etwa 40 hoch exprimierte MRGPRs, unterteilt in die neun Subfamilien MRGPRA bis -H und -X, in den sensorischen Neuronen des DRG und TG. Bislang ist das volle Spektrum der physiologischen Funktionen nur von den wenigsten MRPGRs beschrieben worden. Bekannt ist, dass -Alanin am MRGPRD bindet und dadurch an der Wahrnehmung von Schmerzen beteiligt ist (Shinohara et al., 2004). Neuere Studien zeigten zudem eine Beteiligung des Rezeptors an der Wahrnehmung

Kapitel 1 - Einleitung

mechanischer und thermischer Stimuli (Rau et al., 2009). Andere MRGPRs, wie MRGPRX1 und MRGPRA3, sind an der Wahrnehmung von Chloroquin und der körpereigenen Substanz BAM8-22 beteiligt und vermitteln dadurch einen Histamin-unabhängigen Juckreiz (Liu et al., 2009). Beispiele, wie die Klasse der MRGPRs zeigen, dass eine genaue Expressionsanalyse in chemosensorischen Systemen wie dem trigeminalen Ganglion einen wichtigen Beitrag zur Detektion neuer potentieller Chemorezeptoren führen kann. Neben den GPCRs spielen auch Ionenkanäle in der Chemosensorik eine ebenso wichtige Rolle (Viana 2011). Ionenkanäle bestehen aus mindestens einem Transmembranprotein, welches eine Kanalpore bildet und Ionen wie Kalium, Calcium, Natrium oder Chlorid durch die Zellmembran leiten. Zellmembranen ermöglichen die Aufrechterhaltung eines asymmetrischen Ionengradienten zwischen dem Zellinneren und dem extrazellulären Raum, welcher durch die Öffnung von membranständigen Ionenkanälen oder Ionenpumpen verändert werden kann. Hierbei existiert eine enorme strukturelle und funktionale Vielfalt an Kanälen zwischen denen unterschieden werden kann. Klassifiziert werden diese abhängig von ihrer Ionenselektivität und davon, welche externen physikalischen oder chemischen Modulatoren ihre Öffnungswahrscheinlichkeit erhöhen (Bertil Hille). Hierbei kann man zwischen konstitutiv geöffneten, spannungs-, liganden-, mechanisch-, licht- und temperatur-gesteuerten Ionenkanälen unterscheiden. In sensorischen Geweben sind Ionenkanäle auch in der Lage flüchtige Substanzen zu detektieren und als zelluläre Sensoren zu agieren. Hierbei liegt insbesondere die Familie der transient receptor potential channels (TRP-Kanäle) im Fokus der heutigen Forschung. Verschiedene TRP-Mitglieder sind an der Detektion von chemischen Substanzen, aber auch an der Wahrnehmung von thermischen und mechanischen Reizen involviert (Julius und Basbaum 2001; Caterina et al., 2000; McKemy et al., 2002; Peier et al., 2002; Damann et al., 2008). So wird beispielsweise durch die Bindung von Menthol an TRPM8 ein kühlender Sinneseindruck vermittelt (McKemy et al., 2002). Andere chemische Substanzen, wie Capsaicin aus der Chillischote oder Senföl, binden an TRPV1 oder an TRPA1 und erzeugen dadurch eine brennende, scharf schmeckende Empfindung (Jordt et al., 2004; Caterina et al., 1997; Caterina und Julius 2001; Patapoutian et al., 2003; Mizushima et al., 2006; Munns et al., 2007). Diese Rezeptoren sind im klassischen Sinne sowohl Chemorezeptoren, als auch Thermo- rezeptoren. Neben den TRP-Kanälen wird in der Chemosensorik auch der Klasse der Kaliumkanäle immer mehr Aufmerksamkeit gewidmet. Wie die TRP-Kanäle sind auch Kaliumkanäle in der Lage chemische Substanzen wie Alkylamine zu detektieren und dadurch eine prickelnde Empfindung auf der Zunge zu vermitteln (Albin und Simons 2010). Natürliche Derivate dieser 12

Kapitel 1 - Einleitung

chemischen Verbindungen kommen beispielsweise in Szechuanpfeffer vor und sind als -Hydroxy-Sanshool beschrieben. Neben der prickelnden Empfindung der Zunge, aktiviert diese Substanz auch weitere trigeminale Thermo- und Mechanorezeptoren (Bryant und Mezine 1999; Lennertz et al., 2010). Hierbei spielt sowohl die Aktivierung von TRPV1 und TRPA1, als auch die von KCNK3, KCNK9 und KCNK18 eine Rolle (Beltrán et al., 2013a; Beltrán et al., 2013b; Bautista und Julius 2008). Hierbei werden die sogenannten background-leak Kaliumkanäle inhibiert, was anschließend zu einer Depolarisation der Zelle führt. Dieser Mechanismus konnte nicht durch TRPV1 und TRPA1 Antagonisten unterdrückt werden (Riera et al., 2009). Ein Beispiel für einen indirekten Chemorezeptor ist die Klasse der spannungsabhängigen Natriumkanäle (voltage gated sodium channel, VGSC). Diese sind zwar zusammen mit den Kaliumkanälen hauptsächlich an der Signalübertragung in Nervenbahnen beteiligt (Weiss et al., 2011; HODGKIN und HUXLEY 1952), können aber auch durch externe Liganden beeinflusst werden. An trigeminalen Neuronen der Maus konnte gezeigt werden, dass Duftstoffe wie Menthol oder Thymol die entstehenden elektrischen Ströme durch Bindung an die VGSC inhibieren und dadurch die Wahrnehmung von Schmerzen deutlich verringern (Lossin et al., 2002). Die Klasse der VGSC gilt, ähnlich wie die Kaliumkanäle als eine neue potentielle Klasse an ionotropen Chemorezeptoren. Durch die Aktivierung von GPCRs oder Ionenkanälen durch äußere chemische Reize ändert sich kurzfristig der intrazelluläre Ionengehalt und leitet die erhaltende Information mittels Aktionspotentiale weiter ins zentrale Nervensystem. Des Weiteren wird durch die Aktivierung von GPCRs weitere nachgeschaltete physiologische Prozesse wie der programmierte Zelltod, die Proliferation, die Migration oder die Differenzierung eingeleitet (Wang et al., 2009; Ye et al., 2007; Sergeev et al., 2006; Dong et al., 2002). Bei den bekannten Chemorezeptoren, wie den ORs oder den TRP-Kanälen, spielt dabei insbesondere die Veränderung des Calciumgehalts eine wichtige Rolle (Spehr et al., 2011; Neuhaus et al., 2009; Busse et al., 2014; Spehr et al., 2003; Braun et al., 2007).

1.3 Calcium als intrazellulärer Botenstoff Beginnend mit der Signaltransduktion in Neuronen bis hin zur Steuerung regulatorischer Prozesse in einer Zelle gilt Calcium als einer der wichtigsten sekundären Botenstoffe in diversen Signaltransduktionskaskaden von Vertebraten (Clapham 2007; Wang et al., 2009; Sergeev et al., 2006; Sergeev 2005). Gerade in der Chemosensorik von ORs wird die intrazelluläre Calciumkonzentration durch die Aktivierung der Rezeptoren stark verändert

Kapitel 1 - Einleitung

(Spehr et al., 2011; Neuhaus et al., 2009; Busse et al., 2014; Spehr et al., 2003; Braun et al., 2007). Hierbei werden durch die OR-vermittelte intrazelluläre Signalkaskade nachgeschaltete, membranständige CNG-Kanäle aktiviert, sodass die cytosolische Calciumkonzentration von etwa 0,1 µM um das Tausendfache ansteigen kann. Die extrazelluläre Calciumkonzentration ist um ein vielfaches höher und erreicht, je nach Gewebe, bis zu 1,8 mM. Gelangt durch die Aktivierung eines GPCRs vermehrt Calcium aus dem extrazellulären Raum ins Cytosol der Zelle, hat dies Auswirkungen auf unterschiedliche physiologischer Prozesse und kann sich inhibitorisch oder verstärkend auf die Proliferation, die Apoptose, die Migration oder die Differenzierung auswirken. So konnte gezeigt werden, dass nach Aktivierung von ORs der intrazelluläre Calciumgehalt erhöht wird und dadurch verschiedene physiologische Zell- prozesse eingeleitet werden (Neuhaus et al., 2009; Busse et al., 2014; Spehr et al., 2003; Braun et al., 2007; Maßberg et al., 2014). Hierbei spielt die Bindung von Calcium an Calmodulin eine zentrale Rolle (Stevens 1983; Klee und Vanaman 1982). Calmodulin ist in der Lage bis zu vier Calcium-Ionen zu binden, um dann je nach Konformationsänderung andere Proteine zu aktivieren und somit die Aktivität vieler Enzyme und Proteinkinasen, insbesondere der MAPKs (mitogen activated protein kinases), einzuleiten (Kretsinger et al., 1980). Dadurch werden terminal nachgeschaltete Transkript- faktoren aktiviert, die die erwähnten physiologischen Änderungen der Zelle nach sich ziehen (Clapham 2007; Colbran und Brown 2004). Der Calcium-Calmodulinkomplex aktiviert die Phosphorylierung von Proteinkinasen wie die p44/42-MAPK, p38-MAPK, Akt und JNK. Gerade die Phosphorylierung der MAPKs beeinflusst die Regulierung von Zellwachstum, induziertem Zelltod, Sekretion und Zelldifferenzierung (Lee et al., 2000; Coticchia et al., 2009; Kushida et al., 2001). An ektopisch exprimierten Chemorezeptoren, wie den ORs, konnte gezeigt werden, dass eine Duftstoffstimulation des Riechrezeptors die Phosphorylierung der Proteinkinasen verändert und dadurch auch physiologische Prozesse, wie beispielsweise die Förderung der Wundheilung in der Haut, aktiviert (Busse et al., 2014).

1.4 Mitogen-aktivierte Proteinkinasen Durch die Wahrnehmung von chemischen Reizen durch Chemorezeptoren und der daraus resultierenden veränderten Calciumhomoestasis, werden oftmals auch physiologische Prozesse in den Zellsystemen eingeleitet. Bei der Übertragung extrazellulärer Reize in intrazelluläre Signale spielen neben Calcium-, Natrium-, Kalium- und Chlorid-Ionen auch Proteinkinasen eine zentrale Rolle. Die Aufgabe dieser Enzyme ist die Übertragung und die Aktivierung einer terminalen Phosphatgruppe von ATP auf spezifische Zielproteine. Reguliert werden

Kapitel 1 - Einleitung

Proteinkinasen durch membranständige- oder nukleäre- Rezeptoren und durch eine Erhöhung sekundärer Botenstoffe, wie intrazelluläres Calcium, ATP, cGMP oder cAMP (Webb et al., 2000; Newton 2003; Newton 1995). Insgesamt gibt es etwa 500 Kinasen die in mehrere unterschiedliche Klassen unterteilt werden (Manning 2005). Die am besten untersuchten Proteinkinasen sind die Mitglieder der mitogen-aktivierten Proteinkinasen (MAPK). MAPKs gehören zu den Serin-Threonin Kinasen und sind an der Katalyse intrazellulärer Signalkaskaden verschiedenster zellulärer Mechanismen wie der Zell- proliferation, der Zelldifferenzierung und der Apoptose beteiligt (McCubrey et al., 2006; Torii et al., 2006; Dhillon et al., 2007). Die MAPK-Signalwege werden nach ihren terminalen MAPK benannt, bestehend aus der extrazellulären signalregulierten Kinase (ERK, p44/42-MAPK), p38-MAPK und JNK (Stress-aktivierte Proteinkinase, c-Jun oder SAPK). Für jedes dieser Enzyme gibt es mehrere unterschiedliche Arten an Isoformen (Dhillon et al., 2007; Schaeffer und Weber 1999). Um der physiologischen Bedeutung von ektopisch exprimierten ORs nachzugehen, wurde in der vorliegenden Arbeit die Regulation der p44/42-MAPK und p38-MAPK-Phosphorylierung während einer Stimulation von OR2AT4 in humanen Leukämiezellen untersucht. Bislang ist bekannt, dass Duftstoffe eine Phosphorylierung der p44/42-MAPK einleiten und dadurch die Gentranskription der ektopisch exprimierten ORs fördern (Watt und Storm 2001). Andere Studien zeigten, dass die p38-MAPK nach Stimulation eines ORs mit seinem Liganden phosphoryliert und dadurch die Proliferation in Hautzellen und in Prostatakrebszellen beeinflusst wird (Busse et al., 2014; Neuhaus et al., 2009).

1.4.1 Die p44/42-MAPK Der ERK-Signalweg ist der meist untersuchte MAPK-Signalweg, da bei diesem die terminale p44/42-MAPK (auch: ERK-MAPK) in Tumorgewebe meist fehlreguliert wird (Zhang et al., 2009). Die oftmals übermäßig starke Phosphorylierung der p44/42-MAPK in Krebszellen resultiert häufig in einer Mutation ERK-aktivierender Proteine (Marshall 1994; Hynes und MacDonald 2009; Nagahara et al., 2005) und fördert oftmals die Migration und Ausbreitung der befallenen Zellen (Huang et al., 2004). Dennoch kann eine erhöhte p44/42-MAPK- Phosphorylierung auch tumorhemmende Zellprozesse in Gang setzen. Zum einen kann die p44/42-MAPK Bax-Proteine aktivieren, wodurch die Apoptose in krebsbefallenen Zellen eingeleitet wird (Wang et al., 2009). Zum anderen kann eine p44/42-MAPK-Phosphorylierung in einigen Krebsarten aber auch das Überleben von Zellen fördern und die Resistenzbildung gegen therapeutische Pharmaka erhöhen (Balmanno und Cook 2009). Je nach Art der Zelle und

Kapitel 1 - Einleitung

chemischer Substanz können die eingeleiteten Funktionen der Proteinkinasen variieren. Der klassische p44/42-MAPK-Singalweg geht von der Aktivierung der MAP4K aus (4K: Kinase- Kinase-Kinase-Kinase), welche durch intrazelluläre oder extrazelluläre Stimuli eingeleitet wird. Die MAP4K GTPase aktiviert die MAP3K, welche die nachgeschaltete MAP2K und anschließend die terminale MAPK-phosphoryliert (Dhillon et al., 2007). Neuere Studien zeigen alternative p44/42-MAPK-Signalwegaktivierungen, die durch ansteigendes Calcium in der Zelle ausgelöst werden (Wang et al., 2009). Eine Erhöhung des intrazellulären Calciums in einer Leukämiezelllinie führt zu einer verstärkten p44/42-MAPK-Phosphorylierung. Diese wiederum aktiviert die aufeinanderfolgend nachgeschalteten Enzyme Bax, Cytochrom-C und Caspase-3, welche anschließend die Apoptose der Zellen einleiten und die Hyperproliferation der Zellen unterdrücken.

1.4.2 Die p38-MAPK Neben der erhöhten p44/42-MAPK-Phosphorylierung in Tumoren wird auch die p38-MAPK- Phosphorylierung fehlreguliert und fördert dadurch die Tumorgenese (Wagner und Nebreda 2009; Bradham und McClay 2006). Bisher gezeigt wurde die Rolle der p38-MAPK an der Regulation physiologischer Prozesse wie der Proliferation, der Differenzierung, der Migration und der Apoptose (Wagner und Nebreda 2009; Bradham und McClay 2006). Die eingeleitete p38-MAPK-Phosphorylierung erfolgt durch extrazelluläre Stimuli wie Zellstress durch UV- Licht, chemische Substanzen, Hitze, osmotischem Schock, aber auch durch Cytokine (TNF-a und IL-1) und Wachstumsfaktoren (CSF-1) (Rouse et al., 1994; Han et al., 1994; Freshney et al., 1994). Ähnlich wie bei der p44/42-MAPK-Phosphorylierung löst auch die p38-MAPK- Phosphorylierung, je nach Zelltyp und Art des Stimulus, unterschiedliche nachgeschaltete Prozesse aus (Sweeney et al., 1999; Heidenreich und Kummer 1996). Der am intensivsten analysierte p38-MAPK-Signalweg wird durch exogene Substanzen oder Stressfaktoren eingeleitet, welche die Singalkaskade MLK3, TAK1, ASK1/Rac aktiviert und anschließend die Phosphorylierung der nachgeschalteten MKK3/6 oder MKK4 einleitet. Diese aktiviert im Anschluss die terminale p38-MAPK durch duale Phosphorylierung (Shi und Gaestel 2002). Die verschiedenen Auswirkungen einer erhöhten p38-MAPK-Phosphorylierung wurden in verschiedenen Zellsystemen untersucht. In der myeloischen Leukämiezelllinie K562 konnte gezeigt werden, dass Butyrat die p38-MAPK-Phosphorylierung schon nach kurzer Zeit erhöhte und dadurch die Differenzierung von Erythrozyten stimulierte (Witt et al., 2000). In einer anderen Studie wurde gezeigt, dass die Zugabe von Hemin, Butyrat, ara-C oder Caispalin nicht die p38-MAPK phosphoryliert, sondern eine zeitabhängig alternierende ERK-

Kapitel 1 - Einleitung

Phosphorylierung und Inhibierung veranlasst, welche die erythrozytäre Differenzierung in K562 begünstigt (Woessmann et al., 2004). Diese gegenteiligen Studien zeigen, dass sowohl die genutzten Konzentrationen der Substanzen als auch die Passagen der Zellen einen Einfluss auf die Phosphorylierung verschiedener Kinasen und auf deren physiologischen Effekte haben. An dem ektopisch exprimierten OR52E1 und OR1A2 konnte gezeigt werden, dass eine Stimulation des Rezeptors mit seinem Liganden die p38-MAPK-Phosphorylierung in Leberkarzinom und in Prostatakrebszellen erhöht und somit die Proliferation der Zellen um bis zu 40 % unterdrückt (Maßberg et al., 2014; Neuhaus et al., 2009). Um die Beteiligung von weiteren ektopisch exprimierter ORs an physiologischen Prozessen zu untersuchen, ist es notwendig die Phosphorylierung der MAPKs genauer zu erforschen.

1.6 Exkurs: Leukämie In dieser Arbeit sollte die ektopische Expression von ORs in der Leukämiezelllinie K562 und in Blutzellen akut erkrankter Leukämiepatienten untersucht werden. Die physiologische Funktion eines dieser Chemorezeptoren, des OR2AT4s, wurde anschließend umfassend charakterisiert. In diesem Kapitel wird daher auf die Pathologie der Leukämieerkrankung näher eingegangen. Die Leukämie ist eine Erkrankung des hämatopoetischen und lymphatischen Systems, die man grob in zwei Typen einteilen kann, die lymphatische und die myeloische Leukämie. Klinisch differenziert werden beide Krankheitsbilder durch die Einteilung der weißen Blutkörperchen, wobei undifferenzierte Granulozyten in der myeloischen Leukämie und undifferenzierte Lymphozyten bei der lymphatischen Leukämie eine Rolle spielen. Beide Typen lassen sich wiederrum in akute und chronische Leukämien unterteilen, wobei die akuten Leukämien unbehandelt innerhalb weniger Wochen zum Tode führen. Die akute Leukämie ist eine Stammzellenerkrankung, bei der die Anzahl an undifferenzierten Leukozyten im Blutbild stark erhöht ist und diese Leukozyten funktionsuntüchtig bleiben. Dadurch wird die physiologische Blutbildung gestört und es entsteht eine Anhäufung von unreifen, proliferierenden Blutzellen in der Peripherie. Die chronische Leukämie lässt sich heutzutage besser behandeln und verläuft aufgrund von neuen Tyrosinkinase-Inhibitoren meist über mehrere Jahre beschwerdefrei. In Deutschland gibt es jährlich etwa 1000 Neuerkrankungen, wobei die chronisch myeloische Leukämie hierbei den größten Anteil ausmacht und am weitesten verbreitet ist (Hochhaus A. 2002). Ähnlich wie bei der akuten Leukämie sind auch bei der chronischen Leukämie

Kapitel 1 - Einleitung

Abbildung 1.5: Differenzierungsmöglichkeiten ausgehend von einer myeloischen Stamm- zelle. Myeloische Stammzellen sind in der Lage sich zu Erythrozyten, Thrombozyten und alle Arten der Granulozyten auszudifferenzieren. In der CML wird durch das mutierte Fusions- protein bcr-abl die Proliferation der Zellen in Knochenmark stark erhöht, sodass die Zellen in allen Reifungstufen aus dem Knochenmark ins Blut ausgeschwemmt werden (modifiziert nach: Terese Winslow, 2007). hämatopoetische Stammzellen betroffen und verlieren durch Mutationen ihre Fähigkeit zur Differenzierung in die verschiedenen Linien des hämatopoetischen Systems, der Erythropoese, Thrombopoese und Leukopoese (Abbildung 1.5).

1.6.1 Die chronisch myeloische Leukämie Die chronisch myeloische Leukämie (CML) wurde erstmals 1845 durch Virchow und Bennet beschrieben. Etwa 20 % aller Leukämiepatienten sind von CML betroffen. Diese tritt vorzugsweise im späten Erwachsenenalter auf, wobei Männer 1,4-mal häufiger betroffen sind als Frauen. Der Ursprung der Erkrankung beruht auf einem klonalen Defekt des hämato- poetischen Systems, dessen Entität der chronisch myeloproliferativen Erkrankung zugeschrieben wird (DAMESHEK 1951). CML zeichnet sich durch eine verstärkte Proliferation von myeloischen und promyeloischen Zellen im Knochenmark, mit einer darauf folgenden Ausschwemmung aller Reifungsstufen ins periphere Blut, aus. Pathogenomisch entsteht durch eine reziproke Translokalisation des Onkogens abl von Chromosom 9q34 an die breakpoint-cluster-region (bcr) auf Chromosom 22q11 ein konstitutiv aktives Fusionsprotein mit erhöhter Tyrosinkinaseaktivität, welches 1986 erstmals als bcr-abl Protein nachgewiesen werden konnte (Ben-Neriah et al., 1986; Prakash und Yunis 1984). Dieser chromosomale Defekt wurde 1960 als Philadelphia-Chromosom bezeichnet und ist charakteristisch für nahezu alle an CML erkrankten Patienten (90 %) (Randolph 2005). Als Risikofaktoren für die CML gelten Expositionen mit Gamma- und Röntgenstrahlungen oder ein langjähriger Kontakt mit Chemikalien, wie beispielsweise aromatischen Lösungs- mitteln (Jacobs 1989; Ichimaru et al., 1991). Bei etwa 10 % der CML Patienten tritt keine Translokalisation von abl auf. Diese Gruppe von Patienten werden als Philadelphia-negative CML Patienten bezeichnet.

Kapitel 1 - Einleitung

Der Krankheitsverlauf der CML kann in drei Phasen eingeteilt werden. Die erste Phase ist die chronisch stabile Phase, welche sich über mehrere Jahre erstrecken kann. Da die erste Phase meist unerkannt bleibt, wird diese nur in Routineuntersuchungen in Form einer Leukozytose, teilweise verbunden mit einer Anhäufung an unreifen Myeloblasten im peripheren Blut, diagnostiziert. Klinisch wird die verstärkte Form der Leukozytose auch als Linksverschiebung bezeichnet. In dieser Phase findet man im Knochenmark eine gesteigerte Anzahl an hyper- plastischer Myelopoese (O'Brien et al., 2014). Die zweite Phase ist die sogenannte instabile Akzelerationsphase, in welcher die vermehrt gebildeten Leukozyten die übrigen Blutzellen langsam verdrängen. Diese Phase weist eine gesteigerte Therapieresistenz gegen Tyrosinkinase-Inhibitoren auf, gefolgt von einer weiterhin steigenden Anzahl an Leukozyten und einer verminderten Anzahl an Thrombozyten und Erythrozyten. Die Patienten leiden in dieser Phase meist an einer erhöhten Splenomegalie, Gewichtsverlust und persistierendem Fieber ohne Infektion. In 80 % der Fälle folgt der Akzelerationsphase der terminale Blastenschub, wobei einige CML- Patienten auch plötzlich während des Verlaufs der ersten Phase in diese dritte Phase gelangen. Charakteristisch für den Blastenschub ist eine 30-prozentige Erhöhung der myeloischen und undifferenzierten Blasten und Promyelozyten im peripheren Blut. Ein Teil der Patienten weist zudem auch undifferenzierte lymphatische Blasten auf. Unbehandelt führt die Blastenkriese innerhalb weniger Wochen zum Tod (Hochhaus A. 2002). Die akute myeloische Leukamie (AML) gleicht dem Blastenschub einer CML bei der auch unreife myeloische Blasten, sogenannte Metamyelozyten, aus dem Knochenmark in den Blutkreislauf gelangen. Um die Physiologie der Leukämieerkrankung genauer zu untersuchen wurden aus Patienten Blutzellen isoliert und genetisch so verändert, dass diese Zellen im Labor kultiviert werden können. Einige bekannte Zelllinien, die als Modelsysteme für die Leukämieerkrankung in der heutigen Forschung genutzt werden, sind K562-, CCRF-CEM-, HL-60- oder Jurkat-Zellen. In der vorliegenden Forschungsarbeit wurde die ektopische Expression von ORs und deren physiologische Einbindung an der Leukämiezelllinie K562 demonstriert.

1.6.2 Die CML-Zelllinie K562 In den letzten Jahren hat man verstärkt anhand von CML-Modelsystemen, wie etwa der etablierten Zelllinie K562, nach neuen Ansätzen für therapieresistente CML-Patienten gesucht. Die Zellinie K562 konnte von Lozzio als erste menschliche immortalisierte myeloische Leukämiezellinie aus einem CML-Patienten in der Blastenkriese isoliert werden (Lozzio und Lozzio 1975). Die K562 Zellen bestehen hauptsächlich aus myeloischen Zellen und

Kapitel 1 - Einleitung

differenzieren sich vereinzelnd zu Erythrozyten, Thrombozyten, Monozyten und Granulozyten aus (Lozzio und Lozzio 1975; Klein et al., 1976). Die Zellen weisen das bcr-abl Fusionsprotein auf und sind nicht adhärent. Die üblichen CML-Behandlungsmethoden durch Tyrosinkinase-Inhibitoren wirken für die meisten Patienten nur ein paar Jahre (Palandri et al., 2009). Die zweite Generation der Tyrosinkinase-Inhibitoren, wie beispielsweise Imatinib, kann die chronische Phase länger hinauszögern, doch CML-Zellen entwickeln oftmals eine Resistenz gegenüber den Inhibitoren. Dies schränkt die Behandlungsmöglichkeiten für Patienten in der Akzelerationsphase und der Blastenkriese ein (Gambacorti-Passerini et al., 1997). Zudem entwickeln sich in CML-Zellen auch Resistenzen gegenüber der üblichen Chemotherapie und der Apoptose. Um die Behandlungsmöglichkeiten zu erweitern, ist es notwendig, alternative Signalwege in Model- systemen wie K562 Zellen zu untersuchen, welche die hyperaktive Proliferation inhibieren oder Apoptose und Differenzierung einleiten (Rutherford et al., 1981; Park et al., 2012; Witt et al., 2000). So konnte in einer neueren Studie gezeigt werden, dass Icaritin unabhängig von dem bcr-abl Signalweg die Proliferation erniedrigt, Apoptose induziert und die Hämoglobin- synthese fördert (Zhu et al., 2011). Hierbei wurde die Phosphorylierung von einigen MAPKs wie von p44/42-MAPK, p38-MAPK, STAT3, Jak-2 und Akt erniedrigt. Eine andere Studie konnte hingegen zeigen, dass eine Erhöhung von intrazellularem Calcium durch ein zyklisches Lipopeptid in K562 Zellen die Phosphorylierung der p44/42-MAPK stimuliert und dadurch die Apoptose einleitet (Wang et al., 2009). Andere Arbeitsgruppen beschreiben, wie unterschiedlich die physiologischen Mechanismen und die Signalwege in CML-Zellen sein können und dass diese abhängig von den verwendeten Substanzen sind (Woessmann et al., 2004). So gibt es Studien, die zeigen, dass eine Inhibierung der p44/42-MAPK-Phosphorylierung in K562 Zellen die Proliferation inhibiert (Anafi et al., 1993; Witt et al., 2000; Brózik et al., 2006). Andererseits konnten andere Studien zeigen, dass bei einer verstärken p44/42-MAPK-Phosphorylierung die Erythrozyten-Differenzierung unterstützt wird und Apoptose Mechanismen eingeleitet werden (Wang et al., 2009; Kang et al., 2000; Wang et al., 2000; Li et al., 2005). Die genannten Studien zeigen die Wichtigkeit der Zelllinien um die grundlegenden Mechanismen der myeloischen Leukämieerkrankung genauer untersuchen zu können.

Kapitel 2 - Zielsetzung

Kapitel 2

Zielsetzung

Der Schwerpunkt der vorliegenden Dissertation beruht auf der Untersuchung und Charakterisierung chemosensorischer Rezeptorproteine in Vertebraten. Um die Expression aller bekannten Rezeptoren in mehreren Geweben parallel untersuchen zu können, wurde zunächst die Anwendung der Next-Generation Sequenzierung am Lehrstuhl für Zellphysiologie der Ruhr-Universität Bochum etabliert. Das erste Ziel dieser Arbeit lag darin, mit Hilfe der Next-Generation Sequenzierung alle bekannten GPCRs und Ionenkanäle im TG und DRG der Maus zu beschreiben. Hierbei ging es primär um den Nachweis von bislang im TG und DRG unbekannten Rezeptoren. Um die spezifische Expression im N. trigeminus bestimmen zu können und somit Hinweise auf die physiologische Bedeutung und einer möglichen Beteiligung an der Chemosensorik zu erhalten, sollte die Expression der Rezeptoren systematisch nach ihrer Spezifität im TG sortiert werden. Bekannt ist, dass das TG die Schleimhäute im Mund- und Nasenbereich innerviert und somit öfters an der Detektion flüchtiger oder gelöster chemischer Verbindungen beteiligt ist als das DRG. Daher stellte sich zusätzlich die Frage, ob die Genexpression des TGs sich möglicherweise von der des DRGs unterscheidet. Um die Unterschiede zwischen den beiden homologen Ganglien zu ermitteln, sollte eine differenzielle Next-Generation Sequenzierung (Cuffdiff) durchgeführt werden. Die Expression einiger interessanter Rezeptoren sollte abschließend mit in-situ Hybridisierung validiert werden. Der erste Teil dieser Arbeit warf die Frage nach dem Expressionsmuster der ektopisch exprimierten ORs auf. Daher war es Ziel des zweiten Teils dieser Arbeit, die Expression von ORs in 16 humanen Geweben zu analysieren und miteinander zu vergleichen. Hierbei sollte die Frage geklärt werden, in welchen Geweben ORs vermehrt exprimiert werden und ob einige dieser ORs in mehreren Geweben nachgewiesen werden können, oder ob ektopisch exprimierte ORs eher gewebespezifisch vorkommen. Die Expression einiger ORs sollte anschließend durch RT-PCR Experimente validiert werden. Die physiologische Bedeutung von ektopisch exprimierten ORs ist bis heute weitestgehend ungeklärt. Neben der Expression von ORs in gesundem Gewebe gibt es nach ersten Studien am Lehrstuhl für Zellphysiologie Hinweise auf die ektopische Expression von ORs in Krebszellen.

Kapitel 2 - Zielsetzung

Die Expression und die funktionale Bedeutung dieser Chemorezeptoren in leukämischen Blutzellen sind bislang unbekannt. Daher beschäftigte sich der dritte und abschließende Teil dieser Forschungsarbeit mit der Charakterisierung des ektopisch exprimierten OR2AT4 in der humanen CML-Blutzelllinie K562 und in Blutzellen akut erkrankter AML-Patienten. Bereits bekannt sind die aktivierenden und inhibierenden Duftstoffe des OR2AT4. In diesem Rahmen sollten die molekularen Grundmechanismen der OR-vermittelten Signaltransduktion und die physiologische Bedeutung von Geruchsrezeptoren in myeloischer Leukämie identifiziert werden. Zunächst sollte die Expression des zuvor auf Transkriptebene detektierten ORs mittels RT-PCR, Western Blot und immuncytochemischen Färbungen in K562 und in Leukämiezellen akut erkrankter Patienten belegt werden. Mit Hilfe bildgebender Verfahren, wie dem Calcium-Imaging oder dem cAMP-GloTM Assay, sollten die induzierten Effekte der Agonisten experimentell ermittelt und die beteiligten Signalwege identifiziert werden. Durch Antagonisten-Experimente sollte im Anschluss die Beteiligung des Riechrezeptors an den Liganden-induzierten Effekten nachgewiesen werden. Weitere Auswirkungen der Duftstoffstimulation sollten Aufschluss über die physiologische Einbindung des ORs auf zelluläre Prozesse wie Proliferation, Apoptose und Differenzierung geben. Mit Hilfe der Western Blot-Methode sollte die Signaltransduktion der Proteinkinasen genauer untersucht werden. Diese Arbeit könnte erstmalig die physiologische Funktion des ektopisch exprimierten OR2AT4 in Leukämiezellen zeigen. Zudem könnten durch diese Arbeit weitere Erkenntnisse über grundlegende funktionale Mechanismen der myeloischen Leukämie gewonnen werden. Dabei könnten die Ergebnisse dazu dienen, alternative therapeutische Ansätze zur Behandlung von Imatinib-resistenten Patienten zu erstellen.

Kapitel 3 - Comprehensive RNA-Seq Expression Analysis of Sensory Ganglia with a Focus on Ion Channels and GPCRs in Trigeminal Ganglia

Kapitel 3

Comprehensive RNA-Seq Expression Analysis of Sensory Ganglia with a Focus on Ion Channels and GPCRs in Trigeminal Ganglia

Stavros Manteniotis, Ramona Lehmann, Caroline Flegel, Felix Vogel, Adrian Hofreuter, Benjamin S. P. Schreiner, Janine Altmüller, Christian Becker, Nicole Schöbel, Hanns Hatt, Günter Gisselmann

Published in PLoS ONE Vol. 8(11): e79523 doi:10.1371

Nov. 08, 2013

Comprehensive RNA-Seq Expression Analysis of Sensory Ganglia with a Focus on Ion Channels and GPCRs in Trigeminal Ganglia

Stavros Manteniotis1, Ramona Lehmann1,2, Caroline Flegel1, Felix Vogel1, Adrian Hofreuter1, Benjamin S. P. Schreiner1, Janine Altmüller3, Christian Becker3, Nicole Schöbel1,4, Hanns Hatt1, Günter Gisselmann1*

1 Department of Cell Physiology, Ruhr-University Bochum, Bochum, Germany, 2 Leibniz Research Center for Working Environment and Human Factors, Dortmund, Germany, 3 Cologne Center for Genomics, University of Cologne, Cologne, Germany, 4 Department of Animal Physiology, Ruhr-University Bochum, Bochum, Germany

Abstract

The specific functions of sensory systems depend on the tissue-specific expression of genes that code for molecular sensor proteins that are necessary for stimulus detection and membrane signaling. Using the Next Generation Sequencing technique (RNA-Seq), we analyzed the complete transcriptome of the trigeminal ganglia (TG) and dorsal root ganglia (DRG) of adult mice. Focusing on genes with an expression level higher than 1 FPKM (fragments per kilobase of transcript per million mapped reads), we detected the expression of 12984 genes in the TG and 13195 in the DRG. To analyze the specific gene expression patterns of the peripheral neuronal tissues, we compared their gene expression profiles with that of the liver, brain, olfactory epithelium, and skeletal muscle. The transcriptome data of the TG and DRG were scanned for virtually all known G-protein-coupled receptors (GPCRs) as well as for ion channels. The expression profile was ranked with regard to the level and specificity for the TG. In total, we detected 106 non-olfactory GPCRs and 33 ion channels that had not been previously described as expressed in the TG. To validate the RNA-Seq data, in situ hybridization experiments were performed for several of the newly detected transcripts. To identify differences in expression profiles between the sensory ganglia, the RNA-Seq data of the TG and DRG were compared. Among the differentially expressed genes (> 1 FPKM), 65 and 117 were expressed at least 10-fold higher in the TG and DRG, respectively. Our transcriptome analysis allows a comprehensive overview of all ion channels and G protein-coupled receptors that are expressed in trigeminal ganglia and provides additional approaches for the investigation of trigeminal sensing as well as for the physiological and pathophysiological mechanisms of pain.

Citation: Manteniotis S, Lehmann R, Flegel C, Vogel F, Hofreuter A, et al. (2013) Comprehensive RNA-Seq Expression Analysis of Sensory Ganglia with a Focus on Ion Channels and GPCRs in Trigeminal Ganglia. PLoS ONE 8(11): e79523. doi:10.1371/journal.pone.0079523 Editor: Zhe Zhang, Xuzhou Medical college, China Received August 15, 2013; Accepted October 2, 2013; Published November 8, 2013 Copyright: © 2013 Manteniotis et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This project was founded by the DFG-Sonderforschungsbereich SFB874 “Integration and Representation of Sensory Processes“. Caroline Flegel was funded by the Heinrich und Alma Vogelsang Stiftung. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscripts. Competing interests: The authors have declared that no competing interests exist. * E-mail: [email protected]

Introduction menthol, tingling by sanshools, burning and stinging by acids or pungency by capsaicin and mustard oil [2–5]. The trigeminal Sensory neurons that arise from cell bodies of the trigeminal system and the DRG are known to act as the pain and warning ganglia (TG) and dorsal root ganglia (DRG) are known to system in mammals. detect a large variety of chemical agents and physical stimuli. Previously, several classes of membrane receptors and ion The DRG are located along the vertebral column. A wide range channels that are critical for trigeminal sensory perception and of specialized neurons detect somatosensory stimuli at the pathophysiological pain behavior have been described and periphery and convey them to the central nervous system. The studied on a molecular level. Much attention has been focused TG are the cranial analogs of the DRG and are located at the on transient receptor potential (Trp) and potassium channels base of the skull (in front of the pons), extending sensory fibers that act as sensors of temperature, pain, and chemical stimuli that terminate as free nerve endings in the facial skin and [6–8]. Furthermore, nicotinic acetylcholine receptors (nAChRs) mucosa [1]. By stimulating these neurons, chemical cues can that sense nicotine, and voltage-gated sodium channels induce a variety of different sensations such as the cooling of (VGSCs) important for pain perception and signal transmission,

PLOS ONE | www.plosone.org 1 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

drew considerable attention [9–14]. Today, G protein-coupled trigeminal functions that are highly or specifically expressed in receptors and ion channels represent two of the most important the TG. Furthermore, we were able to identify the expression of targets for pharmacologically active substances [15–17], and GPCRs, some of their major signaling compounds, and ion the expression pattern of these receptors and ion channels channels whose expression in the TG had not been described remains to be fully understood. In a recent gene expression before, and we verified their expression by in situ hybridization. study in mice, it has been shown that an alteration of the A differential transcriptome analysis of the TG and DRG common gene expression levels for ion channels can be linked identified transcripts that were specific for either of these to pathophysiological pain diseases [18]. neuronal tissues. In addition to ion channels, the superfamily of G-protein- coupled receptors (GPCRs) plays a central role in the Results and Discussion modulation of pain transmission [19] and in detecting a large range of chemicals [20]. GPCRs are the largest superfamily of Transcriptome Data cell surface proteins and have seven transmembrane Using the Illumina Genome Analyzer GαIIx, approximately 36 segments as their structural hallmark [21]. These membrane- million and 37 million 36-nucleotide (nt) reads were generated integral receptor proteins can be activated by either exogenous for the TG and DRG by RNA-Seq, respectively. Both tissues ligands, such as odorants and taste substances, or by contain heterogeneous populations of neurons, such as endogenous ligands, such as neurotransmitters, hormones, mechanosensitive, temperature-responding, and nociceptive and inflammatory substances. The receptor family of GPCRs neurons, as well as glial cells. Each sample was a pool of RNA plays a major role in physiological and pathophysiological from 8 male mice (~P28). The sequencing results were processes [22,23], and approximately 40-60% of all current analyzed by the TopHat and Cufflinks software. The reads drugs target receptors of this class [15,24]. Several classes of were mapped onto the mouse reference genome (mm9). From GPCRs that are critical for trigeminal pain and histamine- the sequenced fragments, 80- 86% could be aligned for both independent pruritus have been identified, including P2Y, tissues (Table 1). The expression values were calculated for opioid receptors, and Mas-related receptors [25–27]. There each sample based on the number of fragments per kilobase of remain many orphan GPCRs that may play important roles in exon per million reads mapped (FPKM) [40]. As an several physiological functions [28]. approximation, 1 FPKM corresponds to weak expression, 10 The trigeminal system is involved in a variety of cranial nerve FPKM to moderate expression, and 100 FPKM to high diseases such as trigeminal neuralgia or neuropathic pain expression. As a basis for comparison, we calculated the [29–31]. Common causes of neuropathic pain are diabetic FPKM values for typical housekeeping genes. For example, the neuropathy, nerve compression syndromes, trigeminal strongly expressed β-actin gene yields an expression value neuralgia, stroke, multiple sclerosis, and spinal cord injury between ~100-1000 FPKM, whereas the weakly to moderately [32,33]. Chronic pain remains a major clinical challenge that expressed TATA box binding protein (Tbp) is detected at can significantly diminish the quality of life in affected approximately 3-10 FPKM (Figure S1). For an overview of individuals [34]. FPKM values for the expression of different genes, we To fully understand the mechanisms of chemosensation and calculated a histogram of the FPKM value distribution for the nociception, it is necessary to analyze the transcriptome of the DRG and TG tissues (Figure S2). Our analysis detected the sensory ganglia and to describe comprehensive gene expression of 16034 genes in the TG and 15946 genes in the expression patterns for all ion channels and GPCRs. DRG, with > 0.1 FPKM. However, to exclude the very weakly During the last few years, a dynamic development in expressed genes from our analysis, we set the expression transcriptome analysis by Next Generation Sequencing (RNA- threshold at 1 FPKM, which is a similar threshold to that used Seq), in combination with rapidly dropping costs, led to a in a comparable study [41]. Gene expression at this level can revolutionary extension of available experimental approaches be regarded as reliably detected and is supported by in transcriptome analysis [35–39]. In contrast to previously approximately 30 reads which map per 1 kb mRNA, as shown used tools, such as microarray analysis, RNA-Seq enables in the Integrative Genomic Viewer (IGV) (Figure S3). Excluding higher resolution measurements of expression [39]. RNA-Seq very weakly expressed genes, our analysis revealed the is a paradigm-shifting technology because of its great expression of 12984 genes in the TG and 13195 genes in the sensitivity, highly accurate quantification of expression levels, DRG (> 1 FPKM of all approximately 23000 genes). The high dynamic range, and its potential to analyze transcriptomes expression levels for all investigated approximately 23000 independently of existing genome annotations. genes can be found in the supplementary data (Table S1). To However, no attempts have thus far been made to validate some selected genes, we prepared in situ hybridization systematically describe the mammalian TG and DRG experiments, for which we used the TG-specific gene Pirt as a transcriptome and to characterize their complete ion channel positive control (Figure 1A-D). and GPCR expression patterns. We used RNA-Seq to analyze the murine TG and DRG The Superfamily of G-Protein-Coupled Receptors transcriptome and to compare the expression profiles of the TG In the next step, we analyzed the expression patterns for all and DRG. Ion channels and GPCRs were ranked according to known non-olfactory GPCRs in mice. A list of 458 GPCRs was their expression level and tissue specificity. We primarily established based on several comprehensive studies of murine detected all important receptors and ion channels with known GPCRs [42–46] (Table S2). Because of the many GPCR

PLOS ONE | www.plosone.org 2 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

Figure 1. Representative in situ. hybridization slices from adult mice. A Schematic overview for the preparation of the mouse head slices (14 µm). The nose and the mandible were removed before the slices were prepared (blue line). The black arrow indicates the cutting direction, while the red line indicates the intersecting plane that was used. B In situ hybridization for Pirt mRNA (25-fold). C 100-fold. D 200-fold magnification of the TG segment. Single cells are strongly stained. Scale bar B: 560 µm, C: 140 µm D: 75 µm. doi: 10.1371/journal.pone.0079523.g001

Table 1. Sequencing details of the TG and DRG RNA-Seq G Protein-Coupled Receptors are Expressed at High experiments. Levels in Trigeminal Ganglia Within the 202 GPCRs that were detected in TG (> 1 FPKM), 106 GPCRs had not been previously described as expressed Reads with at in the TG, whereas 96 of them were mentioned previously Base Pair Total least one (Table S2). Taking weakly expressed receptors into account ( Sequence Prepared reported Reads Failing < 1 FPKM), additional 114 GPCRs were detected in the TG, Sample Fragments Reads alignment (%) Alignment (%) of which 31 were reported previously (Table S2). However, Trigeminal 31716353 5090879 because of this large number of expressed GPCRs, we 36 nt 36807232 Ganglia (86.2%) (13.8%) focused on the 30 most highly expressed GPCRs (Figure 3, Dorsal Root 30227460 7288174 Ref. [47–61]). 36 nt 37515634 Ganglia (80.6%) (19.4%) Among the most highly expressed 30 GPCR genes in the doi: 10.1371/journal.pone.0079523.t001 TG, we detected GPCRs that are known to play a role in nociception, migraine, vasoconstriction, and inflammation. The most highly expressed GPCRs were GABA(B) receptors, genes, we investigated the subfamily of olfactory receptors endothelin B like Gpr37l1, prostaglandin receptors, and Mas- (OR) separately. related receptors (Figure 3). Among the 30 most highly In total, the expression of 202 and 204 non-olfactory GPCRs expressed GPCRs, we identified 14 whose trigeminal in the TG and DRG, respectively, could be detected with an expression has not been previously described. In total, we FPKM that was higher than 1 (Figure 2A). Non-neuronal and newly detected the expression of 107 GPCRs in the TG (Table non-sensory tissues (liver, muscle) had a significantly lower S2) and additionally list all common GPCR signal transduction level of GPCR expression than the neuronal tissues (brain, proteins (Figure S4). The ligands for several of the most highly olfactory epithelium (OE), TG and DRG). The same result can expressed GPCRs have not yet been identified. Next, we be seen when all FPKM values for the GPCRs > 1 FPKM for describe the most prominent of the newly detected GPCRs in TG. each tissue were summarized (sFPKM) (Figure 2B). We Darc. The duffy antigen/chemokine receptor (Darc) is one of analyzed the expression of the distinct GPCR subfamilies in the most highly expressed GPCRs in the TG. The expression different tissues (Figure 2C). Members of the rhodopsin-delta of Darc was previously shown for the DRG, basal ganglia, and adhesion groups show higher expression levels in the TG thalamus, and other cortex regions but never for the TG [62]. and DRG than in the other tissues. Rhodopsin, adhesion, and Darc plays an important role in acute inflammation, infection, glutamate subfamilies are commonly highly expressed in and tumor malignancy [48]. We verified the expression of this neuronal tissues. receptor in the TG by in situ hybridization and found this The expression patterns for the different GPCR classes in receptor to be strongly expressed at the outermost regions of the DRG and TG are highly similar (Figure 2D). Furthermore, the TG (Figure 4). In the center of the TG, the expression nearly 50% of all non-olfactory GPCRs were found to be pattern for Darc was punctate (Figure 4). Paqr/Adipor. In the TG, six members of the progestin and expressed in the TG and DRG and are mostly rhodopsin-alpha adipor receptor families (Adipor1-2, Paqr4, 7, 8, 9) are highly and rhodopsin-delta family members. expressed; furthermore, several newly detected members of this receptor family show FPKM values of 6-40 (Table S2),

PLOS ONE | www.plosone.org 3 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

Figure 2. Expression pattern analysis of all detected GPCRs. A The bar diagram shows the number of detected GPCRs that had FPKM values higher than 1 for the liver (L), skeletal muscle (SM), olfactory epithelium (OE), dorsal root ganglia (DRG), brain (B), and trigeminal ganglia (TG). Black bars: expressed GPCRs, gray bars: not expressed GPCRs. The lowest number of GPCRs was detected in liver (72) and skeletal muscle (89). The highest count was detected in the TG (197), OE (163), DRG (191), and brain (193). B To investigate not only the number of expressed GPCRs but also the general cumulative expression level for each tissue sample, we summarized all FPKM values (sFPKM). The brain (5079 sFPKM), TG (2808 sFPKM) and DRG (2871 sFPKM) had the highest presence of GPCRs. The skeletal muscle had the lowest amount of sFPKM (845), which was followed by the liver (933 sFPKM). C The bar diagram shows the expression pattern for all different GPCR subfamilies (secretin (Sec), adhesion (Adh), glutamate (Glut), frizzle and taste (Fzd/Taste), rhodopsin-alpha to -delta (Rho A-D), and not yet classified GPCRs (others). The rhodopsin-delta subfamily (shown without ORs) is expressed at a higher level in the DRG and TG compared with all other tissues. D The comparison of the distribution of GPCR subfamilies between the DRG and TG. Most members belong to the rhodopsin-alpha and rhodopsin-delta subfamiles. doi: 10.1371/journal.pone.0079523.g002

PLOS ONE | www.plosone.org 4 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

Figure 3. The 30 most highly expressed GPCRs in trigeminal. ganglia. GPCRs are listed depending on their expression level in the TG and DRG in comparison with the brain (B), liver (L), olfactory epithelium (OE), and skeletal muscle (SM). The FPKM value, which is an indicator of the expression strength, is represented by the color intensity. Exp describes whether the expression in the TG was previously known (+) or unknown (-). To the best of our knowledge, among the 30 most highly expressed genes, 14 GPCRs have not been previously described as expressed in the TG. Most of the detected GPCRs have unknown functions. doi: 10.1371/journal.pone.0079523.g003 which demonstrate that all members of the Paqr family are (Figure 3) but also that S1pr1, -2, and -5 are expressed (Table expressed in nociceptive tissues, such as the TG and DRG. In S2). This class of genes mediates vasodilatation, coordinates mammals, the Paqr-family consists of Class I (Adipor1-2, angiogenesis with other lysophospholipid receptors, and is Paqr3) and Class II (Paqr4-9). Class I responds to adiponectin, known to be involved in developmental processes [56]. whereas the ligand for the Class II receptors is progesterone Lgr4. The leucine-rich repeat that contains GPCR is [63–65]. We validated the expression of Paqr6 by in situ involved in a variety of physiological functions, such as hybridization (Figure 4) and found that Paqr6 is strongly embryonic growth, cell development [68], or in physiological expressed in all parts of the TG, which correlates well with the dysfunctions such as in cancer development [69]. Its detected FPKM of approximately 23. The physiological function expression has never been described in the TG and its function of the receptors in the TG is unclear; however, progesterone is unknown. has shown anti-nociceptive effects in the trigeminal nerve root Orphan GPCRs. Based on their specific expression pattern in a rat LPA-pain model [66]. in sensory neurons, some of the most highly expressed orphan S1pr. Furthermore, we could identify the expression of GPCRs may serve as chemoreceptors. For example, we sphingosine1-phosphate receptors (S1pr) in the TG. Meng and detected high expression levels of Gpr158, Gprc5b, and colleagues previously showed that S1pr5 is expressed in the Gprc5c in the TG. These three evolutionarily connected TG of embryonic mice [67]. However, our study not only receptors belong to the GPCR family C and share a high revealed that S1pr3 is the predominant member in the adult TG sequence similarity with GABA(B) receptors, glutamate

PLOS ONE | www.plosone.org 5 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

Figure 4. In situ hybridization experiments in the mouse TG. A Mrgprd (Mas-related Receptor D) B Mrgpre (Mas-Related Receptor E), C Mrgprx1 (Mas-Related Receptor X1) D Cnr (Cannabinoid Receptor 1) E Gpr35 (G-Protein Coupled Receptor 35) F Gpr126 (G-Protein Coupled Receptor 126) G Gpr155 (G-Protein Coupled Receptor 155) H Gpr158 (G-Protein Coupled Receptor 158) I Darc (Duffy/Antigen/Chemokine Receptor) J: Fzd3 (Frizzled 3) K Paqr (Progestin and AdipoQ Receptors) L Tac3 (Tachykainin 3) M Oprmd (mu-Opioid Receptor) N Tbx2 (Thromboxane A2 Receptor) O Drd3 (Dopamin Receptor D3) P O3far1 (Omega 3 Fatty Acid Receptor) Q Olfr78 (Olfactory Receptor 78/PSGR) R Olfr420 (Olfactory Receptor 420) S Olfr1417 (Olfactory Receptor 1417) T Ntrs2 (Neurotensin Receptor 2) (Scale for A, C-T 200 µm, B 100 µm). doi: 10.1371/journal.pone.0079523.g004 receptors, and different taste-1 receptors [70,71]. Gpr158 and binding sweet-tasting substances, such as cyclamate, or Gprc5b/c both have a conserved region (pfam00003) that is inhibitors, such as lactisole. No specific ligands have been also found in sweet-taste receptors, which is important for previously described for these receptors. We revealed the

PLOS ONE | www.plosone.org 6 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

Figure 5. The most TG-specific GPCRs. GPCR genes are ranked according to their specific expression in the TG, which is calculated by the quotient of the FPKM values of TG and the mean FPKM values of brain (B), liver (L), olfactory epithelium (OE), and skeletal muscle (SM). Members of the Mrgprs are the most specific GPCRs that have been detected in the TG and DRG. Among the 30 most specific GPCRs, seven newly detected GPCRs in the TG were identified. Twelve of the most specifically detected GPCRs are still orphans and, based on their specific expression patterns in the TG and DRG, may be important for tissue- specific functions. doi: 10.1371/journal.pone.0079523.g005 expression of Gpr158 in the TG by in situ hybridization [55,26,72,60,73–76,59,77–80,59,81–83]). Many of the top 30 experiments (Figure 4). Furthermore, highly expressed orphan candidates that were thereby identified are involved in GPCRs (Gpr155, Gpr126, Gpr137, Gpr137b or Gpr149) could nociception, migraine, pruritus, inflammation, vasodilatation, be detected in our RNA-Seq study. Based on their specific and vasoconstriction. expression patterns in the DRG and TG, these orphan GPCRs Mrgpr. The most specific and predominantly expressed may be involved in specific functions of the trigeminal sensory GPCRs in the TG and DRG belong to the gene family of Mas- related receptors (Mrgpr) [84–86]. The Mrgpr gene family system (Table S2). Some of these orphan GPCRs were encompasses 20 members, most of which are exclusively investigated by in situ hybridization experiments (Figure 4). expressed in the TG and DRG (Figure S5). Eleven of them belong to the 30 most specific GPCRs for the TG. Mrgpre, G Protein-Coupled Receptors that are Specifically Mrgprf, and Mrgprh are also expressed in other tissues (Figure Expressed in Trigeminal Ganglia S5). The family of Mrgpr is a relatively newly investigated class To identify the most specific GPCRs for the TG, we of receptors of which only three members have been calculated a list of genes that are expressed at a higher level in deorphanized. Mrgprd is involved in β-alanine-mediated pain the TG relative to the mean expression in brain, liver, OE, and transmission [55] and influences the perception of mechanical skeletal muscle (Figure 5, Ref. and thermal stimuli [87]. Mrgprx1 and -a3 are receptors for

PLOS ONE | www.plosone.org 7 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

chloroquine and BAM8-22, which induce histamine- involved in the development of neuropathic pain [97]. The independent pruritus [26]. Furthermore, the function for physiological function of Cysltr2 is unknown; however, Cysltr2 Mrgprb4 was recently shown to be involved in sensing touch or may be involved in cancer progression in other tissues [98]. the massage-like stroking of hair [88]. Although the expression Other GPCRs: Other newly detected TG-specific GPCRs of Mrgprs has already been described in several studies, our were as follows: Gpr149, Gpr139 and Gpr35. Gpr35 is a analysis currently provides the most comprehensive overview recently deorphanized receptor that is activated by agonists for the TG and DRG expression profiles in comparison with such as kuynurenic acid or gallic acid [99,100]. Gpr35 various other tissues. Judging by the specific expression of this activation causes analgesia in the DRG [100]. Regarding the gene family, our data show that Mrgprs are as specific to the recently identified ligands, it seems possible that Gpr35 serves TG and DRG as ORs are to the OE, or pheromone receptors as a nociceptor in the TG or as a chemoreceptor. The are to the vomeronasal organ (Figure S5). Because of their expression of Gpr35 was validated by in situ hybridization in specific expression pattern, the Mrgpr family may be the most the mouse TG, where we show an expression pattern that is important class of chemo- or somatosensory GPCRs in the TG primarily located at the margin of the TG tissue (Figure 4). and DRG. The expression of Mrgprd and Mrgpre was validated by in situ hybridization (Figure 4). Other G Protein-Coupled Receptors that are expressed Other well-known TG-specific GPCRs were members of 5- in Trigeminal Ganglia hydroxytryptamine receptors (Htr), the mu-opioid receptor In addition to the 21 new receptors in the top 30 groups (Oprm1), glutamate receptor 8 (Grm8), the prostacyclin (Figure 3-4), we detected another 79 GPCRs (> 1 FPKM) receptor (Ptgir), and prokineticin receptor 1 (Prokr1). Prokr1, whose trigeminal expression was not known (Table S2). We which is one of the most specifically expressed GPCRs in the surveyed the expression of some of these GPCRs by in situ TG is involved in nociception similar to Trpv1. Negri and hybridization in TG tissue. Here, we will briefly describe the colleagues showed an impairment of nociception and most interesting newly detected GPCRs as well as some well- inflammatory pain sensation in mice that lacked Prokr1 [74]. characterized GPCRs, which were not among the 30 most Among the 30 GPCRs that are most specifically expressed in specific or highest expressed GPCRs. the TG, we identified 7 new candidate transcripts that have not Tac3. The neuromedin-K receptor (Tac3/Nk3) is expressed been previously described. in the spinal dorsal horn, the spinal trigeminal nucleus, and Ghrhr. One of the newly found candidates that is specifically several brain regions [101]. Its expression in the TG has never expressed in the TG but not the DRG is the growth hormone- been reported. Tac1 and Tac3 are suggested to be involved in releasing receptor (Ghrhr) (Figure 5). This receptor is formalin and capsaicin-caused nociception [102,103]. In situ expressed in the pituitary gland, and its activation leads to the hybridization experiments reveal a clear and specific synthesis of growth hormones. Ghrhr is associated with the growth disease Dwarfism of Sindh [72]. expression of Tac3 in several cells of the TG (Figure 4). Hcrtr2. Another interesting candidate transcript is that of the Tbxa2r. The thromboxane receptor 2A (Tbxa2r) is a GPCR orexin receptor 2 (Hcrtr2/Ox2). Orexin receptors are that we found to be specifically expressed in the TG, which we responsible for sleeping disorders, such as narcolepsy, and could also detect by in situ hybridization (Figure 4). The can induce sedative effects [89]. In addition to this function, expression of Tbxa2r seems to be higher in a subset of anti-nociceptive effects were reported for Htcr1, but fewer or trigeminal cells (Figure 4). Tbxa2r is involved in cancer none were reported for Hcrtr2 [81]. The pathophysiological development, anti-platelet aggregation, and vasoconstriction involvement of Hcrtr2 in pain remains to be investigated. The [104–107]. Additionally, Tbxa2r has been suggested to be expression of this receptor in the DRG was recently shown involved in migraine development (US Patent No: 4.839.384), [90]. and new blockers of this receptor may be useful for migraine Htr. Several 5-hydroxytryptamine receptors (Htr) are, among treatment. others, the most specific receptors that are expressed in the Lgr5. Recent studies have shown that the impairment of TG (Figure 5). We detected the expression of Htr1a, Htr1b, Lgr5 is highly up-regulated in various types of cancer cells Htr1d, Htr1f, Htr2a, Htr4, Htr5a, Htr5b, and Htr7 (> 1 FPKM). [108,109]. One study describes how the Lgr5-associated The presence of Htr1a, Htr1b, Htr1d, Htr1f [91,92] Htr2a, and substance fexofenadine induces the relief of symptoms of Htr7 [93,94] mRNA in the human TG was detected by PCR. To seasonal allergic rhinitis, including nasal congestion. However, the best of our knowledge, we could not find any previous these mechanisms remain unclear [110]. reports regarding the expression of Htr4 and Htr5b in the TG, Cnr. For the cannabinoid receptor 1 (Cnr1), we detected an which were weakly expressed with an FPKM of 1-3 (Figure FPKM value of 12 in the TG. The expression of Cnr1 in S6). When comparing both types of sensory ganglia, Htr1d medium and large diameter neurons of the TG is well-known expression is 2-fold higher in the TG (~19 FPKM) than in the [111]. Nevertheless, we confirmed the expression of Cnr1 by in DRG (~9 FPKM). The expression of serotonin receptors in the situ hybridization experiments (Figure 4). Cnr1 regulates the TG, cerebral blood vessels, and meningeal tissues is of major pre-synaptic inhibition of neurotransmission by reducing the interest to understanding the pathophysiology of migraines GABA release by GABAergic axons [112]. Cnr1 is coupled to [95,96]. specific types of potassium channels, mobilizes Htr3 receptors, Cysltr2. The expression of the cysteinyl leukotriene and is negatively coupled to L-type voltage-gated calcium receptors 1 and 2 was shown in the spinal cord in rat. Cysltr1 is channels (VGCCs) [113–115]. Several previous studies

PLOS ONE | www.plosone.org 8 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

demonstrate the importance of Cnr1 in neuronal anti- mGluRs. This high cumulative value argues for the possible inflammatory and nociceptive processes [116,117]. functional involvement of the ORs in trigeminal Hrh. Histamine receptors (Hrhs) are involved in the chemosensation. The low FPKM values of individual ectopically perception of pain and in histamine-dependent pruritus expressed ORs may result from a mosaic gene expression [118,119]. Hrhs were detected in the TG by several previous pattern, which was also suggested in other studies [129] and studies, although with different expression patterns [120,121]. was shown for TAARs [131]. It is conceivable that not all TG In our RNA-Seq analysis, we found that only Hrh3 is expressed neurons express ORs and that these receptors might be at an FPKM value that is higher than 1 (~3 FPKM), which fits located only in a few trigeminal neurons, as was shown for well with the expression analysis of Hrh3 in rat embryonic Olfr1417 (Figure 4). It is also conceivable that a single TG tissues from Hèron and colleagues in 2001 (Table S2) [119]. neuron expresses many different ORs similar to the expression Hrh1 mRNA in the TG was reported by Kashiba and Senba in patterns that were shown for bitter taste receptors [132]. The in 2001 [120] and was found to be weakly expressed in our study situ hybridization staining patterns for 2 ORs (Olfr78 and (0.9 FPKM). Olfr420) argue for the expression of these receptors in a larger Other GPCRs. Most of the newly identified GPCRs that are number of neurons (Figure 4). Probably all odorants are able to expressed in the TG are orphan receptors, and some of them stimulate the TG [133], whereas ORs that are in the TG may seem to be specific for the TG and DRG, such as Gpr126 and support the trigeminal chemosensation of odorants in the nasal Gpr149. The expression of Gpr126 was verified by in situ mucosa. A detailed table containing the total amount of ORs hybridization (Figure 4). We confirmed a few weakly expressed that are expressed in the TG and DRG can be found in the genes (0.1- 1 FPKM) with in situ hybridization experiments to supplementary data (Figure S7). show that RNA-Seq is able to detect weakly expressed genes such as the dopamine D3 (Drd3) and the fatty-acid receptor Ion Channels that are Expressed in Trigeminal Ganglia omega-3 (O3far). However, due to their low expression in the Ion channels play an important role in the trigeminal TG and DRG, it is unclear whether these receptors play any perception of chemical and physical stimuli [134,9,6,135]. We important physiological role in these tissues. assembled a table of 227 ion channels (potassium channels were analyzed separately) and analyzed their expression in the Olfactory Receptors TG (Table S3). In total, 136 ion channels were detected (> 1 In 1991, Buck and Axel discovered ORs that form the largest FPKM). Of these ion channels, 103 have already been superfamily of GPCRs [122]. ORs are primarily expressed in described in previous studies, whereas the trigeminal the OE but also in non-olfactory tissues, such as the testes, expression of 33 ion channels was first detected in the present spermatozoa, prostate, and many other tissues [123–129]. In study. In the class of weakly expressed genes (0.1- 1 FPKM), non-olfactory tissues, these receptors are involved in the 24 were known and 27 were new (Table S3). proliferation of cancer cells [130] and in the swimming behavior of spermatozoa [127]. In general, ectopically expressed ORs Highest Expressed Ion Channels in Trigeminal Ganglia are less represented and less strongly expressed than in the We listed the 30 most highly expressed ion channels for the OE [129]. Therefore, we included in our analysis ORs with TG and found 7 new transcripts among these ion channels lower expression levels (> 0.1 FPKM). Of 1125 OR genes, we (Figure 7, Ref. [136–138,136,139–158,155,159,160]). could detect the expression of 98 ORs in the TG and 33 ORs in Ano. One of the most recently detected families of ion the DRG with low abundances (0.1-1 FPKM) (Figure S6). In channels in the TG is the anoctamin family of proteins (Ano) almost all cases, the expression of ORs was lower than 1 that are calcium-activated chloride channels with eight FPKM. In the TG, we found few moderately expressed ORs, transmembrane domains [161]. Ano1 (Tmem16a) and Ano2 such as Olfr920 and Olfr420 with an FPKM higher than 1, that (Tmem16b) are expressed in sensory and respiratory tissues of are both expressed exclusively in the TG and OE. We verified the nose, trigeminal ganglia, septal organ, vomeronasal organ, the expression of 3 ORs with FPKM levels of 0.1-1 by in situ and Grueneberg ganglion [162]. Ano1 and Ano2 contribute to hybridization (Figure 4). The expression of Olfr78, which is a secretory processes and sensory signal transduction weakly expressed OR (0.2 FPKM) that is also known as PSGR, [163–166]. In a recent study, the expression of Ano1, Ano3, was validated by our analysis. The human orthologous gene of Ano4, Ano6, Ano8, and Ano10 was be shown in the TG, some Olfr78 (PSGR) is a well-known ectopically expressed receptor of which may have a role in signal amplification in TG neurons and evokes calcium responses in the prostate cancer cell line [167]. We validated the expression of the most dominantly LNCaP and primary prostate epithelium cells that are mediated expressed Ano3 (52 FPKM) in the TG by in situ hybridization by steroid hormones (androstenone derivatives). The activation (Figure 8). of PSGR inhibits the proliferation of these cancer cells [130]. Scn. The expression of various voltage-gated sodium

Finally, we compared the cumulated FPKM values for all channel α-subunits (VGSC/Scn/Nav) in the TG was already ORs to investigate not only the number of expressed ORs but shown in recent studies. The best-characterized channels in also the general cumulative expression level and their peripheral neurons are Scn9a (Nav1.7), Scn10a (Nav1.8), and presence in TG compared with well-known receptors and Scn11a (Nav1.9), which play a role in orofacial pain, trigeminal channels (Figure 6). Regarding those cumulative values, the neuropathic pain, and toothache [168–171]. Scn9a is localized presence of ORs (24 sFPKM) is comparable to the cumulative in the axons [172]. A mutation of Scn9a in the OE causes a expression of Cnrs (28 sFPKM), P2Y (38 sFPKM), and painful insensitivity or even anosmia [173,174,150,175].

