DOCSLIB.ORG

Biochemical Characterization of Human Guanylate Kinase And

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Biochemical Characterization of Human Guanylate Kinase And Biochemical Characterization of Human Guanylate Kinase and Mitochondrial Thymidine Kinase: Essential Enzymes for the Metabolic Activation of Nucleoside Analog Prodrugs Dissertation for the award of the degree “Doctor of Philosophy” (Ph.D.) Division of Mathematics and Natural Sciences of the Georg-August-Universität Göttingen submitted by Nazimuddin from Charsadda, Pakistan Göttingen 2014 Member of the Thesis Committee: Dr. Manfred Konrad (Reviewer) Enzyme Biochemistry Research Group, Max Planck Institute for Biophysical Chemistry Member of the Thesis Committee: Dr. Kai Tittmann (Reviewer) Department of Bioanalytics, Georg-August-Universität Göttingen Member of the Thesis Committee: Dr. Matthias Dobbelstein Department of Molecular Oncology, Georg-August-Universität Göttingen Member of the Examination Committee: Dr. Thomas P. Burg Biological Micro- and Nanotechnology, Max Planck Institute for Biophysical Chemistry Member of the Examination Committee: Dr. Jochen Hub Department of Molecular Structural Biology, Georg-August-Universität Göttingen Member of the Examination Committee: Dr. Henning Urlaub Bioanalytical Mass Spectrometry Group, Max Planck Institute for Biophysical Chemistry Date of the oral Examination: February 5, 2015 Affidavit I hereby declare that the Thesis “Biochemical Characterization of Human Guanylate Kinase and Mitochondrial Thymidine Kinase: Essential Enzymes for the Metabolic Activation of Nucleoside Analog Prodrugs” has been written independently and with no other sources and aids than quoted. .............................................. Nazimuddin Göttingen, November 29, 2014 Dedication I dedicate this work to my mother “Fazilat Khan” who inspired me the most in my life because of her great kindness, love, wisdom, and elegance. Acknowledgments I would like to express my deepest gratitude to Dr. Manfred Konrad for offering me the opportunity to do my Ph.D. research work in the Enzyme Biochemistry Research Group. It was indeed an honor and great experience to work under his supervision, and in the very dynamic scientific environment of MPI-bpc, Goettingen. I am highly grateful for his guidance and great support in starting several collaborative projects. I am highly thankful to him for reviewing my PhD thesis, and for his very constructive critique and useful comments. My profound gratitude to the Ph.D. thesis committee members, Prof. Dr. Kai Tittmann and Prof. Dr. Matthias Dobbelstein, for reviewing my research work, constructive critique and for their useful feedback. I am highly thankful to all other members of the Ph.D. Examination Board Prof. Dr. Henning Urlaub, Dr. Thomas P. Burg, and Dr. Jochen Hub for their time and constructive comments. I am highly grateful to our research collaborators Prof. Dr. Wolfgang Parak, Nadeem Sabir and Dr. Susana Carregal from Philipps University of Marburg, Prof. Simone Techert and Rohit Jain from Structural Dynamics of (Bio)chemical Systems group at MPI-bpc Goettingen, Dr. Donghan Lee and Dr. Thomas Michael Sabo from NMR-based Structural Biology at MPI- bpc Goettingen, Dr. Vladimir Pena and Dr. Tales Rocha de Moura from Macromolecular Crystallography research group at MPI-bpc Goettingen, Dr. Andre Skirtach, Dr. Alexey Yashchenok from the department of interfaces at Max-Planck Institute of Colloids and Interfaces Golm/Potsdam, and Dr. Bogdan Parakhonskiy from University of Trento Italy, for their valuable discussions and contribution to this work. My special thanks to our colleague Frau Ursula Welscher-Altschäffel for helping me in learning biochemical techniques, and very often for her useful discussions and kind help. I am thankful to Dr. Christos Karamitros. It was a good time with him, and I found him a very hardworking guy. I am very thankful to Dr. Theresa McSorley for useful discussions and help. I enjoyed with them the weekly intragroup meetings and scientific discussions at daily lunchtime. Let me say thanks to Dr. Claudia Höbartner from nucleic acid chemistry and Dr. Thomas Jovin from cellular dynamics for our weekly seminars and discussions. V I am highly grateful to DAAD for their financial support and for providing me the opportunity to do my