DOCSLIB.ORG

See Also Figure 1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
See Also Figure 1 Figure S1. Box-and-whisker plots depicting the range of expression values per developmental stage, with DESeq normalization (A) or quantile normalization (B). See also Figure 1. Figure S2. Lv-Setmar expression has low variation over developmental time. A. A plot of Lv-setmar versus Lv-ubiquitin expression over time demonstrates that Lv-setmar exhibits less temporal variation than Lv-ubiquitin. B. A representative gel showing Lv-setmar qPCR products amplified from cDNAs representing each sequenced stage in this study, demonstrating comparable product levels and an absence of spurious amplification products. See also Figure 1E. Figure S3. LvEDGE database. Screen shots showing the home page (A), the search window (B), an example search with a temporal expression plot (C), and the numerical data reflected in the plot (D) for the LvEDGE public database, which hosts the data described herein. stage 1 2 3 4 5 6 7 8 9 10 11 Category Subcategory 2-cell 60-cell EB HB TVP MB EG MG LG EP LP meiotic Cell Division Cytokinesis Mitosis checkpoint cell division recombination cell cycle stem cell left-right cell left-right Development maintenance asymmetry morphogenesis asymmetry regulation of multicellular organismal process cell soma cell soma Gene Expression chromatin SWI/SNF Control Chromatin modification chromatin binding complex methylated histone Binding negative sequence- sequence- sequence- regulation of sequence- specific DNA specific DNA specific DNA transcription specific DNA sequence-specific DNA binding binding binding binding factor activity binding DNA binding nuclear mRNA nuclear mRNA nuclear mRNA nuclear mRNA nuclear mRNA nuclear mRNA splicing, via splicing, via splicing, via splicing, via splicing, via splicing, via Processing spliceosome spliceosome spliceosome spliceosome spliceosome spliceosome mRNA processing translation translation translation translation initiation factor initiation factor initiation factor initiation factor Translation activity activity activity activity NADH fatty acid dehydrogenase primary glycosaminoglycan ATP synthesis metabolic (ubiquinone) cell redox cell redox metabolic mitochondrial mitochondrial biosynthetic coupled proton Metabolic process activity homeostasis homeostasis process inner membrane matrix process transport oxidoreductase activity, acting on paired donors, with incorporation or reduction of positive regulation molecular monooxygenase monooxygenase oxidoreductase of cellular oxidoreductase oxygen activity activity activity metabolic process activity oxidoreductase activity, acting on the aldehyde transferase or oxo group of sulfuric ester activity, donors, NAD or hydrolase ATP catabolic transferring NADP as activity process hexosyl groups acceptor ATP synthesis coupled proton transport DNA Metabolic Process ciliary or microtubule Regulation cytoskeleton flagellar motility motor activity actin binding metallo- metallo- serine-type serine-type threonine threonine metallo- metallo- endopeptidase endopeptidase endopeptidase endopeptidase endopeptidase endopeptidase endopeptidase endopeptidase serine-type protease activity activity activity activity activity activity activity activity peptidase activity peptidase metallopeptidase metallopeptidase activity activity activity platelet platelet activation activation identical protein protein