DOCSLIB.ORG

Structure of Autoinhibited Akt1 Reveals Mechanism of PIP3-Mediated Activation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Structure of Autoinhibited Akt1 Reveals Mechanism of PIP3-Mediated Activation Structure of autoinhibited Akt1 reveals mechanism of PIP3-mediated activation Linda Truebesteina,b, Harald Horneggera,b, Dorothea Anratherc, Markus Hartlc, Kaelin D. Flemingd, Jordan T. B. Starihad, Els Pardone,f, Jan Steyaerte,f, John E. Burked,g, and Thomas A. Leonarda,b,1 aDepartment of Structural and Computational Biology, Max Perutz Labs, Vienna BioCenter, 1030 Vienna, Austria; bDepartment of Medical Biochemistry, Medical University of Vienna, 1090 Vienna, Austria; cMass Spectrometry Core Facility, Max Perutz Labs, Vienna BioCenter, 1030 Vienna, Austria; dDepartment of Biochemistry and Microbiology, University of Victoria, Victoria, BC V8W 2Y2, Canada; eStructural Biology Brussels, Vrije Universiteit Brussel (VUB), 1050 Brussels, Belgium; fVIB-VUB Center for Structural Biology, Vlaams Instituut voor Biotechnologie (VIB), 1050 Brussels, Belgium; and gDepartment of Biochemistry and Molecular Biology, The University of British Columbia, Vancouver, BC V6T 1Z3, Canada Edited by Natalie G. Ahn, University of Colorado, Boulder, CO, and approved July 11, 2021 (received for review February 1, 2021) The protein kinase Akt is one of the primary effectors of growth reveal an interface of ∼1,500 Å2 of buried surface area (27–29). factor signaling in the cell. Akt responds specifically to the lipid Stoichiometric phosphorylation of the activation loop in combi- second messengers phosphatidylinositol-3,4,5-trisphosphate [PI(3,4,5) nation with a phosphomimetic aspartate substitution in the hy- P3] and phosphatidylinositol-3,4-bisphosphate [PI(3,4)P2] via its PH do- drophobic motif is insufficient to overcome the requirement for main, leading to phosphorylation of its activation loop and the hy- PI(3,4,5)P3 or PI(3,4)P2 for full activity (20). Accordingly, im- drophobic motif of its kinase domain, which are critical for activity. aging of the Akt-substrate complex in live cells revealed that Akt We have now determined the crystal structure of Akt1, revealing an is active only in its membrane-bound state (23). Within the cell autoinhibitory interface between the PH and kinase domains that is interior, PI(3,4)P has been shown to control Akt signaling on often mutated in cancer and overgrowth disorders. This interface per- 2 sists even after stoichiometric phosphorylation, thereby restricting endosomal membranes (23, 30, 31). Whether PIP3 or PI(3,4)P2 is necessary for sustained Akt ac- maximum Akt activity to PI(3,4,5)P3-orPI(3,4)P2-containing mem- branes. Our work helps to resolve the roles of lipids and phosphory- tivity in the cell, however, is still controversial. It was recently lation in the activation of Akt and has wide implications for the reported that Akt could not be activated by PI(3,4,5)P3 in vitro but that it could be activated independently of lipids by phos- spatiotemporal control of Akt and potentially lipid-activated kinase BIOCHEMISTRY signaling in general. phorylation of its hydrophobic motif (21). The authors proposed that phosphorylation of S473 activates Akt through the formation kinase | signaling | lipid | PIP3 | Akt of an electrostatic interaction with a conserved basic residue (R144) in the PH-kinase domain linker, thereby relieving PH domain- kt is a serine/threonine protein kinase essential for cell mediated autoinhibition. More recently, the mechanism by which Agrowth, proliferation, and metabolism (1, 2). Growth factor S473 phosphorylation induces PH domain displacement and, and insulin signaling via receptor tyrosine kinases activate class I thereby, Akt activation was reported to rely on a conformational phosphoinositide 3-kinase (PI3K), which generates