Ph.D. research in Germany. I am highly impressed the way how nicely they treat their awardees. I found DAAD a very well organized and high standard institution. I appreciate the GGNB team, and the whole GGNB program for giving opportunities to their researchers to participate in a huge variety of method and skill courses in order to expand their scientific horizon. My special gratitude and thanks to Dr. Kamal Chowdhury from MPI-bpc Goettingen for introducing me to Dr. Donghan Lee and helping me to start a very constructive work on NMR structural biology project. Very often in the bus to Fassberg (MPI-bpc), we used to discuss different topics including my always favorite Astronomy (how the universe works, Big Bang theory, birth of stars and their death, supermassive black holes, galaxies, planets, extraterrestrial life, Einstein theory of general relativity, quantum mechanics, string theory, dark matter and dark energy), honey bees, gardening, and politics. I am highly thankful to my friend Ali Ahmadian (Physicist) for his help in using Gnuplot software and for useful discussions. My very special thanks and respect to my parents (Badam Khan and Fazilat Khan), brothers, and sisters who always supported me. VI Abstract Deoxyribonucleoside and nucleotide kinases are key enzymes that catalyze the critical phosphorylation steps in the conversion of antiviral and anticancer nucleoside analogs to their corresponding cytotoxic nucleoside triphosphates for incorporation into DNA. In this work, I characterized three enzymes: Human guanylate kinase (hGMPK), human mitochondrial thymidine kinase (hTK2), and E.coli guanosine-inosine kinase (ecGSK). They were recombinantly produced and kinetically characterized. A series of mutations were introduced to understand the catalytic roles of specific residues. The enzymes were structurally characterized for substrate-induced conformational changes, and two novel assays were devised to study their kinetics. Our main aim was to provide a basis for their potential use in cancer chemotherapy. The hGMPK was recombinantly produced in catalytically active form although it was previously reported to be inactive upon production in E.coli. In order to explain the role of certain residues in catalysis, a series of point mutations were introduced in hGMPK by rational design applying the structural information of mouse GMPK, which is 88% identical to hGMPK allowing us to build a homology model. Interestingly, it was found that a single hydrogen bond between the active site S37 and the carbonyl oxygen of guanine in GMP substrate is critical for binding of GMP and catalysis. Disturbing this single hydrogen bond in the form of the S37A mutation adversely affected the catalytic activity. Besides its catalytic role, S37 is required for the dynamics of the hinge part that connects two structural regions designated as NMP-binding region (NMP-BR) and the CORE region. Its mutation to proline (S37P), which is the least flexible amino acid in terms of sterically allowed conformations, reduced the catalytic efficiency of hGMPK by about 103-fold making the molecule more like the non-enzymatic guanylate kinase domain of MAGUKs (membrane-associated guanylate kinase homologs). Similarly, the bidentate interaction of T83 with the carbonyl oxygen of guanine in GMP is required for catalysis. Y81 interacts with the phosphate of GMP and has a role in binary complex stabilization. We demonstrated in cell culture experiments that hGMPK, which catalyzes the second phosphorylation step in the final conversion of the antileukemic drug 6-thioguanine (6- TG) to 6-thioGTP/6-thiodGTP for incorporation into RNA and DNA, is the bottleneck enzyme in the metabolic activation of 6-TG, enhancing its cytotoxicity by several fold when overexpressed in HEK293 cells. VII Analyzing the SAXS structures of hGMPK in different conformational states, in particular in the open (unliganded) and completely closed (with two bound nucleotides) forms, revealed large conformational changes that occur during catalysis. The open-to-closed conformational transition of hGMPK induced by binding of ligands supports the model of the induced fit mechanism. In addition, we optimized the higher yield production of isotope-labeled (15N, 15N/13C) hGMPK for its structural analysis by NMR. GMP-induced 15N-1H HSQC (Heteronuclear Single Quantum