PLOS ONE | www.plosone.org 9 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

Figure 6. Comparison of cumulative FPKM values (sFPKM). sFPKM values for some prominent ion channels and GPCRs where compared to the sFPKM values of the ORs. The expression of potassium channels is most pronounced in the TG (sFPKM 1551) and DRG (sFPKM 1230), followed by the VGSCs (TG: 963 sFPKM, DRG: 695 sFPKM). Mrgprs, iGlut, P2X, and GABA(A) are expressed at a similar level. Nevertheless, the cumulated FPKM of ORs (TG: 24 sFPKM, DRG: 10 sFPKM) can be compared with the cumulated FPKM of Cnr (TG: 22 sFPKM, DRG: 10 sFPKM), mGlut (TG: 41 sFPKM, DRG: 29 sFPKM), and P2y (TG: 38 sFPKM, DRG: 51 sFPKM). Mrgprs are expressed almost 3-fold higher in the DRG (197 sFPKM) than in the TG (76 sFPKM). doi: 10.1371/journal.pone.0079523.g006

Odorants such as thymol or menthol are able to block VGSC intracellularly expressed channel that releases calcium from currents as effectively as the local anesthetic lidocaine and intracellular stores. A dysfunction of this gene in muscle leads thereby prevent nociception [176]. VGSCs are mainly thought to recessive osteogenesis [158]. to be important in synaptic signaling and in the initiation and Clic. Chloride intracellular channels (Clics) has been shown propagation of action potentials in neurons [177,178]. In to be involved in a variety of chloride ion transports within addition to the previously described VGSCs, we detected different types of cellular compartments. Berryman and SCN1a (Nav1.1) to be highly and specifically expressed in the Bretscher suggest a central role for Clic1, Clic4, and Clic5 in TG and DRG (Figure S8). Scn1a can enhance persistent cellular chloride transport [183]. The function of the protein inward sodium currents, and recent studies indicate that a Clic6, which is a novel member of this ion channel class mutation in this gene might play a role in migraine development remains elusive [184]. In TG, all members of the Clic channel and in epilepsy [179,180]. We verified the expression of Scn1a family could be identified, whereas Clic1 is the most highly and Scn9a by in situ hybridization (Figure 8). expressed subunit (Table S3). Chloride homeostasis plays a GlyR. The glycine beta subunit (GlyRb) is highly expressed crucial role in several functions, which include signal in the TG (Figure S9). The presence of GlyRs in neurons of the transduction, control of the membrane potential, and the TG is not yet known. Glycine is the most prominent inhibitory involvement of various secretory and absorptive cellular mediator in the whole PNS, and both GABA and glycine are the processes [185]. two best-established inhibitory transmitters. Normally, GlyRb is Piezo2. Fam38B (Piezo2) is a mechanically activated cation part of a heteromultimeric complex with GlyR alpha subunits; channel. Coste and colleagues showed the expression of however, the corresponding alpha subunits are virtually absent in the TG ( Piezo2 in the DRG and suggested its involvement in < 1 FPKM, Table S3). Potential partners of GlyRs are the mechanically induced sensations such as pain and touch GABA(A) receptor subunits (Gabra1/2; Gabrg2), which are [142,186]. We detected Piezo1 (Table S3) and Piezo2 (Figure highly expressed in the TG (Figure 7 and Figure S9) [167]; 7) in the TG where its physiological role might be the same as however, the existence of such a heteromeric receptor in vivo in the DRG. is elusive. GlyRs can modulate chronic and neuropathic pain Cacng. Voltage-gated calcium channels (VGCCs) are [181], and a potentiation of GlyRs that are expressed in the calcium permeable ion channels that are expressed in spinal cord contributes to the analgesic effects of cannabinoids excitatory cells of muscles and the nervous system. Some [182]. The RNA-Seq detection of GlyRb was confirmed in our members of the voltage-gated calcium channel γ-subunits study by in situ hybridization (Figure 8). (Cacng) act as AMPA-receptor regulators in the brain [187]. Tmem38b. The trimeric intracellular cation channel B is However, the physiological function of Cacng7 in the TG needs highly expressed in the TG. This gene codes for an to be investigated, and according to previous made studies, the

PLOS ONE | www.plosone.org 10 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

Figure 7. Ranking of the most highly expressed ion channels in the TG. We investigated the expression in the brain (B), liver (L), olfactory epithelium (OE), skeletal muscle (SM), DRG, and TG. Seven of the 30 most highly expressed ion channels have never been described as expressed in sensory ganglia in previous studies (marked with (-)). Many of the most highly expressed ion channels in the TG and DRG are involved in the sensation of pain. doi: 10.1371/journal.pone.0079523.g007 participation of VGCCs in pain processing is possible Hcn, and GABA(A), also belong to the most specific 30 of the [188–190]. trigeminally expressed ion channels. The most specific ion channels for the TG have been thoroughly investigated, which Ion Channels that are Specifically Expressed in the the exception of the four channels Trpc6, Piezo2, GlyRb, and Trigeminal Ganglia Scn1a, which have not previously been detected in the TG. To identify the most specific ion channels for the TG, we iGluR. There are three classes of iGluRs: the α-amino-5- calculated a list of genes that are expressed at a higher level in methyl-3-hydroxy-4-isoxazole propionic acid (AMPA) receptors the TG relative to the mean expression levels found in the (Gria/Grid), N-methyl-D-aspartate (NMDA) receptors (Grin), brain, liver, OE, and skeletal muscle (Figure 9, Ref. and kainite receptors (Grik). iGluRs are expressed in the cell [138,151,144,8,191,192,139,193,194,152,195,155,142,195,155 membranes of neurons and are highly concentrated in ,159,152,196–198,157,153,199–204]). Many of the highly postsynaptic regions [205]. These channels are involved in expressed ion channel types (Figure 7 and Table S3), such as signal transduction between neurons, learning, and in a range VGSCs, ionotropic glutamate receptors (iGluRs), of neurological dysfunctions [206,207]. iGluRs that are purinoreceptors (P2Xs), 5-hydroxytryptamine receptors (Htr3s), localized in the TG play a fundamental role in processing

PLOS ONE | www.plosone.org 11 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

Figure 8. In situ hybridization for some ion channel in mouse TG. A Trpv1 (Transient Receptor Potential Channel 1) B Trpm7 (Transient Receptor Potential Channel M7) C Trpm8 (Transient Receptor Potential Channel M8) D Trpc6 (Transient Receptor Potential Channel C6) E Scn1a (Voltage-Gated Sodium Channel 1A) F Scn9a (Voltage-Gated Sodium Channel 9A) G GlyRb (Glycine Receptor Beta) H Ano3 (Anoctamin 3) I Kcnk3 (Potassium Channel K3) J Kcnk9 (Potassium Channel K9) K Kcnk18 (Potassium Channel 18) L Kcna4 (Potassium Channel A4) M Grik2 (Glutamate Receptor, Ionotropic, Kainate 2) N Pgr (Progesterone Receptor) O Pirt (Phosphoinositide-Interacting Regulator of TRP) P Tlr1 (Toll-Like Receptor 1) Q Grik2 (Glutamate Receptor, Ionotropic, Kainate 2) R Ano3 (Anoctamin 3) S Trpm7 (Transient Receptor Potential Channel M7). Weak signals are marked by arrows. Scale for A-P 250 µm, Q-S 75 µm. doi: 10.1371/journal.pone.0079523.g008

PLOS ONE | www.plosone.org 12 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

Figure 9. Ranking of TG- and DRG-specific ion channels. We compared the expression levels of the most specific ion channels of the TG and DRG with those in the brain (B), liver (L), olfactory epithelium (OE), and skeletal muscle (SM). Four previously unreported ion channels could be identified among the 30 most specific ion channels in the TG (marked with (-)). Most ion channels are involved in TG thermosensation, mechanosensation and pain perception. doi: 10.1371/journal.pone.0079523.g009 orofacial pain [208]. The expression pattern of these receptors well with the existing immunohistochemical data [212]. P2X- in the DRG and TG was widely similar (Figure S9). In receptors are involved in a wide range of pathophysiological invertebrates, receptors belonging to the iGluR class respond pain mechanics, such as migraine-induced, inflammatory, to several odorants. Furthermore, Benton and colleagues neuropathic, or acute pain [216,217]. Spehr and colleagues suggest that iGluRs represent a novel class of chemosensory showed that an alteration of the expression of P2X-receptors in receptors [209]. rat cultured dissociated trigeminal neurons defines their P2X. P2X-receptors are ATP-gated cation-permeable ion chemosensory properties [218]. Odors with an aromatic ring channels. Seven members (P2X1-7) have been functionally structure specifically modulate P2X-receptors in a characterized previously [210,211]. In the TG, the expression concentration-dependent manner. Spehr and colleagues of P2X2-7 is well-described [212–215]. Our RNA-Seq results suggest that this odor-induced activation of trigeminal neurons show the same expression pattern. Additionally, in our could be one of the first steps that contribute to odorant experiments, P2X1 is expressed at low levels (~0.1 FPKM) that perception by the trigeminal sensory system [218]. are consistent with the low expression of P2X1 in rat TG that Htr3. Both alpha and beta subunits of inotropic 5- was found by Kuroda et al. in 2012 by qPCR [214]. The hydroxytryptamine receptors (Htr3a/b) are strongly expressed predominant and specific expression of P2X3 in the sensory in the TG, as demonstrated by in situ hybridization [219] and by ganglia that was revealed by our RNA-Seq data (Figure S9) fits our RNA-Seq data (Figure 7 and Table S3). The most

PLOS ONE | www.plosone.org 13 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

important role of Htr3 in the PNS is the regulation of pain and and Trpa1 are among the 30 most specifically expressed ion hyperalgesia that is caused by tissue injury or inflammation channels in the TG (Figure 9). In total, our RNA-Seq detected [220]. The inhibition of Htr3-evoked currents in cultured 16 Trp channels expressed in the TG (Figure S10), which trigeminal neurons through synthetic derivates of cannabinoids mostly overlap with the most recent RT-PCR study [245], is discussed as a possible new method of peripheral analgesia where 17 of the 28 Trp channels were detected and were [221]. primarily consistent with our RNA-Seq analysis. Differing from GABA(A). In 2006, Hayasaki and coworkers investigated the study of Vandewauw, we detected Trpc2 (1 FPKM), Trpc6 the expression of ionotropic γ- aminobutyric acid receptors (2 FPKM), and Trpp5 (3 FPKM). As shown in the analysis of (GABA(A)) in rat TG cells [222]. Corresponding with our RNA- Vandewauw, Trp-members, such as Trpv3 (~0.2 FPKM) and Seq data, they detected the expression of the GABA(A) Trpv6 (~0.4 FPKM), were also found to be expressed at low subunits α1-6, β1-3, γ1-3, and δ by RT-PCR (Figure S9). levels in our study (Figure S10). Comparing the DRG and TG, Hayasaki showed a strong immunoreactivity for all GABA(A) we detected differences in the expression levels for Trpc1 (TG: subunits in the majority of neurons. The δ and α6 subunits 11 FPKM, DRG: 5 FPKM), Trpm8 (TG: 49 FPKM, DRG: 8 were only observed in small neurons. The most prominently FPKM), and Trpv1 (TG: 12 FPKM, DRG: 29 FPKM). We expressed subunits in the TG were α1 and α2 (~50 FPKM), β2 verified the expression of Trpm7 and Trpc6 in the TG by in situ and β3 (~20 FPKM), and γ2 (~44 FPKM). These highly hybridization (Figure 8). expressed subunits might account for the majority of GABA(A) The Trpc- channel subfamily that was newly detected in the receptors in the TG. The most common GABA(A) receptor TG, seems to play an important role in somatosensation. In constellation in the CNS is α1 β2 γ2 [223]. GABA(A) receptors 2009, Staaf et al. showed that the expression of Trpc3, Trpc4, are involved in craniovascular nociception, whereas mainly and Trpc5 changes after spared nerve injury of the DRG, substances such as valproate, allopregnanolone, or propofol suggesting an involvement in nociception [246]. Furthermore, a may effectively block the neurogenic inflammation that is recent study showed that not only the common Trp channels, mediated by GABA(A) receptors [224,225]. GABAergic such as Trpm8 or Trpa1, are involved in noxious temperature signaling along with intracellular chloride accumulation plays a detection but also Trpc5, which can serve as a cold transducer critical role in the regulation of signal transmission and pain in nociceptive and thermosensory nerve endings [247]. In processed by neurons of the DRG [226–228]. contrast, Trpc6 is known to play an important role in Hcn. Hyperpolarization-activated cyclic nucleotide-gated vasoconstriction [248]. Additionally, these results indicate that channels (Hcn1-4) are known to be expressed in the TG the less-studied Trpc channels may be involved in a variety of [229,230]. As in previous studies, our RNA-Seq data revealed trigeminal functions. that Hcn1-2 are predominately expressed in the TG (40-48 FPKM), whereas Hcn3-4 are expressed at a weaker level (4- 5 Potassium Channels that are Expressed in Trigeminal FPKM) (Figure S9). Cho and colleagues showed that Hcn4 is Ganglia mainly present in 9% of all small-diameter TG neurons and in In recent years, potassium channels have become a focus of 4.7% of the DRG neurons, consistent with our results (TG: ~4 investigation for the mechanisms of somatosensation and FPKM, DRG: ~3 FPKM) [230]. The non-selective Hcn cation nociception [249]. Potassium channels are subgrouped as channels cause an inward cation current and are essential for voltage-gated channels (Kcna-Kcnd, Kcnf-Kcnh, Kcnq and the maintenance of the neuronal membrane potential. In the Kcns), calcium-activated (Kcnm-Kcnn), inwardly rectifying PNS, Hcns are involved in several pathoneurological (Kcnj), and background/leak, 2 pore channels (Kcnk) [250]. mechanisms such as inflammation-induced pain [231]. Kcnk channels are a major fundamental determinant for Trp channels. Transient receptor potential (Trp) channels membrane potential and membrane input resistance in are possibly the best investigated ion channel subfamily that is excitable cells [251]. Three Kcnk channels (Kcnk3, 9, and 18, expressed in sensory ganglia, and their diverse functions, also named TASK-1, 3, and TRESK) function as which include nociception, thermo-, and chemosensation, have chemoreceptors for hydroxyl-α-sanshool in trigeminal neurons been the focus of research in the last few decades [9], which causes a tingling sensation. Other channels, such as [8,232–236]. Trp channels participate in a variety of sensory Kcnk2, are heat-activated potassium channels and are processes and serve as receptors for environmental and important for thermosensation in sensory neurons [252]. We endogenous stimuli and some of them are involved in the identified Kcnk18 as the most TG-specific potassium channel signal transduction cascades downstream of metabotropic (Figure 10, Ref. [253–262,256,263–267,256,268–277]). receptors [237]. In short, 28 members have been described, Further, Kcnk18 was the first gene in which a mutation leads to that fall into six mammalian Trp-subgroups: Trpc (classical- a non-functional channel protein, linked to migraine [278]. To Trp), Trpv (vanilloid-Trp), Trpm (melastatin-Trp), Trpa the best of our knowledge, among the 30 most specific (ANKTM1-Trp), Trpp (polycystin-Trp), and Trpml (mucolipin- potassium channels, 15 of them had not been previously found Trp). The best characterized channels that are expressed in to be expressed in the TG. Some of these potassium channels, the TG and DRG are Trpv1, which senses heat (43°C) and such as Kcns3, are involved in common migraine development capsaicin, Trpm8, which senses cold (23°C) and menthol, as processes [256] or are a focus of the therapeutic treatment well as Trpa1, which has been suggested as a sensor of cold against diverse neurological diseases and pain, such as (17°C) and isothiocyanates [5,8,134,238–244,151]. In line with Kcnma and Kcnmb, which had already been identified in DRG previous reports, our analysis confirmed that Trpv1, Trpm8, neurons but not in the TG [279].

PLOS ONE | www.plosone.org 14 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

Figure 10. Ranking of potassium channels that are most specifically expressed in the TG and DRG. A comparison of the most specific potassium channels in the TG and DRG compared with the brain (B), liver (L), olfactory epithelium (OE), and skeletal muscle (SM). For the TG, newly detected channels are marked with (-). doi: 10.1371/journal.pone.0079523.g010

In summary, only a few potassium channels of the ~80 induced nociception [294,295]. Eleven members of the Tlr members have been well investigated to date and are known to family are known today. In addition to the two known TG- play a role in sensing temperature, chemical substances, and expressed Tlrs, we detected Tlr1, -3, -4, and -5 (Figure S12). pain in the peripheral sensory system [250,280–288,12,289,9]. The expression of Tlr1 in the TG was confirmed by in situ A detailed list of all potassium channels that are expressed in hybridization (Figure 8). the TG and DRG can be found in the supplementary data Aqp. Aquaporins (Aqp) are a family of membrane-spanning (Figure S11). water channels that are involved in fluid transport [296]. Recent studies indicate the fundamental role of Aqp as a potential Other Channels and Proteins that are Expressed in therapeutic target for migraines [297]. The water-selective Trigeminal Ganglia channels Aqp1 and Aqp4 are involved in the pathophysiology In addition to the 30 most specific or most highly expressed of several neurological diseases. Aqp3, Aqp8, and Aqp9 can ion channels or GPCRs, we found other genes that are highly also transport glycerol or larger solutes. The expression or specifically expressed in the TG. patterns for several Aqps are shown in the supplementary data Tlr. Toll-like receptors (Tlrs) are a type of pattern recognition (Figure S12). receptor and recognize molecules that are shared by Calm. We found members of the calmodulin (calcium pathogens (pathogen-associated molecular patterns) modulated protein: Calm1-3) protein family to be highly [290–293]. Recent studies have shown that Tlr2 and Tlr4 are expressed (> 500 FPKM) in the TG (Figure S12). Additionally, also involved in inflammation processes or in chemically we found all members and subunits of the calcium/calmodulin-

PLOS ONE | www.plosone.org 15 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

dependent protein kinase types (Camk) in the TG (Figure S12). the receptor potential [314,315]. Our RNA-Seq data revealed Calm binds intercellular calcium and alters the signals of the expression of Nkcc1 in the TG (63 FPKM) and DRG (47 different target proteins, which influences signal transmission FPKM) (Figure S12). Nkcc1 is one of the transporters that is and neurotransmitter release, as shown for Ano1 in epithelial most specifically expressed in the TG and OE. In trigeminal cells [298]. Camk2a is a well-investigated protein that is sensory neurons, Nkcc1-mediated intracellular chloride important for synaptic plasticity and for the regulation of accumulation is crucial for the amplification of capsaicin- excitatory synaptic transmission in neurons [299]. It was shown induced responses [167]. In the DRG, Nkcc1 activation could that inhibition of Camk2a in rat TG effectively decreased pain- be associated to neurite regeneration [316] and Nkcc1 knock- evoked signals though Trpv1 [300]. Camk2a plays an important out mice displayed reduced pain sensitivity [317]. In agreement role in nociception, inflammation, and injury-evoked events in with previous studies, we did not detect Nkcc2 expression in sensory neurons. the TG or DRG. Cgrp. It has been suggested that the pathology of migraine IL. Several members of the interleukin receptor family (IL) relies on the activation of TG nociceptive neurons by the were found to be moderately to highly expressed in the TG and vasodilatation of intracranial extracerebral blood vessels and DRG. In more detail, the analysis revealed marked expression the subsequent release of vasoactive sensory neuropeptides, of IL-1, IL-4, IL-6, IL-10, IL-13, IL-15, IL-17, IL-18, IL-31, and most prominently in the calcitonin gene-related peptide Cgrp, IL-36 receptor subunits. Of special interest are the IL-6 and which results in an increase in pain [301]. From the trigeminal IL-31 receptors. IL-6 receptor alpha (FPKM 6.7) dimerizes with nuclei, signals are sent to higher centers and pain is perceived. the promiscuous signal transducer IL-6 receptor beta subunit (= Recently, it was shown that there are two different mechanisms gp130) which we found to be highly expressed in the DRG and by which Cgrp can induce migraines: the proton-regulated TG (FPKM 81.6, 110.6). The heteromeric IL-6 receptor, release of Cgrp (with Asic3) and a calcium and synaptosomal- composed of one IL-6 receptor alpha subunit and two gp130 - associated pathway (with Trpv1) [302]. In agreement to other transducers, mediates the elevation of [Cl ]i in DRG neurons via studies, we detected a much higher expression of Cgrpα (325 the JAK/STAT pathway in an axotomy model of neurite FPKM) and a weaker expression of Cgrpβ (40 FPKM) in the regeneration [316]. Beyond that, gp130 is required for signaling TG [303]. Compared with the TG, Cgrpα-β expression is ~3- induced by activation of the IL-6 receptor family member fold higher in the DRG (Figure S12). oncostatin regulator beta (OSMR beta) which we found to be Pirt. The phosphoinositide-interacting regulator of Trp expressed in the TG and DRG (FPKM 5, 9.2). Stimulation of channels (Pirt) is specifically expressed in sensory ganglia OSMR/gp130 was shown to potentiate capsaicin-induced [304]. In all vertebrates, Pirt is a highly conserved membrane currents in small diameter DRG neurons [318] and appears to protein that binds to PiP2 [305]. In our RNA-Seq analysis, Pirt be involved in pathological pain processes [319]. is highly expressed in the TG and DRG, with an FPKM value of The IL-31 receptor alpha subunit (FPKM 3.7, 8.8) was found 160 and 174, respectively (Figure S12), but is absent in all to be highly expressed in human DRG and its ligand other tissues except for the OE (6 FPKM). We used Pirt as a IL-31showed marked overexpression in human pruritic atopic TG-specific marker for in situ hybridization experiments (Figure skin inflammation samples [320]. In accordance with that, the 1 and Figure 8). It is suggested that Pirt plays a fundamental cytokine IL-31 is associated with pruritus and atopic dermatitis role in many aspects of somatosensation. Pirt is able to interact in mice [321]. In the supplementary data we listed the with different Trp channels and possibly other channels, which expression profile for all IL members (Figure S12). indicates a possible regulatory role in neurons [306]. A recent study showed that Pirt is an essential modulator of Trpv1 [307] Differential Expression Pattern Comparing Trigeminal and Trpm8 function [308]. Ganglia and Dorsal Root Ganglia Pgr. In recent studies, the expression of the progesterone TG and DRG are equally important for the detection of receptor (Pgr) was shown in the caudal part of the trigeminal chemicals and the physiology of pain [322]. However, a nucleus, which is located in the pons [309]. We could show Pgr detailed differential expression analysis of both tissues has expression (3 FPKM) in the TG. Pgr is possibly involved in the never been conducted before. Therefore, the main differences development of migraines [310] and in anti-nociceptive effects between the TG and DRG were analyzed. in the DRG of mice [311]. Because the expression of Pgr has One main anatomical difference of the TG and DRG is that never been shown in the TG, we validated our RNA-Seq data the TG lacks cell bodies of large-diameter proprioceptors, by in situ hybridization experiments (Figure 8). which rises from the mesencephalic trigeminal nucleus Nkcc. The sodium-potassium-chloride-cotransporter 1 [323,324] and are not included in our RNA-Seq analysis. This (Nkcc1, Slc12a2) is a chloride importer that is involved in the could probably be the reason why some classes of GPCRs and regulation of intracellular chloride levels. Nkcc1 is highly ion channels are detected with a higher FPKM in the DRG expressed in several peripheral sensory tissues and the compared to the TG. embryonic CNS. In the embryonic and early postnatal CNS, However, the distribution of the FPKM values that were downregulation of Nkcc1 accompanied by an upregulation of obtained by our RNA-Seq analysis is highly similar between the chloride-extruding transporters is linked to the so-called GABA TG and DRG, and expression patterns for both tissues are switch that renders GABA-induced signals inhibitory [312,313]. highly correlated (R2= 0.73, Figure 11A, 11B), whereas the In the olfactory sensory neurons, Nkcc1 maintains high correlation of the TG with other tissues such as the OE is low intracellular chloride concentrations crucial for the generation of (R2= 0.52) (Figure S13).

PLOS ONE | www.plosone.org 16 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

Figure 11. Comparison of expression profiles of the TG and DRG. A Differences in the gene expression pattern of the TG and DRG. Of all the genes detected in the TG and DRG, 98.6% were similar (> 1 FPKM), 8113 genes were detected in neither the DRG nor the TG (< 1 FPKM), and 0.5% of the genes were TG- and 0.9% DRG-specific (> 1 FPKM). B FPKM distribution for both tissues is highly similar when plotting FPKM values against the number of detected genes. C The regression graph visualizes the correlation of the expression patterns for all detected transcripts in the TG and DRG. R2= 0.73. doi: 10.1371/journal.pone.0079523.g011

Our intention was to identify genes with a pronounced the vomeronasal organ. Miyawaki and colleagues suggested differential expression. Therefore, we used Cuffdiff analysis to that Lcn3 is involved in the sexual and reproductive behavior of calculate the amount of significantly differentially expressed mice [326]. genes, and found 19 and 23 genes were significantly higher Many of these detected TG-specific transcripts are linked expressed in the TG and DRG, respectively (Figure 12). directly into olfactory signal transduction, such as the cyclic Therefore, the relative low number of significantly represented nucleotide-gated channel (Cnga2), which is involved in the genes is due to the statistically correction for the approximately signal transduction of ORs [327], and the OR Olfr420, which is 23000 parallel comparisons, which makes it difficult to reach a specifically expressed in the TG and OE. Furthermore, we significant level. In addition to the Cuffdiff analysis, we added detected the trigeminal expression of Gαolf, which is the genes that had at least 10-fold higher differential expression olfactory G-protein alpha subunit (Figure S4). The TG- and OE- levels, similar to the recently published RNA-Seq analysis of specific expression of the hemophilic adhesive molecule Kirrel2 the OE [41] (Figure 12). According to this criterion, the has been shown to be impaired in the olfaction signal expression of 65 genes is higher in the TG compared with the processing in a Cnga2 knockout mouse [328]. A comparison DRG, and 117 genes have higher expression levels in the DRG with the OE transcriptome showed that most of the specific TG compared with the TG (Figure 11C, Figure 12). transcripts are also highly abundant in the OE; additionally, 15 We found 12373 genes that were expressed in both tissues of the 65 genes are virtually exclusively expressed in both, the with an FPKM > 1 (Figure 11A). Of these genes, 0.5% were OE and TG and are involved in diverse functions of olfaction. detected only in the TG with an FPKM > 1, whereas 0.9% of In contrast, the DRG-specific genes that we found are the genes were only detected in the DRG ( primarily involved in cellular processes such as cell growth, < 1 FPKM). localization, development, or cell death (71 of 117). Among the To gain a functional overview for the gene expression 117 genes, 2 voltage-gated calcium channel subunits differences we used a gene ontology tool (http:// (Cacna1s and Cacng1) and one GPCR (Cxcl1) were identified. compbio.charite.de) (Table 2). Interestingly, the TG-specific expression reveals a couple of genes (15) that are involved in Conclusions the chemosensory detection of volatile odorants (marked red in Figure 12). We detected several specifically expressed Using the RNA-Seq method, we established a odorant-binding proteins, such as Lcn3 and Lcn4, Mup3, Mup4, comprehensive analysis of genes that are expressed in the TG Obp1a, Gm14744, Gm14743, Gm5938, Gm1006, Aox3l1, and DRG of mice. As we aimed to analyze genes that are Gm13629, and 5430402E10Rik, which are primarily expressed involved in sensory processes, we primarily focused our only in the OE and TG. Odorant-binding proteins are able to analysis on GPCRs and ion channel expression. transport hydrophobic molecules through the mucus to Our catalog of the most highly or specifically expressed ion receptors [325]. Lcn3 is a putative pheromone-carrier in the channels in the TG demonstrates that nearly all of these ion vomeronasal organ [326]. The expression of this gene was channels are involved in the sensation of pain or in the detected in the nasal septum and in the sensory epithelium of detection of chemicals. Although the specific expression and

PLOS ONE | www.plosone.org 17 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

Figure 12. Genes expressed differentially in the TG and DRG. A 65 genes are expressed at least 10-fold higher in the TG than in the DRG. Brain (B), liver (L), olfactory epithelium (OE), and skeletal muscle (SM) were used to visualize the global expression patterns for the selected genes. The expression of genes that are marked with (*) is significantly different between the TG and DRG. Interestingly, 15 of the trigeminally-expressed genes are also expressed in the OE and have a function in olfaction. B In the DRG, many of the 117 specifically expressed genes play a role in the development or regulation of gene expression, such as Ampd1 or Cfd. Of the 117, 23 genes were significantly expressed at higher levels in the DRG than in the TG. In contrast to the TG, we found several Hox genes with higher expression in the DRG than in the TG. doi: 10.1371/journal.pone.0079523.g012 function of most of these channels in trigeminal sensory channels, only a few are well investigated, whereas the neurons is well-characterized, we nevertheless identified four function of the majority is still unknown. new trigeminally-expressed ion channels. In addition, we found Little is known about GPCRs expressed in the TG, and many many moderately expressed Trp channels whose expression more than we know today may be involved in somatosensation. was not detected in the TG before, except in a very recent Interestingly, most of the highly expressed GPCRs that we found in the TG are still orphan receptors. Beyond that, our study [245]. This observation is surprising because the function study revealed the expression of a greater number of GPCRs of Trp channel in the TG and DRG has been in the focus of that are highly expressed in the TG. Our analysis emphasizes research for many years. However, a potential function for the idea that Mrgprs are a family of specifically expressed these newly detected Trp channels in trigeminal sensation is genes in the sensory ganglia. This receptor type clearly elusive. dominates the group of specific GPCRs in the sensory ganglia. We created a detailed list of all potassium channels that are Judged by their specific expression pattern, these GPCRs can expressed in the TG. In our analysis, we detected the be best compared with ORs in the OE or to bitter taste expression of a couple of potassium channels that have not yet receptors (Tas2rs) in the tongue. In contrast to other been described in the TG. Of the ~80 members of potassium chemosensory receptor families, much less is known about

PLOS ONE | www.plosone.org 18 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

Table 2. Classification of differentially expressed genes. on animal protection). Adult male CD1 mice were obtained from Charles River (Sulzfeld, Germany).

GO-Terms TG detected DRG detected Gene Functions Excision of the TG and DRG GO:0005549 12 0 Odorant Binding For preparation of the TG, mice were sacrificed, sculls were GO:0004984 1 0 Olfactory Receptor opened, the brains removed, and the exposed TG were GO:0050955 1 0 Thermoception dissected using forceps. The ganglia were washed in PBS and GO:0005179 6 2 Hormone Activity then further processed for RNA extraction as described below. GO:0032502 12 46 Developmental Process For preparation of the DRG, the same animals were used. The GO:0005244 1 2 Voltage Gated Ion Channel spines were opened along the midline by cutting through the G-Protein Coupled Receptor vertebral canal and the spinal marrow was removed to expose GO:0001664 1 2 Binding the DRG located in between the vertebral bodies. The GO:0007154 17 16 Cell Communication thoracaic, lumbal, and sacral DRG were removed, washed in GO:0048878 0 10 Chemical Homeostasis PBS, and then further processed for RNA extraction. GO:0042221 10 15 Response to Chemical Stimulus G-Protein Coupled Signaling RNA Isolation and Next Generation Sequencing GO:0007186 12 1 Pathway RNA from murine DRG or TG of pooled tissues from 8 male doi: 10.1371/journal.pone.0079523.t002 adult CD1 mice was isolated with the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer´s protocol, ligands for the Mrgprs, and only three of the 20 members are which included DNaseI digestion. At the Cologne Center for deorphanized. Nevertheless, the characterization of the Genomics NGS unit, libraries for sequencing were constructed remaining Mrgprs and other orphan GPCRs with potential from the total RNA and were subjected to DSN normalization. chemosensory function (e.g., Gprc5b, Gprc5c, Gpr178, or RNA-Seq was performed on the Illumina GAIIx sequencing Gpr158) is a prerequisite to further our understanding of the platform with a 36-nucleotide length. We essentially analyzed sensory functions of the DRG and TG. Our RNA-Seq study the sequence data as described previously [36]. The raw may help to identify the important candidates that will be the sequence data were aligned to the mouse genome reference basis of future studies. sequence (mm9) using the TopHat aligner. To avoid the Differences in tissue-dependent sensory functions are alignment of highly repetitive reads, a multiread-correction was correlated with differences in the expression patterns for genes used, which allowed up to 5 hits per read. that code for membrane receptors. A differential transcriptome Consequently, we could map 33 million or 32 million reads analysis of the TG and DRG identified several genes with for the TG or DRG. Output BAM-files were sorted and indexed pronounced expression variances. Several of the genes that using the SAM tools software package [329]. FPKM values are specific for the TG are also highly expressed in the OE and were subsequently calculated by the Cufflinks program using are involved in the chemical detection of odorants. This the mm9 RefSeq reference transcriptome. We further used a observation implies that the TG has a better capacity than the masked command M and the mask GTF rmsk.gtf to hide all DRG to detect chemical cues. Similarly, the higher cumulative possible reads that were RNA repeats, including tRNA, rRNA, FPKM values for ORs in the TG and for Mrgprs in the DRG snRNA, scRNA, and sprRNA, short as well as long strongly argue for a more chemosensory or somatosensory interspersed nuclear elements (SINE, LINE), and other specialization of these two sensory systems, respectively. different classes of repeats. In order to investigate the In general, a detailed expression profile of all genes can be expression differences between the TG and DRG, we used Cuffdiff with the common RefSeq reference transcriptome. an important tool to promote our understanding of the function Schöbel and colleagues already presented a small subset of of the TG and DRG. In particular, the analysis of GPCRs and our generated data, which describe the expression of Ano1-10 ion channels helps to identify new candidates that participate in and Ttyh1-3 channels in the TG [167]. chemical detection or nociception. This analysis generates a For comparison, we reanalyzed the already-published raw basis for comparison, aims to encourage further studies on ion RNA-Seq data from the brain, liver and skeletal muscle in the channels and GPCRs that are expressed in the TG and DRG, same manner as our own data. The data sets were available in and sheds light on the main differences between these the NCBI SRA archive and the following accession number: functionally and anatomically similar structures. mouse brain (SRR006488, SRR006489), mouse liver (SRR006490, SRR006491, SRR001360, SRR001359) and Materials and Methods mouse skeletal muscle (SRR001361, SRR001362, SRR006492) [38]. The transcriptome from the OE of 4-week- Animals old CD1 mice was calculated using 37 million (male) or 52 All experiments involving animals were carried out in million (female) 36 bp that were reads generated by Illumina accordance with The European Union Community Council sequencing on a GAIIx platform. The analysis of the pooled OE guidelines and approved by the competent state office of the was performed with the same parameters that were used for Federal Land of Northrhine Westphalia (file the TG and DRG. A detailed analysis on the OE transcriptome 87-51.04.2010.A180) and the German Tierschutzgesetz (law will be presented else-where.

PLOS ONE | www.plosone.org 19 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

The identification of genes that were enriched in the TG and reverse: GCATATGCGGCCGCGTCTTCGTACACCACCGTCA; DRG was essentially performed as described in previous RNA- Kcnka4: Seq comparison studies for the OE [41,330]. We focused only forward: GCATATGAATTCAGGTGGTTCTGAGGAGAGTGAG, on protein coding genes that were expressed with at least 1 reverse: FPKM and at least 10-fold difference. GCATATGCGGCCGCGGGCTTCGGCATAGAAAGTA; Kcnk3: Calculation of GO-terms forward: GCATATGAATTCGATCGTGAGGTACCTGCTGCAC, Go-Terms were calculated with a free online tool that is reverse: available at http://compbio.charite.de/contao/index.php/ GCATATGCGGCCGCGATGTGTCGGACGTGGAGAGGT; ontologizer2.html. Kcnk9: forward: In Situ Hybridization GCATATGAATTCGATTATATCCTGGTGGGCCTGAC, reverse: Digoxigenin-labeled sense and antisense RNA-probe GCATATGCGGCCGCGATAAAACGGACCGGAAGTAGGT; fragments, which were typically approximately 200-500 Kcnk18: nucleotides in length, were generated from cDNA fragments cloned into pCDNA3 (Invitrogen, Freiburg, Germany) by in vitro forward: transcription that was performed with the DIG RNA labeling mix GCATATGAATTCGATACCAGGCTCGGTAAGTTCCT, (Roche, Palo, Alti, CA) and T7 or SP6 RNA polymerase reverse: according to the manufacturer’s instructions. The primer pairs GCATATGCGGCCGCGATGGTGGTCAGTGTCACAAAGC; used were as follows: Mrgprd: Ano3: forward: GCATATGAATTCGCAGAGGTCTCCCTTCTGTG, forward: GCATATGAATTCCTTTGGTGAGAAGATTGGCTTA, reverse: reverse: GCATATGCGGCCGCTTGGCTTTCGTTCATTGTGA; GCATATGCGGCCGCTACCAGATGGGGAAAAGCAC; Cnr1: Mrgpre: forward: GCATATGAATTCGCTTGCGATCATGGTGTATG, forward: GCATATGAATTCCAGGGAGAAATGGCTTTCAA, reverse: GCATATGCGGCCGCGTGTTATTGGCGTGCTTGTG; reverse: Darc: GCATATGCGGCCGCTTCAGGGAAGTTCAGCTGGT; forward: GCATATGAATTCCAAGGGGCTGAAGATAGCAC, Mrgprx1: reverse: forward: GCTATGAATTCTCGCTCTCACAGTGATGGC, GCATATGCGGCCGCGTAGCCACACAGTGCAGCAT; reverse: GCATATGCGGCCGCTGTCCTCCAGAGCCCTCTTA; Drd3: Ntrsr2: forward: forward: GCATATGAATTCGTGAACGTGCTGGTCTCCTT, GCATATGAATTCGAGCACATAGAAGACAAACCATATC, reverse: reverse: GCATATGCGGCCGCCGAGCACAATGACCACCAT; GCATATGCGGCCGCGCCCCAGGGAGAGGGTCTTTCT; Fzd3: O3far1: forward: GCATATGAATTCGCCACCATGTCCCAATATGT, forward: GCATATGAATTCACTTCCCTTTCTTCTCGGATG, reverse: reverse: GCATATGCGGCCGCCTACTCGGTCCTCCAGCAAA; GCATATGCGGCCGCCGAGTAACCCCATATGAAAGC; GlyRb: Olfr78: forward: GCATATGAATTCGCATCTTCTCCGTGCTCAGT, forward: GCATATGAATTCGGTGGCTCTGGTCCGGGGAT, reverse: reverse: GCATATGCGGCCGCCTGCAAAGTGCTGATATGAAC; GCATATGCGGCCGCGCCACAGGAGGCAGCAGCAGGT; Gpr35: Olfr420: forward: GCATATGAATTCCTGCTTCCGTCAACAACTTCT, forward: GCATATGAATTCCCCAGCTGACCCTCGGTTGC, reverse: reverse: GCATATGCGGCCGCGCCCTGCAAAGAGCAGAAGACC; GCATATGCGGCCGCGCTCAGGTGCGAGACGCACGTGGAA Gpr126: A; forward: GCATATGAATTCCCAAAGTTGGCAATGAAGGT, Olfr1417: reverse: forward: GCATATGAATTCGGCCATCTGTCACCCTCTGCG, GCATATGCGGCCGCCAATGGAGCCCCAAGAATTA; reverse: Gpr155: GCATATGCGGCCGCGCAAGCAGGAGGAAGCTTATCACCA forward: GCATATGAATTCTGGGACTTGGATTTCTACGC; CC; reverse: GCATATGCGGCCGCTCAGTCGCCTGATTTTTCCT; Oprd: Gpr158: forward: GCATATGAATTCAGACCGCCACCAACATCTAC, forward: GCATATGAATTCCCTTTCACGAACAGCACAAA, reverse: reverse: GCATATGCGGCCGCTGATCAGATGTTTGCCCTTG; GCATATGCGGCCGCCTTTGACAGGATGGCAGACA; Grik2: Paqr6: forward: GCATATGAATTCCACATTCAGACTCGCTGGAA, forward: GCATATGAATTCGCCACCAGCTGTTCCATATC,

PLOS ONE | www.plosone.org 20 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

reverse: solution, 5x SSC, 10 mM DTT, 250 µg/ml yeast tRNA 500 GCATATGCGGCCGCGCAAGGAGGCCGTGAAAGCAG; µg/ml sheared and denatured herring sperm, 50 µg/ml heparin, Pgr: 2.5 mM EDTA, and 0.1% (v/v) Tween-20 was carried out for 1 forward: GCATATGAATTCTTCCTTTGGAAGGACTGAGG, h at 55°C to prevent the nonspecific binding of riboprobes. reverse: Each incubation step was followed by wash step with SSC or GCATATGCGGCCGCGCATCATGCAAGCTGTCGAGAA; PBST -buffers. Scn1a: Finally, 50 ng antisense riboprobes was hybridized at forward: GCATATGAATTCGATCCAGTCGGTGAAGAAGC, 55-65°C on cryosections that were mounted on slides reverse: overnight. The hybridized mRNA was visualized using an GCATATGCGGCCGCTCCAGTCAAACTCGAACACG; alkaline phosphatase-conjugated antibody to digoxigenin and Scn9a: the hydrolysis of nitro-blue tetrazolium chloride/5-bromo-4- forward: GCATATGAATTCGCCCTGATCCAATCAGTGAA, chloro-3-indolylphosphate p-toluidine. An antisense and a reverse: control sense probe were tested in parallel. The slides were GCATATGCGGCCGCTCTAATGTTTCATTCTGCTCAAGG; covered with cover slips using polyvinyl-alcohol that contained Tac3: embedding medium (Mowiol®, Immo-Mount, Thermo-Scientific, forward: GCATATGAATTCGGGTCCCATACAGGGAATCT, Braunschweig, Germany). Digital images were obtained with reverse: an Axiocam camera on an Axioscope2 microscope (Zeiss, GCATATGCGGCCGCGGGCCAAGATGATCCAAATA; Oberkochen, Germany). All images of sense and antisense Tbxa2r: samples were recorded under the same conditions (brightness forward: GCATATGAATTCTGGTTCGCTGCGTCCTTT, contrast and light exposure time). reverse: GCATATGCGGCCGCAGAAGGGCCGTGTGATGC; A signal was considered positive when the antisense labeling Tlr1: was noticeably darker visually than the sense labeling. We forward: used Pirt as a positive control, which is highly and specifically GCATATGAATTCATGACTAAACCAAATTCCCTCATC, expressed in the TG. reverse: GCATATGCGGCCGCGCGAAGAGATTCGGGGTCTTCTTT; Supporting Information Trpc6: forward: GCATATGAATTCGCATGATATGGGCTGAATGT, reverse: Figure S1. Expression strength for housekeeping genes in GCATATGCGGCCGCGCCCAGATTGTAGTATTTAACGTTGT all analyzed tissues. Expression analysis for known CC; expressed housekeeping genes. To show that our calculated Trpm7: FPKM values for all tissues is comparable in principle, we forward: GCATATGAATTCAGTGGAGCAGATGAGCATTC, analyzed the expression of known expressed housekeeping reverse: genes, which could be detected in all of our tested samples. GCATATGCGGCCGCGCAAATCTTGTCCAAACAGATTATAT (TIF) TG; Trpm8: Figure S2. Distribution of FPKM values compared with the forward: GCATATGAATTCGCCATCAACACCTCTGTCAA, different tissues used. The highest numbers of genes are reverse: GCATATGCGGCCGCCCATTTGATCCAGCTCTCAA; expressed between 1-10 FPKM in all tissues. There are fewer In situ hybridization experiments of the TG were performed highly expressed genes with an FPKM of > 100. with male and female P7 CLB6 mice. The mouse brains were (TIF) fixed overnight in 4% paraformaldehyde in PBS at 4°C (7.5 pH). The next day, the brains were incubated in 10% and 20% Figure S3. Integrative Genomic Viewer. Mapped reads for 1- sucrose for 1 h each and additionally overnight in 30% sucrose. kb large genes, which are expressed with 0.1 FPKM, 1 FPKM, The mandibular and the frontal part of the nose were removed. and 10 FPKM. Afterwards, transversal sections (14 µm) of quickly frozen (TIF) heads, which were embedded in the tissue freezing medium OCT that supports tissue during cryotomy (Leica Figure S4. Expression profile for all common GPCR signal Microsystems, Bensheim, Germany), were cut on a cryostat transduction proteins. (Leica Microsystems, CM 3050S, Bensheim, Germany) and (XLSX) mounted on Superfrost® Plus Slides (Menzel-Gläser, Braunschweig, Germany). After dehydration using an Figure S5. Expression profile for the TG and DRG specific increasing ethanol series, slices were stored at -80°C until family Mrpgrs. further use. In situ hybridizations were performed as described (XLSX) with minor modifications [74]. Briefly, fixed cryosections were incubated in RIPA-buffer, followed by an acetylation step with Figure S6. Expression profile for the Htr family. acetic anhydride in TEA buffer. Next, a prehybridization step in 50% deionized formamide, 10% dextran sulfate, 5x Denhardts (XLSX)

PLOS ONE | www.plosone.org 21 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

Figure S7. Expression profile for all existing ORs in the (TIF) TG and DRG. (XLSX) Table S1. Table with the expression pattern for all analyzed ~23000 genes. Figure S8. Expression profile for all members of the (XLSX) VGSCs. (XLSX) Table S2. Table with the expression pattern for all known GPCRs, sorted by their subfamily and marked whether Figure S9. Expression profile for GlyRs, GABA(A), iGluts, they are known to be expressed in the TG. P2Xs, and Hcns. (XLSX) (XLSX) Table S3. Table with the expression pattern for all ion Figure S10. Expression profile for all existing Trp channels in the TG and DRG. channels in the TG and DRG. (XLSX) (XLSX) Acknowledgements Figure S11. Expression profile for all existing potassium We thank Thomas Lichtleitner, Ute Müller, and Jasmin channels and subunits in the TG and DRG. (XLSX) Gerkrath for excellent technical assistance. Author Contributions Figure S12. Expression profile for other interesting membrane proteins. Conceived and designed the experiments: GG HH. Performed (XLSX) the experiments: SM RL CF FV AH BSPS JA CB NS. Analyzed the data: SM. Contributed reagents/materials/analysis tools: Figure S13. Comparison of the gene expression between GG HH JA. Wrote the manuscript: SM GG. the OE and TG and the OE and DRG.

References

1. Albe-Fessard D, Andres KH, Bates JAV, Besson JM, Brown AG et al. 13. Liu L, Chang GQ, Jiao YQ, Simon SA (1998) Neuronal nicotinic (1973) Somatosensory System. Berlin, Heidelberg: Springer Verlag. acetylcholine receptors in rat trigeminal ganglia. Brain Res 809 (2): 2. Lee Y, Lee CH, Oh U (2005) Painful channels in sensory neurons. Mol 238–245. doi:10.1016/S0006-8993(98)00862-2. PubMed: 9853116. Cells 20 (3): 315–324. PubMed: 16404144. 14. Thun J, Persson AK, Fried K (2009) Differential expression of neuronal 3. Patapoutian A, Tate S, Woolf CJ (2009) Transient receptor potential voltage-gated sodium channel mRNAs during the development of the channels: targeting pain at the source. Nat Rev Drug Discov 8 (1): 55– rat trigeminal ganglion. Brain Res 1269: 11–22. doi:10.1016/j.brainres. 68. doi:10.1038/nrd2757. PubMed: 19116627. 2009.02.044. PubMed: 19269275. 4. Nilius B, Voets T (2004) Diversity of TRP channel activation. Novartis 15. Overington JP, Al-Lazikani B, Hopkins AL (2006) How many drug targets are there?. Nat Rev Drug Discov 5 (12): 993–996. doi:10.1038/ Found Symp 258: 140-266; discussion: 15104180. nrd2199. PubMed: 17139284. 5. Jordt SE, Bautista DM, Chuang HH, McKemy DD, Zygmunt PM et al. 16. Ashcroft FM (2000) Ion channels and disease. Channelopathies. xxi. (2004) Mustard oils and cannabinoids excite sensory nerve fibres San Diego: Academic Press. 481 pp. through the TRP channel ANKTM1. Nature 427 (6971): 260–265. doi: 17. Moro S, Spalluto G, Jacobson KA (2005) Techniques: Recent 10.1038/nature02282. PubMed: 14712238. developments in computer-aided engineering of GPCR ligands using 6. Bautista DM, Siemens J, Glazer JM, Tsuruda PR, Basbaum AI et al. the human adenosine A3 receptor as an example. Trends Pharmacol (2007) The menthol receptor TRPM8 is the principal detector of Sci 26 (1): 44–51. doi:10.1016/j.tips.2004.11.006. PubMed: 15629204. environmental cold. Nature 448 (7150): 204–208. doi:10.1038/ 18. Costigan M, Scholz J, Woolf CJ (2009) Neuropathic pain: a nature05910. PubMed: 17538622. maladaptive response of the nervous system to damage. Annu Rev 7. McKemy DD, Neuhausser WM, Julius D (2002) Identification of a cold Neurosci 32: 1–32. doi:10.1146/annurev.neuro.051508.135531. receptor reveals a general role for TRP channels in thermosensation. PubMed: 19400724. Nature 416 (6876): 52–58. doi:10.1038/nature719. PubMed: 11882888. 19. Pan HL, Wu ZZ, Zhou HY, Chen SR, Zhang HM et al. (2008) 8. Caterina MJ, Schumacher MA, Tominaga M, Rosen TA, Levine JD et Modulation of pain transmission by G-protein-coupled receptors. al. (1997) The capsaicin receptor: a heat-activated ion channel in the Pharmacol Ther 117 (1): 141–161. doi:10.1016/j.pharmthera. pain pathway. Nature 389 (6653): 816–824. doi:10.1038/39807. 2007.09.003. PubMed: 17959251. PubMed: 9349813. 20. Chen G, Way J, Armour S, Watson C, Queen K et al. (2000) Use of 9. Bautista DM, Sigal YM, Milstein AD, Garrison JL, Zorn JA et al. (2008) constitutive G protein-coupled receptor activity for drug discovery. Mol Pungent agents from Szechuan peppers excite sensory neurons by Pharmacol 57 (1): 125–134. PubMed: 10617687. 21. Zhang Y, Devries ME, Skolnick J (2006) Structure modeling of all inhibiting two-pore potassium channels. Nat Neurosci 11 (7): 772–779. identified G protein-coupled receptors in the human genome. PLOS doi:10.1038/nn.2143. PubMed: 18568022. Comput Biol 2 (2): e13. doi:10.1371/journal.pcbi.0020013. PubMed: 10. Green BG (1985) Menthol modulates oral sensations of warmth and 16485037. cold. Physiol Behav 35 (3): 427–434. doi: 22. Pierce KL, Premont RT, Lefkowitz RJ (2002) Seven-transmembrane 10.1016/0031-9384(85)90319-1. PubMed: 4070414. receptors. Nat Rev Mol Cell Biol 3 (9): 639–650. doi:10.1038/nrm908. 11. Green BG (2004) Temperature perception and nociception. J Neurobiol PubMed: 12209124. 61 (1): 13–29. doi:10.1002/neu.20081. PubMed: 15362150. 23. George SR, O'Dowd BF, Lee SP (2002) G-protein-coupled receptor 12. Yamamoto Y, Hatakeyama T, Taniguchi K (2009) oligomerization and its potential for drug discovery. Nat Rev Drug Immunohistochemical colocalization of TREK-1, TREK-2 and TRAAK Discov 1 (10): 808–820. doi:10.1038/nrd913. PubMed: 12360258. with TRP channels in the trigeminal ganglion cells. Neurosci Lett 454 24. Lundstrom K (2005) The future of G protein-coupled receptors as (2): 129–133. doi:10.1016/j.neulet.2009.02.069. PubMed: 19429069. targets in drug discovery. IDrugs 8 (11): 909–913. PubMed: 16254784.

PLOS ONE | www.plosone.org 22 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

25. Dirksen R (1990) Opioid receptors and pain. Pharm Weekbl Sci 12 (2): malignancy. Inflamm Res 58 (8): 431–435. doi:10.1007/ 41–45. doi:10.1007/BF01970144. PubMed: 2159614. s00011-009-0023-9. PubMed: 19290478. 26. Liu Q, Tang Z, Surdenikova L, Kim S, Patel KN et al. (2009) Sensory 49. Rasmussen MS, Lihn AS, Pedersen SB, Bruun JM, Rasmussen M et neuron-specific GPCR Mrgprs are itch receptors mediating al. (2006) Adiponectin receptors in human adipose tissue: effects of chloroquine-induced pruritus. Cell 139 (7): 1353–1365. doi:10.1016/ obesity, weight loss, and fat depots. Obesity (Silver Spring) 14 (1): 28– j.cell.2009.11.034. PubMed: 20004959. 35. doi:10.1038/oby.2006.5. PubMed: 16493120. 27. Gerevich Z, Illes P (2004) P2Y receptors and pain transmission. 50. Ouchi N, Higuchi A, Ohashi K, Oshima Y, Gokce N et al. (2010) Sfrp5 Purinergic Signal 1 (1): 3–10. doi:10.1007/s11302-004-4740-9. is an anti-inflammatory adipokine that modulates metabolic dysfunction PubMed: 18404394. in obesity. Science 329 (5990): 454–457. doi:10.1126/science. 28. Bradshaw HB, Lee SH, McHugh D (2009) Orphan endogenous lipids 1188280. PubMed: 20558665. and orphan GPCRs: a good match. Prostaglandins Other Lipid Mediat 51. Singer K, Luo R, Jeong SJ, Piao X (2013) GPR56 and the developing 89 (3-4): 131–134. doi:10.1016/j.prostaglandins.2009.04.006. PubMed: cerebral cortex: cells, matrix, and neuronal migration. Mol Neurobiol 47 19379823. (1): 186–196. doi:10.1007/s12035-012-8343-0. PubMed: 23001883. 29. Monheim LM (1961) Pain. J Am Dent Soc Anesthesiol 8 (7): 199–203. 52. Griswold DE, Douglas SA, Martin LD, Davis TG, Davis L et al. (1999) PubMed: 19598927. Endothelin B receptor modulates inflammatory pain and cutaneous 30. Liu L, Simon SA (1994) A rapid capsaicin-activated current in rat inflammation. Mol Pharmacol 56 (4): 807–812. PubMed: 10496965. trigeminal ganglion neurons. Proc Natl Acad Sci U_S_A 91 (2): 738– 53. Kreienkamp HJ, Zitzer H, Gundelfinger ED, Richter D, Bockers TM 741. doi:10.1073/pnas.91.2.738. PubMed: 8290592. (2000) The calcium-independent receptor for alpha-latrotoxin from 31. Tilney F (1930) Headache and Migraine. Bull N Y Acad Med 6 (2): 69– human and rodent brains interacts with members of the ProSAP/ 88. PubMed: 19311715. SSTRIP/Shank family of multidomain proteins. J Biol Chem 275 (42): 32. Galer BS (1995) Neuropathic pain of peripheral origin: advances in 32387–32390. doi:10.1074/jbc.C000490200. PubMed: 10964907. pharmacologic treatment. Neurology 45 (12 Suppl 9): S17-S36; 54. Choi JW, Herr DR, Noguchi K, Yung YC, Lee CW et al. (2010) LPA discussion: 8538882. receptors: subtypes and biological actions. Annu Rev Pharmacol 33. Eisenberg E, Shifrin A, Krivoy N (2005) Lamotrigine for neuropathic Toxicol 50: 157–186. doi:10.1146/annurev.pharmtox.010909.105753. pain. Expert Rev Neurother 5 (6): 729–735. doi: PubMed: 20055701. 10.1586/14737175.5.6.729. PubMed: 16274331. 55. Shinohara T, Harada M, Ogi K, Maruyama M, Fujii R et al. (2004) 34. Raouf R, Quick K, Wood JN (2010) Pain as a channelopathy. J Clin Identification of a G protein-coupled receptor specifically responsive to Invest 120 (11): 3745–3752. doi:10.1172/JCI43158. PubMed: beta-alanine. J Biol Chem 279 (22): 23559–23564. doi:10.1074/ 21041956. jbc.M314240200. PubMed: 15037633. 35. Garber M, Grabherr MG, Guttman M, Trapnell C (2011) Computational 56. Nofer JR, van der Giet M, Tölle M, Wolinska I, von Wnuck Lipinski K et methods for transcriptome annotation and quantification using RNA- al. (2004) HDL induces NO-dependent vasorelaxation via the seq. Nat Methods 8 (6): 469–477. doi:10.1038/nmeth.1613. PubMed: lysophospholipid receptor S1P3. J Clin Invest 113 (4): 569–581. doi: 21623353. 10.1172/JCI200418004. PubMed: 14966566. 36. Trapnell C, Roberts A, Goff L, Pertea G, Kim D et al. (2012) Differential 57. Mistry T, Digby JE, Chen J, Desai KM, Randeva HS (2006) The gene and transcript expression analysis of RNA-seq experiments with regulation of adiponectin receptors in human prostate cancer cell lines. TopHat and Cufflinks. Nat Protoc 7 (3): 562–578. doi:10.1038/nprot. Biochem Biophys Res Commun 348 (3): 832–838. doi:10.1016/j.bbrc. 2012.016. PubMed: 22383036. 2006.07.139. PubMed: 16899222. 37. Wang Z, Gerstein M, Snyder M (2009) RNA-Seq: a revolutionary tool 58. Kato S, Matsubara M, Matsuo T, Mohri Y, Kazama I et al. (2006) for transcriptomics. Nat Rev Genet 10 (1): 57–63. doi:10.1038/nrg2484. Leucine-rich repeat-containing G protein-coupled receptor-4 (LGR4, PubMed: 19015660. Gpr48) is essential for renal development in mice. Nephron Exp 38. Mortazavi A, Williams BA, McCue K, Schaeffer L, Wold B (2008) Nephrol 104 (2): e63-e75. doi:10.1159/000093999. PubMed: Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat 16785743. Methods 5 (7): 621–628. doi:10.1038/nmeth.1226. PubMed: 18516045. 59. Coughlin SR, Camerer E (2003) Participation in inflammation. J Clin 39. Marioni JC, Mason CE, Mane SM, Stephens M, Gilad Y (2008) RNA- Invest 111 (1): 25–27. doi:10.1172/JCI17564. PubMed: 12511583. seq: an assessment of technical reproducibility and comparison with 60. Li J, Wang YF, Zhou R, Yang L, Zhang H et al. (2007) [Association gene expression arrays. Genome Res 18 (9): 1509–1517. doi: 10.1101/gr.079558.108. PubMed: 18550803. between serotonin 1D gene polymorphisms and attention deficit 40. Trapnell C, Pachter L, Salzberg SL (2009) TopHat: discovering splice hyperactivity disorder comorbid or not comorbid learning disorder]. junctions with RNA-Seq. Bioinformatics 25 (9): 1105–1111. doi: Beijing Xue Xue Bao 39 (5): 535–538. 10.1093/bioinformatics/btp120. PubMed: 19289445. 61. Gondim DV, Araújo JCB, Cavalcante ALC, Havt A, Quetz JS et al. 41. Keydar I, Ben-Asher E, Feldmesser E, Nativ N, Oshimoto A et al. (2012) CB1 and CB2 contribute to antinociceptive and anti- (2013) General Olfactory Sensitivity Database (GOSdb): Candidate inflammatory effects of electroacupuncture on experimental arthritis of Genes and their Genomic Variations. Hum Mutat, 34: 32–41. PubMed: the rat temporomandibular joint. Can. J. Physiol; .Pharmacologist 90 22936402. (11) (1479–1489) 42. Vassilatis DK, Hohmann JG, Zeng H, Li F, Ranchalis JE et al. (2003) 62. Magdaleno S, Jensen P, Brumwell CL, Seal A, Lehman K et al. (2006) The G protein-coupled receptor repertoires of human and mouse. Proc BGEM: an in situ hybridization database of gene expression in the Natl Acad Sci U_S_A 100 (8): 4903–4908. doi:10.1073/pnas. embryonic and adult mouse nervous system. PLOS Biol 4 (4): e86. doi: 0230374100. PubMed: 12679517. 10.1371/journal.pbio.0040086. PubMed: 16602821. 43. Fredriksson R, Schiöth HB (2005) The repertoire of G-protein-coupled 63. Yamauchi T, Kadowaki T (2008) Physiological and pathophysiological receptors in fully sequenced genomes. Mol Pharmacol 67 (5): 1414– roles of adiponectin and adiponectin receptors in the integrated 1425. doi:10.1124/mol.104.009001. PubMed: 15687224. regulation of metabolic and cardiovascular diseases. Int J Obes (Lond) 44. Bjarnadóttir TK, Fredriksson R, Höglund PJ, Gloriam DE, Lagerström 32 Suppl 7: S13-S18. doi:10.1038/ijo.2008.117. PubMed: 19136982. MC et al. (2004) The human and mouse repertoire of the adhesion 64. Kupchak BR, Garitaonandia I, Villa NY, Smith JL, Lyons TJ (2009) family of G-protein-coupled receptors. Genomics 84 (1): 23–33. doi: Antagonism of human adiponectin receptors and their membrane 10.1016/j.ygeno.2003.12.004. PubMed: 15203201. progesterone receptor paralogs by TNFalpha and a ceramidase 45. Bjarnadóttir TK, Gloriam DE, Hellstrand SH, Kristiansson H, inhibitor. Biochemistry 48 (24): 5504–5506. doi:10.1021/bi9006258. Fredriksson R et al. (2006) Comprehensive repertoire and phylogenetic PubMed: 19453184. analysis of the G protein-coupled receptors in human and mouse. 65. Smith JL, Kupchak BR, Garitaonandia I, Hoang LK, Maina AS et al. Genomics 88 (3): 263–273. doi:10.1016/j.ygeno.2006.04.001. PubMed: (2008) Heterologous expression of human mPRalpha, mPRbeta and 16753280. mPRgamma in yeast confirms their ability to function as membrane 46. Haitina T, Fredriksson R, Foord SM, Schiöth HB, Gloriam DE (2009) progesterone receptors. Steroids 73 (11): 1160–1173. doi:10.1016/ The G protein-coupled receptor subset of the dog genome is more j.steroids.2008.05.003. PubMed: 18603275. similar to that in humans than rodents. BMC Genomics 10: 24. doi: 66. Kim MJ, Shin HJ, Won KA, Yang KY, Ju JS et al. (2012) Progesterone 10.1186/1471-2164-10-S3-S24. PubMed: 19146662. produces antinociceptive and neuroprotective effects in rats with 47. Kuner R, Köhr G, Grünewald S, Eisenhardt G, Bach A et al. (1999) microinjected lysophosphatidic acid in the trigeminal nerve root. Mol Role of heteromer formation in GABAB receptor function. Science 283 Pain 8: 16. doi:10.1186/1744-8069-8-16. PubMed: 22429647. (5398): 74–77. doi:10.1126/science.283.5398.74. PubMed: 9872744. 67. Meng H, Lee VM (2009) Differential expression of sphingosine-1- 48. Horne K, Woolley IJ (2009) Shedding light on DARC: the role of the phosphate receptors 1-5 in the developing nervous system. Dev Dyn Duffy antigen/receptor for chemokines in inflammation, infection and 238 (2): 487–500. doi:10.1002/dvdy.21852. PubMed: 19161225.

PLOS ONE | www.plosone.org 23 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

68. Mazerbourg S, Bouley DM, Sudo S, Klein CA, Zhang JV et al. (2004) 87. Rau KK, McIlwrath SL, Wang H, Lawson JJ, Jankowski MP et al. Leucine-rich repeat-containing, G protein-coupled receptor 4 null mice (2009) Mrgprd enhances excitability in specific populations of exhibit intrauterine growth retardation associated with embryonic and cutaneous murine polymodal nociceptors. J Neurosci 29 (26): 8612– perinatal lethality. Mol Endocrinol 18 (9): 2241–2254. doi:10.1210/me. 8619. doi:10.1523/JNEUROSCI.1057-09.2009. PubMed: 19571152. 2004-0133. PubMed: 15192078. 88. Vrontou S, Wong AM, Rau KK, Koerber HR, Anderson DJ (2013) 69. Gao Y, Shan ZY, Wang H, Zhang HM, Teng WP (2009) Inhibitory effect Genetic identification of C fibres that detect massage-like stroking of of shRNA targeting GPR48 on invasion and metastasis of human hairy skin in vivo. Nature 493 (7434): 669–673. doi:10.1038/ cervical carcinoma cell line HeLa. Ai Zheng 28 (2): 104–107. PubMed: nature11810. PubMed: 23364746. 19550120. 89. Scammell TE, Winrow CJ (2011) Orexin receptors: pharmacology and 70. Bräuner-Osborne H, Wellendorph P, Jensen AA (2007) Structure, therapeutic opportunities. Annu Rev Pharmacol Toxicol 51: 243–266. pharmacology and therapeutic prospects of family C G-protein coupled doi:10.1146/annurev-pharmtox-010510-100528. PubMed: 21034217. receptors. Curr Drug Targets 8 (1): 169–184. doi: 90. Yan JA, Ge L, Huang W, Song B, Chen XW et al. (2008) Orexin affects 10.2174/138945007779315614. PubMed: 17266540. dorsal root ganglion neurons: a mechanism for regulating the spinal 71. Kurtenbach S, Mayer C, Pelz T, Hatt H, Leese F et al. (2011) Molecular nociceptive processing. Physiol Res 57 (5): 797–800. PubMed: evolution of a chordate specific family of G protein-coupled receptors. 18973425. BMC Evol Biol 11: 234. doi:10.1186/1471-2148-11-234. PubMed: 91. Rebeck GW, Maynard KI, Hyman BT, Moskowitz MA (1994) Selective 21827690. 5-HT1D alpha serotonin receptor gene expression in trigeminal ganglia: 72. Maheshwari HG, Silverman BL, Dupuis J, Baumann G (1998) implications for antimigraine drug development. Proc Natl Acad Sci Phenotype and genetic analysis of a syndrome caused by an U_S_A 91 (9): 3666–3669. doi:10.1073/pnas.91.9.3666. PubMed: inactivating mutation in the growth hormone-releasing hormone 8170966. receptor: Dwarfism of Sindh. J Clin Endocrinol Metab 83 (11): 4065– 92. Bouchelet I, Cohen Z, Case B, Séguéla P, Hamel E (1996) Differential 4074. doi:10.1210/jc.83.11.4065. PubMed: 9814493. expression of sumatriptan-sensitive 5-hydroxytryptamine receptors in 73. Catt KJ, Mendelsohn FA, Millan MA, Aguilera G (1984) The role of human trigeminal ganglia and cerebral blood vessels. Mol Pharmacol angiotensin II receptors in vascular regulation. J Cardiovasc Pharmacol 50 (2): 219–223. PubMed: 8700126. 6 Suppl 4: S575-S586. doi:10.1097/00005344-198406004-00004. 93. Supornsilpchai W, Sanguanrangsirikul S, Maneesri S, Srikiatkhachorn PubMed: 6083400. A (2006) Serotonin depletion, cortical spreading depression, and 74. Negri L, Lattanzi R, Giannini E, Colucci M, Margheriti F et al. (2006) trigeminal nociception. Headache 46 (1): 34–39. doi:10.1111/j. Impaired nociception and inflammatory pain sensation in mice lacking 1526-4610.2006.00310.x. PubMed: 16412149. the prokineticin receptor PKR1: focus on interaction between PKR1 and 94. Terrón JA, Bouchelet I, Hamel E (2001) 5-HT7 receptor mRNA the capsaicin receptor TRPV1 in pain behavior. J Neurosci 26 (25): expression in human trigeminal ganglia. Neurosci Lett 302 (1): 9–12. 6716–6727. doi:10.1523/JNEUROSCI.5403-05.2006. PubMed: doi:10.1016/S0304-3940(01)01617-2. PubMed: 11278099. 16793879. 95. Srikiatkhachorn A, Anthony M (1996) Serotonin receptor adaptation in 75. DuPen A, Shen D, Ersek M (2007) Mechanisms of opioid-induced patients with analgesic-induced headache. Cephalalgia 16 (6): 419– tolerance and hyperalgesia. Pain Manag Nurs 8 (3): 113–121. doi: 422. doi:10.1046/j.1468-2982.1996.1606419.x. PubMed: 8902250. 10.1016/j.pmn.2007.02.004. PubMed: 17723928. 96. Supornsilpchai W, Le Grand SM, Srikiatkhachorn A (2010) Involvement 76. Nakae K, Saito K, Iino T, Yamamoto N, Wakabayashi M et al. (2005) A of pro-nociceptive 5-HT2A receptor in the pathogenesis of medication- prostacyclin receptor antagonist inhibits the sensitized release of overuse headache. Headache 50 (2): 185–197. doi:10.1111/j. substance P from rat sensory neurons. J Pharmacol Exp Ther 315 (3): 1526-4610.2009.01591.x. PubMed: 20039957. 1136–1142. doi:10.1124/jpet.105.091967. PubMed: 16109742. 97. Okubo M, Yamanaka H, Kobayashi K, Noguchi K (2010) Leukotriene 77. Godínez-Chaparro B, Barragán-Iglesias P, Castañeda-Corral G, synthases and the receptors induced by peripheral nerve injury in the Rocha-González HI, Granados-Soto V (2011) Role of peripheral 5- spinal cord contribute to the generation of neuropathic pain. Glia 58 (5): HT(4), 5-HT(6), and 5-HT(7) receptors in development and 599–610. PubMed: 19908283. maintenance of secondary mechanical allodynia and hyperalgesia. 98. Magnusson C, Bengtsson AM, Liu M, Liu J, Ceder Y et al. (2011) Pain 152 (3): 687–697. doi:10.1016/j.pain.2010.12.020. PubMed: Regulation of cysteinyl leukotriene receptor 2 expression--a potential 21239110. anti-tumor mechanism. PLOS ONE 6 (12): e29060. doi:10.1371/ 78. Hu WP, Zhang C, Li JD, Luo ZD, Amadesi S et al. (2006) Impaired pain journal.pone.0029060. PubMed: 22194989. sensation in mice lacking prokineticin 2. Mol Pain 2: 35. doi: 99. Taniguchi Y, Tonai-Kachi H, Shinjo K (2006) Zaprinast, a well-known 10.1186/1744-8069-2-35. PubMed: 17107623. cyclic guanosine monophosphate-specific phosphodiesterase inhibitor, 79. Murray KC, Stephens MJ, Rank M, D'Amico J, Gorassini MA et al. is an agonist for GPR35. FEBS Lett 580 (21): 5003–5008. doi:10.1016/ (2011) Polysynaptic excitatory postsynaptic potentials that trigger j.febslet.2006.08.015. PubMed: 16934253. spasms after spinal cord injury in rats are inhibited by 5-HT1B and 5- 100. Cosi C, Mannaioni G, Cozzi A, Carlà V, Sili M et al. (2011) G-protein HT1F receptors. J Neurophysiol 106 (2): 925–943. doi:10.1152/jn. coupled receptor 35 (GPR35) activation and inflammatory pain: Studies 01011.2010. PubMed: 21653728. on the antinociceptive effects of kynurenic acid and zaprinast. 80. Dunn IC, Hocking PM, Meddle S, Wilson P, Wardle CA et al. (2013) Neuropharmacology 60 (7-8): 1227–1231. doi:10.1016/j.neuropharm. Decreased expression of the satiety signal receptor CCKAR is 2010.11.014. PubMed: 21110987. responsible for increased growth and body weight during the 101. Ding YQ, Shigemoto R, Takada M, Ohishi H, Nakanishi S et al. (1996) domestication of chickens. Am J Physiol Endocrinol Metab, 304: E909– Localization of the neuromedin K receptor (NK3) in the central nervous 21. PubMed: 23443924. system of the rat. J Comp Neurol 364 (2): 290–310. doi:10.1002/ 81. Chiou LC, Lee HJ, Ho YC, Chen SP, Liao YY et al. (2010) Orexins/ (SICI)1096-9861(19960108)364:2. PubMed: 8788251. hypocretins: pain regulation and cellular actions. Curr Pharm Des 16 102. McCarson KE, Krause JE (1994) NK-1 and NK-3 type tachykinin (28): 3089–3100. doi:10.2174/138161210793292483. PubMed: receptor mRNA expression in the rat spinal cord dorsal horn is 20687883. increased during adjuvant or formalin-induced nociception. J Neurosci 82. Lemons LL, Wiley RG (2011) Galanin receptor-expressing dorsal horn 14 (2): 712–720. PubMed: 8301359. neurons: role in nociception. Neuropeptides 45 (6): 377–383. doi: 103. Santos AR, Calixto JB (1997) Further evidence for the involvement of 10.1016/j.npep.2011.08.002. PubMed: 21880366. tachykinin receptor subtypes in formalin and capsaicin models of pain 83. Damasio A (2005) Human behaviour: brain trust. Nature 435 (7042): in mice. Neuropeptides 31 (4): 381–389. doi:10.1016/ 571–572. doi:10.1038/435571a. PubMed: 15931200. S0143-4179(97)90075-5. PubMed: 9308027. 84. Dong X, Han S, Zylka MJ, Simon MI, Anderson DJ (2001) A diverse 104. Testi R, Pulcinelli FM, Cifone MG, Botti D, Del Grosso E et al. (1992) family of GPCRs expressed in specific subsets of nociceptive sensory Preferential involvement of a phospholipase A2-dependent pathway in neurons. Cell 106 (5): 619–632. doi:10.1016/S0092-8674(01)00483-4. CD69-mediated platelet activation. J Immunol 148 (9): 2867–2871. PubMed: 11551509. PubMed: 1315360. 85. Lembo PMC, Grazzini E, Groblewski T, O'Donnell D, Roy MO et al. 105. Read MA, Leitch IM, Giles WB, Bisits AM, Boura AL et al. (1999) (2002) Proenkephalin A gene products activate a new family of sensory U46619-mediated vasoconstriction of the fetal placental vasculature in neuron--specific GPCRs. Nat Neurosci 5 (3): 201–209. doi:10.1038/ vitro in normal and hypertensive pregnancies. J Hypertens 17 (3): 389– nn815. PubMed: 11850634. 396. doi:10.1097/00004872-199917030-00012. PubMed: 10100077. 86. Zylka MJ, Dong X, Southwell AL, Anderson DJ (2003) Atypical 106. Watkins G, Douglas-Jones A, Mansel RE, Jiang WG (2005) Expression expansion in mice of the sensory neuron-specific Mrg G protein- of thromboxane synthase, TBXAS1 and the thromboxane A2 receptor, coupled receptor family. Proc Natl Acad Sci U_S_A 100 (17): 10043– TBXA2R, in human breast cancer. Int Semin Surg Oncol 2: 23. doi: 10048. doi:10.1073/pnas.1732949100. PubMed: 12909716. 10.1186/1477-7800-2-23. PubMed: 16250911.