protein other binding ubiquitination polyubiquitination positive regulation regulation of of cellular cellular process metabolic process G-protein G-protein coupled coupled G-protein G-protein G-protein G-protein G-protein G-protein G-protein receptor receptor coupled receptor coupled coupled receptor coupled receptor coupled receptor coupled G-protein coupled G-protein coupled coupled Signaling activity activity activity receptor activity activity activity activity receptor activity receptor activity receptor activity receptor activity phosphoinositide cGMP phospholipase C neuropeptide Y neuropeptide Y neuropeptide Y biosynthetic regulation of activity receptor activity receptor activity receptor activity process apoptosis non-membrane spanning protein tyrosine kinase scavenger scavenger MAPKKK activity receptor activity receptor activity receptor binding cascade small GTPase small GTPase small GTPase growth factor mediated signal mediated signal mediated signal activity transduction transduction transduction positive regulation of GTPase activity axonemal dynein microtubule- Structural cytoskeleton complex based process dendritic shaft dendritic spine microtubule cytoskeletal part sarcomere organization nucleosome organelle assembly nucleosome nucleosome nucleosome nucleosome nuclear envelope integral to Golgi intracellular intracellular membrane organelle part organelle structural structural structural structural structural structural structural structural constituent of constituent of constituent of constituent of constituent of constituent of constituent of constituent of ribosome ribosome ribosome ribosome ribosome ribosome ribosome ribosome ribosome ribosome Proteinaceous protein extracellular Extracellular other cytoplasmic part polymerization matrix intracellular part intracellular part region part Extracellular region Figure S4. GO term enrichment is shown at each sequenced developmental stage. 96 GO terms identified as enriched in one or more of the sequenced stages were sorted into nine categories (various colors), and are shown here for each instance of enrichment relative to the adjacent timepoints. See also Fig. 1D and Table S3. Figure S5. GO term enrichment among expression phases. Only transcripts whose expression is limited to a specific expression phase were considered for this analysis. The results are shown as an enrichment heat map. See also Table S4. Figure S6. k-means cluster analysis of the non-ubiquitous transcriptome reveals complete adherence to the expression phases. K-means clustering (k=19) was performed on annotated sequences whose expression is ≤ 1% of the maximum expression level per gene for at least one timepoint (n = 4792 sequences). Left: A heat map depicts the clusters; bright red is maximal expression. Right: Plots of the average normalized expression values for each cluster. Expression phase boundaries are indicated by vertical dashed lines. Clusters a2, b1, c1, d3 and e2 are also shown in Figure 4. See also Table S5. Figure S7. Cluster analysis of the ubiquitous transcriptome reveals clusters that do not adhere to the expression phases. K-means clustering (k=37) was performed on annotated sequences whose expression is > 1% of the maximum expression level for all timepoints (n = 14,773 sequences). Left: A heat map depicts the clusters; bright red is maximal expression. Right: Plots of the average normalized expression values for each