Coherence) chemical shift changes for hGMPK mapped onto its open form confirmed our findings by SAXS studies that hGMPK undergoes substrate-induced conformational changes. In order to develop novel and advanced approaches for studying the catalytic properties of deoxyribonucleoside and nucleotide kinases, we devised two assays. In one assay, we used a CdS/ZnS quantum-dot (QDs)-modified gold electrode for the detection of hGMPK-catalyzed reaction in an enzyme-coupled assay based on the electrochemical sensing of NADH in a GMP concentration-dependent way. We also demonstrated the proof of concept of a light-controlled sensor for hGMPK immobilized on CdS/ZnS QDs-modified gold electrode. Similarly, we established an Amplex Red-based spectrophotometric and fluorometric enzyme-coupled assay for hGMPK as an alternative to the conventional NADH-dependent spectroscopic assay. Our new assay overcomes the overlapping wavelength problem associated with strong absorption of 6-thioguanine nucleotides at 340 nm, and it has the advantage
Load more

Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • DNA Polymerase Exchange and Lesion Bypass in Escherichia Coli
    DNA Polymerase Exchange and Lesion Bypass in Escherichia Coli The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Kath, James Evon. 2016. DNA Polymerase Exchange and Lesion Bypass in Escherichia Coli. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:26718716 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA ! ! ! ! ! ! ! DNA!polymerase!exchange!and!lesion!bypass!in!Escherichia)coli! ! A!dissertation!presented! by! James!Evon!Kath! to! The!Committee!on!Higher!Degrees!in!Biophysics! ! in!partial!fulfillment!of!the!requirements! for!the!degree!of! Doctor!of!Philosophy! in!the!subject!of! Biophysics! ! Harvard!University! Cambridge,!Massachusetts! October!2015! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ©!2015!L!James!E.!Kath.!Some!Rights!Reserved.! ! This!work!is!licensed!under!the!Creative!Commons!Attribution!3.0!United!States!License.!To! view!a!copy!of!this!license,!visit:!http://creativecommons.org/licenses/By/3.0/us! ! ! Dissertation!Advisor:!Professor!Joseph!J.!Loparo! ! ! !!!!!!!!James!Evon!Kath! ! DNA$polymerase$exchange$and$lesion$bypass$in$Escherichia)coli$ $ Abstract$ ! Translesion! synthesis! (TLS)! alleviates!
    [Show full text]
  • Non-Homologous Isofunctional Enzymes: a Systematic Analysis Of
    Omelchenko et al. Biology Direct 2010, 5:31 http://www.biology-direct.com/content/5/1/31 RESEARCH Open Access Non-homologousResearch isofunctional enzymes: A systematic analysis of alternative solutions in enzyme evolution Marina V Omelchenko, Michael Y Galperin*, Yuri I Wolf and Eugene V Koonin Abstract Background: Evolutionarily unrelated proteins that catalyze the same biochemical reactions are often referred to as analogous - as opposed to homologous - enzymes. The existence of numerous alternative, non-homologous enzyme isoforms presents an interesting evolutionary problem; it also complicates genome-based reconstruction of the metabolic pathways in a variety of organisms. In 1998, a systematic search for analogous enzymes resulted in the identification of 105 Enzyme Commission (EC) numbers that included two or more proteins without detectable sequence similarity to each other, including 34 EC nodes where proteins were known (or predicted) to have distinct structural folds, indicating independent evolutionary origins. In the past 12 years, many putative non-homologous isofunctional enzymes were identified in newly sequenced genomes. In addition, efforts in structural genomics resulted in a vastly improved structural coverage of proteomes, providing for definitive assessment of (non)homologous relationships between proteins. Results: We report the results of a comprehensive search for non-homologous isofunctional enzymes (NISE) that yielded 185 EC nodes with two or more experimentally characterized - or predicted - structurally unrelated proteins. Of these NISE sets, only 74 were from the original 1998 list. Structural assignments of the NISE show over-representation of proteins with the TIM barrel fold and the nucleotide-binding Rossmann fold. From the functional perspective, the set of NISE is enriched in hydrolases, particularly carbohydrate hydrolases, and in enzymes involved in defense against oxidative stress.
