DOCSLIB.ORG

Saccharomyces Cerevisiae JEAN-MICHEL MASSON*T, PIERRE MEURIS**, MICHAEL GRUNSTEIN*, JOHN ABELSON§, and JEFFREY H

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Saccharomyces Cerevisiae JEAN-MICHEL MASSON*T, PIERRE MEURIS**, MICHAEL GRUNSTEIN*, JOHN ABELSON§, and JEFFREY H Proc. NatI. Acad. Sci. USA Vol. 84, pp. 6815-6819, October 1987 Genetics Expression of a set of synthetic suppressor tRNAPhe genes in Saccharomyces cerevisiae JEAN-MICHEL MASSON*t, PIERRE MEURIS**, MICHAEL GRUNSTEIN*, JOHN ABELSON§, AND JEFFREY H. MILLER* *Department of Biology and Molecular Biology Institute, University of California, Los Angeles, CA 90024; and §Division of Biology, California Institute of Technology, Pasadena, CA 91125 Contributed by John Abelson, June 15, 1987 ABSTRACT Synthetic ochre and amber tRNA suppressor A OH C genes derived from the yeast tRNAmA sequence have been C constructed. They were efficiently transcribed in vitro and A expressed in vivo via a synthetic expression cassette. tRNAUeA G C and tRNAI AAVS (IVS = intervening sequence) are relatively C G G C inefficient ochre suppressors. They are toxic to the cell when G U expressed on a multicopy plasmid, and they do not suppress at A U all when present as single copies. The intron does not seem to U A have any effect on suppression. In contrast, the amber sup- 2-Me U -A c C U U GACAC A-i-Me pressor tRNAC!AIVS is efficient when expressed from a D ~~~A G single-copy plasmid, while its efficiency is reduced on a D-uU CUCG CUGU UCG multicopy vector. G GAGCGCGGGA G C.GAG 5-Me Suppressor tRNAs are useful genetic tools in investigating C G 5-Me the nature of suppressible mutations as well as the transla- 2-2 diMe- A- U 7-Me tional process. They also provide a very powerful tool for the GO*'U 5-Me analysis of structure-function relationships in proteins by 2'0-Me2'MAUGUCAA allowing defined amino acid substitutions at specified posi- tions. Unfortunately, only a limited set of suppressors can be G C U generated by conventional mutagenesis because (i) most Anticodon A- U tRNA genes would require two or three changes to be converted to suppressor tRNA-encoding genes, and (ii) A A although a number oftRNA genes are known to be redundant A A in the cell, the replacement of a wild-type tRNA gene by its AA suppressor counterpart could be deleterious to the cell. This is likely the case in Saccharomyces cerevisiae, where only FIG. 1. Structure of the precursor tRNAghAA. Numbering is that three classes of suppressor tRNAs have been uncovered, of Nishimura (5). The 18-base intron is delineated by the thick leading to insertion oftyrosine, serine, and leucine (1). Other arrows. Positions of the base modifications are indicated. Abbrevi- suppressors that theoretically could be obtained by a single ations: Me, methyl; 2T-0-Me, 2'-0-methyl; D, dihydroxy; and YI, base change from the tRNAs leading-to insertion of gluta- hypermodified. mine, glutamic acid, lysine, or tryptophan have not been observed. Moreover, it has been shown that a serine- SUP4. Expression of these genes was studied in vitro in a inserting ochre suppressor is lethal in haploids, while the yeast RNA polymerase III system and in vivo by transfor- diploids that bear one intact copy of the corresponding mation of the genes into yeast. tRNASer gene are viable (2, 3). tRNA genes now can be easily synthesized chemically. MATERIALS AND METHODS Therefore, one straightforward way of generating new sup- pressors is to synthesize them de novo. Such an approach has Strains, Plasmids, and Media. E. coli strain MC1061 was been shown to be successful in Escherichia coli, where a used for transformation and large-scale preparation of the large collection of suppressor tRNAs has been obtained (ref. various plasmids. S. cerevisiae strain AHA75 (trpl, ade2-o, 4; also J.