cluster. Expression phase boundaries are indicated by vertical dashed lines. Cluster f1 is also shown in Figure 4. See also Table S6. Figure S8. Cluster analysis of the transcription factors reveals that most are expressed in three or more sequential stages. K-means clustering (k = 23) was performed on all the identified transcription factors in the Lv transcriptome (n = 521). Left: A heat map depicts the clusters; bright red is maximum expression. Right: Plots of the average normalized expression value for each cluster. Phase boundaries are indicated by vertical dashed lines. See also Figure 4 and Table S7. Figure S9. Temporal metabolic network analysis. A. The S. purpuratus-specific network, produced by the built-in filter in iPath. B.-L. The metabolic network expressed in each indicated developmental stage. For these maps, zero expression is depicted in black; expression from 0 – 100 is in light blue, 100 – 1000 is in medium blue, and >1000 is in dark blue. Thin gray lines indicate edges expected to be present based on the filter, but for which expression was not detected in any developmental stage. See also Figure 6. Table S1. qPCR Primer Sequences Gene 5' Primer (5' -> 3') 3' Primer (5' -> 3') LvAlx1 CCGGTACCAGTACCACCAAC AGGATGGGAGTGTTGACTGC LvBlimp GACGATGAGGACGAGTTGGT CGGTTTCCATTGCATCTTCT LvBMP2/4 CCATCAGGAGCTATCATCACG ATCACTGTGTGTCTGTGGTG LvBMP5-8 TACCCTCCACAACGATACACCC GCCTTTAGCAACGGACCATACA LvBrachyury CAGGCTAGAGGACGTGGAAC CCACTCCCCATTGACGATCT LvChordin CCCACTCAAGGCAGAGATAC GAAGGTACACCCTGGAACAC LvDelta CTGCCAAAACAACATCAACG AAACCTCCCATCACATCTCG LvEndo16 CGGATCGGAATCAGAGTCAT AGCAGCATCCAACTCCAAAT LvErg GGACACTTGCTAACCCGGTA TTCTCCCCATCTTCTGGCTA LvEts1 CGGAGGCATTGAGAATCAAG TAGGCATGCGTTCATCAGAG LvEve CATCCCCTATCACGATCACC TGTGGAGGCCAAACTCTAGG LvFoxG GAGCGATACAGAGCCGGAGA CTGAAGGGAGGTTTTTCACC LvFoxO AGCAATAGTTCAGCGGGTTG ACTCTCCCTCGCTTCCTCTC LvFoxQ2 GAGAAGCGTCTATTGCTGTGTG ACGAATACTGTTCCTCCAGCTC LvGataC GGGCCGAGAATGTGTAAACT AAGCGGTCTGTTCTGTCCAT LvGataE TAAACCTCAGCGCCAATACC CATTCCGATTCTGCTTTGCT LvGcm TCCAAAGACACCTGTCTACCAG GGAGAAGCACTGGAACAAAGAC LvGoosecoid TCACCGAAGAACAACTGGAA TAAGCCTCACATGCCCTCTT LvHh GGGAATCAAACTTCGACCAA AGATCCTTGCCTGGTCACTG LvHnf6 GGGAGGAGATCAACACGAAA CTGCCGCTCTTGAGCTTACT LvHox11/13b ACCTCATCCACCACCTCATC GAAGTTGCGATTGATGACCA LvIrxA CCAGGAATCGATGCGGTGATGG CATCTCGATGATCACGGTGGTGG LvNodal CCATGTTCATGGTGGAATTG GAATGTCGGGAAGGAGGTCT LvOtp CCCAACTCAACGAACTGGAG GAGGCCGTGAGATGGTAGAA LvOtx GCCAAACGTTGAACTCATGC AGCTGAGCTCGGGTAAAAGTC LvPtc AGGTTGTCGTGGAAACCAGT GTGGGGGTACTGATGGTGAG LvSetmar1 GCCATCATGTCCTTGTCTCA CACATGAAGCTTGATCAGGTAGTC LvSix1/2 CCCACAACCCTTACCCTTCT TTCCCATTCATAGGCAGGTC LvSix3 GGCTCAAGCCACAGGACTAA GGGTTGGGACTGAGTAAGCA LvSM30 CCACAGCTTCTGCAACAACA AGGCTGGATGGCGTAGTATG LvSmo GATGCTCCTGGTATGGTTGG GTGCTCAATCCCGCTATCAC LvSnail CCGAGGTCTTTTCTCGTCAA ACTTGCCACTGACACAACACC
Load more

Recommended publications
  • Functional and Molecular Heterogeneity Of
    ARTICLE https://doi.org/10.1038/s41467-020-15716-9 OPEN Functional and molecular heterogeneity of D2R neurons along dorsal ventral axis in the striatum ✉ Emma Puighermanal1,2 , Laia Castell1, Anna Esteve-Codina 3, Su Melser4,5, Konstantin Kaganovsky 6, Charleine Zussy1, Jihane Boubaker-Vitre1, Marta Gut3,7, Stephanie Rialle1, Christoph Kellendonk8,9, Elisenda Sanz2, Albert Quintana 2, Giovanni Marsicano4,5, Miquel Martin1, Marcelo Rubinstein10,11,12, ✉ Jean-Antoine Girault 13,14,15, Jun B. Ding6 & Emmanuel Valjent 