    [Show full text]
  • Guanylate Kinase (Ec 2.7.4.8)
    Enzymatic Assay of GUANYLATE KINASE (EC 2.7.4.8) PRINCIPLE: Guanylate Kinase GMP + ATP > GDP + ADP Pyruvate Kinase ADP + PEP > ATP + Pyruvate Pyruvate Kinase GDP + PEP > GTP + Pyruvate Lactic Dehydrogenase 2 Pyruvate + 2 ß-NADH > 2 Lactate + 2 ß-NAD Abbreviations used: GMP = Guanosine 5'-Monophosphate ATP = Adenosine 5'-Triphosphate GDP = Guanosine 5'-Diphosphate ADP = Adenosine 5'-Diphosphate PEP = Phospho(enol)phosphate ß-NADH = ß-Nicotinamide Adenine Dinucleotide, Reduced Form ß-NAD = ß-Nicotinamide Adenine Dinucleotide, Oxidized Form CONDITIONS: T = 30°C, pH = 7.5, A340nm, Light path = 1 cm METHOD: Continuous Spectrophotometric Rate Determination REAGENTS: A. 200 mM Tris HCl Buffer, pH 7.5 at 30°C (Prepare 50 ml in deionized water using Trizma Base, Sigma Prod. No. T-1503. Adjust to pH 7.5 at 30°C with 1 M HCl.) B. 1 M Potassium Chloride Solution (KCl) (Prepare 10 ml in deionized water using Potassium Chloride, Sigma Prod. No. P-4504.) C. 60 mM Magnesium Sulfate Solution (MgSO4) (Prepare 20 ml in deionized water using Magnesium Sulfate, Heptahydrate, Sigma Prod. No. M-1880.) D. 40 mM Phospho(enol)pyruvate Solution (PEP) (Prepare 50 ml in deionized water using Phospho(enol)Pyruvate, Trisodium Salt, Hydrate, Sigma Prod. No. P-7002. PREPARE FRESH.) Revised: 03/10/94 Page 1 of 4 Enzymatic Assay of GUANYLATE KINASE (EC 2.7.4.8) REAGENTS: (continued) E. 100 mM Ethylenediaminetetraacetic Acid Solution (EDTA) (Prepare 10 ml in deionized water using Ethylenediaminetetraacetic Acid, Tetrasodium Salt, Hydrate, Sigma Stock No. ED4SS.) F. 3.8 mM ß-Nicotinamide Adenine Dinucleotide, Reduced Form (ß-NADH) (Prepare 2 ml in deionized water using ß-Nicotinamide Adenine Dinucleotide, Reduced Form, Dipotassium Salt, Sigma Prod.
    [Show full text]
  • WO 2013/180584 Al 5 December 2013 (05.12.2013) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2013/180584 Al 5 December 2013 (05.12.2013) P O P C T (51) International Patent Classification: AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, C12N 1/21 (2006.01) C12N 15/74 (2006.01) BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, C12N 15/52 (2006.01) C12P 5/02 (2006.01) DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, C12N 15/63 (2006.01) HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KN, KP, KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/NZ20 13/000095 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SC, (22) International Filing Date: SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 4 June 2013 (04.06.2013) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, SZ, TZ, (30) Priority Data: UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 61/654,412 1 June 2012 (01 .06.2012) US TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, (71) Applicant: LANZATECH NEW ZEALAND LIMITED MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, [NZ/NZ]; 24 Balfour Road, Parnell, Auckland, 1052 (NZ).