the lipid sec- change in the PH domain (32). In this model, Akt can be activated ond messenger phosphatidylinositol-3,4,5-trisphosphate [PI(3,4,5) by phosphorylation, independent of its binding to PI(3,4,5)P3 or P3]. Akt is activated by PIP3 in the membrane and phosphorylates up to 100 substrates in diverse physiological processes (3). Significance Hyperactivation of the PI3K-Akt pathway is frequently observed in human cancers and overgrowth disorders (4), while autosomal Akt is an essential protein kinase that controls cell growth, dominant inactivation of Akt2 leads to insulin resistance and survival, and metabolism. Akt is activated by the lipid second diabetes (5). messengers PIP and PI(3,4)P and by phosphorylation. How- Akt comprises an N-terminal lipid-binding PH domain with 3 2 ever, the relative contributions of lipid binding and phos- specificity for PI(3,4,5)P and phosphatidylinositol-3,4-bisphos- 3 phorylation to Akt activity in the cell are controversial. Here, phate [PI(3,4)P ](6–8) and a C-terminal AGC kinase domain 2 we have determined the structure of autoinhibited Akt1, which characterized by the presence of a regulatory tail at its C terminus reveals how the lipid-binding PH domain maintains the kinase (9). The C-tail of human Akt1 contains two phosphorylation sites, domain in an inactive conformation in the absence of PIP . one in the turn motif (T450) and one in the hydrophobic motif 3 Despite stoichiometric phosphorylation, Akt adopts an auto- (S473). Phosphorylation of the turn motif occurs cotranslationally inhibited conformation with low basal activity in the absence (10), protects Akt from ubiquitin-mediated degradation (10, 11), of PIP . Our work reveals the mechanistic basis of Akt hyper- and is unaffected by growth factor signaling (11). Recruitment of 3 activation in cancer and overgrowth diseases and unambigu- Akt to PI(3,4,5)P in the plasma membrane promotes its phos- 3 ously establishes that Akt depends on lipids for activity in phorylation by phosphoinositide-dependent kinase 1 (PDK1) in its the cell. activation loop (T308) (12, 13) and by mTORC2 in its hydro- phobic motif (14), rendering it active against substrates. S473 Author contributions: L.T., H.H., J.E.B., and T.A.L. designed research; L.T., H.H., K.D.F., phosphorylation promotes a disorder-to-order transition of the J.T.B.S., and T.A.L. performed research; H.H., E.P., and J.S. contributed new reagents/an- hydrophobic motif (15) that, in synergy with activation loop alytic tools; L.T., H.H., D.A., M.H., K.D.F., J.T.B.S., J.E.B., and T.A.L. analyzed data; and phosphorylation and ATP, stabilizes a phosphatase-resistant active T.A.L. wrote the paper. conformation (16–20) that exhibits catalytic activity orders of The authors declare no competing interest. magnitude higher than unphosphorylated Akt (21, 22). Akt lack- This article is a PNAS Direct Submission. ing phosphorylation of these sites is catalytically inactive (23). This open access article is distributed under Creative Commons Attribution License 4.0 Akt exists in an autoinhibited conformation in the cytosol of (CC BY). unstimulated cells, characterized by an intramolecular interac- 1To whom correspondence may be addressed. Email: [email protected]. tion between its PH domain and the substrate-binding cleft of its This article contains supporting information online at https://www.pnas.org/lookup/suppl/ kinase domain (20, 23–26). Crystal structures of C-terminally doi:10.1073/pnas.2101496118/-/DCSupplemental. truncated Akt1 in complex with various allosteric inhibitors Published August 12, 2021. PNAS 2021 Vol. 118 No. 33 e2101496118 https://doi.org/10.1073/pnas.2101496118 | 1of11 Downloaded by guest on September 30, 2021 PI(3,4)P2. The respective roles of PIP3 and phosphorylation in the and mediating essential crystal lattice contacts. Previously