-M.M., J. Normanly, L. G. Kleina, J.A., and arg8-o, his4-o, leu2-o, lys2-o, tyrJ-o, ura4-o, where o desig- J.H.M., unpublished data); therefore, we decided to extend nates an ochre mutation) (11) was provided by Maynard this strategy to yeast. Olson. S. cerevisiae strain S2 (trpl, met8-1-a, tyr7-1-a, The first suppressors we synthesized are derived from ade3-26-a, where a designates an amber mutation) was tRNArJI (Fig. 1). The tRNAPbC sequence has been deter- constructed by crossing strain AHA75 with strain SL183-21C mined at the RNA and DNA levels (6-8), and its structure has provided by Susan Liebman. E. coli strains were grown on been resolved by x-ray crystallography (9, 10). The tRNAPhC LB medium with ampicillin as described (12), and S. cere- has an intron of 19 base We visiae strains were grown on yeast extract/peptone/dextrose gene pairs (bp) (8). synthesized medium or drop-out plates of synthetic complete medium suppressor tRNA genes with and without the intron. These Sherman et al. synthetic genes were cloned into an expression cassette, minus one amino acid as described by (13). which we designed based on the sequence ofa tRNATYr gene, Abbreviation: IVS, intervening sequence. tPresent address: Departement de genie biochimique et alimentaire, The publication costs of this article were defrayed in part by page charge I.N.S.A., Avenue de Rangueil, 31077 Toulouse Cedex, France. payment. This article must therefore be hereby marked "advertisement" tPresent address: Centre de Recherche de Biochimie et de Genetique in accordance with 18 U.S.C. §1734 solely to indicate this fact. Cellulaires, 31062 Toulouse, France. 6815 Downloaded by guest on October 2, 2021 6816 Genetics: Masson et al. Proc. Natl. Acad. Sci. USA 84 (1987) Oligonucleotides and Gene Synthesis. The following oligo- modified nucleosides were separated by the method of nucleotides were synthesized on an Applied Biosystems Saneyoshi et al. (20) as described (19). (Foster City, CA) 380A DNA synthesizer: In Vivo Suppressor Assays. The efficiency of the suppres- sors in vivo was assayed by the method of Shaw and Olson 1, CGCGGATTTAGCTCAGTTGGGAGAGCGCCAGCCTTTAG; (11). In brief, serial dilutions of cells were plated as 5-,ul 2, AAAAAACTTCGGTCAAGTT; aliquots (107 to 101 cells on selective plates), and the plates 3, ATCTGGAGGTCCTGTGTTCGATCC; were scored for confluent growth after 5 days at 30'C in the 3, ATCTGGAGGTCCTGTGTTCGATCC; case of the ochre suppressors or 2 days at 30'C in the case of 4, ACAGAATTCGCATTTTTTGGTAC; the amber suppressors. 5, CAAAAAATGCGAATTCTGTGGATCGAACACAGGAC; 6, CTCCAGATAACTTGACCGAAGTTTTTTCTAAAGTCT; RESULTS 7, GGCGCTCTCCCAACTGAGCTAAATCCGCGAGCT; 8, CTCCAGCTCTAAAGTCT; Transcription of the tRNAl41A Genes Is Efficient in Vitro. 