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al
    US 2014O155567A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk et al. (43) Pub. Date: Jun. 5, 2014 (54) MICROORGANISMS AND METHODS FOR (60) Provisional application No. 61/331,812, filed on May THE BIOSYNTHESIS OF BUTADENE 5, 2010. (71) Applicant: Genomatica, Inc., San Diego, CA (US) Publication Classification (72) Inventors: Mark J. Burk, San Diego, CA (US); (51) Int. Cl. Anthony P. Burgard, Bellefonte, PA CI2P 5/02 (2006.01) (US); Jun Sun, San Diego, CA (US); CSF 36/06 (2006.01) Robin E. Osterhout, San Diego, CA CD7C II/6 (2006.01) (US); Priti Pharkya, San Diego, CA (52) U.S. Cl. (US) CPC ................. CI2P5/026 (2013.01); C07C II/I6 (2013.01); C08F 136/06 (2013.01) (73) Assignee: Genomatica, Inc., San Diego, CA (US) USPC ... 526/335; 435/252.3:435/167; 435/254.2: (21) Appl. No.: 14/059,131 435/254.11: 435/252.33: 435/254.21:585/16 (22) Filed: Oct. 21, 2013 (57) ABSTRACT O O The invention provides non-naturally occurring microbial Related U.S. Application Data organisms having a butadiene pathway. The invention addi (63) Continuation of application No. 13/101,046, filed on tionally provides methods of using Such organisms to produce May 4, 2011, now Pat. No. 8,580,543. butadiene. Patent Application Publication Jun. 5, 2014 Sheet 1 of 4 US 2014/O155567 A1 ?ueudos!SMS |?un61– Patent Application Publication Jun. 5, 2014 Sheet 2 of 4 US 2014/O155567 A1 VOJ OO O Z?un61– Patent Application Publication US 2014/O155567 A1 {}}} Hººso Patent Application Publication Jun.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • HOXB6 Homeo Box B6 HOXB5 Homeo Box B5 WNT5A Wingless-Type
    5 6 6 5 . 4 2 1 1 1 2 4 6 4 3 2 9 9 7 0 5 7 5 8 6 4 0 8 2 3 1 8 3 7 1 0 0 4 0 2 5 0 8 7 5 4 1 1 0 3 6 0 4 8 3 7 4 7 6 9 6 7 1 5 0 8 1 4 1 1 7 1 0 0 4 2 0 8 1 1 1 2 5 3 5 0 7 2 6 9 1 2 1 8 3 5 2 9 8 0 6 0 9 5 1 9 9 2 1 1 6 0 2 3 0 3 6 9 1 6 5 5 7 1 1 2 1 1 7 5 4 6 6 4 1 1 2 8 4 7 1 6 2 7 7 5 4 3 2 4 3 6 9 4 1 7 1 3 4 1 2 1 3 1 1 4 7 3 1 1 1 1 5 3 2 6 1 5 1 3 5 4 5 2 3 1 1 6 1 7 3 2 5 4 3 1 6 1 5 3 1 7 6 5 1 1 1 4 6 1 6 2 7 2 1 2 e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S HOXB6 homeo box B6 HOXB5 homeo box B5 WNT5A wingless-type MMTV integration site family, member 5A WNT5A wingless-type MMTV integration site family, member 5A FKBP11 FK506 binding protein 11, 19 kDa EPOR erythropoietin receptor SLC5A6 solute carrier family 5 sodium-dependent vitamin transporter, member 6 SLC5A6 solute carrier family 5 sodium-dependent vitamin transporter, member 6 RAD52 RAD52 homolog S.