repor- control of Akt activity are therefore an open question. ted mutations in Akt1, Akt2, and Akt3 associated with Proteus In order to resolve the molecular mechanisms of Akt activation, Syndrome, several cancers, and megalencephalies (33–38) and we have determined the high-resolution structure of Akt1 in com- mutations in Akt1 that drive growth factor-independent cell sur- plex with a nanobody, detailing the autoinhibitory interface between vival in vitro (39) all map to the autoinhibitory interface (Fig. 1D). the PH and kinase domains. This interface both sequesters the In our structure, the PH domain is rotated ∼23° with respect to the PIP3-binding site of the PH domain and is mutually exclusive with structure of Akt in complex with allosteric inhibitors (27–29), the active conformation of the kinase domain. Rare mutations of leading to an overall root mean square deviation of 9.04 Å over Akt associated with cancer (33) and overgrowth disorders (34–36) the whole PH domain (Fig. 1E and SI Appendix, Fig. S2F), indi- map to this autoinhibitory interface. By combining a spectrum of cating that allosteric inhibitors severely distort the autoinhibitory biophysical, structural, and biochemical techniques, we demonstrate interaction between the PH and kinase domains. In the absence of that, while stoichiometric activation loop and hydrophobic motif the C-terminal 35 amino acids, which comprise the turn motif phosphorylation increase the basal kinase activity of Akt1 in vitro, (T450) and the hydrophobic motif (S473), density was not ob- they do not completely relieve autoinhibition by its PH domain. Our served for the glycine-rich loop (residues 154 to 157), αChelix findings provide clear evidence that full activation of Akt is de- (residues 180 to 196), or the activation loop (residues 289 to 306), pendent on both phosphorylation and lipid binding and, therefore, though inspection of the structure reveals that there are no bar- that its activity against cellular substrates is most likely restricted to riers to the αC helix or the glycine-rich loop from
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Cambridge's 92 Nobel Prize Winners Part 2 - 1951 to 1974: from Crick and Watson to Dorothy Hodgkin
    Cambridge's 92 Nobel Prize winners part 2 - 1951 to 1974: from Crick and Watson to Dorothy Hodgkin By Cambridge News | Posted: January 18, 2016 By Adam Care The News has been rounding up all of Cambridge's 92 Nobel Laureates, celebrating over 100 years of scientific and social innovation. ADVERTISING In this installment we move from 1951 to 1974, a period which saw a host of dramatic breakthroughs, in biology, atomic science, the discovery of pulsars and theories of global trade. It's also a period which saw The Eagle pub come to national prominence and the appearance of the first female name in Cambridge University's long Nobel history. The Gender Pay Gap Sale! Shop Online to get 13.9% off From 8 - 11 March, get 13.9% off 1,000s of items, it highlights the pay gap between men & women in the UK. Shop the Gender Pay Gap Sale – now. Promoted by Oxfam 1. 1951 Ernest Walton, Trinity College: Nobel Prize in Physics, for using accelerated particles to study atomic nuclei 2. 1951 John Cockcroft, St John's / Churchill Colleges: Nobel Prize in Physics, for using accelerated particles to study atomic nuclei Walton and Cockcroft shared the 1951 physics prize after they famously 'split the atom' in Cambridge 1932, ushering in the nuclear age with their particle accelerator, the Cockcroft-Walton generator. In later years Walton returned to his native Ireland, as a fellow of Trinity College Dublin, while in 1951 Cockcroft became the first master of Churchill College, where he died 16 years later. 3. 1952 Archer Martin, Peterhouse: Nobel Prize in Chemistry, for developing partition chromatography 4.