9, CGCGGATTTAGCTCAGTTGGGAGAGCGCCAGACTCTAG; Transcription of tRNA genes in eukaryotes is accomplished 10, CTCCAGATCTAGAGTCT; by RNA polymerase III (21). It is primarily controlled by two 11, CGTATACTCTTTCTTCAACAATTAGAGCTCCCGGGTACCAT; sequences internal to the coding region that are highly 12, CGATGGTACCCGGGAGCTCTAATTGTTGAAGAAAGAGTATA. conserved among eukaryotic tRNA genes (22-25). Nonethe- less, some additional features external to the coding region The oligonucleotides were purified, phosphorylated with have been shown to play an important role in transcription. kinase, and hybridized as described (4). The rationale for the These include a series of thymidine residues at the 3' gene synthesis was as follows: oligonucleotides 11 and 12 boundary of the transcription unit and a 5' leader sequence hybridized together are the expression cassette. The ochre (26, 27). suppressor gene was constructed from oligonucleotides 1 To efficiently express the synthetic suppressor tRNA through 7. Modifications to the original tRNARAIA sequence genes in yeast and ensure correct processing of the tran- were: (i) the anticodon was changed from GAA to TTA and scripts, we added a stretch of six thymidine residues at the 3' the complementary intron sequence was changed from TTC end of the tRNA gene sequences and cloned them in vectors to TAA to keep the base pairing between anticodon and YJM1 and YJM2 with a short synthetic expression cassette intervening sequence (IVS); (ii) the 3' transcription termina- (Fig. 2). The role of this cassette is to provide a 5' leader tion signal (a stretch of six thymidine residues) was included sequence as well as the Sac I and Kpn I cloning sites. Shaw in the tRNA gene oligonucleotide sequence instead of the and Olson (11) have shown that 27-36 bases ofthe 5' flanking expression cassette to avoid the risk of incorrect maturation sequence of the SUP4-o gene are required for optimal ofthe 3' end ofthe tRNA, which could have resulted from the expression of the gene. Therefore, we decided to include in introduction of a restriction site between the coding sequence our expression cassette a sequence of 27 bp derived from the and the termination signal; and (iii) Sac I and Kpn I restriction leader sequence of the SUP4-o gene. A cytosine residue was sites were created at the extremities of the tRNA gene added at the 5' end to create a CG cohesive end, and the 3' sequence. end was modified to a Sac I restriction site. Additional Omitting oligonucleotides 2 and 6 and replacing them by restriction sites were included at the 3' end, allowing this single-junction oligonucleotide 8 in the hybridizing reaction cassette to be used in other shuttle vectors. yielded the tRNAfUhUAAIVS gene. The corresponding amber To assess the transcriptional efficiency of the expression suppressor tRNAPheAAIVS gene was constructed by hybrid- cassette, we analyzed the transcription of our constructs in a izing oligonucleotides 3, 4, 5, 7, 9, and 10. yeast nuclear extract. The level of transcription of the Cloning, Transformation, and Selection. The 41-bp expres- tRNAPih6A genes on YJM2 did not differ significantly from sion cassette was introduced at the Cla I site ofthe multicopy that of a Sup53 gene cloned on a 2-gim plasmid (18) (Fig. 3). plasmid YRp7 (14). This site was chosen because it lies The primary transcript was not only produced at the same between the -10 and the -35 region of the tetracycline level as that of the control gene but also was processed promoter.