PLOS ONE | www.plosone.org 24 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

107. Palikhe NS, Kim SH, Lee HY, Kim JH, Ye YM et al. (2011) Association 127. Veitinger T, Riffell JR, Veitinger S, Nascimento JM, Triller A et al. of thromboxane A2 receptor (TBXA2R) gene polymorphism in patients (2011) Chemosensory Ca2+ dynamics correlate with diverse with aspirin-intolerant acute urticaria. Clin Exp Allergy 41 (2): 179–185. behavioral phenotypes in human sperm. J Biol Chem 286 (19): 17311– doi:10.1111/j.1365-2222.2010.03642.x. PubMed: 21070398. 17325. doi:10.1074/jbc.M110.211524. PubMed: 21454470. 108. Uchida H, Yamazaki K, Fukuma M, Yamada T, Hayashida T et al. 128. Xu F, Kida I, Hyder F, Shulman RG (2000) Assessment and (2010) Overexpression of leucine-rich repeat-containing G protein- discrimination of odor stimuli in rat olfactory bulb by dynamic functional coupled receptor 5 in colorectal cancer. Cancer Sci 101 (7): 1731– MRI. Proc Natl Acad Sci U_S_A 97 (19): 10601–10606. doi:10.1073/ 1737. doi:10.1111/j.1349-7006.2010.01571.x. PubMed: 20384634. pnas.180321397. PubMed: 10973488. 109. McClanahan T, Koseoglu S, Smith K, Grein J, Gustafson E et al. (2006) 129. Flegel C, Manteniotis S, Osthold S, Hatt H, Gisselmann G (2013) Identification of overexpression of orphan G protein-coupled receptor Expression profile of ectopic olfactory receptors determined by deep GPR49 in human colon and ovarian primary tumors. Cancer Biol Ther 5 sequencing. PLOS ONE 8 (2): e55368. doi:10.1371/journal.pone. (4): 419–426. doi:10.4161/cbt.5.4.2521. PubMed: 16575208. 0055368. PubMed: 23405139. 110. Knapp HR (1990) Reduced allergen-induced nasal congestion and 130. Neuhaus EM, Zhang W, Gelis L, Deng Y, Noldus J et al. (2009) leukotriene synthesis with an orally active 5-lipoxygenase inhibitor. N Activation of an olfactory receptor inhibits proliferation of prostate Engl J Med 323 (25): 1745–1748. doi:10.1056/ cancer cells. J Biol Chem 284 (24): 16218–16225. doi:10.1074/ NEJM199012203232506. PubMed: 1701029. jbc.M109.012096. PubMed: 19389702. 111. Price TJ, Helesic G, Parghi D, Hargreaves KM, Flores CM (2003) The 131. Borowsky B, Adham N, Jones KA, Raddatz R, Artymyshyn R et al. neuronal distribution of cannabinoid receptor type 1 in the trigeminal (2001) Trace amines: identification of a family of mammalian G protein- ganglion of the rat. Neuroscience 120 (1): 155–162. doi:10.1016/ coupled receptors. Proc Natl Acad Sci U_S_A 98 (16): 8966–8971. doi: S0306-4522(03)00333-6. PubMed: 12849749. 10.1073/pnas.151105198. PubMed: 11459929. 112. Hoffman AF, Riegel AC, Lupica CR (2003) Functional localization of 132. Behrens M, Foerster S, Staehler F, Raguse JD, Meyerhof W (2007) cannabinoid receptors and endogenous cannabinoid production in Gustatory expression pattern of the human TAS2R bitter receptor gene distinct neuron populations of the hippocampus. Eur J Neurosci 18 (3): family reveals a heterogenous population of bitter responsive taste 524–534. doi:10.1046/j.1460-9568.2003.02773.x. PubMed: 12911748. receptor cells. J Neurosci 27 (46): 12630–12640. doi:10.1523/ 113. Mu J, Zhuang SY, Kirby MT, Hampson RE, Deadwyler SA (1999) JNEUROSCI.1168-07.2007. PubMed: 18003842. Cannabinoid receptors differentially modulate potassium A and D 133. Rothermel M, Ng BSW, Grabska-Barwińska A, Hatt H, Jancke D (2011) currents in hippocampal neurons in culture. J Pharmacol Exp Ther 291 Nasal chemosensory-stimulation evoked activity patterns in the rat (2): 893–902. PubMed: 10525114. trigeminal ganglion visualized by in vivo voltage-sensitive dye imaging. 114. Pertwee RG (2000) Cannabinoid receptor ligands: clinical and PLOS ONE 6 (10): e26158. doi:10.1371/journal.pone.0026158. neuropharmacological considerations, relevant to future drug discovery PubMed: 22039441. and development. Expert Opin Investig Drugs 9 (7): 1553–1571. doi: 134. Caterina MJ, Julius D (2001) The vanilloid receptor: a molecular 10.1517/13543784.9.7.1553. PubMed: 11060760. gateway to the pain pathway. Annu Rev Neurosci 24: 487–517. doi: 115. Gebremedhin D, Lange AR, Campbell WB, Hillard CJ, Harder DR 10.1146/annurev.neuro.24.1.487. PubMed: 11283319. 135. Akopian AN, Sivilotti L, Wood JN (1996) A tetrodotoxin-resistant (1999) Cannabinoid CB1 receptor of cat cerebral arterial muscle voltage-gated sodium channel expressed by sensory neurons. Nature functions to inhibit L-type Ca2+ channel current. Am J Physiol 276 (6 Pt 379 (6562): 257–262. doi:10.1038/379257a0. PubMed: 8538791. 2): H2085-H2093. PubMed: 10362691. 136. Meadows LS, Malhotra J, Loukas A, Thyagarajan V, Kazen-Gillespie 116. Richardson JD, Kilo S, Hargreaves KM (1998) Cannabinoids reduce KA et al. (2002) Functional and biochemical analysis of a sodium hyperalgesia and inflammation via interaction with peripheral CB1 channel beta1 subunit mutation responsible for generalized epilepsy receptors. Pain 75 (1): 111–119. doi:10.1016/S0304-3959(97)00213-3. with febrile seizures plus type 1. J Neurosci 22 (24): 10699–10709. PubMed: 9539680. PubMed: 12486163. 117. Ko MC, Woods JH (1999) Local administration of delta9- 137. Yoo BC, Fountoulakis M, Cairns N, Lubec G (2001) Changes of tetrahydrocannabinol attenuates capsaicin-induced thermal nociception voltage-dependent anion-selective channel proteins VDAC1 and in rhesus monkeys: a peripheral cannabinoid action. VDAC2 brain levels in patients with Alzheimer's disease and Down Psychopharmacology (Berl.) 143 (3): 322–326 syndrome. Electrophoresis 22 (1): 172–179. doi: 118. Nakasaki T, Masuyama K, Fukui H, Ogino S, Eura M et al. (1999) 10.1002/1522-2683(200101)22:1. PubMed: 11197169. Effects of PAF on histamine H1 receptor mRNA expression in rat 138. Agarwal N, Offermanns S, Kuner R (2004) Conditional gene deletion in trigeminal ganglia. Prostaglandins Other Lipid Mediat 58 (1): 29–41. primary nociceptive neurons of trigeminal ganglia and dorsal root doi:10.1016/S0090-6980(99)00021-0. PubMed: 10482285. ganglia. Genesis 38 (3): 122–129. doi:10.1002/gene.20010. PubMed: 119. Héron A, Rouleau A, Cochois V, Pillot C, Schwartz JC et al. (2001) 15048809. Expression analysis of the histamine H(3) receptor in developing rat 139. Ke CB, He WS, Li CJ, Shi D, Gao F et al. (2012) Enhanced tissues. Mech Dev 105 (1-2): 167–173. doi:10.1016/ SCN7A/Nax expression contributes to bone cancer pain by increasing S0925-4773(01)00389-6. PubMed: 11429293. excitability of neurons in dorsal root ganglion. Neuroscience 227: 80– 120. Kashiba H, Senba E (2001) [Primary sensory neurons expressing 89. doi:10.1016/j.neuroscience.2012.09.046. PubMed: 23026072. histamine H1-receptor mRNA]. Nippon Yakurigaku Zasshi 118 (1): 43– 140. Sampson MJ, Decker WK, Beaudet AL, Ruitenbeek W, Armstrong D et 49. doi:10.1254/fpj.118.43. PubMed: 11496826. al. (2001) Immotile sperm and infertility in mice lacking mitochondrial 121. Lazarov NE, Gratzl M (2006) Selective expression of histamine voltage-dependent anion channel type 3. J Biol Chem 276 (42): 39206– receptors in rat mesencephalic trigeminal neurons. Neurosci Lett 404 39212. doi:10.1074/jbc.M104724200. PubMed: 11507092. (1-2): 67–71. doi:10.1016/j.neulet.2006.05.050. PubMed: 16797837. 141. Yamada Y, Masuda K, Li Q, Ihara Y, Kubota A et al. (1995) The 122. Buck L, Axel R (1991) A novel multigene family may encode odorant structures of the human calcium channel alpha 1 subunit (CACNL1A2) receptors: a molecular basis for odor recognition. Cell 65 (1): 175–187. and beta subunit (CACNLB3) genes. Genomics 27 (2): 312–319. doi: doi:10.1016/0092-8674(91)90418-X. PubMed: 1840504. 10.1006/geno.1995.1048. PubMed: 7557998. 123. Zhao H, Ivic L, Otaki JM, Hashimoto M, Mikoshiba K et al. (1998) 142. Coste B, Mathur J, Schmidt M, Earley TJ, Ranade S et al. (2010) Functional expression of a mammalian odorant receptor. Science 279 Piezo1 and Piezo2 are essential components of distinct mechanically (5348): 237–242. doi:10.1126/science.279.5348.237. PubMed: activated cation channels. Science 330 (6000): 55–60. doi:10.1126/ 9422698. science.1193270. PubMed: 20813920. 124. Parmentier M, Libert F, Schurmans S, Schiffmann S, Lefort A et al. 143. Yan J, Edelmayer RM, Wei X, de Felice M, Porreca F et al. (2011) (1992) Expression of members of the putative olfactory receptor gene Dural afferents express acid-sensing ion channels: a role for decreased family in mammalian germ cells. Nature 355 (6359): 453–455. doi: meningeal pH in migraine headache. Pain 152 (1): 106–113. doi: 10.1038/355453a0. PubMed: 1370859. 10.1016/j.pain.2010.09.036. PubMed: 20971560. 125. Spehr M, Gisselmann G, Poplawski A, Riffell JA, Wetzel CH et al. 144. Lai J, Hunter JC, Porreca F (2003) The role of voltage-gated sodium (2003) Identification of a testicular odorant receptor mediating human channels in neuropathic pain. Curr Opin Neurobiol 13 (3): 291–297. doi: sperm chemotaxis. Science 299 (5615): 2054–2058. doi:10.1126/ 10.1016/S0959-4388(03)00074-6. PubMed: 12850213. science.1080376. PubMed: 12663925. 145. Ahrens J, Demir R, Leuwer M, de La Roche J, Krampfl K et al. (2009) 126. Vanderhaeghen P, Schurmans S, Vassart G, Parmentier M (1997) The nonpsychotropic cannabinoid cannabidiol modulates and directly Molecular cloning and chromosomal mapping of olfactory receptor activates alpha-1 and alpha-1-Beta glycine receptor function. genes expressed in the male germ line: evidence for their wide Pharmacologist 83 (4): 217–222. PubMed: 19204413. distribution in the human genome. Biochem Biophys Res Commun 237 146. He H, Liu Z, Dong B, Zhou J, Zhu H et al. (2010) Molecular (2): 283–287. doi:10.1006/bbrc.1997.7043. PubMed: 9268701. determination of selectivity of the site 3 modulator (BmK I) to sodium

PLOS ONE | www.plosone.org 25 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

channels in the CNS: a clue to the importance of Nav1.6 in BmK I- 166. Stephan AB, Shum EY, Hirsh S, Cygnar KD, Reisert J et al. (2009) induced neuronal hyperexcitability. Biochem J 431 (2): 289–298. doi: ANO2 is the cilial calcium-activated chloride channel that may mediate 10.1042/BJ20100517. PubMed: 20678086. olfactory amplification. Proc Natl Acad Sci U_S_A 106 (28): 11776– 147. Emery EC, Young GT, Berrocoso EM, Chen L, McNaughton PA (2011) 11781. doi:10.1073/pnas.0903304106. PubMed: 19561302. HCN2 ion channels play a central role in inflammatory and neuropathic 167. Schöbel N, Radtke D, Lübbert M, Gisselmann G, Lehmann R et al. pain. Science 333 (6048): 1462–1466. doi:10.1126/science.1206243. (2012) Trigeminal ganglion neurons of mice show intracellular chloride PubMed: 21903816. accumulation and chloride-dependent amplification of capsaicin- 148. Schizas N, Lian Ø, Frihagen F, Engebretsen L, Bahr R et al. (2010) induced responses. PLOS ONE 7 (11): e48005. doi:10.1371/ Coexistence of up-regulated NMDA receptor 1 and glutamate on journal.pone.0048005. PubMed: 23144843. nerves, vessels and transformed tenocytes in tendinopathy. Scand J 168. Catterall WA (2000) From ionic currents to molecular mechanisms: the Med Sci Sports 20 (2): 208–215. PubMed: 19422642. structure and function of voltage-gated sodium channels. Neuron 26 149. Chen CD, Wang CS, Huang YH, Chien KY, Liang Y et al. (2007) (1): 13–25. doi:10.1016/S0896-6273(00)81133-2. PubMed: 10798388. Overexpression of CLIC1 in human gastric carcinoma and its 169. Dib-Hajj SD, Cummins TR, Black JA, Waxman SG (2010) Sodium clinicopathological significance. Proteomics 7 (1): 155–167. doi: channels in normal and pathological pain. Annu Rev Neurosci 33: 325– 10.1002/pmic.200600663. PubMed: 17154271. 347. doi:10.1146/annurev-neuro-060909-153234. PubMed: 20367448. 150. Goldberg YP, MacFarlane J, MacDonald ML, Thompson J, Dube MP et 170. Strickland IT, Martindale JC, Woodhams PL, Reeve AJ, Chessell IP et al. (2007) Loss-of-function mutations in the Nav1.7 gene underlie al. (2008) Changes in the expression of NaV1.7, NaV1.8 and NaV1.9 in congenital indifference to pain in multiple human populations. Clin a distinct population of dorsal root ganglia innervating the rat knee joint Genet 71 (4): 311–319. doi:10.1111/j.1399-0004.2007.00790.x. in a model of chronic inflammatory joint pain. Eur J Pain 12 (5): 564– PubMed: 17470132. 572. doi:10.1016/j.ejpain.2007.09.001. PubMed: 17950013. 151. Peier AM, Moqrich A, Hergarden AC, Reeve AJ, Andersson DA et al. 171. Padilla F, Couble ML, Coste B, Maingret F, Clerc N et al. (2007) (2002) A TRP channel that senses cold stimuli and menthol. Cell 108 Expression and localization of the Nav1.9 sodium channel in enteric (5): 705–715. doi:10.1016/S0092-8674(02)00652-9. PubMed: neurons and in trigeminal sensory endings: implication for intestinal 11893340. reflex function and orofacial pain. Mol Cell Neurosci 35 (1): 138–152. 152. Holden JE, Farah EN, Jeong Y (2005) Stimulation of the lateral doi:10.1016/j.mcn.2007.02.008. PubMed: 17363266. hypothalamus produces antinociception mediated by 5-HT1A, 5-HT1B 172. Toledo-Aral JJ, Moss BL, He ZJ, Koszowski AG, Whisenand T et al. and 5-HT3 receptors in the rat spinal cord dorsal horn. Neuroscience (1997) Identification of PN1, a predominant voltage-dependent sodium 135 (4): 1255–1268. doi:10.1016/j.neuroscience.2005.07.023. PubMed: channel expressed principally in peripheral neurons. Proc Natl Acad Sci 16165284. U_S_A 94 (4): 1527–1532. doi:10.1073/pnas.94.4.1527. PubMed: 153. Krasowski MD, Koltchine VV, Rick CE, Ye Q, Finn SE et al. (1998) 9037087. Propofol and other intravenous anesthetics have sites of action on the 173. Ahmad S, Dahllund L, Eriksson AB, Hellgren D, Karlsson U et al. gamma-aminobutyric acid type A receptor distinct from that for (2007) A stop codon mutation in SCN9A causes lack of pain sensation. isoflurane. Mol Pharmacol 53 (3): 530–538. PubMed: 9495821. Hum Mol Genet 16 (17): 2114–2121. doi:10.1093/hmg/ddm160. 154. Ambalavanar R, Dessem D (2009) Emerging peripheral receptor PubMed: 17597096. targets for deep-tissue craniofacial pain therapies. J Dent Res 88 (3): 174. Cox JJ, Reimann F, Nicholas AK, Thornton G, Roberts E et al. (2006) 201–211. doi:10.1177/0022034508330176. PubMed: 19329451. An SCN9A channelopathy causes congenital inability to experience 155. Malan TP, Mata HP, Porreca F (2002) Spinal GABA(A) and GABA(B) pain. Nature 444 (7121): 894–898. doi:10.1038/nature05413. PubMed: receptor pharmacology in a rat model of neuropathic pain. 17167479. Anesthesiology 96 (5): 1161–1167. doi: 175. Zufall F, Pyrski M, Weiss J, Leinders-Zufall T (2012) Link between pain 10.1097/00000542-200205000-00020. PubMed: 11981157. and olfaction in an inherited sodium channelopathy. Arch Neurol 69 (9): 156. Guan YY, Wang GL, Zhou JG (2006) The ClC-3 Cl- channel in cell 1119–1123. doi:10.1001/archneurol.2012.21. PubMed: 22733046. volume regulation, proliferation and apoptosis in vascular smooth 176. Haeseler G, Maue D, Grosskreutz J, Bufler J, Nentwig B et al. (2002) muscle cells. Trends Pharmacol Sci 27 (6): 290–296. doi:10.1016/j.tips. Voltage-dependent block of neuronal and skeletal muscle sodium 2006.04.008. PubMed: 16697056. channels by thymol and menthol. Eur J Anaesthesiol 19 (8): 571–579. 157. Chaplan SR, Guo HQ, Lee DH, Luo L, Liu C et al. (2003) Neuronal doi:10.1097/00003643-200208000-00005. PubMed: 12200946. hyperpolarization-activated pacemaker channels drive neuropathic pain. J Neurosci 23 (4): 1169–1178. PubMed: 12598605. 177. Weiss J, Pyrski M, Jacobi E, Bufe B, Willnecker V et al. (2011) Loss-of- 158. Shaheen R, Alazami AM, Alshammari MJ, Faqeih E, Alhashmi N et al. function mutations in sodium channel Nav1.7 cause anosmia. Nature (2012) Study of autosomal recessive osteogenesis imperfecta in Arabia 472 (7342): 186–190. doi:10.1038/nature09975. PubMed: 21441906. reveals a novel locus defined by TMEM38B mutation. J Med Genet 49 178. Hodgkin AL, Huxley AF (1952) A quantitative description of membrane (10): 630–635. doi:10.1136/jmedgenet-2012-101142. PubMed: current and its application to conduction and excitation in nerve. J 23054245. Physiol Lond 117 (4): 500–544. PubMed: 12991237. 159. Wang W, Atianjoh F, Gauda EB, Yaster M, Li Y et al. (2011) Increased 179. Lossin C, Wang DW, Rhodes TH, Vanoye CG, George AL (2002) expression of sodium channel subunit Nav1.1 in the injured dorsal root Molecular basis of an inherited epilepsy. Neuron 34 (6): 877–884. doi: ganglion after peripheral nerve injury. Anat Rec (Hoboken) 294 (8): 10.1016/S0896-6273(02)00714-6. PubMed: 12086636. 1406–1411. doi:10.1002/ar.21437. PubMed: 21714116. 180. Goadsby PJ (2007) Recent advances in understanding migraine 160. Palecek J, Neugebauer V, Carlton SM, Iyengar S, Willis WD (2004) mechanisms, molecules and therapeutics. Trends Mol Med 13 (1): 39– The effect of a kainate GluR5 receptor antagonist on responses of 44. doi:10.1016/j.molmed.2006.11.005. PubMed: 17141570. spinothalamic tract neurons in a model of peripheral neuropathy in 181. Lynch JW, Callister RJ (2006) Glycine receptors: a new therapeutic primates. Pain 111 (1-2): 151–161. doi:10.1016/j.pain.2004.06.012. target in pain pathways. Curr Opin Investig Drugs 7 (1): 48–53. PubMed: 15327819. PubMed: 16425671. 161. Schroeder BC, Cheng T, Jan YN, Jan LY (2008) Expression cloning of 182. Demir R, Leuwer M, de La Roche J, Krampfl K, Foadi N et al. (2009) TMEM16A as a calcium-activated chloride channel subunit. Cell 134 Modulation of glycine receptor function by the synthetic cannabinoid (6): 1019–1029. doi:10.1016/j.cell.2008.09.003. PubMed: 18805094. HU210. Pharmacologist 83 (5): 270–274. PubMed: 19307742. 162. Dauner K, Lissmann J, Jeridi S, Frings S, Möhrlen F (2012) Expression 183. Berryman M, Bretscher A (2000) Identification of a novel member of the patterns of anoctamin 1 and anoctamin 2 chloride channels in the chloride intracellular channel gene family (CLIC5) that associates with mammalian nose. Cell Tissue Res 347 (2): 327–341. doi:10.1007/ the actin cytoskeleton of placental microvilli. Mol Cell Biol 11 (5): 1509– s00441-012-1324-9. PubMed: 22314846. 1521. doi:10.1091/mbc.11.5.1509. PubMed: 10793131. 163. Pifferi S, Dibattista M, Sagheddu C, Boccaccio A, Al Qteishat A et al. 184. Friedli M, Guipponi M, Bertrand S, Bertrand D, Neerman-Arbez M et al. (2009) Calcium-activated chloride currents in olfactory sensory neurons (2003) Identification of a novel member of the CLIC family, CLIC6, from mice lacking bestrophin-2. J Physiol (Lond.) 587 (Pt 17): 4265– mapping to 21q22.12. Gene 320: 31–40. doi:10.1016/ 4279. doi:10.1113/jphysiol.2009.176131. PubMed: 19622610. S0378-1119(03)00830-8. PubMed: 14597386. 164. Pifferi S, Cenedese V, Menini A (2012) Anoctamin 2/TMEM16B: a 185. Begenisich T (1998) Determining ion channel permeation properties. calcium-activated chloride channel in olfactory transduction. Exp Methods Enzymol 293: 383–390. doi:10.1016/S0076-6879(98)93025-7. Physiol 97 (2): 193–199. PubMed: 21890523. PubMed: 9711620. 165. Rasche S, Toetter B, Adler J, Tschapek A, Doerner JF et al. (2010) 186. Dubin AE, Schmidt M, Mathur J, Petrus MJ, Xiao B et al. (2012) Tmem16b is specifically expressed in the cilia of olfactory sensory Inflammatory signals enhance piezo2-mediated mechanosensitive neurons. Chem Sens 35 (3): 239–245. doi:10.1093/chemse/bjq007. currents. Cell Rep 2 (3): 511–517. doi:10.1016/j.celrep.2012.07.014. PubMed: 20100788. PubMed: 22921401.

PLOS ONE | www.plosone.org 26 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

187. Chen RS, Deng TC, Garcia T, Sellers ZM, Best PM (2007) Calcium 208. Lam DK, Sessle BJ, Cairns BE, Hu JW (2005) Neural mechanisms of channel gamma subunits: a functionally diverse protein family. Cell temporomandibular joint and masticatory muscle pain: a possible role Biochem Biophys 47 (2): 178–186. doi:10.1007/s12013-007-0002-0. for peripheral glutamate receptor mechanisms. Pain Res Manag 10 (3): PubMed: 17652770. 145–152. PubMed: 16175250. 188. Cao YQ (2006) Voltage-gated calcium channels and pain. Pain 126 209. Benton R, Vannice KS, Gomez-Diaz C, Vosshall LB (2009) Variant (1-3): 5–9. doi:10.1016/j.pain.2006.10.019. PubMed: 17084979. ionotropic glutamate receptors as chemosensory receptors in 189. Swayne LA, Bourinet E (2008) Voltage-gated calcium channels in Drosophila. Cell 136 (1): 149–162. doi:10.1016/j.cell.2008.12.001. chronic pain: emerging role of alternative splicing. Pflugers Arch 456 PubMed: 19135896. (3): 459–466. doi:10.1007/s00424-007-0390-4. PubMed: 18389277. 210. North RA, Barnard EA (1997) Nucleotide receptors. Curr Opin 190. Perret D, Luo ZD (2009) Targeting voltage-gated calcium channels for Neurobiol 7 (3): 346–357. doi:10.1016/S0959-4388(97)80062-1. neuropathic pain management. Neurotherapeutics 6 (4): 679–692. doi: PubMed: 9232809. 10.1016/j.nurt.2009.07.006. PubMed: 19789072. 211. Ralevic V, Burnstock G (1998) Receptors for purines and pyrimidines. 191. Waldmann R, Lazdunski M (1998) H(+)-gated cation channels: Pharmacol Rev 50 (3): 413–492. PubMed: 9755289. neuronal acid sensors in the NaC/DEG family of ion channels. Curr 212. Cook SP, Vulchanova L, Hargreaves KM, Elde R, McCleskey EW Opin Neurobiol 8 (3): 418–424. doi:10.1016/S0959-4388(98)80070-6. (1997) Distinct ATP receptors on pain-sensing and stretch-sensing PubMed: 9687356. neurons. Nature 387 (6632): 505–508. doi:10.1038/387505a0. 192. Jarvis MF (2003) Contributions of P2X3 homomeric and heteromeric PubMed: 9168113. channels to acute and chronic pain. Expert Opin Ther Targets 7 (4): 213. Ito G, Suekawa Y, Watanabe M, Takahashi K, Inubushi T et al. (2013) 513–522. doi:10.1517/14728222.7.4.513. PubMed: 12885270. P2X7 receptor in the trigeminal sensory nuclear complex contributes to 193. McMahon SB, Wood JN (2006) Increasingly irritable and close to tears: tactile allodynia/hyperalgesia following trigeminal nerve injury. Eur J TRPA1 in inflammatory pain. Cell 124 (6): 1123–1125. doi:10.1016/ Pain 17 (2): 185–199. doi:10.1002/j.1532-2149.2012.00174.x. PubMed: j.cell.2006.03.006. PubMed: 16564004. 22865777. 194. Clarke VR, Ballyk BA, Hoo KH, Mandelzys A, Pellizzari A et al. (1997) 214. Kuroda H, Shibukawa Y, Soya M, Masamura A, Kasahara M et al.

A hippocampal GluR5 kainate receptor regulating inhibitory synaptic (2012) Expression of P2X₁ and P2X₄ receptors in rat trigeminal ganglion transmission. Nature 389 (6651): 599–603. doi:10.1038/39315. neurons. Neuroreport 23 (13): 752–756. doi:10.1097/WNR. PubMed: 9335499. 0b013e3283568a29. PubMed: 22785548. 195. Wonnacott S, Barik J, Dickinson J, Jones IW (2006) Nicotinic receptors 215. Buell G, Lewis C, Collo G, North RA, Surprenant A (1996) An modulate transmitter cross talk in the CNS: nicotinic modulation of antagonist-insensitive P2X receptor expressed in epithelia and brain. transmitters. J Mol Neurosci 30 (1-2): 137–140. doi:10.1385/JMN: EMBO J 15 (1): 55–62. PubMed: 8598206. 30:1:137. PubMed: 17192660. 216. Burnstock G (2009) Purinergic receptors and pain. Curr Pharm Des 15 196. Li L, Cao XH, Chen SR, Han HD, Lopez-Berestein G et al. (2012) Up- (15): 1717–1735. doi:10.2174/138161209788186335. PubMed: regulation of Cavβ3 subunit in primary sensory neurons increases 19442186. voltage-activated Ca2+ channel activity and nociceptive input in 217. Wirkner K, Sperlagh B, Illes P (2007) P2X3 receptor involvement in neuropathic pain. J Biol Chem 287 (8): 6002–6013. doi:10.1074/ pain states. Mol Neurobiol 36 (2): 165–183. doi:10.1007/ jbc.M111.310110. PubMed: 22187436. s12035-007-0033-y. PubMed: 17952660. 197. Xu J, Pato MT, Torre CD, Medeiros H, Carvalho C et al. (2001) 218. Spehr J, Spehr M, Hatt H, Wetzel CH (2004) Subunit-specific P2X- Evidence for linkage disequilibrium between the alpha 7-nicotinic receptor expression defines chemosensory properties of trigeminal receptor gene (CHRNA7) locus and schizophrenia in Azorean families. neurons. Eur J Neurosci 19 (9): 2497–2510. doi:10.1111/j.0953-816X. Am J Med Genet 105 (8): 669–674. doi:10.1002/ajmg.1549. PubMed: 2004.03329.x. PubMed: 15128403. 11803513. 219. Tecott LH, Maricq AV, Julius D (1993) Nervous system distribution of 198. Quick K, Zhao J, Eijkelkamp N, Linley JE, Rugiero F et al. (2012) the serotonin 5-HT3 receptor mRNA. Proc Natl Acad Sci U_S_A 90 (4): TRPC3 and TRPC6 are essential for normal mechanotransduction in 1430–1434. doi:10.1073/pnas.90.4.1430. PubMed: 8434003. subsets of sensory neurons and cochlear hair cells. Open Biol 2 (5): 220. Hu WP, Li XM, Wu JL, Zheng M, Li ZW (2005) Bradykinin potentiates 120068. doi:10.1098/rsob.120068. PubMed: 22724068. 5-HT3 receptor-mediated current in rat trigeminal ganglion neurons. 199. Doutheil J, Paschen W (1999) Effect of 3,4,5-trimethoxybenzoic acid 8- Acta Pharmacol Sin 26 (4): 428–434. doi:10.1111/j. diethylamino-octyl ester (TMB-8) on neuronal calcium homeostasis, 1745-7254.2005.00074.x. PubMed: 15780191. protein synthesis, and energy metabolism. Pharmacol Toxicol 85 (2): 221. Shi B, Yang R, Wang X, Liu H, Zou L et al. (2012) Inhibition of 5-HT(3) 85–91. PubMed: 10488690. receptors-activated currents by cannabinoids in rat trigeminal ganglion 200. Comings DE, Wu S, Rostamkhani M, McGue M, Lacono WG et al. neurons. J Huazhong Univ Sci Technol Med Sci 32 (2): 265–271. doi: (2003) Role of the cholinergic muscarinic 2 receptor (CHRM2) gene in 10.1007/s11596-012-0047-1. PubMed: 22528232. cognition. Mol Psychiatry 8 (1): 10–11. doi:10.1038/sj.mp.4001095. 222. Hayasaki H, Sohma Y, Kanbara K, Maemura K, Kubota T et al. (2006) PubMed: 12556901. A local GABAergic system within rat trigeminal ganglion cells. Eur J 201. Chiesa A, Crisafulli C, Porcelli S, Han C, Patkar AA et al. (2012) Neurosci 23 (3): 745–757. doi:10.1111/j.1460-9568.2006.04602.x. Influence of GRIA1, GRIA2 and GRIA4 polymorphisms on diagnosis PubMed: 16487155. and response to treatment in patients with major depressive disorder. 223. Chang Y, Wang R, Barot S, Weiss DS (1996) Stoichiometry of a Eur Arch Psychiatry Clin Neurosci 262 (4): 305–311. doi:10.1007/ recombinant GABAA receptor. J Neurosci 16 (17): 5415–5424. s00406-011-0270-y. PubMed: 22057216. PubMed: 8757254. 202. Sorge RE, Trang T, Dorfman R, Smith SB, Beggs S et al. (2012) 224. Cutrer FM, Moskowitz MA (1996) Wolff Award 1996. The actions of Genetically determined P2X7 receptor pore formation regulates valproate and neurosteroids in a model of trigeminal pain. Headache 36 variability in chronic pain sensitivity. Nat Med 18 (4): 595–599. doi: (10): 579–585. doi:10.1046/j.1526-4610.1996.3610579.x. PubMed: 10.1038/nm.2710. PubMed: 22447075. 8990596. 203. Kuhse J, Betz H, Kirsch J (1995) The inhibitory glycine receptor: 225. Krusz JC, Scott V, Belanger J (2000) Intravenous propofol: unique architecture, synaptic localization and molecular pathology of a effectiveness in treating intractable migraine. Headache 40 (3): 224– postsynaptic ion-channel complex. Curr Opin Neurobiol 5 (3): 318–323. 230. doi:10.1046/j.1526-4610.2000.00032.x. PubMed: 10759925. doi:10.1016/0959-4388(95)80044-1. PubMed: 7580154. 226. Rudomin P, Schmidt RF (1999) Presynaptic inhibition in the vertebrate 204. Meisler MH, Kearney JA (2005) Sodium channel mutations in epilepsy spinal cord revisited. Exp Brain Res 129 (1): 1–37. doi:10.1007/ and other neurological disorders. J Clin Invest 115 (8): 2010–2017. doi: s002210050933. PubMed: 10550500. 10.1172/JCI25466. PubMed: 16075041. 227. Price TJ, Cervero F, Gold MS, Hammond DL, Prescott SA (2009) 205. Traynelis SF, Wollmuth LP, McBain CJ, Menniti FS, Vance KM et al. Chloride regulation in the pain pathway. Brain. Res Rev 60 (1): 149– (2010) Glutamate receptor ion channels: structure, regulation, and 170. doi:10.1016/j.brainresrev.2008.12.015. function. Pharmacol Rev 62 (3): 405–496. doi:10.1124/pr.109.002451. 228. Willis WD (2006) John Eccles' studies of spinal cord presynaptic PubMed: 20716669. inhibition. Prog Neurobiol 78 (3-5): 189–214. doi:10.1016/j.pneurobio. 206. Zhou X, Ding Q, Chen Z, Yun H, Wang H (2013) Involvement of 2006.02.007. PubMed: 16650518. GluN2A and GluN2B in synaptic and extrasynaptic NMDA receptor 229. Cho HJ, Staikopoulos V, Ivanusic JJ, Jennings EA (2009) function and neuronal excitotoxicity. J Biol Chem. Hyperpolarization-activated cyclic-nucleotide gated 4 (HCN4) protein is 207. Dingledine R, Borges K, Bowie D, Traynelis SF (1999) The glutamate expressed in a subset of rat dorsal root and trigeminal ganglion receptor ion channels. Pharmacol Rev 51 (1): 7–61. PubMed: neurons. Cell Tissue Res 338 (2): 171–177. doi:10.1007/ 10049997. s00441-009-0869-8. PubMed: 19820968.

PLOS ONE | www.plosone.org 27 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

230. Cho HJ, Staikopoulos V, Furness JB, Jennings EA (2009) hypoxic/anoxic injury and general anesthetics. Expert Opin Ther Pat 19 Inflammation-induced increase in hyperpolarization-activated, cyclic (4): 433–460. doi:10.1517/13543770902765151. PubMed: 19441925. nucleotide-gated channel protein in trigeminal ganglion neurons and 251. Goldstein SA, Bockenhauer D, O'Kelly I, Zilberberg N (2001) the effect of buprenorphine. Neuroscience 162 (2): 453–461. doi: Potassium leak channels and the KCNK family of two-P-domain 10.1016/j.neuroscience.2009.04.063. PubMed: 19409968. subunits. Nat Rev Neurosci 2 (3): 175–184. doi:10.1038/35056032. 231. Hatch RJ, Jennings EA, Ivanusic JJ (2013) Peripheral PubMed: 11256078. hyperpolarization-activated cyclic nucleotide-gated channels contribute 252. Maingret F, Patel AJ, Lesage F, Lazdunski M, Honoré E (2000) to inflammation-induced hypersensitivity of the rat temporomandibular Lysophospholipids open the two-pore domain mechano-gated K(+) joint. Eur J Pain, 17: 972–82. PubMed: 23255289. channels TREK-1 and TRAAK. J Biol Chem 275 (14): 10128–10133. 232. Voets T, Droogmans G, Wissenbach U, Janssens A, Flockerzi V et al. doi:10.1074/jbc.275.14.10128. PubMed: 10744694. (2004) The principle of temperature-dependent gating in cold- and 253. Lafrenière RG, Cader MZ, Poulin JF, Andres-Enguix I, Simoneau M et heat-sensitive TRP channels. Nature 430 (7001): 748–754. doi: al. (2010) A dominant-negative mutation in the TRESK potassium 10.1038/nature02732. PubMed: 15306801. channel is linked to familial migraine with aura. Nat Med 16 (10): 1157– 233. Tominaga M, Caterina MJ, Malmberg AB, Rosen TA, Gilbert H et al. 1160. doi:10.1038/nm.2216. PubMed: 20871611. (1998) The cloned capsaicin receptor integrates multiple pain- 254. Isbrandt D, Leicher T, Waldschütz R, Zhu X, Luhmann U et al. (2000) producing stimuli. Neuron 21 (3): 531–543. doi:10.1016/ Gene structures and expression profiles of three human KCND (Kv4) S0896-6273(00)80564-4. PubMed: 9768840. potassium channels mediating A-type currents I(TO) and I(SA). 234. Reilly CA, Taylor JL, Lanza DL, Carr BA, Crouch DJ et al. (2003) Genomics 64 (2): 144–154. Capsaicinoids cause inflammation and epithelial cell death through 255. Occhiodoro T, Bernheim L, Liu JH, Bijlenga P, Sinnreich M et al. (1998) activation of vanilloid receptors. Toxicol Sci 73 (1): 170–181. doi: Cloning of a human ether-a-go-go potassium channel expressed in 10.1093/toxsci/kfg044. PubMed: 12721390. myoblasts at the onset of fusion. FEBS Lett 434 (1-2): 177–182. doi: 235. Tominaga M, Caterina MJ (2004) Thermosensation and pain. J 10.1016/S0014-5793(98)00973-9. PubMed: 9738473. Neurobiol 61 (1): 3–12. doi:10.1002/neu.20079. PubMed: 15362149. 256. Nyholt DR, LaForge KS, Kallela M, Alakurtti K, Anttila V et al. (2008) A 236. Macpherson LJ, Dubin AE, Evans MJ, Marr F, Schultz PG et al. (2007) high-density association screen of 155 ion transport genes for Noxious compounds activate TRPA1 ion channels through covalent involvement with common migraine. Hum Mol Genet 17 (21): 3318– modification of cysteines. Nature 445 (7127): 541–545. doi:10.1038/ 3331. doi:10.1093/hmg/ddn227. PubMed: 18676988. nature05544. PubMed: 17237762. 257. Heide J, Mann SA, Vandenberg JI (2012) The schizophrenia- 237. Damann N, Voets T, Nilius B (2008) TRPs in our senses. Curr Biol 18 associated Kv11.1-3.1 isoform results in reduced current accumulation (18): R880-R889. doi:10.1016/j.cub.2008.07.063. PubMed: 18812089. during repetitive brief depolarizations. PLOS ONE 7 (9): e45624. doi: 238. Patapoutian A, Peier AM, Story GM, Viswanath V (2003) ThermoTRP 10.1371/journal.pone.0045624. PubMed: 23029143. channels and beyond: mechanisms of temperature sensation. Nat Rev 258. Kinali M, Jungbluth H, Eunson LH, Sewry CA, Manzur AY et al. (2004) Neurosci 4 (7): 529–539. doi:10.1038/nrn1141. PubMed: 12838328. Expanding the phenotype of potassium channelopathy: severe 239. Dinh QT, Groneberg DA, Mingomataj E, Peiser C, Heppt W et al. neuromyotonia and skeletal deformities without prominent Episodic (2003) Expression of substance P and vanilloid receptor (VR1) in Ataxia. Neuromuscul Disord 14 (10): 689–693. doi:10.1016/j.nmd. trigeminal sensory neurons projecting to the mouse nasal mucosa. 2004.06.007. PubMed: 15351427. Neuropeptides 37 (4): 245–250. doi:10.1016/S0143-4179(03)00065-9. 259. Hicks GA, Marrion NV (1998) Ca2+-dependent inactivation of large PubMed: 12906843. conductance Ca2+-activated K+ (BK) channels in rat hippocampal 240. Chung MK, Lee H, Caterina MJ (2003) Warm temperatures activate neurones produced by pore block from an associated particle. J Physiol TRPV4 in mouse 308 keratinocytes. J Biol Chem 278 (34): 32037– (Lond.) 508 (Pt 3): 721–734. doi:10.1111/j.1469-7793.1998.721bp.x. 32046. doi:10.1074/jbc.M303251200. PubMed: 12783886. PubMed: 9518728. 241. Güler AD, Lee H, Iida T, Shimizu I, Tominaga M et al. (2002) Heat- 260. Heidenreich M, Lechner SG, Vardanyan V, Wetzel C, Cremers CW et evoked activation of the ion channel, TRPV4. J Neurosci 22 (15): al. (2012) KCNQ4 K(+) channels tune mechanoreceptors for normal 6408–6414. PubMed: 12151520. touch sensation in mouse and man. Nat Neurosci 15 (1): 138–145. 242. Abbadie C, Honoré P, Besson JM (1994) Intense cold noxious PubMed: 22101641. stimulation of the rat hindpaw induces c-fos expression in lumbar spinal 261. Moreno-Domínguez A, Cidad P, Miguel-Velado E, López-López JR, cord neurons. Neuroscience 59 (2): 457–468. doi: Pérez-García MT (2009) De novo expression of Kv6.3 contributes to 10.1016/0306-4522(94)90609-2. PubMed: 8008200. changes in vascular smooth muscle cell excitability in a hypertensive 243. Mizushima T, Obata K, Katsura H, Yamanaka H, Kobayashi K et al. mice strain. J Physiol (Lond.) 587 (Pt 3): 625–640. doi:10.1113/jphysiol. (2006) Noxious cold stimulation induces mitogen-activated protein 2008.165217. kinase activation in transient receptor potential (TRP) channels TRPA1- 262. Carrasquillo Y, Burkhalter A, Nerbonne JM (2012) A-type K+ channels and TRPM8-containing small sensory neurons. Neuroscience 140 (4): encoded by Kv4.2, Kv4.3 and Kv1.4 differentially regulate intrinsic 1337–1348. doi:10.1016/j.neuroscience.2006.03.024. PubMed: excitability of cortical pyramidal neurons. J Physiol (Lond.) 590 (Pt 16): 16675144. 3877–3890. doi:10.1113/jphysiol.2012.229013. PubMed: 22615428. 244. Munns C, AlQatari M, Koltzenburg M (2007) Many cold sensitive 263. Tsantoulas C, Zhu L, Shaifta Y, Grist J, Ward JPT et al. (2012) Sensory peripheral neurons of the mouse do not express TRPM8 or TRPA1. neuron downregulation of the Kv9.1 potassium channel subunit Cell Calcium 41 (4): 331–342. doi:10.1016/j.ceca.2006.07.008. mediates neuropathic pain following nerve injury. J Neurosci 32 (48): PubMed: 16949152. 17502–17513. doi:10.1523/JNEUROSCI.3561-12.2012. PubMed: 245. Vandewauw I, Owsianik G, Voets T (2013) Systematic and quantitative 23197740. mRNA expression analysis of TRP channel genes at the single 264. Cooper EC (2011) Made for "anchorin": Kv7.2/7.3 (KCNQ2/KCNQ3) trigeminal and dorsal root ganglion level in mouse. BMC Neurosci 14: channels and the modulation of neuronal excitability in vertebrate 21. doi:10.1186/1471-2202-14-S1-P21. PubMed: 23410158. axons. Semin Cell Dev Biol 22 (2): 185–192. doi:10.1016/j.semcdb. 246. Staaf S, Oerther S, Lucas G, Mattsson JP, Ernfors P (2009) Differential 2010.10.001. PubMed: 20940059. regulation of TRP channels in a rat model of neuropathic pain. Pain 144 265. Kim DS, Choi JO, Rim HD, Cho HJ (2002) Downregulation of voltage- (1-2): 187–199. doi:10.1016/j.pain.2009.04.013. PubMed: 19446956. gated potassium channel alpha gene expression in dorsal root ganglia 247. Zimmermann K, Lennerz JK, Hein A, Link AS, Kaczmarek JS et al. following chronic constriction injury of the rat sciatic nerve. Brain Res. (2011) Transient receptor potential cation channel, subfamily C, Mol Brain Res 105 (1-2): 146–152. doi:10.1016/ member 5 (TRPC5) is a cold-transducer in the peripheral nervous S0169-328X(02)00388-1. PubMed: 12399117. system. Proc Natl Acad Sci U_S_A 108 (44): 18114–18119. doi: 266. Santi CM, Ferreira G, Yang B, Gazula VR, Butler A et al. (2006) 10.1073/pnas.1115387108. PubMed: 22025699. Opposite regulation of Slick and Slack K+ channels by 248. So I, Chae MR, Kim SJ, Lee SW (2005) Lysophosphatidylcholine, a neuromodulators. J Neurosci 26 (19): 5059–5068. doi:10.1523/ component of atherogenic lipoproteins, induces the change of calcium JNEUROSCI.3372-05.2006. PubMed: 16687497. mobilization via TRPC ion channels in cultured human corporal smooth 267. Delisle BP, Slind JK, Kilby JA, Anderson CL, Anson BD et al. (2005) muscle cells. Int J Impot Res 17 (6): 475–483. doi:10.1038/sj.ijir. Intragenic suppression of trafficking-defective KCNH2 channels 3901356. PubMed: 16034470. associated with long QT syndrome. Mol Pharmacol 68 (1): 233–240. 249. Gerhold KA, Bautista DM (2009) Molecular and cellular mechanisms of PubMed: 15851652. trigeminal chemosensation. Ann N Y Acad Sci 1170: 184–189. doi: 268. Boda E, Hoxha E, Pini A, Montarolo F, Tempia F (2012) Brain 10.1111/j.1749-6632.2009.03895.x. PubMed: 19686135. expression of Kv3 subunits during development, adulthood and aging 250. Judge SIV, Smith PJ (2009) Patents related to therapeutic activation of and in a murine model of Alzheimer's disease. J Mol Neurosci 46 (3): K(ATP) and K(2P) potassium channels for neuroprotection: ischemic/ 606–615. doi:10.1007/s12031-011-9648-6. PubMed: 21912965.

PLOS ONE | www.plosone.org 28 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

269. Heilstedt HA, Burgess DL, Anderson AE, Chedrawi A, Tharp B et al. fibres. Pain 138 (3): 537–545. doi:10.1016/j.pain.2008.01.031. (2001) Loss of the potassium channel beta-subunit gene, KCNAB2, is PubMed: 18331780. associated with epilepsy in patients with 1p36 deletion syndrome. 289. Maingret F, Lauritzen I, Patel AJ, Heurteaux C, Reyes R et al. (2000) Epilepsia 42 (9): 1103–1111. PubMed: 11580756. TREK-1 is a heat-activated background K(+) channel. EMBO J 19 (11): 270. Hao J, Padilla F, Dandonneau M, Lavebratt C, Lesage F et al. (2013) 2483–2491. doi:10.1093/emboj/19.11.2483. PubMed: 10835347. Kv1.1 channels act as mechanical brake in the senses of touch and 290. Schwandner R, Dziarski R, Wesche H, Rothe M, Kirschning CJ (1999) pain. Neuron 77 (5): 899–914. doi:10.1016/j.neuron.2012.12.035. Peptidoglycan- and lipoteichoic acid-induced cell activation is mediated PubMed: 23473320. by toll-like receptor 2. J Biol Chem 274 (25): 17406–17409. doi: 271. Bartnik M, Szczepanik E, Derwińska K, Wiśniowiecka-Kowalnik B, 10.1074/jbc.274.25.17406. PubMed: 10364168. Gambin T et al. (2012) Application of array comparative genomic 291. Asea A, Rehli M, Kabingu E, Boch JA, Bare O et al. (2002) Novel signal hybridization in 102 patients with epilepsy and additional transduction pathway utilized by extracellular HSP70: role of toll-like neurodevelopmental disorders. Am J Med Genet B Neuropsychiatr receptor (TLR) 2 and TLR4. J Biol Chem 277 (17): 15028–15034. doi: Genet 159 (7): 760–771. PubMed: 22825934. 10.1074/jbc.M200497200. PubMed: 11836257. 272. Murphy GG, Fedorov NB, Giese KP, Ohno M, Friedman E et al. (2004) 292. Underhill DM, Ozinsky A, Hajjar AM, Stevens A, Wilson CB et al. Increased neuronal excitability, synaptic plasticity, and learning in aged (1999) The Toll-like receptor 2 is recruited to macrophage phagosomes Kvbeta1.1 knockout mice. Curr Biol 14 (21): 1907–1915. doi:10.1016/ and discriminates between pathogens. Nature 401 (6755): 811–815. j.cub.2004.10.021. PubMed: 15530391. doi:10.1038/44605. PubMed: 10548109. 273. Bocksteins E, Raes AL, van de Vijver G, Bruyns T, van Bogaert PP et 293. Alexopoulou L, Holt AC, Medzhitov R, Flavell RA (2001) Recognition of al. (2009) Kv2.1 and silent Kv subunits underlie the delayed rectifier K+ double-stranded RNA and activation of NF-kappaB by Toll-like receptor current in cultured small mouse DRG neurons. Am J Physiol Cell 3. Nature 413 (6857): 732–738. doi:10.1038/35099560. PubMed: Physiol 296 (6): C1271-C1278. doi:10.1152/ajpcell.00088.2009. 11607032. PubMed: 19357235. 294. Lewis SS, Hutchinson MR, Zhang Y, Hund DK, Maier SF et al. (2013) 274. Zou A, Lin Z, Humble M, Creech CD, Wagoner PK et al. (2003) Glucuronic acid and the ethanol metabolite ethyl-glucuronide cause toll- Distribution and functional properties of human KCNH8 (Elk1) like receptor 4 activation and enhanced pain. Brain Behav. Immun. potassium channels. Am J Physiol Cell Physiol 285 (6): C1356-C1366. 295. Bastos LFS, Godin AM, Zhang Y, Jarussophon S, Ferreira BCS et al. doi:10.1152/ajpcell.00179.2003. PubMed: 12890647. (2013) A minocycline derivative reduces nerve injury-induced allodynia, 275. Kingwell K (2012) Genetics: mutations in potassium channel KCNT1-a LPS-induced prostaglandin E2 microglial production and signaling via novel driver of epilepsy pathogenesis. Nat. Rev Neurol 8 (12): 658. doi: toll-like receptors 2 and 4. Neurosci Lett. 10.1038/nrneurol.2012.229. 296. Verkman AS, Yang B, Song Y, Manley GT, Ma T (2000) Role of water 276. Mongan LC, Hill MJ, Chen MX, Tate SN, Collins SD et al. (2005) The channels in fluid transport studied by phenotype analysis of aquaporin distribution of small and intermediate conductance calcium-activated knockout mice. Exp Physiol 85: 233S-241S. doi:10.1111/j.1469-445X. potassium channels in the rat sensory nervous system. Neuroscience 2000.tb00028.x. PubMed: 10795927. 131 (1): 161–175. doi:10.1016/j.neuroscience.2004.09.062. PubMed: 297. Xu GY, Wang F, Jiang X, Tao J (2010) Aquaporin 1, a potential 15680700. therapeutic target for migraine with aura. Mol Pain 6: 68. doi: 277. Blankenship ML, Coyle DE, Baccei ML (2013) Transcriptional 10.1186/1744-8069-6-68. PubMed: 20969805. expression of voltage-gated Na⁺ and voltage-independent K⁺ channels 298. Jung J, Nam JH, Park HW, Oh U, Yoon JH et al. (2013) Dynamic in the developing rat superficial dorsal horn. Neuroscience 231: 305– modulation of ANO1/TMEM16A HCO3(-) permeability by Ca2+/ 314.. calmodulin. Proc Natl Acad Sci U_S_A 110 (1): 360–365. doi:10.1073/ 278. Sabharwal RK, Gupta M, Sharma D, Mehndiratta MM, Anjaneyulu A pnas.1211594110. PubMed: 23248295. (1990) Hemiplegic migraine. J Assoc Physicians India 38 (3): 227–228. 299. Colbran RJ, Brown AM (2004) Calcium/calmodulin-dependent protein PubMed: 2391303. kinase II and synaptic plasticity. Curr Opin Neurobiol 14 (3): 318–327. 279. Zhang YH, Vasko MR, Nicol GD (2002) Ceramide, a putative second doi:10.1016/j.conb.2004.05.008. PubMed: 15194112. messenger for nerve growth factor, modulates the TTX-resistant Na(+) 300. Price TJ, Jeske NA, Flores CM, Hargreaves KM (2005) current and delayed rectifier K(+) current in rat sensory neurons. J Pharmacological interactions between calcium/calmodulin-dependent Physiol (Lond.) 544 (Pt 2): 385–402 doi:10.1113/jphysiol.2002.024265. kinase II alpha and TRPV1 receptors in rat trigeminal sensory neurons. PubMed: 12381813. Neurosci Lett 389 (2): 94–98. doi:10.1016/j.neulet.2005.07.029. 280. Takeda M, Tsuboi Y, Kitagawa J, Nakagawa K, Iwata K et al. (2011) PubMed: 16095822. Potassium channels as a potential therapeutic target for trigeminal 301. Hargreaves RJ, Shepheard SL (1999) Pathophysiology of migraine-- neuropathic and inflammatory pain. Mol Pain 7: 5. doi: new insights. Can J Neurol Sci 26 Suppl 3: S12-S19. PubMed: 10.1186/1744-8069-7-5. PubMed: 21219657. 10563228. 281. Camerino DC, Tricarico D, Desaphy JF (2007) Ion channel 302. Durham PL, Masterson CG (2013) Two mechanisms involved in pharmacology. Neurotherapeutics 4 (2): 184–198. doi:10.1016/j.nurt. trigeminal CGRP release: implications for migraine treatment. 2007.01.013. PubMed: 17395128. Headache 53 (1): 67–80. doi:10.1111/j.1526-4610.2012.02262.x. 282. Rajan S, Wischmeyer E, Xin Liu G, Preisig-Müller R, Daut J et al. PubMed: 23095108. (2000) TASK-3, a novel tandem pore domain acid-sensitive K+ 303. Amara SG, Arriza JL, Leff SE, Swanson LW, Evans RM et al. (1985) channel. An extracellular histiding as pH sensor. J Biol Chem 275 (22): Expression in brain of a messenger RNA encoding a novel 16650–16657. doi:10.1074/jbc.M000030200. PubMed: 10747866. neuropeptide homologous to calcitonin gene-related peptide. Science 283. La JH, Kang D, Park JY, Hong SG, Han J (2006) A novel acid-sensitive 229 (4718): 1094–1097. doi:10.1126/science.2994212. PubMed: K+ channel in rat dorsal root ganglia neurons. Neurosci Lett 406 (3): 2994212. 244–249. doi:10.1016/j.neulet.2006.07.039. PubMed: 16904821. 304. Kim AY, Tang Z, Liu Q, Patel KN, Maag D et al. (2008) Pirt, a 284. Takeda M, Tanimoto T, Ikeda M, Nasu M, Kadoi J et al. (2006) phosphoinositide-binding protein, functions as a regulatory subunit of Enhanced excitability of rat trigeminal root ganglion neurons via TRPV1. Cell 133 (3): 475–485. doi:10.1016/j.cell.2008.02.053. decrease in A-type potassium currents following temporomandibular PubMed: 18455988. joint inflammation. Neuroscience 138 (2): 621–630. doi:10.1016/ 305. Caterina MJ, Leffler A, Malmberg AB, Martin WJ, Trafton J et al. (2000) j.neuroscience.2005.11.024. PubMed: 16387448. Impaired nociception and pain sensation in mice lacking the capsaicin 285. Takeda M, Kitagawa J, Takahashi M, Matsumoto S (2008) Activation of receptor. Science 288 (5464): 306–313. doi:10.1126/science. interleukin-1beta receptor suppresses the voltage-gated potassium 288.5464.306. PubMed: 10764638. currents in the small-diameter trigeminal ganglion neurons following 306. Kim SJ, Park GH, Kim D, Lee J, Min H et al. (2011) Analysis of cellular peripheral inflammation. Pain 139 (3): 594–602. doi:10.1016/j.pain. and behavioral responses to imiquimod reveals a unique itch pathway 2008.06.015. PubMed: 18694623. in transient receptor potential vanilloid 1 (TRPV1)-expressing neurons. 286. Ichikawa H, Sugimoto T (2003) Kv1.2-immunoreactive primary sensory Proc Natl Acad Sci U_S_A 108 (8): 3371–3376. doi:10.1073/pnas. neurons in the rat trigeminal ganglion. Brain Res 974 (1-2): 222–227. 1019755108. PubMed: 21300878. doi:10.1016/S0006-8993(03)02583-6. PubMed: 12742640. 307. Patel KN, Liu Q, Meeker S, Undem BJ, Dong X (2011) Pirt, a TRPV1 287. Xu W, Wu Y, Bi Y, Tan L, Gan Y et al. (2010) Activation of voltage- modulator, is required for histamine-dependent and -independent itch. gated KCNQ/Kv7 channels by anticonvulsant retigabine attenuates PLOS ONE 6 (5): e20559. doi:10.1371/journal.pone.0020559. PubMed: mechanical allodynia of inflammatory temporomandibular joint in rats. 21655234. Mol Pain 6: 49. doi:10.1186/1744-8069-6-49. PubMed: 20796319. 308. Tang Z, Kim A, Masuch T, Park K, Weng H et al. (2013) Pirt functions 288. Roza C, Lopez-Garcia JA (2008) Retigabine, the specific KCNQ as an endogenous regulator of TRPM8. Nat Commun 4: 2179. channel opener, blocks ectopic discharges in axotomized sensory PubMed: 23863968.

PLOS ONE | www.plosone.org 29 November 2013 | Volume 8 | Issue 11 | e79523 Expression Profile of the Trigeminal Ganglia

309. Haywood SA, Simonian SX, van der Beek EM, Bicknell RJ, Herbison 319. Andratsch M, Mair N, Constantin CE, Scherbakov N, Benetti C et al. AE (1999) Fluctuating estrogen and progesterone receptor expression (2009) A key role for gp130 expressed on peripheral sensory nerves in in brainstem norepinephrine neurons through the rat estrous cycle. pathological pain. J Neurosci 29 (43): 13473–13483. doi:10.1523/ Endocrinology 140 (7): 3255–3263. doi:10.1210/en.140.7.3255. JNEUROSCI.1822-09.2009. PubMed: 19864560. PubMed: 10385422. 320. Sonkoly E, Muller A, Lauerma AI, Pivarcsi A, Soto H et al. (2006) IL-31: 310. Lee H, Sininger L, Jen JC, Cha YH, Baloh RW et al. (2007) Association a new link between T cells and pruritus in atopic skin inflammation. J of progesterone receptor with migraine-associated vertigo. Allergy Clin Immunol 117 (2): 411–417. doi:10.1016/j.jaci.2005.10.033. Neurogenetics 8 (3): 195–200. doi:10.1007/s10048-007-0091-3. PubMed: 16461142. PubMed: 17609999. 321. Dillon SR, Sprecher C, Hammond A, Bilsborough J, Rosenfeld-Franklin 311. Kondo D, Yabe R, Kurihara T, Saegusa H, Zong S et al. (2006) M et al. (2004) Interleukin 31, a cytokine produced by activated T cells, Progesterone receptor antagonist is effective in relieving neuropathic induces dermatitis in mice. Nat Immunol 5 (7): 752–760. doi:10.1038/ pain. Eur J Pharmacol 541 (1-2): 44–48. doi:10.1016/j.ejphar. ni1084. PubMed: 15184896. 2006.05.010. PubMed: 16759651. 322. Darian-Smith J (1973) The trigeminal system. In A Iggo. Handbook of 312. Rivera C, Voipio J, Payne JA, Ruusuvuori E, Lahtinen H et al. (1999) sensory physiology. Berlin: Springer Verlag. The K+/Cl- co-transporter KCC2 renders GABA hyperpolarizing during 323. Cody FW, Lee RW, Taylor A (1972) A functional analysis of the neuronal maturation. Nature 397 (6716): 251–255. doi:10.1038/16697. components of the mesencephalic nucleus of the fifth nerve in the cat. PubMed: 9930699. J Physiol Lond 226 (1): 249–261. PubMed: 4263681. 313. Ben-Ari Y (2002) Excitatory actions of gaba during development: the 324. Lazarov NE (2007) Neurobiology of orofacial proprioception. Brain. Res nature of the nurture. Nat Rev Neurosci 3 (9): 728–739. doi:10.1038/ Rev 56 (2): 362–383. doi:10.1016/j.brainresrev.2007.08.009. nrn920. PubMed: 12209121. 325. Godfrey PA, Malnic B, Buck LB (2004) The mouse olfactory receptor 314. Kaneko H, Nakamura T, Lindemann B (2001) Noninvasive gene family. Proc Natl Acad Sci U_S_A 101 (7): 2156–2161. doi: measurement of chloride concentration in rat olfactory receptor cells 10.1073/pnas.0308051100. PubMed: 14769939. with use of a fluorescent dye. Am J Physiol Cell Physiol 280 (6): 326. Miyawaki A, Matsushita F, Ryo Y, Mikoshiba K (1994) Possible C1387-C1393. PubMed: 11350733. pheromone-carrier function of two lipocalin proteins in the vomeronasal 315. Reisert J, Lai J, Yau KW, Bradley J (2005) Mechanism of the excitatory organ. EMBO J 13 (24): 5835–5842. PubMed: 7813422. Cl- response in mouse olfactory receptor neurons. Neuron 45 (4): 553– 327. Cheng KT, Chan FL, Huang Y, Chan WY, Yao X (2003) Expression of 561. doi:10.1016/j.neuron.2005.01.012. PubMed: 15721241. olfactory-type cyclic nucleotide-gated channel (CNGA2) in vascular 316. Pieraut S, Lucas O, Sangari S, Sar C, Boudes M et al. (2011) An tissues. Histochem Cell Biol 120 (6): 475–481. doi:10.1007/ autocrine neuronal interleukin-6 loop mediates chloride accumulation s00418-003-0596-2. PubMed: 14618336. and NKCC1 phosphorylation in axotomized sensory neurons. J 328. Serizawa S, Miyamichi K, Takeuchi H, Yamagishi Y, Suzuki M et al. Neurosci 31 (38): 13516–13526. doi:10.1523/JNEUROSCI. (2006) A neuronal identity code for the odorant receptor-specific and 3382-11.2011. PubMed: 21940443. activity-dependent axon sorting. Cell 127 (5): 1057–1069. doi:10.1016/ 317. Sung KW, Kirby M, McDonald MP, Lovinger DM, Delpire E (2000) j.cell.2006.10.031. PubMed: 17129788. Abnormal GABAA receptor-mediated currents in dorsal root ganglion 329. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J et al. (2009) The neurons isolated from Na-K-2Cl cotransporter null mice. J Neurosci 20 Sequence Alignment/Map format and SAMtools. Bioinformatics 25 (16): (20): 7531–7538. PubMed: 11027211. 2078–2079. doi:10.1093/bioinformatics/btp352. PubMed: 19505943. 318. Langeslag M, Constantin CE, Andratsch M, Quarta S, Mair N et al. 330. Shiao MS, Chang AY, Liao BY, Ching YH, Lu MJ et al. (2012) (2011) Oncostatin M induces heat hypersensitivity by gp130-dependent Transcriptomes of mouse olfactory epithelium reveal sexual differences sensitization of TRPV1 in sensory neurons. Mol Pain 7: 102. doi: in odorant detection. Genome Biol Evol 4 (5): 703–712. doi: 10.1186/1744-8069-7-102. PubMed: 22196363. 10.1093/gbe/evs039. PubMed: 22511034.

PLOS ONE | www.plosone.org 30 November 2013 | Volume 8 | Issue 11 | e79523 Kapitel 3 - Comprehensive RNA-Seq Expression Analysis of Sensory Ganglia with a Focus on Ion Channels and GPCRs in Trigeminal Ganglia

Supplementary Material

Aufgrund der großen Anzahl untersuchter Gene sind die Fig. S4- Fig. S11 und Tab. S1- Tab. S3 nur online einzusehen: http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0079523

Figure S1. Expression strength for housekeeping genes in all analyzed tissues. Expression analysis for known expressed housekeeping genes. To show that our calculated FPKM values for all tissues in principle is comparable, we analyzed the expression of known expressed housekeeping genes, which could be detected in all our tested samples.

Figure S2. Distribution of FPKM values compared for the different used tissues. The highest number of genes is expressed between 1 - 10 FPKM in all tissues. There are less high expressed genes with an FPKM of > 100.

Kapitel 3 - Comprehensive RNA-Seq Expression Analysis of Sensory Ganglia with a Focus on Ion Channels and GPCRs in Trigeminal Ganglia

Figure S3. Integrative Genomic Viewer. Mapped reads for 1 kb large gene, being expressed with 1 FPKM.

25 Kapitel 3 - Comprehensive RNA-Seq Expression Analysis of Sensory Ganglia with a Focus on Ion Channels and GPCRs in Trigeminal Ganglia

Figure S13. Comparison of the gene expression for the OE and TG, OE and DRG.

Kapitel 4 - Expression Profile of Ectopic Olfactory Receptors Determined by Deep Sequencing

Kapitel 4

Expression Profile of Ectopic Olfactory Receptors Determined by Deep Sequencing

Caroline Flegel, Stavros Maneniotis, Sandra Osthold, Hanns Hatt, Günther Gisselmann

Published in PLoS ONE Vol. 8(2): e55368 doi:10.1371

Feb. 6, 2013

27 Expression Profile of Ectopic Olfactory Receptors Determined by Deep Sequencing

Caroline Flegel, Stavros Manteniotis, Sandra Osthold, Hanns Hatt, Gu¨ nter Gisselmann* Department of Cell Physiology, Ruhr-University Bochum, Bochum, Germany

Abstract Olfactory receptors (ORs) provide the molecular basis for the detection of volatile odorant molecules by olfactory sensory neurons. The OR supergene family encodes G-protein coupled proteins that belong to the seven-transmembrane-domain receptor family. It was initially postulated that ORs are exclusively expressed in the olfactory epithelium. However, recent studies have demonstrated ectopic expression of some ORs in a variety of other tissues. In the present study, we conducted a comprehensive expression analysis of ORs using an extended panel of human tissues. This analysis made use of recent dramatic technical developments of the so-called Next Generation Sequencing (NGS) technique, which encouraged us to use open access data for the first comprehensive RNA-Seq expression analysis of ectopically expressed ORs in multiple human tissues. We analyzed mRNA-Seq data obtained by Illumina sequencing of 16 human tissues available from Illumina Body Map project 2.0 and from an additional study of OR expression in testis. At least some ORs were expressed in all the tissues analyzed. In several tissues, we could detect broadly expressed ORs such as OR2W3 and OR51E1. We also identified ORs that showed exclusive expression in one investigated tissue, such as OR4N4 in testis. For some ORs, the coding exon was found to be part of a transcript of upstream genes. In total, 111 of 400 OR genes were expressed with an FPKM (fragments per kilobase of exon per million fragments mapped) higher than 0.1 in at least one tissue. For several ORs, mRNA expression was verified by RT-PCR. Our results support the idea that ORs are broadly expressed in a variety of tissues and provide the basis for further functional studies.