1 1234567890():,; Action control is a key brain function determining the survival of animals in their environ- ment. In mammals, neurons expressing dopamine D2 receptors (D2R) in the dorsal striatum (DS) and the nucleus accumbens (Acb) jointly but differentially contribute to the fine reg- ulation of movement. However, their region-specific molecular features are presently unknown. By combining RNAseq of striatal D2R neurons and histological analyses, we identified hundreds of novel region-specific molecular markers, which may serve as tools to target selective subpopulations. As a proof of concept, we characterized the molecular identity of a subcircuit defined by WFS1 neurons and evaluated multiple behavioral tasks after its temporally-controlled deletion of D2R. Consequently, conditional D2R knockout mice displayed a significant reduction in digging behavior and an exacerbated hyperlocomotor response to amphetamine. Thus, targeted molecular analyses reveal an unforeseen hetero- geneity in D2R-expressing striatal neuronal populations, underlying specific D2R’s functional features in the control of specific motor behaviors. 1 IGF, CNRS, INSERM, Université Montpellier, Montpellier, France. 2 Neuroscience Institute, Department of Cell Biology, Physiology and Immunology, Autonomous University of Barcelona, Bellaterra, Spain.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplementary Table S5. Differentially Expressed Gene Lists of PD-1High CD39+ CD8 Tils According to 4-1BB Expression Compared to PD-1+ CD39- CD8 Tils
    BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Immunother Cancer Supplementary Table S5. Differentially expressed gene lists of PD-1high CD39+ CD8 TILs according to 4-1BB expression compared to PD-1+ CD39- CD8 TILs Up- or down- regulated genes in Up- or down- regulated genes Up- or down- regulated genes only PD-1high CD39+ CD8 TILs only in 4-1BBneg PD-1high CD39+ in 4-1BBpos PD-1high CD39+ CD8 compared to PD-1+ CD39- CD8 CD8 TILs compared to PD-1+ TILs compared to PD-1+ CD39- TILs CD39- CD8 TILs CD8 TILs IL7R KLRG1 TNFSF4 ENTPD1 DHRS3 LEF1 ITGA5 MKI67 PZP KLF3 RYR2 SIK1B ANK3 LYST PPP1R3B ETV1 ADAM28 H2AC13 CCR7 GFOD1 RASGRP2 ITGAX MAST4 RAD51AP1 MYO1E CLCF1 NEBL S1PR5 VCL MPP7 MS4A6A PHLDB1 GFPT2 TNF RPL3 SPRY4 VCAM1 B4GALT5 TIPARP TNS3 PDCD1 POLQ AKAP5 IL6ST LY9 PLXND1 PLEKHA1 NEU1 DGKH SPRY2 PLEKHG3 IKZF4 MTX3 PARK7 ATP8B4 SYT11 PTGER4 SORL1 RAB11FIP5 BRCA1 MAP4K3 NCR1 CCR4 S1PR1 PDE8A IFIT2 EPHA4 ARHGEF12 PAICS PELI2 LAT2 GPRASP1 TTN RPLP0 IL4I1 AUTS2 RPS3 CDCA3 NHS LONRF2 CDC42EP3 SLCO3A1 RRM2 ADAMTSL4 INPP5F ARHGAP31 ESCO2 ADRB2 CSF1 WDHD1 GOLIM4 CDK5RAP1 CD69 GLUL HJURP SHC4 GNLY TTC9 HELLS DPP4 IL23A PITPNC1 TOX ARHGEF9 EXO1 SLC4A4 CKAP4 CARMIL3 NHSL2 DZIP3 GINS1 FUT8 UBASH3B CDCA5 PDE7B SOGA1 CDC45 NR3C2 TRIB1 KIF14 TRAF5 LIMS1 PPP1R2C TNFRSF9 KLRC2 POLA1 CD80 ATP10D CDCA8 SETD7 IER2 PATL2 CCDC141 CD84 HSPA6 CYB561 MPHOSPH9 CLSPN KLRC1 PTMS SCML4 ZBTB10 CCL3 CA5B PIP5K1B WNT9A CCNH GEM IL18RAP GGH SARDH B3GNT7 C13orf46 SBF2 IKZF3 ZMAT1 TCF7 NECTIN1 H3C7 FOS PAG1 HECA SLC4A10 SLC35G2 PER1 P2RY1 NFKBIA WDR76 PLAUR KDM1A H1-5 TSHZ2 FAM102B HMMR GPR132 CCRL2 PARP8 A2M ST8SIA1 NUF2 IL5RA RBPMS UBE2T USP53 EEF1A1 PLAC8 LGR6 TMEM123 NEK2 SNAP47 PTGIS SH2B3 P2RY8 S100PBP PLEKHA7 CLNK CRIM1 MGAT5 YBX3 TP53INP1 DTL CFH FEZ1 MYB FRMD4B TSPAN5 STIL ITGA2 GOLGA6L10 MYBL2 AHI1 CAND2 GZMB RBPJ PELI1 HSPA1B KCNK5 GOLGA6L9 TICRR TPRG1 UBE2C AURKA Leem G, et al.