    [Show full text]
  • Signaling in the Type I Interferon Antiviral Innate Immune Response
    Signaling in the type I interferon antiviral innate Most vertebrate cells respond to viral infection by producing and sensing NF-κB, transcription factors that trigger the expression of genes encod- immune response type I interferon (IFN), which establishes an antiviral state characterized ing type I IFN proteins and other mediators of innate immune activation. by inhibition of viral replication, apoptosis of infected cells, and stimu- Type I IFN proteins bind to the type I IFN receptor and activate Janus ki- David E Levy & Isabelle J Marié lation of innate immune mechanisms that augment subsequent adaptive nase–signal transducer and activator of transcription (Jak-STAT) signaling 4,2 immune responses. Vertebrate cells detect virus infection either via the and formation of the trimeric transcription factor complex ISGF3, which #$ cytoplasmic RNA helicase sensors RIG-I and MDA-5, the cytoplasmic promotes expression of antiviral effector proteins as well as proteins that -$ DNA-dependent activator of IFN-regulatory factor (DAI), and/or via a positively and negatively modulate subsequent signaling. This poster high- pathway initiated by transmembrane Toll-like receptors (TLRs). All path- lights common and distinct components of these pathways that together ways culminate in activation of interferon regulatory factor (IRF) and lead to a highly orchestrated innate immune response to viral infection. 42!- -!, 42)& -Y$ Pathogen recognition: the cytosolic pathway and TYK2 kinases, respectively. IFN binding results in kinase Many viruses replicate in the cell cytoplasm after invading cells activation, receptor phosphorylation, and STAT protein recruit- )2!+ 2)0 by fusion either with the plasma membrane or with endosomal ment and tyrosine phosphorylation.
    [Show full text]
  • Abx651433 Datasheet.Pdf
    Datasheet Version: 3.0.0 Revision date: 23 Apr 2021 Human Protein Kinase R (PKR) Protein (Active) Catalogue No.:abx651433 SDS-PAGE analysis of recombinant Human PKR. Western blot analysis of recombinant Human PKR, using PKR antibody (abx128520). Gene sequencing extract of recombinant Human PKR. Binding activity of PKR with CDK1. For Reference Only Human Protein Kinase R (PKR) Protein (Active) is a recombinant active Human protein expressed in E. coli. Target: Protein Kinase R (PKR) Origin: Human Tested Applications: WB, SDS-PAGE v1.0.0 Abbexa LTD, Cambridge, UK · Phone: +44 (0) 1223 755950 · Fax: +44 (0) 1223 755951 1 of 3 Abbexa LLC, Houston, TX USA · Phone: +1 832 327 7413 Website: www.abbexa.com · Email: [email protected] Datasheet Version: 3.0.0 Revision date: 23 Apr 2021 Host: E. coli Conjugation: Unconjugated Form: Lyophilized Purity: > 80% Reconstitution: Reconstitute to the original concentration in ddH2O. If further dilutions are required, dilute in 20 mM Tris, 150 mM NaCl, pH 8.0, to a concentration of 0.1-1.0 mg/ml. Do not vortex. Storage: Store at 2-8 °C for up to one month. Store at -80 °C for up to one year. Avoid repeated freeze/thaw cycles. UniProt Primary AC: P19525 (UniProt, ExPASy) KEGG: hsa:5610 String: 9606.ENSP00000233057 Molecular Weight: Calculated MW: 35.8 kDa Observed MW: 32 kDa Possible reasons why the actual band size differs from the predicted band size: 1. Splice variants. Alternative splicing may create different sized proteins from the same gene. 2. Relative charge. The composition of amino acids may affect the charge of the protein.