Citation: Flegel C, Manteniotis S, Osthold S, Hatt H, Gisselmann G (2013) Expression Profile of Ectopic Olfactory Receptors Determined by Deep Sequencing. PLoS ONE 8(2): e55368. doi:10.1371/journal.pone.0055368 Editor: Johannes Reisert, Monell Chemical Senses Center, United States of America Received September 25, 2012; Accepted December 21, 2012; Published February 6, 2013 Copyright: ß 2013 Flegel et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: Caroline Flegel was funded by the Heinrich und Alma Vogelsang Stiftung. Hanns Hatt was funded by the DFG-Sonderforschungsbereich 642 ‘‘GTP- and ATP dependent membrane processes’’. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscripts. Competing Interests: The authors have declared that no competing interests exist. * E-mail: [email protected]

Introduction Parmentier and colleagues reported that mammalian ORs are also expressed in a non-olfactory tissue (testis) [10]. Later, Spehr and Olfactory receptors (ORs) detect volatile odorant molecules in colleagues demonstrated the functional expression of an OR in the environment. In 1991, Linda Buck and Richard Axel human spermatozoa [11]. Activation of OR1D2 in spermatozoa identified a supergene family that encodes G-protein coupled by the odorant bourgeonal influences the swimming direction and receptor proteins (GPCRs) in olfactory epithelium of the rat [1]. swimming speed of spermatozoa. The expression of more than 50 These authors postulated that ORs are exclusively expressed in the ORs has been detected in the testes of several species including olfactory epithelium, where they are located in the cilia of human, dog, mouse and rat [10–14]. The well characterized olfactory sensory neurons. In 1998, Zhao et al. showed that ORs OR51E2, also known as PSGR, is highly expressed in prostate serve as neuronal odorant sensors [2]. The superfamily of ORs in [15,16]. Activation of this receptor by its specific ligand inhibits the humans represents the largest gene family known; about it proliferation of prostate cancer cells [17]. Moreover, odorants contains approximately 400 functional OR genes and approxi- reaching the luminal environment of the gut may stimulate mately 600 non-functional OR pseudogenes [3,4]. OR genes are serotonin release via ORs present in enterochromaffin cells [18]. found throughout the human genome except on chromosome 20 These examples illustrate the importance and some of the possible and the Y chromosome [4,5]. They are usually organized in function of ORs outside the olfactory epithelium. Although many clusters that are found mostly in telomeric regions [6]. Most OR past studies have focused on the expression of ORs, most have genes have an intron-free reading frame of approximately 1000 only studied expression in a single mammalian tissue. Expression nucleotides that encodes ,330 amino acids [1,5,7]. Some ORs, of individual OR transcripts in various tissues, including the including MHC-linked ORs, have splice variants in the 59 autonomic nervous system [19], brain [20–22], tongue [23,24], untranslated gene regions (59UTRs), suggesting that the transcrip- erythroid cells [25], prostate [15], placenta [26], gut [18] and tion of these genes involves an unusual and complex regulatory kidney [27], has been described. So far, only a few systematic mechanism [8,9]. studies have analyzed the entire olfactory subtranscriptome in a Recent studies have shown that expression of receptors encoded variety of different human tissues. These studies were performed by the OR supergene family is not restricted to the olfactory using EST data and microarray analysis [28,29]. The results of epithelium. In 1992, only one year after the discovery of ORs,

PLOS ONE | www.plosone.org 1 February 2013 | Volume 8 | Issue 2 | e55368 Ectopic Expression of Olfactory Receptors these studies do not correlate well with each other, and only a few negative rate (Figure S3D). However, our statistical analysis human ORs were detected using either approach [29]. showed that genes below this threshold with FPKM values The new high-throughput mRNA sequencing (RNA-Seq) between 0.01 and 0.1 are also truly positive in 83.5% of cases. We technique, which is based on Next Generation Sequencing decided to leave these expressed ORs in our analysis, labeling (NGS), has emerged as one of the most promising new them as a group of ‘potentially expressed’ genes. This was partially developments in quantitative expression profiling [30,31]. RNA- based on the fact that the analyzed RNA was derived from Seq provides high-resolution measurement of expression and is a complex organs that contain different cell types; we supposed that suitable method for comprehensive expression analysis. One small FPKM values between 0.01 and 0.1 could indicate the advantage of NGS is that it makes it possible to reanalyze existing expression of genes in a small number of specific cells. In addition, sequencing data for a variety of purposes, such as the detection of we compared two independent sequencing runs of the same tissue novel transcribed gene loci and splice variants. In addition, NGS to a different tissue. We detected 51 ORs in the 75-bp single-read techniques allow comparison of data from different studies [32]. In data set of testis tissue within a range of 0.01–0.1 FPKM. Sixty- recent years, the transcriptomes of a variety of tissues have been seven percent of these ORs were also detected in the indepen- sequenced, and transcriptome data have accumulated in public dently sequenced paired-end testis data set, indicating that the data bases. Recently, RNA-Seq data sets of 16 different human most of the OR transcripts within this expression range are truly tissues were generated as part of the Illumina Body Map project positive and not artificial. In contrast, we detected only 6% (3 of 2.0 (http://www.illumina.com). We reanalyzed these large data 51) of these ORs in the analysis of skeletal muscle data. This sets to establish a comprehensive overview of ectopic OR gene indicates that the weakly expressed ORs are not derived from expression in multiple human tissues. In a subsequent experiment, randomly distributed mapped reads (Figure S4). expression of the most interesting ORs was verified by RT-PCR. We analyzed the expression of ORs in each of the 16 different tissues. Due to the number of generated sequences in the Body Results Map project 2.0, the expression of ORs is typically confirmed by hundreds to thousands of mapped reads. For example, the highly Due to the recent dynamic development of the NGS technique, expressed OR51E2 gene (8.5 FPKM in prostate) is confirmed by a large number of transcriptome data sets obtained from multiple 2320 mapped reads, and the less highly expressed OR51E1 gene projects have accumulated. Several groups have already reana- (0.8 FPKM in prostate) is confirmed by 353 reads (Figure 1A). lyzed these data for a variety of purposes [33–35]. In our study, we Calculated for prostate tissue with 78 million aligned reads, an reanalyzed the available RNA-Seq data from human tissues to FPKM value of ,0.01–0.02 represents two mapped reads in a 1- assess the expression of OR genes in a broad range of tissues. The kb exon. Illumina Body Map project 2.0 is a comprehensive human transcriptome project. We investigated sequence data for 16 Expression of OR Genes different human tissues generated within this project and analyzed We detected ectopically expressed OR genes in each of the 16 the 75-bp single-read data sets, which typically consist of ,80 tissues investigated. The lowest number of expressed OR genes million reads. The large number of sequences produced by the was found in liver (2 ORs), and the highest number was found in HiSeq2000 Genome Analyzer provide for very sensitive gene testis (55 ORs) (Figure 1B; FPKM .0.1). In each tissue except expression analysis, and the properties of NGS data permit skeletal muscle, some ORs were exclusively expressed (Figure 1C). comparison between different studies. For further comparison, We calculated the cumulative expression of ORs (the sum of all testis transcriptome data from an additional study was analyzed OR FPKM values per tissue) and found that OR genes are more [36] (Table 1). To generate comparable expression data, we highly expressed in testis than in any other tissue (Figure S5). We reanalyzed the human NGS transcriptome data starting from the checked the sequence similarities of the most highly ectopically fastq raw data sets. expressed OR genes. Due to their coding sequence similarity (99– Sequencing results were analyzed by TopHat and Cufflinks 100%), the FPKM values of OR2A4 and OR2A7, as well as those software. Reads were mapped onto the human reference genome of OR2A1 and OR2A42 are presented together. (hg19). Expression values were calculated for each sample based We next analyzed OR gene expression patterns. Of the 400 OR on the number of fragments per kilobase of exon per million genes, 111 ORs showed FPKM values higher than 0.1, and 10 fragments mapped (FPKM) [37] (Table S1). In a rough scale, 1 showed values higher than 1 FPKM, in at least one tissue. Ninety- FPKM corresponds to weak expression, 10 FPKM to moderate one additional ORs were expressed at an FPKM between 0.01– expression and 100 FPKM to high expression. As a basis for 0.1 in at least one tissue; these were regarded as potentially comparison, we calculated the FPKM values for typical house- expressed genes (Figure S3). The three most highly expressed keeping genes. For example, the strongly expressed ß-actin gene receptors were OR4N4 in testis (9.9 FPKM), OR51E2 in prostate yields an expression value between ,500–5000 FPKM, while the (8.5 FPKM) and OR2W3 in thyroid (5.1 FPKM). To establish a weakly to moderate expressed TATA box binding protein is general ranking of ectopically expressed ORs, we calculated the detected at ,1.6–21 FPKM (Figure S1). To gain an impression of sum of all FPKM values for each respective OR in all 16 tissues. In FPKM values for the expression of genes, we calculated a total, 40 ORs had cumulative FPKM values of at least 0.5; these histogram of FPKM value distribution for brain tissue (Figure S2). were defined as the most highly ectopically expressed ORs. Our analysis detected the expression of ,17000 genes in the Interestingly, we observed that a wide variety of tissues expressed appropriate tissue (FPKM .0.1 out of all ,23000 genes). similar sets of ORs. Of the broadly expressed ORs, OR51E2 was We next defined a threshold for classification of a gene as found in 12 different tissue samples, OR51E1 was found in 13 expressed. A comparison of mapped reads between exon and samples, and OR2W3 was found in 9, while several other specific intergenic regions was used to estimate an FPKM value that transcripts were found in 13 or fewer tissues (FPKM .0.1; indicates with high confidence a level of gene expression above Figure 2). As expected, we detected high expression of OR51E2 in background level, as described by Ramsko¨ld et al. [32] (Figure S3). prostate, but it was also expressed in various other tissues. Other We set the threshold value at 0.1 FPKM, which is slightly higher widely expressed receptors were OR52N4 and OR2A4/7. Several than the intersection of the false discovery rate and the false receptors were specifically expressed in only one tissue, primarily

PLOS ONE | www.plosone.org 2 February 2013 | Volume 8 | Issue 2 | e55368 Ectopic Expression of Olfactory Receptors

Table 1. Summary of RNA-Seq data.

Sample Organism read length read structure Total prepared Reads with at least one reported alignment (%) Source

Adipose human 75 bp single 76269225 71283632 (93%) Body Map 2.0 Adrenal human 75 bp single 76171569 71161611 (93%) Body Map 2.0 Brain human 75 bp single 64313204 60789593 (95%) Body Map 2.0 Breast human 75 bp single 77195260 71996826 (93%) Body Map 2.0 Colon human 75 bp single 80257757 75646124 (94%) Body Map 2.0 Heart human 75 bp single 76766862 72517553 (95%) Body Map 2.0 Kidney human 75 bp single 79772393 74520114 (93%) Body Map 2.0 Liver human 75 bp single 77453877 72420736 (94%) Body Map 2.0 Lung human 75 bp single 81255438 75348205 (93%) Body Map 2.0 Lymph Node human 75 bp single 81916460 74638341 (91%) Body Map 2.0 Ovar human 75 bp single 81003052 76139023 (94%) Body Map 2.0 Prostate human 75 bp single 83319902 78237991 (94%) Body Map 2.0 Skeletal Muscle human 75 bp single 82864636 76882152 (93%) Body Map 2.0 Testis human 75 bp single 82044319 76801169 (94%) Body Map 2.0 Testis 2 human 32 bp single 28654069 25767031 (90%) Wang et al., 2008 Testis 3 human 50 bp paired-end 81836199 left: 77403519 (95%) Body Map 2.0 right: 75427140 (92%) Thyroid human 75 bp single 80246657 74860275 (93%) Body Map 2.0 Thyroid 2 human 50 bp paired-end 81912887 left: 78512529 (96%) Body Map 2.0 right: 76452409 (93%) White Blood Cells human 75 bp single 82785673 77253598 (93%) Body Map 2.0

doi:10.1371/journal.pone.0055368.t001 in testis (OR4N4, OR6F1 and OR2H1) (Figure 1C and 2). No ORs in Testis specific ORs were found in skeletal muscle. The expression of ORs in testis has been reported for a number of species [13,39,40]. Our study identified testis as the tissue with Expression of OR Pseudogenes the largest number of detected OR transcripts (Figure 1 and 4A). There are slightly more annotated OR pseudogenes than OR Comparison of the two RNA-Seq data sets for testis used in this genes; in contrast to OR genes, OR pseudogenes lack full open study (Table 1) showed that 36 ORs were detected in testis using reading frames (ORF). In our analysis, some OR pseudogenes either data set (Figure 4C). The high expression of OR4N4 found showed a broad expression pattern. We detected expression of 254 in both RNA-Seq data sets is striking (Figure 4B). While human of these OR pseudogenes in at least one tissue (FPKM .0.01). Of OR1D2 could be detected in both data sets, it showed lower these, 144 were detected in at least one tissue with an FPKM value FPKM values than the most highly expressed ORs and was not higher than 0.1. In the 16 tissues, we detected 62 OR pseudogenes exclusively expressed in testis, confirming the results of Feldmesser with summed FPKM values higher than 0.5; of these, 58% belong and colleagues [28]. Several studies have reported an expression of to the OR7E subfamily, the largest subfamily in the human OR the MHC-linked ORs, which are localized within a cluster on the repertoire (Figure 3). This subfamily has most likely expanded in short arm of chromosome 6 [9,41]. In total, 6 of the 15 MHC- the human genome through a series of segmental gene duplication linked OR-genes were detected in both investigated testis samples. events [38]. OR7E24 is the only member of this family that is not OR2H1, a member of this prominent group, is testis-specific. a pseudogene. In general, OR pseudogenes showed FPKM values similar to those of the OR genes. In some cases, OR pseudogene OR Expression Analysis expression exceeded the expression of OR genes. For example, To identify potential artificial results that might be caused by OR7E47P showed an FPKM value of 24 in lung tissue, and nearby or overlapping highly expressed genes, we analyzed the OR2A9P and OR2A20P were nearly ubiquitously and highly distribution of mapped reads for the 20 most highly expressed OR expressed, with FPKMs of up to 20. Other highly but more genes in all tissues using the Integrative Genomic Viewer. The specifically expressed OR pseudogenes were also found, for possible interference of adjacent highly expressed genes was example, OR10J6P in liver (5.3 FPKM), OR52K3P in white suggested previously [28]. In contrast to microarray or RT-PCR blood cells (5.3 FPKM), and OR7E19P (2.6 FPKM) and OR4N1P data, RNA-Seq permits detailed analysis at the level of de novo (2.2 FPKM) in testis (Figure 3). We checked the sequence detection of exons and splice sites. For highly expressed OR genes similarities of the most highly ectopically expressed OR pseudo- such as OR51E1 and OR51E2, the aligned sequences in known genes. The OR pseudogenes that showed sequence similarities exon regions had equal distributions, while intron-spanning reads between 99 and 100% are listed together (Figure 3). were found to connect known 59UTRs with the ORF-containing exons (Figure 1A). No mapped reads were found within 2 kb up- or downstream of the adjacent OR gene regions.

PLOS ONE | www.plosone.org 3 February 2013 | Volume 8 | Issue 2 | e55368 Ectopic Expression of Olfactory Receptors

Figure 1. Detection of weakly and highly expressed ORs with RNA-Seq. A: Sample representation of read coverage of weakly and highly expressed ORs detected in the prostate and visualized by the Integrative Genomic Viewer. The gray segments indicate reads that were mapped onto the reference genome. The gene is indicated by black bars (exon) and thin lines (intron). Above, the read coverage is shown (detected and mapped counts/bases at each respective position). B: Each bar represents the number of OR genes (black) or OR pseudogenes (gray) that were expressed in one of the 16 investigated tissues with an FPKM value .0.1. The largest number of ORs were detected in testis, brain and ovary; only a few ORs were detected in skeletal muscle and liver. C: The bar diagram shows the number of ORs exclusively expressed in each tissue. Exclusively expressed ORs have greater FPKM values than 0.1 in the tissue indicated and are expressed at FPKM values lower than 0.1 in all other tissues. Testis had the greatest number of exclusively expressed ORs. In skeletal muscle, no exclusively expressed ORs were detected. doi:10.1371/journal.pone.0055368.g001

The expression pattern of other ORs with high FPKM values or (Figure S7). Therefore, our results suggest that OR2W3 and broad expression was more complex (Figure 5). In several tissues, Trim58 expression are under control of the same promoter. In this the FPKM values of OR2W3 and the nearby gene Trim58 case, it seems that OR2W3 expression is a byproduct of erroneous correlate with each other (Figure 5A). According to our splice splicing. Nevertheless, in some human tissues, the expression analysis, OR2W3 shares exons with Trim58 (Figure 5C). RNA- values of OR2W3 exceed those of Trim58 (Figure 5A). We were Seq indicated the presence of chimeric transcripts that code for a not able to detect chimeric transcripts in every tissue by RNA-Seq; prematurely terminated Trim58 protein but also contain the this indicates different control of the expression of OR2W3 in complete intact coding sequence of OR2W3; however, the some tissues. We also detected splice junctions from exon 5 of OR2W3 coding sequence is not in frame with the Trim58 coding Trim58 to OR2T8. These transcripts code for a part of Trim58 sequence (Figure 5C). The detected chimeric transcripts were and the complete intact coding sequence of OR2T8 (Figure 5C). confirmed by RT-PCR with a forward primer located in exon 5 of Translation of this protein could encode a new protein combining the Trim58 gene and a reverse primer located in the ORF of features of Trim58 and OR2T8. Similar shared 59UTR exons OR2W3 (Figure 5B). The analysis of available EST clones have been demonstrated for OR5V1 and OR12D3 within the confirmed the presence of chimeric transcripts of Trim58 and MHC locus [9]. A similar constellation of fused transcripts was OR2W3. We found clones containing only the last two exons, 5 observed in the paired-end data sets for thyroid tissue (data not and 6, of Trim58, indicating a potential different initiation site of shown). transcription (Figure 5C). However, RT-PCR experiments with a A slightly different situation was found for OR4N4 expression. forward primer located in exon 3 or 4 of Trim58 and a reverse The OR4N4 gene has chimeric transcripts with an uncharacter- primer located in the ORF of OR2W3 revealed a specific ized non-coding RNA loc727924. Both are almost exclusively fragment, indicating that the EST clones may be incomplete and present in testis (Figure 5A and D). Chimeric transcript expression that further upstream exons belong to the chimeric transcript was verified by RT-PCR (Figure 5B). Both EST clones and RNA-

PLOS ONE | www.plosone.org 4 February 2013 | Volume 8 | Issue 2 | e55368 Ectopic Expression of Olfactory Receptors

Figure 2. Expression pattern of ectopically expressed ORs. The heat map shows FPKM values for the 40 most highly expressed ORs found in the human tissues studied. Dark blue indicates high expression (FPKM values higher than 3), and white indicates no expression. ORs are sorted by the sum of their expression values across all tissues. doi:10.1371/journal.pone.0055368.g002

PLOS ONE | www.plosone.org 5 February 2013 | Volume 8 | Issue 2 | e55368 Ectopic Expression of Olfactory Receptors

PLOS ONE | www.plosone.org 6 February 2013 | Volume 8 | Issue 2 | e55368 Ectopic Expression of Olfactory Receptors

Figure 3. Pattern of expression of OR pseudogenes in different tissues. All OR pseudogenes with summed FPKM values .0.5 across all 16 from Body Map 2.0 are listed. The color intensity represents the FPKM value. Of the expressed pseudogenes, 58% belong to the 7E subfamily; genes in this family are indicated by bold letters. doi:10.1371/journal.pone.0055368.g003

Seq of loc727924 and OR4N4 revealed a complex expression difficult to speculate whether OR2A7 or the non-coding pattern in this gene region. EST clone analysis confirmed the loc728377 is expressed. presence of the chimeric transcripts loc727924 and OR4N4. All of We analyzed the 20 most highly expressed ORs and detected 6 these transcripts start from an unannotated 59UTR exon located ORs that form chimeric transcripts with upstream genes in at least between exons 3 and 4 of loc727924. Consistent with this, we one investigated tissue. In these cases, expression might be caused detected splice junctions from this unannotated exon to the by nearby genes or involve unknown 59UTRs that lie within annotated exon 4 of loc727924 but no splice junctions derived nearby genes (Figure 6A). In some cases, no annotated genes could from the upstream exons of loc727924, indicating independent be located in the upstream OR regions, indicating common expression of OR4N4 (Figure 5D). These findings suggest that two 59UTRs for many OR transcripts. types of transcripts are expressed. One variant starts at exon 1 of For the 20 most highly ectopically expressed ORs, we also loc727924 but never contains OR4N4. The second variant starts checked for splicing events within the ORF (Figure 6B). In some with a 59UTR consisting of the newly identified exon between tissues, two different internal splice variants of OR51E1 were exons 3 and 4 of loc727924 and exons 4–8 of loc727924 followed observed. OR4N4, which almost exclusively occurs in testis, has by the complete coding sequence of OR4N4. Fused transcripts of one internal splice variant (Figure 6C). The occurrence of splicing loc727924 and OR4N3P could also be detected. events similar to these has been described in recent studies [8,9]. In two further RT-PCR verified cases, expression may have In consequence, the fraction of mRNAs with intact ORFs is been partly caused by or influenced by nearby genes. First, reduced. Furthermore, we observed that some genomic regions OR7E14P shares chimeric transcripts with the Plekha7 gene. are highly and uniformly expressed. OR expression could not be Second, a part of the OR2A7 ORF overlays with exon 13 of specifically assigned when ORs are located in such a cluster. For loc728377 (Figure 5B and E). Because these genes overlap, it is example, OR13E1P in brain is located in a highly expressed gene

Figure 4. Expression of ORs in testis. A: Expression profile for the 60 most highly expressed OR genes and pseudogenes in two testis samples, sorted by FPKM values of Testis 2. B: Plotted expression pattern correlation for all detected ORs in two testis samples. R2 is the coefficient of determination. C: Venn diagram showing the intersection of OR transcripts detected in two independent RNA-Seqs of human testis (FPKM .0.1). In both RNA-Seq analyses, we detected 36 identical ORs. (Testis 1 = Body Map 2.0; Testis 2 = Wang et al., 2008). doi:10.1371/journal.pone.0055368.g004

PLOS ONE | www.plosone.org 7 February 2013 | Volume 8 | Issue 2 | e55368 Ectopic Expression of Olfactory Receptors

PLOS ONE | www.plosone.org 8 February 2013 | Volume 8 | Issue 2 | e55368 Ectopic Expression of Olfactory Receptors

Figure 5. Chimeric transcripts of different ectopically expressed ORs in various tissues. A: The table shows expression values for four different ORs and their respective nearby genes in various tissues. Corresponding chimeric transcripts could be detected in different tissues. B: PCR experiments confirmed the observed chimeric transcripts of these ORs. OR2W3 shares chimeric transcripts with the Trim58 gene, while OR2A7 shares chimeric transcripts with part of loc728377. In testis only, OR4N4 shows chimeric transcripts with the loc727924 gene. The OR pseudogene OR7E14P yield chimeric transcripts with the Plekha7 gene. We confirmed the amplified PCR products by Sanger sequencing. C: Schematic representation of the detected chimeric transcripts of Trim58 with OR2W3 and OR2T8. RNA-Seq of thyroid tissue reveals a complex splice pattern (red arcs) leading to chimeric transcripts of Trim58 and OR2W3 or OR2T8 as well as chimeric transcripts of OR2W3 with OR2T8. The green arrows indicate ORFs. Depending on the used splice sites, the reading frame of the odorant receptor can, in principle, be intact or fused to the Trim58 reading frame. D: Splicing between the uncharacterized loc727924 gene and the OR4N4 or OR4N3P in testis. Parts of the coding exon of OR4M2 gene overlap with exons of the loc727924 gene. E: Chimeric transcripts of OR2A7 and loc728377 in kidney. The coding exon of OR2A7 overlaps with exon 13 of the loc728377 gene. doi:10.1371/journal.pone.0055368.g005 cluster of ,10 kb (Figure S8). We also focused on the dependence nents of olfaction (ORs, adenylyl cyclase III and the Ga subunit of OR expression on the genomic environment to investigate Gaolf) in the kidneys of mice and suggested a functional role for whether the expression of non-OR gene neighbors influences the these components in the modulation of renin secretion and expression of ORs (Figure S9). We found that 71% of expressed glomerular filtration rate [27]. ORs and OR pseudogenes were located next to at least one non- In olfactory neurons, binding of an odorant to its appropriate OR gene. In contrast, 43% of ORs and OR pseudogenes that had OR leads, in principle, to the activation of a cAMP-activated an OR neighbor were ectopically expressed in at least one tissue. second messenger pathway that involves Gaolf, adenylyl cyclase III The results indicate that ORs with a non-OR neighbor have a and the CNG channel subunits CNGA2, CNGA4 and CNGB1 higher tendency to be expressed than ORs that are located next to [42]. Gaolf signaling is enhanced by the nucleotide exchange factor other OR genes. Ric8b [43]. Our analysis indicates that the basic components of olfactory signal transduction components, the specific Ga subunit Verification of OR Expression Results by RT-PCR Gaolf and the adenylyl cyclase III, could be detected in all tissues. Today, RT-PCR is considered the ‘‘gold standard’’ for However, the CNGA2 subunit of CNG channels was only expression analysis. In this study, we used RT-PCR to confirm detected in testis (Figure 8). several examples of the NGS expression data from six tissues. In the last step of our analysis, we focused on the expression of Because we do not have access to the original samples analyzed by other GPCR-type chemoreceptors, namely trace amine receptors the Body Map project, we used commercially available RNA (TAARs), bitter (TAS2Rs) and sweet/umami receptors (TAS1Rs) samples from human brain, breast, colon, kidney, lung and testis. and vomeronasal type 1 receptor (VN1R). VN1R1 was detected in Although these tissues are from other donors than those who various tissues by RNA-Seq (Figure 9). The taste receptors provided tissues for the Body Map project, we could validate the TAS1R3 (sweet taste receptor), TAS2R14 and TAS2R20 (both expression of the interesting broadly expressed ORs (Figure 7A). bitter taste receptors) showed broad expression in all 16 For four of the six investigated tissues we confirmed all of the investigated tissues. While TAAR1 expression in ovary is NGS-detected ORs by RT-PCR. One OR in lung tissue and appreciable, the expression patterns for other TAARs are weak. seven of 26 ORs in breast tissue could not be confirmed by PCR (Figures 7B and S10). In some cases, we detected expressed OR Discussion genes by RT-PCR but not by NGS sequencing, indicating that RT-PCR is more sensitive than our RNA-Seq analysis for Comprehensive analyses of the ectopic expression of ORs in extremely weakly expressed transcripts. Additionally, we cannot human tissues are still rare. In this paper, we analyzed exclude differences between tissues obtained from different donors. transcriptome data generated by the relatively new NGS method In this context, our RT-PCR experiments indicate the expression RNA-Seq. This method allowed a comparable and quantitative of OR2W3 in breast and kidney, whereas the NGS data did not. investigation of OR expression at the mRNA level. Previous We found that OR51E1 was not detected with PCR in our studies have investigated OR gene expression by microarray available breast tissue despite a robust FPKM value for this gene in analysis, which has methodical limitations for the analysis of the RNA-Seq analysis. OR51E1 was detected in the lung RNA ectopically expressed ORs [29,44]. Using the RNA-Seq approach, sample by RT-PCR. OR2A4/7, which is not detectable in brain we were able to determine the expression of OR genes and RNA by deep sequencing, was evident by RT-PCR in the brain pseudogenes in various tissues independently, in contrast to RNA sample. Despite the use of RNA samples from different microarray analysis, which only allows the comparison of OR donors in the RT-PCR and NGS sequencing experiments, it was expression levels between different tissue samples [44]. RNA-Seq in general possible to confirm broad and exclusively expressed has been shown to be highly accurate for quantifying expression ORs by RT-PCR. Furthermore, our experiments indicated that levels, and its accuracy has been confirmed many times by there might be differences in OR expression between different quantitative PCR [45]. Weakly expressed genes that are difficult to donors, depending on the exact localization of the tissue samples analyze with microarrays can be detected by NGS at a high and the gender and age of the donors. sequencing depth (.40 million reads) [37]. With more than 70 million generated reads for each tissue in the Body Map project Signaling Pathway Components and Other 2.0, it is obvious that these data provide a more accurate basis for comparison of gene expression than microarray analysis [46]. We Chemosensors established a comprehensive analysis of ectopically expressed Next, we determined the expression pattern of components human ORs using the suitable method of RNA-Seq; the results of other than ORs that are involved in olfactory signal transduction. this analysis represent an important step towards understanding Data on the expression of such components can serve as a hint for the molecular basis of ectopically expressed ORs. the existence of downstream olfactory signal transduction. As an example, Pluznick et al. measured the expression of key compo-

PLOS ONE | www.plosone.org 9 February 2013 | Volume 8 | Issue 2 | e55368 Ectopic Expression of Olfactory Receptors

Figure 6. Analysis of OR transcripts across tissues. A: Analysis of the 20 most highly expressed ORs (summed FPKM .1). The graphic illustrates the presence of detected chimeric transcripts or unannotated untranslated regions in the upstream areas of the respective OR ORF. B: Overview of detected internal splicing events within the ORF of the 20 most highly expressed ORs. The heat map indicates the level of expression of the respective receptor and the detected internal splicing events (red frames). C: Schematic representation of detected internal splicing events of the broadly expressed OR51E1 and the testis-specific OR4N4. doi:10.1371/journal.pone.0055368.g006

PLOS ONE | www.plosone.org 10 February 2013 | Volume 8 | Issue 2 | e55368 Ectopic Expression of Olfactory Receptors

PLOS ONE | www.plosone.org 11 February 2013 | Volume 8 | Issue 2 | e55368 Ectopic Expression of Olfactory Receptors

Figure 7. Validation of RNA-Seq results using RT-PCR. A: Gel electrophoresis of the amplified PCR products from cDNA samples (+) of brain, breast, colon, kidney, lung and testis. The RNA of the investigated tissues does not contain genomic DNA contamination, as shown in (2). The presence of broadly expressed ORs detected by RNA-Seq could be confirmed by RT-PCR. B: Table showing the summarized PCR validation in comparison to RNA-Seq data. We investigated 26 different ORs that showed broad or high expression. Green color indicates the detection of ORs with the respective technique; red color indicates no detection. doi:10.1371/journal.pone.0055368.g007

Ectopically Expressed ORs (73%) are also expressed in the human olfactory epithelium (Figure In general, we found that 111 of the 400 ORs in the genome are S12). We suggest that ectopically expressed ORs do not form a expressed with high confidence in at least one tissue (FPKM .0.1). separate group with other functions than ORs that are expressed We detected transcripts of different ORs in all 16 of the human in the olfactory epithelium. tissues we investigated. However, the number of expressed OR A large number of ORs are pseudogenes. In our study, 31% of genes was tissue-dependent; it ranged from 2 in liver to 55 in testis. all OR pseudogenes were expressed in at least one non-olfactory This indicates considerably lower OR expression than was tissue. Previous studies have described pseudogene expression in previously estimated based on microarray data from human olfactory epithelium. It was hypothesized that a suggested olfactory epithelium (76% of all ORs) [29] or RNA-Seq data of nonsense-mediated decay RNA system might not remove OR murine olfactory epithelium, in which virtually all ORs are pseudogene mRNA and that the expression of OR pseudogenes expressed [47]. may play a role in the regulation of OR gene expression in In agreement with previous studies, our results indicate broad olfactory sensory neurons [29]. Expression of OR pseudogenes in ectopic expression of some ORs [28,29,44,48]. Previous studies non-olfactory tissues may be involved in similar processes of gene have indicated that lung and heart display the highest number of regulation, but the exact reason for the expression of OR ectopically expressed ORs [28,29]. Our data, however, clearly pseudogenes is unclear. identify testis as the tissue with the highest number of expressed ORs, and indicate a possible important functional role of ORs in Expression Level of ORs testis. However, the functionalities of the majority of ectopically Based on our calculated FPKM values, mRNA for most ORs is expressed ORs are uncertain because functional data are still of low abundance. In an expression ranking of ,23000 genes, sparse. The majority of the most highly ectopically expressed ORs ORs are typically found at positions .10000. Overall, we detected

Figure 8. Expression of signaling pathway components across tissues. Expression analysis of signaling components including, Gaolf (GNAL), adenylyl cyclase III (ADCY3), CNG channel subunits (CNGA2, CNGA4 and CNGB1), calcium-activated chloride channel (ANO2) and the nucleotide exchange factor Ric8b (RIC8B). We also investigated the expression of accessory proteins including receptor-transporting proteins (RTP1 and RTP2) and receptor-enhancing proteins 1 (REEP1), as well as the expression of the olfactory marker protein (OMP), a specific marker for olfactory sensory neurons. doi:10.1371/journal.pone.0055368.g008

PLOS ONE | www.plosone.org 12 February 2013 | Volume 8 | Issue 2 | e55368 Ectopic Expression of Olfactory Receptors

PLOS ONE | www.plosone.org 13 February 2013 | Volume 8 | Issue 2 | e55368 Ectopic Expression of Olfactory Receptors

Figure 9. Expression of other chemosensors in human tissues. TAARs show very weak or no expression in the investigated tissues, while the taste receptors TAS1R and TAS2R show detectable expression across the investigated tissues. The vomeronasal receptors (VN1R), namely VN1R1, show a widespread expression pattern. doi:10.1371/journal.pone.0055368.g009 the expression of 111 ORs at FPKM higher than 0.1 in at least one Seq may therefore be regarded as the minimum number of tissue. Compared to housekeeping genes, the FPKM values of expressed ORs in the respective tissue. ORs indicate weaker gene expression; their level of expression is roughly comparable to that of the TATA box binding protein, Most Highly Ectopically Expressed ORs with an average expression value of 3 in the case of OR51E2. In Our analysis provides a list of OR genes that are transcribed in many cases, the FPKM values of OR genes were lower than 1, a variety of human tissues. To the best of our knowledge, ligands indicating that their overall expression in the respective tissues is for only two of the 20 most highly ectopically expressed ORs, are weak. known [17,50,51]. The ß-ionone receptor OR51E2 is highly The RNA samples investigated in this study were all extracted expressed in prostate tissue. The prominent expression of OR51E2 from whole organs. Therefore, it is possible that ORs are highly and its possible physiological functions have already been expressed in specific cell types that represent a small fraction of the described [17,52]. The second deorphanized OR is the 3- tissues that make up these organs. A similar pattern, referred to as methyl-valeric acid and nonanoic acid receptor OR51E1, which mosaic gene expression, could be shown for TAAR1 in brain [49]. was recently postulated as a marker for neuroendocrinic carcino- In several reports describing the ectopic expression of ORs, it was ma cells and is overexpressed in human prostate cancer [53,54]. shown that only a few cells in some complex tissues express ORs, Fujita and colleagues demonstrated that OR51E1 is also expressed adenylyl cyclase III or Gaolf. For instance, in the gut, ORs were in various human tissues, a finding that is consistent with our detected in human gastrointestinal enterochromaffin cells, which results [50]. Our investigations showed that there is almost constitute only a minor proportion of the total intestinal ubiquitous expression of both these receptors in the tissues epithelium and have a diffuse distribution [18]. In mouse kidney, investigated in this study. The results suggest a general involve- Gaolf and adenylyl cyclase III were detected at the RNA and ment of OR51E1 and OR51E2 in physiological processes, and the protein levels in the distal nephrons [27]. In RNA isolated from effect of their ligands on these tissues should be tested in the future. these tissues, RNA from these cells is extremely diluted; thus, the The other highly expressed orphan ORs are interesting candidates respective FPKM values are low or expression is not detectable. for further deorphanization studies, however, their functionality in For similar reasons, we cannot assess whether the low FPKM a recombinant system has not yet been shown. values observed in our study depend on generally low expression We analyzed EST and microarray data for five most highly or on mosaic expression. We suggest that expression of ORs even ectopically expressed ORs which were available on NCBI. Ectopic at very low FPKM values could be meaningful and could indicate OR2W3 expression is confirmed by EST data from fetal brain, the involvement of these gene products in physiological processes. blood and liver as well as with microarray data in breast cancer The investigation of ORs at the cellular resolution level by in situ cells [55]. The RNA-Seq data showed that OR4N4 is highly and hybridization or immunohistochemistry of whole tissue slices specifically expressed in testis, a finding that is confirmed by EST might be a suitable approach to localize the expression of OR data. The expression of OR2A1 is known to be regulated in transcripts or proteins and would indicate whether there are response to chemotherapy in ovarian cancer [56]. EST data specialized cell types or areas that highly express OR transcripts. indicate expression OR2A1 in lung and several tumors. As we In this regard, it is plausible that there might be other expressed have shown here, OR2A1/42 is broadly expressed in various ORs in different tissues that are not detectable by RNA-Seq human tissues. Consistent with our results, the EST data for analysis of whole organs or complete tissues. The detection of ORs OR2A7 indicate that it is expressed in more than 20 different at the protein level is important to gain more information about human tissues. In general, RNA-Seq results for broadly expressed the functionality of ectopically expressed ORs. ORs are confirmed by EST data, and ORs with many known EST Our RT-PCR validation confirmed the NGS data. We clones have higher FPKM values in our analyses. All of the measured the expression of 26 OR genes in six different tissues available previous data indicate that there is broad expression of (brain, breast, colon, kidney, lung, testis) by RT-PCR. We selected ORs in different tissues. Our data extend previous results and ORs that showed broad expression or high expression in specific permit quantitative and comprehensive analysis of the expression tissues. In five of the six investigated tissues, all receptors detected of ORs in different tissues. by RNA-Seq, with the exception of only one receptor in lung We found the largest number of OR transcripts in testis (55 tissue, were confirmed by RT-PCR. For breast tissue, we ORs; FPKM .0.1); six of these ORs showed expression values confirmed only 56% of the NGS-detected ORs by RT-PCR. higher than 1 FPKM. We also detected the well-characterized The breast tissue investigated by RNA-Seq was obtained from a OR1D2 and OR7A5, as well as 40% of the MHC-linked ORs, in 29-year-old female, whereas the breast tissue used for our RT- testis [11,14]. It is speculated that the latter ORs may be involved PCR experiments originated from a 52-year-old female. The in the detection of MHC peptides in testis and spermatozoa [41]. expression pattern of ORs in breast tissue might change with age A number of studies have already addressed the expression and or as a result of environmental influences. Although the cDNA function of ORs in spermatozoa and testis of various species [10– probes used for RT-PCR were prepared from different tissue 14]. In addition to involvement in the process of chemotaxis in samples than the Body Map project tissues, the OR expression spermatozoa, ORs could be involved in sperm development and pattern in five of the six investigated tissues was conserved. competition or interaction between spermatozoa and oocytes Furthermore, we detected more ORs by RT-PCR than by RNA- [39,41,57]. Our results support the idea that ORs are involved in Seq. Discrepancies between RT-PCR and RNA-Seq could be physiological processes in testis and spermatozoa. expected due to the higher sensitivity of RT-PCR in comparison to our RNA-Seq data sets. The number of ORs detected by RNA-

PLOS ONE | www.plosone.org 14 February 2013 | Volume 8 | Issue 2 | e55368 Ectopic Expression of Olfactory Receptors

Interference of OR Expression with Upstream Non-OR that could direct proteins to the ER and Golgi apparatus [58]. The Genes Trim58/OR2T8 protein would be an interesting candidate for The use of RNA-Seq permitted expression analysis not only of functional characterization. all ORs as well as OR pseudogenes but also analysis of all other genes expressed in each tissue. With this advantage, we were able Chimeric Transcripts with loc727924 to investigate the possible interference of neighboring genes with OR4N4 is highly and almost exclusively expressed in testis and OR gene expression. Feldmesser et al. reported that ORs located displays chimeric transcripts with an upstream gene locus, within 0.5 M of non-OR genes have a higher tendency to be loc727924. Originally defined by Rinn and Chang, loc727924 is expressed than others [28]. We confirmed this and also found that a long non-coding RNA [64]. Because our analysis revealed that OR genes located adjacent to non-OR genes, have a higher all chimeric transcripts start at a new, unannotated exon between tendency to be expressed. In addition, we detected chimeric exons 3 and 4 of loc717924, we propose that these chimeric transcripts consisting of ORs and upstream non-olfactory genes. transcripts have a different initiation site of transcription than the Previous studies have reported the presence of chimeric transcripts loc727924 transcript and that part of the loc727924 locus serves as for non-OR genes in the human Body Map 2.0 data sets from a complex 59UTR for OR4N4. Previous studies have shown that healthy tissues [58]. It is possible that the chimeric transcripts long non-coding RNAs can activate the expression of protein- found in healthy tissues encode new proteins with different coding genes in their immediate genomic neighborhood [65]. functions [59,60]. In our study, we described chimeric transcripts Various 59 untranslated exons have been detected in human and for ORs and upstream genes and verified several by RT-PCR. mouse OR genes, especially in expressed transcripts of testis The occurrence of such chimeric transcripts may explain the [9,66,67]. It is known that transcription of MOR23, the murine ectopic expression of some ORs in healthy non-olfactory tissues; lyral receptor, is initiated from two distinct regions and that these the exact mechanisms and reasons for their production remain be are differentially utilized in the olfactory epithelium and testis [7]. discovered. The authors of that study postulated that different 59UTR We also identified new, unannotated 59UTRs for several ORs; structures may be required for posttranscriptional regulation of these may represent chimeric transcripts shared with unannotated the expression of this OR. Initiation of transcription of the genes or a complex pattern of the 59UTRs of ORs. A previous OR4N4 gene in the human olfactory epithelium would be an study showed that testicular OR gene transcripts are generated by interesting aspect to investigate to evaluate whether transcription a highly unorthodox combination of complex transcriptional of this gene is regulated in a novel way. It has been already events, including long-distance and intracoding exon splicing [9]. postulated that the OR genes that are expressed in diverse tissues Another possible explanation of seemingly broad ectopic require different promoters for flexible transcriptional regulation, a expression was suggested, for example, in the cases of OR5K2 feature that has already been demonstrated for other genes [9,68]. and OR13E1P. These genes are located within a large and highly expressed gene region that is uniformly covered with aligned reads Internal Splicing with no visible intron/exon structure. It is probable that aligned Previous analysis of mouse EST data suggested that splicing reads do not originate from any OR gene expression. Such within the OR ORF can, for example, produce a protein with only artifacts in gene expression cannot be detected by RT-PCR or five transmembrane domains [8]. Our investigation of internal microarray analysis; however, they become obvious following splicing events revealed the existence of ORF splice variants of at detailed RNA-Seq analysis. least 3 out of the 20 most highly expressed ORs in some tissues; these splice variants do not encode complete OR proteins with Chimeric Transcripts with Trim58 seven transmembrane domains. For example, we showed that We observed that in some tissues expression of OR2W3 internal splicing within the ORF of OR4N4 occurs and that the correlates with the expression of Trim58. We found that OR2W3 number of transcripts of the complete ORF is therefore reduced. shares transcripts with Trim58. The 59 portion of the shared Due to a frame shift, splicing leads to premature termination after transcripts is coded by Trim58 (up to exon 6); it is spliced at its 39 RNA coding for 90 amino acids has been transcribed. Due to end to an exon containing the complete OR2W3 ORF. Due to the premature stops or frame shifts, internal splicing within the prediction that in most eukaryotes mRNA translation initiates at broadly expressed OR51E1 transcript can also lead to a protein the first AUG starting from the 59-cap [61], this transcript would containing only the first OR transmembrane domain. Therefore, code for a truncated Trim58 protein and not for a fused protein we think that in several of the cases analyzed in this study, internal that also contains OR2W3. However, OR2W3 could be translated splicing leads to the production of non-functional OR proteins. if the internal start ATG of the OR2W3 ORF were used. All trim Relevant to this, it should be determined whether potential genes (tripartite motif-containing genes) provide proteins that have truncated OR proteins interfere with the function of complete OR three specific motifs (a RING finger, a B-box and coiled coil proteins. The results of this study indicate that some ectopically motifs). Trim proteins bind unwanted proteins and tag them with OR transcripts may not code for a functional protein. ubiquitin. They are involved in a broad range of biological processes, and some function as important regulators in carcino- Other Genes genesis [62]. Interestingly, a previous study showed that mRNA In olfactory neurons, binding of an odorant to its OR activates a expression for OR2W3 and Trim58 in blood cells is downregu- cAMP-mediated second messenger pathway consisting of Gaolf, lated if beta-adrenergic receptor antagonists are applied [63]. adenylyl cyclase III and CNG-channels. As Plutznick and OR2T8 is also part of a chimeric transcript with Trim58 that colleagues have already shown using mouse kidney, expression was detected in some tissues. In this case, the chimeric transcript of these major elements is not restricted to primary chemosensory codes for a chimeric protein comprising a portion of the N- cells [27]. Although most of the basic components of the cAMP- terminus of the Trim58 protein and a portion of the C-terminus of mediated pathway were detected in all tissues, the specific subunit the OR2T8 protein. Frenkel-Morgenstern and colleagues showed CNGA2 of CNG channels is expressed only in testis, an indication that chimeric transcripts found using NGS could also be detected that a potential olfactory signal transduction pathway targets at the protein level. Some chimeras incorporate signal peptides effectors other than cAMP-gated ion channels. Spehr and

PLOS ONE | www.plosone.org 15 February 2013 | Volume 8 | Issue 2 | e55368 Ectopic Expression of Olfactory Receptors coauthors suggested that activation of OR51E2 by ß-ionone leads tophat --output-dir ,name output. --GTF ,hg19ref- to Src kinase-dependent influx of Ca2+ ions via TRPV6 channels seq.gtf.,indexes. tissue.fq in prostate cells [69]. Furthermore, odorant-induced signaling was shown to activate phospholipase C in gastrointestinal enterochromaffin cells [18]. The results indicate that activation of ectopically Alignment Assembly and Gene Expression using expressed ORs may target signaling pathways other than those Cufflinks involved in classical olfactory signal transduction. The software Cufflinks v1.0.3 was used to calculate abundance Our data also present a comprehensive overview of the of transcripts [81] on the base of the refseq gene model. The widespread ectopic expression of non-olfactory chemoreceptors reference transcriptome (hg19) is available in Gene Transfer in various human tissues. The VNO-type chemoreceptor VN1R1, Format (GTF) from the UCSC Genome Bioinformatics site of the the function of which in humans is still elusive, is present in human University of California Santa Cruz and was modified to include olfactory epithelium, brain, kidney, liver and lung [70,71]. We also all OR pseudogenes that were lacking in the reference data were able to show that VN1R1 is also expressed in nearly all of the but are listed in the HORDE database. The accuracy of the human tissues investigated. Furthermore, we detected the sweet relative transcript abundance estimation was improved with a taste receptor Tas1R3 and the bitter taste receptors Tas2R14 and multifasta file (hg19.fa) [82]. The relative abundance of transcripts Tas2R20 in all 16 investigated tissues. Interestingly, Tas2R14 is a was reported in FPKM (fragments per kilobase of exon per million broad-range bitter receptor that responded to 33 of 104 tested fragments mapped) units [81]. The Cufflinks parameters are listed bitter substances [72] and that could be responsible for the below. detection of bitter substances throughout the human body. Several studies have addressed the ectopic expression of taste receptors, for example in the gastrointestinal tract, in airways and in mammalian cufflinks --output-dir ,name output2. --GTF ,hg19ref- spermatozoa [73–76]. In human gut, Tas1R3 is involved in the seq.gtf. --multi-read-correct --compatible-hits-norm --min- glucose-stimulated secretion of glucagon-like peptide-1 [77]. Our frags-per-transfrag 1 --frags-bias-correct ,hg19.fa. sorted.- study supports previous data indicating that non-olfactory bam chemoreceptors are expressed in a variety of human tissues. The results obtained using RNA-Seq provide a brief but comprehensive overview of the expression of taste receptors and vomeronasal RNA-Seq Background Estimation receptors. To estimate an FPKM value to use in designating a gene as expressed, we used the approach described by Ramsko¨ld et al. in Conclusion 2009 [32]. A collection of intergenic regions were used to estimate In summary, recent advances in deep sequencing technologies the technical background over which genes can be classified with have allowed us to conduct the first comprehensive RNA-Seq high confidence as expressed. Referring to van Bakel et al. [83], analysis of ectopically expressed ORs using a broad panel of suitable intergenic regions do not lie within introns or 10 kb down- human tissues. One hundred and eleven OR genes were found to or upstream of a gene. Annotated genes from several gene models be expressed in the investigated tissues. The expression pattern of available from the UCSC table browser (Vega genes, UCSC, several ORs is highly conserved, and many ORs are broadly tRNA, snomiRNA, refseqgenes, NScanGenes, lincRNA, Genid- expressed in various tissues. However, some ORs are tissue- Gene, GenecodeV12, Ensembl, AceGene) were considered. We used a perl script to construct a gtf file in which the number and specific. A possible explanation for the broad ectopic expression of length distribution of intergenic regions were equal to the some ORs is the fusion of transcripts with transcripts of upstream annotated exons of the refseq gene model but were spread genes. Our results support the hypothesis that ORs play a randomly across intergenic parts of the genome. After setting functional role not only in the olfactory system but also in many intergenic regions, we calculated FPKM values with Cufflinks for other tissues. these regions for every Body Map data set, thus obtaining a background distribution for each analyzed data set. A comparison Methods between the expression levels of exons and intergenic regions of all Alignment of RNA-Seq Reads using TopHat tissues together was then used to find a threshold for detectable expression above background (Figure S3). In the manner The Body Map 2.0 data used in this study were obtained with described by Ramsko¨ld, we set the threshold value at 0.1 FPKM, the Illumina Genome Analyzer HiSeq2000 (read length: 75 bp which is slightly higher than the intersection of the false discovery and 50 bp paired-end). For each tissue, standard mRNA-Seq rate and the false negative rate (Figure S3). Approximately 44% of libraries were prepared from poly-A selected mRNA. Samples the detected ORs have FPKM values lower than this threshold. To were not multiplexed. Data were obtained from the NCBI GEO estimate the true number of expressed genes, we multiplied the database with the accession number GSE30611. Data from Wang detected refseq genes by the false discovery rate for each bin. The and colleagues were obtained using an Illumina Genome Analyzer subtraction of this product from the number of detected genes in (read length: 32 bp), and library preps were made according to each bin, revealed the true number of expressed genes. The standard protocols (for further information, see: [36]; GSE12946). resulting curve (black) was compared to the detected refseq genes We analyzed the sequence data as previously described [78]. (red), same shown as in Fig S3A (Fig. S3C). Because we were also RNA-Seq reads were aligned to the hg19 reference genome by interested in low abundance RNA (FPKM,0.1), we calculated the TopHat v1.2.0 [79]. The TopHat aligner is open-source software fraction of true positive hits in the FPKM range between 0.01 and that can identify splice junctions (http://tophat.cbcb.umd.edu). 0.1 FPKM. Within this range, we estimated the number of hits in The software SAM tools sort and index files in the BAM format randomly intergenic regions (false positives) and divided it by the [80]. Aligned data were visualized with the Integrative Genomic number of expressed refseq genes (false and true positives). We Viewer (http://www.broadinstitute.org/igv/). The command line found out that 16.5% of the detected genes of the Body Map data used while using TopHat was selected as follows: sets are false positive and concluded that 83.5% of the expressed

PLOS ONE | www.plosone.org 16 February 2013 | Volume 8 | Issue 2 | e55368 Ectopic Expression of Olfactory Receptors genes within this range are true positives. Therefore, these genes effect between 0.01 and 10 FPKM. B: Bins were converted to were included in the analysis as a separate fraction of potentially cumulative amounts of expressed genes above each expression expressed OR genes. level (cumulative genes; dark red) and intergenic regions All bioinformatic analyses were run on a Linux-based computer. (cumulative intergenic; dark blue). A false discovery rate (FDR; Further processing of data was carried out using Excel 2007, green) was calculated at each expression level as described by Sigma Plot 8.0 and Corel Draw X4. Ramsko¨ld et al. (2009). C: The true number of expressed genes in To determine whether single read and paired-end data sets of each bin (Approx true; black) was estimated from the observed the same tissue detected the same ORs, we compared both runs of numbers of refseq genes (red, same as A) by multiplication by the thyroid tissue of the Body Map project. We found identical most FDR. The genes expressed at levels between 0.01 and 0.1 FPKM highly expressed ORs (Figure S6) and a strong correlation of are false positive in 16.5% of cases, whereas 83.5% of the genes expression (R2 = 0.97). within this range are true positive. The true number of expressed genes in each bin was converted to the cumulative amount, and Total RNA and cDNA Synthesis the false negative rate (FNR) was estimated as described by RNA samples were purchased from commercial sources (colon, Ramsko¨ld et al. (2009). D: FDR and FNR for the detection of brain, breast, kidney, and lung from BioChain Institute, Inc., expressed genes as a function of the detection threshold used. Newark, NJ, USA and testis from Cell Applications, San Diego, (PDF) CA, USA). The RNA samples were subjected to DNaseI- Figure S4 Reliability of weakly expressed ORs (0.01–0.1 treatment using the TURBO DNA-free Kit (Life Technologies, FPKM) in RNA-Seq data sets of testis. A: We detected 51 Carlsbad, CA, USA) according to the standard protocol. cDNA ORs in the testis 75-bp single-read data set that showed expression synthesis was performed using the iScript cDNA Synthesis Kit in the range 0.01–0.1 FPKM. Of these ORs, 67% were also (Bio-Rad Laboratories, Hercules, CA, USA) according to the detected in the independent paired-end testis data set, indicating manufacturer’s instructions. An equivalent of 50 ng of total RNA that most of these OR transcripts are true positive. B: In contrast, was used for each RT-PCR experiment. we detected only 6% of these ORs in the skeletal muscle data set, demonstrating that weakly expressed ORs are not derived from RT-PCR randomly distributed mapped reads. To validate the expression of different ORs, we designed (PDF) primers that detect ,100–300 bp of the OR ORF (Figure S11). To detect multiple splice forms, we designed exon-exon spanning Figure S5 The sum of FPKM values of ORs per tissue. primers (Figure S11). PCR was performed using GoTaq qPCR The cumulative expression (the sum of FPKM values .0.01) of ORs Master Mix (Promega, Madison, WI, USA) with the Mastercycler and OR pseudogenes in various tissues is shown. The expression of realplex2 (eppendorf, Hamburg, Germany) (20 ml total volume, 40 ORsismorepronouncedintestisthaninanyothertissue. cycles: 95uC, 59uC, 72uC, 45 s each). All experiments were (PDF) conducted in triplicate. Figure S6 Correlation of FPKM values of ORs between thyroid-sequencing 1675 bp single-read data versus Supporting Information 2650 bp paired-end data. ORs with FPKM values .0.01 are shown. R2 is the coefficient of determination. Figure S1 Expression patterns of housekeeping genes in (PDF) different tissues. The highly expressed (ß-actin (ACTB) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH)), moder- Figure S7 Validation of the Trim58/OR2W3 chimeric ately expressed (ribosomal protein L29 (RPL29) and ribosomal transcript by RT-PCR. The detected chimeric transcripts were protein L13A (RPL13A)) and weakly expressed genes (b- confirmed by RT-PCR with a forward primer located in exon 3, 4 glucuronidase (GUSB), transferrin receptor (TFRC), hypoxan- or 5 of the Trim58 gene and a reverse primer located in the ORF thine phosphoribosyltransferase 1 (HPRT1) and TATA box of OR2W3. We confirmed the amplified PCR products by Sanger binding protein (TBP)) are frequently used as quantitative RT- sequencing. The double band in lane 1 represents splice variants. PCR standards. The upper band consists of exons 3, 4, 5 and parts of exon 6 of (PDF) Trim58 and OR2W3. The lower band consists of the same components, except for exon 6 of Trim58. In lane 3, the weak Figure S2 Distribution of FPKM values in brain. To upper band contains exon 6 of Trim58, while the lower band does obtain an estimate of FPKM values for the expression of genes, we not. calculated a histogram of FPKM distribution for brain tissue (Body (PDF) Map 2.0). Values ,0.3 can be regarded as indicating very weakly expressed, 0.3–3 as indicated weakly expressed and 3 and 230 as Figure S8 OR13E1P is located within a cluster of highly indicating moderately expressed genes. Values of 30–100 indicates expressed genes in brain tissue. Sample representation of high expression, and values .100 indicate extremely high read coverage of an OR located in a highly expressed gene cluster expression. Of the ,23000 analyzed genes, expression at .0.1 (Integrative Genomic Viewer). The gray segments indicate reads FPKM was detected for ,17000 genes; mRNA for ,500 of these that were mapped onto the reference genome. The transcript is genes is highly abundant, with FPKM .100. indicated by blue bars (exon) or lines (intron). Above, the read (PDF) coverage is shown (detected and mapped counts/bases at each respective position). Figure S3 Estimation of an expression threshold. A: (PDF) Reads were mapped to refseq genes (red) and intergenic background regions (blue). The intergenic regions have the same Figure S9 Dependence of OR expression on the genomic length distribution as the exons of annotated refseq genes. The neighborhood. The bar diagram shows the dependence of the expression levels of all genes and background regions of all 16 ectopic expression of ORs and OR on a non-OR neighbor. Body Map tissues were binned. The figures focus on the expression (PDF)

PLOS ONE | www.plosone.org 17 February 2013 | Volume 8 | Issue 2 | e55368 Ectopic Expression of Olfactory Receptors

Figure S10 Validation of NGS-data by RT-PCR. Compar- included or were not detectable in the previous microarray ison of RNA-Seq data with RT-PCR experiments. M = 50 bp analysis of the olfactory epithelium. DNA ladder; + = cDNA; 2 = RNA. PCR results were verified by (PDF) Sanger sequencing. In some cases, the primers amplified fragments that originated from two ORs. In these cases, both names are Table S1 Expression profile of all genes in 16 different human given in column one. tissues. (PDF) (XLSX) Figure S11 Primer sequences used for PCR and chime- Acknowledgments ric transcript validation. The listed primers are shown in the 59-39 direction. We thank T. Lichtleitner (Ruhr-University Bochum) for excellent technical (PDF) support and A. Mosig for fruitful discussions (Ruhr-University Bochum).

Figure S12 Expression of the most highly ectopically Author Contributions expressed ORs in the human olfactory epithelium. Out of the 40 most highly ectopically expressed ORs (RNA-Seq), 73% Conceived and designed the experiments: GG HH. Performed the were detected in the human olfactory epithelium (microarray data experiments: CF SM SO. Analyzed the data: CF. Wrote the paper: CF [29]). The other most highly ectopically expressed ORs were not GG.

References 1. Buck L, Axel R (1991) A novel multigene family may encode odorant receptors: 21. Conzelmann S, Levai O, Bode B, Eisel U, Raming K, et al. (2000) A novel brain a molecular basis for odor recognition. Cell 65 (1): 175–187. receptor is expressed in a distinct population of olfactory sensory neurons. Eur. J. 2. Zhao H, Ivic L, Otaki JM, Hashimoto M, Mikoshiba K, et al. (1998) Functional Neurosci. 12 (11): 3926–3934. expression of a mammalian odorant receptor. Science 279 (5348): 237–242. 22. Otaki JM, Yamamoto H, Firestein S (2004) Odorant receptor expression in the 3. Firestein S (2001) How the olfactory system makes sense of scents. Nature 413 mouse cerebral cortex. J. Neurobiol. 58 (3): 315–327. (6852): 211–218. 23. Gaudin JC, Breuils L, Haertle´ T (2001) New GPCRs from a human lingual 4. Glusman G, Yanai I, Rubin I, Lancet D (2001) The complete human olfactory cDNA library. Chem. Senses 26 (9): 1157–1166. subgenome. Genome Res. 11 (5): 685–702. 24. Durzyn´ski L, Gaudin J, Myga M, Szydłowski J, Goz´dzicka-Jo´zefiak A, et al. 5. Ben-Arie N, Lancet D, Taylor C, Khen M, Walker N, et al. (1994) Olfactory (2005) Olfactory-like receptor cDNAs are present in human lingual cDNA receptor gene cluster on human chromosome 17: possible duplication of an libraries. Biochem. Biophys. Res. Commun. 333 (1): 264–272. ancestral receptor repertoire. Hum. Mol. Genet. 3 (2): 229–235. 25. Feingold EA, Penny LA, Nienhuis AW, Forget BG (1999) An olfactory receptor 6. Glusman G, Bahar A, Sharon D, Pilpel Y, White J, et al. (2000) The olfactory gene is located in the extended human beta-globin gene cluster and is expressed receptor gene superfamily: data mining, classification, and nomenclature. in erythroid cells. Genomics 61 (1): 15–23. Mamm. Genome 11 (11): 1016–1023. 26. Itakura S, Ohno K, Ueki T, Sato K, Kanayama N (2006) Expression of Golf in 7. Asai H, Kasai H, Matsuda Y, Yamazaki N, Nagawa F, et al. (1996) Genomic the rat placenta: Possible implication in olfactory receptor transduction. Placenta structure and transcription of a murine odorant receptor gene: differential 27 (1): 103–108. initiation of transcription in the olfactory and testicular cells. Biochem. Biophys. 27. Pluznick JL, Zou D, Zhang X, Yan Q, Rodriguez-Gil DJ, et al. (2009) Res. Commun. 221 (2): 240–247. Functional expression of the olfactory signaling system in the kidney. Proc. Natl. 8. Younger RM, Amadou C, Bethel G, Ehlers A, Lindahl KF, et al. (2001) Acad. Sci. U.S.A. 106 (6): 2059–2064. Characterization of clustered MHC-linked olfactory receptor genes in human 28. Feldmesser E, Olender T, Khen M, Yanai I, Ophir R, et al. (2006) Widespread and mouse. Genome Res. 11 (4): 519–530. ectopic expression of olfactory receptor genes. BMC Genomics 7: 121. 9. Volz A, Ehlers A, Younger R, Forbes S, Trowsdale J, et al. (2003) Complex 29. Zhang X, La Cruz O de, Pinto JM, Nicolae D, Firestein S, et al. (2007) transcription and splicing of odorant receptor genes. J. Biol. Chem. 278 (22): Characterizing the expression of the human olfactory receptor gene family using 19691–19701. a novel DNA microarray. Genome Biol. 8 (5): R86. 30. Wang Z, Gerstein M, Snyder M (2009) RNA-Seq: a revolutionary tool for 10. Parmentier M, Libert F, Schurmans S, Schiffmann S, Lefort A, et al. (1992) transcriptomics. Nat. Rev. Genet. 10 (1): 57–63. Expression of members of the putative olfactory receptor gene family in 31. Salzberg SL (2010) Recent advances in RNA sequence analysis. F1000 Biol Rep mammalian germ cells. Nature 355 (6359): 453–455. 2: 64. 11. Spehr M, Gisselmann G, Poplawski A, Riffell JA, Wetzel CH, et al. (2003) 32. Ramsko¨ld D, Wang ET, Burge CB, Sandberg R (2009) An abundance of Identification of a testicular odorant receptor mediating human sperm ubiquitously expressed genes revealed by tissue transcriptome sequence data. chemotaxis. Science 299 (5615): 2054–2058. PLoS Comput. Biol. 5 (12): e1000598. 12. Vanderhaeghen P, Schurmans S, Vassart G, Parmentier M (1997) Molecular 33. Frazee AC, Langmead B, Leek JT (2011) ReCount: a multi-experiment resource cloning and chromosomal mapping of olfactory receptor genes expressed in the of analysis-ready RNA-seq gene count datasets. BMC Bioinformatics 12: 449. male germ line: evidence for their wide distribution in the human genome. 34. Markovets AA, Herman D (2011) Analysis of cancer metabolism with high- Biochem. Biophys. Res. Commun. 237 (2): 283–287. throughput technologies. BMC Bioinformatics 12 Suppl 10: S8. 13. Vanderhaeghen P, Schurmans S, Vassart G, Parmentier M (1997) Specific 35. Xie L, Weichel B, Ohm J, Zhang K (2011) An integrative analysis of DNA repertoire of olfactory receptor genes in the male germ cells of several methylation and RNA-Seq data for human heart, kidney and liver. BMC Syst mammalian species. Genomics 39 (3): 239–246. Biol 5 (Suppl 3): S4. 14. Veitinger T, Riffell JR, Veitinger S, Nascimento JM, Triller A, et al. (2011) 36. Wang ET, Sandberg R, Luo S, Khrebtukova I, Zhang L, et al. (2008) Chemosensory Ca2+ dynamics correlate with diverse behavioral phenotypes in Alternative isoform regulation in human tissue transcriptomes. Nature 456 human sperm. J. Biol. Chem. 286 (19): 17311–17325. (7221): 470–476. 15. Xu LL, Stackhouse BG, Florence K, Zhang W, Shanmugam N, et al. (2000) 37. Mortazavi A, Williams BA, McCue K, Schaeffer L, Wold B (2008) Mapping and PSGR, a novel prostate-specific gene with homology to a G protein-coupled quantifying mammalian transcriptomes by RNA-Seq. Nat. Methods 5 (7): 621– receptor, is overexpressed in prostate cancer. Cancer Res. 60 (23): 6568–6572. 628. 16. Cunha AC, Weigle B, Kiessling A, Bachmann M, Rieber EP (2006) Tissue- 38. Yue Y, Haaf T (2006) 7E olfactory receptor gene clusters and evolutionary specificity of prostate specific antigens: comparative analysis of transcript levels chromosome rearrangements. Cytogenet. Genome Res. 112 (1–2): 6–10. in prostate and non-prostatic tissues. Cancer Lett. 236 (2): 229–238. 39. Walensky LD, Ruat M, Bakin RE, Blackshaw S, Ronnett GV, et al. (1998) Two 17. Neuhaus EM, Zhang W, Gelis L, Deng Y, Noldus J, et al. (2009) Activation of an novel odorant receptor families expressed in spermatids undergo 59-splicing. J. olfactory receptor inhibits proliferation of prostate cancer cells. J. Biol. Chem. Biol. Chem. 273 (16): 9378–9387. 284 (24): 16218–16225. 40. Fukuda N, Yomogida K, Okabe M, Touhara K (2004) Functional character- 18. Braun T, Voland P, Kunz L, Prinz C, Gratzl M (2007) Enterochromaffin cells of ization of a mouse testicular olfactory receptor and its role in chemosensing and the human gut: sensors for spices and odorants. Gastroenterology 132 (5): 1890– in regulation of sperm motility. J. Cell. Sci. 117 (Pt 24): 5835–5845. 1901. 41. Ziegler A, Dohr G, Uchanska-Ziegler B (2002) Possible roles for products of 19. Weber M, Pehl U, Breer H, Strotmann J (2002) Olfactory receptor expressed in polymorphic MHC and linked olfactory receptor genes during selection ganglia of the autonomic nervous system. J. Neurosci. Res. 68 (2): 176–184. processes in reproduction. Am. J. Reprod. Immunol. 48 (1): 34–42. 20. Raming K, Konzelmann S, Breer H (1998) Identification of a novel G-protein 42. Bo¨nigk W, Bradley J, Mu¨ller F, Sesti F, Boekhoff I, et al. (1999) The native rat coupled receptor expressed in distinct brain regions and a defined olfactory zone. olfactory cyclic nucleotide-gated channel is composed of three distinct subunits. Recept. Channels 6 (2): 141–151. J. Neurosci. 19 (13): 5332–5347.

PLOS ONE | www.plosone.org 18 February 2013 | Volume 8 | Issue 2 | e55368 Ectopic Expression of Olfactory Receptors

43. von Dannecker LEC, Mercadante AF, Malnic B (2006) Ric-8B promotes 64. Rinn JL, Chang HY (2012) Genome regulation by long noncoding RNAs. functional expression of odorant receptors. Proc. Natl. Acad. Sci. U.S.A. 103 Annu. Rev. Biochem. 81: 145–166. (24): 9310–9314. 65. Ørom UA, Derrien T, Beringer M, Gumireddy K, Gardini A, et al. (2010) Long 44. de La Cruz O, Blekhman R, Zhang X, Nicolae D, Firestein S, et al. (2009) A noncoding RNAs with enhancer-like function in human cells. Cell 143 (1): 46– signature of evolutionary constraint on a subset of ectopically expressed olfactory 58. receptor genes. Mol. Biol. Evol. 26 (3): 491–494. 66. Sosinsky A, Glusman G, Lancet D (2000) The genomic structure of human 45. Nagalakshmi U, Wang Z, Waern K, Shou C, Raha D, et al. (2008) The olfactory receptor genes. Genomics 70 (1): 49–61. transcriptional landscape of the yeast genome defined by RNA sequencing. 67. Glusman G, Clifton S, Roe B, Lancet D (1996) Sequence analysis in the Science 320 (5881): 1344–1349. olfactory receptor gene cluster on human chromosome 17: recombinatorial 46. Illumina (2011) RNA-Seq Data Comparison with Gene Expression Microarrays. events affecting receptor diversity. Genomics 37 (2): 147–160. A cross-platform comparison of diffential gene expression analysis. White Paper. 68. Chiu IM, Touhalisky K, Baran C (2001) Multiple controlling mechanisms of 47. Shiao M, Chang AY, Liao B, Ching Y, Lu MJ, et al. (2012) Transcriptomes of FGF1 gene expression through multiple tissue-specific promoters. Prog. Nucleic mouse olfactory epithelium reveal sexual differences in odorant detection. Acid Res. Mol. Biol. 70: 155–174. Genome Biol Evol 4 (5): 703–712. 69. Spehr J, Gelis L, Osterloh M, Oberland S, Hatt H, et al. (2011) G protein- 48. Zhang X, Rogers M, Tian H, Zhang X, Zou D, et al. (2004) High-throughput coupled receptor signaling via Src kinase induces endogenous human transient microarray detection of olfactory receptor gene expression in the mouse. Proc. receptor potential vanilloid type 6 (TRPV6) channel activation. J. Biol. Chem. Natl. Acad. Sci. U.S.A. 101 (39): 14168–14173. 286 (15): 13184–13192. 49. Borowsky B, Adham N, Jones KA, Raddatz R, Artymyshyn R, et al. (2001) 70. Rodriguez I, Greer CA, Mok MY, Mombaerts P (2000) A putative pheromone Trace amines: identification of a family of mammalian G protein-coupled receptor gene expressed in human olfactory mucosa. Nat. Genet. 26 (1): 18–19. receptors. Proc. Natl. Acad. Sci. U.S.A. 98 (16): 8966–8971. 71. Shirokova E, Raguse JD, Meyerhof W, Krautwurst D (2008) The human 50. Fujita Y, Takahashi T, Suzuki A, Kawashima K, Nara F, et al. (2007) vomeronasal type-1 receptor family–detection of volatiles and cAMP signaling in Deorphanization of Dresden G protein-coupled receptor for an odorant HeLa/Olf cells. FASEB J. 22 (5): 1416–1425. receptor. J. Recept. Signal Transduct. Res. 27 (4): 323–334. 72. Meyerhof W, Batram C, Kuhn C, Brockhoff A, Chudoba E, et al. (2010) The 51. Li YR, Matsunami H (2011) Activation state of the M3 muscarinic acetylcholine molecular receptive ranges of human TAS2R bitter taste receptors. Chem. receptor modulates mammalian odorant receptor signaling. Sci Signal 4 (155): Senses 35 (2): 157–170. ra1. 73. Deshpande DA, Wang WCH, McIlmoyle EL, Robinett KS, Schillinger RM, et al. (2010) Bitter taste receptors on airway smooth muscle bronchodilate by 52. Xia C, Ma W, Wang F, Hua S, Liu M (2001) Identification of a prostate-specific localized calcium signaling and reverse obstruction. Nat. Med. 16 (11): 1299– G-protein coupled receptor in prostate cancer. Oncogene 20 (41): 5903–5907. 1304. 53. Leja J, Essaghir A, Essand M, Wester K, Oberg K, et al. (2009) Novel markers 74. Rozengurt E, Sternini C (2007) Taste receptor signaling in the mammalian gut. for enterochromaffin cells and gastrointestinal neuroendocrine carcinomas. Curr Opin Pharmacol 7 (6): 557–562. Mod. Pathol. 22 (2): 261–272. 75. Iwatsuki K, Nomura M, Shibata A, Ichikawa R, Enciso PLM, et al. (2010) 54. Weng J, Wang J, Hu X, Wang F, Ittmann M, et al. (2006) PSGR2, a novel G- Generation and characterization of T1R2-LacZ knock-in mouse. Biochem. protein coupled receptor, is overexpressed in human prostate cancer. Int. J. Biophys. Res. Commun. 402 (3): 495–499. Cancer 118 (6): 1471–1480. 76. Meyer D, Voigt A, Widmayer P, Borth H, Huebner S, et al. (2012) Expression of 55. Rodriguez-Martinez A, Alarmo E, Saarinen L, Ketolainen J, Nousiainen K, et Tas1 taste receptors in mammalian spermatozoa: functional role of Tas1r1 in al. (2011) Analysis of BMP4 and BMP7 signaling in breast cancer cells unveils regulating basal Ca2? and cAMP concentrations in spermatozoa. PLoS ONE 7 time-dependent transcription patterns and highlights a common synexpression (2): e32354. group of genes. BMC Med Genomics 4: 80. 77. Steinert RE, Gerspach AC, Gutmann H, Asarian L, Drewe J, et al. (2011) The 56. L’Espe´rance S, Bachvarova M, Tetu B, Mes-Masson A, Bachvarov D (2008) functional involvement of gut-expressed sweet taste receptors in glucose- Global gene expression analysis of early response to chemotherapy treatment in stimulated secretion of glucagon-like peptide-1 (GLP-1) and peptide YY ovarian cancer spheroids. BMC Genomics 9: 99. (PYY). Clin Nutr 30 (4): 524–532. 57. Branscomb A, Seger J, White RL (2000) Evolution of odorant receptors 78. Trapnell C, Roberts A, Goff L, Pertea G, Kim D, et al. (2012) Differential gene expressed in mammalian testes. Genetics 156 (2): 785–797. and transcript expression analysis of RNA-seq experiments with TopHat and 58. Frenkel-Morgenstern M, Lacroix V, Ezkurdia I, Levin Y, Gabashvili A, et al. Cufflinks. Nat Protoc 7 (3): 562–578. (2012) Chimeras taking shape: Potential functions of proteins encoded by 79. Trapnell C, Pachter L, Salzberg SL (2009) TopHat: discovering splice junctions chimeric RNA transcripts. Genome research 22(7): 1231–1242. with RNA-Seq. Bioinformatics 25 (9): 1105–1111. 59. Li H, Wang J, Ma X, Sklar J (2009) Gene fusions and RNA trans-splicing in 80. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, et al. (2009) The Sequence normal and neoplastic human cells. Cell Cycle 8 (2): 218–222. Alignment/Map format and SAMtools. Bioinformatics 25 (16): 2078–2079. 60. Gingeras TR (2009) Implications of chimaeric non-co-linear transcripts. Nature 81. Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, et al. (2010) 461 (7261): 206–211. Transcript assembly and quantification by RNA-Seq reveals unannotated 61. Kozak M (1999) Initiation of translation in prokaryotes and eukaryotes. Gene transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 28 234 (2): 187–208. (5): 511–515. 62. Hatakeyama S (2011) TRIM proteins and cancer. Nat. Rev. Cancer 11 (11): 82. Roberts A, Pimentel H, Trapnell C, Pachter L (2011) Identification of novel 792–804. transcripts in annotated genomes using RNA-Seq. Bioinformatics 27 (17): 2325– 63. Kohli U, Grayson BL, Aune TM, Ghimire LV, Kurnik D, et al. (2009) Change 2329. in mRNA Expression after Atenolol, a Beta-adrenergic Receptor Antagonist and 83. van Bakel H, Nislow C, Blencowe BJ, Hughes TR (2010) Most ‘‘dark matter’’ Association with Pharmacological Response. Arch Drug Inf 2 (3): 41–50. transcripts are associated with known genes. PLoS Biol. 8 (5): e1000371.