Load more

Recommended publications
  • Curriculum Vitae, Nils G. Walter, Dr. Ing. (Chemistry)
    Curriculum Vitae, Nils G. Walter, Dr. Ing. (Chemistry) Department of Chemistry, Rm. 2405 Phone: (734) 615-2060 930 N. University Ave. FAX: (734) 647-4865 University of Michigan E-mail: [email protected] Ann Arbor, MI 48109-1055 http://singlemolecule.lsa.umich.edu http://sites.lsa.umich.edu/walter-lab https://rna.umich.edu PROFESSIONAL EXPERIENCE FACULTY 2020-present Faculty Director of the Microscopy Core in the Biomedical Research Core Facilities (BRCF) 2018 Sabbatical Visitor, Chan Zuckerberg Biohub, San Francisco 2017-present Francis S. Collins Collegiate Professor of Chemistry, Biophysics, and Biological Chemistry, College of Literature, Science and the Arts 2016-present Founding Co-Director, Center for RNA Biomedicine, U. of Michigan; awarded a 5-year $10.2M Biosciences Initiative Award in 2018 to further build this grassroots, 150-faculty member effort 2016-present Professor of Biological Chemistry 2015-present Co-Director, Microfluidics in Biomedical Sciences Training Program 2015-present Associate Director, Michigan Post-baccalaureate Research Education Program (PREP) 2010-present Founding Director, Single Molecule Analysis in Real-Time (SMART) Center 2009-present Professor of Chemistry 2005-2009 Associate Professor of Chemistry 2006 Sabbatical Visitor, Harvard University, with Sunney Xie in Chemistry & Chemical Biology 2006 Distinguished Visitor, JILA, Boulder, with David Nesbitt 2002-2005 Dow Corning Assistant Professor of Chemistry 1999-2005 Assistant Professor of Chemistry 1999-present Member of the Biophysics (since 1999), Applied Physics (since 2000), Cellular & Molecular Biology (since 2001), and Chemical Biology (since 2005) Interdepartmental Graduate Programs University of Michigan, Ann Arbor POSTDOCTORATE 1996-1999 Postdoctoral Research Fellow with Prof. John M. Burke, University of Vermont; Subject: Biophysical Studies of the Hairpin Ribozyme 1995 Postdoctoral Research Fellow with Nobel laureate Prof.
    [Show full text]
  • Interview with Melvin I. Simon
    MELVIN I. SIMON (b. 1937) INTERVIEWED BY SHIRLEY K. COHEN May 24 and June 5, 2005 Melvin I. Simon ARCHIVES CALIFORNIA INSTITUTE OF TECHNOLOGY Pasadena, California Subject area Biology Abstract Interview in two sessions, May 24 and June 5, 2005, with Melvin I. Simon, Anne P. and Benjamin F. Biaggini Professor of Biological Sciences, emeritus, in the Division of Biology. Dr. Simon received his BS from City College of New York in 1959 and his PhD in biochemistry from Brandeis in 1963. After receiving his degree, he was a postdoctoral fellow with Arthur Pardee at Princeton for a year and a half and then joined the faculty of the University of California at San Diego. In 1978, Dr. Simon and his UCSD colleague John Abelson established the Agouron Institute in San Diego, focusing on problems in molecular biology. He (along with Abelson) joined the faculty of Caltech as a full professor in 1982, and he served as chair of the Biology Division from 1995 to 2000. http://resolver.caltech.edu/CaltechOH:OH_Simon_M In this interview, he discusses his education in Manhattan’s Yeshiva High School (where science courses were taught by teachers from the Bronx High School of Science), at CCNY, and as a Brandeis graduate student working working with Helen Van Vunakis on bacteriophage. Recalls his unsatisfactory postdoc experience at Princeton and his delight at arriving at UC San Diego, where molecular biology was just getting started. Discusses his work on bacterial organelles; recalls his and Abelson’s vain efforts to get UCSD to back a full-scale initiative in molecular biology and their subsequent founding of their own institute.