    [Show full text]
  • 14-3-3 Proteins Inactivate DAPK2 by Promoting Its Dimerization And
    ARTICLE https://doi.org/10.1038/s42003-021-02518-y OPEN 14-3-3 proteins inactivate DAPK2 by promoting its dimerization and protecting key regulatory phosphosites ✉ ✉ Matej Horvath 1,2, Olivia Petrvalska1,2, Petr Herman 3, Veronika Obsilova 2 & Tomas Obsil 1,2 Death-associated protein kinase 2 (DAPK2) is a CaM-regulated Ser/Thr protein kinase, involved in apoptosis, autophagy, granulocyte differentiation and motility regulation, whose activity is controlled by autoinhibition, autophosphorylation, dimerization and interaction with scaffolding proteins 14-3-3. However, the structural basis of 14-3-3-mediated DAPK2 reg- ulation remains unclear. Here, we structurally and biochemically characterize the full-length 1234567890():,; human DAPK2:14-3-3 complex by combining several biophysical techniques. The results from our X-ray crystallographic analysis revealed that Thr369 phosphorylation at the DAPK2 C terminus creates a high-affinity canonical mode III 14-3-3-binding motif, further enhanced by the diterpene glycoside Fusicoccin A. Moreover, concentration-dependent DAPK2 dimerization is disrupted by Ca2+/CaM binding and stabilized by 14-3-3 binding in solution, thereby protecting the DAPK2 inhibitory autophosphorylation site Ser318 against depho- sphorylation and preventing Ca2+/CaM binding. Overall, our findings provide mechanistic insights into 14-3-3-mediated DAPK2 inhibition and highlight the potential of the DAPK2:14- 3-3 complex as a target for anti‐inflammatory therapies. 1 Department of Physical and Macromolecular Chemistry, Faculty of Science, Charles University, Prague, Czech Republic. 2 Department of Structural Biology of Signaling Proteins, Division BIOCEV, Institute of Physiology of the Czech Academy of Sciences, Vestec, Czech Republic. 3 Institute of Physics, Faculty of ✉ Mathematics and Physics, Charles University, Prague, Czech Republic.
    [Show full text]
  • Muscle Wasting in Myotonic Dystrophies: a Model of Premature Aging
    REVIEW published: 09 July 2015 doi: 10.3389/fnagi.2015.00125 Muscle wasting in myotonic dystrophies: a model of premature aging Alba Judith Mateos-Aierdi 1,2, Maria Goicoechea 1,2, Ana Aiastui 2,3, Roberto Fernández-Torrón 1,2,4, Mikel Garcia-Puga 5, Ander Matheu 5 and Adolfo López de Munain 1,2,4,6* 1 Neuroscience Area, Biodonostia Health Research Institute, San Sebastián, Spain, 2 CIBERNED, Instituto Carlos III, Ministerio de Economía y Competitividad, Madrid, Spain, 3 Cell Culture Platform, Biodonostia Health Research Institute, San Sebastián, Spain, 4 Department of Neurology, Hospital Universitario Donostia, San Sebastián, Spain, 5 Oncology Area, Biodonostia Health Research Institute, San Sebastián, Spain, 6 Department of Neuroscience, Universidad del País Vasco UPV-EHU, San Sebastián, Spain Myotonic dystrophy type 1 (DM1 or Steinert’s disease) and type 2 (DM2) are multisystem disorders of genetic origin. Progressive muscular weakness, atrophy and myotonia are the most prominent neuromuscular features of these diseases, while other clinical manifestations such as cardiomyopathy, insulin resistance and cataracts are also common. From a clinical perspective, most DM symptoms are interpreted as a result of an accelerated aging (cataracts, muscular weakness and atrophy, cognitive decline, metabolic dysfunction, etc.), including an increased Edited by: Jaime J. Carvajal, risk of developing tumors. From this point of view, DM1 could be described as Centro Andaluz de Biología del a progeroid syndrome since a notable age-dependent dysfunction of all systems Desarrollo, Spain occurs. The underlying molecular disorder in DM1 consists of the existence of Reviewed by: a pathological (CTG) triplet expansion in the 3’ untranslated region (UTR) of the John Charles McDermott, York University, Canada Dystrophia Myotonica Protein Kinase (DMPK) gene, whereas (CCTG)n repeats in Daniela Palacios, the first intron of the Cellular Nucleic acid Binding Protein/Zinc Finger Protein Fondazione Santa Lucia, Italy 9 (CNBP/ZNF9) gene cause DM2.