PLOS ONE | www.plosone.org 19 February 2013 | Volume 8 | Issue 2 | e55368 Kapitel 4 - Expression Profile of Ectopic Olfactory Receptors Determined by Deep Sequencing

Supplementary Material

Aufgrund der großen Anzahl untersuchter Gene sind die Fig. S10 – Fig. S11 und Tab. S1 nur online einzusehen: http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0055368

Figure S1. Expression patterns of housekeeping genes in different tissues. The highly expressed (ß- actin (ACTB) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH)), moderately expressed (ribosomal protein L29 (RPL29) and ribosomal protein L13A (RPL13A)) and weakly expressed genes (β-glucuronidase (GUSB), transferrin receptor (TFRC), hypoxanthine phosphoribosyltransferase 1 (HPRT1) and TATA box binding protein (TBP) are frequently used as quantitative RT-PCR standards.

Figure S2. Distribution of FPKM values in brain. To obtain an estimate of FPKM values for the expression of genes, we calculated a histogram of FPKM distribution for brain tissue (Body Map 2.0). Values <0.3 can be regarded as indicating very weakly expressed, 0.3–3 as indicated weakly expressed and 3 and −30 as indicating moderately expressed genes. Values of 30–100 indicates high expression, and values >100 indicate extremely high expression. Of the ~23000 analyzed genes, expression at >0.1 FPKM was detected for ~17000 genes; mRNA for ~500 of these genes is highly abundant, with FPKM >100.

Kapitel 4 - Expression Profile of Ectopic Olfactory Receptors Determined by Deep Sequencing

Figure S3. Estimation of an expression threshold. A: Reads were mapped to refseq genes (red) and intergenic background regions (blue). The intergenic regions have the same length distribution as the exons of annotated refseq genes. The expression levels of all genes and background regions of all 16 Body Map tissues were binned. The figures focus on the expression effect between 0.01 and 10 FPKM. B: Bins were converted to cumulative amounts of expressed genes above each expression level (cumulative genes; dark red) and intergenic regions (cumulative intergenic; dark blue). A false discovery rate (FDR; green) was calculated at each expression level as described by Ramsköld et al., (2009). C: The true number of expressed genes in each bin (Approx true; black) was estimated from the observed numbers of refseq genes (red, same as A) by multiplication by the FDR. The genes expressed at levels between 0.01 and 0.1 FPKM are false positive in 16.5% of cases, whereas 83.5% of the genes within this range are true positive. The true number of expressed genes in each bin was converted to the cumulative amount, and the false negative rate (FNR) was estimated as described by Ramsköld et al., (2009). D: FDR and FNR for the detection of expressed genes as a function of the detection threshold used.

29 Kapitel 4 - Expression Profile of Ectopic Olfactory Receptors Determined by Deep Sequencing

Figure S4. Reliability of weakly expressed ORs (0.01–0.1 FPKM) in RNA-Seq data sets of testis. A: We detected 51 ORs in the testis 75-bp single-read data set that showed expression in the range 0.01– 0.1 FPKM. Of these ORs, 67% were also detected in the independent paired-end testis data set, indicating that most of these OR transcripts are true positive. B: In contrast, we detected only 6% of these ORs in the skeletal muscle data set, demonstrating that weakly expressed ORs are not derived from randomly distributed mapped reads.

Figure S5. The sum of FPKM values of ORs per tissue. The cumulative expression (the sum of FPKM values >0.01) of ORs and OR pseudogenes in various tissues is shown. The expression of ORs is more pronounced in testis than in any other tissue.

30 Kapitel 4 - Expression Profile of Ectopic Olfactory Receptors Determined by Deep Sequencing

Figure S6. Correlation of FPKM values of ORs between thyroid-sequencing 1×75 bp single-read data versus 2×50 bp paired-end data. ORs with FPKM values >0.01 are shown. R2 is the coefficient of determination

. Figure S7. Validation of the Trim58/OR2W3 chimeric transcript by RT-PCR. The detected chimeric transcripts were confirmed by RT-PCR with a forward primer located in exon 3, 4 or 5 of the Trim58 gene and a reverse primer located in the ORF of OR2W3. We confirmed the amplified PCR products by Sanger sequencing. The double band in lane 1 represents splice variants. The upper band consists of exons 3, 4, 5 and parts of exon 6 of Trim58 and OR2W3. The lower band consists of the same components, except for exon 6 of Trim58. In lane 3, the weak upper band contains exon 6 of Trim58, while the lower band does not.

Kapitel 4 - Expression Profile of Ectopic Olfactory Receptors Determined by Deep Sequencing

Figure S8. OR13E1P is located within a cluster of highly expressed genes in brain tissue. Sample representation of read coverage of an OR located in a highly expressed gene cluster (Integrative Genomic Viewer). The gray segments indicate reads that were mapped onto the reference genome. The transcript is indicated by blue bars (exon) or lines (intron). Above, the read coverage is shown (detected and mapped counts/bases at each respective position).

Figure S9. Dependence of OR expression on the genomic neighborhood. The bar diagram shows the dependence of the ectopic expression of ORs and OR on a non-OR neighbor.

Figure S12. Expression of the most highly ectopically expressed ORs in the human olfactory epithelium. Out of the 40 most highly ectopically expressed ORs (RNA-Seq), 73% were detected in the human olfactory epithelium (microarray data). The other most highly ectopically expressed ORs were not included or were not detectable in the previous microarray analysis of the olfactory epithelium.

32 Kapitel 5 - Characterization of the ectopically expressed OR2AT4 in human myelogenous leukemia cells

Kapitel 5

Characterization of the ectopically expressed OR2AT4 in human myelogenous leukemia cells

Stavros Manteniotis, Sebastian Wojcik, Patrik Brauhoff, Lars Petersen, Ulrich Dührsen, Wolf Schmiegel, Günther Gisselmann, Hanns Hatt

Prior to submission

Characterization of the ectopically expressed OR2AT4 in human myelogenous leukemia cells

Abstract With approximately 1000 genes, the olfactory receptor (OR) class is the largest G-protein coupled receptor (GPCR) subfamily in mammalian. Two decades ago, this receptor family was found to be expressed in the nasal epithelium and to be activated by a variety of odorants. However, recently several ORs were characterized to be functionally expressed also in different other tissues of the human body, such as in prostate, sperm, intestine or skin. In this study, we observed the ectopic expression of ORs in the human chronic myelogenous leukemia cell line K562 and in white blood cells of clinically diagnosed acute myeloid leukemia patients. By analyzing Next-Generation Sequencing data, we could detect 29 ORs in K562, while 7 of them were expressed higher than 1 FPKM, such as OR51B5, OR51B4, OR52D1, OR2AT4, OR2W3, OR2B6, and OR51l2. We validated the expression of these seven ORs in K562 and in white blood cells of AML-patients by RT-PCR. We characterized in more detail the physiological role of one of these receptors (OR2AT4) in myelogenous leukemia. In both cell systems the OR2AT4 agonist Sandalore evokes a strong Ca2+ influx through a cAMP-, adenylate cyclase-mediated pathway. The known OR2AT4 antagonist Phenirat prevents the Sandalore induced intracellular Ca2+ increase. In addition, long time stimulation of the OR2AT4 reduced the proliferation by decreasing the p38-MAPK phosphorylation after 30 minutes incubation and induce apoptosis via phosphorylation of the p44/42-MAPK. Furthermore, Sandalore incubation lightly increased the number of hemoglobin containing cells by initiating MAPK phosphorylation. Additionally, we observed that both, the p44/42-MAPK and Akt phosphorylation, is caused by the activation of the OR2AT4 and the subsequent increase of intracellular Ca2+ which activates the Ca2+ activated calmodulin.

Introduction Olfactory receptors (ORs) were discovered in 1991 by Buck and Axel as the largest GPCR superfamily, being mainly located in olfactory receptor cells in the upper part of the nasal epithelium [1]. The human gene repertoire codes around 1000 different ORs, while only 400 seem to be functionally expressed [2–4]. However, in the last two decades, ectopic gene expression analysis discovered that OR expression is not only restricted to the nasal

1 epithelium but is spread in different parts of the human body, such as in testes, sperm, heart, prostate, or white blood cells [5–10]. Unfortunately, the function of ectopic expressed ORs is known only in very few instances. The prostate-specific G-protein-coupled receptor (PSGR), also known as OR51E2, is highly expressed in prostate cells and in the prostate cancer cell line LNCaP [11,12]. -Ionon was able to elicit a rapid Ca2+ increase in LNCaP by activating the PSGR and caused an inhibition of the proliferation through MAPK-phosphorylation [8]. Recently, a study showed that in hepatocellular carcinoma and in the cell line Huh7, the OR1A2 increases intracellular Ca2+ and reduces the cell proliferation after (-)-citronellal treatment [9]. Furthermore, the OR1D2 expressed in spermatogonia is involvement in sperm chemotaxis [10]. In enterochromaffin cells odor stimulation released serotonin in the gut [13]. Further investigated roles for ORs in different tissues is the involvement in cell cytokinesis [14], blood pressure regulation and enzyme secretion in kidneys [15]. In 2014, OR2AT4 could be detected in the skin and in primary keratinocytes, respectively. OR2AT4 activation supported the wound healing after a stimulation of the OR2AT4 agonist Sandalore. Sandalore evokes an intracellular Ca2+ increase and a phosphorylation of the p44/42-MAPK and p38- MAPK in keratinocytes [16]. An increase of intracellular Ca2+ can stimulate the phosphorylation of MAPKs, such as p44/42-MAPK, p38-MAPK, or JNK, which activate various cell regulating transcript factors in the nucleus [17–20]. According to these findings, previous studies have shown that an intracellular Ca2+ increase activates several physiological functions, such as differentiation, inhibition of proliferation, apoptosis or chemotaxis through activation of downstream mechanisms [21–23]. The cell line we used in this present work, K562, is a chronic myelogenous leukemia (CML) cell line derived from a 53 year old CML-patient in the blast crisis [24]. This commonly used cell line serves as a model to explore the molecular mechanisms of human myeloid leukemia. K562 contains mainly myeloid precursor cells and undifferentiated granulocytes and erythro- cytes [25,26]. The main characteristic of the CML disease is the Philadelphia chromosome containing a fusion of the two genes bcr on chromosome 9 and abl on chromosome 22 [27,28]. CML is clinically described by an increase of proliferation and a high resistance to apoptosis [29–32]. The bcr-abl fusion gene produces a constitutive active tyrosine kinase and leads to an uncontrolled proliferation of undifferentiated blood cells. Unfortunately, tyrosine kinase inhibitors such as imatinib are only effective against CML in newly and in time diagnosed patients [33]. In later disease states of CML, a resistance against bcr-abl tyrosine kinase inhibitor can occur and hinders the treatment of CML [34]. The later disease state of

CML is similar to acute myelogenous leukemia (AML) which, if remains unhandled, leads to death within a few weeks. Until today the mechanism besides the bcr-abl pathways are widely unknown, but can provide a novel therapeutic target for the treatment against later stages of resistant CML. In this study, we could detect seven expressed ORs (> 1 FPKM) in the CML cell line K562 and confirm their expression also in white blood cells of newly diagnosed AML-patients. We mainly focused on the functionally characterization of the OR2AT4, which is activated by the synthetic agonist Sandalore and inhibited by the antagonist Phenirat [16]. We characterized the signaling pathway and detected an involvement of an adenylate cyclase which triggers cAMP production, and increases intracellular Ca2+ through the influx of extracellular Ca2+ by activating Ca2+ channels via a PKA. We observed an alternation of the proliferation, apoptosis and hemoglobin production in Sandalore incubated cells, caused by a regulation of the MAPK-phosphorylation.

Materials and methods Cell culture K562 cells were purchased from LGC Standards GmbH (Wesel, Germany). The cells were cultured at 37 °C, 6 % CO2 in RPMI-1640 (Life Technologies, Carlsbad, USA) containing 10 % (v/v) fetal bovine serum (FBS), 5 % GlutaMAX (Life Technologies) and 100 units/ml penicillin/streptomycin [26]. The cells were diluted three times a week at a rate of 1:10 with freshly prepared medium. Depending on the experiments, cells were counted and seeded at a density of 1 x 105 cells/ml up to 1 x 106 cells/ml. All odorants used were purchased from Sigma Aldrich (Sigma Aldrich, Munich, Germany).

Cell proliferation assay Cells were seeded in cell culture flasks at a density of 1 x 105 cells/ml and treated with the different odorant concentrations (10 µM - 300 µM) or 0.1 % DMSO as control. Alternatively, cells were stimulated with the odor including inhibitors for the p38-MAPK, Akt, and p44/42- MAPK. To measure the cell viability a proliferation assay was performed every 24 h in 96- well plates using the CyQUANT cell proliferation kit (Life Technologies) according to the manufacturer’s protocol. The proliferation was investigated for 5 days.

RT-PCR-experiments RNAs of K562 cells and white blood cells of AML-patients were isolated by using the QIAamp RNA Blood Mini Kit (Quiagen, Hilden, Germany) as described in the manufacturer’s instructions. After isolating the RNA, we used the TURBO DNA free Kit (Life Technologies, Carlsbad, USA) to prevent contamination of genomic DNA. cDNA synthesis was performed by using the iScriptTM cDNA Synthesis Kit (Biorad Laboratories, Hercules, USA). As a control for possible contamination with genomic DNA we performed a (-) RT-control. RT-PCR was performed using GoTaq qPCR Master Mix (Promega, Madison, WI, USA) (20 µl) and OR specific primer pairs (10 pmol). The RT-PCR amplifications were done for 40 cycles (1 min, 95 °C; 45 s, 59 °C; 1 min, 72 °C). The housekeeping gene TBP was used as a positive control. PCR was performed with cDNA (equivalent of ~30 ng total RNA) and specific primer pairs. PCR reactions were performed using the Mastercycler realplex2 (Eppendorf, Hamburg, Germany) and the resulting products were confirmed using Sanger sequencing. All experiments were conducted in triplicate. The following Primer pairs were constructed: OR2AT4 forward: 5’ GCCCATCCCAGCAGTAGTAAG 3’, OR2AT4 reverse: 5’ CTCACACCAATTCTCAACCCCCTC 3’ OR51B5 forward: 5’ CAATGGCACCCTCCTTCTTC 3’, OR51B5 reverse: 5’ CAAGCAGAATGCCAGACTCG 3’ OR52D1 forward: 5’ TCTGAGTACCTGTGGCTCCCAC 3’ OR52D1 reverse: 5’ CGGTGGGTGAGAAGGAGAAGA 3’ OR2W3 forward: 5’ CTGCCGGGGCTTGGTGTCAG 3’ OR2W3 reverse: 5’ TCCACCTCGTGGTGCCCACA 3’ OR52l2 forward: 5’ GTGGCCTTCATTGCTGCCTCCTA 3’ OR52l2 reverse: 5’ CACTACATCCTGCCCCAACCAGG 3’ OR51B4 forward: 5’ ATTGCCATCCGCACACACCACTGAG 3’ OR51B5 reverse: 5’ CCAGACGCAATGCCCATCACTGT 3’ OR2B6 forward: 5’ TCGTGGCTGTGTAGCCCAGC 3’ OR2B6 reverse: 5’ GCAGCTGCCAACTGGAGGGCA 3’ TBP forward: 5’ GGGGAGCTGTGATGTGAAGT 3’ TBP reverse: 5’ CCAGGAAATAATTCTGGCTCA 3’

Next-Generation Sequencing The Next-Generation Sequencing (NGS) data of K562 sequenced with Illumina Genome Analyzer HiSeq2000 was obtained from the NCBI GEO database (AccNo.: SRR1207231). We reanalyzed the sequencing data by using TopHat and Cufflinks on a Linux based system as described in previously studies [7]. The reads were mapped onto the human reference genome (hg19), and FPKM values calculated using the Refseq gene model (UCSC Genome Bioinformatics, University of Carlifornia Santa Cruz) and detected the expression of 13952 genes (< 1 FPKM). One FPKM represents the number of fragments per kilobase of an exon mapped per million reads [35]

Apoptosis straining Apoptosis was measured by using the Annexin-V FITC Apoptosis Detection Kit (Sigma Aldrich) according to the manufacturer’s instructions. Briefly, cells were incubated in cell culture flasks at a density of 1 x 105 cells/ml in RPMI-1640 containing 10 % FBS, 5 % GlutaMAX, 100 units/ml penicillin/streptomycin with 10 µM, 30 µM, 100 µM, 300 µM, 700 µM or 1 mM of odorants for 1 hour. Afterwards, the cells were washed in PBS-/-, and incubated for 5 minutes with annexin-V and propidium iodide (1:1) in the dark. Cells were kindly placed on a 35 mm cover slip and investigated under a Zeiss Axioskop-2 microscope (Carl Zeiss, Oberkochen, Germany) [36,22]. Using the Annexin-V FITC Apoptosis Detection Kit enabled us to differentiate between early apoptotic cells (green staining), necrotic cells (red staining) and viable cells (no staining). cAMP-GloTM assay To determine the intracellular cAMP level of odorant stimulated cells, we used the cAMP- GloTM assay (Promega) according to manufacturer’s instructions. Before starting the experiments we generated a cAMP standard curve to compare the strength of luminescence signals with the different cAMP concentrations, as described elsewhere [16]. The cell suspension K562 was cultured as previously described in a flask. During the experiments, cells were placed in 96-well plates at a density of 5 x 105 cells/well and treated with different odorants at 1 mM concentration for 5 min at room temperature. Prior to correlation, all luminescence signals were normalized to 10 µM forskolin [16].

Hemoglobin determination and Pappenheim staining To investigate the effect of Sandalore on the blood hemoglobin levels, we used the Hemoglobin Assay Kit (Sigma Aldrich). The kit was used as described in the manufactures protocol. We incubated 5 ml 1 x 106 cells/ml in cell culture flasks with 100 µM Sandalore or 10 µM hemin for six days. The RPMI-1640 medium containing 10 % FBS, 5 % GlutaMAX, 100 units/ml penicillin/streptomycin and the odorant were replaced every second day [26]. After six days incubation, there were much fewer cells in the 100 µM Sandalore treated cells. To be able to compare the amount of hemoglobin containing cells, before the spectrometric analysis, control and Sandalore treated cells were divided into an equal amount of cells by using a Neubauer counting chamber. To distinguish between the different cell types in culture, Sandalore treated and untreated cells were stained with the Pappenheim standard staining solution according to the manufactures protocol (LT-SYS, Berlin, Germany). Briefly, 60 µl of 1 x 106 cells/ml Sandalore treated and untreated cells were placed on poly-L-lysine coated 5 mm cover slips and dried for 15 minutes. The 5 mm cover slips were dipped for 3 seconds, 5 times each, into the different staining solutions and after that washed immediately with aqua dest. Cell morphology was analyzed with a Zeiss Axioskop 2 microscope and investigated with 20 magnification (Carl Zeiss) [37].

Calcium-imaging K562 cells were incubated for 20 minutes in poly-L-lysine (Sigma Aldrich) coated 35 mm dishes with RPMI-1640 (Life Technologies), 10 % FBS, 5 % GlutaMAX, 100 units/ml penicillin/streptomycin, and incubated for further 20 minutes in RPMI-1640 containing 3 mM fura-2-AM (Molecular Probes, Eugene, Oregon) at 37 °C and 6 % CO2. White blood cells delivered from AML-patients were incubated for 20 minutes in concanavalin A (Sigma Aldrich) laminated 35 mm dishes. Before measuring the cells, RPMI-1640 medium was replaced with ringer’s solution (140 mM NaCl, 5 mM KCL, 2 mM CaCl2, 1 mM MgCl, and 10 mM HEPES; pH 7.3). Calcium-imaging experiments were performed as described previously [8,10]. To create Ca2+-free conditions, we added 10 mM EGTA into a Ca2+-free ringer’s solution. We used the adenylate cyclase inhibitor MDL-12,330A (10 µM), and SQ- 22536 (10 µM), the phospholipase C inhibitor U-73122 (30 µM), and protein kinase A inhibitor H89 (10 µM) to analyze the OR2AT4-mediated signaling pathway (Sigma Aldrich). Furthermore, we used different calcium channel blockers such as midefradil (10 µM) and NNC-550396 (30 µM) inhibiting T-type calcium channels, and L-cis diltiazem (150 µM)

6 blocking CNGA1 and CNGA3 channels as well as L-type calcium channels (Sigma Aldrich). Before and after applying the odorant with the appropriate inhibitor, the cells were pre- and postincubated with the blocking solution. For the OR2AT4 antagonist experiments we used Phenirat (300 µM) in the same concentration as Sandalore (300 µM). To investigate the cell viability 100 µM ADP were applied on the cells at the end of a measuring. In previously made studies, ADP has shown to increase the amount of intracellular Ca2+ in K562 cells [38,39].

Western blotting analysis K562 cells were treated with 100 µM Sandalore in a time dependent manner (5’, 15’, 30’,

60’) at 37 °C and 6 % CO2. Cells were harvested and homogenized in lysis buffer (RIPA: 50 mM Tris HCl, 150 mM NaCl, 1 mM EDTA, 1 % Triton X-100, pH 7.4) with protease- (cOmpleteTM, Roche Applied Science, Basel, Switzerland) and phosphatase- inhibitors (PhosSTOP, Roche Applied Science). For isolating proteins out of the cell membrane samples were ultracentrifuged at maximum (100.000 g, 1.5 h, 4 °C) after homogenization. All western blot experiments were performed as described elsewhere [8,16]. Detection was performed using the ECLTM Select Western Blotting Detection System (Amersham Biosciences, GE, Healthcare, Solingen, Germany). We used the polyclonal rabbit antibody against p44/42 MAPK (Cat. No. #9102), p38-MAPK (Cat. No. #9212), JNK-SAPK (Cat. No. #9252) and Akt (Cat. No. #4059), as well as the phosphorylated antibody pp44/42-MAPK (Cat. No. #9101), pp38-MAPK (Cat. No. #9211), pJNK-SAPK (Cat. No. #9251), and pAkt (Cat. No. #4060) (Cell Signaling Technology). For the detection of OR2AT4, we used the same α- OR2AT4 antibody as described elsewhere [16]. For quantification we used the Java-based software ImageJ 1.46, to calculate the relative pixel intensity [40]. Inhibitors for the mitogen activated-protein kinase pp44/42-MAPK, U0126 10 µM (Cell Signaling Technology, New England Biolabs), the pp38-MAPK inhibitor SB203580 (10 µM) (Cell Signaling Technology), and the Akt inhibitor LY294002 (10 µM) were used for the blocker experiments (Sigma Aldrich). To investigate the influence of the intracellular Ca2+ increase, we inhibited the calmodulin kinase II (CaMKII) with KN-62 (10 µM) (Sigma Aldrich). KN-62 binds directly to the CalmKII and leads to a consequently inactivation [41]. Since CaMKII is activated by Ca2+, and is necessary for the activation of calmodulin, one could observe the influence of increased intracellular Ca2+. Therefore, we pre-incubated the cells with KN-62 for at least 60 minutes, before starting the Sandalore incubation. The blocking effects on Sandalore treated cells were observed for further 60 minutes, before isolating the proteins. To

7 load equal amounts of protein we calculated the total amount with bradford (Life Tech- nologies) and optimized it with a coomassie-staining on a SDS-PAGE. For some experiments we used the antibody against the housekeeping protein vinculin (Cell Signaling Technology) as a control.

Immunocytochemistry For Immunocytochemistry experiments, custom-designed antibodys were used against the C- terminus of the OR2AT4, polyclonal, dilution 1:50 (Eurogentec, Seraing, Belgium)[16]; anti- OR51B5, polyclonal, dilution 1:25 (Eurogentec); anti-caspase-3, polyclonal, dilution 1:300 (Sigma Aldrich). Briefly, 5 mm cover slips were coated for 15 minutes with poly-L-lysine (Sigma Aldrich) and dried for 30 minutes at the air. We used 60 µl of 1 - 5 x 106/ml K562 cells and incubated them in medium onto the coated 5 mm cover slips. Medium was removed and the cells were fixed in 4 % paraformaldehyde for 20 minutes at 4 °C. In order to wash and permeabilize the membrane, PBS medium including 0.1 % Triton X-100 (Sigma Aldrich) (PBST) was used. K562 cells were incubated with primary antibodies, diluted in blocking solution, containing PBST, 1 % fish gelatin, 3 % horse serum, for 3 hours at room temperature. After having rewashed it three times with PBST, cells were incubated with a secondary goat anti-rabbit antibody (1:1000) (Alexa Fluor 488, Life Technologies) and 4’6’- diamidino-2-phenylindole (1:300) in blocking solution for 1 hour at room temperature. After that, cells were washed with PBST again, and covered on an object slide with ProLong Gold antifade Reagent (Invitrogen). Images were obtained using a Zeiss LSM 510 META confocal microscope (Carl Zeiss).

Statistical analysis Statistical analyses were made with Microsoft Excel and Sigma Plot 12. All results were tested for normality (Shapiro-Wilk) and equal variance. Significance levels were calculated with a two-tailed unpaired t-test, while significant values were separated in < 0.05 (*), < 0.01

(**), and < 0.0005 (***). Dose-response curves and EC50 values were made with the 4- parameter Hill model. Values were represented the mean ± SEM (standard error of the mean) from at least three independent experiments.

Fig. 1 Olfactory receptors are expressed in the K562 cell line and in white blood cells of acute myeloid leukemia patients. A Next-Generation Sequencing (RNA-Seq) data of K562 revealed 7 ORs expressed higher than 1 FPKM in K562 and further 22 ORs (< 1 FPKM) shown in the supplementary data (Fig. S1). B We confirmed the expression for the 7 highest ORs detected with RNA-Seq in K562 by RT-PCR. C In RT-PCR experiments, we found the same ORs in white blood cell cDNA of newly diagnosed acute myeloid leukemia patients. D Western blot analysis revealed the occurrence of OR2AT4 (35 kD) in the K562 membrane, but not in the cytosolic fraction. (m) represents the marker. E Immunofluorescence stainings of OR2AT4 in K562 cells were analyzed with a confocal microscopy. The expression of the receptor-protein is shown in red. DAPI (blue) was used to visualize the cell nucleus. Scale bars: 20 µm.

Results K562 and white blood cells of acute myeloid leukemia-patients expresses olfactory receptors For the initial detection of ectopically expressed ORs in myelogenous leukemia, we reanalyzed an online available NGS-dataset from K562 cells with Tophat and Cufflinks. In total, transcripts of 29 ORs could be detected, while 7 ORs were expressed higher than 1 FPKM (Fig. 1 A, Fig. S1). The expression of ORs higher than 1 FPKM was validated by RT-

PCR of K562 cDNA (Fig. 1 B). Additionally, we investigated the expression for members of the common G-protein coupled signaling pathways (Fig. S1). Here, we detected the expression for different types of the adenylate cyclases, G-proteins, protein lipase C (PLC), and protein kinase A (PKA). Gaolf and CNGA2 which are an essential part for the common signaling transduction for ORs in the nasal epithelium could not be detected. The expression of the highest ORs was also observed in white blood cells of acute myeloid leukemia (AML) patients by using the RT-PCR method (Fig. 1 C). One of the highest expressed OR in K562 cells was the OR2AT4. Recently, the OR2AT4 was shown to be expressed in keratinocytes and responding to Sandalore and Brahmanol, synthetic sandalwood compounds [16]. Our Western blot analysis revealed the expression of the OR2AT4 protein in the membrane of K562 cells, but not in the cytosolic protein fraction (Fig. 1 D). Also immunocytochemical stainings of OR2AT4, validated the expression in K562 cells (Fig. 1 E). To investigate the function of the ectopic expressed ORs in K562 and AML-white blood cells we focused on the functional characterization of the OR2AT4.

Sandalore increases the intracellular Ca2+ level and the cAMP level in K562 Previously made studies have shown that most ectopically expressed ORs increase intracellular Ca2+ by a cAMP-mediated pathway [16,9,10]. Therefore, we incubated the cells for 5 minutes with the appropriate odorant (1 mM) and measured the increase of intracellular cAMP with the cAMP-GloTM Assay relative to 10 µM forskolin (Fig. 2 A). Stimulating K562 cells with the OR2AT4 agonist Sandalore evoked a cAMP increase of 78 % (±28).

Fig. 2 Sandalore increases intracellular cAMP level. A The OR2AT4 ligand Sandalore increases the cAMP-level significantly higher than the control DMSO (n = 5). Other chosen odorants were tested, such as the OR2AT4 antagonist Phenirat (n = 3) [16]. To investigate a possible activity of the odorants on the K562 cells we used a 1 mM concentration for screening (n = 3). B We created a dose- response curve for the described OR2AT4 ligands. The EC50 value for Sandalore was 310 µM (±25).

The OR2AT4 antagonist Phenirat did not increase the amount of intracellular cAMP. Brahmanol, a further described ligand for the OR2AT4 raised the cAMP level up to 17 % (±7) [16]. The odorant citronellal which increase the intracellular cAMP level via an OR1A2 activation in the hepatocarcinoma cell line Hu7 [9], did not activate the cAMP production in K562. However, (-)-citronellol activates the cAMP-production in K562 significant. For the

OR2AT4 agonist Sandalore dose-response curves were made (Fig. 2 B). The EC50 value for Sandalore is 310 µM (±25). Next, calcium-imaging experiments with the appropriate odorants were done. Applying 30 seconds each, Sandalore and Brahmanol increased the intracellular amount of Ca2+ (Fig. 3 A). However, more cells increased their intracellular Ca2+ when applying 30 seconds Sandalore (~8 %), in contrast to Brahmanol (~5 %) (data not shown). Longtime stimulation (10 minutes) with 300 µM Sandalore revealed that cells raise their intracellular Ca2+ level within the first 2 minutes during the odor application (Fig. 3 B). The number of Sandalore responding cells raised, the longer the odorant was applied. In the first 30 seconds approximately 8 % of the cells could increase their intracellular Ca2+ level (Fig. 3 E). After a 2 minute application with Sandalore, about 40 % of the cells could increase their intracellular amount of Ca2+. Citronellal, citronellol, geraniol and the OR2AT4 antagonist Phenirat could not raise the Ca2+ level in K562 cells (Fig. S2). Dose-response curve for Sandalore and Brahmanol showed that 50 µM was the lowest concentration which was able to slightly increase the intracellular Ca2+ level (Fig. 3 C). Saturation was reached for both substances at 1 mM concentration. The calculated EC50 for Sandalore was 265 µM (±32) and 392 µM (±29) for Brahmanol (Fig. 3 D). Next, we observed a receptor desensitization, after a repetitive Sandalore stimulation (Fig. 3 F). The amplitude of the second and third application is significantly reduced compared to the first one. After the third application the amplitude started to raise up again. Next, we were interested, if a single cell can respond to either Sandalore or ADP. Therefore, we applied the odorants successively in 300 µM concentration. In total, 25 % of the Sandalore responding cells were able to raise their intracellular Ca2+ level when applying ADP afterwards (Fig. 3 G). It seems that two different populations differentially expressing OR2AT4 and the already described P2Y-receptors for ADP in K562 [38].

Fig. 3 Sandalore increases intracellular Ca2+ concentration in K562. A Odorants tested on their average response in 1 mM concentration. No increase of intracellular Ca2+could be observed for the OR2AT4 antagonist Phenirat (n = 3), or for citronellal and citronellol (n = 3), which increased intracellular Ca2+ in other cancer cell lines. 100 µM ADP, a P2Y agonist [38], was used to investigate the cell viability in K562. Sandalore (n = 483 cells) and Brahmanol (n = 221 cells) increased the intracellular Ca2+. B Longtime Sandalore stimulation in calcium-imaging experiments are shown. Within 2 minutes most K562 cells increased their intracellular Ca2+ level (blue lines) when applying 300 µM Sandalore (n = 383 cells). The control was made with ringer application (grey line). C Sandalore (n = 684 cells) and Brahmanol (n = 380 cells) increases intracellular Ca2+ during application in a dose-dependent manner D The dose-response curve revealed an EC50 of 209 µM (±28) for Sandalore, and 447 µM (±32) for Brahmanol. E In longtime stimulation we observed a time depended response rate of K562 cells. For instance, 9 % of the cells responded after 30 sec, while after two minutes ~40 % of the K562 cells increased their intracellular Ca2+. F After repetitive Sandalore stimulation we observed that the second and third stimulation was lower than the first one (~0.1 f340/f380). G The response pattern of a single K562 cell on two consecutively applied substances (Sandalore and ADP). Around 25 % of all Sandalore responding cells were able to increase their intracellular Ca2+ when applying afterwards ADP (n = 5 cells).

Sandalore evokes an increase of intracellular Ca2+ by activating the OR2AT4 and a cAMP- adenylate cyclase-mediated signaling pathway To investigate the involvement of OR2AT4 in the Sandalore evoked increase of intracellular Ca2+, we used the OR2AT4 antagonist Phenirat in a 1:1 ratio (Fig. 4 A). By co-applying the antagonist with the agonist, Ca2+ currents could be completely blocked in a reversible manner. To explore the OR2AT4 signal transduction pathway, we determined the source of Ca2+ by using the Ca2+ chelator EGTA. The absence of extracellular Ca2+ abolished the Sandalore evoked increase of intracellular Ca2+ (Fig. 4 B). After rewashing with ringer’s solution, cells were able again to increase the amount of intracellular Ca2+ after Sandalore application. To investigate the induction of a cAMP-mediated pathway in K562 cells, adenylate cyclase inhibitors SQ-22536 (10 µM) and MDL-12,330A (10 µM) were used. Both inhibitors abolished a Sandalore evoked Ca2+ increase reversibly (Fig. 4 C, D). Next, cells were preincubated with the irreversible PLC inhibitor U-73122 (30 µM) for 30 minutes. U-73122 could not inhibit the Sandalore evoked increase of intracellular Ca2+ (Fig. 4 E). The protein kinase A inhibitor H-89 (10 µM) abolished the Sandalore evoked Ca2+ increase (Fig. 4 F). In the K562 sequencing analysis, the expression of several different L-type and T-type calcium channels could be observed (Fig. S1). However, the T-type channel blockers NNC-55396 (10 µM) and mibefradil (10 µM) could not inhibit the Sandalore induced Ca2+ increase (Fig. 4 G, H). In contrast, 150 µM L-cis diltiazem, an inhibitor of cyclic nucleotide-gated channels, which inhibits additionally L-type Ca2+ channels, reduced the Sandalore response significantly (Fig. I). To investigate, if an L-type voltage-gated Ca2+ channel is involved in the increase of intracellular Ca2+, we used the inhibitor Verapamil (20 µM). Cells being incubated in Verapamil had a significant lower increase of intracellular Ca2+ (Fig. 4 J). In figure 5, an overview of the calcium-imaging results are shown. In figure 3 F we showed a desensitizing effect after repetitive Sandalore application. To investigate the significance of the blocking effect, we compared the Ca2+ increase evoked by the Sandalore and the inhibitors to the average of Sandalore application done in figure 3 F. For the inhibitor experiments with U-73122 (30 µM), EGTA (10 mM) and Verapamil (20 µM), we preincubated the cell culture with the inhibitors before starting the experiments, so these amplitudes were compared to the first control application of Sandalore. Summarized calcium-imaging results can be found in figure 5.

Fig. 4 Sandalore activates the OR2AT4 and triggers an adenylate cyclase- PKA-mediated signaling pathway. A The 300 µM Sandalore response could be blocked almost completely when co- applying the OR2AT4 antagonist Phenirat (ratio, 1:1, n = 55 cells). B The Sandalore induced increase of intracellular Ca2+ is dependent on extracellular Ca2+. 10 mM EGTA was used and preincubated for 2 minutes. The same cells were able to response again after the wash out (n = 85 cells). C/D The adenylate cyclase inhibitor SQ-22536 (10 µM, n = 201 cells) and MDL-12,330A (10 µM, n = 258 cells) completely blocked the Sandalore induced increase of intracellular Ca2+. E The PLC inhibitor U- 73122 (30 µM) was incubated 30 minutes before starting the experiment. The Sandalore induced respond could not be blocked by the PLC inhibitor (n = 177 cells). F The PKA inhibitor H-89 (10 µM) blocked the Sandalore induced increase of intracellular Ca2+ (n = 78 cells). G The T-type calcium channel inhibitor NNC-550396 was not able to decrease the influx of extracellular Ca2+ (n = 92 cells). H Mibefradil, a further T-type calcium channel inhibitor, could not block the influx of extracellular Ca2+ (n = 67 cells). I L-cis diltiazem slightly blocked the Ca2+ influx (n = 182 cells). J Cells were preincubated with 20 µM Verapamil before starting the experiments. The L-type channel blocker significantly decreased the increase of intracellular Ca2+ compared to Sandalore. However, Verapamil could not completely abolish the Sandalore evoked increase of intracellular Ca2+.

Fig. 5 Summarized signaling amplitudes of the Sandalore. Sandalore induced a Ca2+ increase in K562 cells. Inhibitor experiments were analyzed relative to the first and second application of Sandalore. Verapamil, EGTA and U-73122 were preincubated before starting the experiments so that these applications were compared to the first control Sandalore application: Sandalore (1. n = 483 cells), Verapamil (n = 68 cells), U-73122 (n = 177 cells), EGTA (n = 85 cells). Other inhibitor experiments were compared to the second application of Sandalore: Sandalore (2. n = 421 cells), H89 (n = 78 cells), SQ-22536 (n = 201 cells), MDL-12,330A (n = 258 cells), mibefradil (n = 67 cells), NNC-550396 (n = 92 cells), L-cis diltiazem (n = 182 cells), Phenirat and Sandalore (1:1) (n = 55 cells).

Sandalore evokes an increase of intracellular Ca2+ in white blood cells delivered from AML-patients To investigate if Sandalore increases intracellular Ca2+ also in native cells, we isolated white blood cells of clinically diagnosed AML-patients and measured them with calcium-imaging. During application with Sandalore AML-cells significantly increased their intracellular Ca2+ (Fig. 6 A, B). To observe if the same signaling pathway as in K562 is used in native cells, we inhibited the adenylate cyclase with 10 µM SQ-22536 and determined the source of Ca2+ (Fig 6. C, D). As shown for K562 both, extracellular Ca2+ and the adenylate cyclase are necessary for the increase of intracellular Ca2+. However, in contrast to K562 cells, many AML-cells spontaneously showed transient Ca2+ signals. To distinguish between a spontaneously and an odorant induced increase of intracellular Ca2+, we applied ringer’s solution to deter-mine the rate of responding cells during application. In the average, 10 % (±0.2) of the cells were responding spontaneously during the application of ringer’s solution (Fig. 6 E). Nevertheless, a significantly higher amount of cells increased the intracellular Ca2+ during the application of 300 µM Sandalore (31 % ±2.5). No significant difference could be observed between the control- and a 10 µM Sandalore application (Fig. 6 E).

Fig. 6 Sandalore increases the intracellular Ca2+ in white blood cells of AML-patients. A White blood cells were isolated and incubated with fura-2 AM. Cells increased their intracellular Ca2+ during Sandalore application. All experiments were performed at least at 3 different AML-diagnosed patients (n = 3). B The OR2AT4 agonist could repetitively increase the intracellular Ca2+ (n = 6). C The adenylate cyclase inhibitor SQ-22536 (10 µM) completely blocked the Sandalore induced increase of intracellular Ca2+ (n = 3). D EGTA incubated cells were not able to increase the amount of intracellular Ca2+ (n = 3). E To distinguish between spontaneously and agonist evoked cell responses, we compared the number of responding cells during odor application to the cells responding during ringer’s solution application (grey line). The number of responding cells for 10 µM Sandalore was not different from the control. SQ-22536 and EGTA significantly reduced the number of responding cells and verify an involvement of the adenylate cyclase and extracellular Ca2+.

Sandalore increases p44/42-MAPK and Akt phosphorylation and induces a time dependent in- and decrease of the p38-MAPK phosphorylation To observe how the increase of intracellular Ca2+ by Sandalore affects main physiological functions in K562 cells, such as differentiation, proliferation, or apoptosis, we performed western blot experiments to investigate the phosphorylation for the kinases involved in such processes. Cells were incubated for 1 hour with 100 μM Sandalore which increased the p44/42-MAPK and Akt phosphorylation, respectively (Fig. 7 A, B).

Fig. 7 Sandalore induces Akt and p44/42-MAPK phosphorylation and decreases p38-MAPK phosphorylation. A K562 cells were incubated for 5, 15, 30, and 60 min with 100 µM Sandalore. Proteins were isolated and the phosphorylation of p44/42-MAPK, JNK, p38-MAPK and Akt were investigated. The phosphorylation of Akt and p44/42-MAPK strongly increased. Sandalore did not alter the JNK phosphorylation. The phosphorylation of p38-MAPK was, except after 15 minutes, under the basal phosphorylation of the DMSO control. B Summarized time dependent phosphorylation for p44/42-MAPK, p38-MAPK, JNK and Akt.

Fig. 8 p44/42-MAPK and Akt are activated by calmodulin. A The Sandalore induced phosphorylation of p44/42-MAPK and Akt is dependent on the activation of the Ca2+ activated protein calmodulin. The CaMKII activity was inhibited by 10 µM KN-62. Vinculin was used as a charging control. B The inhibition of CaMKII significantly decreased the Sandalore evoked p44/42-MAPK phosphorylation and indicates an involvement of calmodulin. C KN-62 had no influence on p38-MAPK phosphorylation. D As shown for p44/42-MAPK, KN-62 also decreased the Akt phosphorylation significantly.

The strongest phosphorylation for p44/42-MAPK was observed after 60 minutes of incubation with 100 µM Sandalore (Fig. 7 B). The p44/42-MAPK phosphorylation was 2.1 (±0.22) times higher (Fig. 7 B), while the Akt phosphorylation was 2.7 (±0.34) times higher than in the control. The p38-MAPK phosphorylation was mainly reduced by around 0.74 (±0.09) after 60 minutes, except in the 15 minute probe (1.39 ±0.21) (Fig. 7 B). The phosphorylation of the JNK-SAPK did not alter in comparison to the DMSO cells (Fig. 7 B). Previous studies showed that Ca2+ activates calmodulin, which is able to trigger the phosphorylation of MAPKs [42,43]. Therefore, cells were treated for 1 hour with 100 µM Sandalore including 10 µM of the CaMKII inhibitor KN-62 (Fig. 8 A, B). KN-62 and Sandalore treated cells showed a decreased p44/42-MAPK and Akt phosphorylation compared to the control cells (Fig. 8 B). The p38-MAPK phosphorylation did not change with the inhibitor.

The activation of OR2AT4 by Sandalore inhibits cell proliferation in K562 by decreasing the early phosphorylation p38-MAPK In previous studies it was shown that odors can influence the proliferation of cancer cells via OR activation [9,44,8,45]. Therefore, cells were incubated for 5 days with different concentrations of Sandalore which was able to decrease the cell proliferation significantly in a dose-dependent manner (Fig. 9 C) whereas DMSO had no effect (Fig. 9 A). 10 µM Sandalore did not decrease the cell proliferation significantly, whereas 30 µM Sandalore could inhibit the proliferation after 5 days for about 15 % (Fig. 9 B). In contrast, 100 µM Sandalore inhibited the proliferation for about 54 %, while 300 µM Sandalore treated cells did not only inhibit the proliferation, but rather decreased the cell number in comparison to the first day. The IC50 for Sandalore was 124 µM. To investigate the involvement of MAPKs and Akt we incubated the cells with the appropriate inhibitors and measured the number of cells after 5 days of incubation (Fig. 9 D). All used inhibitors decreased the proliferation rate compared to the DMSO treated cells. In correlation to this, we observed a lower p38-MAPK phosphorylation beginning after 30 minutes incubation with 100 µM Sandalore. Phenirat were used to investigate, if the antagonist could prevent the inhibitory effect of Sandalore (Fig. 9 D). However, an incubation of Phenirat and Sandalore could increase again the amount of cells, but not significantly (Fig. 9 D).

Fig. 9 Sandalore decreases the K562 proliferation. A As a control 0.1 % DMSO treated cells were used and compared to RPMI-1640 medium incubated cells. Relative proliferation was measured with the CyQUANT cell proliferation assay in a 96-well plate-reader. B Relative proliferation for Sandalore treated cells compared to the control DMSO C Dose-response curve for the inhibitory effect of

Sandalore after 5 days of incubation (IC50 = 124 µM) D Cell proliferation normalized and compared to 0.1 % DMSO treated cells after 5 days. Inhibitors were used in a concentration 10 µM. The Sandalore concentration was 100 µM (n = 5 - 9).

The activation of OR2AT4 by Sandalore evokes cell apoptosis in K562 by increasing p44/42-MAPK phosphorylation To investigate if the increase phosphorylation of p44/42-MAPK and Akt may correlate with an increased apoptosis, we investigated the Sandalore induced apoptosis by using annexin-V and propidium iodide. Therefore, cells were incubated for 1 hour with different Sandalore concentrations. Sandalore evoked apoptosis in a dose-dependent manner (Fig. 10 A). The saturation of Sandalore induced apoptosis was reached at concentrations of 700 µM, with a total amount of 62 % (±4.4) apoptotic cells. The EC50 for the Sandalore induced apoptosis was 395 µM (Fig. 10 B). Immunocytochemical stainings revealed an activation of caspase-3 after an 1 hour treatment with 100 µM Sandalore, compared to the control 0.1 % DMSO (Fig. 10 C).

Fig. 10 Sandalore evokes apoptosis and activates caspase-3. A Fluorescence microscopy of annexin-V and propidium iodide showed that Sandalore induces apoptosis (green), and very rare necrosis (red), in a dose-dependent manner. K562 cells were incubated for 1 hour with 10 µM - 1 mM Sandalore. DMSO did not induce any apoptosis in K562 cells (n = 5). B Dose-dependent concentrations of Sandalore increase the apoptosis rate, and weakly the necrosis rate in K562 cells.

The IC50 for the Sandalore evoked apoptosis is 395 µM. C Immunofluorescence staining with the antibody for caspase-3 revealed an increase of caspase-3 after 1 hour incubation with 100 µM Sandalore in contrast to the untreated cells (0.1 % DMSO in RPMI-1640 medium). Scale bar: 20 µm.

To investigate, how the phosphorylation of the MAPKs and Akt are involved in the Sandalore induced apoptosis, we used 10 µM of U0126 (pp44/42-MAPK inhibitor), SB203580 (pp38- MAPK inhibitor), and LY294002 (pAKT inhibitor) (Fig. 11 A). By blocking the p44/42- MAPK phosphorylation, the apoptotic influence of 300 µM Sandalore was completely abolished. Inhibiting the Akt phosphorylation increased the apoptosis rate to the same level as the Sandalore treated cells. The p38-MAPK inhibitor did not change the Sandalore induced apoptosis and is clearly not involved in the apoptotic mechanism of K562 cells. In figure 11 B the amount of necrotic cells during the experiments are shown.

Fig. 11 p44/42-MAPK phosphorylation is necessary for the Sandalore induced apoptosis. A The pp44/42-MAPK inhibitor U0126 could almost completely inhibit the 300 µM Sandalore induced apoptosis back to the normal apoptosis rate. The Akt inhibitor increased the apoptosis rate and showed a further enhancement if incubated with Sandalore. The pp38-MAPK inhibitor SB203580 did not affect the Sandalore induced apoptosis rate. B pp44/42-MAPK inhibitor also decreased the amount of necrotic cells. The other inhibitors did not influence the necrosis rate relative to the medium treated cells. (n = 4 - 5).

Sandalore enhances the hemoglobin synthesis in K562 cells by increasing p44/42-MAPK and time dependent p38-MAPK phosphorylation In K562 cells the p38-MAPK phosphorylation, but also the p44/42-MAPK phosphorylation is said to be linked to an increase of erythrocyte differentiation [46–49]. To investigate, if 100 µM Sandalore is able to enhance the erythrocyte differentiation, we measured the hemoglobin (HgB) concentration after a 6 day treatment with different substances (Fig. 12 A). We used 10 µM hemin as a positive control for the enhancement of the HgB synthesis [50]. Sandalore was used in a 100 µM concentration and showed a significant increase of HgB synthesis in comparison to untreated cells (Fig. 12 A). Next, the OR2AT4 antagonist Phenirat was used to prove the involvement in the hemoglobin synthesis. Thus, Phenirat significantly decreased the Sandalore induced hemoglobin synthesis to the control level. 100 µM Phenirat did not influence the HgB production. To examine the involvement of MAPKs and calmodulin, we used the same inhibitors as described previously. The strong observed phosphorylation of p44/42-MAPK and the early (at minute 15) p38-MAPK phosphorylation were necessary for the Sandalore induced HgB production.

Fig. 12 Sandalore enhances the hemoglobin synthesis in K562 cells and the amount of proerythrobasts. A Spectrometric analysis showed that 100 µM Sandalore enhances the hemoglobin synthesis in K562 cells after 6 days of incubation. 10 µM hemin was used as a positive control. 100 µM Phenirat prevent the Sandalore increased hemoglobin production significantly (n = 9) B The p44/42-MAPK phosphorylation and the early stage phosphorylation of p38-MAPK within the first 15 minutes, are partially involved in the hemoglobin synthesis enhancement through Sandalore, but not for hemin C According to the increase of hemoglobin by 100 µM Sandalore, the Pappenheim-staining revealed a higher amount of proerythroblast cells in Sandalore incubated cells, compared to the control (blue arrows). Scale bars: 10 µm.

In accordance to previous studies, the hemin induced HgB synthesis was not blocked by the inhibitors [46]. However, the p44/42-MAPK and p38-MAPK inhibitors, but also the CaMKII inhibitor KN-62 prevent the Sandalore induced HgB production. Furthermore, K562 cells were incubated in 100 µM Sandalore and stained with the Pappenheim-staining (Fig. 12 B). The staining experiments revealed that the Sandalore treated cells have more precursor cells of erythroblasts (white arrows), compared to the control (DMSO).

Discussion The function of ectopic expressed olfactory receptors Several studies describe the anti-cancer effect induced by odorous substancens, often terpenes, which are parts in essential oils [51–56,9]. In total, half of all produced anti-cancer drugs are natural products or synthetic derivatives [57,58]. In some cases, ORs are reported to serve as targets for such substances and inhibit the proliferation of cancer cells [8,9]. In this present work, we used K562 cells, a common cell model used for investigating the physiology of CML. Here, we detected seven moderately expressed ORs including the OR2AT4. A previously made study characterized the OR2AT4 in transfected HEK293 cells and HaCaT cells and determine the specific agonists Sandalore, Javanol, and Brahmanol and the antagonists Phenirat and Oxyphenilon [16]. We validated the expression of OR2AT4 in

K562 by RT-PCR, immunohistological stainings, and western blots. We confirmed the expression of all higher (> 1 FPKM) detected ORs in native white blood cells of newly diagnosed AML-patients by RT-PCR. Further, we observed the same OR2AT4-mediated signaling pathway in both cell systems. In addition to this, we characterized the involvement of OR2AT4 in main physiological functions, such as proliferation, apoptosis and differentiation.

The OR2AT4 signaling pathway in K562 and in white blood cells of AML-patients In calcium-imaging experiments 1 mM Sandalore was able to increase the amount of intracellular Ca2+ in K562. To describe the physiological function of ORs in the myeloid cells, we focused mainly on the characterization of the OR2AT4. The OR2AT4 is described to be a narrowly tuned receptor which responds only to a small subset of molecular related odorants

[59,16]. Our Next-Generation Sequencing data revealed that K562 cells express no Golf- protein which is an essential part of the OR-specific signaling transduction pathway in the nasal epithelium [60]. However, in previously done experiments, ectopic expressed ORs showed the possibility to bind to other G-proteins, such as Gq or Gs [61,62]. It has been shown, that ectopically expressed ORs can use a variety of different signal transduction mechanisms, such as Src-kinase, PLC- or cAMP-mediated pathways [63,13,16]. Our experiments showed that the OR2AT4 signaling pathway is cAMP- and PKA-mediated, with downstream located L-type calcium channels which partially enable an influx of extracellular Ca2+. According to this, other ectopically expressed ORs, such as the OR1A2 in the hepatocarcinoma cell line Hu7 or the OR2AT4 in keratinocytes are also described to activate a cAMP-dependent signaling pathway [16,9]. Dose-respond curves showed that the EC50 for the activation of OR2AT4 by Sandalore in K562 (209 µM) is in similar concentration as previously mentioned for the OR in keratinocytes (430 µM). Also the EC50 value for the cAMP-activation in K562 (305 µM) is similar to the activation mentioned in keratinocytes (197 µM). In white blood cells of newly diagnosed myelogenous leukemia patients we detected the same OR expression pattern as in K562 cells. In these native cells Sandalore could repetitively raise the intracellular Ca2+ level. To distinguish between a spontaneous and an odor induced activation, we performed control experiments in which we applied repetitively ringer’s solution. Odors in 10 µM concentration did not differentiate between the ringer applications. As shown in K562, also in this native cell system extracellular Ca2+ and the adenylate cyclase

23 was necessary for the Sandalore induced increase of intracellular Ca2+. This experiments verify that the OR2AT4 in native AML-cells use the same signaling pathway in the CML- model K562.

Physiological role of the OR2AT4 in K562 cells Sandalore could strongly inhibit the proliferation of K562 cells in a dose-dependent manner. After 5 days a 100 % inhibition of proliferation could be observed with 300 µM Sandalore. A concentration of 100 µM Sandalore decreased the proliferation to ~54 %. According to the dose-respond curves in the calcium-imaging experiments, no significant effect could be observed with 10 µM and 30 µM Sandalore. In contrast to this, the activation of the OR2AT4 by Sandalore (500 µM) in keratinocytes has been shown to increase the cell proliferation up to approximately 20 %. The physiological function of the OR2AT4 in skin differs. Comparing both cell systems, one reason for that could be the different MAPK-phosphorylation. In keratinocytes the p38-MAPK was significantly increased [16], in contrast to the decreased p38-MAPK phosphorylation observed in K562 cells. We detected a decreased phosphorylation of the p38-MAPK after 30 minutes incubation with 100 µM Sandalore. According to this, other studies in K562 showed that an increase of p38-MAPK did not affect the proliferation, while a decreased p38-MAPK phosphorylation significantly reduced the cell proliferation [64]. The physiological role of MAPKs can vary dependent on the cell system and applied substance [65,66]. Our inhibitor experiments verify the involvement of p38- MAPK in the Sandalore induced inhibition of proliferation. However, when the cells were treated with SB203580 and Sandalore the decreased proliferation effect was additive. Therefore, we investigated additional initiations of apoptosis through Sandalore, which could be the reason for the cumulative decreased proliferation. By investigating the apoptosis rate, we observed a dose-dependent activity of Sandalore. In maximum, about 62 % apoptotic cells were detected after incubation with 700 µM Sandalore. Additionally to this, inhibitor experiments showed a significant involvement of the p44/42- MAPK phosphorylation in the Sandalore induced apoptosis. In previous studies, it has been shown that in K562 cells both possibilities namely an inhibition and an enhancement of apoptosis through p44/42-MAPK phosphorylation exists, depending on either, the substance or the involved receptor [67–69,22,70]. A growing number of newly made studies report that a phosphorylation of p44/42-MAPK within 24 hours initiates apoptosis [71–80,48]. However, in the present work we showed that apoptosis induced by Sandalore is evoked through an

24 increase of intracellular Ca2+ which activates calmodulin and triggers the p44/42-MAPK phosphorylation, followed with an caspase-3 activation. In 2007, Wang and colleagues showed a similar case evoked by a cyclic lipopeptide, a substance inducing apoptosis via a caspase-3 activation in K562 [36]. Later, Wang observed that this apoptosis processes due to an increase of intracellular Ca2+, an increased p44/42-MAPK phosphorylation, followed by a Bcl-2 down-regulation, and a cytochrome-c, caspase-3 activation [22]. We highly suggest a similar mechanism in the Sandalore induced apoptosis, triggered by the strong Ca2+ influx through the OR2AT4. Beside p38-MAPK and p44/42-MAPK, we observed that Sandalore increases the phosphorylation of Akt in K562 cells in a time dependent manner. The PI3K/Akt pathway is broadly described as a critical downstream signaling pathway, playing an essential role in enhancing the survival ability and inducing less apoptosis of chronic myelogenous leukemia and other cancer types [81,82]. In Sandalore treated cells, Akt is highly phosphorylated and displays the insistent attempt of K562 cells to proliferate and survive when Sandalore is applied, which fits well to the inhibitor experiments in the proliferation. However, the p44/42- MAPK phosphorylation induced by Sandalore seems to be more dominant, so that cells start die through apoptosis. When Akt phosphorylation was inhibited by LY254002 during Sandalore incubation, more apoptotic cells could be identified. Next, we investigated that 100 µM Sandalore could increase the amount of produced hemoglobin in a K562 cell culture. According to previously made studies with other substances, inhibiting early p38- and p44/42-MAPK phosphorylation [30,46,48,83] prevent this process for Sandalore, but not for 10 µM hemin [46]. In our case, both the p44/42-MAPK and the p38-MAPK phosphorylation are partially necessary for the hemoglobin synthesis by 6 days stimulation with 100 µM Sandalore. According to this, inhibiting the CaMKII with KN- 62 triggers the phosphorylation of p44/42-MAPK and leads to a decreased amount hemoglobin. Further, a Pappenheim-staining with 100 µM Sandalore treated cells for 5 days, revealed an increase of erythroblastic precursor cells compared to untreated K562 cells. To sum up, we discovered ectopically expressed ORs in both K562 and AML-white blood cells. We showed that the synthetic sandalwood compound Sandalore activates the OR2AT4 in K562, triggers cAMP-adenylate cyclase-mediated pathway and leads to an increase of intracellular Ca2+. The same signaling pathway could be observed in white blood cells of fresh diagnosed and untreated AML-patients. In K562, Sandalore partially activates calmodulin. The activation of calmodulin phosphorylates p44/42-MAPK and Akt, but is not involved in

25 the decreased p38-MAPK phosphorylation. Phosphorylated p44/42-MAPK evokes an enhancement of apoptosis in K562, probably as described by Wang in 2009, through a subsequent Bcl-2 down-regulation and an increased cytochrome-c, caspase-3 activation [22]. Additionally, both, p44/42-MAPK and the early p38-MAPK phosphorylation seem to play a partially role in initiating hemoglobin producing cells in K562. Discovering this signaling pathway which can induce a decreased proliferation, an increased apoptosis and an enhanced hemoglobin synthesis, should give a greater insight to the functional role of ectopic expressed ORs in cancer cells. Additionally this present work reveals an insight of new physiological mechanisms in myeloid leukemia cells.

References

1. Buck L, Axel R (1991) A novel multigene family may encode odorant receptors: a molecular basis for odor recognition. Cell 65 (1): 175–187. 2. Firestein S (2001) How the olfactory system makes sense of scents. Nature 413 (6852): 211–218. 3. Glusman G, Yanai I, Rubin I, Lancet D (2001) The complete human olfactory subgenome. Genome Res. 11 (5): 685–702. 4. Mombaerts P (2004) Genes and ligands for odorant, vomeronasal and taste receptors. Nat. Rev. Neurosci. 5 (4): 263–278. 5. Feldmesser E, Olender T, Khen M, Yanai I, Ophir R et al. (2006) Widespread ectopic expression of olfactory receptor genes. BMC Genomics 7: 121. 6. Vanderhaeghen P, Schurmans S, Vassart G, Parmentier M (1997) Molecular cloning and chromosomal mapping of olfactory receptor genes expressed in the male germ line: evidence for their wide distribution in the human genome. Biochem. Biophys. Res. Commun. 237 (2): 283–287. 7. Flegel C, Manteniotis S, Osthold S, Hatt H, Gisselmann G (2013) Expression profile of ectopic olfactory receptors determined by deep sequencing. PLoS ONE 8 (2): e55368. 8. Neuhaus EM, Zhang W, Gelis L, Deng Y, Noldus J et al. (2009) Activation of an olfactory receptor inhibits proliferation of prostate cancer cells. J. Biol. Chem. 284 (24): 16218–16225. 9. Maßberg D, Simon A, Häussinger D, Keitel V, Gisselmann G et al. (2014) Monoterpene (-)-citronellal affects hepatocarcinoma cell signaling via an olfactory receptor. Arch. Biochem. Biophys. 10. Spehr M, Gisselmann G, Poplawski A, Riffell JA, Wetzel CH et al. (2003) Identification of a testicular odorant receptor mediating human sperm chemotaxis. Science 299 (5615): 2054–2058. 11. Weng J, Wang J, Hu X, Wang F, Ittmann M et al. (2006) PSGR2, a novel G-protein coupled receptor, is overexpressed in human prostate cancer. Int. J. Cancer 118 (6): 1471–1480. 12. Xu LL, Stackhouse BG, Florence K, Zhang W, Shanmugam N et al. (2000) PSGR, a novel prostate-specific gene with homology to a G protein-coupled receptor, is overexpressed in prostate cancer. Cancer Res. 60 (23): 6568–6572. 13. Braun T, Voland P, Kunz L, Prinz C, Gratzl M (2007) Enterochromaffin cells of the human gut: sensors for spices and odorants. Gastroenterology 132 (5): 1890–1901.

14. Zhang X, Bedigian AV, Wang W, Eggert US (2012) G protein-coupled receptors participate in cytokinesis. Cytoskeleton (Hoboken) 69 (10): 810–818. 15. Pluznick JL, Protzko RJ, Gevorgyan H, Peterlin Z, Sipos A et al. (2013) Olfactory receptor responding to gut microbiota-derived signals plays a role in renin secretion and blood pressure regulation. Proc. Natl. Acad. Sci. U.S.A. 110 (11): 4410–4415. 16. Busse D, Kudella P, Grüning N, Gisselmann G, Ständer S et al. (2014) A Synthetic Sandalwood Odorant Induces Wound-Healing Processes in Human Keratinocytes via the Olfactory Receptor OR2AT4. J. Invest. Dermatol. 17. Ye J, Mao W, Wu A, Zhang N, Zhang C et al. (2007) Cadmium-induced apoptosis in human normal liver L-02 cells by acting on mitochondria and regulating Ca(2+) signals. Environ. Toxicol. Pharmacol. 24 (1): 45–54. 18. Sergeev IN, Li S, Colby J, Ho C, Dushenkov S (2006) Polymethoxylated flavones induce Ca(2+)-mediated apoptosis in breast cancer cells. Life Sci. 80 (3): 245–253. 19. Miglietta A, Bozzo F, Bocca C, Gabriel L, Trombetta A et al. (2006) Conjugated linoleic acid induces apoptosis in MDA-MB-231 breast cancer cells through ERK/MAPK signalling and mitochondrial pathway. Cancer Lett. 234 (2): 149–157. 20. Ramljak D, Coticchia CM, Nishanian TG, Saji M, Ringel MD et al. (2003) Epidermal growth factor inhibition of c-Myc-mediated apoptosis through Akt and Erk involves Bcl- xL upregulation in mammary epithelial cells. Exp. Cell Res. 287 (2): 397–410. 21. Veitinger T, Riffell JR, Veitinger S, Nascimento JM, Triller A et al. (2011) Chemosensory Ca2+ dynamics correlate with diverse behavioral phenotypes in human sperm. J. Biol. Chem. 286 (19): 17311–17325. 22. Wang CL, Ng TB, Cao XH, Jiang Y, Liu ZK et al. (2009) CLP induces apoptosis in human leukemia K562 cells through Ca(2+) regulating extracellular-related protein kinase ERK activation. Cancer Lett. 276 (2): 221–227. 23. Sergeev IN (2005) Calcium signaling in cancer and vitamin D. J. Steroid Biochem. Mol. Biol. 97 (1-2): 145–151. 24. Lozzio CB, Lozzio BB (1975) Human chronic myelogenous leukemia cell-line with positive Philadelphia chromosome. Blood 45 (3): 321–334. 25. Klein E, Ben-Bassat H, Neumann H, Ralph P, Zeuthen J et al. (1976) Properties of the K562 cell line, derived from a patient with chronic myeloid leukemia. Int. J. Cancer 18 (4): 421–431. 26. Andersson LC, Nilsson K, Gahmberg CG (1979) K562--a human erythroleukemic cell line. Int. J. Cancer 23 (2): 143–147. 27. NOWELL PC, HUNGERFORD DA (1960) Chromosome studies on normal and leukemic human leukocytes. J. Natl. Cancer Inst. 25: 85–109. 28. Bartram CR, Klein A de, Hagemeijer A, van Agthoven T, van Geurts Kessel A et al. (1983) Translocation of c-ab1 oncogene correlates with the presence of a Philadelphia chromosome in chronic myelocytic leukaemia. Nature 306 (5940): 277–280. 29. Jiang Y, Zhao RC, Verfaillie CM (2000) Abnormal integrin-mediated regulation of chronic myelogenous leukemia CD34+ cell proliferation: BCR/ABL up-regulates the cyclin-dependent kinase inhibitor, p27Kip, which is relocated to the cell cytoplasm and incapable of regulating cdk2 activity. Proc. Natl. Acad. Sci. U.S.A. 97 (19): 10538– 10543. 30. Sawyers CL (1993) Molecular consequences of the BCR-ABL translocation in chronic myelogenous leukemia. Leuk. Lymphoma 11 Suppl 2: 101–103. 31. Bedi A, Zehnbauer BA, Barber JP, Sharkis SJ, Jones RJ (1994) Inhibition of apoptosis by BCR-ABL in chronic myeloid leukemia. Blood 83 (8): 2038–2044.

32. McGahon AJ, Martin SJ, Bissonnette RP, Mahboubi A, Shi Y et al. (1995) The end of the (cell) line: methods for the study of apoptosis in vitro. Methods Cell Biol. 46: 153– 185. 33. Druker BJ, Guilhot F, O'Brien SG, Gathmann I, Kantarjian H et al. (2006) Five-year follow-up of patients receiving imatinib for chronic myeloid leukemia. N. Engl. J. Med. 355 (23): 2408–2417. 34. Calabretta B, Perrotti D (2004) The biology of CML blast crisis. Blood 103 (11): 4010– 4022. 35. Trapnell C, Pachter L, Salzberg SL (2009) TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 25 (9): 1105–1111. 36. Wang CL, Ng TB, Yuan F, Liu ZK, Liu F (2007) Induction of apoptosis in human leukemia K562 cells by cyclic lipopeptide from Bacillus subtilis natto T-2. Peptides 28 (7): 1344–1350. 37. Illert AL, Albers C, Kreutmair S, Leischner H, Peschel C et al. (2014) Grb10 is involved in BCR-ABL-positive leukemia in mice. Leukemia. 38. Murgo AJ, Sistare FD (1992) K562 leukemia cells express P2T (adenosine diphosphate) purinergic receptors. J. Pharmacol. Exp. Ther. 261 (2): 580–585. 39. Palme D, Misovic M, Schmid E, Klumpp D, Salih HR et al. (2013) Kv3.4 potassium channel-mediated electrosignaling controls cell cycle and survival of irradiated leukemia cells. Pflugers Arch. 465 (8): 1209–1221. 40. Schneider CA, Rasband WS, Eliceiri KW (2012) NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 9 (7): 671–675. 41. Okazaki K, Ishikawa T, Inui M, Tada M, Goshima K et al. (1994) KN-62, a specific Ca++/calmodulin-dependent protein kinase inhibitor, reversibly depresses the rate of beating of cultured fetal mouse cardiac myocytes. J. Pharmacol. Exp. Ther. 270 (3): 1319–1324. 42. Williams CL, Phelps SH, Porter RA (1996) Expression of Ca2+/calmodulin-dependent protein kinase types II and IV, and reduced DNA synthesis due to the Ca2+/calmodulin- dependent protein kinase inhibitor KN-62 (1-[N,O-bis(5-isoquinolinesulfonyl)-N-methyl- L-tyrosyl]-4-phenyl piperazine) in small cell lung carcinoma. Biochem. Pharmacol. 51 (5): 707–715. 43. Ci W, Li W, Ke Y, Qian Z, Shen X (2003) Intracellular Ca(2+) regulates the cellular iron uptake in K562 cells. Cell Calcium 33 (4): 257–266. 44. Hong J, Nam J, Seo E, Lee SK (2010) Daphnane diterpene esters with anti-proliferative activities against human lung cancer cells from Daphne genkwa. Chem. Pharm. Bull. 58 (2): 234–237. 45. Bardon S, Foussard V, Fournel S, Loubat A (2002) Monoterpenes inhibit proliferation of human colon cancer cells by modulating cell cycle-related protein expression. Cancer Lett. 181 (2): 187–194. 46. Witt O, Sand K, Pekrun A (2000) Butyrate-induced erythroid differentiation of human K562 leukemia cells involves inhibition of ERK and activation of p38 MAP kinase pathways. Blood 95 (7): 2391–2396. 47. Sawafuji K, Miyakawa Y, Kizaki M, Ikeda Y (2003) Cyclosporin A induces erythroid differentiation of K562 cells through p38 MAPK and ERK pathways. Am. J. Hematol. 72 (1): 67–69. 48. Woessmann W, Zwanzger D, Borkhardt A (2004) ERK signaling pathway is differentially involved in erythroid differentiation of K562 cells depending on time and the inducing agent. Cell Biol. Int. 28 (5): 403–410. 49. Kucukkaya B, Arslan DO, Kan B (2006) Role of G proteins and ERK activation in hemin-induced erythroid differentiation of K562 cells. Life Sci. 78 (11): 1217–1224.