    [Show full text]
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
    [Show full text]
  • Associations Among Dietary Non-Fiber Carbohydrate, Ruminal Microbiota
    Shen et al. Microbiome (2017) 5:123 DOI 10.1186/s40168-017-0341-z RESEARCH Open Access Associations among dietary non-fiber carbohydrate, ruminal microbiota and epithelium G-protein-coupled receptor, and histone deacetylase regulations in goats Hong Shen1,2†, Zhongyan Lu3*†, Zhihui Xu1,2, Zhan Chen1,2 and Zanming Shen3 Abstract Background: Diet-derived short-chain fatty acids (SCFAs) in the rumen have broad effects on the health and growth of ruminants. The microbe-G-protein-coupled receptor (GPR) and microbe-histone deacetylase (HDAC) axes might be the major pathway mediating these effects. Here, an integrated approach of transcriptome sequencing and 16S rRNA gene sequencing was applied to investigate the synergetic responses of rumen epithelium and rumen microbiota to the increased intake of dietary non-fiber carbohydrate (NFC) from 15 to 30% in the goat model. In addition to the analysis of the microbial composition and identification of the genes and signaling pathways related to the differentially expressed GPRs and HDACs, the combined data including the expression of HDACs and GPRs, the relative abundance of the bacteria, and the molar proportions of the individual SCFAs were used to identify the significant co-variation of the SCFAs, clades, and transcripts. Results: The major bacterial clades promoted by the 30% NFC diet were related to lactate metabolism and cellulose degradation in the rumen. The predominant functions of the GPR and HDAC regulation network, under the 30% NFC diet, were related to the maintenance of epithelium integrity and the promotion of animal growth. In addition, the molar proportion of butyrate was inversely correlated with the expression of HDAC1, and the relative abundance of the bacteria belonging to Clostridum_IV was positively correlated with the expression of GPR1.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Table 1A SIRT1 Differential Binding Gene List Down
    Rp1 Rb1cc1 Pcmtd1 Mybl1 Sgk3 Cspp1 Arfgef1 Cpa6 Kcnb2 Stau2 Jph1 Paqr8 Kcnq5 Rims1 Smap1 Bai3 Prim2 Bag2 Zfp451 Dst Uggt1 4632411B12Rik Fam178b Tmem131 Inpp4a 2010300C02Rik Rev1 Aff3 Map4k4 Il1r1 Il1rl2 Tgfbrap1 Col3a1 Wdr75 Tmeff2 Hecw2 Boll Plcl1 Satb2 Aox4 Mpp4 Gm973 Carf Nbeal1 Pard3b Ino80d Adam23 Dytn Pikfyve Atic Fn1 Smarcal1 Tns1 Arpc2 Pnkd Ctdsp1 Usp37 Acsl3 Cul3 Dock10 Col4a4 Col4a3 Mff Wdr69 Pid1 Sp110 Sp140 Itm2c 2810459M11Rik Dis3l2 Chrng Gigyf2 Ugt1a7c Ugt1a6b Hjurp A730008H23Rik Trpm8 Kif1a D1Ertd622e Pam Cntnap5b Rnf152 Phlpp1 Clasp1 Gli2 Dpp10 Tmem163 Zranb3 Pfkfb2 Pigr Rbbp5 Sox13 Ppfia4 Rabif Kdm5b Ppp1r12b Lgr6 Pkp1 Kif21b Nr5a2 Dennd1b Trove2 Pdc Hmcn1 Ncf2 Nmnat2 Lamc2 Cacna1e Xpr1 Tdrd5 Fam20b Ralgps2 Sec16b Astn1 Pappa2 Tnr Klhl20 Dnm3 Bat2l2 4921528O07Rik Scyl3 Dpt Mpzl1 Creg1 Cd247 Gm4846 Lmx1a Pbx1 Ddr2 Cd244 Cadm3 Fmn2 Grem2 Rgs7 Fh1 Wdr64 Pld5 Cep170 Akt3 Pppde1 Smyd3 Parp1 Enah Capn8 Susd4 Mosc1 Rrp15 Gpatch2 Esrrg Ptpn14 Smyd2 Tmem206 Nek2 Traf5 Hhat Cdnf Fam107b Camk1d Cugbp2 Gata3 Itih5 Sfmbt2 Itga8 Pter Rsu1 Ptpla Slc39a12 Cacnb2 Nebl Pip4k2a Abi1 Tbpl2 Pnpla7 Kcnt1 Camsap1 Nacc2 Gpsm1 Sec16a Fam163b Vav2 Olfm1 Tsc1 Med27 Rapgef1 Pkn3 Zer1 Prrx2 Gpr107 Ass1 Nup214 Bat2l Dnm1 Ralgps1 Fam125b Mapkap1 Hc Ttll11 Dennd1a Olfml2a Scai Arhgap15 Gtdc1 Mbd5 Kif5c Lypd6b Lypd6 Fmnl2 Arl6ip6 Galnt13 Acvr1 Ccdc148 Dapl1 Tanc1 Ly75 Gcg Kcnh7 Cobll1 Scn3a Scn9a Scn7a Gm1322 Stk39 Abcb11 Slc25a12 Metapl1 Pdk1 Rapgef4 B230120H23Rik Gpr155 Wipf1 Pde11a Prkra Gm14461 Pde1a Calcrl Olfr1033 Mybpc3 F2 Arhgap1 Ambra1 Dgkz Creb3l1
    [Show full text]
  • The New Melanoma: a Novel Model for Disease Progression
    DISS. ETH NO. 17606 The new melanoma: A novel model for disease progression A dissertation submitted to SWISS FEDERAL INSTITUTE OF TECHNOLOGY ZÜRICH for the degree of DOCTOR OF SCIENCES presented by Natalie Schlegel Master of Science, Otago University (New Zealand) born on January 20th 1976 citizen of Zürich (ZH) accepted on the recommendation of Professor Sabine Werner, examinor Professor Reinhard Dummer, co-examinor Professor Josef Jiricny, co-examinor 2008 22 Table of Contents Abstract ...................................................................................................................................... 6 Résumé....................................................................................................................................... 8 Abbreviations ........................................................................................................................... 10 1. Introduction ...................................................................................................................... 13 1.1 Definition ................................................................................................................. 14 1.2 Clinical features........................................................................................................ 14 1.3 Pathological features and staging............................................................................. 16 1.3.2 Clark’s level of invasion and Breslow’s thickness........................................... 16 1.3.3 TNM staging ...................................................................................................