    [Show full text]
  • Curriculum Vitae
    1 CURRICULUM VITAE David Ross Engelke EDUCATION 1974 University of Wisconsin, Madison, B.S. (Biochemistry) 1979 Washington University, St. Louis, Ph.D. (Biological Chemistry) Advisor: Robert G. Roeder POSTDOCTORAL TRAINING 1979-1983 Postdoctoral Fellow, Department of Chemistry, University of California, San Diego, La Jolla, California, Advisor: John Abelson ACADEMIC APPOINTMENTS 1983-1989 Assistant Professor, Department of Biological Chemistry, The University of Michigan, Ann Arbor, Michigan 1989-1996 Associate Professor, Department of Biological Chemistry, The University of Michigan 1996-2015 Professor, Department of Biological Chemistry, University of Michigan 1995 Interim Director, Medical Scientist Training Program 1995-1998 Director, Cellular and Molecular Biology Ph.D. Program, The University of Michigan 1998-2007 Founding Director, Program in Biomedical Sciences, The University of Michigan 2000-2007 Assistant Dean, Graduate and Postdoctoral Studies, UM Medical School 2008-2012 Associate Dean, H. H. Rackham School of Graduate Studies University of Michigan 2009-2010 Founding Director, Michigan Postbaccalaureate Research Education Program (PREP) 2010-2015 Associate Director, Michigan PREP 2013-2015 Chair, Department of Biological Chemistry, University of Michigan 2015-present Professor of Chemistry, University of Colorado Denver | Anschutz Professor of Biochemistry and Molecular Genetics, UC Denver | Anschutz Dean of the Graduate School, UC Denver | Anschutz CONSULTING POSITIONS 1989-1994 Parke-Davis 1990/91 Merck Inc. 1994 NeXstar,
    [Show full text]
  • CURRENT TECHNOLOGY and RESOURCE NEEDS the Specific and Primary Agouronpurposes Are to Perform Research in the Sciences
    The Agouron Institute GEOBIOLOGY CURRENT TECHNOLOGY and RESOURCE NEEDS The specific and primary AGOURONpurposes are to perform research in the sciences INSTITUTEand in mathematics, to disseminate the results obtained therefrom, all to benefit mankind. Cover photo: Phototrophic sulfur and non-sulfur bacteria in an enrichment from a microbial mat reveal part of the enormous diversity of microorganisms. © 2001 The Agouron Institute 45 GEOBIOLOGY CURRENT TECHNOLOGY and RESOURCE NEEDS The Agouron Institute INTRODUCTION 3 GEOBIOLOGY: 5 Current Research General Overview 5 Advances in Probing The Rock Record 6 Advances in Molecular Biology and Genomics 9 Current Research Directions 11 Questions of What and When: Detecting Life in the Geologic Record 12 Molecular Fossils 12 Morphological Fossils 14 Isotopic Signatures 16 Question of Who and How: Deciphering the Mechanisms of Evolution 18 Genetic Diversity 18 Microbial Physiology 20 Eukaryotic Systems 23 Experimental Paleogenetics 25 GEOBIOLOGY: Resource Needs 29 An Intensive Training Course in Geobiology 30 A Postdoctoral Fellowship Program in Geobiology 31 Support for Specific Research Projects 32 REFERENCES 34 2 Agouron Institute had expanded considerably and had obtained additional funding from the NSF and the NIH. A group of molecular biologists and chemists were collaborating to exploit new technology in which synthetic oligonucleotides were used to direct specific mutations in genes. A crystallography group had been INTRODUCTION formed and they were collaborating with the molecular biologists to study the properties of the altered proteins. These were among the very first applications of the new technology to form what is now the very ith the discovery of recombi- large field of protein engineering.
    [Show full text]
  • California Meetings
    California Meetings An artist’s rendering of what the Archean earth looked like at the time of the rise of oxygen. The Birth of Oxygen John Abelson This presentation was given at a meeting of the American Academy, held at the University of California, San Diego, on November 17, 2006. John Abelson is George Beadle Professor of Biology, Emeritus, at the California Institute of Technology, Adjunct Professor of Biochemistry at the University of California, San Francisco, and the President of the Agouron Institute. He has been a Fellow of the American Academy since 1985. We take it for granted that our atmosphere thesis was, after the origin of life itself, the The closely linked evolution of photosyn- contains oxygen, but we and most other ani- most important development in the history thesis and the evolution of the atmosphere is mals would die within minutes if the oxygen of our planet. About twelve times as much perhaps the best example of the interdepen- was removed. It is not widely appreciated energy is derived from the aerobic metabo- dence of biological and geological processes. that for half of the earth’s history there was lism of a molecule of glucose as the energy In chronicling the rise of oxygen, I will ½rst virtually no oxygen in the atmosphere. Oxy- obtained from anaerobic metabolism. With- describe photosynthesis and its origins. Then gen appeared 2.45 billion years ago, and it has out the invention of oxygenic photosynthe- I will turn to a discussion of the state of the been present ever since–though not always sis, multicellular organisms could not have earth and its atmosphere before and during at its present level of 21 percent.