50. Sasaki D, Kosunago S, Mikami T, Matsumoto T, Suzuki M (1994) Growth-inhibition by hemin in K562 human leukemic cells is related to hemoglobin-producing activity. Biol. Pharm. Bull. 17 (5): 586–590. 51. Paz-Elizur T, Sevilya Z, Leitner-Dagan Y, Elinger D, Roisman LC et al. (2008) DNA repair of oxidative DNA damage in human carcinogenesis: potential application for cancer risk assessment and prevention. Cancer Lett. 266 (1): 60–72. 52. Lampronti I, Saab AM, Gambari R (2006) Antiproliferative activity of essential oils derived from plants belonging to the Magnoliophyta division. Int. J. Oncol. 29 (4): 989– 995. 53. Jaganathan SK, Mazumdar A, Mondhe D, Mandal M (2011) Apoptotic effect of eugenol in human colon cancer cell lines. Cell Biol. Int. 35 (6): 607–615. 54. Jaganathan SK, Supriyanto E (2012) Antiproliferative and molecular mechanism of eugenol-induced apoptosis in cancer cells. Molecules 17 (6): 6290–6304. 55. Xiao Y, Yang F, Li S, Hu G, Lee S et al. (2008) Essential oil of Curcuma wenyujin induces apoptosis in human hepatoma cells. World J. Gastroenterol. 14 (27): 4309–4318. 56. Sylvestre M, Legault J, Dufour D, Pichette A (2005) Chemical composition and anticancer activity of leaf essential oil of Myrica gale L. Phytomedicine 12 (4): 299–304. 57. Cragg GM, Newman DJ, Weiss RB (1997) Coral reefs, forests, and thermal vents: the worldwide exploration of nature for novel antitumor agents. Semin. Oncol. 24 (2): 156– 163. 58. Newman DJ, Cragg GM (2007) Natural products as sources of new drugs over the last 25 years. J. Nat. Prod. 70 (3): 461–477. 59. Bieri S, Monastyrskaia K, Schilling B (2004) Olfactory receptor neuron profiling using sandalwood odorants. Chem. Senses 29 (6): 483–487. 60. Jones DT, Reed RR (1989) Golf: an olfactory neuron specific-G protein involved in odorant signal transduction. Science 244 (4906): 790–795. 61. Boekhoff I, Breer H (1990) Differential stimulation of second messenger pathways by distinct classes of odorants. Neurochem. Int. 17 (4): 553–557. 62. Boekhoff I, Tareilus E, Strotmann J, Breer H (1990) Rapid activation of alternative second messenger pathways in olfactory cilia from rats by different odorants. EMBO J. 9 (8): 2453–2458. 63. Spehr J, Gelis L, Osterloh M, Oberland S, Hatt H et al. (2011) G protein-coupled receptor signaling via Src kinase induces endogenous human transient receptor potential vanilloid type 6 (TRPV6) channel activation. J. Biol. Chem. 286 (15): 13184–13192. 64. Zhang H, Tan S, Wang J, Chen S, Quan J et al. (2014) Musashi2 modulates K562 leukemic cell proliferation and apoptosis involving the MAPK pathway. Exp. Cell Res. 320 (1): 119–127. 65. Sweeney G, Somwar R, Ramlal T, Volchuk A, Ueyama A et al. (1999) An inhibitor of p38 mitogen-activated protein kinase prevents insulin-stimulated glucose transport but not glucose transporter translocation in 3T3-L1 adipocytes and L6 myotubes. J. Biol. Chem. 274 (15): 10071–10078. 66. Heidenreich KA, Kummer JL (1996) Inhibition of p38 mitogen-activated protein kinase by insulin in cultured fetal neurons. J. Biol. Chem. 271 (17): 9891–9894. 67. Persons DL, Yazlovitskaya EM, Cui W, Pelling JC (1999) Cisplatin-induced activation of mitogen-activated protein kinases in ovarian carcinoma cells: inhibition of extracellular signal-regulated kinase activity increases sensitivity to cisplatin. Clin. Cancer Res. 5 (5): 1007–1014. 68. Cummings BS, Schnellmann RG (2002) Cisplatin-induced renal cell apoptosis: caspase 3-dependent and -independent pathways. J. Pharmacol. Exp. Ther. 302 (1): 8–17.

69. Li DW, Liu J, Mao Y, Xiang H, Wang J et al. (2005) Calcium-activated RAF/MEK/ERK signaling pathway mediates p53-dependent apoptosis and is abrogated by alpha B- crystallin through inhibition of RAS activation. Mol. Biol. Cell 16 (9): 4437–4453. 70. Kang CD, Yoo SD, Hwang BW, Kim KW, Kim DW et al. (2000) The inhibition of ERK/MAPK not the activation of JNK/SAPK is primarily required to induce apoptosis in chronic myelogenous leukemic K562 cells. Leuk. Res. 24 (6): 527–534. 71. Stefanelli C, Tantini B, Fattori M, Stanic' I, Pignatti C et al. (2002) Caspase activation in etoposide-treated fibroblasts is correlated to ERK phosphorylation and both events are blocked by polyamine depletion. FEBS Lett. 527 (1-3): 223–228. 72. Tang D, Wu D, Hirao A, Lahti JM, Liu L et al. (2002) ERK activation mediates cell cycle arrest and apoptosis after DNA damage independently of p53. J. Biol. Chem. 277 (15): 12710–12717. 73. Lee E, Kang Y, Kim J, Lee HT, Cho S (2005) Modulation of apoptosis in HaCaT keratinocytes via differential regulation of ERK signaling pathway by flavonoids. J. Biol. Chem. 280 (36): 31498–31507. 74. Alexia C, Fallot G, Lasfer M, Schweizer-Groyer G, Groyer A (2004) An evaluation of the role of insulin-like growth factors (IGF) and of type-I IGF receptor signalling in hepatocarcinogenesis and in the resistance of hepatocarcinoma cells against drug-induced apoptosis. Biochem. Pharmacol. 68 (6): 1003–1015. 75. Fernández C, Ramos AM, Sancho P, Amrán D, Blas E de et al. (2004) 12-O- tetradecanoylphorbol-13-acetate may both potentiate and decrease the generation of apoptosis by the antileukemic agent arsenic trioxide in human promonocytic cells. Regulation by extracellular signal-regulated protein kinases and glutathione. J. Biol. Chem. 279 (5): 3877–3884. 76. Lee E, Kim J, Kang Y, Ahn J, Kim J et al. (2006) Interplay between PI3K/Akt and MAPK signaling pathways in DNA-damaging drug-induced apoptosis. Biochim. Biophys. Acta 1763 (9): 958–968. 77. Liu J, Mao W, Ding B, Liang C (2008) ERKs/p53 signal transduction pathway is involved in doxorubicin-induced apoptosis in H9c2 cells and cardiomyocytes. Am. J. Physiol. Heart Circ. Physiol. 295 (5): H1956-65. 78. Lee Y, Soh J, Jeoung D, Cho C, Jhon GJ et al. (2003) PKC epsilon -mediated ERK1/2 activation involved in radiation-induced cell death in NIH3T3 cells. Biochim. Biophys. Acta 1593 (2-3): 219–229. 79. Wang X, Martindale JL, Holbrook NJ (2000) Requirement for ERK activation in cisplatin-induced apoptosis. J. Biol. Chem. 275 (50): 39435–39443. 80. Woessmann W, Mivechi NF (2001) Role of ERK activation in growth and erythroid differentiation of K562 cells. Exp. Cell Res. 264 (2): 193–200. 81. Wu Q, Chen Y, Cui G, Cheng Y (2009) Wortmannin inhibits K562 leukemic cells by regulating PI3k/Akt channel in vitro. J. Huazhong Univ. Sci. Technol. Med. Sci. 29 (4): 451–456. 82. García-Regalado A, Vargas M, García-Carrancá A, Aréchaga-Ocampo E, La González- De Rosa CH (2013) Activation of Akt pathway by transcription-independent mechanisms of retinoic acid promotes survival and invasion in lung cancer cells. Mol. Cancer 12: 44. 83. Huo X, Zhang J (2005) Annexin1 regulates the erythroid differentiation through ERK signaling pathway. Biochem. Biophys. Res. Commun. 331 (4): 1346–1352.

Kapitel 5 - Characterization of the ectopically expressed OR2AT4 in human myelogenous leukemia cells

Supplementary Material

Figure S1. FPKM values for different Genes expressed in K562

Figure S2. Calcium-Imaging Experiments with different odorants 34

Kapitel 6 - Diskussion

Kapitel 6

Diskussion Im Zuge der Evolution höherer Vertebraten haben sich chemosensorische Systeme auf die Detektion vielfältiger Umweltreize spezialisiert. Hierbei dienen Oberflächenrezeptoren zur Wahrnehmung und Differenzierung flüchtiger und gelöster chemischer Reize. Neben dem olfaktorischen und gustatorischen System gilt der N. trigeminus als ein chemosensorisches System das peripher mittels freiliegender Nervenenden unterschiedliche Signale der äußeren Umwelt wahrnehmen kann. Bis heute sind die molekularen Mechanismen zur Wahrnehmung chemosensorischer Reize durch den N. trigeminus nicht genau verstanden. Ein genaues Expressionsmuster für die meisten Rezeptoren ist unbekannt, lediglich die Expression einiger klassischer Chemorezeptoren sind bis zum jetzigen Zeitpunkt beschrieben worden. Die vorliegende Dissertation befasste sich mit der Etablierung der Next-Generation Sequenziermethode (RNA-Seq) für das trigeminalen Ganglion (TG). Diese neuartige Methode ermöglichte es, eine umfassende Expressionsanalyse von bislang unbekannten Chemorezeptortypen im TG anzufertigen. In der RNA-Seq Analyse wurde die Expression von allen bekannten GPCRs und Ionenkanälen im TG und im Spinalganglion (DRG) der Maus untersucht. Insgesamt konnten 107 GPCRs und 33 Ionenkanäle im TG beschrieben werden, die dort bislang noch nicht detektiert wurden, darunter auch chemosensorische Rezeptoren, wie die Klasse der olfaktorischen Rezeptoren (ORs) (Manteniotis et al., 2013). Des Weiteren wurde ein Fokus auf die Untersuchung der ektopisch exprimierten Geruchs- rezeptoren gelegt. Die ektopische Expression von ORs konnte bislang nicht umfassend dargestellt werden (Feldmesser et al., 2006; Zhang et al., 2007). Mittels der RNA-Seq Analyse war es möglich erstmals ein sehr präzises Expressionsprofil von ektopisch exprimierten Geruchsrezeptoren in 16 humanen Geweben zu erstellen und miteinander zu vergleichen. Dabei wurde die ektopische Expression von etwa 400 funktionalen ORs untersucht. Hierbei ließen sich sowohl gewebespezifische ORs ausfindig machen, als auch andere, die in multiplen Geweben nachgewiesen werden konnten. Das Vorkommen von breit-exprimierten ORs in einigen Gewebetypen kommt zum Teil durch eine Fusion mit stromaufwärts gelegenen DNA- Bereichen zustande. Diese Arbeit unterstützt die These, dass gewebespezifisch exprimierte ORs eine funktionale Rolle einnehmen (Flegel et al., 2013).

35 Kapitel 6 - Diskussion

Der dritte Teil dieser Dissertation, befasste sich mit dem ektopisch exprimierten OR2AT4 in der humanen CML-Zelllinie K562 und in Blutzellen akut erkrankter AML-Patienten. Hierbei konnte erstmalig die physiologische Funktion eines ORs in humanen Blutzellen identifiziert werden. Dabei wurde zunächst, mit Hilfe von pharmakologischen Experimenten, der OR- vermittelte Signaltransduktionsweg untersucht. Abschließend wurde die physiologische Bedeutung des Riechrezeptors in Bezug auf grundlegende Mechanismen wie die Proliferation, Differenzierung und Apoptose charakterisiert. (Manteniotis et al., in Vorbereitung)

6.1 RNA-Seq Expressionsanalyse sensorischer Neurone mit Fokus auf das trigeminale Ganglion Unser alltägliches Leben wird entscheidend durch die sensorische Wahrnehmung exogener Umwelteinflüsse gesteuert. Hierbei spielt die Wechselwirkung zwischen den sensorischen Systemen, wie beispielsweise der trigeminalen Schmerzempfindung und der Geruchs- wahrnehmung, eine essentielle Rolle. Bis dato ist unklar, inwiefern sensorische Wahr- nehmungen ausschließlich trigeminal-vermittelt werden, oder zusätzlich auch über das DRG wahrgenommen werden. Einige wissenschaftliche Arbeiten stützen sich auf die Annahme, dass eine durch die Nahrung ausgelöste Schmerzwahrnehmung auch durch das DRG vermittelt sein muss, da die Raphe-Kerne des Hinterhorns des Rückenmarks Projektionen direkt vom Geschmack und Geruchssystem erhalten (Behbehani et al., 1988; Rizvi et al., 1991; Krukoff et al., 1993; Behbehani 1995; Hermann et al., 1997). Laut der Kontrollschrankentheorie werden peripher erfasste Schmerzreize in schmerzkontrollierende Hirnareale gesendet und mittels deszendierender Projektionen ins Hinterhorn des Rückenmarks weitergeleitet. Von dort aus werden die Signale an das zweite Neuron der Schmerzbahn verschaltet und können so wahrgenommen oder sogar unterdrückt werden (Melzack und Wall 1965). Man geht davon aus, dass es Menschen somit möglich ist unter Schockzustand keine Schmerzen wahrzunehmen. Sowohl die Genexpression als auch die physiologischen Mechanismen im DRG sind hinsichtlich der endogenen Schmerzkontrolle bereits sehr genau untersucht worden. Weniger gut untersucht ist der Einfluss und die Funktionsweise des trigeminalen Systems, dessen Mechanismen bislang als kaum verstanden gelten (Cairns et al., 1996; Meng et al., 2000; Cobos et al., 2003). Um einen Beitrag zum Verständnis des trigeminalen Systems zu leisten, wurde die Expression aller bekannten GPCRs und Ionenkanäle im TG und DRG analysiert und miteinander vergleichen.

36 Kapitel 6 - Diskussion

6.1.1 Die Expression von GPCRs im trigeminalen System Das TG ist das kraniale Analogon zum DRG (Lazarov 2002) und ist für die sensible Versorgung mittels freier Nervenendungen im Gesichtsbereich, der Mund- und Nasenschleimhäute, der Cornea und der Konjunktiven zuständig (Chen et al., 2000; Silver et al., 1991). In den sensorischen Fasern des TGs findet man Mechano-, Chemo-, Thermo-, Propio- und Nozizeptoren (Lazarov 2002; Vandewauw et al., 2013; Manteniotis et al., 2013; Bautista und Julius 2008; Bautista et al., 2007; Bautista et al., 2008b). Bislang wurden die Expression und die funktionale Rolle von nur einem Teil bekannter Rezeptoren und Ionenkanälen im TG genauer untersucht (Lazarov 2002; Vandewauw et al., 2013; Kuroda et al., 2012; Chen et al., 2014b; Li et al., 2014; Price et al., 2003; Dineley-Miller und Patrick 1992). Um das Verständnis der Schmerzverarbeitung und der sensorischen Eigenschaften des TGs genauer zu verstehen, ist eine Expressionsanalyse aller bekannten Ionenkanäle und Rezeptoren notwendig (Costigan et al., 2009; Pierce et al., 2002; George et al., 2002; Overington et al., 2006; Lundstrom 2005; Bradshaw et al., 2009; Liu und Simon 1994; Tilney 1930; Raouf et al., 2010). Um dieses Kriterium zu erfüllen, wurde im Rahmen dieser Dissertation erstmalig eine umfassende Expressionsanalyse erstellt, welche die Expression aller bekannter GPCRs und Ionenkanäle im TG und DRG der Maus mit einbezieht (Manteniotis et al., 2013). Hierbei wurden von 458, bis zu diesem Zeitpunkt beschriebenen, (nicht olfaktorischen) GPCRs insgesamt 202 Mitglieder im TG und 204 GPCRs im DRG mit einem FPKM > 1 (fragments per kilobase of exon per million fragments mapped) detektiert. Die hier untersuchten Rezeptoren umfassen laut mehrerer Studien alle bislang bekannten murinen GPCRs (Vassilatis et al., 2003; Fredriksson und Schiöth 2005; Bjarnadóttir et al., 2006; Bjarnadóttir et al., 2004; Haitina et al., 2009). Die Expression der ORs wurde aufgrund ihrer großen Anzahl separat behandelt. Die Expression wurde mit nicht-neuronalem und neuronalem Gewebe verglichen (Muskel, Leber, Gehirn, olfaktorisches Epithel). Wie zu erwarten, korrelierte das Expressionsmuster im TG stark mit dem des DRGs (Lazarov 2002, 2007). In beiden Geweben konnten etwa gleich viele exprimierte Ionenkanäle und GPCRs detektiert werden. Auch die summierten FPKM-Werte der GPCRs beider Gewebe waren ähnlich und unterschieden sich eindeutig von den Werten der nicht-neuronalen Vergleichsgewebe. Dies unterstützt die Annahme, dass GPCRs in sensorischen Geweben stärker präsent sind als in nicht-sensorischen Geweben (Regard et al., 2008). Bislang war von den 202 detektierten GPCR im TG die Expression von nur 96 (> 1 FPKM) bekannt. Bei Betrachtung der niedrig exprimierten Gene (< 1 FPKM) konnten zusätzlich 114 GPCRs detektiert werden, von denen bisher nur 31 im TG beschrieben worden sind. Im DRG 37

Kapitel 6 - Diskussion hingegen ist die Expression von nahezu allen detektierten Rezeptoren bereits weitestgehend bekannt (> 1 FPKM). Aufgrund der großen Anzahl der zu untersuchenden Rezeptoren wurden im Rahmen dieser Studie die höchsten 30 detektierten GPCRs sowohl nach ihrer Expressions- stärke als auch nach ihrer Exklusivität im TG tabellarisch aufgelistet. Unter den höchsten 30 exprimierten GPCRs waren 14 Mitglieder, deren Expression im TG bisher nicht bekannt war. Die Funktion der höchst exprimierten GPCRs spielen oftmals eine zentrale Rolle in trigeminal- vermittelter Nozizeption, der Migräne, der Vasokonstriktion und in entzündungs-vermittelten Schmerzen (Manteniotis et al., 2013). Bei der Betrachtung der, im Vergleich zum Referenzgewebe, 30 spezifisch in TG exprimierten Rezeptoren fiel schnell auf, dass nahezu alle diese Rezeptoren auch im DRG nachgewiesen werden konnten. Die funktionale Rolle von insgesamt 13 der hier aufgelisteten GPCRs ist an schmerzauslösenden Prozessen, wie Migräne, Nozizeption, neuropathischen Schmerzen oder Juckreiz beteiligt. Von 12 der 30 spezifischen im TG exprimierten GPCRs ist die Funktion noch nicht bekannt. Aufgrund ihres Expressionsmusters ist es höchst wahrscheinlich, dass diese bislang orphanen GPCRs eine TG-spezifische Funktion einnehmen. Die mögliche Beteiligung an der Chemosensorik oder der Schmerzwahrnehmung, muss anhand von weiteren Studien überprüft werden. So konnte ähnliches vor etwa einem Jahrzehnt anhand damals unbekannter und spezifisch exprimierter GPCRs im TG und DRG gezeigt werden. 2003 detektierten Shinohara und Mitarbeiter erstmals die Klasse der Mrgprs im DRG und TG der Ratte und postulierten damals, aufgrund des Expressionsmusters, die Beteiligung dieser Rezeptoren an der Schmerzwahrnehmung (Shinohara et al., 2004). Übereinstimmend mit den Ergebnissen von Shinohara und Mitarbeiter konnten wir von den rund 40 Mitgliedern der Mrgprs 11 unter den 30 spezifisch-exprimierten GPCRs im TG und DRG nachweisen. Obwohl die Klasse der Mrgprs schon seit über zehn Jahren bekannt ist konnte die Funktion bis heute nur von vier Mitgliedern gezeigt werden (Shinohara et al., 2004; Rau et al., 2009; Vrontou et al., 2013). In 2004 konnte diesbezüglich gezeigt werden, dass -Alanin den Mrgprd aktiviert und dadurch die Wahrnehmung von Schmerzen induziert (Shinohara et al., 2004). Zusätzlich zeigte eine andere Studie, dass die Modulation des Rezeptors auch an der Wahrnehmung von sowohl mechanischen als auch thermischen Stimuli beteiligt ist (Rau et al., 2009). Weitere Studien zeigten, dass das Malariamittel Chloroquin und die körpereigene Substanz BAM8-22 die Rezeptoren Mrgpx1 und Mrgpra3 modulieren und dadurch einen Histamin-unabhängigen Juckreiz vermitteln (Liu et al., 2009). Der vierte bisher charakterisierte 38 Kapitel 6 - Diskussion

Mrgpr ist der Mrgprb4, welcher ausschließlich Berührungen über die Haare auf der Haut wahrnimmt (Vrontou et al., 2013). Es scheint höchst wahrscheinlich, dass die Klasse der Mrgprs eine bislang unbekannte Gruppe an sensorischen Rezeptoren bildet, die an der Chemosensorik beteiligt sein könnten. Neben dieser im TG beschriebenen Rezeptorklasse konnten unter den 30 spezifisch exprimierten GPCRs auch weitere bisher unbekannte und deorphanisierte Rezeptoren, wie der Orexin-Rezeptor (Hcrtr2), der Serotonin-Rezeptor (Htr4/Htr5b) und der Leukotrien-Rezeptor (Cysltr2) nachgewiesen werden. Die Beteiligung dieser Rezeptoren wurde bereits in anderen Geweben beschrieben und reicht von der Zellentwicklung bis hin zur Schmerzwahrnehmung (Kato et al., 2006; Damasio 2005; Chiou et al., 2010; Murray et al., 2011; Coughlin und Camerer 2003). Andere Rezeptoren wie der GPR35, welcher durch die adstringierende Substanz Gallussäure aktiviert wird, könnten im TG auch als möglicher chemosensorischer Rezeptor agieren (Taniguchi et al., 2006). Cosi und Mitarbeiter postulieren eine Beteiligung an der Schmerzwahrnehmung im DRG durch den GPR35 (Cosi et al., 2011). Doch auch andere bislang kaum in Publikationen erwähnte Rezeptoren wie der orphane GPR158 sind hoch spezifischen im TG exprimiert und könnten neue potentielle Chemorezeptoren sein. Bjarnadóttir und Mitarbeiter (2006) zeigten, dass der GPR158 eine ähnliche Sequenz wie Glutamatrezeptoren, Vomeronasal-Rezeptoren und metabotroper Tasterezeptoren besitzt (Bjarnadóttir et al., 2005). So bestätigten auch lehrstuhlinterne Daten das Vorkommen hoch konservierter Regionen ähnlich der metabotropen sweet-Tasterezeptoren in GPR158. Durch die tabellarische Anordnung abhängig von der Expressionsstärke und der exklusiven Expression in TG konnten viele bislang nicht im TG erwähnte Rezeptoren detektiert werden, die aufgrund ihres Expressionsmuster wahrscheinlich an TG und DRG spezifischen, sensorischen Mechanismen beteiligt sind.

6.1.2 Die Expression von olfaktorischen Rezeptoren im trigeminalen System Neben den 458 untersuchten GPCRs wurden die Expression von 1125 OR-Genen im TG und DRG untersucht. ORs bilden die größte Klasse an Chemorezeptoren und werden in Vertebraten hauptsächlich im olfaktorischen Epithel exprimiert (Buck und Axel 1991). Sowohl in einigen neueren Studien (Feldmesser et al., 2006; Zhao et al., 1998; Parmentier et al., 1992; Spehr et al., 2003; Vanderhaeghen et al., 1997a; Veitinger et al., 2011; Xu et al., 2000a), als auch im Rahmen der zweiten Studie dieser Dissertation (Flegel et al., 2013) wurden OR-Gene auch außerhalb des Riechepithels nachgewiesen. Die Funktion der ektopisch exprimierten ORs

39 Kapitel 6 - Diskussion

variiert je nach Gewebstyp und reicht von der Wundheilung in der Haut (Busse et al., 2014), der Zellwachstumsregulation in Prostatakrebszellen (Neuhaus et al., 2009), bis hin zum Schwimmverhalten von Spermien (Spehr et al., 2003; Veitinger et al., 2011). Ektopisch auftretende OR-Gene werden häufig sehr niedrig exprimiert (Flegel et al., 2013; Kang und Koo 2012), sodass wir in dieser RNA-Seq Analyse auch ORs die geringer als 0,1 FPKM exprimiert wurden mit einbezogen haben. Im TG konnten erstmalig 98 niedrig exprimierte (0,1 - 1 FPKM) OR-Gene detektiert werden. Einer der niedrig exprimierten ORs war der Olfr78, dessen orthologes Gen im humanen Genom als PSGR (prostate-specific gene) beschrieben wurde (Xu et al., 2000b). Der PSGR wird sowohl im Prostatakarzinom als auch in der Prostatakrebszelllinie LNCaP exprimiert und lässt sich dort durch -Ionon und Androstenon-Derivate aktivieren (Neuhaus et al., 2009). Die Aktivierung des PSGRs inhibierte die Proliferation und erhöhte die intrazelluläre Calciumkonzentration in Prostatakrebszellen. Im DRG konnten 33 ORs erstmalig nachgewiesen werden. Die Expression von drei niedrig exprimierten OR-Genen im TG wurde mit Hilfe der in-situ Hybridisierung validiert. Neben den 98 gering exprimierten ORs im TG konnten auch zwei höher exprimierte ORs (> 1 FPKM) detektiert werden (Olfr920 und Olfr420). Beide ORs kommen ausschließlich im olfaktorischen Epithel und im TG vor. Die Anzahl der im TG detektierten ORs ist neben dem Testes-Gewebe das Gewebe mit dem meisten ektopisch exprimierten ORs. Auf die ektopische Expression im humanem testikulären Gewebe wird im zweiten Teilprojekt näher eingegangen (Flegel et al., 2013). Um nicht nur die Anzahl exprimierter ORs zu bestimmen, sondern auch deren Präsenz im TG, wurden die kumulativen FPKM-Werte berechnet und mit anderen im TG bereits bekannten Rezeptoren verglichen. Die summierten FPKM-Werte der ORs im TG waren vergleichbar mit denen von Cannabinoid-Rezeptoren, P2Y-Rezeptoren und metabotropen Glutamat-Rezeptoren. Auch anderen Studien zeigten, dass ORs in Vertebraten außerhalb des Riechepithels eine eher niedrige Expression aufweisen (Vanderhaeghen et al., 1997a, 1997b; Parmentier et al., 1992; Asai et al., 1996; Itakura et al., 2006). Die meisten dieser Studien basierten auf einen RT-PCR- Nachweis. Die niedrige Expression der ektopisch exprimierten ORs wird dadurch erklärt, dass die isolierten OR-Gene durch das Gesamtgewebe stark verdünnt werden (Kang und Koo 2012). Auch die niedrige Expression der meisten ORs im TG könnte darauf zurück zu führen sein, dass nicht alle trigeminalen Neurone ORs exprimieren und ORs nur in speziellen Neuronen vorkommen. Dies bestätigte auch die Ergebnisse der in-situ Hybridisierung mit dem niedrig exprimierten (FPKM < 1) Olfr1417, welcher nur in vereinzelten Neuronen angefärbt werden konnte. Ähnliches konnte bereits in anderen Studien für die niedrig exprimierten Bitter- 40

Kapitel 6 - Diskussion

Geschmacksrezeptoren gezeigt werden (Behrens et al., 2007). Es könnte sein, dass ORs im TG in einer mosaikartigen Weise exprimiert werden, wie es schon für die Klasse der TAAR- Rezeptoren gezeigt werden konnte (Borowsky et al., 2001). Stärker exprimierte ORs wie der Olfr420 (FPKM > 1) hingegen, scheinen auch in den in-situ Hybridisierung Experimenten in deutlich mehr Neuronen angefärbt zu sein. Die Detektion von ektopisch exprimierten ORs wird zudem weiter erschwert, da, aufgrund der hohen Sequenzhomologie untereinander, nur wenige qualitativ hochwertige und spezifische OR-Antikörper existieren. Die Charakterisierung der ektopisch exprimierten ORs wird zusätzlich dadurch erschwert, dass die Agonisten und Antagonisten von nur wenigen ORs beschrieben werden konnten und dadurch die funktionale Charakterisierung für die meisten ORs nicht möglich ist. Über die funktionale Rolle der im TG exprimierten ORs kann daher nur spekuliert werden. Bis heute wurden die Mechanismen zur Wahrnehmung von volatilen Geruchsmolekülen durch das TG nicht eingehend untersucht. Rothermel und Kollegen zeigten am TG der Ratte, dass alle untersuchten Duftstoffe die Nerven des TG auf spezifische Weise stimulieren (Rothermel et al., 2011). Unklar ist, ob und inwiefern ORs an diesem Prozess beteiligt sein könnten. Es wird angenommen, dass die Aktivierung trigeminaler Subpopulationen sensorischer Neurone durch eine Aktivierung von verschiedenen TRP-Kanälen und durch die Inhibition von Kaliumkanälen erfolgen könnten (Lübbert et al., 2013). Auch wenn das olfaktorische Epithel hauptsächlich für die Detektion von Geruchsmolekülen in der Luft zuständig ist, konnte dennoch gezeigt werden, dass Anosmiker durch den trigeminalen Nerv in der Lage sind, Duftstoffe in einer tausendfach höheren Konzentration grob voneinander zu unterscheiden (Doty et al., 1978; Laska et al., 1997). Es scheint, dass die chemosensorische Wahrnehmung flüchtiger Substanzen aus einem Zusammenspiel zwischen dem olfaktorischen und trigeminalen System vermittelt wird (Carlson et al., 2013; Brand 2006). Ein weiterer Hinweis für die Interaktion der beiden Systeme ist, dass die meisten Duftstoffe auch trigeminale Empfindungen, wie ein stechendes, brennendes oder prickelndes Gefühl auslösen (Doty et al., 1978).

Neuere Studien haben auch gezeigt, dass das geruchslose Kohlenstoffdioxid (CO2), die allgemeine Duftstoff-Wahrnehmung durch eine Interaktion mit dem N. trigeminus verstärkt

(Carlson et al., 2013). Passend dazu zeigten Chevy und Mitarbeiter vor kurzem, dass eine CO2 Stimulation des trigeminalen Nervs Antworten im olfaktorischen Cortex auslösen (Chevy und Klingler 2014). Dabei wiesen die trigeminal-ausgelösten Stimuli andere Antwortmuster im olfaktorischen Cortex auf als die nasal-induzierten. Es scheint durchaus möglich, dass die im TG detektierten ORs an der Interaktion beider Systeme beteiligt sein könnten. 41

Kapitel 6 - Diskussion

6.1.3 Die Expression von Ionenkanälen im trigeminalen System Ähnlich wie die Klasse der GPCRs spielen auch Ionenkanäle eine zentrale Rolle bei der trigeminalen Wahrnehmung von chemischen oder physikalischen Stimuli (Caterina und Julius 2001; Bautista und Julius 2008; Bautista et al., 2007; Akopian et al., 1996). Daher stellte sich die Frage, wie sich das Expressionsmuster von allen bisher bekannten Ionenkanälen im TG verhält. Da bis heute keine Annotationsliste von den bekannten Ionenkanälen erstellt wurde, wurde im Rahmen dieser Dissertation eine Liste angefertigt, die insgesamt 227 Mitglieder umfasst. Von diesen Kanälen konnten 136 mit einem FPKM > 1 detektiert werden. Die Expression von 103 Ionenkanälen wurde bereits im TG beschrieben. Insgesamt konnte die Expression von 33 Kanälen im TG erstmals beschrieben werden. Bei Betrachtung der niedrig exprimierten Ionenkanäle (< 1 FPKM) war die Expression von 24 Ionenkanälen bereits bekannt und von weiteren 27 noch unbekannt. Um Ionenkanäle zu detektieren, die höchstwahrscheinlich eine trigeminale Funktion einnehmen, wurden die untersuchten Kanäle nach ihrer Expressions- stärke und nach ihrer spezifischen Expression im TG sortiert. Unter den 30 detektierten hoch exprimierten Ionenkanälen wurden sieben noch nicht im TG beschrieben. Die überwiegende Mehrheit der hier detektierten Mitglieder ist eindeutig an der Schmerzwahrnehmung des TGs beteiligt. Zum Teil konnte die Funktion einiger neu entdeckter Ionenkanäle im TG bereits in anderen Geweben beschrieben werden. Die Glycinrezeptor- Untereinheit und der spannungs- abhängige Natriumkanal SCN1A sind zwei im TG neu entdeckte Membranproteine, die in anderen Geweben an der Schmerzwahrnehmung beteiligt sind (Ahrens et al., 2009; Wang et al., 2011). Dennoch sind andere Mitglieder der SCN-Familie, wie der SCN9A, der SCN10A und der SCN11A bereits im TG beschrieben worden und bei trigeminal-vermittelten Schmerzen involviert (Dib-Hajj et al., 2010; Strickland et al., 2008; Catterall 2000). Weitere Studien zeigten, dass die Aktivität dieser Ionenkanäle durch Duftstoffe wie Thymol oder Menthol inhibiert wird und dadurch Schmerzen lindert (Haeseler et al., 2002). Mutationen des SCN9A im OE der Maus hingegen bewirkten Anosmien und blockierten das Schmerzempfinden (Ahmad et al., 2007; Cox et al., 2006; Zufall et al., 2012). Diese Ergebnisse führen uns zur Hypothese, dass die Klasse der SCN-Kanäle in einer noch unbekannten Weise an der Chemosensorik und der Interaktion zwischen dem TG und dem olfaktorischen Epithel beteiligt sein könnten. Unter den 30 hochspezifischen Ionenkanälen konnten drei bislang nicht im TG beschriebene Kanäle detektiert werden, wobei zwei dieser Kanäle wie der SCN1A und die Glycinrezeptor- 42

Kapitel 6 - Diskussion

Untereinheit war. Die überwiegende Mehrheit der im TG spezifischen Ionenkanäle sind zusammen mit TRP-Kanälen, Purinorezeptoren, GABA(A) Rezeptoren und ionotropen Glutamatrezeptoren hauptsächlich an der Schmerzwahrnehmung und der Chemosensorik beteiligt. Neben dem SCN1A und der Glycinrezeptor- Untereinheit, war der dritte bislang im TG noch nicht erwähnte Kandidat der TRPC6. Die Klasse der TRP-Kanäle ist in letzter Zeit die wohl am intensivsten erforschte Subfamilie der Ionenkanäle. TRP-Mitglieder werden vermehrt in sensorischen Ganglien exprimiert und sind an der Chemosensorik, der Temperaturwahrnehmung und der Schmerzempfindung beteiligt (Caterina et al., 1997; Voets et al., 2004; Tominaga et al., 1998; Tominaga und Caterina 2004; Reilly et al., 2003; Macpherson et al., 2007). Hierbei spielen TRP-Kanäle für die Wahrnehmung von sowohl endogenen als auch von exogenen Reizen eine essentielle Rolle. Vorangegangene Studien zeigen, dass diese Kanäle auch in metabotropen Signalkaskaden nachgeschaltet werden und für den Calciumeinstrom in die Zelle verantwortlich sind (Wetzel et al., 1999; Spehr et al., 2011). Doch auch innerhalb der TRP-Kanalklasse stehen nicht alle Mitglieder im Fokus der heutigen Forschung. Von den 28 TRP-Kanälen der Säuger gelten der TRPM8, der TRPV1 und der TRPA1 als die bislang am besten charakterisierten Kanäle. Der TRPV1 kann sowohl Hitze (43 °C) als auch die Schärfe von Capsaicin wahrnehmen (Caterina et al., 1997). Der TRPM8 hingegen ist ein Sensor für kalte Temperaturen (23 °C) und nimmt auch die kühlende Wirkung von Menthol wahr (Bautista et al., 2007), wohin gegen der TRPA1 Temperaturen um die 17 °C wahrnimmt und durch Substanzen wie Isothiocyanate aktiviert wird (Jordt et al., 2004). Diese drei Kanäle kommen, wie auch in anderen Studien bereits gezeigt wurde, hoch exprimiert im TG und DRG vor (Caterina et al., 1997; Vandewauw et al., 2013; Huang et al., 2012). Im TG konnten wir mit Hilfe der RNA-Seq Analyse insgesamt 16 verschiedene TRP-Kanäle detektieren. Eine erst kürzlich veröffentliche PCR-Studie der TRP-Kanäle untersuchte zum ersten Mal die TRP-Expression in den sensorischen Ganglien TG und DRG (Vandewauw et al., 2013). In der Studie von Vandewauw konnten 17 TRP-Kanäle mit einer Reihe noch nicht erwähnter Kandidaten im TG detektiert werden. Im direkten Vergleich wurden drei Kanäle detektiert: der TRPC2 (1 FPKM), TRPC6 (2 FPKM) und der TRPP5 (3 FPKM), die sich von den Ergebnissen der q-PCR Studie von Vandewauw unterschieden. Der Grund hierfür könnte auf die biologische Varianz zwischen den Tieren zurück zu führen sein. Dennoch stimmten die PCR-Ergebnisse von Vandewauw mit den im Rahmen dieser Dissertation angefertigten RNA- Seq Analyse weitestgehend überein. So konnten in beiden Studien übereinstimmend niedrig

43 Kapitel 6 - Diskussion

exprimierte (< 1 FPKM) TRP-Mitglieder wie der TRPV3 (0,3 FPKM) und der TRPV6 (0,4 FPKM) detektiert werden. Im Laufe dieser Arbeit konnte mit Hilfe der in-situ Hybridisierung die Expression des TRPC6 im murinen TG validiert werden. Die weniger im Fokus der Forschung liegende Subfamilie der TRPC-Kanäle konnte erst vor kurzem im TG beschrieben werden und scheint wichtig für die allgemeine Somatosensorik in Vertebraten zu sein (Staaf et al., 2009). Die Kanäle TRPC3, TRPC4 und TRPC5 sind an der Wahrnehmung von Schmerzen durch mechanisch induzierte Verletzungen beteiligt. In einer neueren Studie wurde zusätzlich gezeigt, dass der TRPC5 in chemo- und thermosensorischen Nervenenden exprimiert wird und dort an der Wahrnehmung von kalten Temperaturen involviert ist (Zimmermann et al., 2011). Die Funktion von TRPC6 wurde bislang nicht genau analysiert, doch zeigten erste wissenschaftliche Arbeiten, dass dieser Kanal in anderen Geweben an der Vasokonstriktion beteiligt ist (So et al., 2005). Neben den wenigen intensiv untersuchten TRP-Kanälen, scheinen auch die im TG neu entdeckten und weniger untersuchten Mitglieder an den trigeminalen Grundmechanismen beteiligt zu sein. In den vergangenen Jahren ist das Interesse an der funktionalen Charakterisierung auch zunehmend für die Mitglieder der Kaliumkanäle gestiegen (Gerhold und Bautista 2009). Lange bekannt ist bereits ihre Funktion in den Nervenbahnen und exzitatorischen Nervenzellen (Goldstein et al., 2001). Doch neuere Studien entdeckten, dass diese Kanäle nicht nur zur Aufrechterhaltung des Membranpotentials oder zur Weiterleitung von Aktionspotentialen zuständig sind, sondern dass diese in sensorischen Ganglien auch chemosensorische Funktionen einnehmen und unterschiedliche Temperaturen wahrnehmen können (Bautista und Julius 2008; Maingret et al., 2000). Bis heute sind etwa 80 Mitglieder der Kaliumkanäle beschrieben worden, welche sich in die Unterklassen der spannungsabhängigen Kanälen (Kcna- Kcnd, Kcnf-Kcnh, Kcnq, Kcns), der Calcium-aktivierten Kanälen (Kcnm-Kcnn), der einwärtsgerichteten Kanälen (Kcnj) und der Background-Leak zwei Poren-Kanäle (Kcnk) unterteilen lassen. Von dieser großen Anzahl an Mitglieder konnte die Funktion von nur wenigen beschrieben werden. In unserer RNA-Seq Analyse wurden von den 30 im TG spezifisch exprimierten Kalium- kanälen, 18 bislang noch nicht beschriebene Kandidaten identifiziert. Der im TG am spezifischsten exprimierte Kaliumkanal ist der Kcnk18 (TRESK), welcher neben Kcnk3, 9 (TASK-1, TASK-3) eine wichtige Rolle in der trigeminal vermittelten prickelnden Wahr- nehmung von Hydroxyl--Sanshool spielt (Bautista et al., 2008a). Weitere Studien zeigten, dass TRESK, TASK-1, TASK-3 an der chemosensorischen Wahrnehmung des TGs beteiligt sind und durch chemische Substanzen wie Piperin, oder 2-Gingerol inhibiert werden und 44

Kapitel 6 - Diskussion

dadurch möglicherweise auch an der prickelnden Sinnesempfindung dieser Substanzen mit verantwortlich sind (Beltrán et al., 2013a). Neben der chemosensorischen Funktion im TG, spielen Kaliumkanäle aber auch eine zentrale Rolle in der Detektion von Schmerzen. Bereits ältere Studien zeigten, dass eine Mutation welche die Funktion des Kcnk18-Kanals inhibiert zu Migräneanfällen führte (Sabharwal et al., 1990). Das breite funktionale Spektrum der Kanäle macht sie in der heutigen Forschung zu einer der interessantesten Ionenkanäle. Auch die im TG neu entdeckten Kaliumkanäle wie Kcns1, Kcnk3 oder Kcnk1 sind zum Teil bereits im DRG beschrieben worden und dort an der Entstehung neurologischer Erkrankungen sowie an der Schmerzwahrnehmung beteiligt (Nyholt et al., 2008; Zhang et al., 2002). Die Funktionen anderer Mitglieder, wie beispielsweise die des Kcnh1, nehmen auch in anderen untersuchten Geweben sensorische Funktionen ein, wie die Wahrnehmung von mechanisch-induziertem Druck (Hao et al., 2013).

6.1.4 Differenziell-exprimierte Gene im trigeminalen- und dorsalen Wurzelganglion Sowohl das TG als auch das DRG dienen in Vertebraten hauptsächlich der Wahrnehmung sensibler Informationen aus dem Körper und seiner Umwelt. Das DRG innerviert mit freien Nervenenden hauptsächlich den peripheren Teil des Körpers, ausgenommen des Kopf- bereiches. Das TG hingegen verarbeitet ausschließlich sensible Informationen kranialer Regionen. Beide Gewebe werden als homologe Nervengewebe angesehen (Darian-Smith J. 1973; Lazarov 2002). Das TG innerviert die Schleimhäute im Mund- und Nasenbereich und ist somit öfters an der Detektion flüchtiger oder gelöster chemischer Verbindungen beteiligt als das DRG. Zudem konnte gezeigt werden, dass das TG eng mit dem Geruchsinn verknüpft ist (Rothermel et al., 2011; Carlson et al., 2013; Brand 2006; Lübbert et al., 2013). Daher stellte sich die Frage, ob die Genexpression des TGs sich möglicherweise von der des DRGs unterscheidet. Um dem nachzugehen wurde mit der differenziellen RNA-Seq Analyse (Cuffdiff) die Unterschiede der exprimierten Transkripte beider Ganglien ermittelt. Bisher wurde die umfassendste Expressionsanalyse des TGs 2002 von Lazarov durchgeführt und belegt die Expression bekannter Ionenkanäle und GPCRs mittels q-PCR oder in situ- Hybridisierung (Lazarov 2002). Während der Gewebepräparation des TGs wurde das gesamte Ganglion mit seinen sensorischen Nervensträngen präpariert und die RNA isoliert. Da es technisch nicht möglich war, die Ursprungszellen der großen propriozeptiven Neurone des TGs (10 - 20 µm) aus dem mesenzephalischen trigeminalen Nukleus zu isolieren, wurden sie aus der RNA-Seq Analyse

Kapitel 6 - Diskussion

ausgeschlossen. Daher könnten einige FPKM-Werte für das TG leicht abweichen. Dennoch zeigt die Verteilung der FPKM-Werte beider Ganglien hoch korrelierende Werte an und zeugt für die Ähnlichkeit beider Gewebe. Um auszuschließen, dass möglicherweise alle neuronalen Gewebe korrelierende FPKM-Werte besitzen, wurden die FPKM-Werte beider Ganglien mit dem des olfaktorischen Epithels verglichen. Hierbei zeigte sich anhand der kleineren Regressionswerte eindeutig, dass die Verteilung der FPKM-Werte von einander abweicht. Um die Unterschiede zwischen den beiden homologen Ganglien genauer zu ermitteln, wurde zusätzlich zu der RNA-Seq eine Cuffdiff-Analyse durchgeführt. Nur 19 Gene im TG und 23 Gene im DRG wurden als signifikant unterschiedlich exprimiert angezeigt. Anzumerken ist hier, dass das Signifikanzniveau in der Cuffdiff-Analyse nur schwer zu erreichen ist, da diese Analyse zum einen die hoch konservative Bonferroni-Holm Korrektur anwendet und zum anderen die parallele statistische Analyse von 23000 Genen das Erreichen des Signifikanz- niveaus zunehmend erschwert. Aus diesem Grund wurden, wie in einer vergleichbaren Studie des olfaktorischen Epithels (Keydar et al., 2012), noch zehnfach unterschiedlich regulierte Gene in diese Analyse miteinbezogen. Von den 12373 untersuchten Genen (> 1 FPKM) waren somit 98,6 % in beiden Ganglien gleich stark exprimiert, während nur 0,5 % (65) der Gene höher im TG sowie 0,9 % (117) höher im DRG waren. Auffällig war hier, dass eine Reihe von unterschiedlich exprimierten Genen zur Klasse der odorant-binding Proteine gehören und exklusiv nur im TG und im olfaktorischen Epithel exprimiert werden. Diese Proteinklasse ist an der chemosensorischen Detektion volatiler Substanzen im olfaktorischen Epithel involviert und ermöglicht den Transport durch den Schleim der Nase zu den Zilien der Riechsinneszellen (Godfrey et al., 2004; Miyawaki et al., 1994). Die differenzielle Expression der odorant-binding Proteine unterstützte unsere Annahme, dass die Genexpression zwischen den Ganglien unterschiedlich ausfallen müsse, da das TG den Mund- und Nasenbereich mit innerviert und somit öfter an der Detektion chemischer Substanzen involviert ist als das DRG. Eine kürzlich veröffentlichte Studie zeigte, dass die Gesichtshaut (Aktivierung von Keratinozyten durch Sandelholzdüfte) chemosensorische Informationen erhält und diese Reizinformation, an trigeminale Neurone weiterleitet (Sondersorg et al., 2014). Neben den odorant-binding Proteinen, konnten weitere differenziell exprimierte Komponenten des olfaktorischen Systems, wie die OR-spezifische Golf-Untereinheit und die Kanaluntereinheit CNGA2, detektiert werden. Beide sind essentielle Bestandteile der olfaktorischen Signal- kaskade im olfaktorischen Epithel (Cheng et al., 2003). Daher ist es wahrscheinlich, dass die 46

Kapitel 6 - Diskussion

im TG detektierten ORs die gleiche Signalkaskade nutzten, wie ORs im olfaktorischen Epithel. Ein weiteres Gen, das nur im TG und im olfaktorischen Epithel exprimiert wird, ist der Olfr420. Es scheint, dass viele der differentiell exprimierten Gene im TG auch spezifisch im olfaktorischen Epithel exprimiert werden. Ein weiterer interessanter differentiell exprimierter Kandidat war der Menthol-Rezeptor TRPM8, der um ein vielfaches höher im TG exprimiert wird als im DRG. Eine ähnliche Expressionstendenz wurde auch in der q-PCR Studie von Vandewauw gezeigt (Vandewauw et al., 2013). Die im DRG differentiell exprimierten Gene sind überwiegend an zellulären Prozessen wie dem Zellwachstum, der Zellentwicklung und der Zelldifferenzierung beteiligt und haben nichts mit der Verarbeitung sensorischer Informationen zu tun.

6.1.5 Die Problematik der differentiellen Expressionsanalyse Weitere Gene, wie die fünf im TG spezifisch detektierten Gene Ghrhr, Cga, Ihb, Prl und POMC scheinen durch Kontaminationen während der TG-Präparation mit der Hypophyse zustande gekommen zu sein. Alle diese Gene sind hochexklusiv-exprimierte Gene der Hypophyse. Um dem nachzugehen, haben wir frei erhältliche Next-Generation Sequenzierungen der Hypophyse, reanalysiert (GTEx Projekt: www.broadinstitude.org/gtex/, Daten nicht gezeigt). Diese Analyse belegte, dass die Gene hoch spezifisch in der Hypophyse vorkommen (Prl: 30000 FPKM, POMC: 18000 FPKM, Cga: 3900 FPKM, Ihb: 2100 FPKM, Ghrhr: 260 FPKM). Im Maus TG konnten wir Prl mit einem FPKM von 279 detektieren. Dies entspricht einer einprozentigen RNA-Kontamination des TGs mit der Hypophyse. Ähnliche Werte ergaben sich auch für die vier anderen Kandidaten. Da es nur wenige so hoch exprimierte Gene in der Hypophyse gibt und keiner dieser wenigen spezifischen Gene im Fokus dieser Arbeit (GPCRs und Ionenkanäle) lag, hat die Kontamination keinen weiteren Einfluss auf die Ergebnisse. Eine Alternative ist, dass diese Werte nicht wegen einer Kontamination zustande gekommen sind, sondern aufgrund der biologischen Varianz entstanden sind. Um dem nachzugehen wurden 30 weitere biologische Replikate verschiedener Gewebe reanalysiert. Auch hier wurde in einigen Geweben Prl mit einem FPKM über 500 detektiert. Wie stark die biologische Varianz auftreten kann, wurde im Fall von Cga noch klarer. Hierbei reanalysierten wir Muskelgewebe und detektierten Cga in der überwiegenden Mehrheit der analysierten Gewebe mit einem FPKM < 1. In sechs Muskelgewebeproben jedoch wurde Cga mit einem FPKM > 100 detektiert. Gewisse Schwankungen der detektierten FPKM-Werte scheinen also möglich zu sein und sollten im Durchschnitt betrachtet werden.

Kapitel 6 - Diskussion

6.1.6 Zusammenfassung der Expressionsanalyse im trigeminalen Ganglion Die Mechanismen zur chemosensorischen Wahrnehmung durch das trigeminale Ganglion sind bisher nur zu einem Teil verstanden. Um die Funktionen des TGs genau zu verstehen, wurde im Rahmen dieser Dissertation die Expression aller Ionenkanäle und GPCRs genauer untersucht. Damit ein Überblick geschaffen werden konnte, wurden die untersuchten Kanäle zum einen nach ihrer Expressionsstärke und zum anderen nach ihrer spezifischen Expression im TG und DRG sortiert. Dadurch konnten sowohl stark exprimierte als auch hochspezifische Gene in TG detektiert werden, deren Expression dort bislang nicht bekannt war und diese sehr wahrscheinlich an der trigeminal-sensorischen Informationsverarbeitung beteiligt sind. Insgesamt konnten 106 GPCRs und 33 Ionenkanäle (> 1 FPKM), die bislang noch nicht im TG beschrieben worden waren, erstmalig gezeigt werden. Neben den nicht-olfaktorischen GPCRs wurden auch 93 exprimierte ORs im TG und 33 im DRG detektiert. Das DRG innerviert hauptsächlich die peripheren Bereiche des Körpers außerhalb des Kopfbereiches. Im Gegensatz zum DRG innerviert das TG ausschließlich die kranialen Bereiche und kommt durch die Mund- und Nasenschleimhäute häufiger in Kontakt mit chemischen Substanzen. Viele Studien deuten auf eine Interaktion zwischen dem TG und dem olfaktorischen Epithel hin. Diese Arbeit lieferte erste Hinweise auf die differenzielle Expression zwischen den beiden funktionalen und anatomisch ähnlichen Ganglien TG und DRG. Der Hauptunterschied zwischen dem TG und DRG ist, dass im TG eine Reihe von Genen exprimiert ist, die exklusiv im olfaktorischen Epithel vorkommen und dort an der Geruchswahrnehmung beteiligt sind. Diese Ergebnisse unterstützt die Hypothese, dass das TG an der Wahrnehmung von Duftstoffen involviert ist. Die Klasse der ORs ist die größte bekannte Gruppe an Chemorezeptoren in Vertebraten und dient hautsächlich der Detektion von Duftstoffen. In der vorliegenden Arbeit konnte die Expression von ORs erstmalig im TG und DRG nachgewiesen werden. Dadurch stellte sich die Frage, ob und in welchen anderen Geweben ektopisch exprimierte Riechrezeptoren vorkommen und wie das Expressionsmuster dieser Chemorezeptoren aussieht. Um dem nachzugehen, wurde im zweiten Teil dieser Dissertation die ektopische Expression von ORs in 16 humanen Geweben untersucht.

Kapitel 6 - Diskussion

6.2. Erstellung eines Expressionsprofils ektopisch exprimierter olfaktorischer Rezeptoren mittels der Next-Generation Sequenzierung Linda Buck und Richard Axel entdeckten 1991 die Superfamilie der olfaktorischen Rezeptoren (ORs) im olfaktorischen Epithel der Ratte (Buck und Axel 1991). Bis vor zwei Jahrzehnen ging man davon aus, dass ORs ausschließlich im olfaktorischen Epithel der Säuger vorkommen und dort an der Geruchswahrnehmung beteiligt sind (Zhao et al., 1998). Immer mehr Studien belegen jedoch, dass ORs in Säugern ektopisch exprimiert werden und in anderen neuronalen Geweben, wie dem autonomen Nervensystem oder dem Gehirn vorkommen (Raming et al., 1998; Conzelmann et al., 2000; Otaki et al., 2004), aber auch im nicht-neuronalen Gewebe wie in der Zunge (Durzyński et al., 2005; Gaudin et al., 2001), der Cornea (Pronin et al., 2014), den Erythrozyten (Feingold et al., 1999), der Prostata (Xu et al., 2000b), der Placenta (Itakura et al., 2006), dem Darm (Braun et al., 2007), den Schleimhäuten (Verbeurgt et al., 2014), den Spermien (Spehr et al., 2003) oder den Nieren (Pluznick et al., 2013) exprimiert werden. Seitdem haben sich nur wenige Studien umfassend mit der Expression von humanen ORs befasst, wobei die Ergebnisse der durchgeführten Microarray- Studien nur für die wenigsten ORs übereinstimmen (Feldmesser et al., 2006; Zhang et al., 2007). Da ektopisch exprimierte OR-Gene nur gering exprimiert werden und Microarrys nur sehr ungenaue Ergebnisse liefern, war die Next-Generation Sequenzierung (RNA-Seq) die geeignetste Methode um die Expression der ORs genauer zu untersuchen. Die RNA-Seq Methode ermöglichte eine sehr genaue Quantifizierung der OR-Transkripte aus 16 frei erhältlichen Datensätzen von humanen Geweben (Illumina Bodymap Projekt 2.0) (Wang et al., 2008). Die Genauigkeit dieser Sequenziermethode ist weitaus höher als die der Microarrays (Illumina 2011) und konnte bereits in einigen Studien mittels q-PCR Experimenten belegt werden (Nagalakshmi et al., 2008). Zugleich ermöglicht RNA-Seq durch eine hohe Sequenziertiefe (< 40 Millionen reads) die Detektion von niedrig exprimierten Transkripten (Mortazavi et al., 2008). Die in dieser Arbeit genutzten Daten wiesen alle eine Sequenziertiefe von mindestens 70 Millionen reads auf und ließen es deshalb auch zu sehr gering exprimierte OR-Gene zu identifizieren.

Kapitel 6 - Diskussion

6.2.1 Die ektopische Expression von olfaktorischen Rezeptoren Von den ungefähr 400 funktional exprimierten humanen ORs konnten wir im Rahmen dieser Analyse 111 ORs in 16 Geweben nachweisen (> 0,1 FPKM). Etwa die Hälfte der detektierten ORs (50) wurde im testikulären Gewebe detektiert. Das Gewebe mit der niedrigsten Anzahl exprimierter ORs (2) war die Leber. In Übereinstimmung mit bereits durchgeführten Expressionsstudien zeigte sich, dass einige ORs, wie der OR2W3, der OR51E1, der OR52E2, der OR52N4 und der OR2A4/7 in vielen der untersuchten Geweben exprimiert werden (Feldmesser et al., 2006; Zhang et al., 2007; La Cruz et al., 2009; Zhang et al., 2004). Da die Sequenzen des OR2A4 und des OR2A7 sich sehr ähneln kann nicht zwischen den beiden OR-Genen unterschieden werden und wird daher immer zusammengefasst dargestellt. Durch die zuvor durchgeführten Mircoarray-Anaysen wurde bislang angenommen, dass die meisten ektopisch exprimierten ORs in der Lunge und im Herzen auftreten (Feldmesser et al., 2006; Zhang et al., 2007). Im Rahmen dieser RNA-Seq Analyse konnte gezeigt werden, dass im humanen Gewebe das testikuläre Gewebe mit 50 OR-Genen die größte Anzahl ektopisch exprimierter ORs besitzt. Jedoch zeigte sich in der ersten RNA-Seq Analyse des murinen TGs und DRGs, dass in neuronalen Geweben möglicherweise noch mehr ORs exprimiert werden (98 ORs im murinen TG und 33 ORs im murinen DRG). Dies könnte in ähnlicher Form auch für das humane TG und DRG zutreffen (Manteniotis et al., 2013). Eine erst vor kurzem veröffentliche RNA-Seq Studie an muriner Cornea konnte 96 exprimierte ORs detektieren (Pronin et al., 2014). Auch dies lässt vermuten, dass ORs vermehrt in neuronalen Geweben exprimiert werden. Dennoch ist die Anzahl von 50 ORs im Testes- Gewebe verglichen zum DRG sehr hoch und lässt vermuten, dass ORs dort an physiologische Funktionen beteiligt sind. Neben den OR-Genen konnten in den Geweben 31 % aller deklarierten OR-Pseudogene gefunden werden. Insgesamt wurden 254 OR-Pseudogene in den 16 untersuchten Geweben identifiziert. Zhang und Mitarbeiter postulieren, dass OR-Pseudogene die Expression von OR- Genen im olfaktorischen sensorischen Neuronen regulieren (Zhang et al., 2007). Möglicher- weise übernehmen ektopisch exprimierte OR-Pseudogene auch in anderen Geweben eine ähnliche Funktion. Die meisten ektopisch exprimierten ORs sind niedrig exprimiert und nur wenige, wie der OR51E2 mit einem durchschnittlichen FPKM-Wert von 3, konnten stärker exprimiert detektiert werden. Im Vergleich mit bekannten Haushaltsgenen ist die Expression des OR51E2 vergleichbar mit denen der TATA-Box Binde-Proteine. Die niedrige Expression der überwiegenden Mehrheit der detektierten ORs könnte, ähnlich wie schon für die TAAR- 50

Kapitel 6 - Diskussion

Rezeptoren beschrieben, an einem mosaikartigen Expressionsmuster liegen (Borowsky et al., 2001). Möglich wäre, dass ORs nur in bestimmten Zellen des Gewebes vorkommen und durch die RNA-Isolation des gesamten Gewebes stark verdünnt werden und die FPKM-Werte dementsprechend niedrig ausfallen. Während der RNA-Seq Analyse des murinen TGs wurden zur Validierung der Expressionen auch in-situ Hybridisierungen für ORs durchgeführt. Diese zeigten, dass einige ORs, wie der niedrig exprimierte Olfr1417, nur in wenigen Neuronen des TGs exprimiert werden (Manteniotis et al., 2013). Stärker exprimierte ORs (> 1 FPKM), wie der Olfr420, wurden in deutlich mehr Neuronen angefärbt. Es könnte durchaus sein, dass auch in nicht-neuronalen humanen Geweben niedrig exprimierte ORs nur in einigen Zelltypen vorkommen. Um einen möglichst großen Teil der Daten zu validieren, wurden RT-PCR Experimente durchgeführt. Hierzu wurden ORs ausgewählt, die entweder in vielen oder nur in vereinzelten Geweben detektiert werden konnten. Die RT-PCR Experimente deckten sich weitestgehend mit der RNA-Seq Analyse und wiesen von sechs untersuchten Geweben nur Unstimmigkeiten im Brustgewebe auf. Im Brustgewebe konnte die Expression von nur 56 % der RNA-Seq detektierten ORs bestätigt werden. Denkbar ist es, dass das Expressionsmuster der verschiedenen Spendergewebe für RNA-Seq (29 jährige Frau) und für die RT-PCR (52 jährige Frau), durch den großen Altersunterschied und durch die unterschiedlichen Lebensumstände variiert. Unterschiede in den PCR- und RNA-Seq Experimenten kommen höchstwahrscheinlich durch die unterschiedlich hohe Sensitivität der Methoden zustande. Mittels der PCR-Experimente konnten etwas mehr ORs detektiert werden als durch die RNA-Seq Analyse. Dies verdeutlicht, dass die PCR-Methode sensitiver für sehr niedrig exprimierte Gene ist als die RNA-Seq. Die Anzahl der durch die RNA-Seq detektierten ORs kann als das Minimum an ektopisch exprimierten ORs angesehen werden. Neben den vielen niedrig exprimierten ORs konnten auch einige stärker exprimierte (> 1 FPKM) detektiert werden. Die zwei wohl bekanntesten ORs waren der OR51E1 und der OR51E2 (auch: PSGR prostate-specific G-protein coupled receptor). Die Expression des PSGR konnte in 14 Geweben nachgewiesen werden, wobei der Rezeptor am höchsten (~3 FPKM) in der Prostata exprimiert wird. Die Rolle des PSGR in der Prostata konnte in einer vorangegangen Studien charakterisiert werden (Neuhaus et al., 2009). Ähnlich wie der PSGR konnte auch der OR51E1 in 14 Geweben detektiert werden, wobei dieser am stärksten (1 - 3 FPKM) im Fettgewebe, in der Brust und im Herz nachgewiesen wurde. Diese Ergebnisse stimmen mit der Studie von Fujita überein, in welcher der OR51E1 51

Kapitel 6 - Diskussion

auch in mehreren unterschiedlichen Geweben nachgewiesen werden konnte (Fujita et al., 2007). 2006 wurde der OR51E1 erstmals in Prostata und Prostatakrebszellen detektiert und wird seitdem als möglicher Marker für neuroendokrine Tumoren diskutiert (Leja et al., 2009; Weng et al., 2006). Für die am höchsten exprimierten ORs wurden zusätzlich frei zugängliche EST- und Microarry- Daten neu ausgewertet. Auch diese Daten bestätigten die spezifische Expression des OR4N4 im Testes-Gewebe. Des Weiteren wurden von den 50 detektierten ORs im testikulären Gewebe sechs mit einem FPKM über 1 nachgewiesen. Die physiologische Funktion von zwei dieser ORs OR1D2 und OR7A5 konnte bereits in anderen Studien beschrieben werden (Branscomb et al., 2000; Ziegler et al., 2002; Walensky et al., 1998; Veitinger et al., 2011; Spehr et al., 2003). Die gezeigten Ergebnisse unterstützen die Annahme, dass ORs weitgehend in physiologischen Funktionen im Testes-Gewebe und in Spermien involviert sind.

6.2.2 Die Entdeckung von bislang unbekannten chimären OR- Transkripten Eine weitere Besonderheit der RNA-Seq Methode ist die Möglichkeit, nah lokalisierte Gene zu detektieren und Spleißvarianten zu erkennen. Feldmesser und Mitarbeiter berichteten über den Einfluss von umliegenden Genen (< 0,5 M) auf ORs und postulieren, dass diese die Expression der ektopisch exprimierten ORs verstärken (Feldmesser et al., 2006). Auch im gesunden Gewebe werden immer wieder neue chimäre Transkripte zwischen Genen nachgewiesen (Li et al., 2009; Gingeras 2009). Die Funktion der chimären Transkripte weicht dabei oftmals von der ursprünglichen ab. Im stromaufwärts liegenden Genbereich der ORs konnten wir erstmals einige Gene identifizieren, die mit ORs chimäre Transkripte bilden und konnten diese Ergebnisse mit RT-PCR Experimenten validieren. Die Bildung von chimären Transkripten könnte die ektopische Expression einiger ORs in manchem gesunden Gewebe erklären, doch ist ihre Funktionalität nicht bekannt. Es scheint, dass einige der stromaufwärts-lokalisierten Gene mit einer bislang unbekannten nicht annotierten 5’UTR (Untranslatierter Bereich) der ORs ein Genkomplex bilden und dadurch die chimären Transkripte zustande kommen. Ähnliches wurde schon für ektopisch exprimierte ORs im malignen Hodentumor gezeigt, bei dem eine unübliche Kombination von Genen die Transkription der ORs anzuregen scheinen (Volz et al., 2003). Die zwei Gene OR2W3 und OR2T8 bilden in einem Teil des untersuchten Gewebes mit dem stromaufwärts-lokalisiertem Gen Trim58 (triplate motif-containing gene 58) ein chimäres Transkript. Die reguläre Funktion der Trim-Gene ist an vielfältigen biologischen Prozessen

Kapitel 6 - Diskussion

beteiligt und scheint zusätzlich auch an der Karzinogenese involviert zu sein (Hatakeyama 2011). In einer zuvor durchgeführten Studie wurde erwähnt, dass durch Hinzugabe des 2-Adrenozeptoren Liganden die Expression von OR2W3 und Trim58 in Blutzellen runterreguliert wird (Kohli et al., 2009). Es scheint möglich, dass diese beiden Gene auch in anderen, hier nicht untersuchten Geweben zusammen exprimiert werden und eine bislang unbekannte physiologische Funktion einnehmen. Auch der im Testes-Gewebe hoch exprimierte OR4N4 bildet dort ein chimäres Transkript mit dem stromaufwärts-lokalisiertem Genlocus loc727924, indem es sich mit der 5’UTR Region des ORs überschneidet. Der Genlocus loc727924 ist als nicht-kodierende RNA beschrieben worden. Eine zuvor durchgeführte wissenschaftliche Arbeit zeigte, dass auch nicht-kodierende RNAs die Expression anderer Gene in ihrem Umfeld stimulieren (Ørom et al., 2010). Weitere Studien postulieren, dass unterschiedliche 5’UTR Strukturen notwendig für eine Regulation der posttranskriptionalen Modifikation von einigen ORs sind (Asai et al., 1996). Wie auch schon für andere Gene gezeigt werden konnte, wurde angenommen, dass ektopisch exprimierte OR- Gene andere Promotoren und andere 5’UTRs nutzen als im olfaktorischen Epithel (Volz et al., 2003; Chiu et al., 2001). Von den 20 am höchst exprimierten ORs konnten 3 Mitglieder gefunden werden, die mit umliegenden Genen chimäre Transkripte bilden. Es konnte gezeigt werden, dass durch Spleißen innerhalb des OR-ORFs (offener Leserahmen), das Protein- Produkt modifiziert wird und möglicherweise weniger Transmembrandomänen besitzt (Younger et al., 2001). Wie exemplarisch anhand des OR4N4 gezeigt wurde, scheinen die Proteinprodukte der drei gespleißten ORs keine vollständigen ORs zu bilden. Grund hierfür ist die Internalisierung eines anderen Genes innerhalb des offenen Leserahmens, die dadurch resultierende Verschiebung des Leserasters und die Entstehung eines neuen Stopcodons. Es scheint, dass solche Events verantwortlich sind für die Entstehung einiger funktionsloser ektopisch exprimierter ORs.

6.2.3 Zusammenfassung der ektopischen Expression von ORs Mit Hilfe von RNA-Seq war es möglich, die ektopische Expression von ungefähr 400 funktionalen ORs in 16 Geweben zu untersuchen. Insgesamt konnten 111 ORs in den Geweben detektiert werden, wobei einige dieser ORs in viele Geweben nachgewiesen wurden und andere wiederrum hochspezifisch vorkamen. Hierbei fiel auf, dass einige Gewebe, wie die Leber, nahezu keine ORs exprimierten und andere, wie das testikuläre Gewebe, eine große Anzahl an

Kapitel 6 - Diskussion

ektopisch exprimierten ORs besitzen. Diese Tatsache unterstützt die Hypothese, dass ektopisch exprimierte Rezeptoren eine funktionale Rolle in den Geweben einnehmen. Zusätzlich konnte im Rahmen dieser Studie erstmalig chimäre Transkripte für ORs beschrieben werden. Insgesamt 3 der 20 höchst exprimierten ORs wiesen eine Bildung von chimären Transkripten auf. Die Bildung von Fusionsgenen, kommt durch das Spleißen zwischen einer 5’UTR mit stromaufwärts-lokalisierten Genen zustande. ORs die eine Fusion mit stromaufwärts-lokalisierten Genen bilden, sind höchstwahrscheinlich durch eine Verschiebung der Leserasters (Frameshift) funktionslos.

6.2.4 Die Expression von olfaktorischen Rezeptor-spezifischen Bestandteilen der Signalkaskade Neben der Untersuchung exprimierter ORs wurde auch die Expression einiger OR-spezifische Bestandteile der Signalkaskade überprüft. Der klassische OR-vermittelte Signalweg aktiviert ein Golf Protein, das die cAMP Produktion durch eine gesteigerte Adenylatcyclase-III Aktivierung einleitet und dadurch sowohl CNG-Kanäle als auch indirekt Calcium-aktivierte Chloridkanäle öffnet. Zuvor durchgeführte Studien an ektopisch exprimierten ORs zeigten, dass Teile der olfaktorischen Signalkaskade in Geweben außerhalb des olfaktorischen Epithels nicht notwendig sind (Spehr et al., 2011; Busse et al., 2014). So ist es möglich, dass Gs-Proteine die zu 88 % in der Sequenz übereinstimmenden Golf-Proteine ersetzten (Jones und Reed 1989). Am Lehrstuhl für Zellphysiologie der Ruhr-Universität Bochum wurde eine Arbeit veröffentlicht, welche zeigte, dass aktivierte ORs auch ganz alternative Signalkaskaden, wie den Src-Kinase abhängigen Signalweg, einleiten können (Spehr et al., 2011). Braun und

Mitarbeiter postulieren, dass ORs im Darm den Gq-vermittelten Signalweg nutzen und wiesen dort die Beteilig der PLC nach (Braun et al., 2007). Auch die im Laufe dieser Forschungsarbeit erhaltenen Ergebnisse zeigen, dass zumindest die meisten essentiellen Bestandteile des olfaktorischen Systems, wie die Adenylatcyclase-3, RIC8B oder REEP1 in allen Geweben exprimiert werden. Einige Komponenten der OR-

Signalkaskade, wie die CNG-Kanäle oder Golf konnten häufig nicht nachgewiesen werden. Es ist denkbar, dass gerade ektopisch exprimierte ORs andere Signalwege nutzen als im olfaktorischen Epithel.