    [Show full text]
  • A Global Analysis of Enzyme Compartmentalization to Glycosomes
    pathogens Article A Global Analysis of Enzyme Compartmentalization to Glycosomes Hina Durrani 1, Marshall Hampton 2 , Jon N. Rumbley 3 and Sara L. Zimmer 1,* 1 Department of Biomedical Sciences, University of Minnesota Medical School, Duluth Campus, Duluth, MN 55812, USA; [email protected] 2 Mathematics & Statistics Department, University of Minnesota Duluth, Duluth, MN 55812, USA; [email protected] 3 College of Pharmacy, University of Minnesota, Duluth Campus, Duluth, MN 55812, USA; [email protected] * Correspondence: [email protected] Received: 25 March 2020; Accepted: 9 April 2020; Published: 12 April 2020 Abstract: In kinetoplastids, the first seven steps of glycolysis are compartmentalized into a glycosome along with parts of other metabolic pathways. This organelle shares a common ancestor with the better-understood eukaryotic peroxisome. Much of our understanding of the emergence, evolution, and maintenance of glycosomes is limited to explorations of the dixenous parasites, including the enzymatic contents of the organelle. Our objective was to determine the extent that we could leverage existing studies in model kinetoplastids to determine the composition of glycosomes in species lacking evidence of experimental localization. These include diverse monoxenous species and dixenous species with very different hosts. For many of these, genome or transcriptome sequences are available. Our approach initiated with a meta-analysis of existing studies to generate a subset of enzymes with highest evidence of glycosome localization. From this dataset we extracted the best possible glycosome signal peptide identification scheme for in silico identification of glycosomal proteins from any kinetoplastid species. Validation suggested that a high glycosome localization score from our algorithm would be indicative of a glycosomal protein.
    [Show full text]
  • Mutations in Mitochondrial DNA Polymerase-&Gamma
    Journal of Human Genetics (2009) 54, 516–524 & 2009 The Japan Society of Human Genetics All rights reserved 1434-5161/09 $32.00 www.nature.com/jhg ORIGINAL ARTICLE Mutations in mitochondrial DNA polymerase-c promote breast tumorigenesis Keshav K Singh1, Vanniarajan Ayyasamy1, Kjerstin M Owens1, Manika Sapru Koul2 and Marija Vujcic1 Decreased mitochondrial oxidative phosphorylation (OXPHOS) is one of the hallmarks of cancer. To date, the identity of nuclear gene(s) responsible for decreased OXPHOS in tumors remains unknown. It is also unclear whether mutations in nuclear gene(s) responsible for decreased OXPHOS affect tumorigenesis. Polymerase-c (POLG) is the only DNA polymerase known to function in human mitochondria. Mutations in POLG are known to cause mitochondrial DNA (mtDNA) depletion and decreased OXPHOS, resulting in mtDNA depletion syndrome in humans. We therefore sequenced all coding exons (2–23) and flanking intron/splice junctions of POLG in breast tumors. We found that the POLG gene was mutated in 63% of breast tumors. We identified a total of 17 mutations across the POLG gene. Mutations were found in all three domains of the POLG protein, including T251I (the exonuclease domain), P587L (the linker region) and E1143G (the polymerase domain). We identified two novel mutations that include one silent (A703A) and one missense (R628Q) mutation in the evolutionarily conserved POLG linker region. In addition, we identified three novel mutations in the intronic region. Our study also revealed that mtDNA was depleted in breast tumors. Consistently, mutant POLG, when expressed in breast cancer cells, induced a depletion of mtDNA, decreased mitochondrial activity, decreased mitochondrial membrane potential, increased levels of reactive oxygen species and increased Matrigel invasion.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2010/0158968 A1 Panitch Et Al