    [Show full text]
  • Identification of Five Putative Yeast RNA Helicase Genes
    Proc. Nati. Acad. Sci. USA Vol. 87, pp. 1571-1575, February 1990 Biochemistry Identification of five putative yeast RNA helicase genes (gene family/degenerate oligonucleotides/polymerase chain reaction) TIEN-HsIEN CHANG, JAIME ARENAS, AND JOHN ABELSON Division of Biology 147-75, California Institute of Technology, Pasadena, CA 91125 Contributed by John Abelson, December 5, 1989 ABSTRACT The RNA helicase gene family encodes a characterized Drosophila gene vasa (7); yeast genes TIFI, group of eight homologous proteins that share regions of TIF2, and MSSJ16 (8, 9); as well as mouse PLIO gene (10). sequence similarity. This group of evolutionarily conserved Based on the amino acid sequence alignments of these pro- proteins presumably all utilize ATP (or some other nucleoside teins, an additional gene family, the RNA helicase gene family, triphosphate)' as an energy source for unwinding double- consisting of both established and putative RNA helicase stranded RNA. Members of this family have been implicated in genes, was defined (11). Although the sequence conservation a variety of physiological functions in organisms ranging from is spread out over a stretch of 420 amino acids, several Escherichia coli to human, such as translation initiation, mito- sequence elements are especially striking. The sequence D X4 chondrial mRNA splicing, ribosomal assembly, and germinal A X4 G K T, found in all eight proteins, is typical for the A line cell differentiation. We have applied polymerase chain motif of ATP binding proteins (12-14). The D E A D reaction technology to search for additional members of the box, (V/I) L D E A D X2 L, on the other hand, represents a RNA helicase family in the yeast Saccharomyces cerevisiae.
    [Show full text]
  • Understanding Pre-Mrna Dynamics in Single Spliceosome Complexes
    Understanding Pre-mRNA Dynamics in Single Spliceosome Complexes by Ramya Krishnan A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Chemistry) in the University of Michigan 2013 Doctoral Committee: Professor Nils G. Walter, Chair Professor Hashim M. Al-Hashimi Professor Carol A. Fierke Assistant Professor Aaron C. Goldstrohm © Ramya Krishnan 2013 To amma, appa, Chikki, Girish and Abhi ii Acknowledgements First, I would like to thank my advisor, Dr. Nils Walter for taking me into his group and giving me the independence to pursue the science I wanted to. My days spent doing experiments have been fun alongside Mario Blanco and Matt Kahlscheuer, whom I have to thank for being great colleagues with a solid team spirit. I am honored to have worked in close collaboration with two great scientists in the field, Drs. John Abelson and Christine Guthrie. I would like to thank them for the insightful and encouraging discussions. For my time spent as a GSI, and for being a source of constant encouragement and support, I want to extend my wholehearted gratitude to Dr. Kathleen Nolta. Finally I would like to thank my friends in the Walter lab for maintaining a congenial environment, full of fun and life. Of course, none of this would be possible without the unconditional love and support from mom, dad and my sister. My mom has always encouraged me to excel in whatever I did, and my dad has set an example for the confident person I am today. I know this will make them proud.
    [Show full text]
  • Nobel Prize Biography
    5/3/2019 Thomas A. Steitz - Biographical This website uses cookies to improve the user experience. By using this website you consent to all cookies in accordance with our cookie policy. I understand Thomas A. Steitz More Thomas A. Steitz Biographical was born in Milwaukee, Wisconsin in 1940, and my family lived in an apartment above a paint store in the downtown I area until 1949. Although my father had obtained a law degree from Marquette University in Milwaukee, he became the administrator in charge of personnel at the Milwaukee County Hospital. My mother grew up on a farm in Waukesha county outside of Milwaukee and graduated from Carol College, a small college in Waukesha. My mother devoted her time to all of the domestic chores required for raising a family which eventually grew to five children – two younger brothers and two younger sisters. My father’s parents lived about 20 blocks away and my mother’s parents and her brother’s family lived on the family farm in Waukesha county. I attended elementary school at the Elm Street School, an old brick building with an asphalt playground located a few blocks from our apartment. I did not like the school much and often got beaten up by a bunch of slightly older guys on my way home from school. My report card, which I brought home for my parents’ signatures at the end of second grade, showed grades that were just above failure. My parents were upset and https://www.nobelprize.org/prizes/chemistry/2009/steitz/biographical/ 1/24 5/3/2019 Thomas A.