    [Show full text]
  • Max Ferdinand Perutz 1914–2002
    OBITUARY Max Ferdinand Perutz 1914–2002 Max Ferdinand Perutz, who died on in the MRC Laboratory of Molecular 6 February, will be remembered as Biology, which has grown to house one of the 20th century’s scientific over 400 people. He published over giants. Often referred to as the ‘fa- 100 papers and articles during his re- ther of molecular biology’, his work tirement. Once asked why he didn’t re- remains one of the foundations on tire at 65 he replied that he was tied up which science is being built today. in some very interesting research at Born in Vienna in 1914, Max was the time. Until the Friday before educated in the Theresianum, a Christmas, he was active in the lab al- grammar school originating from most every day, submitting his last an earlier Officers’ academy. His paper just a few days before then. parents suggested that he study law Max’s scientific interests ranged far to prepare for entering the family beyond medical research. As a sideline, business, but he chose to study he also worked on glaciers in his chemistry at the University of youth. He studied the transformation Vienna. of snowflakes that fall on glaciers into In 1936, with financial support the huge single ice crystals that make from his father, he began a PhD at the Cavendish up its bulk, and the relationship between the mechanical Laboratory in Cambridge. Using X-ray crystallography he properties of ice measured in the laboratory and the mecha- aimed to determine the structure of hemoglobin. But the nism of glacier flow.
    [Show full text]
  • Double Stranded RNA Dependent Protein Kinase (PKR) and Type 2 Diabetes
    Pharmacy & Pharmacology International Journal Mini Review Open Access Double stranded RNA dependent protein kinase (PKR) and type 2 diabetes Abstract Volume 2 Issue 2 - 2015 Type 2 diabetes greatly increases the risk for developing cardiovascular and metabolic Arti Dhar,1 Priyanka Reddy,1 Audesh Bhat,2 disorders. Despite recent development in medical science, scientific understandings 3 on the root mechanisms of type 2 diabetes are still not fully understood, and such Indu Dhar 1Department of Pharmacy, Birla Institute of Technology and insufficient understanding contributes to the relative lack of effective treatments Sciences Pilani, India for such diseases. Protein Kinase R (PKR) is a serine threonine kinase activated 2Department of Microbiology & Immunology, University of during various stress conditions. Activation of PKR can increase reactive oxygen Saskatchewan, Canada species generation, inflammation and induce oxidative stress. In this review we 3Department of Pharmacology, University of Saskatchewan, discuss the potential role of PKR in type 2 diabetes, pathways activated by it and Canada the interrelationship between pathways activated. Specific and effective inhibitors of PKR are being developed and can become potential treatment for type 2 diabetes and Correspondence: Arti Dhar, Department of Pharmacy, Birla prevent many diseases. Institute of Technology and Sciences Pilani, Jawahar Nagar, Shameerpet, Hyderabad, Andhra Pradesh 500078, India, Tel Keywords: PKR, type 2 diabetes, inflammation, insulin resistance 04066303647, Email [email protected] Received: February 28, 2015 | Published: March 26, 2015 Abbreviations: PKR, protein kinase r; ER, endoplasmic reti- Type 2 diabetes is associated with elevated blood glucose levels, culum; Nfkb, nuclear factor kappa-light-chain-enhancer of activated b which in turn will affect plasma insulin levels.
    [Show full text]
  • Max Perutz (1914–2002)
    PERSONAL NEWS NEWS Max Perutz (1914–2002) Max Perutz died on 6 February 2002. He Nobel Prize for Chemistry in 1962 with structure is more relevant now than ever won the Nobel Prize for Chemistry in his colleague and his first student John as we turn attention to the smallest 1962 after determining the molecular Kendrew for their work on the structure building blocks of life to make sense of structure of haemoglobin, the red protein of haemoglobin (Perutz) and myoglobin the human genome and mechanisms of in blood that carries oxygen from the (Kendrew). He was one of the greatest disease.’ lungs to the body tissues. Perutz attemp- ambassadors of science, scientific method Perutz described his work thus: ted to understand the riddle of life in the and philosophy. Apart from being a great ‘Between September 1936 and May 1937 structure of proteins and peptides. He scientist, he was a very kindly and Zwicky took 300 or more photographs in founded one of Britain’s most successful tolerant person who loved young people which he scanned between 5000 and research institutes, the Medical Research and was passionately committed towards 10,000 nebular images for new stars. Council Laboratory of Molecular Bio- societal problems, social justice and This led him to the discovery of one logy (LMB) in Cambridge. intellectual honesty. His passion was to supernova, revealing the final dramatic Max Perutz was born in Vienna in communicate science to the public and moment in the death of a star. Zwicky 1914. He came from a family of textile he continuously lectured to scientists could say, like Ferdinand in The Tempest manufacturers and went to the Theresium both young and old, in schools, colleges, when he had to hew wood: School, named after Empress Maria universities and research institutes.