    [Show full text]
  • Supp Table 6.Pdf
    Supplementary Table 6. Processes associated to the 2037 SCL candidate target genes ID Symbol Entrez Gene Name Process NM_178114 AMIGO2 adhesion molecule with Ig-like domain 2 adhesion NM_033474 ARVCF armadillo repeat gene deletes in velocardiofacial syndrome adhesion NM_027060 BTBD9 BTB (POZ) domain containing 9 adhesion NM_001039149 CD226 CD226 molecule adhesion NM_010581 CD47 CD47 molecule adhesion NM_023370 CDH23 cadherin-like 23 adhesion NM_207298 CERCAM cerebral endothelial cell adhesion molecule adhesion NM_021719 CLDN15 claudin 15 adhesion NM_009902 CLDN3 claudin 3 adhesion NM_008779 CNTN3 contactin 3 (plasmacytoma associated) adhesion NM_015734 COL5A1 collagen, type V, alpha 1 adhesion NM_007803 CTTN cortactin adhesion NM_009142 CX3CL1 chemokine (C-X3-C motif) ligand 1 adhesion NM_031174 DSCAM Down syndrome cell adhesion molecule adhesion NM_145158 EMILIN2 elastin microfibril interfacer 2 adhesion NM_001081286 FAT1 FAT tumor suppressor homolog 1 (Drosophila) adhesion NM_001080814 FAT3 FAT tumor suppressor homolog 3 (Drosophila) adhesion NM_153795 FERMT3 fermitin family homolog 3 (Drosophila) adhesion NM_010494 ICAM2 intercellular adhesion molecule 2 adhesion NM_023892 ICAM4 (includes EG:3386) intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)adhesion NM_001001979 MEGF10 multiple EGF-like-domains 10 adhesion NM_172522 MEGF11 multiple EGF-like-domains 11 adhesion NM_010739 MUC13 mucin 13, cell surface associated adhesion NM_013610 NINJ1 ninjurin 1 adhesion NM_016718 NINJ2 ninjurin 2 adhesion NM_172932 NLGN3 neuroligin
    [Show full text]
  • Supplementary Information For
    1 Supplementary Information for 2 Molecular map of GNAO1-related disease phenotypes and reactions to therapy 3 Ivana Mihalek, Jeff L. Waugh, Meredith Park, Saima Kayani, Annapurna Poduri, Olaf Bodamer 4 Ivana Mihalek, Olaf Bodamer 5 E-mail: [email protected], [email protected] 6 This PDF file includes: 7 Supplementary text 8 Figs. S1 to S9 9 Tables S1 to S5 10 Legend for Movie S1 11 Legend for Dataset S1 12 SI References 13 Other supplementary materials for this manuscript include the following: 14 Movie S1 15 Dataset S1 Ivana Mihalek, Jeff L. Waugh, Meredith Park, Saima Kayani, Annapurna Poduri, Olaf Bodamer 1 of 18 16 Supporting Information Text 17 Building the target-response profiles 18 To construct the target-response profiles used in Fig. 1 in the main text, we collected the information about the targets of 19 drugs reported as therapy for GNAO1-related symptoms. We collected both the direction of action (up- or down-regulation), 20 and its micromolar activity for each drug-target pair, keeping in mind that drugs typically have multiple targets. The sources 21 were DrugBank (1), BindingDB (2), GuideToPharm (3), PDSP (4), and PubChem (5), as well as manual literature search in a 22 handful of cases. This information is included on Dataset S1. The full collection can be found and downloaded as an SQLite 23 database from the accompanying CodeOcean capsule (codeocean.com/capsule/8747824). 24 Giving the name td to the combined label of target + drug activity direction, for example GABR ↑ for upregulated GABA-A 25 receptor (Human Genome Nomenclature Committee symbol GABR), we assign to it a weight −log (activity) + 6, if the activity is < 106µM w(td) = 10 0 otherwise.