    US 20100158968A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2010/0158968 A1 Panitch et al. (43) Pub. Date: Jun. 24, 2010 (54) CELL-PERMEANT PEPTIDE-BASED Publication Classification INHIBITOR OF KINASES (51) Int. Cl. (76) Inventors: Alyssa Panitch, West Lafayette, IN st e8 CR (US); Brandon Seal, West ( .01) Lafayette, IN (US) A638/10 (2006.01) s A638/16 (2006.01) Correspondence Address: A6IP 43/00 (2006.01) GREENBERG TRAURIG, LLP (52) U.S. Cl. ................ 424/422:514/15: 514/13: 514/14 200 PARKAVE., P.O. BOX 677 FLORHAMPARK, NJ 07932 (US) (57) ABSTRACT The described invention provides kinase inhibiting composi (21) Appl. No.: 12/634,476 tions containing a therapeutic amount of a therapeutic inhibi (22) Filed: Dec. 9, 2009 torpeptide that inhibits at least one kinase enzyme, methods e 19 for treating an inflammatory disorder whose pathophysiology comprises inflammatory cytokine expression, and methods Related U.S. Application Data for treating an inflammatory disorder whose pathophysiology (60) Provisional application No. 61/121,396, filed on Dec. comprises inflammatory cytokine expression using the kinase 10, 2008. inhibiting compositions. 20 { ki> | 0: & c s - --- 33- x: SE PEPELE, ics 1.-- E- X K. AAA 22.9 --- KKK. Y.A., 3.2; C. -r { AAEASA. A. E. i : A X AAAAAAA; ; ; ; :-n. 4:-: is SEEKESAN.ARESA, 3523 -- -- Yili.A.R.AKA: 5,342 3. {{RCE: Rix i: Patent Application Publication US 2010/0158968A1 & ******** NO s ***** · Patent Application Publication Jun. 24, 2010 Sheet 2 of 11 US 2010/0158968A1 it, O Peptide: Cso: g E 100 WRRKAWRRKANRO, GWAA.
    [Show full text]
  • Mitochondrial Hepatopathies Etiology and Genetics the Hepatocyte Mitochondrion Can Function Both As a Cause and As a Target of Liver Injury
    Mitochondrial Hepatopathies Etiology and Genetics The hepatocyte mitochondrion can function both as a cause and as a target of liver injury. Most mitochondrial hepatopathies involve defects in the mitochondrial respiratory chain enzyme complexes (Figure 1). Resultant dysfunction of mitochondria yields deficient oxidative phosphorylation (OXPHOS), increased generation of reactive oxygen species (ROS), accumulation of hepatocyte lipid, impairment of other metabolic pathways and activation of both apoptotic and necrotic pathways of cellular death. Figure 1: Since the mitochondria are under dual control of nuclear DNA and mitochondrial DNA (mtDNA), mutations in genes of both classes have been associated with inherited mitochondrial myopathies, encephalopathies, and hepatopathies. Autosomal nuclear gene defects affect a variety of mitochondrial processes such as protein assembly, mtDNA synthesis and replication (e.g., deoxyguanosine kinase [dGUOK]) and DNA polymerase gamma [POLG]), and transport of nucleotides or metals. MPV17 (function unknown) and RRM2B (encoding the cytosolic p53-inducible ribonucleotide reductase small subunit) are two genes recently identified as also causing mtDNA depletion syndrome and liver failure, as has TWINKLE, TRMU, and SUCLG1. Most children with mitochondrial hepatopathies have identified or presumed mutations in these nuclear genes, rather than mtDNA genes. A classification of primary mitochondrial hepatopathies involving energy metabolism is presented in Table 1. Drug interference with mtDNA replication is now recognized as a cause of acquired mtDNA depletion that can result in liver failure, lactic acidosis, and myopathy in human immunodeficiency virus infected patients and, previously, in hepatitis B virus patients treated with nucleoside reverse transcriptase inhibitors. Current estimates suggest a minimum prevalence of all mitochondrial diseases of 11.5 cases per 100,000 individuals, or 1 in 8500 of the general population.
    [Show full text]