Kapitel 6 - Diskussion

6.2.5 Die ektopische Expression von olfaktorischen Rezeptoren in Tumorzellen Immer mehr neuere Studien zeigen dass ORs nicht nur im gesunden Gewebe ektopisch exprimiert werden, sondern auch vermehrt in Tumorzellen vorkommen. So konnte zum Beispiel vor kurzem mittels RT-PCR gezeigt werden, dass vermehrt ORs in enterochromaffinen Tumorzellen exprimiert werden (Sanz et al., 2014). Hierbei zeigte sich, dass auch mehrere ORs in einer Zelle coexprimiert werden (Veitinger et al., 2011). Auch in Brust- und Lungen Tumoren konnte die Expression von ORs gezeigt werden (Lawrence et al., 2013; Muranen et al., 2011). Die genaue Charakterisierung dieser ORs war aber aufgrund der unbekannten Liganden bislang nicht möglich. Bis heute konnte lediglich der PSGR durch eine Stimulation in Prostatakrebszellen charakterisiert werden und ein Zusammenhang zur Proliferation gezogen werden (Neuhaus et al., 2009). Im Rahmen der ektopischen Expressionsanalyse deuteten die von uns untersuchten EST-Daten auf die weitere Expression des OR2A1 in malignen Tumoren hin. Dass die Expression von ORs womöglich mit der Entstehung oder der Genesung von Tumoren einhergeht, zeigte nochmals die erst kürzlich veröffentlichte Studie von L'Espérance und Mitarbeiter (L'Espérance et al., 2008). Hier konnte gezeigt werden, dass der OR2A1 während einer Chemotherapie hochreguliert wird (L'Espérance et al., 2008). Bis heute ist die Charakterisierung der Funktion von ektopisch exprimierten ORs problematisch, da nur von wenigen ORs Agonisten und Antagonisten beschrieben wurden. Aufgrund dieser interessanten Entdeckungen stellte sich hier die Frage, ob man bereits deorphanisierte ORs in Krebszellen detektieren könnte und die Funktion dieser anschließend charakterisiert. Diese Fragestellung führte zum dritten Teil meiner Dissertation und wird im Anschluss behandelt.

6.3 Die Expression von olfaktorischen Rezeptoren in Zellen der myeloischen Leukämie Die Expression von ORs in malignen Zellen konnte erstmals im Jahr 2000 gezeigt werden (Xu et al., 2000b). In der zweiten Studie dieser Dissertation konnte die ektopische Expression von ORs in humanen Blutzellen nachgewiesen werden (Flegel et al., 2013). Im Rahmen einer RNA- Seq Analyse wurden von insgesamt acht humanen Blutzelllinien, die meisten ORs in der chronisch myeloischen Leukämie (CML) Zelllinie K562 detektiert. Insgesamt wurden in K562 29 ORs detektiert, von denen die sieben ORs OR2AT4, OR2W3, OR52D1, OR51B5, OR51B4, OR2B6 und OR51l2 mit einem FPKM > 1 exprimiert werden.

Kapitel 6 - Diskussion

Durch RT-PCR Experimente konnte die Expression der sieben am höchsten exprimierten ORs validiert werden. In zuvor durchgeführten Studien wurde bereits das Ligandenspektrum des OR2AT4 und des OR51D2 umfangreich charakterisiert (Busse et al., 2014; Sanz et al., 2005). Busse und Mitarbeiter zeigten, dass Sandalore, Brahmanol und Javanol die Rezeptoraktivität modulierten und diese durch die spezifischen Antagonisten Phenirat und Oxyphenilon unterbunden werden konnte. Hierbei zeigte sich, dass der OR2AT4 ein sogenannter narrowly tuned receptor ist und sich nur durch ein kleines und strukturell ähnliches Spektrum an Duftstoffen aktivieren lässt (Bieri et al., 2004; Saito et al., 2009). Sandalore und Brahmanol sind synthetische Sandelholzdüfte und unterscheiden sich lediglich durch den Aufbau ihrer Kohlenstoffkette (Brocke et al., 2008). Der natürliche Ligand des OR2AT4 ist bislang unbekannt. Ein natürliches Sandelholzöl war nicht in der Lage den OR2AT4 zu aktivieren, was durch die Hypothese von Bieri unterstützt wird, dass natürliches Sandalore andere ORs aktiviert als die synthetischen Sandelholzdüfte (Bieri et al., 2004). Ferner, ist in 2005 das Ligandenspektrum des OR51D2 analysiert worden und gezeigt, dass Methyloctanoat der Ligand mit der höchsten Rezeptoraffinität ist (Sanz et al., 2005). Da lediglich vom OR2AT4 Rezeptor-Antagonisten bekannt sind, wurde dieser Rezeptor ausgewählt, um an weiterführenden Experimenten den Signalwegtransduktionsweg und die physiologische Funktion von ORs in CML-Zellen zu beschreiben. Zunächst wurde die Expression des OR2AT4 und die anderer ORs mit Hilfe von RNA-Seq, RT-PCR und immunhistochemischen Färbungen in K562 überprüft. Mittels Western Blot Experimenten konnte das Vorkommen des OR2AT4 in der Zellmembran von K562 nachgewiesen werden. Dadurch konnte insbesondere die Expression des OR2AT4 in K562 und der K562 Zellmembran gewährleistet werden. Um dies nicht nur am Leukämie Modelsystem K562 zu zeigen, wurden q-PCR Experimente an AML-Patienten Blut durchgeführt. Übereinstimmend mit der Expression in K562 konnten die gleichen OR-Transkripte an den weißen Blutzellen erkrankter Patienten detektiert werden. Um den OR-vermittelten Signalweg in myeloischen Zellen zu untersuchen, wurde in anschließenden Experimenten das Calcium-Imaging Verfahren und das cAMP-GloTM Assay genutzt.

Kapitel 6 - Diskussion

6.3.1 Die Sandalore-induzierte Signalkaskade in der humanen CML- Zellinie K562 Die Calcium-Imaging Experimente an K562 ergaben, dass während der Liganden-Applikation der intrazelluläre Calciumspiegel signifikant und repetitiv erhöht werden konnte. Im Gegensatz dazu konnten andere Duftstoffe wie Citronellol oder Dimetol sowie der OR2AT4 Antagonist Phenirat den intrazellulären Calciumspiegel nicht beeinflussen. Unterstützt wurden diese Experimente durch ein cAMP-GloTM Assay, bei dem man einen direkten cAMP-Anstieg nach fünfminütiger Ligandenstimulation durch Sandalore beobachten konnte. Auch hier wurde die Wirkung weiterer Duftstoffe untersucht, welche übereinstimmend mit den Calcium-Imaging Experimenten keinen signifikanten Einfluss auf die intrazelluläre cAMP-Konzentration zeigten. Nach repetitiver Sandalore Stimulation konnte eine Desensitisierung beobachtet werden. Die Desensitisierung wurde als der Verlust der Reaktion der Zellen auf die kontinuierliche oder die repetitive Verabreichung eines Liganden beschrieben (Hausdorff et al., 1990). Hierbei kann die Applikationsdauer des Agonisten von Sekunden bis hin zu Stunden oder Tagen reichen, die benötigt werden, um einen GPCR zu desensitisieren. Eine kürzlich veröffentlichte Studie zeigte, dass die Desensitisierung von ORs in olfaktorischen Neuronen durch die Aktivierung einer G-Protein gekoppelten Rezeptor-Kinase (GRK) eingeleitet wird und diese die Rezeptor-Internalisierung veranlasst (Kato et al., 2014). Dieser Effekt war reversibel. Gegenteiliges wurde in der Studie von Busse gezeigt, bei der eine repetitive Sandalore Stimulation eine Sensitisierung des OR2AT4 in HaCaT-Zellen erzielte (Busse et al., 2014). Grund für die Rezeptorsensitisierung in den HaCaT Zellen waren Gap-Junctions, deren Einfluss durch spezifische Inhibitoren vollständig unterdrückt werden konnte. Durch Gap- Junctions werden Ionen, Second-Messenger, und kleinere Metaboliten zwischen Zellen ausgetauscht (Salomon et al., 1988; Goldberg et al., 2004; Meşe et al., 2007). Gap-Junctions gewähren somit in HaCaT Zellen den Austausch von cAMP oder Calcium und ermöglichen dadurch die Sensitisierung. Anders als HaCaT Zellen, sind K562 Zellen aber nicht adhärent und bilden als Suspensionszellen während der Calcium-Imaging Experimente auch keine Kolonien untereinander. Wie schon erwähnt, scheint der Grund für die Desensitisierung des OR2AT4 in K562 möglicher Weise eine GRK-induzierte Phosphorylierung an der dritten intrazellulären Schleife des C-Terminus sein (Kato et al., 2014; Oakley et al., 2001). Durch die GRK-Aktivierung koppelt sich -Arrestin an den Rezeptor, was letztlich die Internalisierung des ORs durch Clathrin- 57

Kapitel 6 - Diskussion beschichtete Versikel ermöglicht (Krupnick und Benovic 1998; Kato et al., 2014; Pitcher et al., 1998). Weiterführende Experimente zeigten, dass der OR2AT4 Antagonist Phenirat die Sandalore induzierte Calciumerhöhung in K562 signifikant inhibiert. Die bekannten OR2AT4 Antagonisten sind Phenole und tragen eine Ketongruppe in ihrer Kohlenstoffkette. 2014 zeigte Busse erstmals die Hemmung des Sandalore aktivierten OR2AT4s durch Hinzugabe von Phenirat und Oxyphenilon und postuliert, dass die Ketongruppen beider Antagonisten die Inhibition des Rezeptors begünstigen (Busse et al., 2014). Unklar ist bislang, ob es sich bei der Hemmung des OR2AT4 Antagonisten um eine kompetitive oder allosterische Hemmung handelt. Es konnte aber gezeigt werden, dass die Antagonisten durch eine Erhöhung der Sandalorekonzentration ihre inhibitorische Wirkung verloren. Dies resultiert wahrscheinlich aus der Verdrängung des Antagonisten aus der Rezeptorbindestelle (Daniela Busse 2013). Eine allosterische Hemmung scheint unwahrscheinlich, da hierbei Antagonisten eine andere Bindestelle nutzen würden als die Agonisten (Oberdisse 2002). Die Charakterisierung der OR2AT4 Signalkaskade zeigte in den Calcium-Imaging Messungen und dem cAMP-GloTM Assay, dass die Sandalore-induzierten Calcium-Signale extrazelluläres Calcium benötigen und eine cAMP Erhöhung durch die Aktivierung der Adenylatcyclase ausgelöst wird. Die Aktivierung der PKA war notwendig um eine intrazelluläre Calciumerhöhung in K562 zu erzielen. Die Beteiligung der PLC konnte hier nicht gezeigt werden. Diese Daten bestätigen einen cAMP-abhängigen Signalweg des OR2AT4 in der K562 Zelllinie. Gleiches wurde auch für die Sandalore-induzierte Aktivierung des OR2AT4 in HaCaT Zellen gezeigt (Daniela Busse 2013). Die OR-vermittelte Signalkaskade im olfaktorischen Epithel erfolgt klassischer Weise durch die Aktivierung des olfaktorischen G-Proteins Golf (Jones und Reed 1989; Pfeuffer et al., 1989; Bakalyar und Reed 1990). Zusätzlich werden nachgeschaltete CNG-Kanäle durch cAMP geöffnet und ermöglichen den Einstrom von Natrium und Calcium-Ionen in die Zellen (Nakamura und Gold 1987; Dhallan et al., 1990; Liman und Buck 1994; Sautter et al., 1998). Die im Rahmen dieser Arbeit durchgeführte RNA-Seq-Analyse konnte weder die Expression von CNG-Kanälen, noch die von Golf in K562 bestätigen (FPKM 0 - 0,1). Allerdings konnte für den OR2AT4-vermittelten Signalweg in HaCaT Zellen gezeigt werden, dass CNG-Kanäle am Calciumeinstrom beteiligt sind (Busse et al., 2014). Auch das spezifische olfaktorische

Golf-Protein konnte in der Hautzelllinie nachgewiesen werden. Aufgrund des analysierten

Signalweges scheint es für K562 Zellen wahrscheinlich, dass der OR2AT4 anstelle eines Golf-

58 Kapitel 6 - Diskussion

Proteins ein Gs-Protein (FPKM ~63) aktiviert. Jones und Reed zeigten 1989, dass Golf und

Gs eine 88-prozentige Sequenzhomologie besitzen und dass ORs beide G-Proteine nutzten können (Jones und Reed 1989). Dies ist nicht unwahrscheinlich, da auch in neueren Studien und anderen Zellsystemen die Nutzung von alternativen OR-Signalwegen diskutiert und beobachtet wurde (Ache 2010; Spehr et al., 2011; Maßberg et al., 2014). In der Leberzellkarzinom Zelllinie Hu7 ist die OR1A2-ausgelöste Signalkaskade Adenylat- cyclase vermittelt (Maßberg et al., 2014), wohingegen im Darm die Thymol-induzierten Signale über den PLC-vermittelten Signalweg induziert werden (Braun et al., 2007). In den Prostatazellen wird ohne Einfluss eines G-Proteins, die Src-Kinase direkt aktiviert, die einen nachgeschalteten TRPV6 Kanal öffnet (Spehr et al., 2011). In den olfaktorischen Rezeptor- neuronen konnte sowohl die Aktivierung eines cAMP-Signalweges als auch eines über die PI3-Kinase vermittelten Signalweges beobachtet werden (Klasen et al., 2010; Ache 2010). Diese Ergebnisse deuten darauf hin, dass die OR2AT4-vermittelte Signalkaskade in K562 durch die Aktivierung eines Gs-Proteins die Aktivität der Adenylatcyclase stimuliert und dadurch vermehrt cAMP gebildet wird. Eine Erhöhung des intrazellulären cAMP-Gehaltes führt zur Aktivierung der PKA, welche im Anschluss nachgeschaltete Calcium-selektive Ionenkanäle aktiviert. Die Untersuchung der möglichen nachgeschalteten Ionenkanäle wird im Kapitel 6.3.3 diskutiert. Um den OR2AT4-vermittelten Signalweg nicht nur in K562 zu zeigen, wurden im Anschluss Calcium-Imaging Daten an AML-Patientenblut erhoben.

6.3.2 Die Sandalore-induzierte Signalkaskade im AML-Patientenblut Während einer akuten Leukämie schwemmen aus dem Knochenmark der Patienten vermehrt unreife Myelozyten und Metamyelozyten ins periphere Blut und vermehren sich dort durch eine gestörte Hyperproliferation. Diese akute und lebensbedrohliche Phase eines AML-Patienten gleicht der Endphase (Blastenkriese) von chronisch myeloischen Patienten. K562 Zellen sind isolierte Blutzellen aus einem erkrankten Patienten, der sich in der Blastenkriese befindet. Um also ein geeignetes natives Zellsystem zu nutzen, erhielten wir in Kooperation mit dem Universitätsklinikum Knappschaftskrankenhaus Bochum und dem Universitätsklinikum Essen Blut von akut erkrankten AML-Patienten. Um die in K562 erhaltenen Daten zur OR-vermittelten Signalkaskade auch im nativen Zellsystem zu testen, wurde Sandalore und Methyloctanoat mittels Calcium-Imaging Experimenten auf die isolierten Leukozyten appliziert. Die erhobenen Daten stimmen mit den Ergebnissen in K562 überein und deuten auf den gleichen Adenylatcyclase-vermittelten Signalweg hin.

Kapitel 6 - Diskussion

Diese Ergebnisse weisen darauf hin, dass die OR-vermittelten Mechanismen im nativen Zellsystem die gleichen sind wie in K562. Da AML-Patienten nur selten diagnostiziert werden und die Zellen sich nicht kultivieren lassen, wurden anhand weiterer Experimente die nachgeschalteten Ionenkanäle in K562 untersucht.

6.3.3 Mögliche nachgeschaltete Ionenkanäle in K562 Im Gegensatz zu den meisten anderen OR-exprimierenden Zellsystemen scheinen CNG-Kanäle während der OR-vermittelten Signalkaskade in der K562 keine Rolle zu spielen. Mit Hilfe der RNA-Seq-Analyse konnten einige Kandidaten als mögliche nachgeschaltete Calcium-selektive Kanäle identifiziert werden. Hierbei schien insbesondere die Expression der T-Typ als auch der L-Typ Calciumkanäle in Frage zu kommen. Die Calcium-Inhibitor-Experimente bestätigten, dass die Klasse der L-Typ spannungs- abhängigen Calciumkanäle mögliche nachgeschaltete Calcium-selektive Kanäle der OR2AT4 vermittelten Signalkaskade sind. Dennoch konnten die Inhibitoren den Sandalore-induzierten Calciumeinstrom nicht komplett unterdrücken. Es scheint, dass auch noch andere Kanäle an der Calciumerhöhung in K562 beteiligt sind. Übereinstimmend mit unseren Ergebnissen konnte anhand vorhergegangener Studien eine Aktivierung der spannungsabhängigen Calciumkanäle durch die PKA, aber auch durch die PLC beobachtet werden (Kamp und Hell 2000). Um die Auswirkungen auf die Sandalore-induzierte Erhöhung des intrazellulären Calciums auf physiologische Prozesse zu untersuchen, wurden als Nächstes die Folgen einer Sandalore- Inkubation auf grundlegende Mechanismen wie die Proliferation, die Apoptose und die Differenzierung untersucht. Viele vorangegangene Studien zeigen, dass eine intrazelluläre Calciumerhöhung physiologische Prozesse beeinflusst (Ci et al., 2003; Colbran und Brown 2004; Li et al., 2005).

6.3.4 Die physiologisch Funktion des OR2AT4 an der Proliferation Um den physiologischen Einfluss des aktivierten OR2AT4 in K562 zu untersuchen, wurde zunächst ein fünftägiger Proliferationsverlauf an Sandalore-inkubierten Zellen durchgeführt. Bekannt ist, dass Duftstoffe wie D-Limonene (125 µM - 1 mM) oder die Essenz von Pterodon pubescens die Proliferation in K562 inhibieren und Apoptose einleiten (Pereira et al., 2011). Im Allgemeinen wurde die anti-proliferierende Wirkung von Terpenen an malignen Zellentypen mehrfach beschrieben (Vieira et al., 2008; Thoppil und Bishayee 2011; Khaw-on und Banjerdpongchai 2012). Auch die Beteiligung von ektopisch exprimierten ORs an Proliferationsprozessen konnte hier bereits nachgewiesen werden (Neuhaus et al., 2009; Maßberg et al., 2014). 60

Kapitel 6 - Diskussion

In K562 inhibiert Sandalore signifikant die Hyperproliferation in einer konzentrations- wirkungsabhängigen Weise. In Gegenwart des Antagonisten konnte eine Aufhebung des proliferationshemmenden Effektes durch Sandalore gezeigt werden, jedoch nur als Tendenz. Interessanterweise diente, wie die zuvor durchgeführte Studie von Busse zeigte, die Aktivierung des OR2AT4 die Förderung von Wundheilungsprozessen in der Haut und aktivierte proliferationsverstärkende Mechanismen (Busse et al., 2014). Diese gegensätzliche OR2AT4 vermittelte Funktion scheint abhängig vom Zellsystem zu sein. Um diesen Unterschied genauer zu erforschen, wurde im Rahmen dieser Arbeit auch die p38-MAPK- Phosphorylierung untersucht. Die p38-MAPK wurde bereits beschrieben an der Steuerung proliferativer Mechanismen in K562 beteiligt zu sein (Zhang et al., 2014). In Keratinozyten wurde gezeigt, dass die p38- MAPK unter Sandalore-Behandlung deutlich stärker phosphoryliert wurde und dadurch Proliferation der Hautzellen unterstützte (Busse et al., 2014). Einige Studien zeigen, dass in K562 eine p38-MAPK-Phosphorylierung die Zellproliferation nicht beeinflusst (Kohmura et al., 2004), andere Arbeitsgruppen zeigten gegenteiliges (Dumka et al., 2009). In unseren Experimenten wurde während einer einstündigen Sandalore-Inkubation die p38- MAPK-Phosphorylierung nach 15 Minuten erhöht und fiel anschließend (30 Minuten - 60 Minuten) aber unter das basale Level. Ähnliches wurde bereits auch in einer anderen Studie in K562 beobachtet (Witt et al., 2000). In Gegenwart des p38-MAPK Inhibitors wurde die Proliferation deutlich inhibiert. Dies lässt vermuten, dass die erniedrigte p38-MAPK- Phosphorylierung nach der 30-minütigen Sandalore-Inkubation Grund für die proliferations- hemmende Wirkung ist. Diese Ergebnisse stimmen mit den anderer Studien überein (Zhang et al., 2014; Kambhampati 2009). In Keratinozyten wies Busse eine erhöhte p38-MAPK-Phosphorylierung nach, die verantwortlich für die Proliferationsförderung der Zellen war (Busse et al., 2014). Unsere Ergebnisse unterstützen damit die Annahme, dass die Proliferations-inhibierenden Mechanismen in K562 aus der unterschiedlichen Phosphorylierung der p38-MAPK resultieren. Die p44/42-MAPK, JNK-SAPK und Akt-Kinase waren an der Sandalore-induzierten Proliferationsinhibierung nicht beteiligt. Sandalore beeinflusste die basale JNK- Phosphorylierung nicht. Die p44/42-MAPK wurde während der Sandalore-Inkubation deutlich stärker phosphoryliert als in den unbehandelten Zellen. Wie bereits gezeigt werden konnte, wird durch eine erniedrigte p44/42-MAPK die Proliferation in K562 deutlich inhibiert (Kortenjann et al., 1994; Pagès et al., 1993). Bisher ist nicht bekannt, ob eine erhöhte p44/42-MAPK in K562 die Proliferation in irgendeiner Weise begünstigt. Die verstärkte Akt-Phosphorylierung 61

Kapitel 6 - Diskussion

ist für das Überleben der Zellen verantwortlich und konnte bereits in vielen Krebsarten beobachtet werden (Chen et al., 2014a; Han et al., 2014). Eine erhöhte Akt-Phosphorylierung verstärkt eher das Überleben der K562-Zellen und verhindert den programmierten Zelltod (Xu et al., 2014). Dennoch war die beobachtete p44/42-MAPK-Phosphorylierung, die während der Sandalore- Inkubation auftrat nicht an der Proliferation beteiligt und warf somit die Frage nach ihrer Funktion auf. Mehrere Studien konnten zeigen, dass in K562 nach Inkubation mit chemischen Substanzen eine erhöhte p44/42-MAPK-Phosphorylierung zu beobachten war, die einherging mit einer veränderten Apoptose-Rate. Um diesen Effekt genauer zu untersuchen, wurde in anschließenden Experimenten die Sandalore-induzierte Apoptose bestimmt und ihr Einfluss auf die MAPK-Phosphorylierung mittels Inhibitoren überprüft.

6.3.5 Die Beteiligung des OR2AT4 an der Sandalore-induzierten Apoptose Ein Annexin-V FITC Propodium Iodid Assay wurde durchgeführt, um zu untersuchen, ob zusätzlich eingeleitete Apoptosemechanismen mitverantwortlich für die Sandalore-induzierte Proliferationsinhibierung sind. Die Ergebnisse zeigten deutlich, dass eine verstärkte p44/42- MAPK-Phosphorylierung an der Sandalore eingeleiteten Apoptose involviert ist. Sandalore konnte schon innerhalb einer Stunde in einer konzentrationsabhängigen Weise den programmierten Zelltod einleiten. Anhand immunohistochemischer Färbungen konnte zusätzlich eine Caspase-3 Aktivierung nach Sandalore Inkubation beobachtet werden. Ähnliches konnte bereits 2009 von der Arbeitsgruppe Wang gezeigt werden (Wang et al., 2009). Das zyklische Lipopeptid CLP induziert Apoptose in K562, indem es den intrazellulären Calciumgehalt der Zellen erhöht und somit die p44/42-MAPK aktiviert. Die erhöhte p44/42- MAPK-Phosphorylierung inhibiert die Bcl-2 und verstärkte dadurch die Cytochrom-C und die Caspase-3 Aktivität. Der gleiche Signalweg scheint auch während der Sandalore-induzierten Apoptose genutzt zu werden. Mit diesen Experimenten konnte gezeigt werden, dass nach Sandalore-Inkubation die p44/42-MAPK-Phosphorylierung erhöht wird und dadurch die Caspase-3 aktiviert und letztlich die Apoptose eingeleitet wird. Um zu prüfen inwiefern der OR2AT4 an dieser Signalkaskade beteiligt ist und nicht irgendein anderer Rezeptor, wurde als nächstes der Einfluss der intrazellulären Calciumerhöhung durch Sandalore auf die MAPK-Phosphorylierung überprüft. Bislang konnten vorangegangene Studien die Regulation der MAPK-Phosphorylierung durch Calcium über den Calmodulin-

Kapitel 6 - Diskussion

Signalweg nachweisen (Lee et al., 2000; Okazaki et al., 1994; Si und Collins 2008; Wright et al., 1997; Monaco et al., 2014; Kajiwara et al., 2013; Won et al., 2001).

6.3.6 Die Beteiligung der OR2AT4-vermittelten Calciumerhöhung an der MAPK-Phosphorylierung Um die Beteiligung der OR2AT4-vermittelten cytosolischen Calciumerhöhung an der Apoptose zu untersuchen, wurde in anschließenden Experimenten der Einfluss des Calcium- bindenden Proteins Calmodulin überprüft. Der hier genutzte Calmodulin-Inhibitor war KN-62. Dieser inhibiert die Calmodulin-aktivierte Kinase II und verhindert dadurch die Aktivierung des Calmodulins (Brooks und Tavalin 2011; Tsutsui et al., 1996; Okazaki et al., 1994). Bereits bekannt ist, dass aktiviertes Calmodulin in anderen Zellsystemen die Phosphorylierung der p44/42- und p38-MAPK einleitet (Lee et al., 2000; Rosengart et al., 2000). Eine Inhibition des Calcium-bindenden Proteins inhibierte die Sandalore-induzierte p44/42-MAPK-Phosphory- lierung vollständig und verhinderte dadurch die OR2AT4 eingeleitete Apoptose. Die intrazelluläre Calciumerhöhung durch den Sandalore-aktivierten OR2AT4 scheint unerlässlich, um Calmodulin zu aktivieren und die Apoptose einzuleiten. Somit konnte erstmalig die Beteiligung des ektopisch exprimierten OR2AT4 an der Apoptose gezeigt werden. Da neben der Apoptose und der Proliferation auch weitere Mechanismen wie die Differenzierung eine entscheidende Rolle spielen und hierbei die bereits untersuchten MAPKs eine zentrale Funktion einnehmen, sollte anhand weiterer Experimenten die Auswirkungen von Sandalore auf die Differenzierung untersucht werden.

6.3.7 Sandalore erhöht den Hämoglobingehalt in K562 Zellen Abschließend wurde die Beteiligung des OR2AT4 an möglichen Differenzierungs- mechanismen untersucht. Im nativen System wird die Differenzierung der Metamyelozyten in Erythrozyten durch Interleukine (IL) und Cytokine eingeleitet. Bereits beschrieben wurde, dass IL-3 und Erythropoetin (Epo) die p38-MAPK-Phosphorylierung aktivieren und dadurch die Hämoglobinsynthese stimulieren (Nagata et al., 1997). Vorrangegangene Studien belegten bereits, dass auch weitere Substanzen wie Hemin, Cyclosporin A, Butyrate oder Ethanol- extrakte aus Fructus trichosanthis die Hämoglobinsynthese in K562 durch die Beeinflussung der MAPK-Phosphorylierung stimulieren können (Witt et al., 2000; Sawafuji et al., 2003; Sasaki et al., 1994; Li et al., 2011; Woessmann et al., 2004). Um den Hämoglobingehalt nach sechstägiger Sandalore-Inkubation zu messen, wurde ein Hämoglobin-Assay genutzt. Da die K562-Zellen nach sechstägiger Inkubation mit Sandalore weniger anwachsen, wurde die Zellzahl bestimmt und mit der der Kontrolle angeglichen. 63

Kapitel 6 - Diskussion

Hierbei zeigte sich deutlich, dass die Sandalore-behandelten Zellkulturen signifikant mehr Hämoglobin aufwiesen als die Kontrolle. Sowohl der p38-MAPK Inhibitor als auch der OR2AT4 Antagonist Phenirat konnte die Sandalore induzierte Hämoglobinsynthese signifikant inhibieren. Die Mechanismen der Hämoglobinsynthese sind bis heute nicht genau verstanden. Im Allgemeinen wurde oftmals, eine erhöhte p38-MAPK und eine erniedrigte p44/42-MAPK- Phosphorylierung während der Hämoglobinsynthese in K562 beobachtet (Witt et al., 2000). Andere Arbeiten zeigen aber auch gegenteiliges. Oftmals wurde keine p38-MAPK- Phosphorylierung sondern lediglich eine erhöhte p44/42-MAPK-Phosphorylierung während einer erhöhten Hämoglobin-Produktion beobachtet (Woessmann et al., 2004). Im Rahmen unserer Western Blot Experimente konnte eine frühe (nach 15 Minuten) p38- MAPK-Phosphorylierung beobachtet werden, welche im Anschluss (nach 30 Minuten) unter das basale Level fiel. Die p44/42-Phosphorylierung war während der Sandalore-Inkubation dauerhaft erhöht. Wurde die frühe p38-MAPK-Phosphorylierung durch spezifische Inhibitoren geblockt, war die Hämoglobinsynthese signifikant erniedrigt. Wurde hingegen die p44/42- MAPK-Phosphorylierung und die Calmodulin-Aktivität inhibiert, fiel auch hier der Hämoglobingehalt der Zellen signifikant geringer aus. Als Positivkontrolle wurde 10 µM Hemin genutzt und mit der Wirkung von 100 µM Sandalore verglichen (Sasaki et al., 1994). Hemin förderte innerhalb der sechstägigen Inkubation die Hämoglobinsynthese deutlich stärker. Wie schon in zuvor publizierten Studien beschrieben wurde, war auch während unserer Experimente die Hemin induzierte Hämoglobinsynthese unabhängig von der p44/42-MAPK und p38-MAPK-Phosphorylierung (Woessmann und Mivechi 2001; Woessmann et al., 2004). Doch auch hier gibt es gegenteilige Ergebnisse von Arbeitsgruppen die zum Teil nach 2 bis 4 Stunden eine erniedrigte p44/42-MAPK-Phosphory- lierung aufwiesen, welche für die Hemin-induzierte Hämoglobinsynthese verantwortlich war (Woessmann et al., 2004). Unsere Ergebnisse weisen darauf hin, dass die Sandalore-induzierte Hämoglobinsynthese sowohl durch die erhöhte frühe p38-MAPK-Phosphorylierung (innerhalb der 15-minütigen Sandalore-Inkubation), als auch durch eine dauerhafte p44/42-MAPK-Phosphorylierung unterstützt wird. Es ist durchaus möglich, dass die frühe p38-MAPK-Phosphorylierung die Hämoglobinsynthese einleitet und eine anschließende erniedrigte p38-MAPK notwendig für den Sandalore erzielten Effekt ist.

Kapitel 6 - Diskussion

In weiterführenden Experimenten könnte man die MAPK-Phosphorylierung auch über mehrere Tage untersuchen. Wichtig wäre es hier, die MAPK-Phosphorylierung aller Substanzen welche die Hämoglobinsynthese fördern parallel an gleicher Zellpassage zu untersuchen.

Abbildung 6.1: Zusammenfassung der OR2AT4 vermittelten Signalwege in K562.

Sandalore bindet an den OR2AT4 wodurch ein G-Protein (wahrscheinlich Gs) aktiviert wird. Dadurch wird die membranständige Adenylatcyclase aktiviert und vermehrt cAMP gebildet. cAMP aktiviert die PKA welche daraufhin teilweise L-Typ Calciumkanäle aktiviert. Denkbar ist auch, dass die PKA alleine auch weitere Signalwege anschalten kann. Durch die aktivierten L-Typ Calciumkanäle kann extrazelluläres Calcium ins Cytosol einströmen und bindet mit Hilfe der CaMKII an Calmodulin. Das aktivierte Calmodulin erhöht die Phosphorylierung der p44/42-MAPK und Akt. Die Signalkaskaden der p44/42-MAPK und p38-MAPK regulieren eine Vielzahl von Zielgegen die an der Proliferation, Apoptose und Hämoglobinsynthese beteiligt sind. Sowohl die p38-MAPK als auch die p44/42-MAPK sind an der Sandalore-induzierten Hämoglobinsynthese beteiligt, nutzten aber wahrscheinlich andere Signalwege als bisher beschrieben. Die p44/42-MAPK induzierte Apoptose ist deutlich Einflussreicher als die Überlebensfunktion durch eine erhöhte Akt-Phosphorylierung in Krebszellen. (+) deutet auf eine erhöhte und (-) auf eine erniedrigte Phosphorylierung hin.

Bislang variieren auch die Inkubationszeiten der Substanzen in den Forschungsarbeiten stark (zwischen einer Stunde und 3 Tagen) und lassen sich somit nur schwer miteinander vergleichen.

6.3.8 Zusammenfassung - Die Charakterisierung des OR2AT4 in K562 und AML-Patientenblut In der vorliegenden Forschungsarbeit an K562 konnte die Expression von mehreren ORs in der humanen Leukämiezelllinie K562 nachgewiesen werden. Bei einem dieser Rezeptoren handelt 65

Kapitel 6 - Diskussion

es sich um den OR2AT4, dessen Funktion kürzlich anhand von Keratinozyten und HaCaT- Zellen charakterisiert werden konnte (Busse et al., 2014). Mit der Charakterisierung des OR2AT4 in der CML-Zelllinie und in AML-Patientenblut konnten neue Erkenntnisse über die chemosensorische Funktion ektopisch exprimierter ORs gewonnen werden. Bereits bekannt waren die Rezeptor-spezifischen aktivierenden und inhibierenden Duftstoffe. In Calcium- Imaging Experimenten konnte abhängig von der Duftstoff-Applikationszeit ein Anstieg des intrazellulären Calciums beobachtet werden. Der OR2AT4 nutzt in K562 einen Gs- gekoppelten Signalweg, bei dem die Aktivierung der Adenylatcyclase und der PKA unerlässlich für den intrazellulären Anstieg an Calcium ist (Abbildung 6.1). Durch nachgeschaltete L-Typ Calciumkanäle, sowie möglicherweise auch durch TRP-Kanäle, gelangt extrazelluläres Calcium durch die Membran ins Cytosol der Zellen. Der O2AT4 vermittelte Anstieg des intrazellulären Calciumgehaltes führt durch eine Aktivierung des Calmodulins zu einer erhöhten p44/42-MAPK-Phosphorylierung und über den in K562 bereits bekannten Bax2-, Bcl-, Caspase-3 Signalweg zu einer gesteigerten Apoptose. Sandalore stimulierte in den Zellen durch eine frühe p38-MAPK-Phosphorylierung und der bereits erwähnten p44/42- MAPK-Phosphorylierung zu einer leicht erhöhten Hämoglobinsynthese. Die nach 30-minütiger Sandalore-Inkubation beobachtete erniedrigte p38-MAPK-Phosphorylierung, scheint verantwortlich für die verminderte Zellproliferation zu sein. Unsere Ergebnisse decken sich mit bereits charakterisierten Signalwegen in K562. Diese Befunde liefern möglicherweise auch neue therapeutische Ansätze zur Behandlung von Imatinib-resistenten Leukämiepatienten im Blastenschub.

Kapitel 7 - Zusammenfassung

Kapitel 7

Zusammenfassung

Die vorliegende Arbeit untersuchte verschiedene Aspekte der chemosensorischen Wahrnehmung von Vertebraten und wurde aufgrund der umfassenden Analysen in drei Teilprojekte unterteilt. Der erste Teil der vorliegenden Dissertation, befasste sich mit der Sequenzierung und der Analyse des trigeminalen- und des Spinalganglions der Maus. Hierzu wurde die RNA aus dem präpariertem Gewebe isoliert und mit Hilfe der Next-Generation Sequenzierung analysiert. Ziel dieses Projektes war es, bis dato noch nicht in diesem Gewebe beschriebene sensorische Rezeptorproteine zu detektieren. Hierzu wurde eine Annotationsliste von allen bekannten GPCRs und Ionenkanäle erstellt und das Expressionsmuster mit Kontrollgeweben verglichen. Insgesamt konnten 106 GPCRs und 33 Ionenkanäle detektiert werden, deren Expression im TG noch nicht bekannt war. Ferner konnten 98 niedrig exprimierte ORs im TG und 33 im DRG nachgewiesen werden (0,1 - 1 FPKM). Sowohl die hoch exprimierten, als auch die im TG spezifisch exprimierten Rezeptoren sind überwiegend an der Wahrnehmung von Schmerzen und an der Detektion von flüchtigen oder gelösten Substanzen beteiligt. Die Expression der neu entdeckten Rezeptoren wurde mittels der in-situ Hybridisierung validiert. Darüber hinaus konnten erstmals die Expressionsunterschiede zwischen den beiden Ganglien untersucht und differenziert werden. Hierbei fiel auf, dass viele der im trigeminalen Ganglion differentiell exprimierten Gene auch hoch spezifisch im olfaktorischen Epithel exprimiert werden und dort an der Chemosensorik des Geruchsinns beteiligt sind. Diese Arbeit liefert die erste umfassende Expressionsanalyse des trigeminalen- und dorsalen Wurzelganglions. Zugleich erweitert diese Arbeit das Verständnis des TGs und liefert neue Forschungsansätze im Gebiet der trigeminalen Chemosensorik. Im Rahmen des zweiten Teils dieser Forschungsarbeit wurde die ektopische Expression von ORs mit Hilfe der Next-Generation Sequenzierung beschrieben. ORs bilden die größte bekannte Gruppe der Chemorezeptoren und sind für die Geruchswahrnehmung in olfaktorischen Sinneszellen verantwortlich. Es wurde die Expression in 16 frei erhältlichen mRNA-Datensätzen humaner Gewebe analysiert. Insgesamt konnten 111 ektopisch exprimierte ORs nachgewiesen werden. Dadurch wird die Hypothese unterstützt, dass ORs auch im nicht- neuronalem Gewebe eine funktionale Rolle einnehmen könnten. Die Expression einiger

Kapitel 7 - Zusammenfassung

interessanter Kandidaten wurde mittels RT-PCR validiert. Zudem konnten bislang noch nicht beschriebene 5’UTR für ORs nachgewiesen werden und deren Einbindung in die Bildung von funktionslosen Fusionsgenen postuliert werden. Der dritte Teil der vorliegenden Dissertation befasste sich mit der Charakterisierung des ektopisch exprimierten OR2AT4 in der humanen Leukämiezelllinie K562 und in nativen Blutzellen akut erkrankter AML-Patienten. Bislang gibt es nur wenige Arbeiten, welche die physiologische Relevanz der ektopischen Expression von ORs in humanen Zellen beschreiben. Die Ergebnisse dieser Arbeit zeigen anhand von RT-PCR Experimenten, immuncytochemischen Färbungen und Western Blots, dass der OR2AT4 sowohl in weißen Blutzellen erkrankter AML-Patienten als auch in der K562 Modelzelllinie für myeloische Leukämie exprimiert wird. Calcium-Imaging und die cAMP-GloTM Assay Experimente zeigten, dass der OR2AT4-Agonist einen rapiden Anstieg des intrazellulären Calciums über einen cAMP- vermittelten Signalweg induzierte. Weitere Ergebnisse dieser Studie weisen darauf hin, dass der Sandalore-induzierte Calcium- einstrom ins Cytosol teilweise durch die Aktivierung nachgeschalteter L-Typ Calciumkanäle eingeleitet wird. OR2AT4 Antagonisten-Experimente belegten die Beteiligung des ORs an den untersuchten Prozessen. Neben der Charakterisierung der OR-vermittelten Signaltransduktion in K562 und AML- Blutzellen wurde zusätzlich die Frage der physiologischen Funktion des OR2AT4 in Leukämiezellen aufgeklärt. Nach Agonisten-Stimulation unterdrückte der OR2AT4 durch Phosphorylierung der MAPK die Proliferation, induzierte Apoptose und förderte die Hämoglobinsynthese. Mit Hilfe von Western Blot Experimenten wurde auch hier die Beteiligung von Proteinkinasen an der OR-vermittelten Signaltransduktion untersucht. Diese Ergebnisse liefern einen fundamentalen Beitrag zum Verständnis der Funktionalität ektopisch exprimierter ORs und zeigen zugleich neue alternative therapeutische Ansätze zur Behandlung von Imatinib-resistenten Patienten in der Blastenkriese.

Chapter 7 - Conclusion

Chapter 7 Conclusion

The present study investigated various aspects of chemosensory perception in mammals and was divided into three subprojects. The first part of this dissertation dealt with a comprehensive sequencing analysis of the murine DRG and TG. For this purpose, RNA was isolated from fresh prepared tissue and sequenced by using the Next-Generation Sequencing method. As we aimed to analyze genes involved in sensory processes, we focused on the expression of GPCRs and ion channels. For this purpose, we created a list of all known GPCRs and ion channels in mammalian, and compared the expression with control tissues. In total, we detected 106 non-olfactory GPCRs and 33 ion channels, which have previously not been described as expressed in TG. In addition to that, we could detect the expression of 98 ORs in the TG and 33 ORs in the DRG with low abundances (0.1 - 1 FPKM). A catalogue of the highest and most specifically ion channels expressed in TG demonstrated that nearly all of these are involved in sensation of pain or detection of chemicals. To partially validate the RNA-Seq data, in-situ hybridization experiments for several newly discovered membrane proteins were performed. Further, a differential expression between the two homologues ganglia TG and DRG was carried out. Differences in the sensory function correlate with a shift of the expression pattern for genes such as membrane receptors. A differential transcriptome analysis of TG and DRG identified a number of genes with pronounced expression variances. Several of the trigeminal specific genes are also highly expressed in the OE and involved in the chemical detection of odorants. This work presents the first comprehensive transcriptome analysis of TG and DRG. At the same time, this work extends the understanding and provides new research approaches in the field of trigeminal chemosensation. In the second part of this work, the ectopic expression pattern of ORs was analyzed by using the Next-Generation Sequencing. ORs are the largest known group of chemoreceptors and are involved in the detection of volatile odors through the olfactory epithelium. Therefore, the ectopic expression pattern for ORs was analyzed in 16 freely available mRNA-Seq data of various human tissues. A total number of 111 ectopically expressed ORs were detected, thus supporting the hypothesis that ORs may play a functional role in non-neuronal tissues. The expression of some ORs was validated by RT-PCR. In addition, previously not described 5'UTR

Chapter 7 - Conclusion

for ORs have been detected and their involvement of forming non-functional chimeric transcripts was shown and validated by RT-PCR experiments. The third part of this thesis focused on the characterization of the ectopically expressed OR2AT4 in the human leukemia cell line K562 and native white blood cells of acute diagnosed AML-patients. So far, the physiological relevance of ectopically expressed ORs has rarely been described. We validated the expression of the OR2AT4 with RNA-Seq, RT-PCR, immunocytochemical staining and western blots. Calcium-imaging and cAMP-GloTM assay experiments showed that the OR2AT4 agonist sandalore induced a rapid increase of intracellular calcium through a cAMP-mediated signaling pathway. Downstream located L-type calcium channels insure the sandalore induced calcium influx. The involvement of the OR was validated by a previously described OR2AT4 antagonist. Furthermore, we observed the physiological role of the OR2AT4 in myelogenous leukemia. Agonist stimulation of the OR2AT4 evoked an inhibition of the proliferation, an enhanced apoptosis and promoted the hemoglobin synthesis through regulation of the MAPK-phosphorylation. The basic mechanisms of the MAPK-signaling pathway were investigated with western blot experiments. These results support a novel contribution in understanding the functionality of ectopically expressed ORs and display new alternative therapeutic approaches for the treatment of imatinib- resistant patients in blast crisis.

Abbildungsverzeichnis

Abbildungsverzeichnis Kapitel 1 Abb. 1.1: Signalweiterleitung eines Duftmoleküls im Riechsystem des Menschen. Abb. 1.2: Anordnung der Aminosäurenstruktur in ORs. Abb. 1.3: Die klassische Signalkaskade in olfaktorischen Rezeptorneuronen. Abb. 1.4: Anatomie des Nervus Trigeminus. Abb. 1.5: Differenzierungsmöglichkeiten ausgehend von einer myeloischen Stammzelle. Kapitel 3 Figure 1: Representative in-situ hybridization slices from adult mice Figure 2: Expression pattern analysis of all detected GPCRs Figure 3: The 30 most highly expressed GPCRs in trigeminal ganglia Figure 4: In-situ hybridization experiments in the mouse TG Figure 5: The most TG-specific GPCRs Figure 6: Comparison of cumulative FPKM values (sFPKM) Figure 7: Ranking of the most highly expressed ion channels in the TG Figure 8: In-situ hybridization for some ion channels in mouse TG Figure 9: Ranking of TG- and DRG-specific ion channels Figure 10: Ranking of potassium channels that are most specifically expressed in the TG and DRG Figure 11: Comparison of expression profiles of the TG and DRG Figure 12: Genes expressed differentially in the TG and DRG Figure S1: Expression strength for housekeeping genes in all analyzed tissues. Figure S2: Distribution of FPKM values compared with the different tissues used. Figure S3: Integrative Genomic Viewer. Figure S13: Comparison of the gene expression between the OE and TG and the OE and DRG.

Kapitel 4 Figure 1: Detection of weakly and highly expressed ORs with RNA-Seq Figure 2: Expression pattern of ectopically expressed ORs Figure 3: Pattern of expression of OR pseudogenes in different tissues Figure 4: Expression of ORs in testis

Abbildungsverzeichnis

Figure 5: Chimeric transcripts of different ectopically expressed ORs in various tissues Figure 6: Analysis of OR transcripts across tissues Figure 7: Validation of RNA-Seq results using RT-PCR Figure 8: Expression of signaling pathway components across tissues Figure 9: Expression of other chemosensors in human tissues Figure S1: Expression patterns of housekeeping genes in different tissues. Figure S2: Distribution of FPKM values in brain. Figure S3: Estimation of an expression threshold. Figure S4: Reliability of weakly expressed ORs (0.01–0.1 FPKM) in RNA-Seq data sets of testis. Figure S5: The sum of FPKM values of ORs per tissue. Figure S6: Correlation of FPKM values of ORs between thyroid-sequencing 1×75 bp single-read data versus 2×50 bp paired-end data. Figure S7: Validation of the Trim58/OR2W3 chimeric transcript by RT-PCR. Figure S8: OR13E1P is located within a cluster of highly expressed genes in brain tissue. Figure S9: Dependence of OR expression on the genomic neighborhood. Figure S12: Expression of the most highly ectopically expressed ORs in the human olfactory epithelium.

Kapitel 5 Figure 1: Olfactory receptors are expressed in the K562 cell line and in white blood cells of acute myeloid leukemia patients. Figure 2: Sandalore increases intracellular cAMP level. Figure 3: Sandalore increases intracellular Ca2+ concentration in K562. Figure 4: Sandalore activates the OR2AT4 and triggers an adenylate cyclase- PKA mediated signaling pathway. Figure 5: Summarized signaling amplitudes of the Sandalore. Figure 6: Sandalore increases the intracellular Ca2+ in white blood cells of AML-patients. Figure 7: Sandalore induces an Akt and p44/42-MAPK-phosphorylation and a decrease p38-MAPK-phosphorylation. Figure 8: p44/42-MAPK and Akt are activated by calmodulin. Figure 9: Sandalore decreases the K562 proliferation. Figure 10: Sandalore evokes apoptosis and activates caspase-3.

Abbildungsverzeichnis

Figure 11: p44/42-MAPK-phosphorylation is necessary for the Sandalore induced apoptosis. Figure 12: Sandalore enhances the hemoglobin synthesis in K562 cells and the amount of proerythrobasts. Figure S1: FPKM values for different Genes expressed in K562 Figure S2: Calcium-imaging experiments with different odorants

Kapitel 6 Abbildung 6: Zusammenfassung der OR2AT4 vermittelten Signalwege in K562.

Abkürzungsverzeichnis

AML akut myeloische Leukämie ATP Adenosintriphosphat cAMP zyklisches Adensosinmonophosphat CaCC calcium aktivated chloride channel Calcium-aktiverter Chloridkanal CaMKII Calmodulin aktiverende Kinase II cGMP zyklisches Guanosinmonophosphat CML chronische myeloische Leukämie CNG cyclic nucleotide-gated zyklisch Nukleotid-gesteuert DAG Diazylglyzerol DAPI 4′,6-Diamidin-2-phenylindol DRG dorsal root ganglia Dorsales Wurzel Ganglion ER Endoplasmatisches Retikulum ERK extracellular-signal regulated kinase extrazelluläre Signal-regulierte Kinase FPKM fragments per kilobase of transcript per. million mapped reads GPCR G-protein coupled receptor G-Protein gekoppelter Rezeptor GRK G-protein coupled receptor kinase G-Protein gekoppelte Rezeptorkinase IP3 Inositoltriphosphat JNK stress-activated phospho-kinase Stress-aktivierte phospho-Kinase MAPK mitogen-activated protein kinase mitogen-aktivierte Proteinkinase Mrgpr Mas-related G-protein coupled receptor OBP odorant binding protein Duftstoff bindendes Protein

Abkürzungsverzeichnis

OR olfactory receptor Riechrezeptor p38 Proteinkinase 38 p44/42 Proteinkinase 44/42 PIP3 Phosphatidyl-3,4,5-triphosphat PKA Proteinkinase A PKC Proteinkinase C PLC Phospholipase C RNA-Seq gesamt-Transkriptom-Shotgun-Sequenzierung RT-PCR reverse transcriptase – polymerase chain reaction Reverse Transkriptase Polymerase Kettenreaktion SAPK stress-activated phospho-kinase Stress-aktivierte phospho-Kinase SCN sodium channel, voltage gated TAAR trace amine-associated receptor TG trigeminal ganglia trigeminales Ganglion TRP transient receptor potential VGSC voltage gated sodium channel

Publikationsliste - Poster

Publikationsliste

Manuskripte publiziert:

Manteniotis S1, Lehmann R, Flegel C, Vogel F, Hofreuter A, Schreiner BS, Altmüller J, Becker C, Schöbel N, Hatt H, Gisselmann G. (2013) Comprehensive RNA-Seq analysis of sensory ganglia with a focus on ion channels and GPCRs in trigeminal ganglia. PLoS One, Vol. 8(11): e79523 doi:10.1371

Flegel C, Manteniotis S, Osthold S, Hatt H, Gisselmann G. (2013) Expression Profile of Ectopic Olfactory Receptors Determined by Deep Sequencing. PLoS One, Vol. 8(2): e55368 doi:10.1371

Manuskript in Vorbereitung:

Manteniotis S, Wojcik S, Brauhoff P, Petersen L, Neumann H, Schmiegel W, Dürig J, Dürsen C. Gisselmann G, Hatt H. (2015) Characterization of the ectopically expressed OR2AT4 in human myelogenous leukemia cells.(In Vorbereitung)

Poster

Manteniotis S1, Lehmann R, Flegel C, Vogel F, Hofreuter A, Schreiner BS, Altmüller J, Becker C, Schöbel N, Hatt H, Gisselmann G. (2013) Expression pattern of ion channels and GPCRs in trigeminal ganglia. (34rd Göttingen Neurobiology Conference, 10th Meeting of the German Neuroscience Society.). Abstract book, p. 346

Eigenanteil

Publikation “Comprehensive RNA-Seq analysis of sensory ganglia with a focus on ion channels and GPCRs in trigeminal ganglia.”

Projektplanung (P): 70 % Experimentelle Durchführung (E): 80 % Schreiben des Manuskriptes (M): 90 %

Abbildung 1 B - D: Ergebnisse stammen aus der Bachelorarbeit Hofreuter, 2013, modifiziert. Abbildung 4: Ergebnisse stammen teilweise aus der Bachelorarbeit Vogel und Hofreuter, 2013, modifiziert. Abbildung 8: Ergebnisse stammen teilweise aus der Bachelorarbeit Vogel und Hofreuter, 2013, modifiziert.

Publikation “Expression Profile of Ectopic Olfactory Receptors Determined by Deep Sequencing.”

Projektplanung (P): 10 % Experimentelle Durchführung (E): 10 % Schreiben des Manuskriptes (M): 5 %

Abbildung 7: Ergebnisse stammen teilweise aus der Masterarbeit Osthold, 2012, modifiziert. Abbildung S10: Ergebnisse stammen teilweise aus der Masterarbeit Osthold, 2012, modifiziert.

Publikation „Characterization of the ectopically expressed OR2AT4 in human myelogenous leukemia cells”

Projektplanung (P): 70 % Experimentelle Durchführung (E): 85 % Schreiben des Manuskriptes (M): 100 %

Abbildung 9: Ergebnisse stammen aus der Bachelorarbeit Brauhoff, 2014, modifiziert. Abbildung 10: Ergebnisse stammen teilweise aus der Bachelorarbeit Brauhoff, 2014, modifiziert.

Curriculum Vitae

persönliche Daten

Name Stavros Manteniotis Adresse Universitätsstraße 83 44789 Bochum E-Mail Adresse [email protected] Geburtsdatum 09.05.1982 Geburtsort Troisdorf Familienstand ledig Staatsangehörigkeit deutsch-griechisch Religion griechisch orthodox akademische Laufbahn

01/2003 Studium der Wirtschaftsinformatik an der Fachhochschule der Wirtschaft in Bergisch Gladbach

10/2003 Studium der Biologie an der Universität Vechta

10/2004 - 10/2007 Studium der Biologie an der Universität zu Köln mit dem Abschluss des Bachelor of Science Titel der Arbeit: „Charakterisierung des Rufverhaltens von Bombina orientalis“

10/2008 – 06/2011 Studium der Biologie an der Ruhr-Universität Bochum mit dem Abschluss des Master of Science Titel der Arbeit: „Elektrophysiologische Charakterisierung der Modulation von rekombinanten Liganden gesteuerten Ionenkanäle der Wirbeltiere durch Duftstoffe“

Curriculum Vitae

Seit 10/2011 Anfertigung der vorliegenden Dissertation am Lehrstuhl für Zellphysiologie bei Prof. Dr. Dr. Dr. Hatt mit dem Titel: „Expressionsanalyse von Chemorezeptoren und funktionale Charakterisierung des Riechrezeptors OR2AT4 in chronisch myeloischen Leukämiezellen“

März 2015 voraussichtliches Ende der Promotion mit dem Abschluss des Doctor Rerum Naturalium

schulische Laufbahn

10/1988 – 10/1992 Grundschule Hanftalstraße, Hennef 10/1992 – 10/2000 Städtisches Gymnasium Hennef 10/2000 – 06/2002 Siegtal Gymnasium Eitorf Abschluss: Abitur

Danksagung

Abschließend möchte ich mich bei allen bedanken, die zum Gelingen dieser Arbeit beigetragen haben.

Insbesondere danke ich meinem Doktorvater Herrn Prof. Dr. Dr. Dr. H. Hatt für die Überlassung des interessanten Themas, die Bereitstellung des Arbeitsplatzes, die wissenschaftliche Betreuung, Förderung und Motivation und für die kontinuierliche Unterstützung und offene Diskussionsbereitschaft während meiner gesamten Promotion.

Herrn PD Dr. M. Schmidt danke ich für das Interesse an dieser Arbeit und für die Übernahme des Koreferates.

Herrn Dr. G. Gisselmann danke ich für seine Hilfsbereitschaft, sein schnelles Korrekturlesen, seine Hilfe bei fachlichen Fragen und seine konstruktive Unterstützung bei der Durchführung dieser Arbeit, sowie für die Gespräche abseits jeglicher wissenschaftlicher Thematik.

Herrn Prof. Dr. med. Neumann danke ich für die Anregenden wissenschaftlichen Diskussionen.

Ich bedanke mich bei Herrn Prof. Dr. med. U. Dührsen, des Uniklinikums Essen für die gute Zusammenarbeit.

Auch möchte ich mich bei Herrn Prof. Dr. med. W. Schmiegel und Dr. L. Petersen des Knappschaftskrankenhaus in Langendreer für die gelungene Kooperation bedanken.

Ich danke Patrik Brauhoff, Sebastian Wojcik, Caroline Flegel, Felix Vogel, Adrian Hofreuter, Benjamin Schreiner Fanziska Mößler und Jasmin Gerkrath für die gute Zusammenarbeit im Labor.

Ulrike Thomes und Thomas Lichtleitner gilt mein großer Dank an die vielen administrativen Unterstützungen.

Ich danke meinen Freunden, insbesondere Jens Behley und Benjamin Lourier die mich seit klein auf durch mein Leben begleiten und mir immer gute Freunde waren. Auf euch ist immer verlass.

Ich danke meiner Freundin die mir stets zur Seite stand, Mut zugesprochen hat und niemals an mir gezweifelt hat. Danke Dir, Du bist mein Glück auf Erden.

Und nicht zuletzt danke ich meiner Mutter, meinem Vater und meinem Bruder, die mich während meines ganzen Lebens schon gefördert haben und die Grundsteine für meinen Weg gelegt hat. Ich liebe euch!

Literaturverzeichnis

Abaffy, Tatjana; Malhotra, Arun; Luetje, Charles W. (2007): The molecular basis for ligand specificity in a mouse olfactory receptor: a network of functionally important residues. In: J. Biol. Chem. 282 (2), S. 1216–1224. Ache, Barry W. (2010): Odorant-specific modes of signaling in mammalian olfaction. In: Chem. Senses 35 (7), S. 533–539. Adipietro, Kaylin A.; Mainland, Joel D.; Matsunami, Hiroaki (2012): Functional evolution of mammalian odorant receptors. In: PLoS Genet. 8 (7), S. e1002821. Ahmad, Sultan; Dahllund, Leif; Eriksson, Anders B.; Hellgren, Dennis; Karlsson, Urban; Lund, Per- Eric et al., (2007): A stop codon mutation in SCN9A causes lack of pain sensation. In: Hum. Mol. Genet. 16 (17), S. 2114–2121. Ahrens, Jörg; Demir, Reyhan; Leuwer, Martin; La Roche, Jeanne de; Krampfl, Klaus; Foadi, Nilufar et al., (2009): The nonpsychotropic cannabinoid cannabidiol modulates and directly activates alpha-1 and alpha-1-Beta glycine receptor function. In: Pharmacology 83 (4), S. 217–222. Akopian, A. N.; Sivilotti, L.; Wood, J. N. (1996): A tetrodotoxin-resistant voltage-gated sodium channel expressed by sensory neurons. In: Nature 379 (6562), S. 257–262. Albin, Kelly C.; Simons, Christopher T. (2010): Psychophysical evaluation of a sanshool derivative (alkylamide) and the elucidation of mechanisms subserving tingle. In: PLoS ONE 5 (3), S. e9520. Anafi, M.; Gazit, A.; Zehavi, A.; Ben-Neriah, Y.; Levitzki, A. (1993): Tyrphostin-induced inhibition of p210bcr-abl tyrosine kinase activity induces K562 to differentiate. In: Blood 82 (12), S. 3524–3529. Asai, H.; Kasai, H.; Matsuda, Y.; Yamazaki, N.; Nagawa, F.; Sakano, H.; Tsuboi, A. (1996): Genomic structure and transcription of a murine odorant receptor gene: differential initiation of transcription in the olfactory and testicular cells. In: Biochem. Biophys. Res. Commun. 221 (2), S. 240–247. Axel, R.; Buck, L. (2004): Odorant receptors and the organization of the olfactory system. In: Nobelprize.org Press Release 4 Oct. 2004. Baghaei, K.A. (2013). Large scale analysis of olfactory receptors with highly genetically variations in relation with specific anosmia. Bakalyar, H. A.; Reed, R. R. (1990): Identification of a specialized adenylyl cyclase that may mediate odorant detection. In: Science 250 (4986), S. 1403–1406. Balmanno, K.; Cook, S. J. (2009): Tumour cell survival signalling by the ERK1/2 pathway. In: Cell Death Differ. 16 (3), S. 368–377. Bautista, Diana M.; Siemens, Jan; Glazer, Joshua M.; Tsuruda, Pamela R.; Basbaum, Allan I.; Stucky, Cheryl L. et al., (2007): The menthol receptor TRPM8 is the principal detector of environmental cold. In: Nature 448 (7150), S. 204–208. Bautista, Diana M.; Sigal, Yaron M.; Milstein, Aaron D.; Garrison, Jennifer L.; Zorn, Julie A.; Tsuruda, Pamela R. et al., (2008a): Pungent agents from Szechuan peppers excite sensory neurons by inhibiting two-pore potassium channels. In: Nat. Neurosci. 11 (7), S. 772–779. Bautista, Diana M.; Sigal, Yaron M.; Milstein, Aaron D.; Garrison, Jennifer L.; Zorn, Julie A.; Tsuruda, Pamela R. et al., (2008b): Pungent agents from Szechuan peppers excite sensory neurons by inhibiting two-pore potassium channels. In: Nat. Neurosci. 11 (7), S. 772–779. Bautista, Diana; Julius, David (2008): Fire in the hole: pore dilation of the capsaicin receptor TRPV1. In: Nat. Neurosci. 11 (5), S. 528–529. Behbehani, M. M. (1995): Functional characteristics of the midbrain periaqueductal gray. In: Prog. Neurobiol. 46 (6), S. 575–605. 81

Literaturverzeichnis

Behbehani, M. M.; Park, M. R.; Clement, M. E. (1988): Interactions between the lateral hypothalamus and the periaqueductal gray. In: J. Neurosci. 8 (8), S. 2780–2787. Behrens, Maik; Foerster, Susann; Staehler, Frauke; Raguse, Jan-Dirk; Meyerhof, Wolfgang (2007): Gustatory expression pattern of the human TAS2R bitter receptor gene family reveals a heterogenous population of bitter responsive taste receptor cells. In: J. Neurosci. 27 (46), S. 12630–12640. Beltrán, Leopoldo R.; Dawid, Corinna; Beltrán, Madeline; Gisselmann, Guenter; Degenhardt, Katharina; Mathie, Klaus et al., (2013a): The pungent substances piperine, capsaicin, 6-gingerol and polygodial inhibit the human two-pore domain potassium channels TASK-1, TASK-3 and TRESK. In: Front Pharmacol 4, S. 141. Beltrán, Leopoldo; Beltrán, Madeline; Aguado, Ainhara; Gisselmann, Günter; Hatt, Hanns (2013b): 2- Aminoethoxydiphenyl borate activates the mechanically gated human KCNK channels KCNK 2 (TREK-1), KCNK 4 (TRAAK), and KCNK 10 (TREK-2). In: Front Pharmacol 4, S. 63. Ben-Arie, N.; Lancet, D.; Taylor, C.; Khen, M.; Walker, N.; Ledbetter, D. H. et al., (1994): Olfactory receptor gene cluster on human chromosome 17: possible duplication of an ancestral receptor repertoire. In: Hum. Mol. Genet. 3 (2), S. 229–235. Ben-Neriah, Y.; Bernards, A.; Paskind, M.; Daley, G. Q.; Baltimore, D. (1986): Alternative 5' exons in c-abl mRNA. In: Cell 44 (4), S. 577–586. Bertil Hille: ION CHANNELS OF EXCITABLE MEMBRANES . Bieri, Stephan; Monastyrskaia, Katherine; Schilling, Boris (2004): Olfactory receptor neuron profiling using sandalwood odorants. In: Chem. Senses 29 (6), S. 483–487. Bjarnadóttir, Thóra K.; Fredriksson, Robert; Höglund, Pär J.; Gloriam, David E.; Lagerström, Malin C.; Schiöth, Helgi B. (2004): The human and mouse repertoire of the adhesion family of G-protein-coupled receptors. In: Genomics 84 (1), S. 23–33. Bjarnadóttir, Thóra K.; Fredriksson, Robert; Schiöth, Helgi B. (2005): The gene repertoire and the common evolutionary history of glutamate, pheromone (V2R), taste(1) and other related G protein- coupled receptors. In: Gene 362, S. 70–84. Bjarnadóttir, Thóra K.; Gloriam, David E.; Hellstrand, Sofia H.; Kristiansson, Helena; Fredriksson, Robert; Schiöth, Helgi B. (2006): Comprehensive repertoire and phylogenetic analysis of the G protein- coupled receptors in human and mouse. In: Genomics 88 (3), S. 263–273. Borowsky, B.; Adham, N.; Jones, K. A.; Raddatz, R.; Artymyshyn, R.; Ogozalek, K. L. et al., (2001): Trace amines: identification of a family of mammalian G protein-coupled receptors. In: Proc. Natl. Acad. Sci. U.S.A. 98 (16), S. 8966–8971. Bradham, Cynthia; McClay, David R. (2006): p38 MAPK in development and cancer. In: Cell Cycle 5 (8), S. 824–828. Bradshaw, Heather B.; Lee, Sung Ha; McHugh, Douglas (2009): Orphan endogenous lipids and orphan GPCRs: a good match. In: Prostaglandins Other Lipid Mediat. 89 (3-4), S. 131–134. Brand, Gérard (2006): Olfactory/trigeminal interactions in nasal chemoreception. In: Neurosci Biobehav Rev 30 (7), S. 908–917. Branscomb, A.; Seger, J.; White, R. L. (2000): Evolution of odorant receptors expressed in mammalian testes. In: Genetics 156 (2), S. 785–797. Braun, Thomas; Voland, Petra; Kunz, Lars; Prinz, Christian; Gratzl, Manfred (2007): Enterochromaffin cells of the human gut: sensors for spices and odorants. In: Gastroenterology 132 (5), S. 1890–1901. Brocke, Constanze; Eh, Marcus; Finke, Anja (2008): Recent developments in the chemistry of sandalwood odorants. In: Chem. Biodivers. 5 (6), S. 1000–1010. Broeck, J. V. (2001): Insect G protein-coupled receptors and signal transduction. In: Arch. Insect Biochem. Physiol. 48 (1), S. 1–12.

Literaturverzeichnis

Brooks, Ian M.; Tavalin, Steven J. (2011): Ca2+/calmodulin-dependent protein kinase II inhibitors disrupt AKAP79-dependent PKC signaling to GluA1 AMPA receptors. In: J. Biol. Chem. 286 (8), S. 6697–6706. Brózik, A.; Casey, N. P.; Hegedus, Cs; Bors, A.; Kozma, A.; Andrikovics, H. et al., (2006): Reduction of Bcr-Abl function leads to erythroid differentiation of K562 cells via downregulation of ERK. In: Ann. N. Y. Acad. Sci. 1090, S. 344–354. Bryant, B. P.; Mezine, I. (1999): Alkylamides that produce tingling paresthesia activate tactile and thermal trigeminal neurons. In: Brain Res. 842 (2), S. 452–460. Buck, L.; Axel, R. (1991): A novel multigene family may encode odorant receptors: a molecular basis for odor recognition. In: Cell 65 (1), S. 175–187. Bushdid, C.; Magnasco, M. O.; Vosshall, L. B.; Keller, A. (2014): Humans can discriminate more than 1 trillion olfactory stimuli. In: Science 343 (6177), S. 1370–1372. Busse, Daniela; Kudella, Philipp; Grüning, Nana-Maria; Gisselmann, Günter; Ständer, Sonja; Luger, Thomas et al., (2014): A Synthetic Sandalwood Odorant Induces Wound-Healing Processes in Human Keratinocytes via the Olfactory Receptor OR2AT4. In: J. Invest. Dermatol. Cain, W. S.; Murphy, C. L. (1980): Interaction between chemoreceptive modalities of odour and irritation. In: Nature 284 (5753), S. 255–257. Cairns, B. E.; McErlane, S. A.; Fragoso, M. C.; Jia, W. G.; Soja, P. J. (1996): Spontaneous discharge and peripherally evoked orofacial responses of trigemino-thalamic tract neurons during wakefulness and sleep. In: J. Neurosci. 16 (24), S. 8149–8159. Carlson, Kaitlin S.; Xia, Christina Z.; Wesson, Daniel W. (2013): Encoding and representation of intranasal CO2 in the mouse olfactory cortex. In: J. Neurosci. 33 (34), S. 13873–13881. Caterina, M. J.; Julius, D. (2001): The vanilloid receptor: a molecular gateway to the pain pathway. In: Annu. Rev. Neurosci. 24, S. 487–517. Caterina, M. J.; Leffler, A.; Malmberg, A. B.; Martin, W. J.; Trafton, J.; Petersen-Zeitz, K. R. et al., (2000): Impaired nociception and pain sensation in mice lacking the capsaicin receptor. In: Science 288 (5464), S. 306–313. Caterina, M. J.; Schumacher, M. A.; Tominaga, M.; Rosen, T. A.; Levine, J. D.; Julius, D. (1997): The capsaicin receptor: a heat-activated ion channel in the pain pathway. In: Nature 389 (6653), S. 816–824. Catterall, W. A. (2000): From ionic currents to molecular mechanisms: the structure and function of voltage-gated sodium channels. In: Neuron 26 (1), S. 13–25. Chen, G.; Way, J.; Armour, S.; Watson, C.; Queen, K.; Jayawickreme, C. K. et al., (2000): Use of constitutive G protein-coupled receptor activity for drug discovery. In: Mol. Pharmacol. 57 (1), S. 125– 134. Cheng, Kwong-Tai; Chan, Franky Leung; Huang, Yu; Chan, Wing-Yee; Yao, Xiaoqiang (2003): Expression of olfactory-type cyclic nucleotide-gated channel (CNGA2) in vascular tissues. In: Histochem. Cell Biol. 120 (6), S. 475–481. Chen, Jinhua; Wang, Wenfang; Wang, Hongyuan; Liu, Xinyong; Guo, Xiuli (2014a): Combination treatment of ligustrazine piperazine derivate DLJ14 and adriamycin inhibits progression of resistant breast cancer through inhibition of the EGFR/PI3K/Akt survival pathway and induction of apoptosis. In: Drug Discov Ther 8 (1), S. 33–41. Chen, Yangxi; Zhang, Li; Yang, Jingwen; Zhang, Lu; Chen, Zhi (2014b): LPS-induced dental pulp inflammation increases expression of ionotropic purinergic receptors in rat trigeminal ganglion. In: Neuroreport 25 (13), S. 991–997. Chevy, Quentin; Klingler, Esther (2014): Odorless trigeminal stimulus CO2 triggers response in the olfactory cortex. In: J. Neurosci. 34 (2), S. 341–342.