    [Show full text]
  • National-Academies-Letter.Pdf
    July 6, 2009 Dear Governor Schwarzenegger: The three hundred signers of this letter write to you as members of the US National Academy of Sciences, the National Academy of Engineering, and the Institute of Medicine, and as professors at the University of California to express our deep concern about the latest round of proposed cuts to the UC budget. Current proposals being weighed by your office and the Legislature call for a 19% reduction from 2007-8 levels in state support for UC, producing an $800 million shortfall in the UC budget for the 2009-10 fiscal year. This will lead to increases in student fees, reductions in pay or furloughs for faculty and staff, and cuts in virtually all University services. These cuts will be devastating to every part of the University’s mission, but as scientists and engineers we are particularly concerned about their effects on the future of science and technology in California. While we recognize that our state faces an unprecedented financial crisis, the proposed cuts come on top of a decades-long trend of declining state support for the University of California. The situation has reached a breaking point. Further cuts of the magnitude being contemplated in the latest round of budget proposals are likely to destroy UC’s status as the leading public university in the United States. This would undermine prospects for economic recovery and damage California’s competitiveness for decades. Before making a decision in the heat of a crisis that will have negative consequences for decades to come, we ask that you consider the following: • It is estimated that 85% of per capita economic growth in the United States is due to technological change1, and the University of California has been a leading driver of that change.
    [Show full text]
  • Interview with Seymour Benzer
    SEYMOUR BENZER (1921-2007) INTERVIEWED BY HEIDI ASPATURIAN September 11, 1990–February 1991 Photo by Floyd Clark ARCHIVES CALIFORNIA INSTITUTE OF TECHNOLOGY Pasadena, California Subject area Biology, biophysics Abstract Interview conducted in eleven sessions between September 1990 and February 1991 with Seymour Benzer, James G. Boswell Professor of Neuroscience in the Division of Biology. Benzer received his PhD in physics from Purdue in 1947. His interests had already turned to biophysics, after he read Erwin Schrödinger’s What is Life? In this lengthy interview he recounts his peripatetic life visiting Oak Ridge National Laboratory (1948-49); Max Delbrück at Caltech (1949-51); the Pasteur Institute with André Lwoff, François Jacob, and Jacques Monod (1951-52); the Cavendish Laboratory at Cambridge, with Francis Crick and Sydney Brenner (1957-1958); Roger Sperry’s lab at Caltech (1965-67); and intermittently Woods Hole and Cold Spring Harbor—all while he was also a member first of the physics and then the biology faculty at Purdue (1945-1967). In the early 1960s, he participated for a while in the establishment of the Salk Institute. In 1967 he became a professor of biology at Caltech, meanwhile spending summers in the early 1970s at the Salk Institute; recollections of the Biology Division and of Salk during that time. He discusses the early years and flourishing of molecular biology, including recollections of such pioneers as http://resolver.caltech.edu/CaltechOH:OH_Benzer_S Salvador Luria, Renato Dulbecco, Francis Crick, James Watson, Gunther Stent, and Delbrück’s phage group. He discusses his own work on r mutants of bacteriophage, genetic fine structure, behavioral mutants of Drosophila, and monoclonal antibodies.