    [Show full text]
  • Pre-Mrna Splicing and Human Disease
    Downloaded from genesdev.cshlp.org on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW Pre-mRNA splicing and human disease Nuno Andre´Faustino1,3 and Thomas A.Cooper 1,2,4 Departments of 1Pathology and 2Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas 77030, USA; 3Graduate Program in Basic and Applied Biology, ICBAS, University of Oporto, Portugal The precision and complexity of intron removal during snRNP binds the branch site via RNA:RNA interactions pre-mRNA splicing still amazes even 26 years after the between the snRNA and the pre-mRNA (Fig. 1B). Spli- discovery that the coding information of metazoan genes ceosome assembly is highly dynamic in that complex is interrupted by introns (Berget et al. 1977; Chow et al. rearrangements of RNA:RNA, RNA:protein, and pro- 1977). Adding to this amazement is the recent realiza- tein:protein interactions take place within the spliceo- tion that most human genes express more than one some. Coinciding with these internal rearrangements, mRNA by alternative splicing, a process by which func- both splice sites are recognized multiple times by inter- tionally diverse protein isoforms can be expressed ac- actions with different components during the course of cording to different regulatory programs. Given that the spliceosome assembly (for example, see Burge et al. 1999; vast majority of human genes contain introns and that Du and Rosbash 2002; Lallena et al. 2002; Liu 2002). The most pre-mRNAs undergo alternative splicing, it is not catalytic component is likely to be U6 snRNP, which surprising that disruption of normal splicing patterns joins the spliceosome as a U4/U6 · U5 tri-snRNP (Villa can cause or modify human disease.
    [Show full text]
  • Guides to the Royal Institution of Great Britain: 1 HISTORY
    Guides to the Royal Institution of Great Britain: 1 HISTORY Theo James presenting a bouquet to HM The Queen on the occasion of her bicentenary visit, 7 December 1999. by Frank A.J.L. James The Director, Susan Greenfield, looks on Front page: Façade of the Royal Institution added in 1837. Watercolour by T.H. Shepherd or more than two hundred years the Royal Institution of Great The Royal Institution was founded at a meeting on 7 March 1799 at FBritain has been at the centre of scientific research and the the Soho Square house of the President of the Royal Society, Joseph popularisation of science in this country. Within its walls some of the Banks (1743-1820). A list of fifty-eight names was read of gentlemen major scientific discoveries of the last two centuries have been made. who had agreed to contribute fifty guineas each to be a Proprietor of Chemists and physicists - such as Humphry Davy, Michael Faraday, a new John Tyndall, James Dewar, Lord Rayleigh, William Henry Bragg, INSTITUTION FOR DIFFUSING THE KNOWLEDGE, AND FACILITATING Henry Dale, Eric Rideal, William Lawrence Bragg and George Porter THE GENERAL INTRODUCTION, OF USEFUL MECHANICAL - carried out much of their major research here. The technological INVENTIONS AND IMPROVEMENTS; AND FOR TEACHING, BY COURSES applications of some of this research has transformed the way we OF PHILOSOPHICAL LECTURES AND EXPERIMENTS, THE APPLICATION live. Furthermore, most of these scientists were first rate OF SCIENCE TO THE COMMON PURPOSES OF LIFE. communicators who were able to inspire their audiences with an appreciation of science.
    [Show full text]