Literaturverzeichnis

Chiou, Lih-Chu; Lee, Hsin-Jung; Ho, Yu-Cheng; Chen, Shih-Pin; Liao, Yan-Yu; Ma, Chia-Hau et al., (2010): Orexins/hypocretins: pain regulation and cellular actions. In: Curr. Pharm. Des. 16 (28), S. 3089–3100. Chiu, I. M.; Touhalisky, K.; Baran, C. (2001): Multiple controlling mechanisms of FGF1 gene expression through multiple tissue-specific promoters. In: Prog. Nucleic Acid Res. Mol. Biol. 70, S. 155– 174. Ci, Weimin; Li, Wenyu; Ke, Ya; Qian, Zhong-Ming; Shen, Xun (2003): Intracellular Ca(2+) regulates the cellular iron uptake in K562 cells. In: Cell Calcium 33 (4), S. 257–266. Clapham, David E. (2007): Calcium signaling. In: Cell 131 (6), S. 1047–1058. Cobos, A.; Lima, D.; Almeida, A.; Tavares, I. (2003): Brain afferents to the lateral caudal ventrolateral medulla: a retrograde and anterograde tracing study in the rat. In: Neuroscience 120 (2), S. 485–498. Colbran, Roger J.; Brown, Abigail M. (2004): Calcium/calmodulin-dependent protein kinase II and synaptic plasticity. In: Curr. Opin. Neurobiol. 14 (3), S. 318–327. Conzelmann, S.; Levai, O.; Bode, B.; Eisel, U.; Raming, K.; Breer, H.; Strotmann, J. (2000): A novel brain receptor is expressed in a distinct population of olfactory sensory neurons. In: Eur. J. Neurosci. 12 (11), S. 3926–3934. Cosi, Cristina; Mannaioni, Guido; Cozzi, Andrea; Carlà, Vincenzo; Sili, Maria; Cavone, Leonardo et al., (2011): G-protein coupled receptor 35 (GPR35) activation and inflammatory pain: Studies on the antinociceptive effects of kynurenic acid and zaprinast. In: Neuropharmacology 60 (7-8), S. 1227–1231. Costigan, Michael; Scholz, Joachim; Woolf, Clifford J. (2009): Neuropathic pain: a maladaptive response of the nervous system to damage. In: Annu. Rev. Neurosci. 32, S. 1–32. Coticchia, Christine M.; Revankar, Chetana M.; Deb, Tushar B.; Dickson, Robert B.; Johnson, Michael D. (2009): Calmodulin modulates Akt activity in human breast cancer cell lines. In: Breast Cancer Res. Treat. 115 (3), S. 545–560. Coughlin, Shaun R.; Camerer, Eric (2003): PARticipation in inflammation. In: J. Clin. Invest. 111 (1), S. 25–27. Cox, James J.; Reimann, Frank; Nicholas, Adeline K.; Thornton, Gemma; Roberts, Emma; Springell, Kelly et al., (2006): An SCN9A channelopathy causes congenital inability to experience pain. In: Nature 444 (7121), S. 894–898. Croy, Ilona; Schulz, Max; Blumrich, Anna; Hummel, Cornelia; Gerber, Johannes; Hummel, Thomas (2014): Human olfactory lateralization requires trigeminal activation. In: Neuroimage 98, S. 289–295. Daiber, Philipp; Genovese, Federica; Schriever, Valentin A.; Hummel, Thomas; Möhrlen, Frank; Frings, Stephan (2013): Neuropeptide receptors provide a signalling pathway for trigeminal modulation of olfactory transduction. In: Eur. J. Neurosci. 37 (4), S. 572–582. Damann, Nils; Voets, Thomas; Nilius, Bernd (2008): TRPs in our senses. In: Curr. Biol. 18 (18), S. R880-9. Damasio, Antonio (2005): Human behaviour: brain trust. In: Nature 435 (7042), S. 571–572. DAMESHEK, W. (1951): Some speculations on the myeloproliferative syndromes. In: Blood 6 (4), S. 372–375. Daniela Busse (2013): OIfaktorische Rezeptoren in humanen Keratinozyten-. Molekulare Mechanismen und physiologische Bedeutung. Ruhr-Universiätt Bochum. Darian-Smith J. (1973): The trigeminal system. In Iggo A (Ed). Handbook of sensory physiology. Berlin: Springer. Dhallan, R. S.; Yau, K. W.; Schrader, K. A.; Reed, R. R. (1990): Primary structure and functional expression of a cyclic nucleotide-activated channel from olfactory neurons. In: Nature 347 (6289), S. 184–187. 84

Literaturverzeichnis

Dhillon, A. S.; Hagan, S.; Rath, O.; Kolch, W. (2007): MAP kinase signalling pathways in cancer. In: Oncogene 26 (22), S. 3279–3290. Dib-Hajj, Sulayman D.; Cummins, Theodore R.; Black, Joel A.; Waxman, Stephen G. (2010): Sodium channels in normal and pathological pain. In: Annu. Rev. Neurosci. 33, S. 325–347. Dineley-Miller, K.; Patrick, J. (1992): Gene transcripts for the nicotinic acetylcholine receptor subunit, beta4, are distributed in multiple areas of the rat central nervous system. In: Brain Res. Mol. Brain Res. 16 (3-4), S. 339–344. Dong, Chen; Davis, Roger J.; Flavell, Richard A. (2002): MAP kinases in the immune response. In: Annu. Rev. Immunol. 20, S. 55–72. Dong, X.; Han, S.; Zylka, M. J.; Simon, M. I.; Anderson, D. J. (2001): A diverse family of GPCRs expressed in specific subsets of nociceptive sensory neurons. In: Cell 106 (5), S. 619–632. Doszczak, Leszek; Kraft, Philip; Weber, Hans-Peter; Bertermann, Rüdiger; Triller, Annika; Hatt, Hanns; Tacke, Reinhold (2007): Prediction of perception: probing the hOR17-4 olfactory receptor model with silicon analogues of bourgeonal and lilial. In: Angew. Chem. Int. Ed. Engl. 46 (18), S. 3367– 3371. Doty, R. L.; Brugger, W. E.; Jurs, P. C.; Orndorff, M. A.; Snyder, P. J.; Lowry, L. D. (1978): Intranasal trigeminal stimulation from odorous volatiles: psychometric responses from anosmic and normal humans. In: Physiol. Behav. 20 (2), S. 175–185. Dumka, Disha; Puri, Poonam; Carayol, Nathalie; Lumby, Crystal; Balachandran, Harikrishnan; Schuster, Katja et al., (2009): Activation of the p38 Map kinase pathway is essential for the antileukemic effects of dasatinib. In: Leuk. Lymphoma 50 (12), S. 2017–2029. Durzyński, Lukasz; Gaudin, Jean-Charles; Myga, Magdalena; Szydłowski, Jarosław; Goździcka- Józefiak, Anna; Haertlé, Thomas (2005): Olfactory-like receptor cDNAs are present in human lingual cDNA libraries. In: Biochem. Biophys. Res. Commun. 333 (1), S. 264–272. Feingold, E. A.; Penny, L. A.; Nienhuis, A. W.; Forget, B. G. (1999): An olfactory receptor gene is located in the extended human beta-globin gene cluster and is expressed in erythroid cells. In: Genomics 61 (1), S. 15–23. Feldmesser, Ester; Olender, Tsviya; Khen, Miriam; Yanai, Itai; Ophir, Ron; Lancet, Doron (2006): Widespread ectopic expression of olfactory receptor genes. In: BMC Genomics 7, S. 121. Firestein, S. (2001): How the olfactory system makes sense of scents. In: Nature 413 (6852), S. 211– 218. Flegel, Caroline; Manteniotis, Stavros; Osthold, Sandra; Hatt, Hanns; Gisselmann, Günter (2013): Expression profile of ectopic olfactory receptors determined by deep sequencing. In: PLoS ONE 8 (2), S. e55368. Fredriksson, Robert; Lagerström, Malin C.; Lundin, Lars-Gustav; Schiöth, Helgi B. (2003): The G- protein-coupled receptors in the human genome form five main families. Phylogenetic analysis, paralogon groups, and fingerprints. In: Mol. Pharmacol. 63 (6), S. 1256–1272. Fredriksson, Robert; Schiöth, Helgi B. (2005): The repertoire of G-protein-coupled receptors in fully sequenced genomes. In: Mol. Pharmacol. 67 (5), S. 1414–1425. Freshney, N. W.; Rawlinson, L.; Guesdon, F.; Jones, E.; Cowley, S.; Hsuan, J.; Saklatvala, J. (1994): Interleukin-1 activates a novel protein kinase cascade that results in the phosphorylation of Hsp27. In: Cell 78 (6), S. 1039–1049. Frings, S.; Seifert, R.; Godde, M.; Kaupp, U. B. (1995): Profoundly different calcium permeation and blockage determine the specific function of distinct cyclic nucleotide-gated channels. In: Neuron 15 (1), S. 169–179. Fuchs, T.; Glusman, G.; Horn-Saban, S.; Lancet, D.; Pilpel, Y. (2001): The human olfactory subgenome: from sequence to structure and evolution. In: Hum. Genet. 108 (1), S. 1–13. 85

Literaturverzeichnis

Fujita, Yoshifumi; Takahashi, Tomoko; Suzuki, Akiko; Kawashima, Kayo; Nara, Futoshi; Koishi, Ryuta (2007): Deorphanization of Dresden G protein-coupled receptor for an odorant receptor. In: J. Recept. Signal Transduct. Res. 27 (4), S. 323–334. Gakamsky, Anna; Armon, Leah; Eisenbach, Michael (2009): Behavioral response of human spermatozoa to a concentration jump of chemoattractants or intracellular cyclic nucleotides. In: Hum. Reprod. 24 (5), S. 1152–1163. Gambacorti-Passerini, C.; Le Coutre, P.; Mologni, L.; Fanelli, M.; Bertazzoli, C.; Marchesi, E. et al., (1997): Inhibition of the ABL kinase activity blocks the proliferation of BCR/ABL+ leukemic cells and induces apoptosis. In: Blood Cells Mol. Dis. 23 (3), S. 380–394. Gat, U.; Nekrasova, E.; Lancet, D.; Natochin, M. (1994): Olfactory receptor proteins. Expression, characterization and partial purification. In: Eur. J. Biochem. 225 (3), S. 1157–1168. Gaudin, J. C.; Breuils, L.; Haertlé, T. (2001): New GPCRs from a human lingual cDNA library. In: Chem. Senses 26 (9), S. 1157–1166. Gelis, Lian; Wolf, Steffen; Hatt, Hanns; Neuhaus, Eva M.; Gerwert, Klaus (2012): Prediction of a ligand-binding niche within a human olfactory receptor by combining site-directed mutagenesis with dynamic homology modeling. In: Angew. Chem. Int. Ed. Engl. 51 (5), S. 1274–1278. George, Susan R.; O'Dowd, Brian F.; Lee, Samuel P. (2002): G-protein-coupled receptor oligomerization and its potential for drug discovery. In: Nat Rev Drug Discov 1 (10), S. 808–820. Gerhold, Kristin A.; Bautista, Diana M. (2009): Molecular and cellular mechanisms of trigeminal chemosensation. In: Ann. N. Y. Acad. Sci. 1170, S. 184–189. Gingeras, Thomas R. (2009): Implications of chimaeric non-co-linear transcripts. In: Nature 461 (7261), S. 206–211. Glusman, G.; Yanai, I.; Rubin, I.; Lancet, D. (2001): The complete human olfactory subgenome. In: Genome Res. 11 (5), S. 685–702. Godfrey, Paul A.; Malnic, Bettina; Buck, Linda B. (2004): The mouse olfactory receptor gene family. In: Proc. Natl. Acad. Sci. U.S.A. 101 (7), S. 2156–2161. Goldberg, Gary S.; Valiunas, Virginijus; Brink, Peter R. (2004): Selective permeability of gap junction channels. In: Biochim. Biophys. Acta 1662 (1-2), S. 96–101. Goldstein, S. A.; Bockenhauer, D.; O'Kelly, I.; Zilberberg, N. (2001): Potassium leak channels and the KCNK family of two-P-domain subunits. In: Nat. Rev. Neurosci. 2 (3), S. 175–184. Gudziol, H.; Schubert, M.; Hummel, T. (2001): Decreased trigeminal sensitivity in anosmia. In: ORL J. Otorhinolaryngol. Relat. Spec. 63 (2), S. 72–75. Haeseler, G.; Maue, D.; Grosskreutz, J.; Bufler, J.; Nentwig, B.; Piepenbrock, S. et al., (2002): Voltage- dependent block of neuronal and skeletal muscle sodium channels by thymol and menthol. In: Eur J Anaesthesiol 19 (8), S. 571–579. Haitina, Tatjana; Fredriksson, Robert; Foord, Steven M.; Schiöth, Helgi B.; Gloriam, David E. (2009): The G protein-coupled receptor subset of the dog genome is more similar to that in humans than rodents. In: BMC Genomics 10, S. 24. Han, Ihn; Yun, Miyong; Kim, Eun-Ok; Kim, Bonglee; Jung, Min-Hyung; Kim, Sung-Hoon (2014): Umbilical cord tissue-derived mesenchymal stem cells induce apoptosis in PC-3 prostate cancer cells through activation of JNK and downregulation of PI3K/AKT signaling. In: Stem Cell Res Ther 5 (2), S. 54. Han, J.; Lee, J. D.; Bibbs, L.; Ulevitch, R. J. (1994): A MAP kinase targeted by endotoxin and hyperosmolarity in mammalian cells. In: Science 265 (5173), S. 808–811. Hao, Jizhe; Padilla, Françoise; Dandonneau, Mathieu; Lavebratt, Catharina; Lesage, Florian; Noël, Jacques; Delmas, Patrick (2013): Kv1.1 channels act as mechanical brake in the senses of touch and pain. In: Neuron 77 (5), S. 899–914. 86

Literaturverzeichnis

Hatakeyama, Shigetsugu (2011): TRIM proteins and cancer. In: Nat. Rev. Cancer 11 (11), S. 792–804. Hatt, Hanns (2004): Molecular and cellular basis of human olfaction. In: Chem. Biodivers. 1 (12), S. 1857–1869. Hausdorff, W. P.; Lohse, M. J.; Bouvier, M.; Liggett, S. B.; Caron, M. G.; Lefkowitz, R. J. (1990): Two kinases mediate agonist-dependent phosphorylation and desensitization of the beta 2-adrenergic receptor. In: Symp. Soc. Exp. Biol. 44, S. 225–240. Heidenreich, K. A.; Kummer, J. L. (1996): Inhibition of p38 mitogen-activated protein kinase by insulin in cultured fetal neurons. In: J. Biol. Chem. 271 (17), S. 9891–9894. Hermann, D. M.; Luppi, P. H.; Peyron, C.; Hinckel, P.; Jouvet, M. (1997): Afferent projections to the rat nuclei raphe magnus, raphe pallidus and reticularis gigantocellularis pars alpha demonstrated by iontophoretic application of choleratoxin (subunit b). In: J. Chem. Neuroanat. 13 (1), S. 1–21. Hochhaus A., Müller M. C. Hehlmann R. (2002): Diagnostik und Therapie der chronischen myelotischen Leukämie. HODGKIN, A. L.; HUXLEY, A. F. (1952): A quantitative description of membrane current and its application to conduction and excitation in nerve. In: J. Physiol. (Lond.) 117 (4), S. 500–544. Huang, Cai; Jacobson, Ken; Schaller, Michael D. (2004): MAP kinases and cell migration. In: J. Cell. Sci. 117 (Pt 20), S. 4619–4628. Huang, Dongyue; Li, Shuyang; Dhaka, Ajay; Story, Gina M.; Cao, Yu-Qing (2012): Expression of the transient receptor potential channels TRPV1, TRPA1 and TRPM8 in mouse trigeminal primary afferent neurons innervating the dura. In: Mol Pain 8, S. 66. Hummel, Thomas; Livermore, Andrew (2002): Intranasal chemosensory function of the trigeminal nerve and aspects of its relation to olfaction. In: Int Arch Occup Environ Health 75 (5), S. 305–313. Hynes, Nancy E.; MacDonald, Gwen (2009): ErbB receptors and signaling pathways in cancer. In: Curr. Opin. Cell Biol. 21 (2), S. 177–184. Ichimaru, M.; Tomonaga, M.; Amenomori, T.; Matsuo, T. (1991): Atomic bomb and leukemia. In: J. Radiat. Res. 32, S. 162–167. Illumina (2011): RNA-Seq Data Comparison Gene Expression Microarrays. A cross platform comparison of differential gene expression analysis. White Paper. Itakura, S.; Ohno, K.; Ueki, T.; Sato, K.; Kanayama, N. (2006): Expression of Golf in the rat placenta: Possible implication in olfactory receptor transduction. In: Placenta 27 (1), S. 103–108. Jacobs, A. (1989): Benzene and leukaemia. In: Br. J. Haematol. 72 (2), S. 119–121. Jones, D. T.; Reed, R. R. (1989): Golf: an olfactory neuron specific-G protein involved in odorant signal transduction. In: Science 244 (4906), S. 790–795. Jordt, Sven-Eric; Bautista, Diana M.; Chuang, Huai-Hu; McKemy, David D.; Zygmunt, Peter M.; Högestätt, Edward D. et al., (2004): Mustard oils and cannabinoids excite sensory nerve fibres through the TRP channel ANKTM1. In: Nature 427 (6971), S. 260–265. Julius, D.; Basbaum, A. I. (2001): Molecular mechanisms of nociception. In: Nature 413 (6852), S. 203– 210. Kajiwara, Aya; Tsuchiya, Yukihiro; Takata, Tsuyoshi; Nyunoya, Mayumi; Nozaki, Naohito; Ihara, Hideshi; Watanabe, Yasuo (2013): Nitric oxide enhances increase in cytosolic Ca(2+) and promotes nicotine-triggered MAPK pathway in PC12 cells. In: Nitric Oxide 34, S. 3–9. Kajiya, K.; Inaki, K.; Tanaka, M.; Haga, T.; Kataoka, H.; Touhara, K. (2001): Molecular bases of odor discrimination: Reconstitution of olfactory receptors that recognize overlapping sets of odorants. In: J. Neurosci. 21 (16), S. 6018–6025. Kambhampati, Suman (2009): p38 in chronic myelogenous leukemia: a target and a possible biomarker. In: Leuk. Lymphoma 50 (12), S. 1909–1910. 87

Literaturverzeichnis

Kamp, T. J.; Hell, J. W. (2000): Regulation of cardiac L-type calcium channels by protein kinase A and protein kinase C. In: Circ. Res. 87 (12), S. 1095–1102. Kaneko, H.; Nakamura, T.; Lindemann, B. (2001): Noninvasive measurement of chloride concentration in rat olfactory receptor cells with use of a fluorescent dye. In: Am. J. Physiol., Cell Physiol. 280 (6), S. C1387-93. Kaneko, Hiroshi; Putzier, Ilva; Frings, Stephan; Kaupp, U. Benjamin; Gensch, Thomas (2004): Chloride accumulation in mammalian olfactory sensory neurons. In: J. Neurosci. 24 (36), S. 7931–7938. Kang, C. D.; Yoo, S. D.; Hwang, B. W.; Kim, K. W.; Kim, D. W.; Kim, C. M. et al., (2000): The inhibition of ERK/MAPK not the activation of JNK/SAPK is primarily required to induce apoptosis in chronic myelogenous leukemic K562 cells. In: Leuk. Res. 24 (6), S. 527–534. Kang, NaNa; Koo, JaeHyung (2012): Olfactory receptors in non-chemosensory tissues. In: BMB Rep 45 (11), S. 612–622. Katada, Sayako; Hirokawa, Takatsugu; Oka, Yuki; Suwa, Makiko; Touhara, Kazushige (2005): Structural basis for a broad but selective ligand spectrum of a mouse olfactory receptor: mapping the odorant-binding site. In: J. Neurosci. 25 (7), S. 1806–1815. Kato, Aya; Reisert, Johannes; Ihara, Sayoko; Yoshikawa, Keiichi; Touhara, Kazushige (2014): Evaluation of the role of g protein-coupled receptor kinase 3 in desensitization of mouse odorant receptors in a Mammalian cell line and in olfactory sensory neurons. In: Chem. Senses 39 (9), S. 771– 780. Kato, Shigeki; Matsubara, Mitsunobu; Matsuo, Tsuyoshi; Mohri, Yasuaki; Kazama, Itsuro; Hatano, Ryo et al., (2006): Leucine-rich repeat-containing G protein-coupled receptor-4 (LGR4, Gpr48) is essential for renal development in mice. In: Nephron Exp. Nephrol. 104 (2), S. e63-75. Keller, Andreas; Zhuang, Hanyi; Chi, Qiuyi; Vosshall, Leslie B.; Matsunami, Hiroaki (2007): Genetic variation in a human odorant receptor alters odour perception. In: Nature 449 (7161), S. 468–472. Kerr, Daniel S.; Dannecker, Luiz Eduardo C. von; Davalos, Marcela; Michaloski, Jussara S.; Malnic, Bettina (2008): Ric-8B interacts with G alpha olf and G gamma 13 and co-localizes with G alpha olf, G beta 1 and G gamma 13 in the cilia of olfactory sensory neurons. In: Mol. Cell. Neurosci. 38 (3), S. 341– 348. Keydar, Ifat; Ben-Asher, Edna; Feldmesser, Ester; Nativ, Noam; Oshimoto, Arisa; Restrepo, Diego et al., (2012): General Olfactory Sensitivity Database (GOSdb): Candidate Genes and their Genomic Variations. In: Hum. Mutat. Khaw-on, Patompong; Banjerdpongchai, Ratana (2012): Induction of intrinsic and extrinsic apoptosis pathways in the human leukemic MOLT-4 cell line by terpinen-4-ol. In: Asian Pac. J. Cancer Prev. 13 (7), S. 3073–3076. Klasen, K.; Corey, E. A.; Kuck, F.; Wetzel, C. H.; Hatt, H.; Ache, B. W. (2010): Odorant-stimulated phosphoinositide signaling in mammalian olfactory receptor neurons. In: Cell. Signal. 22 (1), S. 150– 157. Klee, C. B.; Vanaman, T. C. (1982): Calmodulin. In: Adv. Protein Chem. 35, S. 213–321. Kleene, S. J.; Gesteland, R. C. (1991): Calcium-activated chloride conductance in frog olfactory cilia. In: J. Neurosci. 11 (11), S. 3624–3629. Klein, E.; Ben-Bassat, H.; Neumann, H.; Ralph, P.; Zeuthen, J.; Polliack, A.; Vánky, F. (1976): Properties of the K562 cell line, derived from a patient with chronic myeloid leukemia. In: Int. J. Cancer 18 (4), S. 421–431. Kohli, Utkarsh; Grayson, Britney L.; Aune, Thomas M.; Ghimire, Laxmi V.; Kurnik, Daniel; Stein, C. Michael (2009): Change in mRNA Expression after Atenolol, a Beta-adrenergic Receptor Antagonist and Association with Pharmacological Response. In: Arch Drug Inf 2 (3), S. 41–50.

Literaturverzeichnis

Kohmura, Kanoko; Miyakawa, Yoshitaka; Kawai, Yoko; Ikeda, Yasuo; Kizaki, Masahiro (2004): Different roles of p38 MAPK and ERK in STI571-induced multi-lineage differentiation of K562 cells. In: J. Cell. Physiol. 198 (3), S. 370–376. Kortenjann, M.; Thomae, O.; Shaw, P. E. (1994): Inhibition of v-raf-dependent c-fos expression and transformation by a kinase-defective mutant of the mitogen-activated protein kinase Erk2. In: Mol. Cell. Biol. 14 (7), S. 4815–4824. Krautwurst, D.; Yau, K. W.; Reed, R. R. (1998): Identification of ligands for olfactory receptors by functional expression of a receptor library. In: Cell 95 (7), S. 917–926. Kretsinger, R. H.; Rudnick, S. E.; Sneden, D. A.; Schatz, V. B. (1980): Calmodulin, S-100, and crayfish sarcoplasmic calcium-binding protein crystals suitable for X-ray diffraction studies. In: J. Biol. Chem. 255 (17), S. 8154–8156. Krukoff, T. L.; Harris, K. H.; Jhamandas, J. H. (1993): Efferent projections from the parabrachial nucleus demonstrated with the anterograde tracer Phaseolus vulgaris leucoagglutinin. In: Brain Res. Bull. 30 (1-2), S. 163–172. Krupnick, J. G.; Benovic, J. L. (1998): The role of receptor kinases and arrestins in G protein-coupled receptor regulation. In: Annu. Rev. Pharmacol. Toxicol. 38, S. 289–319. Kurahashi, T.; Yau, K. W. (1993): Co-existence of cationic and chloride components in odorant-induced current of vertebrate olfactory receptor cells. In: Nature 363 (6424), S. 71–74. Kuroda, Hidetaka; Shibukawa, Yoshiyuki; Soya, Manabu; Masamura, Aya; Kasahara, Masataka; Tazaki, Masakazu; Ichinohe, Tatsuya (2012): Expression of P2X₁ and P2X₄ receptors in rat trigeminal ganglion neurons. In: Neuroreport 23 (13), S. 752–756. Kushida, N.; Kabuyama, Y.; Yamaguchi, O.; Homma, Y. (2001): Essential role for extracellular Ca(2+) in JNK activation by mechanical stretch in bladder smooth muscle cells. In: Am. J. Physiol., Cell Physiol. 281 (4), S. C1165-72. La Cruz, Omar de; Blekhman, Ran; Zhang, Xiaohong; Nicolae, Dan; Firestein, Stuart; Gilad, Yoav (2009): A signature of evolutionary constraint on a subset of ectopically expressed olfactory receptor genes. In: Mol. Biol. Evol. 26 (3), S. 491–494. Laska, M.; Distel, H.; Hudson, R. (1997): Trigeminal perception of odorant quality in congenitally anosmic subjects. In: Chem. Senses 22 (4), S. 447–456. Lawrence, Michael S.; Stojanov, Petar; Polak, Paz; Kryukov, Gregory V.; Cibulskis, Kristian; Sivachenko, Andrey et al., (2013): Mutational heterogeneity in cancer and the search for new cancer- associated genes. In: Nature 499 (7457), S. 214–218. Lazarov, Nikolai E. (2002): Comparative analysis of the chemical neuroanatomy of the mammalian trigeminal ganglion and mesencephalic trigeminal nucleus. In: Prog. Neurobiol. 66 (1), S. 19–59. Lazarov, Nikolai E. (2007): Neurobiology of orofacial proprioception. In: Brain Res Rev 56 (2), S. 362– 383. Lee, S. A.; Park, J. K.; Kang, E. K.; Bae, H. R.; Bae, K. W.; Park, H. T. (2000): Calmodulin-dependent activation of p38 and p42/44 mitogen-activated protein kinases contributes to c-fos expression by calcium in PC12 cells: modulation by nitric oxide. In: Brain Res. Mol. Brain Res. 75 (1), S. 16–24. Leja, Justyna; Essaghir, Ahmed; Essand, Magnus; Wester, Kenneth; Oberg, Kjell; Tötterman, Thomas H. et al., (2009): Novel markers for enterochromaffin cells and gastrointestinal neuroendocrine carcinomas. In: Mod. Pathol. 22 (2), S. 261–272. Lennertz, Richard C.; Tsunozaki, Makoto; Bautista, Diana M.; Stucky, Cheryl L. (2010): Physiological basis of tingling paresthesia evoked by hydroxy-alpha-sanshool. In: J. Neurosci. 30 (12), S. 4353–4361. L'Espérance, Sylvain; Bachvarova, Magdalena; Tetu, Bernard; Mes-Masson, Anne-Marie; Bachvarov, Dimcho (2008): Global gene expression analysis of early response to chemotherapy treatment in ovarian cancer spheroids. In: BMC Genomics 9, S. 99. 89

Literaturverzeichnis

Li, David Wan-Cheng; Liu, Jin-Ping; Mao, Ying-Wei; Xiang, Hua; Wang, Juan; Ma, Wei-Ya et al., (2005): Calcium-activated RAF/MEK/ERK signaling pathway mediates p53-dependent apoptosis and is abrogated by alpha B-crystallin through inhibition of RAS activation. In: Mol. Biol. Cell 16 (9), S. 4437–4453. Li, Hui; Ko, Chun Hay; Tsang, Suk Ying; Leung, Ping Chung; Fung, Ming Chui; Fung, Kwok Pui (2011): The Ethanol Extract of Fructus trichosanthis Promotes Fetal Hemoglobin Production via p38 MAPK Activation and ERK Inactivation in K562 Cells. In: Evid Based Complement Alternat Med 2011, S. 657056. Li, Hui; Wang, Jinglan; Ma, Xianyong; Sklar, Jeffrey (2009): Gene fusions and RNA trans-splicing in normal and neoplastic human cells. In: Cell Cycle 8 (2), S. 218–222. Liman, E. R.; Buck, L. B. (1994): A second subunit of the olfactory cyclic nucleotide-gated channel confers high sensitivity to cAMP. In: Neuron 13 (3), S. 611–621. Li, Na; Lu, Zhan-ying; Yu, Li-hua; Burnstock, Geoffrey; Deng, Xiao-ming; Ma, Bei (2014): Inhibition of G protein-coupled P2Y2 receptor induced analgesia in a rat model of trigeminal neuropathic pain. In: Mol Pain 10, S. 21. Liu, L.; Simon, S. A. (1994): A rapid capsaicin-activated current in rat trigeminal ganglion neurons. In: Proc. Natl. Acad. Sci. U.S.A. 91 (2), S. 738–741. Liu, Qin; Tang, Zongxiang; Surdenikova, Lenka; Kim, Seungil; Patel, Kush N.; Kim, Andrew et al., (2009): Sensory neuron-specific GPCR Mrgprs are itch receptors mediating chloroquine-induced pruritus. In: Cell 139 (7), S. 1353–1365. Lossin, Christoph; Wang, Dao W.; Rhodes, Thomas H.; Vanoye, Carlos G.; George, Alfred L. (2002): Molecular basis of an inherited epilepsy. In: Neuron 34 (6), S. 877–884. Lozzio, C. B.; Lozzio, B. B. (1975): Human chronic myelogenous leukemia cell-line with positive Philadelphia chromosome. In: Blood 45 (3), S. 321–334. Lübbert, Matthias; Kyereme, Jessica; Schöbel, Nicole; Beltrán, Leopoldo; Wetzel, Christian Horst; Hatt, Hanns (2013): Transient receptor potential channels encode volatile chemicals sensed by rat trigeminal ganglion neurons. In: PLoS ONE 8 (10), S. e77998. Lundstrom, Kenneth (2005): The future of G protein-coupled receptors as targets in drug discovery. In: IDrugs 8 (11), S. 909–913. Macpherson, Lindsey J.; Dubin, Adrienne E.; Evans, Michael J.; Marr, Felix; Schultz, Peter G.; Cravatt, Benjamin F.; Patapoutian, Ardem (2007): Noxious compounds activate TRPA1 ion channels through covalent modification of cysteines. In: Nature 445 (7127), S. 541–545. Maingret, F.; Lauritzen, I.; Patel, A. J.; Heurteaux, C.; Reyes, R.; Lesage, F. et al., (2000): TREK-1 is a heat-activated background K(+) channel. In: EMBO J. 19 (11), S. 2483–2491. Mainland, Joel D.; Keller, Andreas; Li, Yun R.; Zhou, Ting; Trimmer, Casey; Snyder, Lindsey L. et al., (2014): The missense of smell: functional variability in the human odorant receptor repertoire. In: Nat. Neurosci. 17 (1), S. 114–120. Malnic, B.; Hirono, J.; Sato, T.; Buck, L. B. (1999): Combinatorial receptor codes for odors. In: Cell 96 (5), S. 713–723. Manning, Gerard (2005): Genomic overview of protein kinases. In: WormBook, S. 1–19. Manteniotis, Stavros; Lehmann, Ramona; Flegel, Caroline; Vogel, Felix; Hofreuter, Adrian; Schreiner, Benjamin S. P. et al., (2013): Comprehensive RNA-Seq expression analysis of sensory ganglia with a focus on ion channels and GPCRs in Trigeminal ganglia. In: PLoS ONE 8 (11), S. e79523. Marshall, C. J. (1994): MAP kinase kinase kinase, MAP kinase kinase and MAP kinase. In: Curr. Opin. Genet. Dev. 4 (1), S. 82–89.

Literaturverzeichnis

Maßberg, Désirée; Simon, Annika; Häussinger, Dieter; Keitel, Verena; Gisselmann, Günter; Conrad, Heike; Hatt, Hanns (2014): Monoterpene (-)-citronellal affects hepatocarcinoma cell signaling via an olfactory receptor. In: Arch. Biochem. Biophys. McCubrey, James A.; Lahair, Michelle M.; Franklin, Richard A. (2006): Reactive oxygen species- induced activation of the MAP kinase signaling pathways. In: Antioxid. Redox Signal. 8 (9-10), S. 1775– 1789. McKemy, David D.; Neuhausser, Werner M.; Julius, David (2002): Identification of a cold receptor reveals a general role for TRP channels in thermosensation. In: Nature 416 (6876), S. 52–58. Melzack, R.; Wall, P. D. (1965): Pain mechanisms: a new theory. In: Science 150 (3699), S. 971–979. Meng, I. D.; Hu, J. W.; Bereiter, D. A. (2000): Parabrachial area and nucleus raphe magnus inhibition of corneal units in rostral and caudal portions of trigeminal subnucleus caudalis in the rat. In: Pain 87 (3), S. 241–251. Meşe, Gülistan; Richard, Gabriele; White, Thomas W. (2007): Gap junctions: basic structure and function. In: J. Invest. Dermatol. 127 (11), S. 2516–2524. Miyawaki, A.; Matsushita, F.; Ryo, Y.; Mikoshiba, K. (1994): Possible pheromone-carrier function of two lipocalin proteins in the vomeronasal organ. In: EMBO J. 13 (24), S. 5835–5842. Mizushima, T.; Obata, K.; Katsura, H.; Yamanaka, H.; Kobayashi, K.; Dai, Y. et al., (2006): Noxious cold stimulation induces mitogen-activated protein kinase activation in transient receptor potential (TRP) channels TRPA1- and TRPM8-containing small sensory neurons. In: Neuroscience 140 (4), S. 1337–1348. Mombaerts, Peter (2004): Genes and ligands for odorant, vomeronasal and taste receptors. In: Nat. Rev. Neurosci. 5 (4), S. 263–278. Monaco, Sara; Rusciano, Maria Rosaria; Maione, Angela S.; Soprano, Maria; Gomathinayagam, Rohini; Todd, Lance R. et al., (2014): A novel crosstalk between calcium/calmodulin kinases II and IV regulates cell proliferation in myeloid leukemia cells. In: Cell. Signal. 27 (2), S. 204–214. Mortazavi, Ali; Williams, Brian A.; McCue, Kenneth; Schaeffer, Lorian; Wold, Barbara (2008): Mapping and quantifying mammalian transcriptomes by RNA-Seq. In: Nat. Methods 5 (7), S. 621–628. Munns, Clare; AlQatari, Mona; Koltzenburg, Martin (2007): Many cold sensitive peripheral neurons of the mouse do not express TRPM8 or TRPA1. In: Cell Calcium 41 (4), S. 331–342. Muranen, Taru A.; Greco, Dario; Fagerholm, Rainer; Kilpivaara, Outi; Kämpjärvi, Kati; Aittomäki, Kristiina et al., (2011): Breast tumors from CHEK2 1100delC-mutation carriers: genomic landscape and clinical implications. In: Breast Cancer Res. 13 (5), S. R90. Murray, Katherine C.; Stephens, Marilee J.; Rank, Michelle; D'Amico, Jessica; Gorassini, Monica A.; Bennett, David J. (2011): Polysynaptic excitatory postsynaptic potentials that trigger spasms after spinal cord injury in rats are inhibited by 5-HT1B and 5-HT1F receptors. In: J. Neurophysiol. 106 (2), S. 925– 943. Nagahara, Hisashi; Mimori, Koshi; Ohta, Mitsuhiko; Utsunomiya, Tohru; Inoue, Hiroshi; Barnard, Graham F. et al., (2005): Somatic mutations of epidermal growth factor receptor in colorectal carcinoma. In: Clin. Cancer Res. 11 (4), S. 1368–1371. Nagalakshmi, Ugrappa; Wang, Zhong; Waern, Karl; Shou, Chong; Raha, Debasish; Gerstein, Mark; Snyder, Michael (2008): The transcriptional landscape of the yeast genome defined by RNA sequencing. In: Science 320 (5881), S. 1344–1349. Nagata, Y.; Moriguchi, T.; Nishida, E.; Todokoro, K. (1997): Activation of p38 MAP kinase pathway by erythropoietin and interleukin-3. In: Blood 90 (3), S. 929–934. Nakamura, T.; Gold, G. H. (1987): A cyclic nucleotide-gated conductance in olfactory receptor cilia. In: Nature 325 (6103), S. 442–444.

Literaturverzeichnis

Neuhaus, Eva M.; Zhang, Weiyi; Gelis, Lian; Deng, Ying; Noldus, Joachim; Hatt, Hanns (2009): Activation of an olfactory receptor inhibits proliferation of prostate cancer cells. In: J. Biol. Chem. 284 (24), S. 16218–16225. Newton, A. C. (1995): Protein kinase C: structure, function, and regulation. In: J. Biol. Chem. 270 (48), S. 28495–28498. Newton, Alexandra C. (2003): Regulation of the ABC kinases by phosphorylation: protein kinase C as a paradigm. In: Biochem. J. 370 (Pt 2), S. 361–371. Nyholt, Dale R.; LaForge, K. Steven; Kallela, Mikko; Alakurtti, Kirsi; Anttila, Verneri; Färkkilä, Markus et al., (2008): A high-density association screen of 155 ion transport genes for involvement with common migraine. In: Hum. Mol. Genet. 17 (21), S. 3318–3331. Oakley, R. H.; Laporte, S. A.; Holt, J. A.; Barak, L. S.; Caron, M. G. (2001): Molecular determinants underlying the formation of stable intracellular G protein-coupled receptor-beta-arrestin complexes after receptor endocytosis*. In: J. Biol. Chem. 276 (22), S. 19452–19460. Oberdisse (Hg.) (2002): Pharmakologie und Toxikologie. Mit 155 Tabellen. Springer-Lehrbuch. 3rd ED. Berlin: Springer (XXXVI,839). O'Brien, Susan; Radich, Jerald P.; Abboud, Camille N.; Akhtari, Mojtaba; Altman, Jessica K.; Berman, Ellin et al., (2014): Chronic myelogenous leukemia, version 1.2015. In: J Natl Compr Canc Netw 12 (11), S. 1590–1610. Oka, Yuki; Omura, Masayo; Kataoka, Hiroshi; Touhara, Kazushige (2004): Olfactory receptor antagonism between odorants. In: EMBO J. 23 (1), S. 120–126. Okazaki, K.; Ishikawa, T.; Inui, M.; Tada, M.; Goshima, K.; Okamoto, T.; Hidaka, H. (1994): KN-62, a specific Ca++/calmodulin-dependent protein kinase inhibitor, reversibly depresses the rate of beating of cultured fetal mouse cardiac myocytes. In: J. Pharmacol. Exp. Ther. 270 (3), S. 1319–1324. Ørom, Ulf Andersson; Derrien, Thomas; Beringer, Malte; Gumireddy, Kiranmai; Gardini, Alessandro; Bussotti, Giovanni et al., (2010): Long noncoding RNAs with enhancer-like function in human cells. In: Cell 143 (1), S. 46–58. Otaki, Joji M.; Yamamoto, Haruhiko; Firestein, Stuart (2004): Odorant receptor expression in the mouse cerebral cortex. In: J. Neurobiol. 58 (3), S. 315–327. Overington, John P.; Al-Lazikani, Bissan; Hopkins, Andrew L. (2006): How many drug targets are there? In: Nat Rev Drug Discov 5 (12), S. 993–996. Pagès, G.; Lenormand, P.; L'Allemain, G.; Chambard, J. C.; Meloche, S.; Pouysségur, J. (1993): Mitogen-activated protein kinases p42mapk and p44mapk are required for fibroblast proliferation. In: Proc. Natl. Acad. Sci. U.S.A. 90 (18), S. 8319–8323. Palandri, Francesca; Castagnetti, Fausto; Alimena, Giuliana; Testoni, Nicoletta; Breccia, Massimo; Luatti, Simona et al., (2009): The long-term durability of cytogenetic responses in patients with accelerated phase chronic myeloid leukemia treated with imatinib 600 mg: the GIMEMA CML Working Party experience after a 7-year follow-up. In: Haematologica 94 (2), S. 205–212. Park, Yu-Kyoung; Do, Young Rok; Jang, Byeong-Churl (2012): Apoptosis of K562 leukemia cells by Abnobaviscum F®, a European mistletoe extract. In: Oncol. Rep. 28 (6), S. 2227–2232. Parmentier, M.; Libert, F.; Schurmans, S.; Schiffmann, S.; Lefort, A.; Eggerickx, D. et al., (1992): Expression of members of the putative olfactory receptor gene family in mammalian germ cells. In: Nature 355 (6359), S. 453–455. Patapoutian, Ardem; Peier, Andrea M.; Story, Gina M.; Viswanath, Veena (2003): ThermoTRP channels and beyond: mechanisms of temperature sensation. In: Nat. Rev. Neurosci. 4 (7), S. 529–539. Peier, Andrea M.; Moqrich, Aziz; Hergarden, Anne C.; Reeve, Alison J.; Andersson, David A.; Story, Gina M. et al., (2002): A TRP channel that senses cold stimuli and menthol. In: Cell 108 (5), S. 705– 715. 92

Literaturverzeichnis

Pereira, Monica Farah; Martino, Thiago; Dalmau, Sergio Ranto; Albano, Rodolfo Mattos; Férézou, Jean-Pierre; Costa, Sonia Soares et al., (2011): Terpenic subfraction of Pterodon pubescens induces apoptosis of K562 leukemic cells by modulating gene expression. In: Oncol. Rep. 25 (1), S. 215–221. Pfeuffer, E.; Mollner, S.; Lancet, D.; Pfeuffer, T. (1989): Olfactory adenylyl cyclase. Identification and purification of a novel enzyme form. In: J. Biol. Chem. 264 (31), S. 18803–18807. Pierce, Kristen L.; Premont, Richard T.; Lefkowitz, Robert J. (2002): Seven-transmembrane receptors. In: Nat. Rev. Mol. Cell Biol. 3 (9), S. 639–650. Pifferi, Simone; Pascarella, Giovanni; Boccaccio, Anna; Mazzatenta, Andrea; Gustincich, Stefano; Menini, Anna; Zucchelli, Silvia (2006): Bestrophin-2 is a candidate calcium-activated chloride channel involved in olfactory transduction. In: Proc. Natl. Acad. Sci. U.S.A. 103 (34), S. 12929–12934. Pilpel, Y.; Lancet, D. (1999): The variable and conserved interfaces of modeled olfactory receptor proteins. In: Protein Sci. 8 (5), S. 969–977. Pitcher, J. A.; Freedman, N. J.; Lefkowitz, R. J. (1998): G protein-coupled receptor kinases. In: Annu. Rev. Biochem. 67, S. 653–692. Pluznick, Jennifer L.; Protzko, Ryan J.; Gevorgyan, Haykanush; Peterlin, Zita; Sipos, Arnold; Han, Jinah et al., (2013): Olfactory receptor responding to gut microbiota-derived signals plays a role in renin secretion and blood pressure regulation. In: Proc. Natl. Acad. Sci. U.S.A. 110 (11), S. 4410–4415. Prakash, O.; Yunis, J. J. (1984): High resolution chromosomes of the t(9;22) positive leukemias. In: Cancer Genet. Cytogenet. 11 (4), S. 361–367. Price, T. J.; Helesic, G.; Parghi, D.; Hargreaves, K. M.; Flores, C. M. (2003): The neuronal distribution of cannabinoid receptor type 1 in the trigeminal ganglion of the rat. In: Neuroscience 120 (1), S. 155– 162. Pronin, Alexey; Levay, Konstantin; Velmeshev, Dmitry; Faghihi, Mohammad; Shestopalov, Valery I.; Slepak, Vladlen Z. (2014): Expression of olfactory signaling genes in the eye. In: PLoS ONE 9 (4), S. e96435. Raming, K.; Konzelmann, S.; Breer, H. (1998): Identification of a novel G-protein coupled receptor expressed in distinct brain regions and a defined olfactory zone. In: Recept. Channels 6 (2), S. 141–151. Randolph, Tim R. (2005): Chronic myelocytic leukemia--Part I: History, clinical presentation, and molecular biology. In: Clin Lab Sci 18 (1), S. 38–48. Raouf, Ramin; Quick, Kathryn; Wood, John N. (2010): Pain as a channelopathy. In: J. Clin. Invest. 120 (11), S. 3745–3752. Rasche, Sebastian; Toetter, Bastian; Adler, Jenny; Tschapek, Astrid; Doerner, Julia F.; Kurtenbach, Stefan et al., (2010): Tmem16b is specifically expressed in the cilia of olfactory sensory neurons. In: Chem. Senses 35 (3), S. 239–245. Rau, Kristofer K.; McIlwrath, Sabrina L.; Wang, Hong; Lawson, Jeffrey J.; Jankowski, Michael P.; Zylka, Mark J. et al., (2009): Mrgprd enhances excitability in specific populations of cutaneous murine polymodal nociceptors. In: J. Neurosci. 29 (26), S. 8612–8619. Regard, Jean B.; Sato, Isaac T.; Coughlin, Shaun R. (2008): Anatomical profiling of G protein-coupled receptor expression. In: Cell 135 (3), S. 561–571. Reilly, Christopher A.; Taylor, Jack L.; Lanza, Diane L.; Carr, Brian A.; Crouch, Dennis J.; Yost, Garold S. (2003): Capsaicinoids cause inflammation and epithelial cell death through activation of vanilloid receptors. In: Toxicol. Sci. 73 (1), S. 170–181. Reisert, Johannes; Bauer, Paul J.; Yau, King-Wai; Frings, Stephan (2003): The Ca-activated Cl channel and its control in rat olfactory receptor neurons. In: J. Gen. Physiol. 122 (3), S. 349–363. Reisert, Johannes; Lai, Jun; Yau, King-Wai; Bradley, Jonathan (2005): Mechanism of the excitatory Cl- response in mouse olfactory receptor neurons. In: Neuron 45 (4), S. 553–561.

Literaturverzeichnis

Restrepo, D.; Okada, Y.; Teeter, J. H. (1993): Odorant-regulated Ca2+ gradients in rat olfactory neurons. In: J. Gen. Physiol. 102 (5), S. 907–924. Riera, C. E.; Menozzi-Smarrito, C.; Affolter, M.; Michlig, S.; Munari, C.; Robert, F. et al., (2009): Compounds from Sichuan and Melegueta peppers activate, covalently and non-covalently, TRPA1 and TRPV1 channels. In: Br. J. Pharmacol. 157 (8), S. 1398–1409. Rizvi, T. A.; Ennis, M.; Behbehani, M. M.; Shipley, M. T. (1991): Connections between the central nucleus of the amygdala and the midbrain periaqueductal gray: topography and reciprocity. In: J. Comp. Neurol. 303 (1), S. 121–131. Rosengart, M. R.; Arbabi, S.; Garcia, I.; Maier, R. V. (2000): Interactions of calcium/calmodulin- dependent protein kinases (CaMK) and extracellular-regulated kinase (ERK) in monocyte adherence and TNFalpha production. In: Shock 13 (3), S. 183–189. Rothermel, Markus; Ng, Benedict Shien Wei; Grabska-Barwińska, Agnieszka; Hatt, Hanns; Jancke, Dirk (2011): Nasal chemosensory-stimulation evoked activity patterns in the rat trigeminal ganglion visualized by in vivo voltage-sensitive dye imaging. In: PLoS ONE 6 (10), S. e26158. Rouse, J.; Cohen, P.; Trigon, S.; Morange, M.; Alonso-Llamazares, A.; Zamanillo, D. et al., (1994): A novel kinase cascade triggered by stress and heat shock that stimulates MAPKAP kinase-2 and phosphorylation of the small heat shock proteins. In: Cell 78 (6), S. 1027–1037. Rutherford, T.; Clegg, J. B.; Higgs, D. R.; Jones, R. W.; Thompson, J.; Weatherall, D. J. (1981): Embryonic erythroid differentiation in the human leukemic cell line K562. In: Proc. Natl. Acad. Sci. U.S.A. 78 (1), S. 348–352. Sabharwal, R. K.; Gupta, M.; Sharma, D.; Mehndiratta, M. M.; Anjaneyulu, A. (1990): Hemiplegic migraine. In: J Assoc Physicians India 38 (3), S. 227–228. Saito, Harumi; Chi, Qiuyi; Zhuang, Hanyi; Matsunami, Hiroaki; Mainland, Joel D. (2009): Odor coding by a Mammalian receptor repertoire. In: Sci Signal 2 (60), S. ra9. Salomon, D.; Saurat, J. H.; Meda, P. (1988): Cell-to-cell communication within intact human skin. In: J. Clin. Invest. 82 (1), S. 248–254. Sanz, Guenhaël; Leray, Isabelle; Dewaele, Aurélie; Sobilo, Julien; Lerondel, Stéphanie; Bouet, Stéphan et al., (2014): Promotion of cancer cell invasiveness and metastasis emergence caused by olfactory receptor stimulation. In: PLoS ONE 9 (1), S. e85110. Sanz, Guenhaël; Schlegel, Claire; Pernollet, Jean-Claude; Briand, Loïc (2005): Comparison of odorant specificity of two human olfactory receptors from different phylogenetic classes and evidence for antagonism. In: Chem. Senses 30 (1), S. 69–80. Sasaki, D.; Kosunago, S.; Mikami, T.; Matsumoto, T.; Suzuki, M. (1994): Growth-inhibition by hemin in K562 human leukemic cells is related to hemoglobin-producing activity. In: Biol. Pharm. Bull. 17 (5), S. 586–590. Sautter, A.; Zong, X.; Hofmann, F.; Biel, M. (1998): An isoform of the rod photoreceptor cyclic nucleotide-gated channel beta subunit expressed in olfactory neurons. In: Proc. Natl. Acad. Sci. U.S.A. 95 (8), S. 4696–4701. Sawafuji, Kanoko; Miyakawa, Yoshitaka; Kizaki, Masahiro; Ikeda, Yasuo (2003): Cyclosporin A induces erythroid differentiation of K562 cells through p38 MAPK and ERK pathways. In: Am. J. Hematol. 72 (1), S. 67–69. Schaeffer, H. J.; Weber, M. J. (1999): Mitogen-activated protein kinases: specific messages from ubiquitous messengers. In: Mol. Cell. Biol. 19 (4), S. 2435–2444. Schmiedeberg, Kristin; Shirokova, Elena; Weber, Hans-Peter; Schilling, Boris; Meyerhof, Wolfgang; Krautwurst, Dietmar (2007): Structural determinants of odorant recognition by the human olfactory receptors OR1A1 and OR1A2. In: J. Struct. Biol. 159 (3), S. 400–412.

Literaturverzeichnis

Sekizawa, S. I.; Tsubone, H. (1994): Nasal receptors responding to noxious chemical irritants. In: Respir Physiol 96 (1), S. 37–48. Sergeev, Igor N. (2005): Calcium signaling in cancer and vitamin D. In: J. Steroid Biochem. Mol. Biol. 97 (1-2), S. 145–151. Sergeev, Igor N.; Li, Shiming; Colby, Julie; Ho, Chi-Tang; Dushenkov, Slavik (2006): Polymethoxylated flavones induce Ca(2+)-mediated apoptosis in breast cancer cells. In: Life Sci. 80 (3), S. 245–253. Shinohara, Tokuyuki; Harada, Masataka; Ogi, Kazuhiro; Maruyama, Minoru; Fujii, Ryo; Tanaka, Hideyuki et al., (2004): Identification of a G protein-coupled receptor specifically responsive to beta- alanine. In: J. Biol. Chem. 279 (22), S. 23559–23564. Shi, P.; Zhang, J. (2009): Extraordinary diversity of chemosensory receptor gene repertoires among vertebrates. In: Results Probl Cell Differ 47, S. 1–23. Shirokova, Elena; Schmiedeberg, Kristin; Bedner, Peter; Niessen, Heiner; Willecke, Klaus; Raguse, Jan- Dirk et al., (2005): Identification of specific ligands for orphan olfactory receptors. G protein-dependent agonism and antagonism of odorants. In: J. Biol. Chem. 280 (12), S. 11807–11815. Shi, Yu; Gaestel, Matthias (2002): In the cellular garden of forking paths: how p38 MAPKs signal for downstream assistance. In: Biol. Chem. 383 (10), S. 1519–1536. Si, Jutong; Collins, Steven J. (2008): Activated Ca2+/calmodulin-dependent protein kinase IIgamma is a critical regulator of myeloid leukemia cell proliferation. In: Cancer Res. 68 (10), S. 3733–3742. Silver, W. L.; Farley, L. G.; Finger, T. E. (1991): The effects of neonatal capsaicin administration on trigeminal nerve chemoreceptors in the rat nasal cavity. In: Brain Res. 561 (2), S. 212–216. So, I.; Chae, M. R.; Kim, S. J.; Lee, S. W. (2005): Lysophosphatidylcholine, a component of atherogenic lipoproteins, induces the change of calcium mobilization via TRPC ion channels in cultured human corporal smooth muscle cells. In: Int. J. Impot. Res. 17 (6), S. 475–483. Sondersorg, Anna Christina; Busse, Daniela; Kyereme, Jessica; Rothermel, Markus; Neufang, Gitta; Gisselmann, Günter et al., (2014): Chemosensory information processing between keratinocytes and trigeminal neurons. In: J. Biol. Chem. 289 (25), S. 17529–17540. Spehr, Jennifer; Gelis, Lian; Osterloh, Markus; Oberland, Sonja; Hatt, Hanns; Spehr, Marc; Neuhaus, Eva M. (2011): G protein-coupled receptor signaling via Src kinase induces endogenous human transient receptor potential vanilloid type 6 (TRPV6) channel activation. In: J. Biol. Chem. 286 (15), S. 13184– 13192. Spehr, Marc; Gisselmann, Gunter; Poplawski, Alexandra; Riffell, Jeffrey A.; Wetzel, Christian H.; Zimmer, Richard K.; Hatt, Hanns (2003): Identification of a testicular odorant receptor mediating human sperm chemotaxis. In: Science 299 (5615), S. 2054–2058. Staaf, Susanne; Oerther, Sandra; Lucas, Guilherme; Mattsson, Jan P.; Ernfors, Patrik (2009): Differential regulation of TRP channels in a rat model of neuropathic pain. In: Pain 144 (1-2), S. 187– 199. Stevens, F. C. (1983): Calmodulin: an introduction. In: Can. J. Biochem. Cell Biol. 61 (8), S. 906–910. Strickland, Iain T.; Martindale, Jo C.; Woodhams, Peter L.; Reeve, Alison J.; Chessell, Iain P.; McQueen, Daniel S. (2008): Changes in the expression of NaV1.7, NaV1.8 and NaV1.9 in a distinct population of dorsal root ganglia innervating the rat knee joint in a model of chronic inflammatory joint pain. In: Eur J Pain 12 (5), S. 564–572. Sweeney, G.; Somwar, R.; Ramlal, T.; Volchuk, A.; Ueyama, A.; Klip, A. (1999): An inhibitor of p38 mitogen-activated protein kinase prevents insulin-stimulated glucose transport but not glucose transporter translocation in 3T3-L1 adipocytes and L6 myotubes. In: J. Biol. Chem. 274 (15), S. 10071– 10078.

Literaturverzeichnis

Taniguchi, Yasuhito; Tonai-Kachi, Hiroko; Shinjo, Katsuhiro (2006): Zaprinast, a well-known cyclic guanosine monophosphate-specific phosphodiesterase inhibitor, is an agonist for GPR35. In: FEBS Lett. 580 (21), S. 5003–5008. Tareilus, E.; Noé, J.; Breer, H. (1995): Calcium signals in olfactory neurons. In: Biochim. Biophys. Acta 1269 (2), S. 129–138. Thoppil, Roslin J.; Bishayee, Anupam (2011): Terpenoids as potential chemopreventive and therapeutic agents in liver cancer. In: World J Hepatol 3 (9), S. 228–249. Thüraüf, N.; Gjuric, M.; Kobal, G.; Hatt, H. (1996): Cyclic nucleotide-gated channels in identified human olfactory receptor neurons. In: Eur. J. Neurosci. 8 (10), S. 2080–2089. Tilney, F. (1930): Headache and Migraine. In: Bull N Y Acad Med 6 (2), S. 69–88. Tominaga, M.; Caterina, M. J.; Malmberg, A. B.; Rosen, T. A.; Gilbert, H.; Skinner, K. et al., (1998): The cloned capsaicin receptor integrates multiple pain-producing stimuli. In: Neuron 21 (3), S. 531– 543. Tominaga, Makoto; Caterina, Michael J. (2004): Thermosensation and pain. In: J. Neurobiol. 61 (1), S. 3–12. Torii, Satoru; Yamamoto, Takuya; Tsuchiya, Yoshiki; Nishida, Eisuke (2006): ERK MAP kinase in G cell cycle progression and cancer. In: Cancer Sci. 97 (8), S. 697–702. Torre, V.; Ashmore, J. F.; Lamb, T. D.; Menini, A. (1995): Transduction and adaptation in sensory receptor cells. In: J. Neurosci. 15 (12), S. 7757–7768. Tsutsui, M.; Yanagihara, N.; Fukunaga, K.; Minami, K.; Nakashima, Y.; Kuroiwa, A. et al., (1996): Ca(2+)/calmodulin-dependent protein kinase II inhibitor KN-62 inhibits adrenal medullary chromaffin cell functions independent of its action on the kinase. In: J. Neurochem. 66 (6), S. 2517–2522. Vanderhaeghen, P.; Schurmans, S.; Vassart, G.; Parmentier, M. (1997a): Molecular cloning and chromosomal mapping of olfactory receptor genes expressed in the male germ line: evidence for their wide distribution in the human genome. In: Biochem. Biophys. Res. Commun. 237 (2), S. 283–287. Vanderhaeghen, P.; Schurmans, S.; Vassart, G.; Parmentier, M. (1997b): Specific repertoire of olfactory receptor genes in the male germ cells of several mammalian species. In: Genomics 39 (3), S. 239–246. Vandewauw, Ine; Owsianik, Grzegorz; Voets, Thomas (2013): Systematic and quantitative mRNA expression analysis of TRP channel genes at the single trigeminal and dorsal root ganglion level in mouse. In: BMC Neurosci 14, S. 21. Vassilatis, Demetrios K.; Hohmann, John G.; Zeng, Hongkui; Li, Fusheng; Ranchalis, Jane E.; Mortrud, Marty T. et al., (2003): The G protein-coupled receptor repertoires of human and mouse. In: Proc. Natl. Acad. Sci. U.S.A. 100 (8), S. 4903–4908. Veitinger, Thomas; Riffell, Jeffrey R.; Veitinger, Sophie; Nascimento, Jaclyn M.; Triller, Annika; Chandsawangbhuwana, Charlie et al., (2011): Chemosensory Ca2+ dynamics correlate with diverse behavioral phenotypes in human sperm. In: J. Biol. Chem. 286 (19), S. 17311–17325. Verbeurgt, Christophe; Wilkin, Françoise; Tarabichi, Maxime; Gregoire, Françoise; Dumont, Jacques E.; Chatelain, Pierre (2014): Profiling of olfactory receptor gene expression in whole human olfactory mucosa. In: PLoS ONE 9 (5), S. e96333. Viana, Félix (2011): Chemosensory properties of the trigeminal system. In: ACS Chem Neurosci 2 (1), S. 38–50. Vieira, C. R.; Marques, M. F.; Soares, P. R.; Matuda, L.; Oliveira, C. M. A. de; Kato, L. et al., (2008): Antiproliferative activity of Pterodon pubescens Benth. seed oil and its active principle on human melanoma cells. In: Phytomedicine 15 (6-7), S. 528–532. Voets, Thomas; Droogmans, Guy; Wissenbach, Ulrich; Janssens, Annelies; Flockerzi, Veit; Nilius, Bernd (2004): The principle of temperature-dependent gating in cold- and heat-sensitive TRP channels. In: Nature 430 (7001), S. 748–754. 96

Literaturverzeichnis

Volz, Armin; Ehlers, Anke; Younger, Ruth; Forbes, Simon; Trowsdale, John; Schnorr, Dietmar et al., (2003): Complex transcription and splicing of odorant receptor genes. In: J. Biol. Chem. 278 (22), S. 19691–19701. Vrontou, Sophia; Wong, Allan M.; Rau, Kristofer K.; Koerber, H. Richard; Anderson, David J. (2013): Genetic identification of C fibres that detect massage-like stroking of hairy skin in vivo. In: Nature 493 (7434), S. 669–673. Wagner, Erwin F.; Nebreda, Angel R. (2009): Signal integration by JNK and p38 MAPK pathways in cancer development. In: Nat. Rev. Cancer 9 (8), S. 537–549. Walensky, L. D.; Ruat, M.; Bakin, R. E.; Blackshaw, S.; Ronnett, G. V.; Snyder, S. H. (1998): Two novel odorant receptor families expressed in spermatids undergo 5'-splicing. In: J. Biol. Chem. 273 (16), S. 9378–9387. Wang, C. L.; Ng, T. B.; Cao, X. H.; Jiang, Y.; Liu, Z. K.; Wen, T. Y.; Liu, F. (2009): CLP induces apoptosis in human leukemia K562 cells through Ca(2+) regulating extracellular-related protein kinase ERK activation. In: Cancer Lett. 276 (2), S. 221–227. Wang, Eric T.; Sandberg, Rickard; Luo, Shujun; Khrebtukova, Irina; Zhang, Lu; Mayr, Christine et al., (2008): Alternative isoform regulation in human tissue transcriptomes. In: Nature 456 (7221), S. 470– 476. Wang, Wei; Atianjoh, Fidelis; Gauda, Estelle B.; Yaster, Myron; Li, Yunqing; Tao, Yuan-Xiang (2011): Increased expression of sodium channel subunit Nav1.1 in the injured dorsal root ganglion after peripheral nerve injury. In: Anat Rec (Hoboken) 294 (8), S. 1406–1411. Wang, X.; Martindale, J. L.; Holbrook, N. J. (2000): Requirement for ERK activation in cisplatin- induced apoptosis. In: J. Biol. Chem. 275 (50), S. 39435–39443. Watt, W. C.; Storm, D. R. (2001): Odorants stimulate the ERK/mitogen-activated protein kinase pathway and activate cAMP-response element-mediated transcription in olfactory sensory neurons. In: J. Biol. Chem. 276 (3), S. 2047–2052. Webb, B. L.; Hirst, S. J.; Giembycz, M. A. (2000): Protein kinase C isoenzymes: a review of their structure, regulation and role in regulating airways smooth muscle tone and mitogenesis. In: Br. J. Pharmacol. 130 (7), S. 1433–1452. Weber, Martina; Pehl, Ulrich; Breer, Heinz; Strotmann, Jörg (2002): Olfactory receptor expressed in ganglia of the autonomic nervous system. In: J. Neurosci. Res. 68 (2), S. 176–184. Weiss, Jan; Pyrski, Martina; Jacobi, Eric; Bufe, Bernd; Willnecker, Vivienne; Schick, Bernhard et al., (2011): Loss-of-function mutations in sodium channel Nav1.7 cause anosmia. In: Nature 472 (7342), S. 186–190. Weng, Jinsheng; Wang, Jianghua; Hu, Xiaoxiao; Wang, Fen; Ittmann, Michael; Liu, Mingyao (2006): PSGR2, a novel G-protein coupled receptor, is overexpressed in human prostate cancer. In: Int. J. Cancer 118 (6), S. 1471–1480. Wetzel, C. H.; Oles, M.; Wellerdieck, C.; Kuczkowiak, M.; Gisselmann, G.; Hatt, H. (1999): Specificity and sensitivity of a human olfactory receptor functionally expressed in human embryonic kidney 293 cells and Xenopus Laevis oocytes. In: J. Neurosci. 19 (17), S. 7426–7433. Wilbanks, Alyson M.; Laporte, Stéphane A.; Bohn, Laura M.; Barak, Larry S.; Caron, Marc G. (2002): Apparent loss-of-function mutant GPCRs revealed as constitutively desensitized receptors. In: Biochemistry 41 (40), S. 11981–11989. Witt, O.; Sand, K.; Pekrun, A. (2000): Butyrate-induced erythroid differentiation of human K562 leukemia cells involves inhibition of ERK and activation of p38 MAP kinase pathways. In: Blood 95 (7), S. 2391–2396. Woessmann, W.; Mivechi, N. F. (2001): Role of ERK activation in growth and erythroid differentiation of K562 cells. In: Exp. Cell Res. 264 (2), S. 193–200.

Literaturverzeichnis

Woessmann, Willi; Zwanzger, Dorothea; Borkhardt, Arndt (2004): ERK signaling pathway is differentially involved in erythroid differentiation of K562 cells depending on time and the inducing agent. In: Cell Biol. Int. 28 (5), S. 403–410. Wong, S. T.; Trinh, K.; Hacker, B.; Chan, G. C.; Lowe, G.; Gaggar, A. et al., (2000): Disruption of the type III adenylyl cyclase gene leads to peripheral and behavioral anosmia in transgenic mice. In: Neuron 27 (3), S. 487–497. Won, J. S.; Choi, M. R.; Suh, H. W. (2001): Stimulation of astrocyte-enriched culture with C2 ceramide increases proenkephalin mRNA: involvement of cAMP-response element binding protein and mitogen activated protein kinases. In: Brain Res. 903 (1-2), S. 207–215. Wright, S. C.; Schellenberger, U.; Ji, L.; Wang, H.; Larrick, J. W. (1997): Calmodulin-dependent protein kinase II mediates signal transduction in apoptosis. In: FASEB J. 11 (11), S. 843–849. Xu, F.; Kida, I.; Hyder, F.; Shulman, R. G. (2000a): Assessment and discrimination of odor stimuli in rat olfactory bulb by dynamic functional MRI. In: Proc. Natl. Acad. Sci. U.S.A. 97 (19), S. 10601– 10606. Xu, L. L.; Stackhouse, B. G.; Florence, K.; Zhang, W.; Shanmugam, N.; Sesterhenn, I. A. et al., (2000b): PSGR, a novel prostate-specific gene with homology to a G protein-coupled receptor, is overexpressed in prostate cancer. In: Cancer Res. 60 (23), S. 6568–6572. Xu, Xuefen; Zhang, Yi; Li, Wei; Miao, Hanchi; Zhang, Haiwei; Zhou, Yuxin et al., (2014): Wogonin reverses multi-drug resistance of human myelogenous leukemia K562/A02 cells via downregulation of MRP1 expression by inhibiting Nrf2/ARE signaling pathway. In: Biochem. Pharmacol. 92 (2), S. 220– 234. Ye, Ji-Lin; Mao, Wei-Ping; Wu, Ai-Lian; Zhang, Na-Na; Zhang, Chao; Yu, You-Jiang et al., (2007): Cadmium-induced apoptosis in human normal liver L-02 cells by acting on mitochondria and regulating Ca(2+) signals. In: Environ. Toxicol. Pharmacol. 24 (1), S. 45–54. Younger, R. M.; Amadou, C.; Bethel, G.; Ehlers, A.; Lindahl, K. F.; Forbes, S. et al., (2001): Characterization of clustered MHC-linked olfactory receptor genes in human and mouse. In: Genome Res. 11 (4), S. 519–530. Zhang, Huijuan; Tan, Shi; Wang, Juan; Chen, Shana; Quan, Jing; Xian, Jingrong et al., (2014): Musashi2 modulates K562 leukemic cell proliferation and apoptosis involving the MAPK pathway. In: Exp. Cell Res. 320 (1), S. 119–127. Zhang, Jianming; Yang, Priscilla L.; Gray, Nathanael S. (2009): Targeting cancer with small molecule kinase inhibitors. In: Nat. Rev. Cancer 9 (1), S. 28–39. Zhang, Xiaohong; Firestein, Stuart (2007): Nose thyself: individuality in the human olfactory genome. In: Genome Biol. 8 (11), S. 230. Zhang, Xiaohong; La Cruz, Omar de; Pinto, Jayant M.; Nicolae, Dan; Firestein, Stuart; Gilad, Yoav (2007): Characterizing the expression of the human olfactory receptor gene family using a novel DNA microarray. In: Genome Biol. 8 (5), S. R86. Zhang, Xin; Bedigian, Anne V.; Wang, Wenchao; Eggert, Ulrike S. (2012): G protein-coupled receptors participate in cytokinesis. In: Cytoskeleton (Hoboken) 69 (10), S. 810–818. Zhang, Xinmin; Firestein, Stuart (2002): The olfactory receptor gene superfamily of the mouse. In: Nat. Neurosci. 5 (2), S. 124–133. Zhang, Xinmin; Rogers, Matthew; Tian, Huikai; Zhang, Xiaohong; Zou, Dong-Jing; Liu, Jian et al., (2004): High-throughput microarray detection of olfactory receptor gene expression in the mouse. In: Proc. Natl. Acad. Sci. U.S.A. 101 (39), S. 14168–14173. Zhang, Y. H.; Vasko, M. R.; Nicol, G. D. (2002): Ceramide, a putative second messenger for nerve growth factor, modulates the TTX-resistant Na(+) current and delayed rectifier K(+) current in rat sensory neurons. In: J. Physiol. (Lond.) 544 (Pt 2), S. 385–402.

Literaturverzeichnis

Zhao, H.; Ivic, L.; Otaki, J. M.; Hashimoto, M.; Mikoshiba, K.; Firestein, S. (1998): Functional expression of a mammalian odorant receptor. In: Science 279 (5348), S. 237–242. Zhao, Wei; Ho, Lap; Varghese, Merina; Yemul, Shrishailam; Dams-O'Connor, Kristen; Gordon, Wayne et al., (2013): Decreased level of olfactory receptors in blood cells following traumatic brain injury and potential association with tauopathy. In: J. Alzheimers Dis. 34 (2), S. 417–429. Zhu, Jian feng; Li, Zi jian; Zhang, Guang sen; Meng, Kun; Kuang, Wen yong; Li, Jin et al., (2011): Icaritin shows potent anti-leukemia activity on chronic myeloid leukemia in vitro and in vivo by regulating MAPK/ERK/JNK and JAK2/STAT3 /AKT signalings. In: PLoS ONE 6 (8), S. e23720. Ziegler, Andreas; Dohr, Gotrfried; Uchanska-Ziegler, Barbara (2002): Possible roles for products of polymorphic MHC and linked olfactory receptor genes during selection processes in reproduction. In: Am. J. Reprod. Immunol. 48 (1), S. 34–42. Zimmermann, Katharina; Lennerz, Jochen K.; Hein, Alexander; Link, Andrea S.; Kaczmarek, J. Stefan; Delling, Markus et al., (2011): Transient receptor potential cation channel, subfamily C, member 5 (TRPC5) is a cold-transducer in the peripheral nervous system. In: Proc. Natl. Acad. Sci. U.S.A. 108 (44), S. 18114–18119. Zufall, F.; Hatt, H.; Firestein, S. (1993): Rapid application and removal of second messengers to cyclic nucleotide-gated channels from olfactory epithelium. In: Proc. Natl. Acad. Sci. U.S.A. 90 (20), S. 9335– 9339. Zufall, Frank; Pyrski, Martina; Weiss, Jan; Leinders-Zufall, Trese (2012): Link between pain and olfaction in an inherited sodium channelopathy. In: Arch. Neurol. 69 (9), S. 1119–1123.