    [Show full text]
  • John Abelson, Karl Hostetler, Dan Lindsley and John Wheatley Receive John Simon Guggenheim Fellowships
    John Abelson, Karl Hostetler, Dan Lindsley and John Wheatley receive John Simon Guggenheim fellowships April 9, 1980 Four University of California, San Diego faculty members are among 276 scholars, scientists and artists chosen to receive John Simon Guggenheim fellowships for 1980. The winners were chosen from among 3,066 applicants in the foundation's 56th competition. The four UC San Diego Guggenheim Fellows are: Dr. John N. Abelson, professor of chemistry; Dr. Karl Y. Hostetler, associate professor of medicine in residence; Dr. Dan L. Lindsley, professor of biology, and Dr. John C. Wheatley, professor of physics. The fellowships were awarded on the basis of demonstrated accomplishment in the past and strong promise for the future. The winners were selected by an academic committee based on applications and the worthiness of their research proposals. In all, 96 institutions are represented by one or more fellows. Abelson, a member of the UC San Diego faculty for 11 years, is recognized as being a leader in the research of genetic regulation, particularly nucleic acid structure and function. As a Guggenheim Fellow he will continue his studies in this field through a proposal titled, "The Mechanism of Gene Expression in Higher Organisms." Hostetler came to UC San Diego in 1973. His research interests are in phospholipid bile synthesis. He has traveled to Russia to study cancer cells to see if he could find any abnormalities in the way in which the Russians make phospholipids that might account for the differences sometimes found in phospholipids common to cancer cells. Hostetler's research proposal for his Guggenheim Fellowship is titled "Studies in the Biochemistry of Lipids." Lindsley joined the UC San Diego faculty in 1967 and served as chairman of the Department of Biology from 1977 to 1979.
    [Show full text]
  • Voided Matls Licensing Action for License 34-00738-07 for Case
    _______ ___-__ - _ _-_ - _ _ _ _ _ - _ 's ' < a VOID SHEET TO: License Fee Management Branch r 1 FROM: Rlli - _ James MullaueL \ ( SUBJECT: VOIDED APPLICATION Control Number: 303322___ Applicant: Case Western Rese<ve University License Number: 34-00738-07_ Docket Number: 030-07040 {_ 1 Date Voided: 12/18/97 Reason for Void: The licensee's reauest does not require an amendment. A Dhb > > o a L2fl.? 99 ' ' ' / f Signa}ture ( Date Attachment: Official Record Copy of Voided Action l FOR LFMB USE ONLY b Refund Authorized and processed - / \ No Refund Due ; Fee Exempt or Fee Not Required g\g' Comments: Log completed Processed by: . 5 /rd /J k , [i 9712290059 97121s - PDR ADOCK 03007040 f ||;' | h gj C PM - ** * * - I - - _ _ - . - . ,. - 3 (FOR LFM5 USE) INFORMAT!DN FRp'. LTS O BETWEEN: -------------------- i :- License Fee Management Branch, ARM Program Code: 03510 and Status Code: 0 ! --Q Regional Licensing 3ections Fee Cate r: EI 3E Esp. Dat 0011031 : Fee Comments: 170.11(A)(4) Decom Fin Assur Reqdt N O ::::::::::::::::::::::::::::::::::::: LICENSE FEE TRANSMITTAL O A. REC 10N 1. APPLICATION ATTACHED $ Q Applicant / Licensee CASE WESTERN RESERVE UNIVERSITY ' Received Date 971114 '1, Docket No 3007040 -- Control No.: 303322 a License No. 34-00738-07 :: Q Action Types (;m e= 1me nt 2. FEE ATTACHED Amounts Q ,, ,,,, G seck No.: ,,,, __,_, a c~ 3. COMMENTS j ' O si n,, , je- Da e [[[[[h , E f:7 [' '_'',, Q B. LICENSE FEE MANAGEMENT BRANCH (C esh, epsmiWiton is entered /_/),/ * 1. FeeCategoryandAmountsfh _ k L .. ,__,,_______ 2.
    [Show full text]