    [Show full text]
  • Molecular Programming of Tumor-Infiltrating CD8 T Cells and IL15 Resistance
    Published OnlineFirst August 2, 2016; DOI: 10.1158/2326-6066.CIR-15-0178 Research Article Cancer Immunology Research Molecular Programming of Tumor-Infiltrating CD8þ T Cells and IL15 Resistance Andrew L. Doedens1, Mark P. Rubinstein1,2, Emilie T. Gross3, J. Adam Best1, David H. Craig2, Megan K. Baker2, David J. Cole2, Jack D. Bui3, and Ananda W. Goldrath1 Abstract Despite clinical potential and recent advances, durable immu- in the lung and spleen were activated and dramatically expanded. þ notherapeutic ablation of solid tumors is not routinely achieved. Tumor-infiltrating CD8 T cells exhibited cell-extrinsic and cell- IL15expandsnaturalkillercell(NK),naturalkillerTcell(NKT)and intrinsic resistance to IL15. Our data showed that in the case of þ CD8 T-cell numbers and engages the cytotoxic program, and thus persistent viral or tumor antigen, single-agent systemic IL15cx is under evaluation for potentiation of cancer immunotherapy. We treatment primarily expanded antigen-irrelevant or extratumoral þ found that short-term therapy with IL15 bound to soluble IL15 CD8 Tcells.Weidentified exhaustion, tissue-resident memory, þ receptor a–Fc (IL15cx; a form of IL15 with increased half-life and and tumor-specific molecules expressed in tumor-infiltrating CD8 activity) was ineffective in the treatment of autochthonous PyMT T cells, which may allow therapeutic targeting or programming þ murine mammary tumors, despite abundant CD8 T-cell infiltra- of specific subsets to evade loss of function and cytokine resist- tion. Probing of this poor responsiveness revealed that IL15cx ance, and, in turn, increase the efficacy of IL2/15 adjuvant cytokine þ only weakly activated intratumoral CD8 T cells, even though cells therapy.
    [Show full text]
  • Human Ortholog of Drosophila Melted Impedes SMAD2 Release from TGF
    Human ortholog of Drosophila Melted impedes SMAD2 PNAS PLUS release from TGF-β receptor I to inhibit TGF-β signaling Premalatha Shathasivama,b,c, Alexandra Kollaraa,c, Maurice J. Ringuetted, Carl Virtanene, Jeffrey L. Wranaa,f, and Theodore J. Browna,b,c,1 aLunenfeld-Tanenbaum Research Institute at Mount Sinai Hospital, Toronto, ON, Canada M5T 3H7; Departments of bPhysiology, cObstetrics and Gynaecology, dCell and Systems Biology, and fMolecular Genetics, University of Toronto, Toronto, ON, Canada M5S 3G5; and ePrincess Margaret Cancer Centre, University Health Network, Toronto, ON, Canada M5G 1L7 Edited by Igor B. Dawid, The Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD, and approved May 5, 2015 (received for review March 11, 2015) Drosophila melted encodes a pleckstrin homology (PH) domain- The gene locus encompassing human VEPH1, 3q24-25, lies containing protein that enables normal tissue growth, metabo- within a region frequently amplified in ovarian cancer (6, 7). Tan lism, and photoreceptor differentiation by modulating Forkhead et al. (8) found that this locus was also amplified in 7 of 12 ep- box O (FOXO), target of rapamycin, and Hippo signaling pathways. ithelial ovarian cancer cell lines. A gene copy number analysis of Ventricular zone expressed PH domain-containing 1 (VEPH1) is the 68 primary tumors by Ramakrishna et al. (9) identified frequent mammalian ortholog of melted, and although it exhibits tissue- (>40%) VEPH1 gene amplification that correlated with tran- restricted expression during mouse development and is poten- script levels. We determined the impact of VEPH1 on gene ex- tially amplified in several human cancers, little is known of its pression in an ovarian cancer cell line using a whole-genome function.
    [Show full text]